Osteoprotegerin binding proteins and receptors

Description

Osteoprotegerin-binding proteins and receptors The present invention relates to polypeptides involved in the differentiation of osteoclast (bone-resorbing) cells. More specifically, the invention relates to osteoprotegerin binding proteins, nucleic acids encoding the proteins, expression vectors, and host cells producing the proteins, as well as binding assays. The invention relates to polypeptides involved in the differentiation of osteoprotegerin, nucleic acids encoding the proteins, expression vectors, and host cells producing the proteins, as well as binding assays. The invention relates to polypeptides for the treatment of bone diseases, such as osteoporosis, bone loss due to arthritis, Paget's disease, and hypercalcemia. The invention also provides receptors for osteoprotegerin binding proteins, as well as methods and techniques for treating bone diseases using the receptors. In living bone tissue, there is a dynamic balance between bone formation and bone resorption. These processes are primarily mediated by two cell types: osteoblasts, which secrete the organic matrix of bone; and osteoclasts, which promote the dissolution of the bone matrix and the release of bone salts into solution. In young people with growing bones, the rate of bone deposition exceeds bone resorption, while in older people the rate of resorption may exceed deposition. In the latter situation, increased bone breakdown leads to a decrease in bone mass and strength, which increases the rate of fractures and slows or incompletely heals broken bones. They arise in the bone marrow from hematopoietic stem cells. Although the growth and formation of mature, functional osteoclasts are not yet fully understood, it is thought that osteoclasts mature together with the monocyte / macrophage cell family in response to various growth-promoting factors. The development of bone marrow precursor cells into pro-osteoclasts is thought to be driven by soluble factors, such as tumor necrosis factor-α (TNFα), tumor necrosis factor-β (TNF-β), interleukin-1, interleukin-4 (IL-41), interleukin-6 (IL-6), and leukemia inhibitory factor. <ILF) közvetítik. Tenyészetben pro-osteodastok képződnek hozzáadott makrofág: telepserkentő faktor (MCSF) jelenlétében. Ezek a faktorok elsődlegesen az osteoclast fejlődésének korai lépéseiben hatnak.The involvement of polypeptide factors in the final stage of osteoclast formation has not yet been described in detail. However, it has been described that parathyroid hormone stimulates the formation and activity of osteoclasts, and calcitonin has the opposite effect, although to a lesser extent. Recently, a novel polypeptide factor, osteoprotegerin (OPG), has been described that negatively regulates osteoclast formation in the MTM and MAO (see U.S. Patent No. 08 / 577,788, filed December 22, 1995, U.S. Patent No. 08 / 577,788, filed September 3, 1996, which are hereby incorporated by reference, and WO96 / 2627I) and reduces bone loss when administered to ovariectomized rats. Analysis of the activity of OPG in in vitro osteoclast formation revealed that osteoprotegerin does not interfere with the growth and differentiation of monocyte / macrophage precursors, but rather blocks the differentiation of osteoclasts into monocyte / macrophages. Thus, it appears that csteoprotegerin specifically regulates osteoclast formation. Osteoprotegerin contains two polypeptide domains with distinct structural and functional properties. The N-terminal domain extends from amino acids 2294 to 2414 of the full-length polypeptide (the N-terminal methionine is considered group 1) and shows homology to other members of the tumor necrosis factor receptor (TNFR) family, especially TNFR-2, although the conservation of the ribosome-rich domains is characteristic of TNFR family members. The C-terminal domain, extending from residues 194 to 401, shows no significant homology to any known sequence. Unlike other members of the TNFR family, osteoprotegerin appears to be an exclusively secreted protein and does not appear to be synthesized in a membrane-associated form. Based on its activity (negative regulation of osteoclast formation), it is postulated that osteoprotegerin may bind to a polypeptide factor involved in osteoclast differentiation and thereby block one or more of the terminal steps leading to the formation of mature osteoclasts. Accordingly, it is an object of the present invention to identify polypeptides that interact with osteoprotegerin. Said polypeptides may play a role in. in osteoclast maturation and may be useful in the treatment of bone diseases. A novel member of the tumor necrosis factor family was identified from a cDNA library expressed in murine COS cells, using a recombinant osteoprotegerin-Fc fusion protein as an affinity probe for screening. The novel polypeptide is a transmembrane osteoprotegerin-binding protein estimated to be 316 amino acids long and has an H-terminal cytoplasmic domain, a transmembrane domain, and a C-terminal extracellular domain. The osteoprotegerin-binding proteins of the invention may be membrane-bound or may be in soluble form. The invention provides antibodies or fragments thereof that specifically bind to osteoprote germt binding protein (OPGbp), wherein the antibody or fragment thereof inhibits osteoclast formation. The invention also provides pharmaceutical compositions containing these antibodies or fragments. The invention also provides said antibodies or fragments thereof for use in inhibiting bone resorption and osteoclastogenesis. The invention also provides a method for identifying a compound that reduces the activity of OPGbp. Osteoprotegerin binding proteins can be used in various assays to quantify osteoprotegerin levels in biological samples, identify cells and tissues that contain osteoprotegerin binding protein, and identify new members of the osteoprotegerin and osteoprotegerin-binding protein families. The invention relates to <rt továbbá azok az eljárások, amikkel. azokat a vegyületeket lehet azonosítani, amik kölcsönhatásba lépnek az osteoprotegerint kötő fehérjével. Ilyen vegyületek lehetnek a nukleinsavak, peptidek, fehérjék, szénhidrátok, lipidek vagy kis molekulasülyű szerves molekulák, és az osteoprotegerint kötő fehérje aktivitásának agoPistájaként vagy aniagonistájaként hathatnak. Osteoprotegerin binding proteins play a role in osteoclast differentiation, and the level of osteoclast activity in turn influences bone resorption. Agonists and antagonists of osteoprotegerin binding protein influence osteoclast formation and bone resorption, and can be used to treat conditions characterized by alterations in bone resorption, such as osteoporosis, hypercalcemia, bone resorption due to arthritis, Paget's disease, osteopetrosis, a. prophytic laxity, and the like. Pharmaceutical compositions comprising osteoprotegerin binding proteins and antagonists of osteoprotegerin binding proteins are also within the scope of the present invention. We have also identified receptors for osteoprotegerin-binding proteins from a murine cDNA library prepared from bone marrow cells that bind to a fluorescently labeled osteoprotegerin-binding protein. The receptors can be used to identify agonists and antagonists of osteoprotegerin-binding protein interactions with its receptors, which in turn can be used to treat bone disease. domain and the positions of the carbohydrate chains attached to asparagine are underlined. Figure 2: Expression of osteoprotegermt binding protein in COS-7 cells transfected with pcDNA / 32D-F3 vector. Cells were lipofected with pcDNA / 32D-F3 DNA, which was assayed for binding to goat anti-human IgG1 alkaline phosphatase conjugate (secondary only), human OPG [22-201 hFc plus secondary (OFG-Fc), or a chimeric ATAR extracellular domain-Fc fusion protein (sATAR-Fc). ATAR is a novel member of the YNFR g' superfamily, and the sATAR-Fc fusion protein serves as a control for both human IgG1 Fe domain binding and generic THFRr-related protein, which binds to 32D cell surface molecules. Figure 3: Expression of osteoprotease-binding proteins in human tissues. Northern blot analysis of human tissue mRNA (Clontech) using a radiolabeled 32D-F3-derived hybridization probe. Relative molecular mass is shown on the left in kilobase pairs (kb). The arrowhead on the right shows the migration of a transcript of approximately 2.5 kilobases that was detected in lymph node mRNA. Figure 4: Structure and sequence of the pcDNA / hu OPGbp L1 insert, which encodes the human osteoprotegerin-derived protein. The predicted transmembrane domain and the positions of the asparagine-linked carbohydrate chains are underlined. Figure 5: Stimulation of osteoclast development in cultured bone marrow macrophages and ST2 cells treated with recombinant murine osteoprotegerin binding protein (158-316): The cultures were treated with different concentrations of murine osteoprotegerin binding protein, ranging from 1.6 to 500 X ng / ml. After 8-10 days, the cultures are lysed and TRAP activity is measured by assay in solution. In addition, some cultures are simultaneously treated with 1, 10, 100, 500 and 1000 ng / ml of recombinant murine OPG [22-401]~Fc protein. The murine osteoprotegerin binding protein induces a dose-dependent induction of osteoclast formation, while OPG [22-401 ΙΓο inhibits osteoelast formation. Figure 5: The development of osteoelast from bone marrow precursors and then cultured in the presence of 250, 500, 1000 and 2000 U / ml M-CSF. Osteoelast development was measured using the TRAP solution assay. Figure 7: Osteoelastocytes derived from bone marrow cells in the presence of both M-CSF and osteoprotegerin binding protein (158-316) are able to resorb bone. Bone marrow cells treated with M-CSF-M, osteoprotegerin binding protein, or both factors in combination are plated on bone slices in culture media and allowed to develop into mature osteoclasts. The resulting cultures are then stained with Toluidine Blue (left column) or histochemically to detect TRAP enzyme activity (right column). Cultures treated with both factors produce mature osteoclasts that are able to erode bone, as judged by the presence of blue-stained pits on the bone surface. This is consistent with the presence of multiple, large, multinucleated TRAP-positive cells. Figure 8: Graph showing whole blood ionized calcium (iCa) levels in mice injected with osteoprotegerin binding protein 51 hours after the first injection and in mice concurrently receiving osteoprotegerin. Osteoprotegerin binding protein significantly and dose-dependently increased iCa levels. Osteoprotegerin (1 mg / kg / day) completely blocked the increase in iCa levels by 5 pg / day of osteoprotegerin binding protein and partially blocked the increase by 25 pg / day of osteoprotegerin binding protein. (*) differs from vehicle-treated control (p<0.05). # iCa levels in osteoprotegerin-treated mice differ significantly from those in mice receiving only osteoprotegerin binding protein (p<0.05)< Figure 9: Radiographic images of the left femur and tibia of mice treated with 0.5f25 or 100 |ug: / day of osteoprotegerin protein for 3.5 days. A dose-dependent decrease in bone density is observed, which is most clearly observed in the proximal tibial metaphysis in these mice, and this is the result of the The sequence of the 625-residue open reading frame is shown, as well as the translation of the indicated open reading frame. The hydrophobic signal peptide is underlined and the hydrophobic transmembrane sequence (residues 214-234) is highlighted. The cysteine ​​residues of the cysteine-rich repeat motif in the extracellular domain are also highlighted. Figure 11: Immunofluorescence staining of ODAR-Fc binding to cells transfected with osteoprotegerin binding protein. COS-7 cells transfected with an expression plasmid encoding osteoprotegerin binding protein were treated with human IgG (upper panel). Incubate with ODAR-Fc (middle panel) or OPG-Fc (bottom panel). A FITC-labeled goat anti-human IgG Fc antibody is used as secondary antibody. Cells showing positive binding are examined by confocal microscopy. Figure 12: Effect of ODAR-Fc on the in vitro generation of osteoclasts from mouse bone marrow. Murine bone marrow cultures were established as described in Example S and then exposed to 5 ng / ml osteoprotegerin binding protein and 30 ng / ml CSF-1. Different concentrations of ODAR-Fc (1500 ng / ml - 65 ng / ml) were added. Osteoclast formation was assessed by TRAP cytochemistry and TRAP solution assay after 5 days of culture. Figure 13: Bone mineral density in mice after four days of treatment with different doses of ODAR-Fc. Mice received daily subcutaneous injections of ODAR-Fc in phosphate-buffered saline. Bone mineral density The proximal tibia metaphysis was imaged using peripheral quantitative computed tomography (pQCT) (XCT-960M, Norland Medical Systems, Ft Atkinson, WI). Two 0.5 mm sections of bone were analyzed using our tibia analyzer (XMCE 5.2, Stratec, Germany) to determine the total bone mineral density in the metaphysis. A soft tissue preparation with a threshold of 1500 was used to determine where the metaphyseal bone was located in the bone mineral density in the proximal tibia metaphysis. Group. n~4. The polypeptide known as osteoprotegerin binding protein described in this invention specifically binds OPG and plays a role in osteoclast differentiation. A cDNA clone encoding the murine form of the polypeptide was identified from a library prepared from mouse myelomunocyte 32-D cell lines and then transfected into COS cells. A. transfectants were tested for their ability to bind an OPG[22-201]-Fe fusion polypeptide (Example 1). The nucleic acid sequence revealed that osteoprotegerin binding protein is a novel member of the TNF family. and is closely related to AGP-1, a polypeptide described in U.S. Patent No. 08 / 660,562, filed June 7, 1996. A polypeptide identical to AGP-1, called TRAIL, has been described in the literature [Wiley et al., Immunity 3, 673682 (1995)]. Osteoprotegerin binding protein is believed to be a type 11 transmembrane protein that has a cytoplasmic domain at the ?