Modulators of TNF receptor associated factor (TRAF), their preparation and use

Description

The invention relates to DNA sequences encoding proteins capable of binding to TRAF2 factor and their isoforms, analogs, fragments or derivatives capable of binding to TRAF2 protein, as well as to proteins encoded by the DNA sequences of the invention and their isoforms, analogs, fragments and derivatives capable of binding to TRAF2 protein. The invention also relates to vectors containing the DNA sequences of the invention, eukaryotic and prokaryotic host cells transformed with the vectors; methods for producing the proteins of the invention; antibodies raised against the proteins of the invention, their active fragments and derivatives, and their production. The invention also provides pharmaceutical compositions for modulating cellular effects modulated / mediated by TRAF2 proteins. In addition, the invention provides methods for modulating / mediating NF-κB activity and other intracellular signaling activities modulated / mediated by TRAF2 proteins in cells. The invention also provides methods for identifying and producing ligands capable of binding to the proteins of the invention and DNA sequences encoding them. The invention also provides the use of the proteins, DNA sequences, antibodies and pharmaceutical compositions of the invention for the treatment of pathological conditions associated with NF-xB induction and other TRAF2 factor-mediated activity. A common defining feature of the members of the tumor necrosis factor (TNF) / nerve growth factor (NGF) receptor superfamily is the structural homology of their extracellular domains [Bazan: (1993); Beutler and van Huffel: (1994); Smith et al.: (1994)]. Apart from two receptors, the p55TNF and Fas / APO1 receptors, the intracellular domains of the different members of the receptor family do not show obvious structural similarities. However, the functions of the above receptors are highly similar, suggesting that they are linked to common signaling pathways. This similarity is manifested, for example, in the ability of several receptors belonging to the TNF / NGF family to activate the transcription factor NF-κΒ. This common feature is attributed to the fact that the cytoplasmic protein that activates NF-xB, TNF receptor-associated protein 2.Factor (TNF-Receptor Associated Factor 2; TRAF2) is able to bind to the structurally distinct intracellular domains of several receptors belonging to the TNF / NGF family. The mechanism by which TRAF2 proteins exert their effects and the regulation that determines the sensitivity of the proteins to the different receptors to which they bind are not yet known. The TRAF2 protein is a recently described member of the TRAF family of proteins, of which several members have been identified, including TRAF1 and TRAF2 proteins [Rothe M., Wong SC Henzel WJ and Goeddel D.: Cell 78, 681 (1994); PCT Publication No. WO 95 / 33051], TRAF3 protein [Cheng G. et al. (1995)], and TRAF6 protein [see Cao et al. (1996a)]. The C-terminal domain of all TRAF family proteins shows a high degree of amino acid sequence identity, while their N-terminal domains may differ. Figure 1 shows a schematic representation of the structure of the TRAF2 protein, which shows that the molecule contains a ring finger motif and two TFIIIA-like zinc fingers in the N-terminal region of the molecule. The C-terminal half of the molecule contains a region called the “TRAF domain”, which contains a potential leucine zipper region, in the region corresponding to amino acids 264-358 (named N-TRAF), in addition, the carboxy-terminal part of the domain, corresponding to amino acids 359-501 (named C-TRAF), is responsible for binding to TRAF receptors and to other TRAF molecules, which binding leads to the formation of homo- or heterodimers. Activation of the transcription factor NF-κΒ is one of the manifestations of the TRAF2-mediated signaling cascade through TNF / NGF receptors. NF-κB factors are dimer-forming proteins homologous to the Rel oncogene, which function as transcription factors in a dimeric form. These factors are ubiquitous and participate in the regulation of the expression of numerous genes. Although NF-κB was first identified as a factor that is continuously detected in B cells during the expression of Igx light chains, it is currently known primarily as an inducible transcriptional activator. In most known cases, NF-κB is a primary factor, namely, it becomes active through the activation of molecules already present in the cell in an inactive form, under the influence of inducible transcription factors that “turn on” the NF-κB gene, and is not synthesized de novo. The effects of NF-κB are very diverse. Most of these effects have in common that they can be rapidly induced by extracellular stimuli.Most of the NF-xB-activating agents enhance immune defense, such agents and effects include components of viruses and bacteria, cytokines that regulate immune responses, ultraviolet (UV) light, and the like. Accordingly, many genes regulated by NF-xB play a role in immune defense [for reviews on this topic, see Blank et al. (1992); Grilli et al. (1993); Baeuerle and Henkel (1994)]. A key feature of NF-xB regulation is that this factor can exist in a cytoplasmic, non-DNA-binding form that, upon induction, translocates to the nucleus, binds to DNA, and activates transcription. Which of the two forms the NF-xB protein adopts is regulated by the l-xB factor, a family of proteins that includes proteins containing the repeat domains first identified in the ankrin erythrocyte protein [Gilmore and Morin: (1993)]. In the unstimulated form, the NF-xB dimer occurs in association with l-xB factor, which results in it remaining in the cytoplasm, not interacting with NF-xB-binding DNA sequences, and not activating transcription. The NF-xB factor is activated by the l-xB factor. HU 226 328 The critical step in the