Methods and compositions for inducing tumor-specific cytotoxicity

Description

Gene therapy method and vector for inducing tumor-specific cytotoxicity This invention is a continuation-in-part of pending U.S. patent application Ser. No. 08 / 943,608, filed October 3, 1977, the entire contents of which are incorporated herein by reference. The invention relates to the field of tumor cell biology and cancer therapy. More particularly, the invention relates to the specific expression of target genes, particularly genes encoding cytotoxic products, in tumor cells. The Ή19 gene is one of the few genes known to be imprinted in humans (Íüurst et al., Nature). Genetics 42, 234-237 (1996; p. 111). Early in embryogenesis, H19 is expressed from both chromosomal alleles. DeGroot et al. Trophoblast 8, 285-302 (1994)1. Shortly thereafter, the paternal alleles & They become silent, and only the alleles inherited from the mother are transcribed. H19 is highly expressed during embryogenesis and was the first gene to be co-regulated with alpha-fetoprotein in the liver by the trans-acting raf gene (Pachnis et al., Proc. Het. Acad. Sci. USA 81, 5523-5527 (1984)). In addition, H19 has been independently cloned by several groups using screening methods for genes expressed during tissue differentiation. For example, Davis et al. (Cell 51, 987-1000 * * * ♦ (1987) | identified the mouse homologue of H19 by screening for genes expressed early during differentiation of C3H10T1 / 2 cells. Pourier et al. (Development 113, 110511X4 (1991)1 found that mouse H19 was expressed during stem cell differentiation and implantation. It was discovered that human. R19 gene is also transcribed during differentiation of cytotrophoblasts from human placenta (Rachmilewitz et al., Molec. Repród. Dev. 32, 196-202 (1992)}, While H1.9 RNA transcription occurs in a variety of embryogenic tissues throughout fetal life, HIS expression is inhibited after birth. Furthermore, relatively low levels of HIS transcription have been reported in muscle and liver of adult mice (Brunkow and Tilghman, Genes & Dev. 5, 1092-1101 (1991)). H19 is also activated in cancer cells after birth. Ariéi et al. (Molec, Pathol. 50, 34-44 (1997)] HI9 expression was demonstrated in tumors derived from a number of tissues in which H19 was expressed prenatally. Furthermore, these authors found H19 RNA in tumors derived from neural tissues, particularly astrocytic tumors and ossangioneurobiastomas, which were not known to be associated with HIS expression. Because of the large number of tumors expressing HIS RNA, these authors hypothesized that HI9 is ​​an oncofetal RNA and suggested that B19 should be investigated as a marker of human neoplasia. The human and mouse HI9 genes have also been cloned and sequenced [Brannan et al., Molec. Cell. Biol, 10, 25-36 (1990)]. A comparison of the human and mouse HI9 genes revealed a total of 771 nucleotide sequence identities. Although the nucleotide homology between the two species is so conserved, only a very small amount of deduced amino acid sequence identity could be predicted from the open reading frames of the two genes (above). Furthermore, although HIS RK-St transcribes RNA polymerase II, then undergoes splicing and polyadenylation, it does not appear to be translated. Instead, Hl9 RNA was found to be associated with 28S cytoplasmic RNA, leading to the hypothesis that Hl9 RNA may function as an RNA component of a ribonucleoprotein (see above). The true physiological role of H19 is not yet fully understood. H19 may function as a dominant lethal gene? High aberrant expression of a HIS transgene. It causes lethality in mice shortly before birth (Srunkow et al., supra). This lethal period coincides with the period when HI9 transcription becomes repressed. On the other hand, no defects were observed in mice carrying either heterozygous or homozygous H19 knockout alleles (Leighton et al., Nature 37 S, 34-39 (1995)). The maternally inherited allele knockout affects the imprinting of the genetically linked and oppositely imprinted IGF-2 gene; the resulting mice are larger at birth than their littermates due to increased prenatal expression of IGF-2 (supra). Since these two oppositely imprinted genes form cis-acting regulatory sequences, Leighton and colleagues hypothesized that H19 might be the It is involved in the imprinting of the 1GF-2 gene. Another proposed function of the H19 gene product is as a tumor suppressor. RNA function. Hao et al. (Nature 365, 76-4-767 (1993)) reported that transfection of two embryonic tumor cell lines, RD and G401, with an H19 expression construct resulted in cell growth inhibition, morphological changes, and reduced tumorigenicity in nude mice. This tumor suppressor activity was observed to be consistent with the fact that aberrant expression causes silencing in mice (Ha et al., supra) and with the fact that mice in which the maternal HIS allele was knocked out showed increased size (Leighton et al., supra). However, the assumption that H19 is a tumor suppressor has been disputed. Some of these results have reportedly not been reproducible, and other candidate tumor suppressor genes closely linked to HIS exist. (Ariei et al., supra.The proposed tumor suppressor role of H19 is in contrast to experimental data showing that H19 is activated in a wide range of tumor cells (see, for example, Lustig Yariv et al., Oncogene 23, 189-177 (1997)). Insulin-like growth factor (IGF) genes IGF-2 is another imprinted gene whose expression depends on which parent it is inherited from. However, unlike IGF-2, in both animals and humans, imprinting occurs on the maternal side, and therefore it is expressed from the paternally inherited allele [Rainer et al., Nature 363, 747-749 (1933)1 . The human IGF-2 gene exhibits a complex transcriptional pattern. There are four IGF-2 promoters that are activated in a tissue- and development-specific manner. Only three of the promoters, P2, P3, and P4, are imprinted and are active during fetal development and in cancerous tissues. The fourth, P1, is not imprinted and is expressed only in the adult liver and in the choroid plexus of the third and fourth ventricles. The isi.h3 stem plexus is activated [see Holthui2«n et al., Hol. Repród. Dev. 35, 391-393 (19-93)]. The P3 promoter of the IGF-2 gene is involved in the development of liver cirrhosis and hepatocellular carcinoma [Kin and Park., J. Korean Med. Sci. 13# 171-173 -(1998)]. Wilm's tumor also involves loss of IGF-2 imprinting (Ogawa et al., Nature 353:749-751 {1993)1. This observation has led many investigators to hypothesize that loss of imprinting and the dual expression of imprinted genes may be involved in growth disorders and cancer development [see also Rainer et al., Nature 352:747-749 (1993)], and Glassman et al., Cancer Genet. Cytogenet. 39, 59-73 (1396)1. Regulatory sequences of tumor-associated genes have been used to selectively target the expression of a parental gene in tumor-derived cells. For example, alpha-fetoprotein expression is induced in hepatocellular carcinoma. Huber et al. (Proc. Cat. Acad. Sci. USA 38:839-843 (1991)) used control sequences from the albumin gene or the alpha-fos protein gene to direct the expression of sequences encoding Varicella zoster thymidine kinase (VZV TK) in hepatoma cells. Hepatoma cells infected with a retroviral vector containing one of these expression constructs expressed VZV TK and became sensitive to the normally nontoxic S-methoxypurine arabinonucleoside (arait). Kaneko et al. (Cancer Res. 55:5283-5287 (1995)) constructed an adenoviral vector that expressed the alpha-fos protein control sequences. Recombinant adenovirus particles containing this vector were directly injected into hepatocellular carcinoma-derived tumors in hairless nude mice. Subsequent injections of ganciclovir caused regression of the hepatocellular carcinoma-derived tumors. Osaki et al. {Canoe Res. 54, 5258--5261 {1954}} transfected AS49 lung carcinoma cells with an expression construct containing the regulatory sequences of the lung carcinoma embryonic antigen gene linked to the coding sequence of Herpes simplex virus thymidine kinase (HSV TK). The transfected cells were sensitive to ganciclovir. Furthermore, tumor growth from subcutaneously transfected cells in nude mice was inhibited by repeated intraperitoneal injections of ganciclovir. However, the karyoembryonic gene has recently been described to be expressed in normal colonic mucosa, limiting the utility of these control sequences as tumor-specific regulatory regions (Qsaka et al., supra). Thus, there remains a need to develop gene therapy vectors that specifically express the gene product in tumor cells. The invention relates to methods and compositions for inducing selective expression of heterologous genes in tumor cells. More particularly, the invention relates to polynucleotides comprising regulatory transcriptional sequences operably linked to heterologous genes that result in tumor-specific expression of the heterologous genes. In particular, the regulatory transcription sequence is derived from a gene that is specifically expressed in cancer cells, such as H19, and the XGF-2 P3 and P4 promoters, and the heterologous gene encodes a cytotoxic protein or cytostatic gene product. In another embodiment of the invention, the IGF-1 promoter is operably linked to a heterologous gene to result in tumor-specific expression of the gene. The regulatory sequences will direct gene expression in a variety of cancer cell types.Such methods and compositions may be used in the treatment of a wide range of cancers and hyperproliferative conditions. One aspect of the invention is an expression vector comprising polynucleotides containing such regulatory regions operably linked to heterologous genes. Particularly preferred are regulatory sequences encoding HIS regulatory regions, such as promoter and enhancer sequences, such as an IGF-2 F3 or ?4 promoter or an IGE-I promoter. In this context, the H19 enhancer and its active parts can be used in any combination with the H19 promoter, promoter or the pror with Peter, IGE- dagger The ta iá Imam Imam host cells «ί α s. In this regard, the heterologous gene-expression construct comprising a promoter controlled by the H19 enhancer or not can be introduced into a cell together with a second construct comprising a heterologous gene controlled by the IGF-1 promoter or the IGE-2 P3 promoter or the FM promoter in combination with the H19 enhancer. In another embodiment < fr χ ♦ provides methods for expressing heterologous genes in tumor cells. A further object of the invention is the treatment of cancer using the vectors of the invention in gene therapy. Figure 1A-1C; Nucleotide sequence of the human HU promoter region. The promoter region extending from position -837 to position -?