-terminus, a transmembrane domain, and a C-terminal extracellular domain (Figure 1). The N-terminal cytoplasmic domain extends from about residues 1 to 48, the transmembrane domain extends from about residues 49 to 69, and the extracellular domain extends from about residues 70 to 31.6, as shown in Figure 1 (SEQ ID NO: 2). The membrane-associated protein specifically binds to osteoprotegerin (Figure 2). Thus, the osteoprotegerin-binding protein and osteoprotegerin share many of the properties of a receptor-ligand pair, although it is possible that other naturally occurring receptors for osteoprotegerin-binding protein exist. A DNA clone encoding human osteoprotegerin binding protein was isolated from a lymph node cDNA library. The human sequence (Figure 4) is homologous to the murine sequence. The purified soluble murine osteoprotegerin binding protein stimulates osteoclast formation in. mtro and induces hypercalcemia and bone resorption m. vfeo. An osteoprotegerin binding protein is a polypeptide having an amino acid sequence identical to the amino acid sequence of a mammalian osteoprotegerin binding protein, or a fragment, analog or derivative thereof, and having at least osteoprotegerin binding activity. In preferred embodiments, the osteoprotegerin binding protein is of rodent or human origin. In another embodiment, the osteoprotegerin binding protein is a soluble protein that is in the form of an isolated extracellular domain, separated from the cytoplasmic and transmembrane domains. Osteoprotegerin binding protein plays a role in osteoclast formation and in determining the rate and extent of bone resorption, and has been shown to stimulate osteoclast formation and stimulate bone resorption. The present invention also describes isolated nucleic acids of osteoprotegerin binding proteins. Hereinafter, the term nucleic acid may mean cDNA, genomic DNA, partially or fully synthetic DNA and RNA. These may be selected from the following group: a) the nucleic acids shown in Figure 1 (SEQ ID NO: 1) and Figure 4 (SEQ ID NO: 3); b) : nucleic acids that hybridize in Figure L (Fig. 1). 'SEQ ID NO:3) to the region encoding the polypeptide shown; and remain hybridized to the nucleic acids even under strong hybridization conditions; and c) nucleic acids that are degenerate compared to nucleic acids (a) and (b). Nucleic acid hybridizations are generally multi-step processes that have a first hybridization step in which nucleic acid duplexes are formed from single-stranded nucleic acids, followed by a second hybridization step performed under much more stringent conditions to selectively retain nucleic acid duplexes* that have the desired homology. The conditions of the first hybridization step are generally not critical, provided they are not more stringent than those of the second hybridization step. The second hybridization is generally performed under stringent hybridization conditions, where "stringent" conditions refer to temperature and salt parameters that are approximately 12-20°C below the melting point (Tm) of the perfect hybrid formed by the complementary strands, or a portion thereof, shown in Figure 1 (SEQ ID NO:2) and Figure 4 (SEQ ID NO:4).In one embodiment, the term "stringent" conditions means about 65°C and no more than 1 mol / l NaN. It is understood that the salt concentration, temperature and / or length of incubation may be varied, either in the first or second hybridization step, so as to obtain the hybridizing nucleic acid molecules of the invention. The hybridization of nucleic acids around ?. and nucleic acid hybrids. Calculation of the Tm value can be found in the literature [Sambrook et al.: Molecular Cloningi A Laboratory Materials; Cold Spring Harbor Press, Coki Spring Harbor, NX (19890A nucleic acids can hybridize to the region or a portion thereof of the osteoprotegerin binding protein shown in Figure 1 (SEQ ID NO: 2) and Figure 4 (SEQ ID NO: 4) encoding the polypeptide; as a result, they can be truncated or extended versions of the nucleic acid sequences described herein. It may be that7a nucleic acid encodes a polypeptide of at least 10 amino acids. In another case, the nucleic acid encodes a peptide of at least 20 amino acids.In a further embodiment, the nucleic acid encodes a peptide of at least 50 amino acids. The hybridizing nucleic acids may also comprise non-coding sequences located 5' and / or 3' to the osteoprotegerin binding protein coding region. The non-coding sequences include regulatory regions involved in the expression of the osteoprotegerin binding protein, such as promoters, enhancer regions, translation initiation sites, transcription termination sites, and the like. The nucleic acids preferably encode murine or human osteoprotegerin binding proteins. The nucleic acids may encode a membrane-bound form of the osteoprotegerin binding protein or soluble forms thereof lacking a functional transmembrane region. The predicted transmembrane region of the murine osteoprotegerin binding protein comprises amino acid residues 46-69 as shown in Figure 1 (SEQ ID NO: 1). The predicted transmembrane region of the human osteoprotegerin binding protein comprises amino acids 49-69 as shown in Figure 4 (SEQ ID NO: 1). Substitutions that replace hydrophobic amino acids in this region with neutral or hydrophilic amino acids are expected to disrupt membrane binding and result in a soluble osteoprotegerin binding protein. In addition, deletions of the entire transmembrane region, or part of it, are also expected to result in the production of soluble forms of the osteoprotegerin binding protein. Nucleic acids encoding amino acids 70-316, as shown in Figure 1 (SEQ ID NO:1), or fragments and analogs thereof, encode soluble osteoprotegerin binding proteins. Nucleic acids encoding truncated forms of soluble human osteoprotegerin binding proteins are also included. Soluble forms include proteins containing residues 69-317 as shown in Figure 4 (SEQ ID NO:3), as well as truncated forms thereof. In one embodiment, the H-terminal truncations generate polypeptides starting with the following residues: 70-317, 71-317, 72-317, and so on. In another embodiment, the nucleic acids encode soluble osteoprotegerin binding protein (OPGbp) containing residues 69-317, as well as truncations thereof at the N-terminal, up to the osteoprotegerin binding protein 158-317 or, alternatively, the osteoprotegerin binding protein 166-317. The plasmid phuOPGbp 1.1 was used to encode human osteoprotegerin binding Specifically, the sequences can be used to screen cDNA and genomic libraries for related osteoprotegerin binding protein sequences, especially in other species. The nucleic acids can also be used to The level of osteoprotegerin binding protein is modulated by antisense technology or by m uivo gene expression. The development of transgenic animals expressing osteoprotegerin binding protein is well suited for studying activity. The nucleic acids are linked to DNA sequences to express a biologically active osteoprotegerin binding protein. The sequences required for expression are known to those skilled in the art and include those for expression of RNA synthesis [Methods in Enzymology, 185, let DV>SAoademic Press (1990)]. The mammalian host16 .ο The osteoprotegerin binding protein may be the product of prokaryotic or eukaryotic expression of an exogenous DNA sequence, i.e. normal DNA and synthetic DNA The osteoprotegerin binding protein may be the product of bacterial, yeast, plant, insect or mammalian cell expression, or may be derived from cell-free translation systems. The osteoprotegerin binding protein produced in bacterial cells has an N-terminal methionine. The invention further provides a method for producing an osteoprotegerin binding protein, which comprises propagating prokaryotic or eukaryotic host cells transformed or transfected with a nucleic acid encoding an osteoprotegerin binding protein, and then isolating the polypeptide expression products of the nucleic acids. The polypeptides described in the invention include polypeptides that are osteoprotegerin binding proteins or fragments, analogs or derivatives thereof. In a preferred embodiment, the osteoprotegerin binding protein is a human osteoprotegerin binding protein. The term fragment of an osteoprotegerin binding protein refers to a polypeptide from which one or more amino acids have been deleted such that the resulting polypeptide has at least the property of binding osteoprotegerin. In said fragments, the deletions have been made at the N-terminus, at the C-terminus and within the polypeptide. Fragments of osteoprotegerin binding proteins contain at least about 10 amino acids, at least about 20 amino acids, or at least about 50 amino acids. In preferred embodiments, the osteoprotegerin:binding protein comprises one or more amino acid deletions in the transmembrane region (amino acid residues 49-69, as shown in Figure 1).), or, alternatively, one or more amino acid residues in the N-terminal region up to the transmembrane region; and / or including the transmembrane region (amino acid residues 149, as shown in FIG. 1). In another embodiment, the osteoprotegerin binding protein is a soluble protein comprising, for example, amino acids 69-316 or amino acids 70-316, or a C-terminal or N-terminal truncated form thereof, which retains osteoprotegerin binding activity. The osteoprotegerin binding protein may also be a human soluble protein, as shown in FIG. 4, comprising residues 69-317, as shown in FIG. 4. and their N-terminal truncated forms, e.g. 70-517, 71-517, 71-317, 72-317, etc. A preferred embodiment.In one embodiment, the soluble human osteoprotegerin binding protein comprises residues 69-317, as well as N-terminally truncated forms thereof, up to residues 158-317 of the osteoprotegerin binding protein, or alternatively, up to residues 166-317 of the osteoprotegerin binding protein. The term osteoprotegerin binding protein analog refers to a polypeptide that contains one or more amino acid substitutions or additions such that the resulting polypeptide has at least the property of binding osteoprotegerin. In said analogs, the substitution or addition may occur anywhere in the polypeptide. Preferred analogs are those that are soluble osteoprotegerin binding proteins. Fragments or analogs may occur in nature, i.e., they may be the products of an allelic variant polypeptide, or of an mRNA splice variant, or they may be produced by techniques for manipulating and synthesizing nucleic acids available to those skilled in the art. The polypeptides may or may not contain an N-terminal methionine. Derivatives of osteoprotegerin binding proteins known in the invention are polypeptides that have undergone post-translational modifications (i.e., N-linked or O-linked carbohydrate chains, processing of the N-terminal or C-terminal ends, attachment of chemical groups to the amino acid backbone, chemical modification of the N-linked or O-linked carbohydrate chains, and addition of an N-terminal methionine as a result of expression in a prokaryotic host cell. More specifically, chemically modified