Strain t14 / 15 of pantoea allii and the application of strain pantoea allii t14 / 15 in plant protection
Patent Information
- Application Number
- HRP20260869T
- Authority / Receiving Office
- HR · HR
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2022-07-25
- Filing Date
- 2023-07-24
- Publication Date
- 2026-09-11
- Estimated Expiration
- 2043-07-24
AI Technical Summary
Current methods for biological plant protection against fungal and bacterial diseases often have a narrow spectrum of activity, requiring multiple treatments and leading to increased costs and chemical use.
The use of the Pantoea allii T14/15 strain, which exhibits a broad spectrum of antagonistic activity against various fungal and bacterial pathogens, is applied as an aqueous suspension to plant surfaces or in storage conditions to protect plants from multiple diseases simultaneously.
The Pantoea allii T14/15 strain effectively reduces the need for multiple treatments by providing broad-spectrum protection against diseases such as white rot, gray mold, powdery mildew, and fire blight, thereby reducing costs and chemical use while maintaining high protection efficacy.
Abstract
Description
[0001] The subject of the invention is a strain belonging to the Pantoea genus and the application of strain from the Pantoea genus in the protection of vegetable, fruit, agricultural, and ornamental plants against fungal diseases such as, for example, white mold, gray mold, alternariosis, anthracnose, brown rot, bull's eye rot, powdery mildew, and blue mold, as well as bacterial diseases such as, for example, fire blight or soft rot, affecting cultivated plants during the vegetation period and throughout the storage of harvest.
[0002] One of the main goals of agriculture in highly developed countries is to reduce the use of chemical pesticides by implementing eco-friendly production systems. The widespread adoption and implementation of these systems allow for restoring environmental balance and utilizing its natural resistance against pests and other harmful factors that limit the efficiency of crop production. In society, there is a growing expectation for the development of the methods alternative to chemical approaches. One of the solutions to reduce the chemical impact of agriculture is the application of bioproducts - plant protection agents based on microorganisms that enable plant defense against diseases while also ensuring the production of consumer-safe fruits and vegetables with reduced residues of chemical pesticides.
[0003] One of the most important and commonly occurring fungal diseases in cultivated plants is white rot, caused by the fungus Sclerotinia sclerotiorum. This fungus is a polyphagous pathogen, affecting most vegetable species, and it is also found in the cultivation of crops like rapeseed, sunflower, and soybean. The greatest damage is inflicted by the pathogen on plants that produce storage organs such as roots, bulbs, or tubers. In the case of cabbage vegetables, S. sclerotiorum can cause post-harvest rot of the heads during storage. White mold also poses a significant threat to seed plantations, not only of root vegetables but also cabbage vegetables and agricultural crops. A significant challenge for growers is the effective eradication of the pathogen from cultivation, as the disease-causing agent produces numerous sclerotia, which have a lifespan of several years. As a result, they can persistently contaminate the soil or the storage facilities where harvested vegetables are kept.
[0004] Gray mold caused by the fungus Botrytis cinerea attacks numerous plant species, and it can occur throughout the entire vegetation period, affecting all of their above-ground parts. The disease-causing agent affects agricultural, fruit-bearing, and ornamental plants. Berry plants, in particular, are highly susceptible to infections. The pathogen can cause damage even during the germination phase of plants, leading to damping-off and the death of young seedlings. Gray mold also affects vegetables during storage. The fungus requires high relative humidity in the air and heavily moistened leaves for infection and development. The disease's progression is facilitated by low light levels, plant weakening due to other diseases, as well as calcium and potassium deficiency in the soil.
[0005] Alternariosis diseases constitute a group of leaf, stem, and to a lesser extent, fruit diseases caused by fungi belonging to the Alternaria spp. genus. These microorganisms are widely spread in major cultivation regions of onions, cabbage vegetables, leeks, carrots, potatoes, and tomatoes. Infections caused by Alternaria spp. spores can lead to significant losses in the quality and quantity of harvested crops and contribute to their poorer storage. A characteristic feature of diseases caused by fungi of the Alternaria spp. is the presence of concentric, slightly sunken, small spots ranging in color from green to dark brown. These spots are centrally arranged on the affected plant organs. Over time, the spots transform into dark brown angular forms with a yellow border.
[0006] Anthracnose is a fruit disease caused by the fungus Glomerella acutata, primarily known in its conidial stage as Colletotrichum acutatum, affecting fruits at various stages of their growth. Symptoms can be observed both in orchards and during storage. The fungus overwinters in the form of mycelium in cankers on the bark and occasionally on mummified fruits. During the growth of apples and pears in conditions of high humidity, spores are released, which are carried by wind and raindrops to cause infections. The pathogen can affect apple and pear trees, as well as strawberries, cherries, and highbush blueberries. In the case of apples and pears, the occurrence of anthracnose symptoms during storage often coincides with reaching the consumable ripeness. Moreover, excessively high temperatures in cold storage and during commercial handling stimulate the faster development of decay spots. In recent years, the severity of the disease in central Poland has not been high; however, in 2018, apple infection increased.
[0007] Brown rot of apples, known as moniliosis, is a disease caused by fungi of the Monilinia genus. This disease affects both pome fruit trees like apple trees and stone fruit trees. It particularly affects plums and apricots. The disease has two forms: a summer form that occurs in orchards and the second one - which becomes evident during storage. The harm caused by the disease lies in the rotting of the fruits.
[0008] Bull's eye rot of apples and pears is a disease caused by fungi of the Neofabraea spp. genus. These pathogens induce two types of symptoms: cankers on the bark of apple trees and the "eye rot" of apples and pears during storage. Bark cankers manifest as elliptical necrotic lesions on the tree branches. On the dead bark, elevations can be seen, which are clusters of conidial spores. Fungal spore production on dead twigs, short shoots, and canker lesions serves as a source of infection for the fruits.
[0009] Powdery mildew is the collective term for a group of diseases caused by fungi affecting the above-ground parts of plants. These fungi are highly specialized and often target specific plant species. Consequently, different fungal species causing the same disease can be found in various crops. For instance, roses are generally affected by the fungus Podosphaera pannosa, while grasses and cereals are affected by Erysiphe graminis or Blumeria graminis. Uncinula necator affects grapes, Erysiphe heraclei affects carrots, and Podosphaera leucotricha - apples. These fungi can induce symptoms on all above-ground parts: leaves, stems, fruits, and flowers. Beyond vegetable and ornamental crops, powdery mildew is also present in berry fruit cultivation. Despite the fact that different plant pathogenic fungi attack nearly every crop, a common feature of powdery mildews is the appearance of white, powdery spots, most commonly on the upper side of leaves. Typically, these spots start to appear on the lower parts of the plant. As the fungus spreads, it can cover the entire leaf surface, causing yellowing and ultimately drying out. In cases of severe infection, symptoms may also manifest on the lower side of the leaf and, depending on the species, other above-ground parts of the plant.
[0010] Fire blight is one of the most destructive diseases of apple and pear trees. It has been present in Poland for over 50 years and causes economic damage annually, particularly in orchards. It has been detected in almost all regions where fruit trees are cultivated. However, long-term observations indicate significant irregularity in its occurrence, both in terms of its severity in regions where it has been recorded for years, and its unexpected appearance in areas where it has never been detected before. The variability in the occurrence of fire blight is mainly associated with the course of atmospheric conditions that affect the survival of its causative agent, the bacterium Erwinia amylovora, within infected plant organs. The range of affected host plants is broad, encompassing over 130 species, primarily from the rose family. In addition to apple and pear trees, other plants affected by fire blight in Poland include hawthorn, quince, cotoneaster, fire thorn, rowan, and serviceberry.
[0011] On the other hand, soft rot is caused by bacteria from the species Pectobacterium carotovorum, which can lead to massive, soggy decay of roots or tubers either at the end of the vegetation period or during storage. The decay of roots is accompanied by the characteristic unpleasant smell of rotting fish associated with this disease. During the growing season, small watery spots are visible on the affected roots and tubers, which turn brown and enlarge in size. The tissue in these areas becomes soft, rots, and transforms into a semi-liquid, slimy, foul-smelling mass. The intensity of symptoms increases during storage, especially on mechanically damaged roots and tubers. The development of bacteria is favored by high temperatures and high humidity in storage facilities. Plants become infected in field conditions, during periods of prolonged soil moisture. The bacteria spread extensively in the soil where infected plant residues remain. In most cases, infection occurs during the transport and storage of wet and mechanically damaged roots and tubers. On fruits, wet rot can also be caused by fungi from the Penicillium spp. genus, such as Penicillium expansum.