regulation of Β1 is the dissociation of Ι-κΒ factor from the NF-κB dimer by several inducing agents [DiDonato (1995)]. We still have limited knowledge of the mechanisms involved in the above regulation. Little is also known about what determines the cell specificity for different NF-κB inducing agents. One of the most potent inducing agents of NF-κΒ is the cytokine tumor necrosis factor (TNF). Two different TNF receptors are known, the p55 and p75 receptors. Their expression levels vary independently in different cells [Vandenabeele et al. (1995)]. The p75 receptor is primarily sensitive to the cell-bound form of TNF (TNF is expressed both as a beta-transmembrane protein and as a soluble protein), whereas the p55 receptor is activated by soluble TNF molecules as effectively as the bound form [Grell et al. (1995)]. The intracellular domains of the two receptors differ structurally and they are associated with different cytoplasmic proteins. However, at least some of the effects of TNF, such as the cytocidal effect of TNF and the induction of NF-κB, can be mediated through both receptors. This property is cell-specific. The p55 receptor is capable of inducing cytocidal effects or activating NF-κB in all cells in which TNF induces such effects.The p75 receptor is only able to induce this effect in some cells. In other cells, although they express p75 receptor in high amounts, only stimulation of the p55 receptor shows the above effects [Vandenabeele et al. (1995)]. In addition to TNF receptors, various other receptors belonging to the TNF / NGF family are also able to activate NF-κB, for example the following receptors: CD30 [McDonald et al. (1995)]; CD40 [Berberich et al. (1994)]; LalmanachGirard et al. (1995)]; the lymphotoxin beta receptor; and in some cell types Fas / APO1 [RensingEhl et al. (1995)]. The IL-1 type I receptor, which also effectively activates NF-κB, exerts effects largely identical to those exerted through TNF receptors, despite the lack of structural similarity between them. Activation of NF-κB is achieved by the phosphorylation of the associated Ι-κΒ molecules through the induction of the various receptors mentioned. This phosphorylation leads to degradation of Ι-κΒ, which probably occurs in the proteasome. The nature of the kinase that phosphorylates Ι-κΒ and the mechanism of activation upon receptor stimulation are not yet known. However, in the last two years, three receptor-associated proteins have been identified that appear to play a role in triggering phosphorylation (see diagrams in Figures 2A and 6). A central role in the activation of NF-κB by various receptors belonging to the TNF / NGF family is played by a protein called TRAF2, which was first cloned by D. Goeddel et al. [Roethe et al. (1994)]. This protein, which, when expressed in large quantities, is able to To induce NF-κB activation, it binds to the activated p75 receptor [Roethe et al. (1994)], lymphotoxin beta receptor [Mosialos et al. (1995)], CD40 receptor [Roethe et al. (1995a)], and CD30 receptor (data not published) and induces NF-κB through these receptors. TRAF2 does not bind to the p55 TNF receptor or Fas / APO1, but it can bind to a p55 receptor-associated protein called TRADD, which in turn can bind to a Fas / APO1-associated protein called M0RT1 (or FADD) [see Boldin et al. (1995b and 1996)]. Another receptor-interacting protein, RIP [see Stanger et al. (1995)], is also able to interact with TRAF2 proteins, as well as FAS / APO1, TRADD, the p55 TNF receptor and MORT-1.Thus, while RIP was originally associated with cell cytotoxicity (cell death), its interaction with TRAF2 suggests that this protein also plays a role in NF-κB activation, and may also enhance the interactions between FAS / APO1 receptor, MORT-1 protein, p55-TNF receptor and TRADD protein, as well as TRAF2 protein, leading to NF-κB activation. This association appears to enable NF-κB activation via p55-TNF and Fas / APO1 receptors [Hsu et al. (1995); Boldin et al. (1995); Chinnalyan et al. (1995); Varfolomeev et al. (1996); Hsu et al. (1996)]. Activation of NF-κΒ via IL-1 receptors is a TRAF2-independent event and may involve a recently cloned IL-1 receptor-associated protein kinase called IRAK [Croston et al. (1995)]. The mechanism by which TRAF2 exerts its effects is not yet fully understood. Several cytoplasmic molecules that bind to TRAF2 have been identified [Roethe et al. (1994); Roethe et al. (1995b)]. However, our knowledge of these molecules does not provide any explanation for how TRAF2, which has no enzymatic activity at all, induces the phosphorylation of factor I-κB. Furthermore, we do not know the mechanisms that control the cell specificity of TRAF2 activation through the different receptors; the situation is similar to what we have seen in the case of NF-κB induction through the two TNF receptors. In addition to the above mentioned TRAF proteins, it should be noted that TRAF2 binds to the p55 (CD120a), p75 (CD120b) TNF receptors, as well as to several other receptors of the TNF / NGF family; the binding can be direct or indirect, via other adaptor proteins, as seen for example with the FAS / APO1 receptor and the M0RT-1, TRADD or RlP adaptor proteins. The TRAF2 factor as such is crucial for NF-κB activation [see also Wallach: (1996)]. In contrast, the TRAF3 protein, via receptors of the TNF / NGF family, actually inhibits NF-κB activation [see Rothe and HU 226 328 B1 et al. (1995a)], while the presence of TRAF6 protein is required for the induction of NF-κB factor by IL-1 [see Cao et al. (1996a)]. As mentioned above, with regard to NF-κB activation and the role of this activation in maintaining cell viability, the various intracellular pathways leading to activation are not yet fully understood, for example, we do not know how the various TRAF proteins participate in them, directly or indirectly. Furthermore, as is known for the various members of the TNF / NGF receptor