derivatives of the osteoprotegerin binding protein. which provide additional advantages, such as increased stability, longer circulation time, or reduced immunogenicity, are also contemplated. In particular, modification with polyethylene glycol and its derivatives (see, for example, U.S. Patent No. 4,179,337). The chemical groups for derivatization can be selected from water-soluble polymers, such as polyethylene glycol, ethylene glycol / propylene glycol copolymers, carboxy groups, or even more linked chemical units. The polypeptides can also be modified at predetermined positions, such as the N-terminus, or at selected lysine or arginine residues. Other chemical modifications can include a detectable label, such as an enzymatic, fluorescent, isotopic, or affinity label, which allows the protein to be detected and isolated. Osteoprotegerin binding protein chimeras comprise the osteoprotegerin binding protein, or a portion thereof, fused to a heterologous amino acid sequence. The heterologous sequence may be any sequence that allows the resulting fusion protein to retain at least its osteoprotegerin binding activity. In a preferred embodiment, the C-terminal extracellular domain of the osteoprotegerin binding protein is fused to a heterologous sequence. Such sequences may include, for example, heterologous cytoplasmic domains that allow for alternative intracellular signaling events, sequences that facilitate oligomerization, such as the Fc region of IgG, enzyme sequences that provide a label for the polypeptide, and sequences that provide affinity probes, such as antigen-antibody recognition. The polypeptides are isolated and purified from tissues and cell lines expressing osteoprotegerin binding protein, either from lysates or conditioned growth medium, or from the osteoblasts. extracted from cells. Osteoprotegerin binding protein can be obtained from the murine myelomonocyte cell line 32-D (ATCC accession number CRL-11346). Human osteoprotegerin binding protein, or nucleic acid encoding it, can be isolated from human lymph node or fetal liver tissue. The isolated osteoprotegerin binding protein is free from all other human proteins and other cellular components. The osteoprotegerin binding protein is isolated from natural sources (e.g., tissues and cell lines that normally express osteoprotegerin binding protein). The purification step may comprise one or more standard protein purification steps, in an appropriate sequence, to obtain the purified protein. The chromatography step may be ion exchange, gel filtration, hydrophobic interaction, reversed phase, chromatofocusing, affinity chromatography using an anti-osteoprotegerin binding protein antibody or biotin-streptavidin affinity complex, and the like. Antibodies that specifically bind to polypeptides are also within the scope of the present invention. The antibodies can be prepared by immunization with full-length osteoprotegerin binding protein, soluble forms of osteoprotegerin binding protein, or a fragment thereof. The antibodies of the invention can be polyclonal or monoclonal antibodies, or they can be recombinant antibodies, such as chimeric antibodies, in which the murine constant regions on the light and heavy chains are replaced by human sequences, or CDR-grafted antibodies, in which only the complementarity determining regions are of murine origin. The antibodies of the invention can be human antibodies, such as those obtained by for the production of human antibodies (see, for example, PCT application WO93 / 12227). The antibodies are useful for detecting osteoprotegerin binding [e; ai. from samples, thus allowing the identification of cells or tissues that produce the protein. In addition, those antibodies. that bind to the osteoprotegerin-binding protein and thereby inhibit the interaction with other proteins that are also capable of binding, can be used therapeutically to influence osteoclast differentiation and bone resorption. Antibodies to osteoprotegerin binding proteins may be useful in the treatment of bone diseases such as osteoporosis and Paget's disease. The antibodies are tested in the presence and absence of osteoprotegerin and can be tested for their ability to inhibit ligand-mediated osteoclastogenesis and / or bone resorption. It is also expected that the peptides themselves act as antagonists in the ligand-receptor interaction and inhibit ligand-mediated osteoclastogenesis, and osteoprotegerin binding protein peptides are also tested in this regard. The invention also provides pharmaceutical compositions comprising said antibody or fragment thereof and a pharmaceutically acceptable diluent, carrier, solubilizer, emulsifier, preservative and / or adjuvant. The pharmaceutical compositions would typically contain a therapeutically effective amount of the active ingredient. The term "therapeutically effective amount" means an amount that provides a therapeutic effect for a specific condition and route of administration. The composition may be in liquid or lyophilized form and may contain a diluent (TRIS, acetal or phosphate buffers) of varying pH and ionic strength, a solubilizer, e.g. Tween. or Polysorbate, carriers such as human serum albumin, gelatin, preservatives such as thimerosal or benzyl alcohol, and antioxidants such as ascorbic acid or sodium metabisulfite. A given component may be .The choice of the appropriate component depends on a number of factors, including the condition being treated, the route of administration, and the desired pharmacokinetic parameters. A detailed summary of components suitable for use in pharmaceutical compositions can be found in the literature (Remington's Pharmaceutical Sciences, 18th ed., eds. AR Gennaro, Mack, Boston. PA (1980)1. The compositions of the invention may be administered by injection, subcutaneously, intravenously or intrathecally, or orally, nasally, pulmonaryly or rectally. The route of administration ultimately selected will depend on a number of factors and will be determined by one skilled in the art. Osteoprotegerin binding proteins can be used in a variety of assays to detect osteoprotegerin and characterize the interaction with osteoprotegerin. The assay generally involves incubating the osteoprotegerin binding protein with a biological sample containing osteoprotegerin under conditions that allow osteoprotegerin to bind to the osteoprotegerin binding protein, and then measuring the extent of binding. Osteoprotegerin may be purified or present in a mixture, such as in body fluids or culture media. Assays can be developed that are either quantitative or qualitative, and the latter can be used to determine the binding parameters (affinity constants and kinetics) of osteoprotegerin to the osteoprotegerin binding protein and to quantify the level of biologically active osteoprotegerin in mixtures.The assays can also be used to evaluate the binding of osteoprotegerin to osteoprotegerin-binding protein fragments, analogs, and derivatives, and to identify new members of the osteoprotegerin and osteoprotegerin-binding protein families. Binding of osteoprotegerin to osteoprotegerin binding protein can be performed in a variety of ways, including cell-based binding assays, membrane-binding assays, solution-phase assays, and immunoassays. Typically, trace levels of labeled osteoprotegerin are incubated with osteoprotegerin binding protein samples for a specified time, followed by measurement of bound osteoprotegerin by filtration, electrochemiluminescence (ECL, ORIGEN system from IGEN), cell-based assays, or immunoassays. Homogeneous assay technologies for measuring radioactivity (SPA; Amersham.) and time-resolved fluorescence (HTRF, Packázd) can also be used. Binding is detected by labeling osteoprotegerin or an anti-osteoprotegerin antibody with radioactive isotopes (12S1,35S,3H), fluorescent dyes (fluorescein), lanthanide (Eu34) chelates or cryptates, orbipyridyl ruthenium (Ru2+) complexes.It is clear that the choice of a labeled probe will depend on the detection system used. Alternatively, osteoprotegerin can be modified with an unlabeled epitope tag (e.g., biotin, peptides, Hisc, myc) and linked to streptavidin, anti-peptide or anti-protein antibodies, the levels of which can be detected as described above. An alternative method is to directly assay osteoprotegerin binding protein using polyclonal or monoclonal antibodies against osteoprotegerin binding protein in an immunoassay. The method involves incubating osteoprotegerin binding protein with a compound under conditions that allow the compound to bind to the osteoprotegerin binding protein; and then measuring the extent of binding. The compound may be substantially purified or may be in the form of a crude mixture. Binding compounds may be nucleic acids, proteins, peptides, carbohydrates, lipids, or small molecular weight organic compounds that inhibit the activity of osteoprotegerin binding protein, with the aim of determining whether they act as agonists or antagonists. Osteoprotegerin binding proteins can also be used to identify intracellular proteins that interact with the cytoplasmic domain using a yeast two-hybrid screening assay. For example, a hybrid construct can be used as a two-hybrid decoy plasmid that contains DNA encoding the N-terminal 50 amino acids of an osteoprotegerin binding protein fused to a yeast GAL4-DxNS binding domain. Positive clones from the screening assay can be further characterized to identify interacting proteins. This information may help to elucidate an intracellular signaling mechanism associated with osteoprotegerin binding protein and may provide intracellular targets for new drugs that affect bone resorption. Osteoprotegerin binding protein can be used to treat conditions characterized by excessive bone density. The most common The disease results in increased bone mass and is usually fatal within the first few years of life. Osteopetrosis is preferably treated with the administration of soluble osteoprotegerin binding protein. The invention also provides modulators (agonists and antagonists) of osteoprotegerin binding protein, and methods for their preparation. An osteoprotegerin binding p· / 1je modulator either increases or decreases at least one activity associated with the osteoprotegerin binding protein, such as binding osteoprotegerin or some other interacting molecule, or regulating osteoclast maturation. Typically, an agonist or an antagonist may be a cofactor, such as a protein, peptide, carbohydrate, lipid, or small molecular weight molecule, that interacts with the osteoprotegerin binding protein to regulate its activity.Potential polypeptide antagonists include those antibodies that react with soluble or membrane-associated forms of osteoprotegerin binding protein, and those soluble forms of osteoprotegerin binding protein that are part of the extracellular domain of osteoprotegerin binding protein. Molecules that regulate the expression of osteoprotegerin binding protein typically include nucleic acids that are complementary to nucleic acids encoding osteoprotegerin binding protein and that act as antisense regulators of expression. Osteoprotegerin binding protein plays a role in the regulated formation of mature osteoblasts, which are primarily involved in bone resorption. An increase in the rate of bone resorption (which exceeds the rate of bone formation) can lead to various bone disorders, collectively known as osteopenias, and includes osteoporosis, osteomyelitis, hypercalcemia, osteopenia resulting from surgery or steroid administration, Paget's disease, osteonecrosis, bone loss resulting from rheumatoid arthritis, and. periodontal (around the tooth) bone loss, immobilization, prostatic loosening, and osteolytic metastasis. Conversely, a decrease in the rate of bone resorption can lead to osteopetrosis, a condition characterized by excessive bone density. Agonists and antagonists of osteoprotegerin binding protein affect osteoclast formation and can be administered to patients with bone disorders. Agonists and antagonists of osteoprotegerin binding protein used to treat osteopenias can be administered alone or in combination with an effective amount of a bone growth promoting agent, which can be a bone growth inhibiting agent such as BMP-1.2 bone morphogenetic factors, transforming growth factors of the β-factor and TGF-β families, fibroblast growth factors FGF-1 FGF-10, interleukin-1 inhibitors, Wα inhibitors, parathyroid hormone, E-series prostaglandins, bisphosphonates, and bone-strengthening minerals such as fluoride and calcium. Osteoprotegerin-binding proteins and their antagonists may be particularly useful in the