[0012] There are known plant protection agents based on microorganisms in patent literature and scientific publications for use in plant cultivation. For instance, patent application PL418852 A1 reveals a biopreparation for protecting plant leaves against gray mold. This biopreparation consists of water (95%), humic acids (4%), and conidial spores of fungal strains Trichoderma atroviride Tr-43 and Tr-53, Trichoderma harzianum WT17AJ, and Trichoderma asperellum WT9, in a minimum quantity of 10 6< colony-forming units per 1 ml of the preparation. This biopreparation forms the basis for a composition of a plant protection agent against gray mold on the leaves.
[0013] From the patent description PL238148 B1, a biopreparation for plant protection against bacterial infections, such as those caused by pectinolytic bacterial pathogens of the Pectobacterium and Dickeya genera (soft rot), is known. This biopreparation is in a powdered formulation containing diatomaceous earth or kaolin as a carrier, along with additives such as methylcellulose, β-cyclodextrin, sodium lignosulfonate, and KH 2 PO 4 . As the biologically active agent, it contains a lyophilized culture of a selected deposited strain of antagonistic bacteria, such as Serratia plymuthica strain A294 deposited under number B / 00143, or Serratia rubidaea strain H469 deposited under number B / 00142, or Serratia rubidaea antagonistic strain H440 deposited under number B / 00141 , or Enterobacter amnigenus antagonistic strain A167 deposited under number B / 00145, or Rahnella aquatilis antagonistic strain H145 deposited under number B / 00144, or a mixture of these five antagonistic bacterial strains.
[0014] From the patent description PL236445 B1, a novel mixture of antagonistic bacteria for plant protection is known. This mixture contains at least two strains selected from among the strains: Serratia plymuthica strain A294, Enterobacter amnigenus strain A167, Rahnella aquatilis strain H145, Serratia rubidaea strains H440 and H469. These strains were deposited in the Polish Collection of Microorganisms (PCM) at the Institute of Immunology and Experimental Therapy of the Polish Academy of Sciences, named after Ludwik Hirszfeld, in Wroc aw, on December 1, 2017. The patent also encompasses the application of the aforementioned mixture of antagonistic bacteria for protecting plants against pectinolytic bacterial infections, as well as the method of applying these antagonistic bacteria. According to this method, the mixture can be applied through spraying, fogging, plant dusting, soaking plants during storage, in greenhouse, field, and hydroponic conditions, where the antagonistic bacteria suppress disease symptoms caused by pectinolytic bacteria at temperatures ranging from 7°C to 40°C.
[0015] In the publication "Perspectives on the use of bacteria in the protection of apple and pear against fire blight (Erwinia amylovora)" authored by A. Mikiciński and P. Sobiczewski, and published in Progress in Plant Protection (2018), Volume 58, Issue 1, pages 68-75, the protection of plants against fire blight involves the integration of various methods aimed at preventing infection and managing the disease. Among chemical plant protection agents, copper-based preparations are almost exclusively registered for combatting fire blight in Poland. However, various limitations associated with their use have driven an increased interest in alternative methods, including biological approaches involving bacteria. The publication highlights that naturally occurring bacteria with antagonistic effects against the causative agent of fire blight have been identified in natural conditions. These bacteria possess the ability to protect plants from the disease. Research conducted in various countries has shown that the most effective species for biological control include Pantoea agglomerans, Pseudomonas fluorescens, Bacillus subtilis, and Lactobacillus plantarum. Extensive research on the application of various strains of P. agglomerans (formerly classified as Erwinia herbicola) for combating fire blight was conducted in the 1980s under the guidance of Professor S. V. Beer at Cornell University in New York state. This research is described in the publication: S. V. Beer, J. R. Rundle, titled "Suppression of Erwinia amylovora by Erwinia herbicola in immature pear fruits," published in Phytopathology (1983), Vol. 73, No. 9, pp. 1346-1346. Introducing a suspension of bacteria onto apple blossoms one day before or three days after inoculation with E. amylovora showed that 52% and 25% of flowers, respectively, remained externally healthy. Similar efficacy (52% of symptom-free flowers) was observed after treatment with streptomycin, as described in another publication by S. V. Beer and colleagues: "Control of fire blight by non-pathogenic bacteria" published in Phytopathology (1980), Vol. 70, No. 5, pp. 459-459.
[0016] Of particular note is the strain C9-1, isolated from canker on an apple tree trunk in Michigan. Initially identified as P. agglomerans (C. A. Ishimaru et al., "Multiple antibiotic production by Erwinia herbicola," Phytopathology, (1988), 78(6), 746-750), it was subsequently reclassified as P. vagans (C. L. Brady et al., "Pantoea vagans sp. nov., Pantoea eucalypti sp. nov., Pantoea deleyi sp. nov. and Pantoea anthophila sp. nov.", Int J Syst Evol Microbiol (2009), 59:2339-2345). Treating apple and pear trees with a suspension of the C9-1 strain during the flowering period reduced the occurrence of fire blight by 50% to 80%, showing similar effectiveness to treatment with streptomycin sulfate. Due to these promising results, the United States Environmental Protection Agency initiated efforts towards its commercialization, as described in the publication by K. B. Johnson and V. O. Stockwell, titled "Biological control of fire blight. Fire blight: the disease and its causative agent, Erwinia amylovora", published by CABI Publishing (2000), Oxon, United Kingdom, 319-337. Based on this strain, the first biopesticide against fire blight was developed, named BlightBan C9-1.
[0017] As revealed by the conducted analysis of the state of the art, known methods of biological plant protection against bacterial and fungal diseases, as well as preparations based on the potential of microorganisms, often offer a relatively narrow scope of action, limited to a small spectrum of targeted pathogens. Typically, this may involve only one pathogen. However, in practice, it is quite common for plants to be simultaneously affected by several pathogens. In such cases, using available solutions often requires the use of additional treatments to combat the other bacterial or fungal pathogens present on the plants at that moment, including synthetic plant protection agents. This leads to increased costs for plant protection and contributes to excessive chemical intervention in the natural environment. Unexpectedly, this problem has been solved in the current invention.
[0018] The objective of this invention is to isolate new strain of bacteria belonging to the Pantoea spp., with a significantly broader spectrum of activity than the currently known and used strains. The utilization of the strain could offer a solution to the inconveniences posed by the known methods in comprehensively protecting various plant species, including vegetables, fruits, and ornamental plants, against simultaneous attacks by different fungal and / or bacterial diseases. The substance of the invention is the strain Pantoea allii T14 / 15, which has been deposited in the Polish Collection of Microorganisms PCM at the Institute of Immunology and Experimental Therapy of the Polish Academy of Sciences in Wroc aw, under the number B / 00276, on November 26, 2019.
[0019] The substance of the invention also includes the use of strain selected from the strain Pantoea allii T14 / 15 deposited in the Polish Collection of Microorganisms PCM at the Institute of Immunology and Experimental Therapy of the Polish Academy of Sciences in Wroc aw, on November 26, 2019, deposit number B / 00276, as a mean for protecting plants against diseases caused by bacterial and / or fungal pathogens.
[0020] The most beneficially, the strain Pantoea allii T14 / 15 are applied in the form of an aqueous suspension to the plant surface, through spraying, soaking of plants or their parts in storage conditions, under cover and in field conditions, with the cell count of the strain in the suspension being at least 10 7< colony-forming units / ml.
[0021] The strain Pantoea allii T14 / 15, which are the subject of the invention, stand out due to their wide spectrum of activity. This strain exhibits antagonistic activity against a variety of plant pathogens, both fungal and bacterial, responsible for diseases such as brown rot, gray mold, powdery mildew, alternariosis leaf spot, anthracnose, brown rot, fire blight, and blue mold. Furthermore, this strain can be used to protect numerous plant species, including apple, pear, raspberry, strawberry, highbush blueberry, grapevine, carrot, cabbage, lettuce and celery. The range of susceptible plant species to gray mold pathogen is reported by Borecki ("Szkodniki i choroby roślin sadowniczych" ("Pests and Diseases of Fruit Plant"), 3rd edition, PWRiL, 1983) to be over 100 species. As stated by Leski ("Szkodniki i choroby roślin warzywnych" ("Pests and Diseases of Vegetable Plant"), PWRiL, 1985), white rot pathogen affects numerous herbaceous plants while soft rot-causing agent (bacteria), attacks most of crop plants including all vegetables.
[0022] The application of strain of the Pantoea spp. genus, according to the invention, reduces the costs of plant protection by reducing the amount of preparations needed to combat various bacterial or fungal pathogens occurring simultaneously on plants during the same period. This, in turn, helps to avoid excessive chemical treatment of plants. Conducted studies have demonstrated that the Pantoea allii T14 / 15 strain exhibit exceptionally strong antagonistic activity against at least 10 plant fungal and / or bacterial pathogens that were tested under laboratory and field conditions.