family and the intracellular signaling pathways associated with them, in which various adaptor, mediator / modulator proteins also play a role (see, for example, WO 97 / 03998 for brief summaries and references), TNF and the FAS / APO1 ligand, for example, can exert both beneficial and detrimental effects on the cell. For example, TNF contributes to the protection of the organism against tumors and infectious agents, and also promotes the healing of injuries by resulting in the destruction of tumor cells and virus-infected cells, or by enhancing the antibacterial activity of granulocytes; in these cases, TNF-induced cell death is therefore beneficial.However, when TNF is present in excess, it can also be harmful; for example, TNF plays an obvious pathogenic role in many diseases, such as septic shock, anorexia, rheumatoid diseases, inflammation and graft versus host reactions. In the above cases, TNF-induced cell death is undesirable. FAS / APO1 ligand, for example, also has beneficial and detrimental effects. FAS / APO1 ligand, during T-cell maturation, results in the destruction of autoreactive T cells through its receptor; that is, it results in the destruction of T cells that recognize self-antigens during T-cell development, thereby preventing the development of autoimmune diseases.Furthermore, many malignant cells and HIV-infected cells express the FAS / APO1 receptor on their surface and can be killed by activating the receptor with an appropriate ligand or by using antibodies specific for the receptor, by activating intracellular processes that lead to cell death (apoptosis) induced by the receptors. However, the FAS / APO1 receptor can also mediate harmful effects; its activation can cause, for example, abnormal tissue destruction, for example in certain diseases such as acute liver inflammation (hepatitis) with the destruction of liver cells. In light of the above - notably considering that TNF / NGF family receptors can both induce cell death pathways and activate cell survival pathways (via NF-κB induction) - it seems that there is a delicate balance between these opposing reactions in the cell. For example, if we want to achieve maximum cell death of tumor cells or other infected or diseased cells, it would be advantageous if TNF and / or FAS / APO1 ligand only induced the cell death pathway without resulting in NF-κB induction. Conversely, if we want to protect cells from the harmful effects of, for example, inflammation, graft versus host reactions or acute hepatitis, it would be advantageous to inhibit the cell death-inducing effects of TNF and / or FAS / APO1 ligand and instead enhance NF-κB induction.Similarly, in certain pathological conditions, inhibition of intracellular signaling pathways mediated by the p75-TNF receptor and IL-1 receptor would be beneficial, while in other conditions, amplification of the above intracellular pathways would be beneficial. The invention relates to novel proteins capable of binding to tumor necrosis factor receptor-associated (TRAF) proteins, their isoforms, analogs, fragments and derivatives. Since TRAF proteins play a role in regulating (modulating) or mediating the activation of the transcription factor NF-κΒ, which activation is triggered by the induction of certain TNF / NGF receptors or other receptors mentioned above, the novel proteins of the invention, by binding to TRAF proteins, are able to influence (modify or mediate) the signal transduction processes activated by various ligands (e.g. TNF, FAS ligand or other ligands) binding to the corresponding receptors, for example by directly or indirectly interacting with TRAF proteins, they can influence their effect of modifying / mediating NF-κB activation. The novel proteins of the invention are therefore direct modifiers / mediators (modulators / mediators) of the intracellular biological activity of TRAF proteins (e.g. the effect of TRAF2 or TRAF6 protein on NF-κB activation, or the effect of TRAF3 protein on NF-κB activation). The novel proteins of the invention similarly indirectly modify / mediate the intracellular biological activity of various other proteins that interact directly or indirectly with TRAF proteins (e.g. FAS / APO1 receptor, p55TNF receptor, p75TNF receptor, IL-1 receptor and related proteins such as MORT-1, TRADD or RIP proteins). The invention also provides antagonists (e.g. antibodies, antagonist peptides, organic compounds or individual isoforms) of the above TRAF binding proteins, such as isoforms, analogues, fragments or derivatives of the above proteins with such activity, which can be used, if desired, to inhibit the signal transduction process; more particularly, to inhibit NF-κB activation and processes related to its role in cell survival. Similarly, if the TRAF binding proteins of the invention or the TRAF protein to which they bind (e.g., the TRAF3 protein) themselves inhibit NF-κB activation, our aim is to produce molecules with antagonistic activity against the above TRAF binding proteins, which can be used, if desired, to activate the signal transduction process, more particularly, to block the inhibitory effect on NF-κB activation, thereby enhancing NF-κB activation. HU 226 328 B1 The invention also provides the use of the above TRAF binding proteins, isoforms, analogs, fragments and derivatives to identify additional proteins or factors that may be involved in the regulation of TRAF protein activity and / or the above receptor activity, for example, to identify additional proteins that bind to TRAF proteins and influence their activity; and / or to isolate and identify other receptors or other cellular proteins located upstream or downstream in the signal transduction process(es) to which these novel proteins, analogs, fragments and derivatives bind, thereby also influencing their function. Furthermore, the invention provides inhibitors which, when delivered to cells, bind to or interact with the