treatment of osteopenia. Certain receptors can interact with osteopro tegerin binding proteins. Specifically, one such receptor is the osteoclast differentiation and activation receptor (ODAR). ODAR is a transmembrane polypeptide that shows the highest degree of homology to CD40, a member of the TNF receptor family. The murine ODAR nucleic acid sequence and the polypeptide sequence it encodes are shown in Figure 10. The human homologue of the murine ODAR can be readily isolated by screening a human cDNA or genomic library by hybridization. Cloning procedures for human ODAR are similar 2£ to those described in Example 5 for cloning human osteoprotegerin binding proteins. The human homologue of the polypeptide shown in Figure 10 was published in Andersen et al. [Anderson et al.: Nature 390, 175-179 (1997)|, and is hereinafter referred to as RANK. RANK can be characterized as a type I transmembrane protein that shows homology to members of the TNF receptor family and plays a role in dendritic cell function. Evidence for the interaction of ODAR and osteoprotegerin binding protein is presented in Figure 13. A soluble form of ODAR (ODAR-Fc fusion protein) inhibits osteoclast maturation in tendon tissue (Figure IX), and increases bone density in normal mice after subcutaneous injection (Figure 13). The results are consistent with the fact that osteoprotegerin binding protein interacts with and activates ODAR, thereby promoting osteoclast maturation. Osteoclast maturation and the rate and extent of bone resorption are regulated by the interaction of osteoprotegerin binding protein and ÖDAR. Compounds that reduce or block the interaction of osteoprotegerin binding protein and ÖDAR are ODAR, are potential antagonists of osteoprotegerin binding protein activity, and may disrupt osteoclast development, resulting in increased bone resorption. Several different assays can be used to screen compounds for their ability to enhance or decrease the rate or extent of binding of the osteoprotegerin binding protein to the QDAR. In one type of assay, the ODAR protein can be immobilized by coupling to the bottom of the wells of a microtiter plate. Radiolabeled osteoprotegerin binding protein (e.g., iodinated osteoprotegerin binding protein) and the test compound(s) can be added to the wells either individually (in any order) or simultaneously. After incubation, the wells can be washed and the solution can be binding of ODAR to osteoprotegerin binding protein A series of control wells, lacking one or more elements of the assay procedure, can be used to evaluate the accuracy of the results. An alternative to this method involves reversing the “positions” of the proteins, i.e. immobilizing the osteoprotegerin binding protein to the wells of a microtiter plate, incubating it with the test compound and radioactive ODAR, and determining the extent of ODAR binding [see, for example: Current Protocols in Molecular Biology, Chapter 18, eds.; Ausubel et al., John Wiley & Sons, New York (1995)]. As an alternative to radioactive labeling, osteoprotegerin binding protein or ODAR can be biotinylated and the presence of the biotinylated protein can then be detected with streptavidin coupled to an enzyme, such as horseradish peroxidase (HRP) or alkaline phosphatase (AP), which can then be detected calorimetrically. or by fluorescent labeling of streptavidin. An antibody against osteoprotegerin binding protein or ODAR can also be used that is conjugated to biotin and detected by incubation with streptavidin coupled to alkaline phosphatase or horseradish peroxidase. immobilized by coupling to an inert substrate. The substrate protein complex can be placed in a solution containing the complement protein and the test compound; after incubation, the beads can be precipitated by centrifugation, and the amount of binding between the osteoprotegerin binding protein and the ODAR can be determined by the methods described above. Alternatively, the substrate protein complex can be immobilized on a column, and the test molecule and the complement protein can be passed through the column. The formation of the complex between the osteoprotegerin binding protein and the ODAR can be estimated using any of the techniques described above, such as radioactive labeling, antibody binding, or the like. A suitable method for identifying a compound that increases or decreases the formation of the ODAR / osteoprotegerin. binding protein complex is a surface plasmon resonance detector system, such as the Biacore assay system (Pharmacia, Piscataway, NJ). The Biacore system can be used according to the manufacturer's instructions. This assay essentially consists of covalently linking either the osteoprotegerin binding protein or ODAR to a dextran-coated sensor chip, which is located in a detector. The test compound and the other complementary protein can then be injected simultaneously or sequentially into the chamber containing the sensor chip, and the amount of binding complementary protein can be determined based on how the physical affinity of the sensor chip for the dextran-coated side changes. -Ota· related molecular weight; the change in molecular weight can be measured with the detector system. In some cases, it may be desirable to evaluate two or more test compounds simultaneously to determine whether they can be used to increase or decrease the formation of the ODAR / osteoprotegerin binding protein complex. In these cases, the assay procedures described above can be readily modified by adding such additional test compound(s), either simultaneously or sequentially to the first test compound. The remaining steps of the assay procedure are the same as those described above. The in vitro assays described above can be advantageously used to rapidly screen a large number of compounds for their effect on the complex formation between ODAR and osteoprotegerin binding protein. The assays can be automated to screen compounds found in phage display, synthetic peptide, and chemical synthesis libraries. Compounds that increase or decrease the formation of a complex between osteoprotegerin binding protein and ODAR can also be used for screening in cell culture using cells and cell lines that carry ODAR. The cells and cell lines can be obtained from any mammalian species, but preferably from human or other primate, canine or rodent sources. ODAR-containing cells, such as osteoclasts, can be enriched from other cell types by affinity chromatography using published methods. The binding of osteoprotegerin binding protein to ODAR-containing cells can be assessed in the presence or absence of test compounds and the extent of binding can be determined, for example, by flow cytometry using a biotinylated antibody raised against osteoprotegerin binding protein. Alternatively, a culture of mouse or human osteoclasts can be established using the method of 8.as described in Example 1, and the compounds tested can be evaluated for their ability to block osteoclast maturation stimulated by the addition of CSF-1 and osteoprotegerin binding protein. Cell culture methods can be advantageously used to further evaluate compounds that have tested positive in the protein binding assays described above. Compounds that increase or decrease the interaction of the osteoprotegerin binding protein with ODAR can also be evaluated for m-photro activity by administering the compounds to mice and then measuring bone density by scanning densitometry or radiography. The bone density can be found in the FCT publication and in Example 13. Certain compounds reduce or block the interaction between osteoprotegerin binding protein and ODAR and are antagonists of osteoclast formation. Such compounds can generally be divided into two groups. One group includes compounds that are derived from osteoprotegerin binding protein or that interact with osteoprotegerin binding protein. These have been described above. A second group includes compounds that are derived from ODAR or that interact with ODAR... Compounds that are antagonists of ODAR may be, for example, nucleic acids, proteins, peptides, carbohydrates, lipids or small molecular weight organic compounds. ODAR antagonists can be compounds that bind to or near one or more of the osteoprotegerin binding protein binding sites in the extracellular domain of ODAR and reduce or completely block the formation of the complex. ODARs are the regions that play a role in the identification of osteoprotegerin that play a role in the formation of the complex. Compounds can then be designed that preferentially bind to the regions involved in the formation of the complex and therefore act as antagonists. ODAR antagonists can also bind to QDAR at sites distant from the osteoprotegerin binding protein binding sites and induce conformational changes in the ODAR polypeptide, resulting in the formation of a reduced amount of complex with osteoprotegerin binding protein, or a nonproductive complex. It is possible that one of the antagonists is a soluble form of ODAR that lacks a functional transmembrane domain. Soluble forms of ODAR may have one or more amino acid deletions in the transmembrane domain (amino acids 214-234, as shown in Figure 10). Soluble ODAR polypeptides may contain the extracellular domain or a portion thereof and may bind osteoprotegerin binding protein. Optionally, the soluble ODAR may be part of a chimeric protein in which the extracellular domain or a portion thereof of ODAR is fused to a heterologous amino acid sequence. In one embodiment, the heterologous amino acid sequence is the Fc region of human IgG. Modulators (agonists and antagonists) of ODAR can be used to prevent or treat osteopenia, including osteoporosis, osteomyelitis, chronic hypercalcemia, osteopenia secondary to surgery or steroid administration, Paget's disease, osteonecrosis, bone loss due to rheumatoid arthritis, periodontal bone loss, immobilization, prostatic loosening, and osteoarticular metastasis. ODAR agonists and antagonists used to treat osteopenia are administered alone or in combination with a therapeutically effective amount of a bone growth promoting agent, including BMP-1. - BMP-1.2 bone morphogenetic factors, β-factor and transforming growth factors of the TGF-β family, FGF-1 - FGF-10 fibroblast growth factors, interleukin-1 inhibitors, TNFa inhibitors, parathyroid hormone, prostaglandins of the E series, bisphosphonates and bone-strengthening minerals, such as a.dumadat and calcium. ODAR antagonists are particularly useful in the treatment of osteopenia. The following examples are provided to illustrate the invention in more detail, but are not intended to limit the scope of the invention. Example 1 Identification of a cell as a source of osteoprotegerin binding protein. clastogenesis in vitro and in vivo. Since osteoprotegerin is a TNFR-related protein, it is likely to interact with .i. L powder medium was removed, and the adherent cultures were washed with phosphate-buffered saline (PBS) (Gibco) containing 1% fetal calf serum. Recombinant mouse osteoprotegerin