[0023] The characteristics of Pantoea allii T14 / 15 strain, as well as the results of in vitro or in vivo studies confirming their effectiveness in exemplary research conducted in apple, carrot, cabbage, lettuce, celery, and grapevine crops, are presented in the following examples. The phylogenetic relationships among all Pantoea spp. species and the Pantoea allii T14 / 15 strain is shown in Figure 1, based on a combined set of gene sequence data including atpD, gyrB, infB, and rpoB.
[0024] These examples should not be regarded as limiting the substance of the solution or restricting the range of the protective invention, as they merely serve as illustrations.Example 1Identification of Pantoea allii T14 / 15
[0025] Strain Pantoea allii T14 / 15 was deposited according to the Budapest Treaty in the Polish Collection of Microorganisms PCM at the Institute of Immunology and Experimental Therapy of the Polish Academy of Sciences, Ludwik Hirszfeld Institute of Immunology and Experimental Therapy in Wroc aw. The deposit was made on November 26, 2019. The deposit was assigned the number B / 00276.Isolation and Colony Morphology of Pantoea allii T14 / 15
[0026] Bacteria were isolated from the surface of strawberry leaves at the beginning of the growing season. Several cut leaves were placed in Erlenmeyer flasks with a volume of 500 ml, containing approximately 200 ml of sterile distilled water with the addition of one drop of Tween 80. The mixture was shaken for 30 minutes. The rinsate was transferred to sterile plastic falcon tubes. The supernatant was poured off, and bacteria were isolated from the sediment by plating them on NAS medium (2.3% nutrient agar with the addition of sucrose to a final concentration of 5%) in Petri dishes with a diameter of 90 mm. Colonies of Pantoea allii T14 / 15 strain, after 24 hours of incubation at 25°C, formed yellow, optically dense, circular colonies with a diameter of 1-2 mm. After another day, their diameter reached 2-3 mm. As time passed, the colonies exhibited a more intense yellow color.Storage of Strain T14 / 15
[0027] Pantoea allii T14 / 15 strain is stored at a temperature of -80°C in glycerol with a PBS buffer (0.27% Na 2 HPO 4 , 0.04% NaH 2 PO 4 , 0.8% NaCl). To deposit the strain, it was plated onto NAS medium (in Petri dishes with a diameter of 90 mm), and after 24 hours of incubation at 25°C, it was rinsed with sterile buffer (1 ml). Then, 0.8 ml of the culture was transferred to a pre-sterilized Eppendorf tube along with 0.2 ml of glycerol. The bacterial suspension of strain T14 / 15 was mixed thoroughly by vortexing and then placed into a cryovial and transferred to a low-temperature freezer at -80°C.Identification of the taxonomic affiliation of Pantoea allii strain T14 / 15
[0028] The taxonomic affiliation of the strain was determined based on phylogenetic analysis conducted using the following sequence data: A. the gene encoding 16S rRNA, B. fragments of genes related to core metabolism: atpD, gyrB, infB, and rpoB, C. analysis of the strain's genome sequence.
[0029] For the purpose of phylogenetic analyses (A, B), DNA was isolated from potential bacteria for biological protection grown for 48 hours on NSA medium (2.3% Difco Nutrient Agar; 5% sucrose). The Genomic Mini kit for bacterial DNA isolation (A&A Biotechnology, Poland) was used according to the manufacturer's instructions. The isolation material was prepared by suspending a pure isolate colony in 100 µl of Tris buffer (10 mM Tris.HCl, pH 8.5). To the resulting suspension, 200 µl of a universal lysis buffer LT (0.25% SDS, 0.2 M NaOH) and 20 µl of Proteinase K solution were added. The mixture was thoroughly mixed and incubated at 37°C for 20 minutes. The sample was then transferred to 75°C and incubated for an additional 5 minutes. The mixture was vortexed for 20 seconds on a Vortex mixer, followed by centrifugation for 3 minutes at 15,000 rpm. The obtained supernatant was applied to a minicolumn for genomic DNA purification. The column was centrifuged for 1 minute at 15,000 rpm. In the next step, 500 µl of washing solution A1 was added to the column, and centrifugation was repeated for 1 minute at 15,000 rpm. The minicolumn was transferred to a new 2 ml tube, and 400 µl of solution A1 was added to the column. The sample was centrifuged for 2 minutes at 15,000 rpm. The dried minicolumn was then placed in a new 1.5 ml tube. For elution, 100 µl of Tris buffer previously heated to 75°C was applied to the minicolumn resin. The sample was incubated for 5 minutes at room temperature and centrifuged for 1 minute at 15,000 rpm. Three microliters of the obtained DNA were used for PCR reaction.A. Analysis of the 16S rRNA gene sequence.
[0030] For the PCR reaction, primers fD1 - 5' AGAGTTTGATCCTGGCTCAG 3' and rP2 - 5' ACGGCTACCTTGTTACGACTT 3' were used, as described in the publication by Weisburg et al., titled: "16 S ribosomal DNA amplification for phylogenetic study," Journal of Bacteriology (1991), 173, 697-703. PCR reactions were conducted in a Biometra ®< T3000 thermocycler. The following amplification reaction conditions were applied: initial denaturation for 4 minutes at 95°C, 35 cycles at 95°C for 45 seconds, 55°C for 45 seconds, and 72°C for 1 minute and 30 seconds. The final extension step was carried out at 72°C for 10 minutes. The resulting amplification reaction product was separated on a 1.5% agarose gel in 0.5 x TBE buffer. To determine the size of the obtained product, 1 µl of the O'Gene RulerTM 100 bp Plus DNA Ladder (#SM1153) from Fermentas was used as a marker. The reaction product was sequenced at Genomed S.A (Warsaw). Sequences obtained for each isolate were assembled using the SeqMan program from the Lasergene package (DNASTAR Inc., Madison, Wisconsin) and compared with sequences deposited in the NCBI GenBank gene bank (http: / / www.ncbi.nlm.nih.gov) and the EzTaxon database (https: / / www.ezbiocloud.net / ) to find the closest matches. Identification based on the 16S rRNA gene sequence allowed for the classification of the tested strain into the genus Pantoea.B. Analysis of sequences of core metabolism gene fragments.
[0031] For the phylogenetic analysis, fragments of 4 core metabolism genes were used: atpD, gyrB, infB, and rpoB. Initially, gene fragments were amplified using specific primers for the infB genes. The amplification reaction conditions were applied as described in the publications by C. Brady et al., titled: "Phylogeny and identification of Pantoea species associated with plants, humans and the natural environment based on multilocus sequence analysis (MLSA)," Systematic and Applied Microbiology (2008), 31 (6-8), pp.447-460, and L. Diancourt et al., titled: "Multilocus sequence typing of Klebsiella pneumoniae nosocomial isolates" (2005), J Clin Microbiol 43: 4178-4182. PCR reactions were carried out using a Biometra ®< T3000 thermocycler. The sequences of all four genes were combined into a single sequence and compared with sequences of the same genes from type strains of other Pantoea species deposited in the NCBI database. For the phylogenetic analysis, all gene sequences were considered (accession numbers are provided on the phylogenetic trees). Maximum Likelihood (ML) trees based on combined sequences of the four studied genes were generated using the MEGA X program. A parametric and evolutionary model recognized as the best substitution model for all sequences of each gene, separately calculated automatically by the program, was utilized. The analysis involved 500 bootstrap replications.
[0032] The phylogenetic analysis and the resulting Maximum Likelihood (ML) tree constructed based on the combined sequences of the core genes atpD, gyrB, infB, and rpoB indicated that the strain T14 / 15 is most closely related to the species Pantoea allii. The ML tree presented in the figure, based on the Tamura-Nei model, illustrates the phylogenetic relationships between the T14 / 15 strain and all Pantoea spp. species using the combined dataset of atpD, gyrB, infB, and rpoB gene sequences. A discrete Gamma distribution was utilized to model evolutionary rate differences among sites (5 categories [+G, parameter = 0.4052]). The rate variation model allowed for some sites to be evolutionarily invariable ([+I], 24.38% of sites). Bootstrap values (expressed as percentages from 500 replicates) are indicated at nodes. The letter "T" following the strain names indicates that the given strain is a typical strain of the species.C. Genome Sequencing and Analysis
[0033] To sequence the genome of Pantoea allii strain T14 / 15, its DNA was isolated using the method by Aljanabi and Martinez, described in the publication by S.M. Aljanabi, I. Martinez, titled: "Universal and rapid salt-extraction of high quality genomic DNA for PCR-based techniques" (1997), Nucleic Acids Res. 25(22), 4692-3. Libraries with short inserts (around 350 bases) were prepared for sequencing on the MiSeq device (Illumina), as well as libraries for sequencing on the MiniON device (Oxford Nanopore Technologies). A total of 2,237,730 reads were obtained from the paired-end short insert library (insert size 300-500 bp) sequenced on the MiSeq (Illumina) device, and 111,460 long reads were obtained from MinION sequencing. All reads were used for de novo genome assembly (Genomed SA, Warsaw, Poland). The de novo assembly was performed using Unicycler ver. 0.4.7 software. The obtained sequences of all genetic elements were annotated using the RAST program.