< (relative to the transcriptional termination site) is shown (SEQ ID NO: 1). Figure 2: Vectors used to express a heterologous gene under the control of H19 regulatory sequences. v«Ut osdiagr amm j- a. Figure 3A-3E: The H19 regulatory sequences drive the expression of a heterologous gene (CAT) in bladder cancer cell lines. The GAT specific activity (cpm / 7g protein) is plotted for five different indicated cell lines as a function of the vector used for transfection, Figure 3A: HT-1370 cells. Figure 3B: EJ28 cells. Figure 3C: T24P cells. Figure 3D: 1137 cells. Figure 3E: UM-üC-3 cells. The following vectors are described in more detail in Example 1 below: (1) pCAT-foasic; 12} pCAT-control; í3g H) pKlóEHlSD; and íS) pH13EHl9R. Figure 4E: The IGF-2 P 3 and P4 promoters drive the expression of seven eroiog genes in bladder cancer cell lines. Five different cell lines are shown with specific activation. ,tést. {cpm / 7g protein) áh? <3 ZQ i '1 UX ci as a function of the IGF-2 promoter region used in transfected constructs to drive luciferase expression. Figure 4A: T24P cells. Figure 4B: 137$ cells. Figure 4C: UM-UC3 cells.. Figure 4D<: 1197 cells. Figure 4S: EJ.28 cells.. The vectors are described in more detail in Example 4, below. Figure 5: Nucleotide sequence of a human Hl 9 promoter fragment (identical sequence 2), Figure 6: Nucleotide sequence of the 0.9 kb Hl9 enhancer fragment (identical sequence 3). Figure 7A and 7B: Nucleotide sequence of the 2 kb Hl 9 enhancer fragment (identical sequence 4). Figure SA-8C: Nucleotide sequence of the 4 kb Hl9 enhancer fragment (identical sequence 5). Figure 9A-9C: Transfection with vectors containing different combinations of the ?19 regulatory region and ?4 promoter in tumor cells drives luciferase expression. Figure 9A: 5637 cells, Figure 9B: Huh? cells, Figure 9C: 293T cells. Figure 10A-10E: Transfection with vectors containing HIS regulatory sequences Directs luciferase expression in tumor cells. Figure 10B: 2S3T cells. Figure 10B: 724? cells. Figure 10C: Huh? cells, Figure 10D: 563? cells. Figure 10E: R7112 cells. The invention is based in part on the recognition that regulatory regions contained in genomically imprinted genes that are expressed in cancer cells can be used to direct the expression of desired coding sequences in cancer cells. More importantly, we have found that HIS expression is activated in a wide range of carcinomas, including but not limited to bladder carcinoma, hepatocellular carcinoma, hepatoblastoma, rhabdomyosarcoma, ovarian carcinoma, cervical carcinoma, lung carcinoma, breast cancer, squamous cell carcinoma of the head and neck, esophageal carcinoma, thyroid carcinoma, astrocytoma, ganglioblastoma, and neuroblastoma.To10 χ**Φ **** **ϊ We have further discovered that constructs comprising H19 promoter regions operably linked to a heterologous gene or an IGF-2 P3 or P4 promoter operably linked to a heterologous gene, or such promoters together with a downstream HIS enhancer are specifically activated in tumor cells. In another embodiment of the invention, an IGF-1 promoter is used to direct the expression of a heterologous gene. Accordingly, one aspect of the invention is methods and compositions for altering the phenotype or selectively killing cancer cells. This aspect of the invention is achieved by introducing into the cells a polynucleotide comprising regulatory regions derived from genomic imprinted genes operably linked to a heterologous gene that is expressed in cancer cells. The heterologous gene may, for example, encode a cytotoxic agent (e.g., a toxin, an antisense RNA, or a ribozyme). Regulatory regions derived from genes that undergo genomic imprinting and are expressed in cancer cells include, but are not limited to, the H19 promoter and enhancer, and the 1GE-2 R3 and Fα promoters. As used herein, the term "operably linked" means that a nucleotide sequence is linked to a regulatory sequence in a manner that allows the expression of the nucleotide sequence to be directed by the regulatory sequence. A 'heterologous' gene sequence, within the meaning of the application, refers to a gene sequence that does not normally receive II χ'·» / ', *'»« χ**» Ο 8 . Ο 8 < ·' * - _ * * > * <.·· is functionally linked to the regulatory sequences of the K19 gene. In general, heterologous gene sequences include sequences that produce cytostatic and cytotoxic gene products, As used herein, the term "expression" refers to the transcription, "splicing", "maturation", "stabilization" and, optionally, translation of the mRNA transcript of the DhS in question. Depending on the structure of the introduced DNA molecule, expression may be transient or continuous, Regulatory sequences of the H19 gene, the XGF-2 P3 and F4 promoters and the XSF-X promoter The application describes H13 regulatory sequences that are useful for directing tumor cell-specific expression of a he fce.ro log coding sequence. These H19 regulatory sequences include the upstream H19 promoter region and / or the downstream KIS enhancer region. The nucleotide sequence of an H19 promoter region is shown in Figures 1A-1C (SEQ ID NO: 1). This 830 nucleotide sequence extends from nucleotides ∼837 to nucleotides ∼837 from the feed site (as described by Brsnnan et al., supra). A consensus TATA sequence is found from nucleotides -27 to -35. Two consensus AF2 binding sites (8 / 9 alignment) are found approximately -50. and -40. nucleotides upstream of the start of transcription. When the regulatory region is placed upstream of the coding region of a heterologous gene, as described in detail below, approximately.The 830 base pair regulatory region is required to direct the expression of an operably linked heterologous gene in cancer cells that also express endogenous HiS. Furthermore, another H19 promoter region between nucleotides -319 and +14 (Figure 5, sequence ID 2) is also suitable for directing the expression of an operably linked heterologous gene in cancer cells. The downstream enhancer region of the human HIS gene can optionally be added to a HIS promoter / heterologous gene construct to provide increased levels of tumor-specific expression. As further illustrated in Example 6, the downstream enhancer region comprises a SacI restriction fragment extending from +5 kb to +11 kb relative to the transcription start site. As would be expected from an enhancer sequence, the downstream enhancer is capable of exerting its effect when placed either upstream or downstream (relative to the direction of the H19 gene in the endogenous H13 gene) of the coding region of a heterologous gene under the control of the HIS promoter. Furthermore, this enhancer is shown in FIGS. 6, 7, 78, and 3A-3C. Fragments containing the sequences shown in the figures can be used to promote gene expression. Expression of the XGF-1 gene is associated with lung and breast cancer. The XGF-1 promoter is the nucleotide sequence between nucleotides 1-1630 in the human XGF-1 gene sequence (Genhank accession number M12659 1477496, which is incorporated by reference in the appendix; [Rotwein et al., J. Biol. Chem. 261, 4628-4831] The gene product is expressed by tying one of four different promoter regions. £ n-gv oromote. it undergoes rom imprinting and is expressed in embryonic tissues; the The Pl promoter, on the other hand, is only activated in adult tissues (Sussenbach et al. <?Growth Reg. 2? occurs in hepatocarcinoma. The< -9 (1992)). The P3 promoter is also imprinted with the ?4 promoter (nucleotide sequence -546 of the 2SF-2 gene) and the P3 promoter (nucleotide sequence -1229 of the XGF-2 gene). big one; - -d02, - +140. nucleotide sequence) is activated in human bladder cancer cells and can be used to direct the expression of an operably linked heterologous gene in tumor cells. The IGF-2' P3 and 94 promoters can be used in conjunction with the H19 enhancer or active fragments thereof. These regulatory sequences, which are derived from genomically imprinted and non-imprinted genes that are expressed in cancer cells, are described in more detail to determine the minimal regulatory sequences required to achieve the desired tumor-specific expression. For example, the promoter region can be altered by additions, substitutions, and deletions and measured for tumor-specific expression function. Different parts of the ul 9 downstream enhancer can be individually tested for their ability to enhance transcription from the HIS promoter. Alteration of regulatory sequences can be accomplished by a variety of chemical and enzymatic methods, which are well known to those skilled in the art. For example, regions of the sequence defined by restriction sites can be deleted. Oligonucleotide-directed mutagenesis can be used to alter the sequence in a specific manner and / or to introduce restriction sites into the sequence. In addition, deletion mutants can be generated using DHS nucleases such as Sal3I or ExoIII and S1 nuclease. Progressively larger deletions in regulatory sequences can be generated by incubating the DHS with the nucleases for increasing periods of time (for a review of mutagenesis methods, see Aus.ubel et al., Current Protocols for Molecular Biology, (1989)1, The altered sequences are tested for their ability to direct tumor-specific expression of the heterologous coding sequences in appropriate host cells, particularly in H19-expressing carcinoma cells (e.g., bladder carcinoma cells). The invention includes the incorporation of any altered regulatory sequence into a recombinant expression vector for further use, which retains the ability to direct tumor-specific expression. A variety of heterologous genes can be expressed under the control of these regulatory sequences, such as genes encoding toxic gene products, potential toxic gene products, and antiproliferative or cytostatic gene products. Marker genes can also be expressed, including enzymes (e.g., CAT, beta-glucosidase, luolferase), fluorescent proteins such as green fluorescent protein, or antigenic markers. Cytotoxic gene products are broadly