[22194] -Fc and human osteoprotegerin [22-20 1]-Fc fusion proteins [U.S. Patent No. 08 / 705,945, filed September 3, 1996] were each diluted to a concentration of 5 μg / ml in phosphate-buffered saline and incubated for 45 minutes at 0 °C. The osteoprotegerin-Fc fusion protein solution was discarded and the cells were washed in PBS-FCS as described above. The cultures were then stained with ncoerythrin. bring into contact (Southern Associates Cat.#2043-09) diluted in PBS-FCS. After incubation at 0 °C for 30-45 minutes, the solution is discarded and the cultures are washed as described above. The cells are then analyzed by immunofluorescence microscopy to detect cell lines that express a cell surface osteoprotegerin. Suspension cell cultures are analyzed in a similar manner with the following modifications: the diluent and wash buffer consist of calcium- and magnesium-free phosphate-buffered saline containing 1% FCS. Cells are harvested from exponentially dividing cultures from the medium, pelleted by centrifugation, and suspended at a density of 1 x 1.07 cells / ml in a 96-well microtiter tissue culture plate (Falcon). The cells are then sequentially exposed to recombinant osteoprotegerin-Fc fusion proteins, followed by secondary exposure as described above, and the cells are washed by centrifugation between steps. The cells are then analyzed by fluorescence-activated cell sorter (FACS) using a Becton Dickinson FACscan. ..1 :al, Expression cloning of a murine osteoprotegerin binding protein A cDNA library was constructed from 32D mRNA and ligated into the pcDNA3.1(A) mammalian expression vector (Invitrogen, San Diego, CA). 32D cells grown exponentially in the presence of recombinant mterleukin-3 were harvested and total mRNA was purified by acid guanidium thiocyanate-phenol-chloroform extraction [Chomczynski and Sacchi: Analytical Biochemistry 162, 156-159 (1987)]. The poly(Ad mRNA fraction was separated by adsorption and elution from the total RNA, using the gy A directed, oligo-dT primed cDNA library was prepared using the Superscript Plasmid System (Gibco BRL?Gaithersburg, MD) using the manufacturer's recommended procedure: The resulting cDNA was completely digested with Sal and The DNA is fractionated with NotI restriction endonuclease and then size-exclusion gel chromatography. The highest molecular weight fraction is selected and ligated into the pcDNA3.1Bj plasmid vector (Invitrogen, San Diego, CA). This vector contains the CMV promoter upstream of the multiple cloning site, which directs high-level expression in eukaryotic cells. The library is then introduced by electroporation. Escherichia coli (ElectroMAX D-H10B, Gibco, NY) and titered on LB agar containing 109 μg / ml ampicillin. The library was then pooled into individual pools containing approximately 1000 klons per pool, and 1.0 ml of culture from each pool was grown for 16-20 hours at 37°C. Plasmid DNA was isolated from each culture using the Qiagen Qiawell 96 Ultra Plasmid Kit (catalog number 16191) following the manufacturer's recommended procedure. Arrayed pools of the 32D cDNA expression library are lipofected into COS-7 cultures and then tested for the presence of the cell surface osteoprotegerin binding protein. To do this, COS-7 cells were plated at a density of 1 x 106 per ml in six-well tissue culture plates (Costar) and cultured overnight in DMEM containing 10% FCS (Gibco). Approximately 2 pg of plasmid DNA from each pool was diluted in 0.5 ml of serum-free DMEM and sterilized by centrifugation through a 0.2 gm Spin-X column (Costar). At the same time, 10 μΐ Lipofectamine (Lile Technologies, catalog number 18324-012) was added to each tube containing 0.5 ml of serum-free DMEM. The DNA and Lipofectamine solution were mixed and incubated at room temperature for 30 minutes. The COS-7 cell cultures are then washed with serum-free DMEM and the DNA-lipofectamine complexes are contacted with the cultures for 2-5 hours at 37°C. After this period, the media is removed and replaced with DMEM containing 1053 FCS. The cells are then cultured for 48 hours at 37°C. To detect cultures expressing osteoprotegerin binding protein, the growth medium was removed and the cells were washed with PBS-FCS. A 1.0 ml volume of PBS-FCS containing 5 µg / ml human OPG[22-2011] fusion protein was added to each well and incubated for 1 hour at room temperature. The cells were washed three times with PBS-FCS and immersed in glutaraldehyde. The cultures were allowed to cool and the FOS solution was aspirated. The cultures were then incubated at room temperature for 30 min. human IgG antibody (S1GMA. Product # A-9S44), then washed three times with a solution containing 20 mmol / l TRIS-HCl (pH-7.6) and 137 mmol / l sodium chloride. The immune complexes formed during these steps are detected by assaying alkaline phosphatase activity with the Fást Red TR / AS-MX Substrate kit (Pierce, catalog number 34034), following the manufacturer's recommended procedure. We screened 32 independent cDNA clones, representing a transfected pool of 300 clones of 1000 each. A single clone was identified that had the ability to specifically carry the osteoprotegerin-Fc fusion protein. This pool was divided by successive rounds of sib selection to yield a single plasmid clone, designated 32D-F3 (Figure 1). The 32D-F3 plasmid DNA was then transfected into COS-7 cells with the 22-2011-Fc fusion protein plus secondary antibody or ATAR-Fe fusion protein [also known as ATAR HVEM; Montgomery et al.: Cell 87: 427-436 (1996)] and immunostained (Figure 2). The secondary antibody alone did not bind to COS-7 / 32D-F3 cells, nor did the ATAR-Fc fusion protein. Only the osteoprotegerin-Fc fusion protein bound to COS-7 / 32D-F3 cells, indicating that a. 32D-F3 encodes an osteoprotegerin-binding protein that is localized to the surface of expressing cells. Example 3 Clone 32D-F3, isolated as above, contains a cDNA insert of approximately 2.3 kilobases (Figure 1), which was sequenced in both directions using an Applied Biosystems 373A automated DNA sequencer using primer-directed Taq dye-terminator reactions (Applied Biosystems), following the manufacturer's recommended procedure. The resulting nucleotide sequence was compared to the DNA sequence database using the FASTA program (GCG, University of Wisconsin) and analyzed for the presence of long open reading frames (LORFs) using the Six-way open reading frame (FRAMES) program (GCG, University of Wisconsin). A 316-amino acid LORF starting with methionine was detected in the correct orientation, preceded by a 5' untranslated region of approximately 150 bp. The 5' untranslated region contains an in-frame stop codon preceding the predicted start codon.This demonstrates that the structure of plasmid 32D-F3 is consistent with its ability to use the CMV promoter region to drive the expression of a 316 amino acid gene product in mammalian cells. The predicted osteoprotegerin-binding protein sequence is then compared to an existing database of known protein sequences using a modified version of the FASTA program. [Pearson: Methods in Enzymology 138, 63-98 (1990)]. The amino acid sequence is further examined for the presence of specific motifs that are conserved in all known members of the tumor necrosis factor (TNF) superfamily using the sequence profile method. (Gribskov et al.: for superfamily, highly significant, with a Z value of 19.46. The amino acid sequence of osteoprotegerin binding protein contains a possibly hydrophobic transmembrane domain starting at M49 and ending at L69. Based on this configuration relative to the methionine start codon, we believe that osteoprotegerin binding protein is a type II transmembrane protein with a short N-terminal intracellular domain and a longer C-terminal extracellular domain (Figure 4). This may be similar to all known members of the TNF family, except lymphotoxin alpha [Nagat and Golstein: Science 267, 1449-1456 (1995)]. A and 100 pg / ml denatured salmon DNA solution for 2-4 hours at 42°C. The biots are then hybridized with 5X SSPE, 50% formamide, 2X Denhardt's solution, 0J% SDS, 100 μg / ml denatured salmon sperm DNA and 5 ng / ml labeled probe solution for 18-24 hours at 42°C. The biots are then washed with 2X SSC for 10 minutes at room temperature and then washed with IX for 10-15 minutes. Using a probe derived from mouse cDNA, hybridization under stringent conditions revealed a predominant mRNA of approximately 2.5 kilobases in lymph nodes (Figure 3). A weak signal of the same relative molecular weight was also detected in fetal liver mRNA. No osteoprotegerin binding protein transcripts were detected in other tissues examined. The data suggest that osteoprotegerin binding protein mRNA is very strictly restricted to human tissues. The data also show that the size of the isolated cDNA clone is very close to the size of the natural transcript. Molecular cloning of human osteoprotegerin binding protein The human homolog of osteoprotegerin binding protein is expressed in human peripheral lymph nodes as an mRNA of approximately 2.5 kilobases in size and can be detected by a mouse cDNA probe under stringent hybridization conditions. DNA encoding human osteoprotegerin binding protein is obtained by screening a human lymph node cDNA library with either recombinant bacteriophage plaques or transformed bacterial colonies using hybridization methods [Sambrook et al., Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Press, Cold Spring Harbor, NY (1989)1. To do this, the dental or plasmid cDNA library is screened with radiolabeled probes derived from the murine osteoprotegerin binding protein clone 32D-F3. The probes are used to screen a nitrocellulose sheet printed from a plated library. These filters are prehybridized and then hybridized under the conditions described in Example 4, ultimately yielding a.Purified clones of human osteoprotegerin binding protein cDNA. Inserts from any of the human osteoprotegerin binding protein clones are sequenced and analyzed as described in Example 3. A human lymph node Af RNA (Clontech., Inc., Falo Alw, CA) was screened for the presence of osteoprotegerin binding protein transcripts as previously described in U.S. application Ser. No. 08 / 577,788, filed December 22, 1995. A Northern blot prepared from this RNA sample was subjected to stringent conditions with a 32P-labeled mouse osteoprotegerin binding protein probe and indicated the presence of human osteoprotegerin binding protein transcripts. Oligo-dT-guided cDNA was synthesized from lymph node mRNA using the SuperScript kit (G1BCO Life Technologies, Gaithersburg, MD) as described in Example 2. The resulting cDNA is size-selected, and the high molecular weight fraction is ligated into the pcDN.A 3.1 (*) plasmid vector (Invitrogen, San Diego, CA).Electrocompetent E. coli DH10 cells (GIBCO Life Technologies, Gaithersburg, MD) were transformed and 1*106 ampicillin-resistant transformants were screened by blot hybridization using a 32P-labeled mouse osteoprotein binding protein probe. A plasmid clone of the putative human osteoprotegerin-binding protein cDNA, phuO'PGbp-1.1, was isolated, which contains a 2.3 kilobase insert. The nucleotide sequence of the phuOPGbp-L1 insert is approximately 80-85% homologous to the cDNA sequence of the mouse osteoprotegerin-binding protein. Translation of the insert DNA sequence reveals the presence of a long open reading frame, which is predicted to encode a polypeptide of 317 amino acids (Figure 4), and comparison of the mouse and human osteoprotegerin-binding proteins shows that: are identical, the protein is highly conserved throughout evolution The DNA and protein sequences of human osteoprotegerin binding protein were not found in Genbank, and no homologous EST sequence could be found. As with the rodent homolog, human osteoprotegerin binding protein shows strong sequence similarity to the cytokine TNFa superfamily. PCR amplification using the primer pairs and therapies described below is used to generate different forms of the murine osteoprotegerin binding protein. One primer of each pair introduces a TAA stop codon and an XhoI or SacI cleavage site after the C-terminus of the gene. The other primer of each primer pair introduces a single NdeI cleavage site, an N-terminal methionine, and optimized codons into the N-terminus of the gene. Polymerase chain reaction is performed using standard recombinant DNA techniques. PCR products are purified, digested with restriction enzymes, and inserted into the unique NdeI and XhoI or SacI cleavage sites of the pAMG21 vector (ATCC accession number 98113) and introduced into the prototrophic Escherichia coli strains 393 or 2596. Other commonly used Escherichia coli expression vectors and host cells are also suitable for expression.After transformation, the clones are selected, plasmid DNA is isolated and the osteoprotegerin binding protein insert sequence is verified. .121-rodent osteoprotegerin binding protein [75-3161 This construct was designed and prepared to be 242 amino acids long and to contain the following N-terminal and C-terminal residues: NHa-Met (75)-Asp-Pro-AsnArg------------—Gln-Asp-He-Asp (316)~COOH. The template used for PCR was pcD.NA / 32D~F3? and the oligonucleotides #1581-72 and #1581-76 were used as primer pairs for PCR and cloning of this gene construct. 1581-72: S'-GTTCTCCTCATATGGATCCAAACCGTAITTCTGAAGACAGG ACTCACTGCTT-3' (sequence number 5) 1531-76: 5*-TACGCACTCCGCGGTTAGl€TATGTCCTGAACTTTGA-3' (SEQ ID NO: 6) pAMG2l·-rodent osteoprotegerin binding protein [95-316] This construct was designed and prepared to be 223 amino acids long and to have the following N-terminal and It contains C-terminal residues: NHa-Met-His (95)--Glu~AsnAla-Gly--------------Gln-Asp-Ile-Asp (316J-COOH. The template used for PCR is pcDNA / 32D-F3, and oligonucleotides #1591-90 and #1591-95 are used as primer pairs for PCR and cloning of this gene construct. 5'-ATTrGATTCTAGAAGGAGG.AATAACA.TATGCATGAAAACG CAGGTCTGCAG-3 (sequence number 7) 1591-95: 5'-TATCCGCGATCC'rCÖAGTTAGTCTATGTCCTGAACnTGAA3 This construct was designed and prepared to be 211 amino acids long and to contain the following N-terminal and C-terminal residues: NHs-Met-Ser (107)-Gl.u-AspThr-beu--------Gln-Asp-Ile-Asp (316)-COOH. The template used for PCR was pcDNA / 32D-F3, and oligonucleotides #1591-93 and #1591-95 were used as primer pairs for PCR and cloning of this gene construct. 