novel TRAF binding proteins and their possible isoforms, thereby inhibiting a TRAF protein-associated activity, such as NF-κB activation, and thus, if desired, can be used to inhibit NF-κB activation; or which can inhibit a TRAF-associated (e.g., TRAF3-associated) inhibitory activity, such as NF-κB activation inhibitory activity, and thus, if desired, can be used to enhance NF-κB activation. The invention also provides the use of the above-mentioned novel TRAF binding proteins, isoforms or analogs, fragments or derivatives thereof as antigens for the production of polyclonal and / or monoclonal antibodies directed against the above. These antibodies can be used, for example, for the purification of the novel proteins of the invention from various sources, such as cell extracts or transformed cell lines. Furthermore, the above antibodies can be used for diagnostic purposes, for example, to identify pathological conditions associated with disorders of cellular functions mediated directly by TRAF proteins or mediated by p55-TNF receptor, FAS / APO1 receptor or other similar receptors and their associated cellular proteins (e.g. M0RT-1, TRADD, RIP), which proteins interact with TRAF proteins, directly or indirectly, to regulate / mediate intracellular processes. The invention also provides pharmaceutical compositions comprising the novel TRAF proteins, isoforms or analogs, fragments or derivatives thereof according to the invention; and pharmaceutical compositions comprising the above antibodies or other antagonists. According to a preferred embodiment of the invention, a number of TRAF-binding proteins have been isolated, in particular TRAF2-binding proteins have been isolated. These TRAF2-binding proteins bind with high specificity to the TRAF2 protein (see the attached examples), and therefore act as regulators or mediators of the intracellular activity of TRAF2. The TRAF2 protein is involved in the regulation or mediation of at least one intracellular signaling process that is associated with the survival or maintenance of the viability of the cell, in which the TRAF2 protein plays a direct role through the activation of the NF-κB factor, which in turn plays a central role in ensuring the survival of the cell. One of said new proteins, the NIK protein ("NF-κB-inducing kinase"), binds to the TRAF2 protein and enhances the activation of the NF-κB factor. The NIK protein is actually a kinase whose sequence shares similarities with several MAPKK kinase sequences (see below).Furthermore, since TRAF2 protein can interact, directly or indirectly, with the aforementioned p55-TNF receptor, p75-TNF receptor, FAS / APO1 receptors and their associated M0RT-1, TRADD and RIP proteins, it can also be considered as a mediator or regulator of NF-κB induction or activation associated with the aforementioned receptors. TRAF2 protein is therefore a regulator / mediator of the cell survival pathways mediated by the aforementioned receptors or their associated proteins (as opposed to pathways leading to cell death), and as such, the degree of interaction between the aforementioned receptors and / or proteins and TRAF2 protein is an important factor in the outcome of the activation of the aforementioned receptors (following activation by the appropriate ligand), namely a determining factor in terms of whether the cell survives or dies.As described above, the proteins of the invention, such as the NIK protein, play a key role in the interaction of the TRAF2 protein with other proteins / receptors that interact with the TRAF2 protein, since such proteins, such as the NIK protein, specifically bind to the TRAF2 protein and modify its activity; and / or their own activity is modified by the interaction with the TRAF2 protein. TRAF-binding proteins, such as TRAF2-binding proteins, including the NIK protein, have been isolated and cloned using the “two-hybrid system”, partially and completely sequenced, characterized, and, as described in detail below, have been shown to be highly specific TRAF2-binding proteins and therefore to specifically modulate / mediate the effects of TRAF2 proteins. In the present description, TRAF protein activity, for example TRAF2 activity, is understood to mean the effect of the protein on modifying / mediating the reaction pathways ensuring the survival of the cell, in particular its NF-κΒ inducing / activating effect. Similarly, in relation to a TRAF-binding protein, in particular TRAF2-binding protein, activity is understood to mean the effect of the protein on modifying / mediating TRAF activity, in particular TRAF2 activity, which effect is exerted through specific binding to a TRAF protein, in particular TRAF2 proteins; this modifying / mediating effect may be, for example, an effect on modifying / mediating the reaction pathways ensuring the survival of the cell, in particular an effect related to NF-κΒ activation / induction, in which TRAF proteins, in particular TRAF2 proteins, play a direct role; thus, TRAF or TRAF2-binding proteins are all of the above-mentioned proteins, and presumably many other, which are involved in the cell's HU 226 328 They can be considered as an indirect modifier / mediator (modulator / mediator) of a protein involved in Β1 survival, primarily NF-κΒ activation / induction, and can also be considered as an indirect modifier / mediator of proteins to which TRAF2 proteins (or other TRAF proteins) bind or with which TRAF2 proteins (or other TRAF proteins) interact, directly or indirectly. As described above, the invention relates to DNA sequences encoding tumor necrosis factor receptor associated (TRAF) molecules. According to a preferred embodiment of the invention, the DNA sequence of the invention encodes a protein capable of binding to TRAF2 protein. According to a further preferred embodiment of the invention, the DNA sequence according to the invention encodes a protein binding to the amino acid sequence of