defined to include agents that induce apoptosis and drugs that induce apoptosis. Furthermore, cytotoxic gene products in the present invention include drug metabolizing enzymes that convert a prodrug into a cytotoxic product. Examples of cytotoxic gene products useful in the methods of the present invention include diphtheria toxin, Pseudomonas toxin, ricin, cholera toxin, PS40, and tumor suppressor genes such as the retinoblastoma gene and p53. Furthermore, the cell is involved in apoptosis. coding sequences 'tót. is jtids include .k the ta 1,, hat. Senet, b ) pspti: 1 (see Wu et al 7} ], the calcitonin c jón nel peptide (Sakuta et al,, J. Heuroimmunoi, 6 / , 103-109 (1996)} 1as well as other known or discovered apoptotic peptides. Drug-metabolizing enzymes that convert drug prodrugs into cytotoxic products include thymidine kinase (Herpes simplex or Varicella zoster virus), cytosolic deaminase, nitroreductase, cytochrome p450 thymidine phosphorylase, purine nucleoside phosphorylase, alkaline phosphatase, Λ and G2 carboxylpeptidase, linamarase, β-lactamase and xanthine oxidase (for background information see Riggs and Slkora, Mol. Med. Today 359-366 (August 1997)} Additionally, antisense, antigen, or aptamer oligonucleotides can be delivered to cancer cells using the expression constructs described herein. Lipozymes or single-stranded RNAs can also be expressed in cancer cells to inhibit the expression of a particular desired gene. The target genes of these antisense or ribozyme molecules should be those that encode gene products that are essential for the survival of the cell or the maintenance of the cancer cell phenotype. Such target genes include, but are not limited to, cdkz, cdkö, cdk21, cdc10é, cyclin Dl, cyclin E, cyclin n, and cdk4. For example, vectors are introduced into cells to limit the expression of endogenous genes that express antisense RNAs or ribozymes specific for oncogenes such as p53, c-fos, c-jun, Kr-ras, and / or Her2 / n.eu under the control of regulatory sequences derived from imprinted genes or the IGF-1 promoter expressed in cancer cells. Tumor cells that express HIS and are capable of activating the H19 regulatory sequences (or that specifically activate the IGF-1, IGF-2 P3 or P4 promoter) may be specific targets for expression of the antisense RNA or ribozyme RNA. The antisense approach involves designing oligonucleotides (in this case mRNA) that are complementary to the target mRNA. The antisense oligonucleotides will bind to the complementary target mRNA transcripts and inhibit translation. Complete complementarity, although preferred, is not required. Sequence complementarity, as used herein, to a portion of an RNA means a sequence that has sufficient complementarity to hybridize with the RNA to form a stable duplex. The ability to hybridize depends on both the degree of complementarity and the length of the antisense nucleic acid. In general, a longer hybridizing nucleic acid may contain more mismatches with an RNA to still form a stable duplex (or triplex, if possible). One skilled in the art can estimate the tolerable mismatches by standard procedures. extent to determine the melting point of the hyporhydized complex.Oligonucleotides that are complementary to the 5' end of the target transcript, such as the S* se® translated sequence including the AUG initiation codon, will be more effective in inhibiting translation. In addition, sequences complementary to the 3' untranslated sequences of mRNAs have recently been shown to effectively inhibit translation of mRNAs. See generally Wagner R., Nature 372, 333-335 (1994). Oligonucleotides complementary to the 3' untranslated noncoding regions of target gene transcripts can be used in an antisense approach to inhibit translation of endogenous genes. Oligonucleotides complementary to the 5' untranslated region of mRNA should include the complement of the AUG start codon. Antisense oligonucleotides complementary to mRNA coding regions are less potent inhibitors of translation, but can also be used in the present invention.Antisense nucleic acids, which are designed to hybridize to either the 5', 3' region of the mRNA or to the coding region, should be at least six nucleotides in length, and preferably range from 6 to about 51 nucleotides in length. In specific embodiments, the oligonucleotide is at least 10 nucleotides, at least 17 nucleotides, at least 25 nucleotides, or at least 50 nucleotides in length. Regardless of the target sequence chosen, it is advantageous to perform preliminary in vitro assays to determine the extent to which antisense oligonucleotides inhibit gene expression. In these assays, controls should be used that distinguish between antisense gene inhibition and nonspecific biological effects of the oligonucleotides. It is also advantageous to compare the amount of target RNA or protein in these assays with the amount of an internal control RNA or protein, Ribozyme molecules designed to catalytically cleave a vital target gene can be used to inhibit translation of the target mRNA. (See, for example, International Publication No. WO 07 / 11364, published October 4, 1988; Sárvár et al., Science 27 4, 1222-12.25 (1990)). When the ribozymes are specific for a gene encoding a protein of importance in the assembly of ribozymes, such ribozymes can cause a reversal of a cancer cell phenotype. (With which ribozymes, which cleave mRNA at site-specific recognition sequences, can be used to destroy target mRNAs, hammerhead ribozymes are preferred. Hammerhead ribozymes cleave mRNAs at sites marked by flanking regions that form a complementary base pair with the target mRNA.The only requirement is that the target mRNA have the following dibase sequence: 5'-UG-3'. The construction and production of hammerhead ribozymes is well known in the art and has been described in detail by Haseloff and Gerlach, Nature 334, 585-591 (1988). Preferably, the ribozyme is designed so that the cleavage recognition site is located near the 5' end of the target mRNA; in order to increase efficiency and minimize the intracellular accumulation of non-functional mRNA transcripts, For the purposes of the present invention, ribozymes also include RbS endoribonucleases (hereinafter referred to as C-type ribozymes), such as a ribozyme that is It occurs naturally in Tetrahymena thermophila (known as IVS or L-19 1VS RNA) and has been described in detail by Thomas Cech et al. (2aug et al., Science, 224, 5?4-5?8 (19841; 2aug and Cech, Science 231, 470-475 (1986); 2aug et al., Nature 324, 429-433 (1986); University Patents Inc. International Publication No. WO 88 / 04300; Besn and Cech, Cell 47, 207-216 (1986). Cech-type ribozymes have an eight base pair active site that hybridizes to a target RNA sequence, and target RNA cleavage occurs. The invention includes those Cech-type ribozymes which target the eight base pair active site sequences present in the target genes. Cells that reactivate the expression of the imprinted gene will also be capable of specific activation of expression constructs containing the regulatory regions of the imprinted gene operably linked to such heterologous gene. Such cells, particularly tumor cells, are suitable targets for the gene therapy methods of the invention. Specific expression of H19 and IGF-2 93 and 94 can be determined in both tumors and cell lines using RNA analysis techniques, in situ hybridization, and reporter gene constructs. Furthermore, tumor cells with activated IGF-1 gene expression can similarly be determined and targeted gene therapy by direct control of a heterologous gene using the IGF-1 promoter. A probe is prepared for the signal that specifically hybridizes to the gene transcript using any of the methods known in the art. The In most ENS analysis applications, y' ,-*s <n es ** ** jelölt próba a HI9 nukleotidszekvencia legalább 15-30 komplementer bázisát tartalmazza, és még előnyösebben « H19 nukl-eotidszekvancía legalább 50-150 komplementer bázisát tartalmazza. A HIS expresszié agy különösen előnyös 'hibridizációs próbája a poli-A helytől .felfelé, a poli-A hely felé tartó hozzávetőleg 800 bázispárról származó N19 mRNS 3fvégével komplementer oolinukle-otíd. In a specific embodiment of the invention, exemplified below, a labeled antisense RNA probe is generated in vitro using a ?? or T3 expression plasmid. H19 probes can also be labeled by random chain priming in the presence of a labeled nucleotide, for example using the Prlm-1 kit from CStretagene, La -Jolía, CA; catalog number: 3003920. Alternatively, labeled probes can be generated in a PCR reaction using a H19 coding region cONS knockout and primers designed to amplify a region of the coding region, or by a standard nick translation reaction. Suitable labels for polynucleotide probes include nucleotides into which radioactive isotopes have been incorporated (such as 3?S~t and 'P-td), fluorescent, luminescent and color labels, and enzymatic moieties. The labeled probe is hybridized in situ to a cell or tissue sample using standard methods, such as those described below in the Working Example and described in copending U.S. Patent No. 08 / 704,706, which is incorporated herein by reference. Alternatively, if sufficient numbers of suitable cells are obtained, standard PCR analysis (such as Northern analysis, Μ-ase protection, or primer extension) can be performed to determine the level of mRNA expression of the gene of interest. Furthermore, it is also possible to perform gene expression assays in situ, i.e. directly on cell sections (fixed or frozen) of diseased tissue from biopsies or excisions, in order to avoid the need for nucleic acid purification. Nucleic acid reagents, such as those described above, can be used as probes and / or printers in such in situ procedures (see, for example, Nu-ovo, G, J, PCR In situ Hybridization: Protocols and Applications., Raven. Press, NY), An alternative method to determine whether a cell type or tumor will be able to specifically activate the Using these methods, we mention two tumor types with expression of mec: dott szabii y ο χ ο x cí ej jú ö w az sjtbe sijtsíós sjtbe. For this purpose, the »rmék. In an assay, the :atja, whether the cell or ia ruleé XÓ róí^iőxk'”· akt í *r X Ί r U 3 <1 .ί. V k. ll.i. > as an example of the following- 1. 