[0034] The high-quality genome of strain T14 / 15 revealed that its genomic material consists of a chromosome (T14 / 15_chrom size: 4,757,119 bp) and one plasmid (pT14 / 15_1 size: 254,755 bp).Average Nucleotide Identity (ANI)
[0035] Average Nucleotide Identity (ANI) was calculated for the genome of Pantoea allii strain T14 / 15 and type strains of species: Pantoea agglomerans DSM3493T, Pantoea allii LMG24248T, Pantoea ananatis LMG2665T, Pantoea vagans LMG24199T using the JSpecies algorithm (JSpeciesWS; http: / / jspeciesWS; http: / / jspeciesWS; .ribohost.com / jspeciesws / ). Values of ANI-MUMmer (ANIm) and ANI-Blast (ANIb), between two strains should be higher than 95% to classify strains within the same species according to the criteria for species affiliation described in the publications by K.T. Konstantinidis et al., titled: "Toward a more robust assessment of intraspecies diversity, using fewer genetic markers," Appl. Environ. Microbiol. 2006, 72, 7286-7293, and M. Richter and R. Rossello-Mora, titled: "Shifting the genomic gold standard for the prokaryotic species definition," Proc. Natl. Acad. Sci. U. S. A., (2009), 106, 19126-19131.
[0036] The ANI analysis confirms the classification of the T14 / 15 strain into the species Pantoea allii, as the ANI value between the genome of Pantoea allii strain T14 / 15 and the genome of the reference strain Pantoea allii is higher than 95% (Table 1, Table 2). Table 1ANIb and Percentage SimilarityT14 / 15T14 / 15*Pantoea agglomerans DSM3493 T< 78.67Pantoea allii LMG24248 T< 98.89 Pantoea ananatis LMG2665 T< 88.14Pantoea vagans LMG24199 T< 78.94 Table 2 ANIm and Percentage SimilarityT14 / 15T14 / 15*Pantoea agglomerans DSM3493 T< 84.00Pantoea allii LMG24248 T< 99.04 Pantoea ananatis LMG2665 T< 89.20Pantoea vagans LMG24199 T< 84.11
[0037] The conducted analysis has shown that the strain belongs to the species: Pantoea allii.Pathogenic Properties
[0038] The pathogenic properties of Pantoea allii strain T14 / 15 were tested on the following: tobacco - to detect hypersensitivity reactions. potato tubers - for testing pectinolytic properties plant species mentioned in the literature as being affected by bacteria from the species P. allii: elephant garlic, onion, adzuki bean, corn, wheat, pea, perennial ryegrass.
[0039] In none of the tests, Pantoea allii strain T14 / 15 exhibited pathogenic properties.Example 2
[0040] Application of Pantoea allii T14 / 15 Strain for Plant Protection Against Sclerotinia sclerotiorum-caused white rot
[0041] In vitro antagonistic properties of Pantoea allii T14 / 15 strain against Sclerotinia sclerotiorum were evaluated. First, the inhibition of Sclerotinia sclerotiorum growth by Pantoea allii T14 / 15 strain was examined. The experiments were conducted on PDA medium (potato dextrose agar), using co-cultures of Pantoea allii T14 / 15 strain along with Sclerotinia sclerotiorum, and the inhibition of the fungal growth was observed. The zone of inhibition of Sclerotinia sclerotiorum growth T14 / 15 strain, after 5 and 7 days, is presented in Table 3. Table 3StrainZone of growth inhibition after 5 days [mm]Zone of growth inhibition after 7 days [mm]Control00T14 / 1585
[0042] The numerical values presented in Table 3 indicate the radius from the edge of the colony to the edge of the growth inhibition zone in millimeters. The inhibition of pathogen growth by the tested strain indicates the ability T14 / 15 strain to produce substances with fungicidal or fungistatic properties.
[0043] The subsequent experiment was conducted in laboratory conditions on leaves of cabbage and carrot. After causing damage using a preparation needle, cabbage leaves and carrot fragments were soaked for 5 minutes in aqueous suspensions containing Pantoea allii T14 / 15 strain at a concentration of 10 7< CFU / ml. After 2 hours, mycelial disks from 7-day cultures of Sclerotinia sclerotiorum were placed at the site of damage. Control samples consisted of cabbage and carrot leaves soaked in distilled water and inoculated with Sclerotinia sclerotiorum. Inoculated cabbage and carrot leaves were placed in trays on moist mats covered with grids. The trays with the leaves were then placed inside plastic bags to maintain increased humidity. After 3 and 5 days of incubation at a temperature of 25°C, the length of infectious lesions was measured. The test was conducted in 6 repetitions, with each bacterial strain being tested on 6 plant fragments (cabbage leaves and carrot fragments). Among the 426 environmental isolates tested Pantoea allii T14 / 15 strain exhibited some of the highest effectiveness in inhibiting the growth of S. sclerotiorum: 54%.
[0044] Subsequently, an assessment of the in vivo antagonistic properties of Pantoea allii T14 / 15 strain against Sclerotinia sclerotiorum was conducted in greenhouse and field experiments.
[0045] The impact of Pantoea allii T14 / 15 bacterial strain on limiting the development of Sclerotinia sclerotiorum-caused white rot was evaluated in greenhouse cultivation of lettuce. For this purpose, lettuce seedlings of the variety 'Królowa Majowych' were transplanted into 0.5-liter P9 pots filled with peat substrate, which were artificially infected with Sclerotinia sclerotiorum. The pathogen inoculum was prepared using oatmeal agar. The plants were placed on window sills in the greenhouse and cultivated for 1.5 months. During this period, the lettuce was watered three times with aqueous suspensions of T14 / 15 strain, 50 ml per pot with the bacterial cell concentration of each type in the suspension being 10 7< CFU / ml. The first application was performed before transplanting the lettuce into the infected substrate. Subsequent applications were conducted at 10-day intervals. The uninfected control consisted of plants growing in clean peat substrate without the pathogen, while the infected control involved lettuce grown in substrate inoculated with S. sclerotiorum and watered with distilled water. The standard (comparative) treatment utilized a commercial product known as Contans WG. The experiment was conducted in 4 repetitions, with 5 plants in each (a total of 20 plants per combination). In the central part of 90 mm diameter Petri dishes, 5 mm diameter PDA agar disks overgrown with mycelium were placed. The pathogen inoculum - S. sclerotiorum - was prepared. The dishes were incubated for 10 days at 25°C. Subsequently, the agar was homogenized (using a homogenizer H500, Pol-Eko Aparatura, Poland) with distilled water (150 ml of water per dish) for 5 minutes. The resulting suspension was thoroughly mixed with peat substrate (TS1 Klasmann, Poland) in a ratio of: contents of 1 dish to 1 liter of substrate. The infected peat was incubated for 7 days in the greenhouse, inside bags with small openings. After a week of incubation, the experiment was set up.
[0046] On the day of each treatment and one week and two weeks after the last watering of lettuce, the degree of plant infection was determined using an 8-point scale: (0-0%; 1-1%; 2-5%; 3-15%; 4-25%; 5-50%; 6-75%; 7-100%). The obtained research results were statistically analyzed using analysis of variance. To determine differences between means, the Duncan test was used, with a significance level of α=0.05. The effectiveness of the preparations was evaluated using the Abbott's formula. The impact of the tested bacteria on limiting Sclerotinia sclerotiorum-caused white rot in lettuce is presented in Table 4. Table 4Tested strain / reference product% of Infection% of Lettuce infectionProtection efficacy, [%]% of Lettuce infectionProtection efficacy [%]1st assessment2nd assessment3rd assessment - at the end of the experimentUninoculated control0.00.0-0.0-Inoculated control3.49.6-45.9-T 14 / 150.01.287.514.867.8Contans WG0.00.990.610.876.4
[0047] An evaluation of the effectiveness of T14 / 15 strain in limiting Sclerotinia sclerotiorum-caused decay (white rot) on celery roots was also conducted in a pot experiment. For this purpose, 'Talar' variety celery plants were transplanted into 12 cm diameter pots filled with peat substrate previously infested with S. sclerotiorum and placed in a greenhouse (plant growth stage: BBCH 13). There were 5 plants per plot. During the celery growth period, 4 plant protection treatments were carried out by watering the plants. A total of 20 ml of working solution was used per plant containing Pantoea allii T14 / 15 strain at a concentration of 10 7< CFU / ml. The treatments were applied every 7 days.