the TRAF2 protein, at least corresponding to amino acid positions 222-501. The invention further relates to the following DNA sequences: a) a cDNA sequence corresponding to clone 9, comprising the nucleotide sequence shown in Figure 3A; b) a cDNA sequence corresponding to clone 10, comprising the nucleotide sequence shown in Figure 4; c) a cDNA sequence corresponding to clone 15, comprising the nucleotide sequence of Figure 5A; d) a fragment of one of the sequences (a)-(c) which encodes a biologically active protein binding to the amino acid sequence of the TRAF2 protein corresponding to at least amino acids 222-501; e) a DNA sequence hybridizing to one of the sequences (a)-(d) under moderately stringent conditions, which encodes a biologically active protein binding to the amino acid sequence of the TRAF2 protein corresponding to at least amino acids 222-501; f) a DNA sequence degenerate compared to one of the sequences (a)-(e) due to the degeneracy of the genetic code, which encodes a biologically active protein binding to the amino acid sequence of the TRAF2 protein, corresponding to at least amino acids 222-501. The DNA sequence of the invention may be, for example, any of the following: the DNA sequence found in one of the cDNA clones labeled 9 and 15; DNA sequence encoding a protein that also modulates NF-κB activity; DNA sequence found in cDNA clone 10. According to a further preferred embodiment of the invention, the DNA sequence according to the invention comprises a sequence encoding a NIK protein ("NF-κB-inducing kinase"). The DNA sequence according to the invention encoding the above NIK protein may be, for example, any of the following: (1) a DNA sequence encoding a NIK protein, an isoform, fragment or analog thereof, which NIK protein, an isoform, fragment or analog thereof is capable of binding to TRAF2 protein and thereby modulating the activity of the NF-κB factor; (2) a DNA sequence as defined in point (i) which is any of the following: a) cDNA sequence from the coding region of native NIK protein; b) a DNA sequence that hybridizes to the sequence of point (a) under moderately stringent conditions and encodes a biologically active NIK protein; c) a DNA sequence that is degenerate compared to one of the sequences according to points (a) and (b) due to the degeneracy of the genetic code, and which encodes a biologically active NIK protein; (3) a DNA sequence according to (1) or (2), which comprises at least a portion of the sequence according to Figure 6 and encodes at least one active NIK protein, isoform, analog or fragment; (4) the DNA sequence of (3) encoding a NIK protein, isoform, analog or fragment comprising at least a portion of the amino acid sequence of Figure 6. The invention also provides proteins or polypeptides encoded by the above DNA coding sequences; and isoforms, analogs, fragments and derivatives of the above proteins and polypeptides; provided that they are capable of binding to the amino acid sequence of the TRAF2 protein, preferably at least corresponding to amino acids 222-501. Such proteins / polypeptides, their isoforms, analogs, fragments and derivatives may be, for example, the following: (a) the protein encoded by clone 10; (b) a protein, isoform, analog, fragment or derivative thereof, which is a NIK protein, isoform, analog, fragment or derivative thereof encoded by any of the above DNA sequences encoding a NIK protein, an isoform, analog, fragment or derivative thereof; and (c) a NIK protein, isoform, analog, fragment or derivative thereof, which is a NIK protein, isoform, analog, fragment or derivative thereof encoded by any of the above DNA sequences encoding a NIK protein, isoform, analog, fragment or derivative thereof, and which protein, isoform, fragment or derivative thereof comprises at least a portion of the amino acid sequence of Figure 6. The invention also provides vectors containing one of the DNA sequences of the invention, which are capable of being expressed in prokaryotic and / or eukaryotic host cells; and transformed prokaryotic or eukaryotic cells containing the above vectors. Furthermore, the invention provides methods for the production of any of the DNA sequences of the invention. HU 226 328 For the production of β1 encoded proteins, isoforms, analogs, fragments or derivatives, which methods comprise culturing the transformed host cells under conditions that allow the expression of said proteins, isoforms, analogs, fragments or derivatives; modifying the latter, as necessary, after translation to produce the above proteins, isoforms, analogs, fragments or derivatives; and then isolating the expressed proteins, isoforms, analogs, fragments or derivatives. The invention also provides antibodies, active fragments or derivatives thereof, which are specific for the above TRAF binding proteins, analogs, isoforms, fragments or derivatives thereof; or are specific for the NIK protein, isoforms, analogs, fragments or derivatives thereof. The invention also provides the following filtration methods: (a) methods for screening ligands capable of binding to one of the proteins of the invention, isoforms, analogs, fragments or derivatives thereof, comprising contacting an affinity chromatography cartridge to which said proteins, isoforms, analogs, fragments or derivatives have been attached with a cell extract, whereby the ligand binds to the cartridge, and then eluting, isolating and analyzing the ligand; (b) methods for screening for DNA sequences encoding a ligand capable of binding to one of the proteins, isoforms, analogs, fragments or derivatives of the invention, using the yeast two-hybrid method, which method comprises cloning the sequence encoding said protein, isoform, analog, fragment or derivative into a first hybrid vector and cloning sequences from a cDNA library or a genomic DNA library into a second hybrid vector; transforming yeast host cells with said vectors; isolating