5'-ATTTGATTCTAGAAGGAGGAATAACATATGTCTGGAAGACAG 1591-95: sequence number) This construct was designed and prepared to be 1.99 amino acids long and contain the following N-terminal and C-terminal residues: HHa-Met (1.18)-lys-GIn-AlaPhe-Gln.....................Gln-Asp-He-Asp (316)-ΟΟΟΗ. The template used for PCR was pεDN.A / '32D-F3, and oligonucleotides #1591-94 and ^1591-95 were used as primer pairs for PCR and cloning of this gene construct. S'-A'H'TGATTCTAGAAGGAGGAATAACATATGxAAACAAGdTF TCAGGGG-3 (sequence number II) 1591-95: 5*-TATCCGCGGATCCTCGAGTTAGTCTATGTCCTGAACTTTGAA3' (SEQ ID NO: 12) pAMG21-rodent osteoprotegerin binding protein [128--316] This construct was designed and prepared to be 190 amino acids long and contain the following H-terminal and C-terminal residues: Nfís-Met-Lys (128)-Glu-LeuGln-His------Gln-Asp-Ile-Asp (316)-COOH. The template used for PCR was pcDNA / 32D-F3, and the oligonucleotides #1591-91 and #1591-95 were used as primer pairs for PCR and cloning of this gene construct. 1591-91: 5'-ATTTGATTCTAGAAGG AGGAATAAC ATATGAAAG A ACTGC AGCACATTGTG-3·· (SEQ ID NO: 13) 1591-95: 5'-TATCCGCGGATCCTCG.AGTTAGTCTATGTCCTGAACTTTGAA3' (SEQ ID NO: 14) pAMG21-Murine Osteoprotegerin Binding Protein [137-316] This construct was designed and prepared to be 181 amino acids in length and to contain the following R-terminal and C-terminal residues; NH^-Met-Gln (137j-Arg-PheSer-Gly--------—Gln-Asp-Ile-Asp (316)-0000. The PCR medium used was pcDNA / 32D-F3, and oligonucleotides #1591-92 and #1591-95 were used as primer pairs for PCR and cloning of this gene construct. 1591-92: S'-ATTTGATTCTAGAAGGAGGAATAACATATGCAGCGTTTCTG TGGTGCTCCA-3' :(sequence number 15..) 1591-95: 5'-TATCCGCGGATCTCGAGTTAGTCTATGTCCTGAACTnxGAA3· (SEQ ID NO: 16) This construct was designed and prepared to be 171 amino acids long and contain the following N-terminal and C-terminal residues: NHs-Met (1.46)-Glu-Gly-SerTrp-------------Gln-Asp-Ile-Asp (316)-COOH. The template used for PCR was pAMG21-murine osteoprotegerin binding protein [753161. and oligonucleotides #1600-98 and #1581-96 were used as primer pairs for PCR and cloning of this gene construct. S'-GTTCTCCTACTATGGAAGGTTCTTGGTTGGATGTGGCCCA3' (SEQ ID NO: 17) .1581-76: 5'-TACGCACTCCGCGGTTAGTCTATGTCCTGAACTTTGA3^ (SEQ ID NO: 18) pAMG21-murine osteoprotegerin binding protein (156-316 a. construct was designed and prepared to be 162 amino acids long and contain the following N-terminal and C-terminal residues: NHa-Met-Arg (156)-Gly-LysPro------—-Gln-Asp-Ile-Asp (316J-CÖOH, The primer used for PCR The template pAMG:21 - rodent osteoprotegerin binding protein |158316], and oligonucleotides #1619-86 and #1581-76 are used as primers for PCR and cloning of this gene construct. TGCA-3 (SEQ ID NO: 19) 1581-76: (SEQ ID NO: 20) &AMG21-rodent osteoprotegerin binding protein [158-316] This construct was designed and prepared to be 160 amino acids long and contain the following N-terminal and C-terminal residues: NH2-Met-Lys (158)-Pro-GluAla.................--Gto-Asp-Ile-Asp (316]-COOH< The template used for PCR was the pcDNA / 32~F3 plasmid, and the nucleotides #1581-73 and #1581-76 were used as primer pairs for PCR and cloning of this gene construct. 1581-73: S'~GTTCTCCTCATATGAAACCTGAAGCTCCAACCATTTGCAC / CTCACCÁTCAAT-3' (SEQ ID NO: 21^ 1581-76: 5'-TACGCACTCCGCGGTTAGTCTATGTCCTGAACTrTGA-3' (SEQ ID NO: 22) •ptegerin binding protein (166-3161 This construct was designed, engineered, and prepared to be 152 amino acids long and contain the following N-terminal and C-terminal residues: NHa-Met-Hís (166)-Leu-ThrIle......—GIn-Asp-IIe-Asp (316J-COOK.The primer used for PCR is the plasmid peDNA / 32-F3, and the oligonucleotides #1581-75 and #1581-76 are used as primer pairs for PCR and cloning of this gene construct. 5'-GTTCTCCTCATATGCATTTAACTATTAACGCTGCATCTATCG (SEQ ID NO: 23) 1581-76: 5'-TACGCACTCCGCGGTTA.GTCTATGTCCTGAACTTTGA3' (SEQ ID NO: 24) contains terminal groups: NHa-Met-Thr (I66)-Ile-AsnAlá-—--........Gln-Asp-IIe-Asp (316)~COOH. The template used for PCR is the pcDNA / 32~F3 plasmid, and the oligonucleotides #1581-74 and #1581-76 are used as primer pairs for PCR and cloning of this gene construct. 5'-GTTCTCCTCATATGACTATTAACGC'TGCATCTATCCCATCG (SEQ ID NO: 25) 1581-76: 5'-TACGCACTCCGCGGTTAGTCTATGTCCTGAACTTTGA-3' (SEQ ID NO: 26) It is evident that the above constructs are only examples, and one skilled in the art can readily produce other forms of the osteoprotegerm binding protein, as described herein.Recombinant bacterial constructs of the pAMG21-murine osteoprotegerin binding protein (75-316) 95-3 were cloned, their DNA sequences were confirmed, and the level of expression of the recombinant gene product after induction was examined. All constructs produced the gene product at levels that were readily visible after SDS-polyacrylamide gel electrophoresis of crude lysates and Coomassie staining. The transformed Escherichia coli was purified from the inclusion body by solubilization and renaturation of the osteoprotegerin binding protein using methods known to those skilled in the art. Recombinant murine osteoprotegerin binding protein [158-316] was found to be mostly produced in an insoluble form, but approximately 40% of it can be found in the soluble fraction.The recombinant protein is purified from the soluble fraction as described below and its biological activity is then assayed. Example 7. Purification of recombinant murine osteoprotegerin binding protein [158-316] Frozen bacterial cells carrying the expressed murine osteoprotegerin binding protein [158-316] are thawed and resuspended in a buffer containing 20 mmol / l TRIS-HCl (pH 7.0), 10 mmol / l EDTA. The 20% w / v cell suspension is then homogenized by passing it through a microfluidizer three times. The lysed cell suspension is centrifuged for 45 minutes in a JA14 rotor at 10,000 rpm. SDSPAGE analysis shows the presence of a band with a molecular weight of approximately 18 kDa, all in the inclusion bodies. both in the supernatant. The soluble fraction was then applied to a Pharmacia SP Sepharose 4FF column, which was equilibrated with 10 mmol / l MES (ρΗ^ό,Ο) solution.The osteoprotegerin binding protein is then eluted with a 20 column volume sodium chloride gradient [0-0.4 mol / l sodium chloride in MBS (pH~6.0)]. Fractions containing t are then applied to an ABX Bakerbond column equilibrated with 20 mmol / l MES (pH=6.0). The osteoprotegerin binding protein is eluted with a 1SCV sodium chloride gradient (0-0.5 mol / l sodium chloride, Mes pH~6.0). The final product is approximately 95% homogeneous by SDS-PAGE. The peptide starting at the N-terminal (with a mitogen group). The relative molecular weight of the protein does not change with reduction during SDS-PAGE. Example 8 Recombinant osteoprotegerin binding protein has previously been shown to block vitamin D3-dependent osteoclast formation from bone marrow and spleen precursors in the osteoclast formation assay described in U.S. Patent No. 08 / 577,788.Since osteoprotegerin binding protein binds to osteoprotegerin and is a novel member of the TNF family of ligands, it is a potential target for the biological activity of osteoprotegerin. We investigated the ability of recombinant soluble osteoprotegerin binding protein [158-316|, which represents the minimal core of the TNF-α-like domain, to influence osteoclast differentiation from osteoclast precursors. Bone marrow cells were isolated from adult mouse femurs and cultured with M cells in the presence and absence of vitamin D3 and dexamethasone. As previously shown, osteoclasts develop only from mixed cultures containing stromal cells (ST2), vitamin D3, and dexamethasone. Recombinant soluble osteoprotegerin binding protein is added at different concentrations, ranging from 0.1.6 to 500 ng / ml, and osteoclast maturation is determined by visual observation.Osteoprotegerin binding protein strongly stimulated osteoclast activity in a dose-dependent manner, suggesting that it acts as an effective inducer of osteoclastogenesis. The effect of osteoprotegerin binding protein is blocked by recombinant osteoprotegerin (Figure 6). To investigate whether osteoprotegerin binding protein can replace the blockade and added steroids, cultures containing different concentrations of M-CSF, which promotes the growth of osteoclast precursors, were established and different amounts of osteoprotegerin binding protein were also added. As shown in Figure 6, osteoprotegerin binding protein stimulated TRAP activity in a dose-dependent manner, and the magnitude of the stimulation depended on the level of added M-CSF, suggesting that these two factors together are crucial for osteoclast development.To confirm the biological significance of this last observation, we established cultures on bovine cortical bone slices and examined the effects of M-CSF and osteoprotegerin binding protein, both alone and in combination. As shown in Figure 7, osteoprotegerin binding protein in the presence of M-CSF stimulates the formation of large TRAP-positive osteoclasts, which erode the bone surface, resulting in small holes. Thus, osteoprotegerin binding protein acts as an osteoclastogenesis-stimulating (differentiating) factor. This suggests that osteoprotegerin blocks osteoclast development by binding osteoprotegerin binding protein. Example 9 In vivo activity of recombinant soluble osteoprotegerin binding protein In vitro studies have shown that recombinant murine osteoprotegerin binding protein [158,316] produced in Escherichia coli is an effective inducer of osteoclast development from myeloid precursors.To determine the effects of MM, 4- to 5-week-old male BDF1 mice (Charles Rivers Laboratories, Wilmington, MA) received subcutaneous injections of osteoprotegerin binding protein [158-316] twice daily for three days and then on the morning of the fourth day (days 0, 1, 2, and 3). Five groups of mice (n=4) received vehicle alone or 1, 5, 25, or 100 pg of osteoprotegerin binding protein [158-316] daily. Five additional groups of mice (n-4) received the above doses of vehicle or osteoprotegerin binding protein [.158-316] plus human F-osteoprotegerin binding protein [22-194], given as a single subcutaneous injection of 1 mg / kg / day (approximately 20 pg / day). Whole blood ionized calcium was determined before treatment on day 0 and 3-4 hours after the first daily injection of osteoprotegerin binding protein [158-316] on days 1, 2, and 3. Day 3 showed a significant increase in blood ionized calcium after two days of treatment at doses of 5 μg / day and higher (Figure 8).The severity of hypercalcemia suggests an effective induction of osteoclast activity resulting from increased bone resorption. Concomitant administration of osteoprotegerin limits hypercalcemia, and osteoprotegerin-binding protein [158-316] and adipose tissue analysis have also been used to determine whether there is a change in bone mineral density [158-316] in the proximal tibia of mice. The decrease in bone density is particularly evident in mice receiving a dose of 100 pg / day, demonstrating that the severe hypercalcemia in these animals results from increased bone turnover as well as from the release of calcium from the skeleton. These data clearly demonstrate that the osteoprotegerin binding protein [158-316] promotes bone resorption, which causes systemic hypercalcemia, and that osteoprotegerin reverses these effects. 