[0048] An untreated control (non-inoculated) consisted of plants grown in pure peat substrate without the pathogen. The inoculated control (inoculated) consisted of lettuce grown in substrate infested with S. sclerotiorum and watered with distilled water. A commercial product Contans WG was used as a standard (comparative) measure. The first treatment was performed 7 days before transplanting the plants into pots, i.e., celery seedlings growing in multiplates. The infection of celery plants was induced artificially. The substrate was infected with S. sclerotiorum at a ratio of 1:1, i.e., 1 liter of substrate to 1 petri dish of S. sclerotiorum mycelium. Observations of the percentage of leaf infection in celery by the causative agent of Sclerotinia rot were conducted on 7 randomly selected leaves, at the onset of the first disease symptoms. The assessment was done using an 8-point scale, where 0 = no disease symptoms, 1° - up to 1% of leaf area affected, 2° - 2 to 6% of leaf area, 3° - 7 to 15% of leaf area, 4° - 16 to 25% of leaf area, 5° - 26 to 50% of leaf area, 6° - 51 to 75% of leaf area, 7° - 76 to 100% of leaf area with Sclerotinia rot symptoms. Measurements of plant height in centimeters (to the base of the highest leaf and whole leaves) were taken. Leaf colour was also determined on an 11-point scale, with 5 representing the control, 0-4 representing light green, pale, yellowing leaves, and 6-10 representing dark green to very dark green leaves. Phytotoxicity symptoms were assessed using the EPPO PP 1 / 135(4) (2014) scale, ranging from 0 to 100%, where 0 indicated no signs of damage, and 100 indicated complete plant destruction. The results were statistically analyzed using analysis of variance. Differences between means were assessed using the Duncan test at a significance level of 5%. The effectiveness of the tested agents was calculated using the Abbott's formula.
[0049] The assessment of the effectiveness of the tested microorganism strain in protecting celery against Sclerotinia rot is presented in Table 5. Table 5CombinationsWhite rot - Sclerotinia sclerotiorumAverage % of leaf infectionEfficacy [%]Observation dateObservation date1st assess ment2nd assessm ent3rd assess ment4th assessm ent1st assessme nt2nd assessm ent3rd assessm ent4th assessme nt1Uninoculated control0000----2Inoculated control2.648.5718.4333.06----3T14 / 1500.321.7916.4210096.390.350.34Contans WG0.140.973.5813.9594.788.780.657.8
[0050] The results of both experiments conducted for lettuce and celery (Table 4, Table 5), carried out under provocative conditions involving artificial substrate inoculation, clearly indicate the high effectiveness and thus the high utility of the tested strain T14 / 15 for combating Sclerotinia rot. The achieved effectiveness results of the tested isolates were at least as effective as the recognized standard, represented by the Contans WG product. Additionally, a positive impact of the isolates on the growth and development of celery plants was observed, as presented in Table 6. Table 6CombinationsHeight of celery plants (cm)Observation date1st assessment2nd assessment3rd assessmentMeasurement from the base to the tip of the highest leaf1Uninoculated control7.538.7810.552Inoculated control7.438.910.353T14 / 158.18.7310.284Contans WG7.257.388.6 Example 3
[0051] Application of Pantoea allii T14 / 15 strain for plant protection against gray mold caused by Botrytis cinerea .
[0052] An assessment of the in vitro antagonistic properties of Pantoea allii T14 / 15 strain against Botrytis cinerea was conducted. Firstly, the limitation of Botrytis cinerea growth by Pantoea allii T14 / 15 strain was investigated. The experiments were carried out on PDA medium (potato dextrose agar), involving co-culturing Pantoea allii T14 / 15 strain with Botrytis cinerea, and the inhibition of the latter's growth was observed. The experiments were conducted in parallel, separately for each strain. The zone of inhibition of Botrytis cinerea growth by T14 / 15 strain, after 5 and 7 days, is presented in Table 7. Table 7StrainZone of Inhibition after 5 days [mm]Zone of Inhibition after 7 days [mm]Control00T14 / 1560 (n.g.)
[0053] The numerical values presented in Table 7 indicate the radius from the edge of the colony to the edge of the growth inhibition zone in millimeters. The inhibition of pathogen growth by the tested T14 / 15 strain indicates their capability to produce substances with fungicidal or fungistatic properties. The abbreviation "n.g." stands for "no growth on surface" - the fungal growth reached the bacterial border but did not extend onto its surface. This suggests a mechanism different from antibiosis, including parasitism or toxins, which might not diffuse into the microbiological medium but remain trapped within the microbial growth.
[0054] An evaluation of the in vitro antagonistic properties of Pantoea allii T14 / 15 strain against Botrytis cinerea was performed on apple blossoms. One-year-old apple trees of the 'Najdared' variety were stored in a regular refrigerator at a temperature of 2-3°C and relative humidity of 98%. Subsequently, they were planted in 24 cm diameter pots with a mixture of peat and soil in a 1:1 ratio. The planted trees were incubated in a greenhouse at a temperature of 20°C for about 2 weeks. After this period, the flower buds started to develop. On each tree, 20 fully bloomed flowers were left, while the rest were removed to minimize experimental errors. Each prepared plant represented a single combination. Using a sprayer, bacterial suspensions were applied to the flowers, and distilled water was applied to the control combination. The suspensions contained Pantoea allii T14 / 15 strain at a concentration of 10 7< CFU / ml. After 24 hours, conidial spore inoculum of B. cinerea (lz1) was applied to the flower buds at a concentration of 10 6< spores / ml. An hour after the infection, plastic bags were placed over the flower buds to maintain high humidity levels beneficial for the development of the applied fungus. The following day, the bags were removed to avoid disrupting the natural physiological processes of the plants. After 5-7 days from the inoculation, individual flowers were carefully collected, avoiding contact with each other, and placed in Falcon tubes, which were then transported to the laboratory. The collected flowers were cut longitudinally at the base using a sterile scalpel, dividing them into two symmetrical halves. The plant material obtained was laid out on Petri dishes with a diameter of 90 mm containing PDA medium. The readings of the experiment were taken 24 hours after the flowers were placed on the medium. Selected bacterial strain were tested on the blossoms multiple times. The results of the study are presented in Table 8. Table 8StrainPathogenBotrytis cinerea Iz1Protection Efficacy [%]Control100-T14 / 150100
[0055] The next experiment was conducted on apples. During the apple inoculation, two isolates of B. cinerea (Iz1 and Iz2) were used, which were obtained from diseased apples from different orchards. Spore suspensions of the fungus were prepared by rinsing 14-day-old cultures with sterile distilled water. Then, 250 ml Erlenmeyer flasks filled with 100 ml of the fungal suspension were placed on a shaker to disperse the spore clusters. After about 2 hours of shaking, the fungal suspensions were standardized using a Bürker chamber. The concentration of conidial spores was adjusted to 10 6< spores / ml. In the conducted study, "Gala" apples from the Experimental Orchard were used. Immediately after harvest, the apples were stored in a regular refrigerator at a temperature of 2°C. The apples were pre-cleaned by rinsing in water. After drying, the skin surface was disinfected using cotton soaked in 95% ethanol. Four evenly spaced wounds with a diameter of 5 mm and a depth of 3 mm were made using a cork borer in the middle part of each fruit's circumference. Then, 30 µl of bacterial suspension was introduced into each wound. A suspension containing Pantoea allii T14 / 15 at a concentration of 10 7< CFU / ml was used. After 1 hour, 30 µl of spore suspension of the B. cinerea isolate Iz1 or Iz2 was added to each wound. The concentration of conidial spores was adjusted to 10 6< spores / ml. In the control combination, 30 µl of sterile distilled water was introduced into the wounds, and after 1 hour, 30 µl of the spore inoculum of the respective B. cinerea isolate was added. The apples were stored for 4 days at room temperature (approximately 19°C) and relative humidity above 90%. The results of the study are presented in Table 9. Table 9StrainName and isolate number of the fungal pathogenBotrytis cinerea Iz1 concentration 10 6< / mlEfficacy [%]Botrytis cinerea Iz2 concentration 10 6< / mlEfficacy [%]Control31.1-35.0-T14 / 157.1778.576
[0056] The research was also conducted on grapes. Mature grapes of the "Solaris" variety were collected from the plantation, then sterilized by immersion in 50% ethanol and washed several times with sterile distilled water. After drying, the fruits were pierced with a sterile needle to a depth of about 1 mm and placed with the wound facing up on Petri dishes with a diameter of 20 cm, after prior immersion in aqueous suspensions of the tested bacteria. Suspensions was used containing Pantoea allii T14 / 15 at a concentration of 10 9< CFU / ml. After 24 hours, inoculation was performed by applying drops of B. cinerea spore suspensions onto the created wounds using a pasteur pipette, with approximately 50 µl of the suspension. The control combination consisted of grape berries infected solely with the spore suspension of the pathogenic fungus B. cinerea. Each combination consisted of 60 berries (20 berries in 3 repetitions). The results were assessed according to the scoring scale: 0 - no symptoms of gray mold on the surface of the grape skin, 1 - 25%, 2 - 50%, 3 - 100% of the surface affected by the disease. The results of the study are presented in Table 10. Table 10CombinationFruit damage on a rating scaleEfficacy [%]Control1.86-T 14 / 150.7957.5
[0057] The obtained results confirm the effectiveness of the strain T14 / 15 in protecting grapes against gray mold.