the positively transformed cells; and then extracting the second hybrid vector from the clone, thereby obtaining the sequence encoding said ligand. The invention also provides methods for isolating and identifying proteins, isoforms, analogs or fragments of the invention that directly bind to the TRAF2 protein using the yeast two-hybrid method, which method comprises cloning a sequence encoding the TRAF2 protein into a hybrid vector and cloning sequences from a cDNA library or a genomic DNA library into another hybrid vector; transforming yeast host cells with said vectors; isolating the positively transformed cells; extracting the second hybrid vector from the clones, thereby obtaining a sequence encoding a protein that binds to the TRAF2 protein. The invention also provides methods for modulating or mediating, in cells, NF-κB activity or any intracellular signaling activity modulated or mediated by TRAF2 proteins or other molecules to which the proteins of the invention, isoforms, analogs, fragments or derivatives thereof bind, comprising subjecting cells to a treatment that results in one or more of the above proteins, isoforms, analogs, fragments or derivatives thereof being delivered to the cells in a form suitable for intracellular delivery; or introducing into the cells a DNA sequence encoding one or more of the above proteins, isoforms, analogs, fragments or derivatives thereof in the form of a suitable vector carrying one of said sequences, which vector is suitable for inserting said sequences into cells so that said sequences are expressed therein. For example, the following methods can be used to modify / mediate NF-κB activity or any intracellular signaling activity modulated or mediated by TRAF2 protein or other molecules in cells: (a) the above methods, according to which cells are treated to introduce into them a DNA sequence encoding a protein, an analogue, fragment or derivative thereof, in the form of a suitable vector carrying said sequence, which vector is suitable for inserting said sequences into cells in such a way that said sequences are expressed therein; (b) the above methods, wherein the treatment of the cells is carried out by transfecting them with a recombinant animal viral vector, according to the following steps: (i) a recombinant animal viral vector carrying a first sequence encoding a viral surface protein (ligand) that binds to a specific cell surface receptor on the surface of the cells to be treated, and a second sequence encoding one of the proteins of the invention, their isoforms, analogs, fragments or derivatives thereof, is produced, which, when expressed in said cells, is capable of modifying / mediating NF-κB activity or any other intracellular signaling activity modified or mediated by TRAF2 protein or other said molecules; (ii) the cells are infected with the vector of point (i). Similarly, the invention provides methods for modulating cellular effects modulated / mediated by TRAF2 protein, which methods comprise treating cells with antibodies, active fragments or derivatives thereof according to the invention, using a suitable composition comprising the antibodies, active fragments or derivatives thereof; and where the TRAF2 binding proteins or portions thereof present in the cell occur on the extracellular surface, formulating the composition in a form suitable for extracellular administration; and HU 226 328 B1 TRAF2-binding proteins are found intracellularly, the preparation is formulated in a form suitable for intracellular application. Methods used to modify cellular effects modified / mediated by the TRAF2 protein include, for example: (a) treating the cells with an oligonucleotide sequence encoding an antisense sequence corresponding to at least a portion of a DNA sequence encoding a TRAF2-binding protein, wherein said DNA sequence may be any DNA sequence according to the invention, whereby said oligonucleotide sequence is capable of preventing the expression of the TRAF2-binding protein; (b) using the above method, wherein the oligonucleotide sequence is delivered to the cells by the above recombinant virus, wherein the second sequence encodes the above oligonucleotide sequence; (c) using the ribozyme method, which comprises introducing into cells a vector encoding a ribozyme sequence that interacts with cellular mRNA sequences encoding TRAF2-binding proteins, isoforms, analogs, fragments or derivatives thereof of the invention, in a form that allows the expression of said ribozyme sequences in the cells, whereby the ribozyme sequence, when expressed in the cells, interacts with and cleaves said cellular mRNA sequence, ultimately resulting in inhibition of the expression of the TRAF2-binding protein in the cells. It should be noted that the protein of the invention used in the methods of the invention may be NIK protein, or at least one isoform, analog, fragment or derivative thereof. The invention also provides methods for preventing or treating pathological conditions associated with NF-κB induction or any activity mediated by TRAF2 or other molecules to which the proteins, isoforms, analogs, fragments or derivatives thereof of the invention bind, comprising administering to a patient in need of treatment an effective amount of a protein, isoform, analog, fragment or derivative of the invention; a DNA molecule encoding the same; or a molecule capable of preventing the interaction between the aforementioned proteins, isoforms, analogs, fragments or derivatives and TRAF2 proteins or any other molecule to which the proteins, isoforms, analogs, fragments or derivatives of the invention bind. The above methods may comprise administering to a patient in need of treatment a protein, isoform, analog, fragment or derivative of the invention, according to claim 10.a protein encoded by clone 10, the NIK protein or an isoform, analog, derivative or fragment of the NIK protein; or a DNA molecule encoding