10.Example Cloning and Expression of Soluble Osteoprotegerin Binding Protein in Mammalian Cells Full-length clones of rodent and human osteoprotegerin binding protein can be expressed in mammalian cells as described above in Example 2. Alternatively, the cDNA clones can be modified to encode secreted forms of the protein when expressed in mammalian cells. To accomplish this, the natural 5' end of the cDNA encoding the initiation codon, extending over approximately the first 69 amino acids of the protein, including the transmembrane region, can be replaced with a signal peptide leader sequence. For example, DNA sequences encoding a known initiation codon and signal peptide can be inserted into the osteoprotegerin binding protein cDNA sequence, which can begin anywhere after the 68 amino acid coding region.The resulting recombinant clones are thought to produce secreted forms of osteoprotegerin binding protein in mammalian cells and must undergo post-translational modifications that normally occur in the C-terminal extracellular domain of the osteoprotegerin protein, such as glycosylation. Using this strategy, a secreted form of osteoprotegerin binding protein was prepared, which contained the murine osteoprotegerin binding protein signal peptide at the 5' end and the human IgG1 Fc domain at the 3' end. The plasmid vector pCEF4 / muOPG[22,401]-Fc (U.S. Patent No. 08 / 577,788, December 22, 1995) was digested with the NotI restriction enzyme to cleave between the 3' end of osteoprotegerin and the Fc gene. The linearized DNA is then partially digested with the restriction enzyme XmnI to cleave osteoprotegerin only at residues 23 and 24, resulting in blunt ends.The restriction digests are then dephosphorylated with CIP. The vector portion obtained in this digestion (including residues 1-23 of osteoprotegerin and the Fc) is then gel purified. The cDNA region encoding amino acid residues 69-316 of the murine osteoprotegerin binding protein is amplified from the plasmid template by polymerase chain reaction using Pfu polymerase (Stratagene, San Diego, CA) and the following oligonucleotides as primers: , which is ligated into a vector. The plasmid is then used to transfect electrocompetent JSschmehfe coi human 293 fibroblasts (application filed December 22, 1995). Using a similar strategy, an expression vector capable of expressing an N-terminally truncated protein fused to the Fc domain of human IgG 1 was designed. This construct contains the murine osteoprotegerin digested with the restriction enzyme NotI to remove the entire osteoprotegerin binding protein reading frame.The murine osteo protegerin binding protein (residues 158-316) was amplified by PCR using pcDNA / 2D-F3 pl.azmid as therapeutics and the following primers: 1616-44: CCT CTG TCG AGT GGA CAA CCC AGA AGG CTG AGG CCC ÁGC CAT TTG C (SEQ ID NO: 29) 1602-59: CCT CTG CGG CCG CGT CT A TGT CCT GAA CTT TG A 1602-59 amplifies the 3' end of the gene and adds an in-frame NotI cleavage site. The PCR product was digested with NotI and XhoI restriction enzymes and gel purified. The following complementary primers are annealed to create an adapter encoding the murine osteoprotegerin signal peptide and a Kozak sequence flanking the translation initiation site: These primers are annealed to produce 5' overhangs at the 5' end that are compatible with the HindIII restriction enzyme and at the 3' end with the Ahol restriction enzyme.The digested vector obtained as above, the annealed oligonucleotides and the digested PCR fragment are ligated together and dectroporated into DOMB cells. The resulting clone is sequenced. » to verify the authentic reconstruction of the connection between the signal peptide, the osteoprotegerin binding protein fragment encoding residues 158-316, and the IgG1 Fc domain. The recombinant plasmid is purified, transfected into human 293 fibroblasts, and then cultured in conditioned medium as described above. Full-length murine and human cDNAs were cloned into the pCEP4 expression vector (Invitrogen, San Diego, CA) and transfected into human 293 fibroblast cultures as described in Example L. Cell cultures were selected with hygromycin as described above, and serum-free conditioned medium was prepared. The conditioned medium was contacted with an immobilized recombinant osteoprotegerin column, and the shed forms of murine and human recombinant osteoprotegerin were affinity purified. Analysis of the N-terminal sequences of purified soluble osteoprotegerin binding proteins showed that the murine protein preferentially cleaves before phenylalanine at residue 139, and the human protein preferentially cleaves before the homologous residue, leucine.In addition, the human protein also preferentially cleaves before glycine 145. This suggests that soluble forms of the human osteoprotegerin binding protein have N-terminal residues at either isoleucine at position 140 or glycine at position 145. Peptides of the osteoprotegerin binding protein and the production of clonal and monoclonal antibodies to the protein ι ρο. Antibodies against specific regions of the osteoprotegerin binding protein can be obtained by immunization with peptides derived from the osteoprotegerin binding protein. These peptides can be used alone or conjugated forms of the peptides can be used for immunization. The crystal structure of mature TNFα has been reported in the literature by J. E. Jones, D. I. Stuart and L. P. C. Walker, J. Cell Sci. i B'BIDG consists of threads and a ma- 111 |EY Jones, DJ. Stuart and NP 13, 11-18 (1990)]. Mutagenesis revealed that two loops of VFu are il, and these are the loops that are OR Goh, CS. Loh et al. (1991)] the BB' and EF loops of the TríFp ligand were found to make the majority of contacts with the receptor in the solved crystal structure of the TNFp:TNFR.55 complex. The amino acid sequence of the murine osteoprotegerin binding protein was compared with the amino acid sequences of TNFa and TNΡβ. The regions corresponding to the BB' and EF loops of the murine osteoprotegerin binding protein were predicted based on this comparison, and the peptides described below were designed. A.. Antigens); Recombinant osteoprotegerin binding protein [158-316] is used as an antigen to immunize animals as described below, and the serum is assayed using the approach described below. Peptides from the putative BB' and EF loops of the murine osteoprotegerin binding protein were synthesized and used for immunizing. BB' loop peptide BB' hyrok-Cvs pepiid: (Sequence number 35) EF loop-Cys peptide: (Sequence No. 36] NHa-NAASIPSGSHKVTLSSWYHDRGWAKISC-COOH NH2-VYWKTSIKIPSSHNLM-COOH NH2-VYWKTSIKIPSSHNLMC-COOH used for conjugation, using the methods described in Section B below, and perform immunization. B. Conjugation with snail hemodanin or bovine serum albumin Selected peptides or protein fragments can be conjugated to keyhole limpet hemocyanin (KLH) to enhance their immunogenicity in animals. In addition, serum Company, Rockford, IL) in water to a final concentration of 10 mg / ml. The peptide or protein fragment is dissolved in phosphate buffer and mixed with an equal weight (g / g) of KLH or BSA. The conjugation reaction is allowed to proceed at room temperature for two hours with gentle agitation. The solution is then passed through a desalting column or dialyzed against phosphate-buffered saline overnight. The peptide conjugate is stored at -20°C until used in immunizations or EIAs. C. Immunization: Balb / c mice (Charles Rivers Laboratories, Wilmington, MA), Lou rats, or New Zealand White rabbits are injected subcutaneously (SQI) with an aqueous solution (50 pg, 150 pg, and 100 pg) emulsified in Complete Freund's Adjuvant (CFA, 50% v / v; Difco Laboratories, Detroit, MI). The rabbits then receive booster injections two or three times every two weeks with antigen prepared in a similar manner as above in Incomplete Freund's Adjuvant (ICFA; Difco Laboratories, Detroit, MI). Ml). Mice and rats are injected with booster injections approximately every four weeks. Seven weeks after the second booster injection test bleeds are performed and serum antibody titers are determined. When titers have developed in the rabbits, SO ml of blood is taken weekly for six consecutive weeks. Mice and rats are selected for hybridoma production based on serum titer levels; animals in which half of the maximum titers are greater than 5000 are used. This protocol Additionally, different types of immunomodulators can be obtained and included in the protocol. D. Enzyme-linked adsorbent (ELA) EIAs are performed to determine serum antibody (ab) levels in individual animals and subsequently to screen for potential hybridomas. Flat-bottom, high-binding, 96-well microtiter EIA / RIA plates (Costar Corporation, Cambridge, MA) are coated with purified recombinant protein or protein fragment (antigen, ag) at a concentration of 5 pg / ml in carbonate-bicarbonate buffer (pH 9.2, 0.015 mol / l Na..?CO3, 0.035 mol / l NaHCO3). The protein fragments can be conjugated to bovine serum albumin (BSA) if necessary. 50 µl of antigen is added to each well. The plates are then covered with a stainless steel film (ICN Biomedicals, Inc., Costa Mesa, CA) and left at room temperature for 2 hours. Incubate for 1 h or overnight at 4 °C on a shaker.The plates were blocked for 30 min at room temperature with 250 μl of 5% BSA per well, prepared by mixing 1 part BSA diluent / blocking solution concentrate (Kirkegaard and Perry Laboratories, Inc., Gaithersburg, MD) with 1 part deionized water. After the blocking solution was discarded, 50 μl of two-fold dilutions of serum (1:100 to 1:12800) or hybridoma tissue culture supernatants were added to each well. The serum diluent was 1% BSA (10% BSA diluent / blocking solution concentrate diluted 1:10 in Dulbecco's phosphate-buffered saline (B-PBS); Gibco BRL, Grand Island, NY), while the hybridoma supernatants were used as is. For hybridoma screening, one well is left as a conjugate control and one as a control.The plates were incubated again at room temperature for 1 hour on a shaker and then washed four times with a single dilution of a 20-fold concentrate in distilled water (Kirkegaard and Perry Laboratories, Inc., Gaithersburg, MD). Horseradish peroxidase-conjugated secondary antibody (Boehringer Mannheim Biochemicals, Indianapolis, IN) was diluted in 1% BSA and incubated in each well for 30 minutes. The plates were weighed as before, blotted dry, and ABTS peroxidase single-component substrate (Kirkegaard and Perry Laboratories, Inc., Gaithersburg, MD) was added. The absorbance was measured in each well at 405 nm using a Microplate EL310 reader (Bic-tek Instruments, Inc., Winooski, VT). The half-maximum titer of the serum is calculated by plotting the base 10 logarithm of the serum dilution against the optical density measured at 405 nm and then extrapolating the 50% point of the maximum optical density obtained with the given strain. A.Hybridomas are considered positive if the optical density value is greater than. a. five times the background. This protocol can be adapted; for example, a conjugated secondary antibody can be chosen for specificity or to avoid cross-reactivity. E. Cell fusion: The animal selected for hybridoma production is injected intravenously with 50-100 µg of antigen dissolved in phosphate-buffered saline. Four days later, the animal is euthanized with carbon dioxide, and the spleen is collected under sterile conditions in 35 ml of Dulbecco's Modified Eagle's Minimum Essential Medium containing 200 U / ml penicillin G, 200 mg / ml streptococcal sulfate, and 4 mmol / l glutamine (2x P / S / G DMEM). The spleen is removed of excess adipose tissue and rinsed in 4 consecutive dishes with clean 2x P / S / G DMEM. It is then placed in a sterile gauze bag (Tekmar, Cincinnati, OH) containing 10 ml of 2x P / S / G DMEM. and then, a single-cell suspension is prepared using a Stomacher bean Blender 80 (Seward Laboratory UAC House; London, UK). As the cells are released from the spleen capsule into the medium, they are removed from the bag and placed in a sterile 50 ml conical centrifuge tube (Becton Diekinson and Company, Lincoln Park, MJ|.Fresh culture medium is added to the package and the procedure is continued until all the spleen cells are released. These splenocytes are washed three times by centrifugation (225*g, 10 minutes). This is the same as the mouse or rat splenocyte. For fusion, Sp2 / 0-Agl4 or Y3-Agl.2.3 myeloma cells (American Type Culture Collection; Rockville, MD) in complete medium (DMEM, 10% inactivated fetal calf serum, 2 mmol / l glutamine, 0.1 mmol / l nonessential amino acids, .1 mmol / l sodium pyruvate, and 10 mmol / l Hepes buffer: Gíbco Laboratories, Grand Island, N¥i grown log-phase cultures were washed similarly. Splenocytes were combined with the myeloma cells and re-sedimented. The medium was aspirated from the cell culture well, and 2 ml of 1500 grade polyethylene glycol (PEG 1500; Boehringer Mannheim Biochemicals, Indianapolis, IN) was gently mixed with the cells for approximately 1 min. Then an equal volume of 2* P / S / G was slowly added. DMEM is added. Allow the cells to fuse at 37°C for 2 minutes, then another 6 ml of 2* P / S / G DMEM is added. Allow the cells to stand again at 37°C for 3 minutes.Finally, 35 ml of 2* P / S / G DMEM is added to the cell suspension and the cells are pelleted by centrifugation. The medium is aspirated from the pellet and the cells are carefully resuspended in complete medium. The cells are plated in 96-well flat-bottom tissue culture plates (Becton Dickinson and Company, Lincoln Park, NJ) by placing a single drop from a 5 ml pipette. The plates are incubated overnight in a humidified atmosphere at 37°C in an atmosphere containing 5% CO. The following day, an equal volume