'Wilm's tumor ··> 3, Embryonic rhabdomyolysis Germ cell tumors and trophoblast tumors * * * J. φ φφ Φ J. * Testicular germ cell tumors zs 9Í-. s Early teratoma of the ovary n S-* W> Ezekrococcygeal tumor 4 » Kor ί ocarcinoma 5. Placental trophoblastic tumors C. Epithelial adult tumors 1. Hú gyhó1yag carcinoma 2, Hepat ocellu1er s carcinoma 3 v Ovarian carcinoma 4. Cervical carcinoma 5 < Lung carcinoma Breast carcinoma *7 Head and neck squamous cell carcinoma 8, Kyo1őcü carolnoma q * Faj z smir so carcinoma 0. Neux •©gen tumors 1. Astrocytoma .«\ G ang 11 ob 1 asz érne Neuroblastoma Teh át a t a s s zerint i s s t a In fact, any tumor that activates Hl 9 expression is a target of the present invention. IGF-2 can be used to activate the 1GF-1 and 1GF-2 P3 and P4 promoters. Other tumors can also be treated with the methods of the invention. For example, IGF-2 is activated in childhood tumors, such as Wilm's tumors, rabtíomioΦΦΦ* * φ ' in sarcomas, neuroblastomas and hepatoblastomas. Methods for delivering polynucleotides under the control of regulatory sequences into gasda.se j needles The invention also relates to a host cell that has been transfected with polynucleotides comprising regulatory regions operably linked to a heterologous gene. Such host cells may be maintained in culture or may be part of an animal, preferably a mammal. The desired polynucleotides may typically be inserted into any of a wide variety of vectors, which are then delivered using the methods and materials described herein. These vectors may be prepared using well-known molecular biology techniques. (See, in general, Sambrook. et al., Molecular Cloning, Vols. 1-111, Coid Spring Harbor Laboratory Press, Coid Spring Harbor, New York (1989), and Current Protocols in Molecular Biology, John Wiley & Sons, all volumes, periodically updated, which are incorporated herein by reference. Typically, where translation is desired, the heterologous genes in question can also be genetically modified to include a suitable 3' polyadenylation sequence, if necessary. Cultured cells Host cells transfected with polynucleotides containing regulatory sequences of the imprinted gene operably linked to the heterologous gene can be any prokaryotic or eukaryotic cell. Ligation of the polynucleotide into a gene construct, such as a vector, and transformation or transfection of host cells, whether eukaryotic (yeast, avian, insect or mammalian) or prokaryotic (bacterial) cells, are among the general procedures widely used in microbiological or tissue culture technologies. Vectors suitable for culturing the polynucleotides of the invention in bacterial cells, such as S. coli, include: O-lfeH 2ΓΠΧ 0.0 K / · p BTac-derived p1a plasmids, following types of plasmids: pSR322-derived <BL~eredefcű piazmidok, pEX-eredetn plazmidok, és pGOeredetü plazmidok. élesztőben történő replikációhoz a YEP24, YIP5, YEP51, pYES2 és YRP17 plazmidok a felhasználható klónozó- és expressziós hordozók a génszerkeze-tek bevitelére S. cerevisiaeöe (lásd például Broach et al<, Experimental manípalation ot Gene Expression (szerk.: Inouye, Academic Press, 63 (1993)1, Ezek a vektorok, replikálhatók £. coliban a p8P322 orí-nak köszönhetően, és élesztőben is a 2 mikronos cirkuláris plazmád repliká-ciós determinánsának köszönhetően. Továbbá gyógyszer rezisztencia, mint például ampicillin rezisztrencia markerek alkalmazhatóak. Similarly, mammalian vectors for the polynucleotides of the invention also contain prokaryotic sequences to enable the vector to replicate in bacteria. Such vectors are transfected into mammalian cells, possibly by integration into the mammalian chromosome for stability using a linked selectable marker gene. Alternatively, viruses such as bovine papillomavirus (BFV-1) or Epstein-Barr virus derivatives can be used for transient expression. Various methods for carrying out plasmid transformation of hosts are well known in the art. Other subvectors that can be designed. hero.sled holds; kalmas vector systems and general recombinant base25 .*% .Ά W'vμ χ. < c .... . ... ,,» see much in the work of Sambrook et al., above. Gene therapy The invention includes the use of polynucleotides comprising a gene regulatory region operably linked to a heterologous gene in gene therapy for the treatment of cancer and hyperproliferative diseases. For gene therapy purposes, the expression constructs of the invention can be administered in a biologically effective carrier, for example, in a preparation or composition capable of effectively delivering the recombinant gene into cells in vivo. These methods include the insertion of the gene into viral vectors, such as recombinant retroviruses, adenovirus, adeno-associated virus, and herpes simplex virus 1, or recombinant acellular or eukaryotic plasmids. Viral vectors infect cells directly; plasmids are transported with the aid of, for example, cationic polymers, cationic liposomes (e.g., lipofectin, cholesterol derivatives, e.g., DDASand cationic phospholipids) or derivatives (e.g., antibody-conjugated) polylysine conjugates, gramicidin S, artificial virus carriers, or other suitable intracellular carriers, as well as direct injection of the naked gene fragment, electroporation, or CAP-O-4 precipitation can also be performed in vivo. For a recent review of gene transfer and expression systems for cancer gene therapy, see Cooper, Seminárs ín Oncology 23, 172-187 (1936). Although transduction of appropriate target cells represents an important first step in gene therapy, it is clear that the choice of a given gene delivery system depends on factors such as the ex26 ♦♦*φ -φ φ φ * * φ * * Φ Φ Φ » φ Λ Φ * the phenotype of the target organism and the mode of administration, which may be, for example, local or systemic administration. It is further understood that a given gene construct provided for the in vivo transduction of expression constructs can also be used for the in vitro transduction of cells, such as in the ex vivo tissue culture systems described above. A preferred method of in vivo delivery of nucleic acid into a cell is by the use of a viral vector containing a nucleic acid, such as a certain cytotoxic gene, under the control of HU regulatory sequences. The advantage of infecting cells with a viral vector is that a large proportion of the target cells can receive the nucleic acid. Furthermore, molecules encoded by the oDLS within the viral vector, such as the viral vector, are efficiently expressed in cells that have taken up the nucleic acid of the viral vector. Suitable vectors that can be delivered using the methods and compositions described herein include herpes simplex virus vectors, adenovirus vectors, adeno-associated virus vectors, retrovirus vectors, pseudorabies virus, alphaherpes virus vectors, and the like. A thorough review of vital vectors can be found, particularly in the no.For a discussion of viral vectors suitable for modifying replicating cells and how to use these vectors in connection with the expression of the polypeptides of interest, see Viral Vectors; Gene Therapy and Neuroscience Applications [eds. Caplitt and Loewy, Academic Press, San Diego (1955)]. It has been shown that it is possible to limit the infection spectrum of viruses and consequently of virus-based vectors by modifying the viral packaging proteins on the surface of the virus particle [see, for example, International Publication Nos. WG93 / 25234 and WO94 / 0692G]. For example, strategies to alter the infection spectrum of retroviral vectors include: linking antibodies specific for cell surface antigens to the viral env protein (Roux et al., Proc. Nat. Acad. Sci. VSA 8 6, 90799083 (1989); Julan et al., J. Gene Virol. u3, 3251-3255 (1992); and Goud et al., Virology 163, 25.1-254 (1983)); or linking cell surface ligands to env proteins [Neda et al., p. Biol. Chem 266, 14143-14146 (1991)].The linkage can be by chemical cross-linking with a protein or other variant (e.g., lactose converts the env protein to an asialoglycoprotein), or by forming fusion proteins (e.g., single-chain antibody / env fusion proteins). For example, cancer cells can be targeted using these methods, for example, by linking antibodies against tumor-associated molecules or cancer cell surface proteins to the surface of the recombinant virus. This method, while it can be used to limit infection or otherwise direct it to certain cell types, can also be used to make an ectotropic vector amphotropic. One preferred viral gene delivery system for use in the invention utilizes vectors derived from adenovirus. The genome of an adenovirus can be manipulated to encode and express a gene product of interest, but its ability to replicate in a normal lytic life cycle is inactivated. See, for example, Berkner et al., BioTechnique 6, 615 (1338); Bosenfeid et al., Science 252, 431-434 (1991); and Rosenfeld et al., Cell 63, 14 3-155 (1992). The 5 d!324 type AD adenovirus or sas acenovi.ru virus is also known as Ad.?, Ad3, Ad?, etc. * « # ♦ »» '.'V Ν . Suitable adenoviral vectors derived from ' * V « » « * χ « *♦*« » « « ♦♦ ** are well known to those skilled in the art. Recombinant adenoviruses may be advantageous in certain circumstances because they can be used in a wide range of cell types, including airway epithelium (Rosenfeld et al., 1992, supra), endothelial cells [Lemarchand et al., Proo. Naél. Acad. Sci USA 69, 6482-64 68 (1992) ]:; hepatocytes (He >rz. and Gerarö, Froc, Nat 90, .2812-2816 (1293)] and muscle cells (Quantin et Acad. Salts, USA 89, 2582 :-258 4 (1992)1 . Furthermore, it is relatively stable, this : property is responsible for concentration, and can be modified so that it is in; watering. spectrum. Furthermore, the introduced adenoviral DNA (and the foreign DNA it contains? does not integrate into the host genome, but remains in episomal form, thereby avoiding the potential problems that can occur as a result of insertional mutagenesis in cases where the introduced DNA integrates into the host genome (e.g., in retroviral ON'S? ). In addition, the adenoviral genome has a large foreign DNA carrying capacity (up to 8 kilobases) compared to other gene delivery vectors (Berkner et al., cited above; Haj-Ahmand. and Graham, J. Virol., 57, 267 (1986?). Most currently used, and thus preferred in the invention, replication-deficient adenoviral vectors have inserted all or part of the viral E1 and E3 genes, but 80% of the adenoviral genetic material is retained (see, e.g., Jones et al., Cell 16, 683 (1979); Berkner et al., supra; and Graham et al., Methods in Molecular Biology, E< u, Murray (ed.j (Humana, Ciifton N. u.1991} 7, 109-127]. Another viral vector system that can be used to deliver the expression constructs of the invention is adeno-associated virus (AAV). Adeno-associated virus is a naturally occurring defective virus that requires another virus, such as an adenovirus or a herpesvirus, for efficient replication and a productive life cycle, {For a review, see Muzyozka et al., Curr. Topics in Micro, and Immunol. 