[0058] Another experiment was conducted under laboratory conditions on cabbage and carrot leaves. After damaging with a preparatory needle, cabbage leaves and carrot fragments were soaked in aqueous suspension for 5 minutes containing Pantoea allii T14 / 15, each at a concentration of 10 7< CFU / ml. Then, after 2 hours, fungal mycelium disks from 7-day-old cultures of Botrytis cinerea were applied to the damaged areas. Control groups consisted of cabbage and carrot leaves soaked in distilled water and inoculated with Botrytis cinerea. The inoculated cabbage leaves and carrot fragments were placed in trays on moistened mats covered with mesh. The trays with cabbage leaves and carrot fragments were then placed inside plastic bags to increase humidity. After 3 and 5 days of incubation at a temperature of 25°C, the length of infectious spots was measured. The test was carried out in 6 repetitions, with each bacterial strain tested on 6 plant segments (cabbage leaves and carrot fragments). Among the 426 environmental isolates examined, the strain T14 / 15 showed one of the highest efficacies in inhibiting the growth of B. cinerea - 37.7% - 51%.
[0059] Next, an assessment of the in vivo antagonistic properties of Pantoea allii T14 / 15 strain against Botrytis cinerea was conducted in greenhouse and field experiments. The effectiveness of strain T14 / 15 in controlling gray mold on apples during fruit storage was evaluated. The biological efficacy of the tested bacteria in combating gray mold on apples was assessed after fruit storage by comparing the number of apples with disease symptoms in the experimental combinations (sprayed with aqueous suspensions of T14 / 15 strain) and the control combination (unsprayed). In the studies, suspensions were used containing Pantoea allii T14 / 15 strain at a concentration of 10 7< CFU / ml. The first treatments were performed during the flowering period, and subsequent ones in the pre-harvest period, 4, 3, 2, and 1 week before harvest, as well as "drenching," which involved dousing the fruits placed in crates with aqueous suspensions of T14 / 15 strain immediately after harvest. The first evaluation was conducted after over 5 months of apple storage in a common refrigerator at a temperature of 2°C (1.8 - 2.2°C) and relative air humidity of 90 - 92%. The second evaluation was carried out after 7 days of apple storage at a temperature of 15-20°C. In each combination, 1000 pieces of fruit were evaluated (4 repetitions x 250 pieces per repetition), counting healthy apples and those with disease symptoms. The results were expressed as the percentage of affected fruit relative to all the apples evaluated in a given combination. The results were statistically analyzed using the analysis of variance method. Differences between means were evaluated using the Newman-Keuls test at a significance level of 5%. The effectiveness assessment results obtained from the conducted observations are shown in Table 11. Symbols A, B, C, D, E, F, G - denote application timings (A - full bloom, B - petal fall, C, D, E, F - respectively, 4, 3, 2, 1 week before harvest, G - "drenching" of fruits). Comparative studies were also conducted for commercial preparations Captan 80 WDG and Luna Experience 400 SC. Table 11CombinationTreatment dates / concentra tion - dosageI assessment after fruit storage in cold roomII assessment after fruit storage at room temperatureBotrytis cinereaEfficacy [%]Botrytis cinereaEfficacy [%]Control-0.7-1.0-Captan 80 WDG, Luna Experience 400 SCABC 1.9 kg E 0.750.442.90.730T14 / 15CDEFG 10 7< 0.357.10.820
[0060] An evaluation of the effectiveness of Pantoea allii T14 / 15 strain in combating gray mold (Botrytis cinerea) on "Solaris" grape variety fruits harvested in the advanced ripening stage (BBCH 89) was also conducted. Protection of the grapes with the tested preparations began at the start of flowering, when 10% of the petals had fallen off. The assessment of the effectiveness of strain T14 / 15 in combating gray mold on grapes during fruit storage was performed. A water suspension containing strain Pantoea allii T14 / 15 at a concentration of 10 7< CFU / ml. The first evaluation of gray mold occurrence was conducted immediately after fruit harvest, just before placement in cold storage. The second evaluation was performed after 40 days of storage in cold storage, and the third after 7 days of storage at 21°C. The results of each evaluation were presented as the percentage of affected berries. The effectiveness of the tested preparations was determined based on the comparison of the percentage of affected berries in the protected combinations compared to the control combination (untreated). The results were statistically analyzed using the analysis of variance method. Differences between means were evaluated using the Newman-Keuls test at a significance level of 5%. The results of the effectiveness assessment obtained from the conducted observations are shown in Table 12. Symbols A, B, C, D, E, F, G - denote application timings (A - beginning of flowering, B - full flowering phase, C - 70% of caps have fallen off, D - end of flowering phase, E - berries begin to touch each other, F - beginning of ripening, berries start to color, G - berries soften, H - berries ripe for harvesting). Comparative studies were also conducted for commercial preparations Serenade ASO, Luna Experience 400 S.C., Switch 62.5 WG). Table 12Gray mold - grapevine 'Solaris'CombinationTreatme nt datesI assessment immediately after harvestII assessment after 40 days of storage in cold storageIII assessment after 7 days of storage at 21°Caverage % of infectionEfficacy [%]average % of infectionEfficacy [%]average % of infectionEfficacy [%]Control-29.6-77.0-84.4-T14 / 15ABCDE FGH2.491.922.071.432.561.5T14 / 15BCEF1.295.914.081.823.072.7Serenade ASOBCEF0.997.05.393.115.681.5Luna Experience 400 SC Switch 62,5 WGBECF1.694.63.196.014.183.3
[0061] The results of both aforementioned experiments conducted under provocative conditions on apples and grapes (Table 11, Table 12), carried out under high agrotechnical standards and production intensity, clearly indicate the high effectiveness and thus the high suitability of Pantoea allii T14 / 15 strain for use in combating gray mold. The achieved effectiveness results of the strain were at least as good as the recognized standard, represented by the Serenade ASO preparation and the chemical protection program.Example 4
[0062] Application Pantoea allii T14 / 15 strain for plant protection against alternariosis caused by Alternaria species.
[0063] The assessment of the effectiveness Pantoea allii T14 / 15 strain in reducing alternariosis was conducted in field experiments on cabbage and carrots.