of selection medium is added to each Inca. The selection medium contains 0.1 mmol / l hypoxanthine, 4 * 1CM mmol / l aminopterin and 1.6 * 1.0'2 mmol / l thymidine in complete medium. The fusion plates are incubated for 7 days, then the medium is changed twice over the next three days; after each change of fluid, HAT selection medium is used.Tissue culture supernatants were aspirated from each hybrid-containing well 3-4 days after the last fluid change and assayed for specific antibody response by EIA. This protocol was modified from that described in the literature [Hudson and Hay: “Practical Immunology, Second Edition”, Blackwell Scientific Publications). political precursor Cloning of the 5-fold osteoprotegerin-binding protein receptor Biologically active recombinant murine osteoprotegerin binding protein [158-316] is conjugated with fluorescein isothiocyanate (FITC) to produce a fluorescent probe. A. Fluorescent labeling is performed by incubating recombinant murine osteoprotegerin binding protein [158-316] with 6-fluorescein-5-(and 6) carboxamido hexanoic acid succinimidyl esters (Molecular Probes, Eugene, OR) in a 1:6 molar ratio for 12 hours at 4 °C. The FITC-labeled osteoprotegerin binding protein [158-316] is further purified by gel filtration chromatography. Mouse bone marrow cells are isolated and incubated in culture in the presence of CSF-1 and osteoprotegerin binding protein [158-316] as described in Example 10. Mouse bone marrow cells were cultured in the presence of 130 ng / ml CSF-1 and 20 ng / ml osteoprotegerin binding protein [158-316]. Non-adherent cells were removed first and stored on ice, and the remaining adherent cells were lysed with cell lysis buffer. After washing and resuspension in PBS containing 0.5% BSA, the cells were contacted with FITC-osteoprotegerin binding protein, washed, and sorted by FACS. Cells that stained positive for FITC-osteoprotegerin binding protein were collected, and their mRNA was isolated as described in Example 2. This mRNA preparation was used to construct a cDNA library as described in Example 2. ?0 The cDNA library prepared from this source is used for random EST sequence analysis, as previously described in •m· PCT Publication No. WO97 / 23614 and Simoné et al. [Simoné et al.: Cell 89, 309319 (1997)]. Using this method, a cDNA of approximately 2.1 kilobases in size was detected, which encodes a novel TNFR-related compound. The long open reading frame of the murine ODAR cDNA encodes a protein of 625 amino acids and contains the characteristic units of TNFR-related proteins: a hydrophobic signal peptide at the N-terminus, four consecutive, lysine-rich repeat sequences, a hydrophobic transmembrane domain and a cytoplasmic signal domain. The homology of this protein to other members of the TNF receptor family and its expression in bone marrow cells associated with FITC-labeled osteoprotegerin binding protein suggest that it is a novel TNFR-related compound. suggests that it is a potential receptor for the TNF-α-binding protein osteoprotegerin. The signaling for this protein is ODAR, or osteoclast differentiation and activation receptor.The synthetic amino acid sequence of the rodent ODAR and the resulting amino acid sequence are shown in Figure 10. Recent analysis of sequences in public databases shows that this protein is the rodent homolog of a human TNFR-related protein known as RÁNK [Andersen et al.: Nature 390: 175-179 (1997)]. Example 13 Production of recombinant ODAR protein in mammalian cells The soluble ODAR extracellular domain fused to the Fc region of human IgCn was prepared using previously published methods for the construction and expression of Fc fusion proteins [PCT Publication No. WO97 / 23614; Simonét et al.: Cell 89, 309-319 (1997)]. To produce soluble ODAR protein in mammalian cells, the extracellular domain of murine ODAR (amino acids 27-11.1) was amplified by polymerase chain reaction using the following oligonucleotide primer pairs: 5' TCT CCA AGC TTG TGA CTG TCC AGG TCA CTG C-3' (SEQ ID NO: 37) 5' TCT CCG CGG CCG CGI AAG GOT GGG GOT CAT TGG GTG (SEQ ID NO: 38). Polymerase chain reactions were performed in a volume of 50 µl with a unit of commercial DNA polymerase (New England Biolabs) in a solution of the following composition: 20 mmol / L TRIS-HCl pH 8.5, 10 mmol / L. potassium chloride, 10 mM (NH4HSO4, 0.1% Triton X-100, 10 μηηοΐ / l of each dNTP, 1 μ mol / l of each primer, and 10 ng of ODAR. cDNA template. The reactions are performed at 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min, for a total of 16 cycles. The POR fragment is isolated by electrophoresis. The PCR fragment creates a HindIII restriction site at the 5' end and a NotI restriction site at the 3' end. The PCR fragment, digested with HindIII-NotI, is then subcloned in frame into a modified pCEP4~Fc vector, in front of the human IgG-γ1 heavy chain sequence, as previously described. as published. [PCT Publication No. WO97 / 23614; Simonet et al.: Cell 89, 309-319 (1997)].We insert a linker, which encodes two irrelevant nucleotides that create a connection between the ODAR extracellular domain and the IgG Fc region. The construct is then digested with the restriction enzymes NheI and HindiI, and the following oligonucleotide pair encoding the osteoprotegerin signal peptide: (amino acids 1-21) is inserted in reading phase: TGG TGC TCC TGG AGA TCA TTG AAT GGA CAA CCC AGA-.-3' (sequence number 39) 5' AGG TTC TGG GTT GTC GAT TCA ATG TTG TCC AGG AGC ACC AGG AGT GCG CAG GAC AGC CAC TTG TTC ATG GTG-3' (SEQ ID NO: 40). A linker encoding two irrelevant amino acids was inserted between the osteoprotegerin signal peptide and ODAR sequences. The resulting construct (ODA.R-Fc / pC.EP4) encodes a fusion protein that contains the following parts from the N-terminus to the C-terminus: osteoprotegerin signal peptide (amino acids 1-21)-linker (LysLeu)-ODAR (amino acids 27-21)-linker (AlaAla)-human IgG Fc. The construct is transfected into 293-EBNA-1 cells using the previously published calcium phosphate method [Current Protocols in Molecular Biology, 1, 9.1-9.1.3, eds.; Ausubel et al., Greene Publishing and Wiley-Interscient New York (1994)]. The transfected cells were then selected with 200 pg / ml of hydroxymycin (GibcoBRL), and the resulting drug-resistant mass cultures were pooled and grown to confluence. The cells were grown once in a single-well plate for 72 hours. The conditioned medium was collected X is collected. A. The ODAR-Fc fusion protein in the culture medium is detected by Western blot analysis using anti-human IgG-Fc antibody. The Fc fusion protein was purified by protein A column chromatography (Pierce) using the manufacturer's recommended procedures. 50 pmol of the purified protein was subjected to H-terminal sequence analysis using automated Edman degradation, essentially as described by Matsudaira et al. (Journal of Biological Chemistry 262, 10-35 (1987)). After 10 cycles, the following amino acid sequence was read: NH2-K LVTLQVT P-CQOH The binding activity of ODAR-Fc to osteoprotegerin binding protein was assayed by immunofluorescence staining of transfected COS-7 cells as described in Example 2. COS-7 cells were transfected with 1 cg expression vector containing DNA encoding murine osteoprotegerin binding protein. After 48 hours of incubation, the cells were incubated for 1 hour at 4°C in PBS-FBS containing 10 pg / ml human IgG Fe, ODAR-Fc-1 or osteoprotegerin-Fc. The cells were then washed twice in phosphate buffered saline and incubated for another hour in PBS-FBS containing 20 pg / ml FITC-labeled goat anti-human IgG (Southern Biotech Associates). After washing with PBS, the cells were examined by confocal microscopy (ACAS, Ultima, Insight Biomedical Imaging, Inc., Okemos, MI). Both ODAR-Fc and osteoprotegerin-Fc bound to COS-7 cells transfected with OPGL (Figure 11). In vitro biological activity of recombinant soluble ODAR The ability of ODAR to inhibit osteoclast formation by stimulating osteoprotegerin binding protein was assessed in mouse bone marrow cultures in the presence of 30 ng / ml CSF-1 and 5 ng / ml osteoprotegerin binding protein. The method for using mouse bone marrow cultures to assay osteoclast maturation is described in U.S. Patent Application WO97 / 23614 and Example 8. The ODAR-Fc fusion protein prepared as described in Example 12 was added at concentrations of 65-1500 ng / ml. Osteoclast formation was assessed by tartrate-resistant alkaline phosphatase (TRAP) cytochemistry followed by a TRAP solution assay after five days of culture. Doric-dependent inhibition of osteoblast formation by ODAR-Fc fusion can be demonstrated by both cytochemistry and TRAP activity. formation, which has an ED 50 value of approximately 10-50 ng / ml. Young, rapidly growing, 3-4 week old male BD'Fl mice are given four different doses of ODAR-Fc fusion protein, prepared in PBS / 0.1% BSA, by subcutaneous injection once daily. The mice are examined by X-ray on day 5. “:AJ between the treated and the treated tibias, and is scored as ,+”~ if the treated tibia is denser than the control based on visual assessment, and the 8 values ​​shown below were obtained. An arbitrarily chosen value of 5 / 8 is required for a “positive” result. (Dose is given in mg / kg / day, n=4). After sacrifice, the right tibia was removed from each animal and the bone density was measured in the proximal metaphysis of the tibia using peripheral computed tomography (pQCT) for this purpose (Stratec, Germany). Two 0.5 mm cross-sectional sections of the bone, 1.5 mm and 2.0 mm from the proximal end of the tibia, were analyzed (XMICE 5.2, Stratec, Germany) to determine the total bone mineral density in the metaphysis. A soft tissue cut-off value of 1500 was used to determine where the bone boundary of the metaphysis was. When administered to young, growing mice, ODAR-Fc inhibits bone resorption at the proximal growth plate of the tibia, creating a region of increased bone density that is visually evident on radiographs. Radiographic changes are evident at doses of 1.5 mg / kg / day and above in two experiments (Table 1). Measurement of bone density by pCQT in a similar region of the tibia in a second experiment confirmed these dose-dependent increases in bone density in these mice (Figure 13).

Claims

Table 1. Inhibition of bone resorption with ODAR-Fc fusion protein Experiment 1 Factor Dose | 1 | 2 | 3 [ 4 5 6 [7 [8 | Result ODAR-Fc 5.0 4 5 ··]»} 4“ u ZJ JZ jö- U Positive 8 / 8 ODAR-Fc 1.5 - 4 Í + : 'V t 4“ Positive 6 / 8 ODAR-Fc 0.5 - “j- J - Negative 0 / 8 ODAR-Fc 0.15 - - Negative 0 / 8 Experiment 2 Factor 11 i 2 |3 4 5 ö | 7 8 | Result ODAR-Fc 1 5.0 »4*· <»: 4“ * |4 4· : 4 1 Positive 8 / 8 ODAR-Fc | 1.5 i; Z 4- í 4- 4- | 4- 4- | Positive 6 / 8 ODAR-Fc | 0.5 : - i - 4* 1 — i... - j Negative 1 / 8 Although the present invention has been described in accordance with the preferred embodiments, it is obvious that various variations and modifications can be made therein by one skilled in the art. Accordingly, it is intended that the appended claims apply to all such equivalent variations. PATENT IGLM POINTS 1. Use of an antibody as an osteoprotegerin binding protein (ÖPGbp) modulator for the preparation of a pharmaceutical composition for the treatment of bone disease, wherein the antibody is an antagonist that is bound to the 4 (SEQ ID NO:3) to OPGbp and which inhibits OPGbp-mediated osmoclast-germination and / or bone resorption.

2. The use according to claim 1, wherein the antibody is a monoclonal antibody.

3. The method of claim 1, wherein the antibody is a recombinant antibody. The use according to claim 1, wherein the antibody is a chimeric antibody or a CDR-grafted antibody.

5. The use of claim 1, wherein the antibody is a human antibody.

6. The use according to claim 5, wherein the antibody is produced by immunizing a human immunodeficiency virus capable of producing human antibodies.

7. The use of claim 1, wherein the antibody binds to a membrane-associated form of OPGbp.

8. The use of claim 1, wherein the antibody binds to a soluble form of OPGbp.

9. The use according to claim 1, wherein the soluble form of OPGbp comprises amino acids 0^-07 of SEQ ID NO:

4.

10. The use of claim 1, wherein the antibody is administered together with one or more bone, morphogenic factors selected from the group consisting of BMTM - BMIM2, transforming growth factor-beta, a transforming growth factor-beta family member. a fibroblast growth factor selected from the group consisting of FCIF-1 - FGF-10, a tumor necrosis factor-1 inhibitor, a TNF-alpha inhibitor, parathyroid hormone, E-series prostaglandin, a bisphosphonate, or a bone-repairing mineral.