158, 97-129; . It is one of the few viruses that can integrate its DUS into non-dividing cells and exhibits a high frequency of stable interactions (see, e.g., Flotte et al., Am. J. Respir. Cell. Mol. Sci. 7, 349-354 (1992); Samuiski et al., J. Virol 63, 3922-9928 (1989}; and McLaughlin et al., u, Virol, 63, 1963-1973 (1989}}. Vectors containing the small, 390 bp AAV can be packaged and integrated. The exogenous DM3 size is about 4, V extends to about 6, AAV vector can be used in DMS cells, for example, as described by Trat seb: in and m run colleagues [Mo .1 < Cell. Bioi, 5, 3251-3260 (19 85). ) . Sgy se Coll, Bioi Endo.r inol.. .934 > Different nucleic acids have been introduced into different cell types using AAV vectors (see, for example, Hormonét et al;, Proo, Natl. Acad. Sd USA 81, 6466-6470 (1984); Tratschin et al., Mole, 207.2-2081 (198.5); Wondisford et al., Mol, .32-39 (1988?; Tratschin et al,, and Flotte et al, , J, Bioi. Chem _ (1 m 3Ί In addition to viral transfer methods, such as those presented above, non-viral methods can also be used to target the expression of a desired heterologous gene in an animal tissue. Most methods of non-viral gene delivery involve the uptake and expression of macromolecules by mammalian cells. p. viroi. 2?·, 268, 3781-3790 ί nr r..~ builds on the normal mechanisms used for transport, In preferred embodiments, the non-vital gene delivery systems of the invention are based on endocytosis pathways for uptake of the expression constructs of the invention into the target cell. Such types of gene delivery systems include liposome-based systems, polylysine conjugates and artificial virus envelopes, In clinical practice for therapeutic expression structures Gene delivery systems belonging to a number of well-known systems, each of which can be administered intravenously, and its specific expression is mainly determined by the type of cell or gene, which is the seven, erological gene expression systems. transfection specificity codes or gene delivery vehicles that target specific cell types together with regulatory sequences. In other embodiments, the initial introduction of the recombinant expression construct is more limited, as the site of introduction into the animal is completely defined. For example, the gene delivery vehicle may be introduced by catheter (see U.S. Patent No. 5,328,470) or by stereotactic injection (see Chen et al., Proc. Natl. Acad. Sci. USA 91, 3054-3057 (1994)). An expression construct of the invention can be introduced into the gene therapy construct by electroporation using methods such as those described by Dev et al. (Cancer Trest. Rev. 20, 105-115 (1994)5 . The pharmaceutical composition of the central structure may consist of a gene delivery system in an acceptable carrier, or may comprise a slow release matrix in which the gene delivery carrier is embedded. Alternatively, where the intact gene delivery system can be produced from recombinant cells, such as recombinant vectors, the pharmaceutical composition may comprise one or more cells producing the gene delivery system. & ultimate therapeutic uses and dosages It is understood by those of ordinary skill in the art that any alleviation or prevention of any undesirable symptom (e.g., pain, tenderness, weight loss, and the like) associated with a cancer condition is desirable from the perspective of a practicing physician or patient. Furthermore, the tumor mass or growth A reduction in the rate of progression is also desirable, as is an improvement in the histopathological appearance of the tumor. Thus, for the purposes of the application, the terms "treatment, therapeutic use, or medicinal use" as used herein are intended to refer to any and all uses of the claimed compositions that cure a disease or symptoms, or otherwise p-en prevents, delays, slows or reverses the progression of the disease or other undesirable symptom in any way. The effective dose and treatment regimen can be determined by conventional means, starting with a low dose in laboratory animals and then increasing the dose while monitoring the effects, and systematically varying the dose regimen. Animal studies, preferably mammalian studies, are generally used to determine the maximum tolerated dose, or MTD, for the bioactive agent per kilogram of body weight. Those skilled in the art will routinely extrapolate effective doses and avoidance of toxicity to other species, including humans. Before human efficacy studies are conducted, phase I clinical trials in normal subjects help to establish safe doses. A clinician may consider several factors when determining the optimal dose for a given individual. Primary among these are toxicity and the half-life of the chosen heterologous gene product. Additional factors include the size of the patient, the age of the patient, the general condition of the patient, the specific cancer being treated, the severity of the disease, the presence of other drugs in the patient, the in vivo activity of the gene product, and the like. Experimental doses should be selected in accordance with the results of animal studies and the clinical literature. For example, a typical human dose of an adenoviral vector containing an H19 regulatory region operably linked to a heterologous gene encoding a cytotoxic agent, such as thymidine kinase, is between 1 x 10 pfu and 1 x 10 pfu injected directly into the tumor material daily. More preferably, the daily dose of such an adenoviral vector injected directly into the tumor is between 1 x 10 pfu and 1 x 10 pfu, depending on the size of the tumor. For an adenoviral vector containing an H19 regulatory region operably linked to a cytotoxic gene product with a different degree of toxicity, these values ​​will of course vary accordingly. Similar doses of an adenoviral vector containing an 1GF-2 P4 receptor and a heterologous gene encoding a cytotoxic agent, such as thymidine kinase, operably linked thereto may be used. ♦' > ak as a suggested starting point. Particularly for intravenous use, the various components of the invention are preferably of high purity and substantially free from potentially harmful impurities (e.g., at least National Food CNF grade, generally analytical grade, and preferably at least pharmaceutical grade). To do this, a given compound must be synthesized prior to use, and such synthesis or subsequent purification preferably results in a product that is substantially free from potentially toxic agents that may have been used during the synthesis or purification procedures. The invention provides a sterilely filled vial or ampoule for the treatment of a condition of a single spermatozoon encoding a cytotoxic agent.6 heterologous gene H19 regulatory region-containing polynucleotide vector or a vector-producing cell. In one embodiment, the kit comprises a polynucleotide vector comprising a regulatory region operably linked to a heterologous gene encoding a cytotoxic agent in a ready-to-administer formulation in unit dose or multi-dose amounts, the package comprising instructions for use of the contents of the package for the treatment of cancer. Alternatively, and in another embodiment of the invention, the package provides a sterilely filled vial or ampoule containing such a vector-producing cell or cell line. For storage and shipping, the vector-producing cell or cell line may be frozen. Optionally, the kit may contain a culture medium and reagents for culturing the vector-producing cell or cell line. The following examples are provided to illustrate the invention described herein without being intended to be limiting. 1. This example describes the production of various expression constructs containing the CAT reporter gene under the control of H19 regulatory sequences, and their transfer into several different bladder cancer cell lines. 1. 1. 1.1.1 The bladder cancer cell lines HT-1376, EJ28, T24P# 1197, and üH-VC-3 were obtained from the American Type Culture Collection (ATTC) and maintained according to ATCC recommendations. Transient transfections were performed using the calcium phosphate precipitation transfection method. Precipitants (containing 7 pg plasmid) in 1 ml of medium were added to 0.3 κ 10° medium. Cells were plated in 30 mm dishes, and after 10 h of transfection, zegst lived ávolltotfuk. and fresh medium two a tté msfekció u tán 24-96 h activity Τ' h-'.tg rt 1 r>.- V# X·' \. ·*· X. -v -i- v.. x. >& organic phase mazá (Sambrcok e :t al., 1983} ha tá- só phase qys .ί χ κ v ο X ját (100 pl) a tászág ,. ki 3 ml szcintilíéoiös f and we measured it with a procedure. 1.1,2. Editing expression vectors The pCAT-basic plasmid (which contains a Cat reporter gene preceded by a multiple cloning heli.v) is a pCAT-orcmote *'Χ·* ♦ ♦ * * X * plasmid (containing the CAT reporter gene under the control of the SV40 promoter), the pCAT-enhancer plasmid (containing the SV40 enhancer downstream of the CAT reporter gene, and a multiple cloning vector) site for insertion of a promoter upstream of the CA? reporter gene), and the pCAT-oontrol plasmid (containing the GAT reporter gene under the control of the SV40 promoter and enhancer) were all obtained commercially from Fromega (Madison, WI). To construct the FH19E plasmid, which contains the GAT reporter gene under the control of the H19 promoter, the HI9 promoter (SEQ ID NO: 1) was first cloned into pSluescript 11 SHd (CRromega). The polynucleotide containing the H15 promoter sequence was amplified from human marketed DHS using the following primers: S.SPCR21: GGGTTCCCCACTTCGCCAGTTT (6, sequence ID no.) and ESFCR22: GGGAAGTCGACAACCTCACCAAAGGCCAAGGT SEQ ID NO: 57), The ends of the RCR products were blunted with Klenow and cloned into the EcoRV site of pBiuescriptliSK*. The inserted DNA was confirmed by digestion with the in-strand cutting enzymes Pvu.II, EcoRl and Apai. The promoter direction was opposite to the direction of the lacS coding region of the vector. The promoter region was then excised with HindIII and PstI, and the resulting fragment of approximately 0.9 kb was inserted into the HindIII and PstI sites of the pCAT-basic plasmid to generate pHluE. Expression plasmids containing the H19 enhancer region inserted in both orientations downstream of the H15 promoter / 'GAT reporter gene were constructed as follows. The 5 kb Saol fragment containing the H15 downstream enhancer (extending from H15 kb to 1 kb relative to the start of H15 transcription) was cloned into the SacI site of pBhC19. This enhancer fragment was then digested with EeoRI and HindIII and ligated into the EeoEI-HindII sites of pBluescript.IX S?