[0064] The first experiment was conducted on cabbage growing in an experimental field. The experiment was set up in a randomized block design with 4 replications and 2 rows of plants per rows (20 plants per plot). It included 6 combinations. For spraying, suspension was used containing Pantoea allii T14 / 15 strain at a concentration of 10 7< colony-forming units per millilitre (CFU / ml). As a comparison, the experiment also included the standard biological product Serenade ASO and the standard chemical product Scorpion 325 SC. The suspensions were applied preventively - before the appearance of disease symptoms. Five spraying treatments were carried out on the cabbage plants. On the day of each spraying treatment, the degree of plant infection was determined using an 8-point scale: (0-0%; 1-1%; 2-5%; 3-15%; 4-25%; 5-50%; 6-75%; 7-100%). The obtained research results were statistically analyzed using analysis of variance. To determine differences between means, Duncan's test was used at a significance level of α=0.05. The effectiveness of the preparations was evaluated using the modified Abbott's formula. Table 13 presents the assessment of the effectiveness of the used suspensions in reducing the development of alternariosis on cabbage. Table 13Combination% leaf infection / % efficacy1st assessment2nd assessment3rd assessment4th assessmentControl10.5-21.1-27.9-35.7-T14 / 153.170.512.441.217.238.423.235.0Serenade ASO3.070.312.141.217.138.423.435.0Scorpion 325 SC0.01000.597.61.096.41.595.8
[0065] Next, the effectiveness of Pantoea allii T14 / 15 strain in limiting carrot alternariosis was evaluated. The experiment was conducted in field conditions on carrots grown in an experimental field. The experiment included 6 combinations and was set up in a randomized block design with 4 replications of 2 rows of plants each. For the spray, aqueous suspensions containing Pantoea allii T14 / 15 strain were used at a concentration of 10 7< CFU / ml. As a comparison, standard biological product Serenade ASO and chemical Scorpion 325 SC were used. The tested formulations were applied preventively, before the appearance of disease symptoms. Five spraying treatments were conducted on the carrot plants. On the day of each spraying treatment, the degree of plant infection was determined using an 8-step scale: (0-0%; 1-1%; 2-5%; 3-15%; 4-25%; 5-50%; 6-75%; 7-100%). The obtained research results were statistically analyzed using analysis of variance. To determine differences between means, the Duncan test was used with a significance level of α=0.05. The effectiveness of the treatments was assessed using the Abbott's corrected formula. Table 14 presents the assessment of the effectiveness of the tested formulations in limiting the development of carrot alternariosis. Table 14Combination% leaf infection / % efficacy3rd assessment3rd assessment3rd assessment3rd assessmentControl10.1-25.2-43.6-62.1-T14 / 154.258.410.956.732.126.451.616.9Serenade ASO7.723.819.223.039.110.358.65.6Scorpion 325 SC0.01000.598.01.197.53.993.7
[0066] The results of both experiments conducted on cabbage and carrots under provoking conditions (Table 13, Table 14) - with a high level of agronomy and production intensity - clearly indicate a high effectiveness and thus a high suitability of Pantoea allii T14 / 15 strain for combating alternariosis. The achieved effectiveness results of the strain, according to the invention, were at least as good as or even better than the recognized standard, represented by Serenade ASO - a biological standard product.Example 5
[0067] Application of Pantoea allii T14 / 15 strain for plant protection against brown rot (moniliosis) caused by fungi from the Monilinia spp. genus.
[0068] A study was conducted on 'Rajka' apple variety harvested at the mature collection stage (BBCH 87). A "drenching" method was employed, involving the immersion of fruits placed in crates with suspensions of the tested T14 / 15 strain. Apples used in the experiment during the pre-harvest period were not treated chemically. The "drenching" was performed a few hours after harvesting. The biological efficacy of the tested bacteria in controlling brown rot of pome fruit trees was evaluated after fruit storage, by comparing the number of apples with disease symptoms in the experimental combinations sprayed with suspension T14 / 15 strain and the control combination (unsprayed). Aqueous suspension containing T14 / 15 strain were used at a concentration of 10 7< CFU / ml. The first assessment was conducted after 3.5 months of apple storage in a common cold storage at a temperature of 2°C (1.8 - 2.2°C) and relative humidity of the air at 90 - 92%. The second and third assessments were carried out after 7 and 14 days of apple storage, respectively, at a temperature of 15-20°C. In each combination, 440 fruits were evaluated (4 repetitions x 110 fruits per repetition), counting healthy and affected apples. The results were expressed as the percentage of diseased fruits in relation to all evaluated apples in a given combination. The data were statistically analyzed using the analysis of variance method. Differences between means were assessed using the Newman-Keuls test at a significance level of 5%. The first assessment was performed after cold storage. The second assessment was conducted after storage at 15-20°C for 7 days. The third assessment was carried out after an additional 7 days of storage at 15-20°C. Table 15 presents the efficacy of the T14 / 15 strain used in the study during apple storage. Table 15CombinationI assessment after fruit storage in the cold roomII assessment after fruit storage at room temperatureIII assessment after fruit storage at room temperatureMonilinia spp.Efficacy [%]Monilinia spp.Efficacy [%]Monilinia spp.Efficacy [%]Control0.3-0.3-0.3-T14 / 150.166.70.233.30.233.3
[0069] The results of the presented experiment, conducted under provocative conditions - with a high level of agronomic practices and production intensity, clearly indicate a high effectiveness and, consequently, a high suitability of the T14 / 15 strain for use in the control of apple brown rot caused by fungi of the genus Monilinia spp.Example 6
[0070] Application of Pantoea allii T14 / 15 strain for plant protection against bull's eye rot caused by fungi of the Neofabrea spp .
[0071] In vitro assessment of the antagonistic properties of Pantoea allii T14 / 15 bacterial strain against Neofabrea spp. fungi was conducted. Initially, studies were conducted to determine the growth inhibition of Neofabrea spp. by the strain Pantoea allii T14 / 15. The experiments were conducted on PDA medium (potato dextrose agar), as co-cultures of Pantoea allii T14 / 15 and Neofabrea spp., observing the suppression of fungal growth. The experiments were conducted separately for each strain. The zone of growth inhibition of the pathogenic Neofabrea spp. fungi by the T14 / 15 strain after 14 days is presented in Table 16. The numerical values provided in the table indicate the radius from the edge of the colony to the edge of the growth inhibition zone in millimeters. Table 16StrainZone of growth inhibition after 14 days [mm]Control0T14 / 154
[0072] The inhibition of pathogen growth by the tested strain indicates the ability of T14 / 15 strain to produce substances with fungicidal or fungistatic properties.
[0073] Subsequently, the efficacy of Pantoea allii T14 / 15 strain in controlling bull's eye rot in apples during fruit storage was evaluated. The initial treatments were administered during the flowering period, followed by treatments in the pre-harvest period 4, 3, 2, and 1 week before harvest, as well as "drenching" or immersing apples in suspensions of the tested strain T14 / 15, immediately after harvest.
[0074] The biological efficacy of the tested bacterial strain in controlling bull's eye rot in apples was evaluated after fruit storage, based on a comparison of the number of apples with disease symptoms in the experimental combinations sprayed with aqueous suspensions of T14 / 15 strain and the control combination (unsprayed). Suspensions containing T14 / 15 strain were used at a concentration of 10 7< CFU / ml. The first assessment was conducted after over 5 months of apple storage in a regular cold storage at a temperature of 2°C (1.8 - 2.2°C) and relative humidity of 90 - 92%, while the second assessment was conducted after 7 days of apple storage at a temperature of 15-20°C. In each combination, 1000 fruit samples were evaluated (4 repetitions x 250 samples per repetition), counting both healthy and affected apples. The results were expressed as the percentage of diseased fruit in relation to all evaluated apples in a given combination. Statistical analysis was performed using the analysis of variance method. Differences between means were assessed using the Newman-Keuls test at a significance level of 5%. Table 17 presents the efficacy of T14 / 15 strain in controlling bull's eye rot in apples during fruit storage. Symbols A, B, C, D, E, F, G - represent application timings (A - full blooming, B - petal fall, C, D, E, F - respectively 4, 3, 2, 1 week before harvest, G - "drenching" of fruit). Comparative studies were conducted for commercial products Captan 80 WDG and Luna Experience 400 SC. Table 17CombinationApplication date / dose / concentrationBull's eye rot caused by Neofabraea spp.Efficacy [%]Control-1.4-Captan 80 WDG Luna Experience 400 SCABC 1.9 kg E 0.750.378.6T14 / 15CDEFG 10 7< 0.285.7
[0075] The results of the presented experiment, conducted under provocative conditions - with a high level of agronomy and production intensity, clearly indicate a high effectiveness and therefore a high suitability of the tested T14 / 15 strain for controlling bull's eye rot in apples caused by fungi of the Neofabrea spp. genus. The achieved efficacy results of T14 / 15 strain were at least as good as, if not better than, established chemical standards (Captan 80 WDG, Luna Experience 400 SC).Example 7
[0076] Application of Pantoea allii T14 / 15 strain in the reduction of powdery mildew on carrots caused by the fungus Erysiphe heraclei .
[0077] The experiment was conducted in field conditions, on carrots grown in an experimental field. The experiment comprised 6 combinations and was set up in a randomized block design with 4 replications of 2 rows of plants. Aqueous suspension was applied, containing Pantoea allii T14 / 15 strain at a concentration of 10 7< CFU / ml. Suspensions were applied preventively - before the appearance of disease symptoms. As a comparison, a standard biological product, Serenade ASO, was used in the experiment. Five plant sprayings were carried out. On the day of each spraying treatment, the degree of plant infection was determined using an 8-point scale: (0-0%; 1-1%; 2-5%; 3-15%; 4-25%; 5-50%; 6-75%; 7-100%). The obtained research results were statistically processed using an analysis of variance method. To determine differences between means, Duncan's test was used, with a significance level of α=0.05. The efficacy of the preparations was assessed using the modified Abbott formula. Table 18 presents the efficacy assessment of T14 / 15 strain in limiting the development of powdery mildew on carrots (Erysiphe heraclei). Table 18Combination% leaf infection / % efficacy1st assessment2nd assessment3rd assessmentControl4.8-7.5-10.1-T14 / 150.01002.172.04.257.4Serenade ASO0.01002.073.33.664.6
[0078] The results of the presented experiment, conducted under provocative conditions - with a high level of agronomy and production intensity, clearly indicate a high efficacy and thus high utility of the T14 / 15 strain in controlling powdery mildew on carrots caused by the fungus Erysiphe heraclei. The achieved efficacy results of the T14 / 15 strain were at least as good as or even better than the recognized product Serenade ASO.Example 8
[0079] Application of Pantoea allii T14 / 15 strain for plant protection against fire blight caused by the bacterium Erwinia amylovora.
[0080] An experiment was conducted under laboratory conditions on pear fruit blossoms. The blossoms of the "Conference" pear variety were sliced transversely into sections and immersed in a water suspension of strain. A suspension contained Pantoea allii T14 / 15 at a concentration of 10 7< CFU / ml, or sterile distilled water for the control. The experiment was conducted separately for each strain. The slices were placed on damp filter paper at the bottom of Petri dishes with a diameter of 20 cm. After 6 hours, infection was performed by spraying the surface of the slices with an inoculum of the pathogenic bacteria Erwinia amylovora (strain Ea 659) at a concentration of 10 7< CFU / ml using a manual sprayer. Each combination consisted of 40 blossoms (4 repetitions). The effectiveness (S) of the T14 / 15 strain against fire blight on pear blossoms is presented in Table 19. Comparative tests were conducted for commercial products Switch 62.5 WG, Miedzian 50WP BlightBan A506, and BlightBan C9-1. Table 19CombinationAssessment after 2 daysS [%]Assessment after 5 daysS [%]Assessment after 7 daysS [%]Positive control0.93-3.0-4.0-Switch 62,5 WG 0,1%0.4848.42.86.73.512.5BlightBan ®< A506 10 8< jtk / ml0.0100.00.1595.00.6384.2BlightBan ®< C9-1 10 8< jtk / ml0.0100.00.0100.00.0100.0T14 / 15 10 8< CFU / ml0.0100.00.0897.30.4888.0Miedzian 50WP 0.15%0.0100.00.2392.30.4389.2Miedzian 50WP 0.3%0.0100.00.0100.00.0100.0
[0081] The results of the presented laboratory experiment clearly indicate a high effectiveness and thus a high suitability of the T14 / 15 strain in combating fire blight caused by the bacterium Erwinia amylovora. The achieved effectiveness of the T14 / 15 strain was at least as good as, if not better than, recognized biological standards (BlightBanOA506, BlightBan ®< C9-1) and chemical standard (Miedzian 50WP).Example 9
[0082] Utilization of Pantoea allii T14 / 15 strain for the protection of apples against blue mold caused by fungi of the genus Penicillium (Penicillium expansum ), and for the protection against carrot root soft rot caused by bacteria Pectobacterium carotovorum .
[0083] An in vitro assessment of the antagonistic properties of Pantoea allii T14 / 15 strain against fungi of the genus Penicillium spp. was conducted. Firstly, the inhibition of growth in Penicillium spp. by the strain Pantoea allii T14 / 15 was investigated. The study was performed on PDA medium (potato dextrose agar), with co-culturing of Pantoea allii T14 / 15 strain along with Penicillium spp. The inhibition of pathogen growth was observed. The studies were conducted with concentration in the suspension being 10 7< CFU / ml. The growth inhibition zones of the Penicillium spp. pathogen by the T14 / 15 strain, observed after 5 and 7 days, were presented in Table 20. Table 20StrainPenicillium expansum growth inhibition zone after 5 days [mm]Penicillium expansum growth inhibition zone after 7 days [mm]Control00T14 / 15100
[0084] The numerical values presented in the table determine the radius from the edge of the colony to the edge of the growth inhibition zone in mm. The inhibition of pathogen growth by the tested strain indicates the ability of T14 / 15 strain to produce substances with fungicidal or fungistatic properties.
[0085] The effectiveness of Pantoea allii T14 / 15 bacterial strain in combating soft apple rot was examined. During the apple inoculation, two isolates of the pathogen Penicillium expansum (Isolate P8 and P11) were utilized, originating from diseased apples from different orchards. Spore suspensions of the fungus Penicillium expansum were obtained by washing 7-day-old cultures with distilled water. Then, 100 ml of the spore suspension was placed in a 250 ml Erlenmeyer flask and shaken to break up spore clusters. The concentration of conidial spores was adjusted to 10 6< CFU / ml for isolate P8 and 10 5< CFU / ml for P11. After about 2 hours of shaking, bacterial suspensions were standardized using a Bürker chamber. "Gala" variety apples were used in the study, which were stored in a regular refrigerator at 2°C immediately after harvesting. The apples were preliminarily cleaned by rinsing in water. After drying, the skin was disinfected using cotton soaked in 95% ethanol. Four wounds, 5 mm in diameter and 3 mm deep, were made symmetrically on the circumference in the central part of each fruit using a cork borer. Then, 30 µl of bacterial suspension was introduced into each wound. Water suspension was used, containing Pantoea allii T14 / 15 strain at a concentration of 10 7< CFU / ml. After 1 hour, 30 µl of the corresponding isolate of P. expansum spore suspension (P8 or P11) was added. The spore concentration was adjusted to 10 6< / ml. In the control combination, 30 µl of sterile distilled water was introduced into the wounds, and after 1 hour, 30 µl of the appropriate P. expansum isolate inoculum was added. The apples were stored for 5 days at room temperature (about 19°C) and relative humidity above 90%. The effectiveness of T14 / 15 strain against apple rot in the apple study is presented in Table 20. Table 20StrainPathogen name and isolate numberPenicillium expansum P8 10 6< Efficacy [%]Penicillium expansum P11 10 5< Efficacy [%]Control28.8-18.2-T14 / 15 10 7< 15.0488.752
[0086] The results of the presented laboratory experiment clearly indicate the effectiveness and thus the usefulness of T14 / 15 strain in combating soft rot caused by the fungus Penicillium expansum.
[0087] In the next study, the effectiveness of Pantoea allii T14 / 15 strain in limiting soft rot of carrot roots during storage, caused by the bacterium Pectobacterium carotovorum, was evaluated. Carrots growing in the experimental field were sprayed four times during vegetation, every 7 days (all plots), alternately with chemical preparations Amistar 250 SC, Zato 50 WG, Score 250 EC, and Scorpion 325 SC. Then, one month before harvesting, three treatments were performed every 10 days using suspensions containing T14 / 15 strain. A water suspension containing T14 / 15 strain was used at a concentration of 10 7< CFU / ml. The treatments were carried out in parallel and separately for each strain. Subsequently, carrots (100 pieces from each combination) were placed in a cold room at a temperature of 4°C. The degree of root infection was assessed three times: on the day of removal from storage and after 10 and 20 days of root storage at room temperature. The degree of root infection was determined using an 8-point scale: (0-0%; 1-1%; 2-5%; 3-15%; 4-25%; 5-50%; 6-75%; 7-100%). The results were statistically analyzed using an analysis of variance. Differences between means were assessed using the Duncan test at a significance level of 5%. The effectiveness of the tested agents was calculated using the Abbott formula. Comparative studies were also conducted for commercial preparations Serenade ASO and Scorpion 325 SC. The results are presented in Table 21. Table 21CombinationsBacterial soft rot (Pectobacterium carotovorum)Average % of head infectionEfficacy [%]Observation dataObservation dataafter removal from the cold storageafter 10 days of storage at room temperatureafter another 10 daysafter removal from the cold storageafter 10 days of storage at room temperatureafter another 10 days1Control0.62.56.0---2T14 / 151.12.42.5-458.33Serenade ASO0.366.512.640--4Scorpion 325 SC0.431.03.028.36050
Claims
1. Pantoea allii T14 / 15 strain, deposited in the Polish Collection of Microorganisms PCM at the Institute of Immunology and Experimental Therapy of the Polish Academy of Sciences, named after Ludwik Hirszfeld in Wroc aw, under number B / 00276, on November 26, 2019.
2. The use of strain selected from Pantoea allii T14 / 15 deposited in the Polish Collection of Microorganisms PCM at the Institute of Immunology and Experimental Therapy of the Polish Academy of Sciences, named after Ludwik Hirszfeld in Wroc aw, on November 26, 2019, deposit number B / 00276, as a mean for plant protection against diseases caused by bacterial and / or fungal pathogens.
3. The use according to reservation 3, characterized in that Pantoea allii T14 / 15 strain is applied in the form of an aqueous suspension to the plant surface, through spraying, soaking the plants or their parts under storage conditions, under cover, and in field conditions, with the number of strain cells in the suspension being at least 107 CFU / ml.