ü to create pBhHlEEnSa. pBhH!9En-Sa was partially digested with BamKI, and the 5 kb fragment containing H19 (and an internal BamKI site) was cloned into pHI9E at the BamKI site downstream of the H19 promoter / CAT reporter gene. Plasmids containing the H19 enhancer in the forward direction (pK19S19D) and reverse direction (pK19EK19Bj) were generated. 1.2, Bredmónyek and their discussion of the different bladder cancer cell lines, KT-137€, SJ- 28, T24P, 1197 and U M-üC-3 pCat- basic plasmid' marked in Figure 2), |χ·> \»'fi A· -control (pSV4ö w <m.‘. V íí.íÍK 2. ábrán), pH19E' - v-er, pHlSEHlüü -vei és pH! The expression results of each construct are shown in Figures 3A-3E. In each cell line, the highest level of CAT activity was observed with the pGAT-control plasmid, which contained both the SV4Q antigen and the SV40 promoter. This construct served as a positive control, since SV40 regulatory sequences have been shown to induce gene expression. However, the ability of SV40 regulatory sequences to induce gene expression is not tumor cell specific. Cell lines infected with pK19E, which contains the Cat reporter gene under the control of the HIS promoter, also showed significantly increased CAT expression compared to background. The extent of induction of Cat activity by the HI9 promoter ranged from a fivefold increase in the KT-137Í **** cell line to a tenfold increase in the ÜH-UC-3 cell line. Addition of the H19 enhancer to the HIS pixomofcex / CAT reporter gene constructs further increased the level of expression in the given cell lines. For example, in the EJ28, T24F and 119? .cell lines, the HIS enhancer significantly increased the expression of the H19 promoter. / CAT reporter gene. However, the orientation of the enhancer gave different results in the different cell lines. In the HT-1376 and VH-UC-3 cell lines, the enhancer was absent or had no effect on expression. The results demonstrate that the human HIS pixometer region drives the expression of an operably linked heterologous reporter gene in a wide range of bladder cancer cell lines. In some bladder cancer cell lines, the HIS enhancer can further increase the expression of the reporter gene under the control of H19, Example 2: The toxm gene undergoing sssshälysation of the Hl9 regulatory sequences 2.1, Materials and methods The expression constructs described above in Example 1 are modified to express a sequence encoding a toxic product or a therapeutic compound in place of CAT. For example, the sequence encoding the CAT gene product is removed and replaced with a sequence encoding herpes simplex virus tim.ld.in pain (HSV-TK) using standard cloning methods known in the art. The HiS / drug combination expression plasmids are transfected into bladder cancer cell lines as described in Example 1. When transfected into bladder cancer cell lines, an H19 / B57-TK expression plasmid induces bladder cancer cell-specific cytotoxicity in the presence of ganciclovir. 3.1. Seventy-five-week-old female C3H / H© mice (Charles River). We reared six mice per cage and allowed them to acclimate to an air-conditioned room with a 12-hour light / 12-hour dark cycle. We started the experiment at eight weeks of age and randomly divided the mice into a control group (10 mice) and an experimental group (68 mice). The experimental group of mice received 0.15% N-butyl-H-(4-hydroxybutyl)-nitrosamine (Tokyo Kasei Kogyo Co., Japan) dissolved in their drinking water ad libitum. Control mice received tap water. Animals from both groups were sacrificed at 4, 8, 12, 15, 28, and 26 weeks after the start of the experiment. The urinary bladders were excised and embedded in paraffin blocks using standard procedures. 3.1.1, Preparing a test A 2.1 kb fragment containing the Sgy mouse Hiu coding region was subcloned into the pBIuescript II KS plasmid (Stratagene, La Jolla, CA) behind the T7 and T3 RNA polymerase binding sites, labeled antisz 3 n 'μ 1 S Ü r· γ xm Íz ii V ó. VU i: 1 · ; X <31?. V 7 < < xinear izál plaz: m.íd DNA -bői 77 polymerases (3c és a Amersham ί\η\· nn A. V o & V -í *· o. rv , <. vt. U· \T- u aJ. rs Ima zva. Az 7 Cí t í t •„tranzkrip amo k 10 7 cpmz-pg specific ak keznenek . 73 ociir ne r á ζ zai (Soehrinoer Manche im< We used a template linearized with £co.R..I. Φν « ΦΆ* Φ > φ *- φ Χ· ♦' « Φ χ Φ φ φφφ φφφ* «χ * Φ* »* as roll, 3.1.2. Hybridization of Σπ ​​aítu Paraffin-fixed sections of formalin-fixed tissues (5 μΜύ) were placed on microscope slides covered with 3-amino-propyl-triethoxysilane (Tespa, Slgms) and dried overnight at 37°C. The sections were de-resined with xylene, fixed with 4% paraformaldehyde, and then treated with protein K-vsl (Sigma). The slides were acetylated to reduce nonspecific binding of the probe and dehydrated through an ethanol series. The b©)-labeled RNA probes (specific activity 50,000 cpu / μΐ) were hybridized as described by Rangird et al. [Mech. Dev. 35, 13-2.4 (1391.)), omitting the thio-AMR step. The slides were exposed to film for 10 days and counterstained with hematoxylin and eosin. The slides were examined and photographed under bright and dark field illumination using a Polyvar (Felehet Jüng) microscope. Controls included hybridization with sense RNA probes and RNase prehybridization treatment. Additionally, sections of adult healthy mouse bladders (which do not express Hi9) and embryonic mouse bladders (which do not express H19) served as negative and positive controls, respectively. 3.2. Results and their discussion By week 26, all mice in the remaining experimental group had developed palpable bladder tumors. High expression of H19 was observed in chemically induced bladder tumors. In contrast, H19 expression was not detected in the normal adult bladder. Consequently, this mouse model of chemically induced bladder is an animal model. « X * * * * > ♦·* * * < ,n< can be used as a model to demonstrate the in vivo tumor-specific cytotoxicity of constructs containing Hl 9 regulatory regions operably linked to the toxin gene. H19 / toxin or prodrug-expressing plasmids are encapsulated in liposomes (as described by T'akashita et al., U., Ciln. Lovast 93, 652-651 (1933), which is incorporated herein by reference, for delivery to the bladder of living mice. The mice used for this experiment have chemically induced bladder tumors as described in Example 3, above. Briefly, SCO μΐ Optime in serum-free medium (8RL Life Technologies, Gaithersburg, Ml?) dissolved 50 ug plasmid DNA was added to 250 pl Lipofectamine in 250 μΐ. water. The mixture was incubated for 30 minutes at room temperature and then diluted in 10 ml balanced salt solution (SSS(~):: 140 mM NaCl, 5.4 mM KOH, 10 mM TrisHCl, pH-?, 6). After the solution was pelleted by centrifugation at 15,000 rpm for 30 minutes, the liposomes were resuspended in 1 ml of SSS(5) containing 1 mM CsCl2. Approximately 0.2 ml of concentrated liposomes were administered via catheter to mice bearing chemically induced bladder tumors. A control group of bladder tumor-bearing mice received liposomes without DOS or containing an irrelevant gene under the control of H19 regulatory sequences. At designated time points, mice from each group were sacrificed and the bladders were excised, fixed, and embedded in paraffin blocks using standard procedures. Every second section was subjected to the above-described Vai probe. Φ* fe* .»*·♦* ΦΛ·ν» * Φ * » «· » * * ν X - * ν Φ X * * » S * * f Φ$Λκ -♦» φ *. '*'·'or Pseudomcnas toxin gene coding sequence is prepared for in situ hybridization using a probe. Furthermore, the size, number and necrosis of tumors are compared between the control and experimental groups. It was found that the expression of Pseuscomocas toxin occurs at the same site as the expression of HIS in bladder tumors from the experimental group of mice. Furthermore, the size of the bladder tumors in the experimental group of mice is reduced and necrotic when compared with the bladder tumors in the control group of mice. 5, Example: Expression of IGF-2 P3 and P4 receptors in tumor cell lines 5.1. Materials and methods In this experiment, we created different expression constructs in which the luciferase gene was placed under the control of one of four different IGF-2 promoters and introduced them into several different bladder cancer cell lines. The following human IGF-2 promoter / Luciferase constructs were prepared: Plasmid structures IGF-2 gon nucleotide sequence Promoter Hupl -960 - +54. Promoter 1 Hup2 -379- +271. Promoter 2 Hup3 -1229 -+140, Promoter 3 πυρ 4 -546 - -102. Promoter 4 The IGF-2 promoter sequences have been described by Sussenbach et al. (Growth Reg, Z, 1-9 (19925), which is incorporated herein by reference. The luciferase reporter vector is commercially available from Promega, Malison, WI {catalog number; fc < fc VXs * -. « V* * - fc :· fcv V' The resulting expression plasmids were transfected into human bladder cancer cell lines HT~1376, EJ28, T24F, 119? and ÖM-UC-3 as described above in Example 1. Luciferase activity was measured using a commercially available assay (Promega, Madison, WI, catalog number: El Söö). Results A2, which are shown in Figure 4A-4E show that the IG9-2 P4 promoter drove the expression of the luciferase reporter gene in all bladder cancer cell lines tested. In the 1197 cell line, the IGF-2 93 promoter also drives the expression of the luciferase reporter gene. In subsequent experiments, the TGE-2 93 and 94 promoters were shown to drive the expression of the luciferase gene in other tumor cell lines, including choriocarcinoma cells and rhabdomyosarcoma cell lines. €, example: The 013 promoter and the IGF-2 pri»ófcar are H19 ;writer Four luciferase reporter vectors, pGL0~basic, pGt pGll-Snhancher and pGL3-Control, were obtained from 9romeg-at. These vectors were transfected into cultured cell lines using a variety of transfection reagents, including lipofetarnane (Gibco / SRL), figene (S-oehringer), the Perfect Transfection Kit with 3 different lipid reagents (Invitrogen), TEX-iö, TFX-20, Tra.ns.fast (Prcmega), and the calcium phosphate method (Germán et al,, Mo-1. Cell. Siói. 2, i no-iηζΐ > ι os·? we amplified the ATATGGTACCGACAACCTCAGCAAAG-3!sequence) is The H19 promoter cloned into the EcoRV site of pBluesoript II SK (pbhI9p#l) was described in Example 1.1 above. The Ki9 prompt was excised by digestion with SmaI and HindIII, and the resulting 0.9 kb fragment was inserted into the SmaI-HindIII site of the pGL3-Basic vector to generate the Luc-pbhi9 construct. The H19 promoter region extending from nucleotides -8.19, - +14 from plasmid PCHpbh!9p#l, 5'(upstream., 8. same i stem number n,?rt ·* :«> *> y / V .'p 5VJ .•τ·'.'PwΆ Γ* Z·*·??».»'·'» '> f A λ nAkSV i ivx Ww λ .A*A\A„kv x <A.· i ^**.5 (downstream,· 9, azonosítószámú szekvencia) prímeteket alkalmazva. A kapott PCH terméket Κρηϊ-gyel és HindiXX-mai emésztettük, és a pGőE-Basic vektor Kpnl-HindiII helyére ligáltuk, mely a Luc-PB«I9 szerkezetet eredményezte. A BCB-ral létrehozott HI9 promótert mindkét irányban megszevenáltuk automatizált festék terminátor ciklus szekvenálóval (AKT Prism 377 DNS szekvenátor, Perkin Elmer). Az 5. ábra mutatja a H19 promóter PCR-ral létrehozott núkleotid szekvenciáját (2, azonosítószámú szekvencia)< In Example 1, the 5 kb HIS downstream enhancer described above was digested with DamH to generate a 4.1 kb fragment and a 0.9 kb fragment at the 3' end. The Luc~PBH19~0.9DH19 and I,uc-BSH19-4EH19 constructs were generated using the H19 enhancer δ, 9 kb, and a, respectively. The enhancer sequences were placed downstream of the H19 promoter / luciferase reporter gene. The 0.9 kb BamHX enhancer fragment was subcloned into the pGL-Basic vector Ligation was performed in place of BamHX to create the Luc-0.9SH19 vector. The H19 promoter of the pbhlűptl plasmid was excised with KpnI-SamHI, r ko-os »3®Ki ** * ♦ and ligated into the Kpn.I~Bg.iII site of the Luc-O,SSH19 construct, resulting in the Luc~pbhl9~0.9SH19 expression construct, which contained the promoter clone described in Example 1 and a 0.9 kb enhancer located downstream of the Hl3 / Luc reporter gene. Expression vectors designated Hup-1, Hup-2, Hup-3 and Hup-4 were constructed, containing the luciferase gene under the control of the human Pl, P2, P3 and F4 IGF-2 promoters, respectively, as described by Sussenbach'h et al. (Growth Reg. 2, 1-9 (1392) ). A 512 bp ?4 region was amplified by PCR from the Hup-4 construct using primers 5'ACAGGTACCTC?AGAGTCGACCT~3f (upstream, SEQ ID NO: 10) and 5'-ATA?AAGC??GCTCCCATCCTGCA-3f (downstream, SEQ ID NO: 11). The resulting PCR product was digested with KpnI-HindIII-maX and the pGL3-Basic reporter gene was cloned with KpnI-HindIII-maX. 12 to create the buo-34 reporter gene vector. Expression vectors containing the IGR-2 P4 promoter and the HIS enhancer were also constructed. The 2 kb BamBI enhancer fragment derived from the previously described 4.1 kb fragment was cloned into the SamHI site of the L.uc-P4 construct, creating the Luc-B'4-2EH19 expression vector. The 0.9 kb, 2 kb and 4.1 kb H19 enhancers were sequenced using automated DPS sequencing. The nucleotide sequence of the 0.9 kb enhancer is shown in Figure 6 (SEQ ID NO: 3). The nucleotide sequence of the 2 kb enhancer is shown in Figures 7A and 7B (SEQ ID NO: 4). The nucleotide sequence of the 4.1 kb enhancer is shown in Figures 5A-5C (SEQ ID NO: 5). δ. 2. Results and results When different transfection reagents were used to introduce the vectors containing the four luciferase genes into cultured cell lines, calcium phosphate precipitation resulted in the highest transfection efficiency in most of the cell lines tested. Therefore, calcium precipitation was subsequently used to transfect the different expression vectors. Furthermore, increased concentrations of plasmid DNA did not inhibit transfection efficiency, even when used at concentrations above the upper limit. The 5637 bladder cell line, the Huh? hepatocellular carcinoma (HCC) cell line, and the 293T renal tumor cell line were each transfected with different constructs containing the luciferase reporter gene under the control of the H13 or IGF-2?4 promoter together with the KIS- enhancer. Cells transfected with Luc-phlS and Luc-PHl 9 containing the reporter gene and the H18 promoter showed increased gene expression compared to background (Figures 3A-9C). The PCR-generated promoter-containing Luc-PH19 construct showed greater activity than Luc-phl9 in all cell lines tested. Addition of the 0.9 kb H19 enhancer fragment to the Luc-phlS reporter vector (Luo-phl9-0.9EH19) further increased this expression level by two- to four-fold in the 5637 and 293T cell lines, respectively. The XGF-2 F4 promoter also increased luciferase expression over background in all cell lines. Addition of the 2 kb H19 enhancer fragment to the Luc-P4 expression vector increased the activity of the P4 promoter. The induction of luciferase activity by the 2 kb enhancer fragment ranged from twofold in the 2937 cell line to sixfold in the Huh? cell line, while the enhancer only slightly increased promoter activity in the 5H?3 cells. Figures 10A-10S show the expression of the Lee~phi9~ 4EH19 construct containing the FCK-generated H19 promoter and a 4.1 kb H19 enhancer fragment. The enhancer greatly increased the promoter activity by 3-28 fold in the cell lines, Except for 5637 seitlines. The following plasmid was deposited with the American Type Culture Collection (ATGCi, Hanassas, VA, under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure: Clone. ATCC accession number: deposit date: PH19EH19' 209322 2997, October 2'. The foregoing description is intended to enable one skilled in the art to practice the invention. Of course, various variations of the means described below for carrying out the invention, which will be obvious to those skilled in the art of molecular biology and medicine or related fields, are intended to remain within the scope of the following claims. The references cited are incorporated by reference in their entirety into this description. OfrS ΟδΤ DEER SoSsaooSoS 3£«0825κ«2 «SőSaoaaSS SSSSSoaSBo £55308555.3 £33£85a£o3 5560358283 svsaSaaSSa £888£S«2«S «ooooaBSoo zeoovsSSoo oSoSoSsSsa SoaoSooaSo 2232233332 8553322322 £S2£-33««22 2328322,283 2223583332 2388833328 3383538,533 832552.508« 3255588328 2323222282 £ <s09>882380 ÖÜS3H «εχχ* vsa <5XX> εεο <ττε> z <000* GO JU ©O 855 22 S 0?>S OS* oz* 09£ Ö80 0*0 081 ®tí 22 SSSaSSSasa 3558333555 «552223252 £S8«5355«S aSoSSqsaSS 23Ő2382825 SoaSeSaasS SSaSsaaSSS 3235«83«35 SaasSSBaw 3δδδ»53335 0S333353SS 5525838222 8558533855 SSSeőSSooS 8333633885 o»5«6SS53» £»«5322383 8a£«25«S55 0338555833 SeSaS»®»»» 5583383323 «£38»2»5a5 SaSaSSaS» o53S«£«35e 53331? «3333 83S3823383 «233332322· 8888838223 8333383365 5235222388 SqasSaaaoJS 20O3555«£5 SaoooaSSSö SaSao-oaSSő £235353538 £s58S«53SS 522235653« 3382332825 23£55«£5«Β BOOS^kSSoO 332332235« 2233388255 £222365828 »3»b£55323 5535«285«5 £558532233 .8233835322 Ő35£S«3325 2 825888353 3283358322 3335853328 3352533232 3Ö565e«5»8 3253533823 »383333223 3338333383 2823838283 2233333883 8588828023 £555522035 5388882338 3832883253 3388855833 33852322«5 5552523553 5823332555 8855838382 2332382228 3883553335 8383288253 3353835238 33353355«» 323225«5«5 £833355525 2830008033 OOSSSOOSSOO 8883005855 £833322255 2333558838 0388833832 3338838833 3355583.533 T<2S8>* 0825«S 8'33;S <£~Z> vsa «πρ 508 <008* <otz> G'C «3T838Λ »A©9»7& OOJ C2£32«Z <S5T» TT <09T> eo-dt-zeet "tet" S05OS / SÖ S5 <gst> O-OWSST <TST* üK’m / βδ sít «sst* &e~oo-sss~ <τ*τ» mos / mx / ioa m-nöö-tsM <οετ> XXX32X05CXX3 □xáX3Sás;xom£ mxónasr voa ssmxxsoáms w ssoexsh «οετ» 85»XSSSn38£> JO A8gS28A0Un Λ®3ί?8Η «%. ?« Λ288820 30212882g228SS8'á BJTSSJX <ott> egsTfvxousA^szs ik ssöt oss GoS ow SS 5 5th century AD ÖÖS s»s 08» ÖCS' ösr Moreover 3»S ANCIENT ANCIENT ANCESTOR U8 0»S oes nose oss OÖS o»s 08» SS» osx est w G8T οετ OS €58 original ANCESTORS 003 s»s SS» ANCESTOR" OSS S0€ ooSouőősob 88s5o3522S 2822225502 foosSoooos SáSSSoőooS 50825=8203 S®«5eSöS'ő3 sossbSSsőS Ő82-53S55SS sbőSSsoo^o S«-9oseő8oS- oőőSioso»»· οο55ο5£ε33 ££8822225« o3353So83a S»08333530 ssoSoBoooo £322323333 3233323355 8253283060 33035553» BO8OOOO23O 22«SS335£5 5335555353 5S2S«55őő2 5233555335 £«55£3£.Ss3 Β3δ55335δ2: 333388030« 23«0300Ő02 225^555033 320S332233 őo.SoooooSe οοοοοδοοοο 533363633« 222-3353332 3253333035 5530335335 O35o0.SS322 2335325230 3322523353 23OO55s5«2 S03033S32S £55bs55&33 5333553355 «oSooooooo 5000332333 3233555553 BsooSobSSS «δοοδδδοοο 23.832222S3 3S23030Ő2S 5322335323 5533333252 3330333322 3333332233 3333233233 3525302333 0223332333 02.53322225 3OO£SO2S25 0203550220 3022083552 53O55OO332 0333335332 o£o32S5353 oSo.SoooőoS 02355ooSS3 3oSS55Sooo 02303230S3 53323o5e55 3S0S2220S0 soooSoőeSo οοοοδοοοοδ 33o63«63S3 SoSoSsSoSo S3S3S0S353 £253235353 £353235353 55530053.63 ££53o5k233 3333533253 822OOO3553 £«03032323 SSOOOSSSOO 23255.53055 3333055333 883200025« 235So55o23 £££££282%?%? 3332222553 2332333555 SSoSSSooaS »33Soo5o£S So«335o5o3 30833S3223 0555255355 2o5o5o2»23 ,3222223330 Sooooooáos SSooooaoB» SooooSSSoo » <053». 38TC88 C3S»H «€7£» νκσ <ετε> OS«t <tts> » <ŐTS> £553335 «05233230« 52235o5556 OOS5««3283 3335oSS520 333353S353 2333OSoo5s 5233322025 33θ£θθ£3O3 3253322353 0So£233038 2230283253 5333000580 2233082233 23200o55o5 0323252333 3223333533 2203232223 3533555008 OOSSOOOSOS 3«5S268053 0350325330 2353255553 3SSS3O3323 3333335308 5o60033SO0 ΟΟΟΟΟΟδδδΟ 8282335553 303355022«! 225&OS33SS 5053003553 25S0500020 2233052235 5O2O22»525 5303233833 8523302503 3350332582 83ŐO288883 2S32000503 2Ϊ20222223 3253333583 2250333003 3303330S03 2353032530 2253333322 000832i5«2 3250223033 2238322302 ΟΟδΟΟΟΟδοΟ 2223333508 0032330533 0358300833 3063022000 3353330530 0O6«3225«O 0θδθ22裫0 2353232320 2353323508 326«003832 33S3000380 OOSOOOOSOO 3358232583 2202333530 035θ3325«2 035o333So3 23SO332S33 33δΒ33θδ«3 3365333023 338033Ő330 3»O3«?SS08S S53S000003 25sb55o5oS o5oooo33«6 «32553556ο «SsoooSoos 3300503335 0232500303 2362033000 oSSooooSso ooSoSooooS SőooooSSoo SSooSosSoS 3333OOO65o 0233000000 2035333322 «55θ233®»5 5280028883 e ÍÍOTáOS 0520*5 «Πϊ> VKü «ετε» 558 € «ττε» <οτε> So5 55®ο3555®ο SoSSeSoooS 5033555222 Soooooőooo δκοοοοοοοοοδ £»22555223 3005553055 δοοοδδοοοδ 3255320322 οοοοοοοοδδ o65£ooooo5 5£S5o53222 SSSoSSoSőo SSSsoooSoo «οοδδοοδο SoSoSoSoS oSSSooSoőö 52o56«oo33 ooSoSSoooo o5o25£«555 53δ3££55«5 SoooooSooS SoooooSooo 2S0332530S 2555520525 5®556o53oo oSSoosoSo» 5o555oS5S3 οοοδίδεο» oS£S5s2383 0025855200 55®o5eo5s5 SSooSSooSS 225oS55eo5 53S3«3oSo3 2222802330 oÖooooSőSe oooooSoőoo 3000523303 oooSSSSo^S 5^25535538 ​​23528£oS33 32S0S2530S 5580380300 3000383333 2358232200 5203323222 «255253335 5555032022 θ£θ5320θ55 3355555533 o5523®«656 2056328832 S£223S«O2« OSkBooSosS o5338«o££o 5330253383 “SSSSoSooS 8> 036' CCS' Q35T SOS' OH' 0 85 ccsr ossz COS om osrr otet ost ost OSZT 0 SÓT ozot őst 00« 038 08» OZi SOS 00$ 0>S OS 5 on asz őst o>z OST ŐZT OS »»»Sa»5S»5 »»£S»®»55» »£££»»»55» ®»33»»S»5» God bless you» í3»»»55»»3 £ε5»ε555»5 3»»555e»»» 33S»5o3S»S »3ε5»££££ε 33£5£££e£)e £3£«2:2:SS£S b5SSS5»»»S 33»»3335a» aoaSaSSaSs S£3S5»3»5» »»5oíi22»33 5335352503 ooSSbSSboo 303»3»»»55 BSoSBfiSSS» »»5eddddB»» a»5»»»»3a5 5»»»»о5»36 SecooSbb&SS »»3B3ΰ»»3» aasSS»»»»» aSsSaasSttS 33»»£«5b5b Sa5a5a5a6a £5»3®555£» 33333:3305» 35553:55555 aao»·»»»»»» S»»»»»»»»» »»S®»»»®£g »»»»B»3B»« boSsSSS»»» eeeede»»»® 555»5£δ33» 55e»55e»5e 5»»£5e£é»e aoaSSavSsS 5黣飣«é3 asa»»5s£»» »»»»SSoo»S SSoo3355»» £££exre333£ £553353533 3330335a»5 03O»bS£o55 55b»»»»»5b £»5»»£»55£ s»»»5ss»»5 333S333330 SSaSaoSoaS SűSbbSSS»» ®S3»555b»3 »»»»»333»» 3;5S»5£«»»3 »3:3^53355» »»3»5β3335 555» s»5aSa 3»a5553355 »»»»»»»555 3£5®5£»»3O 33333»»»®» SS»®»»»»»» S»5£:55»3»» 5353355335 »5552232»» »35333»»»» 3»555»»55s 5S5a£»»»£a £S5»s£k»5£ 33333553»® £3££555»®» a»».»»»»®»» 555»»»SaSS »3.55355» »» 333»»»»®»» ΟδεοδοΒ»»» ,Ο333»»££β» £3»5»££őSő 3»»5»5»3»5 »»£»525»3» 5^55555533 £»53333353 esSesSSass Sa a»55»355 33»»»»»S5a »33333333» »3»»3B»55» 3«55£55bbb a33SasSaSa SSSa £'£33» a »»»»δ65»3» 55»55g3333 3333333333 »»5»»»»»»» 3333033333 aőSS®»»»®» 5aa3»»»»3» £»Sa»»£s»S 5553353333 as3a»S5aa3 ®»®30325ő£ »5»»6555»3 S»0».»3»33» SaaaSaSőSS »333523333 bSbBSOBSbo 5535533333 »335335333 3»»S®33»£» £»»££»»£»3 33555»3»33 K3»3»335»3 3» 3» 3333 33 3335£a»55a 353335333» aaa&safiBoS B»5»0»B»»» a5»33»3Sa5 »£3533333» 533253333» 3333333353 Sa5»5»5»5» 3aS»5»»»S3 33»a»3»»5® £Sa£3»S»»5 5333333333 »3»5»»3»SS 3333335533 3523333033 5525333333 £33.2353» 3 3 SgőSaa»»55 £»»»»»»»»» »»»»£65®»a £»»55»55»3 bkSSbBSboo 3»S5S3»553 »£33355533 S»»»»66»»£ »£ββ5β5»»β »£»»55b555 s£s5£555ag 55055a£3»5 5333335-3» 5 »3»5»5b»»» 3335.233.255 »»£3330003 S»3O5»£»33 3330233333 5®335a33aa £»»»»»5»»» »»»3333333 »»»»»»£»»» S»»»»g5®55 SaSaSaSaSa 335333355a »»55355333 »££»323233 65®O»3»o5B. S < »»»»£S»»£a »3»»»£»333 5a»»5332a5 »££££33333 ®»»3»sS33.S 533353553» »»333»£»»» S5553»£»SS 33£35S££»5 33333S£e»3 ooSaoSSSe» 3»£»3»3»»S 5S5»£35«»® b£5»»»»55® SoSoőSőS»» 533SSa.Sőa £5b3S5»o££ 3355333353 Saa»a»»3»3 5a»S£££»53 3333»»»5»» θ£3»»»3333 3»»»SS®»£3 »»»»55£5£» 2S333»»»5» 3»53»»»S»5 33£3a55aSa 3335333333 5a5»5»5»5» 53»»»»»3»a 5S5££aB»BB »333035»»» £33335523» 00» 333533 oson «πζ» sm *m* S «ÖT 2» osst SZ ST ess? OOBT OH? 089T OZST OSST 00 ST OW 08 TT OSST OSZT OOZT OSTT osor esSeSSfSa» 3»S 3»»a»»35a» 3»e5355»S« £Ss£Sa®»Sa 553555»5»5 3»e3»e55»e 555»5»S»5S »53»SBs3»» 333»»»335» £»3»555353 »»333»5»3δ oaSaoSeoSa οδεδδοεοδδ »»5δ»5»3»ε εοοοοδδοε® 3333333330 5533335533 5553333335 £»»33δ«δ3ε 5»3d3»£££» 55555»»3»» SsSSSSSasíS 5e5»33553» oBbooSbsSS 3553333333 B33o5«»£5S «OSSoSSbSS 3S555a£a»£ SaSeaasaaa SSSes»»»»» 53552^5333 »55БОдоОД» 3θ55e££»»3 s£»isS£s£a3 3££3£££S»5 £»£»5»£»33 »£5£»Sa£aS 33»b5S»®5® 5S«bbo»3£» 3333333»»» aSőS»»»»»» »3££k££S»S £33»5££B»S »5»3»5b»5® 55»5®£®B»3 53333335S» 333333»»£5 5535533353 »33£3»£»»£ »3»£33»»»3 SSasSSSasS 3335333533 5535333253 5555233235 »»»3533333 33333333335 S»35«333»5 SbőSSsS»»» aS55«»»»S« 3»e53d»»33 3333033355 S5»S3»5B33 »»»533333» »533533333 »5»355s555 35355555»« S53»3£«»b5 3355535»5a 3333355a«5 £5s£Sa555a 53»£55aa»3 55»3»333O3 3333335.033 O»5£B333»3 sS£S5»5»s£ »533553333 535333555» »33δεδ3333 555»535333 o55»3~3£53 5»5»£55533 53355»»SS» £ !γ V » * V W3 «5~5> i£ *~T5> S <ots> sm 0SC3 3555285588 £263655326 ŰJS^ 2882253835 2823283363 δ 95 ε 55ο862555» 53&3SS62S3 Οσδ ε 3558388385 6385866556 om 5835656888 2236333335 385ε 3383332883 8832282382 οεεε 8255535553 3333352358 δδδ£ 558555256« 6553568555 oost 2523£5832» 388253555« Ö8S5 3338335333 .6855883858 om 3332365368 5382382335 om 8523258233 3355352223 ooee £335332353 3325533268 doee 22S2223233 ««8388856ο os-ee SSoőoiraSSo 2333336833 othte 3263263335 3333366886 oete «568865883 2855833325 sdoe 5«£«£o65S5 2686333638 doee 8326323238 «336333638 &w «£«££32663 5«5SS88£65 3885 3363536263 5855533363 0885 3238558658 3686332663 0922 353286366« £883822350 08 »2 8336323623 2282838623 «x »«55283333 3038556355 08«e 33«6«d8288 3858235333 oe«e 5255255260 5356236683 0995 8223223333 5385333663 00 35 2665533338 3555553035 sm 5333833352 2303533»»3 ο§ee 5253383583 8550330335 οeee 2688636333 3386823303 09~e 5365336653 8683033865 ddte 2838535322 3580830353 . 8405 0232323223 ooSaaSosoő . aS5 2233338883 282O323S23 8£3o£«sS33 «δδ» usxctes oíoojí <ctj> W <£X£> ee <tte> I. <080> 05«3330003 222330oSSa 9 «'ddd» k»t <?8s csajon <εχε>wa <you> 2t « tte> <ÖT5> SosSs 553255£oo2 βκ»«β»ο5«£ SSSosSSeSS SqSsSgSSSS 8a£»e-»e£SS 25o5o5££82 s»«SSg3»»3 »5SaeSeS3S 3865323838 S5oB5e5S£S 5ο«5255£22 o5o£5£«533 38525653S5 saSSoSoSSo s»S£»3»«»5 5323326833 8B«2868s5S 632325o£»» 3o5o£2«333 3bbSo36S«« aaawjSSSsa-s. «3*»»»033δ· «SoafiSosofi SBeSegaasS 33335«ao»O sSSvSaőBea 3325So£«3« sSooSsoSSo □SaoosaS&s 3333283333 SSSooaaSoa SvsSooSSSS 233.£«25655 o£33£S555S «osssaSaSS oooSSSoS»» SaoossSesS Seasaroosa SoooHooőso £28282228« 3835558683 «SSSscoofiá 6o323«3os3 £S3»»3O.S55 o5«2»o33£» S^osaSSsao 2008203333 3333236382 ososoSfíofife 3628823333 3383022022 *32333303» 2026688888 »£o633»o5o 5683333282 3333333333 3258252233 8580368002 3333233338 8233228233 5533533655 5o2«33S855 586S5«5S5o aooSSSrasS ««SSsSSoSa «ο5»»885δδ £355556255 88«56£686« □S»2«»o6S8 ««SŐ3233SS 55«33o5o«5 o5«S35«333 33O36«OO23 2083330335 8232.632333 £322338223 36«Βθ£565θ £333.533255 8556833383 3855823385 5««558S555 5033320603 8555533555 5833533553 3525383033 5588-225555 0300255358. 8222322283 3368588333 3282355555 3333325533 8283855833 3333233333 3335383855 322328222» 5833333533 «383555035 5553338585 2223588222 05s55«8333 3385338225 5558503823 3282333855 8585683228 5833333358 3333882833 2553533553. 2555833333 3055566503 323SbŐ3503 3352283338 2255523253 5586333333 2882866583 »«23382333 0»»0»0»02» £535235335 5588555838 ££3555858» 0SS08«3225 θ5688θ5θ8θ 3535383353 3223333323 2555283683 3335838556 5838303233 2355833325 8855533233 5538868333 3555583355 553822355« 5S6SS322»» 50220££«55 3828833858 5832333332 5-835833355 5532328825 8238833332 525s503023. ««» ​​a ** * ♦ * * * -* * ♦♦ Jt x « ♦ **» »y «223» íiofso say «4SÖ> S epacgpcacc ^acaaccefce ace&a&a «22«> 3 «2ΧΧ» 28 «2X2 > » «2X3 > Kc;r,« know «4C0> With afcasas^ctt and ettcícccsc acccsgesi <2X5? 20 «322» 23 «222» m «223» K»"ö s&pisn ««00» XŐ acagg&aeet eiagagscffa ecp «2X0» 12 «2X2» 24 «2X2» SNA «2X3» Homo sapisn «áss» father. gccccratec fcsjest< / ctj> < / ots> < / tts> < / ott> < / gst> < / otz>

Claims

1. A vector for expressing a sequence in a tumor cell, comprising a polynucleotide comprising an H19 regulatory sequence operably linked to a heterologous sequence encoding a cytotoxic gene product.

2. The vector according to claim 1, wherein the H19 regulatory sequence is the H19 promoter, the H19 enhancer, or the H19 promoter and the H19 enhancer together, 3. The vector of claim 2, wherein the H19 promoter comprises: (a) the H19 promoter comprises nucleotides 1-530 of SEQ ID NO: 1; or (b) the H18 promoter comprises SEQ ID NO: 2, 4. The vector of claim 2, wherein the H18 enhancer comprises: (a) the H18 enhancer sequence cloned into plasmid pH19EH19 (ATCC Accession No. 209322); (b) SEQ ID NO: 3; (c) SEQ ID NO: 4; (d) SEQ ID NO: 5; wherein the enhancer is optionally located 3' to the heterologous sequence, 5. The vector according to any one of the preceding claims, characterized in that the heterologous sequence is selected from the group consisting of (a) E-galactosidase, diphtheria toxin, Pseudomonas toxin, ricin, cholera toxin, retinoblastoma gene, p53, Herpes simplex thymidine kinase, Varioella zosier thymidine kinase, cytosine deaminase, nitroreductase, cytochrome p-43ö 281, thymidine phosphorylase, porin nucleoside ·-· Jt * * -D * * * * X « « ' * * Λ * « χ « *♦»* Κ«« « Φ # Λ isothioctase, alkaline phosphatase, A and G2 carboxypeptidase, unamarase, yl-iscatamase or xanthine oxidase; (b) an antisense sequence that specifically hybridizes to a sequence encoding a gene selected from cdk2, cdk8, cdk21, odc25A, eskun D1, cyclin E, cyclin Af cdk4 or the oncogene pS3, o-fos, c~jun, Kr-ras or Her2 / neu; or Cc) encodes a ribozyme that specifically cleaves a gene selected from cdk2, cdk8, cdk21, cdc25A.RNA encoding a gene selected from cyclin D1, cyclin E, escin A, cdk4 or the oncogene p53, c-fos, c-jun, Kr-ras or the Her2 / neu gene.

8. The vector according to any one of the preceding claims, characterized in that the host cell is not in the human body. 7> The vector according to any one of claims 1-7, characterized in that the tumor is a bladder tumor cell.

8. The vector according to claim 7, characterized in that the bladder tumor cell is selected from the group consisting of Ht-1376, EJ2S, T24F. 1197 or Öm-UC-3, 9. Use of a vector according to any one of claims 1-5, 7, and 8 for the preparation of a medicament suitable for (a) expressing the heterologous sequence in a tumor cell, wherein the regulatory sequence is an H19 regulatory sequence that is specifically expressed in the tumor cell; > or (b) treating cancer.

10. The use of Claim 9, wherein the medicament is suitable for treating a subject with a tumor or the cancer is bladder carcinoma, hepatocellular carcinoma, hepatoblastoma, rhabdomyosarcoma, ovarian carcinoma, cervical carcinoma, lung carcinoma, breast cancer, head and neck squamous cell carcinoma, esophageal carcinoma, thyroid carcinoma, astrocytoma, ganglionoblastoma or neuroblastoma.

11. A method for expressing a heterologous sequence in a tumor in vitro, characterized in that a > <, * Φ !*V vector according to any one of claims 1-5, 7 and 8 is introduced into the tumor cell.

12. The use according to claim 9, wherein the medicament is for the treatment of cancer and the cytotoxic gene product is selected from diphtheria toxin, Pseudomonas toxin, licin, cholera toxin; retinoblastoma gene or p53.

13. The use of claim 9, wherein the medicament is for the treatment of cancer and the cytotoxic gene product is a cytotoxic gene product.