any of the above. The protein encoded by clone 10 - similarly to other fragments of the NIK protein - inhibits NF-κB induction, while the NIK protein enhances NF-κB activation. The invention also provides pharmaceutical compositions for modifying cellular effects modified / mediated by TRAF2 proteins, which compositions comprise as active ingredient at least one TRAF2-binding protein according to the invention, a biologically active fragment, analogue, derivative thereof, or a mixture thereof. The invention further relates to the following: (a) pharmaceutical compositions for modifying cellular effects modified / mediated by TRAF2 proteins, which comprise as active ingredients a protein capable of binding to a cell surface receptor and a recombinant animal viral vector encoding at least one TRAF2 binding protein, isoform, active fragment or analogue according to the invention; (b) pharmaceutical compositions for modifying cellular effects modified / mediated by TRAF2 proteins, which comprise as active ingredient an oligonucleotide sequence encoding an antisense sequence with respect to the mRNA sequence encoding the TRAF2 binding protein of the invention. In particular, the invention relates to pharmaceutical compositions for the prevention or treatment of pathological conditions associated with NF-κB induction or any activity mediated by TRAF2 or other activity mediated by molecules to which the proteins, isoforms, analogs, fragments or derivatives thereof of the invention bind, which compositions comprise an effective amount of a protein, isoform, analog, fragment or derivative of the invention; a DNA molecule encoding the same; or molecules that prevent the interaction of the above proteins, isoforms, analogs, fragments or derivatives with TRAF2 proteins; or an effective amount of any other molecule to which the proteins, isoforms, analogs, fragments or derivatives of the invention bind. In a preferred embodiment of the invention, the pharmaceutical composition comprises the composition of claim 10.a protein encoded by a clone, a NIK protein, or an isoform, analog, derivative, or fragment of a NIK protein; or an effective amount of a DNA molecule encoding any of the above. The invention also provides pharmaceutical compositions for the prevention or treatment of pathological conditions associated with NF-κB induction or any TRAF2-mediated activity or other activity mediated by molecules to which the NIK protein binds, which compositions comprise molecules capable of inhibiting the kinase activity of the NIK protein. The above compositions may comprise, as a molecule inhibiting kinase activity, an effective amount of a NIK protein that carries a mutation at the amino acid positions corresponding to the active site, whereby the mutated NIK protein inhibits the activity of the native NIK protein, in particular the kinase activity of the NIK protein. Known conditions associated with NF-κB induction include AIDS, autoimmune diseases, and tumors. HU 226 328 B1 The invention also relates to: (a) methods for identifying and producing ligands capable of modulating cellular effects modulated / mediated by TRAF2 proteins, comprising: (i) performing a screening assay to identify ligands capable of binding to a polypeptide comprising a portion of the TRAF2 protein corresponding to at least amino acid positions 221-501; (ii) identifying and characterizing ligands other than TRAF2 or a portion of a receptor in the TNF / NGF family that are screened for binding; and (iii) preparing said ligands in substantially isolated and purified form; (b) methods for identifying and producing ligands capable of modulating cellular effects modified / mediated by the proteins of the invention, their isoforms, analogs, fragments or derivatives, which methods comprise: (i) screening to identify ligands capable of binding to a polypeptide comprising at least a portion of the NIK protein sequence shown in Figure 6; (ii) identifying and characterizing ligands other than TRAF2 or a portion of a receptor in the TNF / NGF family that are screened for binding; and (iii) preparing said ligands in substantially isolated and purified form; (c) methods for identifying and producing ligands capable of modulating cellular effects modified / mediated by NIK protein, comprising: (i) screening to identify ligands capable of binding to a polypeptide comprising at least a portion of the NIK protein sequence shown in Figure 6; (ii) identifying and characterizing ligands other than TRAF2 or a portion of a receptor in the TNF / NGF family that are screened for binding; and (iii) preparing said ligands in substantially isolated and purified form; (d) methods for identifying and producing ligands capable of modulating cellular effects directly or indirectly modulated / mediated by NIK protein, comprising: (i) screening is performed to identify molecules that are capable of modulating effects modulated / mediated by NIK protein; (ii) identifying and characterizing said molecules; and (iii) preparing said molecules in substantially isolated and purified form; (e) methods for identifying and producing molecules capable of modifying cellular effects directly or indirectly modified / mediated by the proteins of the invention, their isoforms, analogs, fragments or derivatives, which methods comprise: (i) screening is performed to identify molecules that are capable of modulating the effects modified / mediated by the proteins of the invention, their isoforms, analogs, fragments or derivatives; (ii) identifying and characterizing the above molecules; and (iii) preparing the above molecules in substantially isolated and purified form. Further objects and preferred embodiments of the invention will be apparent from the detailed description of the invention. It should be noted that in the description, the terms "modifying / mediating the cellular effects of a TRAF protein (or TRAF2 protein)" or other "modifying / mediating" terms refer to both in vitro and in vivo treatments, and to inhibition or enhancement / increase. Below is a brief description of the figures attached to the description. Figure 1 shows a schematic representation of the structure of the TRAF2 molecule. Figures 2A-B show schematic representations of protein interactions involved in NF-κB activation, including those of the novel TRAF-binding proteins (e.g., NIK protein) of the invention; Figure 2A shows a schematic representation of some of the above interactions, while Figure 2B shows them in a more complex form. Figures 3A-B show the nucleotide sequence of the 5' end of clone 9. Figure 4 shows the nucleotide sequence of clone 10. Figures 5A-B show the nucleotide sequence of clone 15 (Figure 5A) and the amino acid sequence deduced from the above sequence (Figure 5B). Figure 6 shows the nucleotide sequence of NIK and the amino acid sequence deduced from the above sequence. In Figure 7, the sequence of the NIK protein was compared with the sequence of the mouse protein kinase mMEKKK (“mouse” MAPK or ERK Kinase Kinase) and with the sequences of several other kinases. The regions corresponding to the conserved sequence elements I—XI. in the protein kinase sequence were marked. Explanation of the markings used in the figure: mouse MEKKK HU 226 328 Β1 (S1); BYR2 (S3); Tpl-2 (S3); Ewing sarcoma oncogene (S4); SS3 (S5); STE11 (S6); NPK1 (S7); BCK1 (S8) and NIK (S9) (see example 2). The solution according to the invention is described in detail below. The invention relates to DNA sequences encoding proteins capable of binding to tumor necrosis factor receptor associated factor (TRAF) molecules, as well as to the proteins encoded by them. Preferably, the invention relates to cDNA sequences encoding proteins capable of binding to TRAF2 protein corresponding to clones 9, 10 and 15, as designated herein (see Figures 3A, 4 and 5A), as well as to proteins encoded by the above DNA sequences. The invention also provides a DNA sequence encoding a NIK protein and the NIK protein itself. The above DNAs and the amino acid sequences deduced from them are novel sequences; they are not found in the DNA or amino acid sequence databases of “GENEBANK” or “PROTEIN BANK”. The invention also relates to fragments of the above DNA sequences and DNA sequences capable of hybridizing with the above sequences or parts thereof under moderately stringent conditions, provided that they encode a biologically active protein or polypeptide binding to the amino acid sequence of the TRAF2 protein corresponding to at least amino acid positions 222-501. Furthermore, the invention relates to DNA sequences degenerate in comparison to the above DNA sequences due to the degeneracy of the genetic code, which encode a biologically active protein binding to the amino acid sequence of the TRAF2 protein corresponding to at least amino acids 222-501. With regard to the TRAF2 protein, it should be noted that several members of the TNF / NGF receptor family, directly or indirectly binding to the TRAF2 protein, activate the NF-κΒ transcription factor, and therefore the TRAF2 protein can be considered an adaptor protein for the above receptors, and also a factor modifying / mediating the NF-κB activating effect of the TNF / NGF receptors (see Figure 2B). Another receptor, the IL-1 receptor, activates the NF-κB factor in a way independent of the TRAF2 protein. Preferably, the TRAF2-binding protein of the invention is the NIK protein, which binds to the TRAF2 protein with high specificity and stimulates NF-κB activity. The NIK protein is a serine / threonine kinase, the sequence of which shows similarity to the sequence of several MAPKK kinases (see the attached examples). NIK analogs or NIK mutants lacking kinase activity (see attached examples) produced by the method of the invention do not stimulate NF-κB activation when expressed in cells.Furthermore, such NIK analogs / mutants, when expressed in cells, inhibit the NF-κB-inducing effect of TNF and other inducing agents, such as bacterial LPS endotoxins, phorbol myristate acetate (a protein kinase C activator), and the HTLV-1 protein TAX. TNF activates NF-κB through one of two TNF receptors (the p55 or p75 TNF receptors), and NIK mutants / analogs appear to inhibit NF-κB activation through this receptor. Similarly, TNF and the FAS / APO1 receptor ligand can also induce NF-κB activation through an additional receptor, the FAS / APO1 receptor, which induction is also inhibited by NIK mutants / analogs. In addition, the above receptors are also associated with adaptor proteins, the so-called TRADD, RIP and MORT1 proteins, which are also able to induce NF-κB activity, but this induction can also be blocked by NIK mutants / analogs.Furthermore, such NIK mutants / analogs inhibit the activation of NF-κB by IL-1 (via the IL-1 receptor). As mentioned above, NIK protein is involved in the cascade of NF-κB induction via both TNF / NGF family receptors and the IL-1 receptor. In addition, NIK protein also directly induces NF-κB activation, presumably by directly enhancing the phosphorylation of I-κB. This was concluded from our observations that NIK analogs / mutants lacking kinase activity (also known as “dominant-negative mutants”), when expressed in cells, do not affect TNF-induced Jun kinase activation at all, suggesting that NIK protein specifically enhances the phosphorylation of I-κB without affecting the MAP kinase involved in Jun phosphorylation. The invention thus provides DNA sequences encoding biologically active TRAF-binding proteins, such as TRAF2-binding proteins, such as NIK proteins; analogs, fragments and derivatives thereof; and analogs, fragments and derivatives of the proteins encoded thereby. Such analogs, fragments or derivatives can be prepared by methods known in the art (see, for example, Sambrook et al. (1989)) in which one or more codons in the DNA coding sequences can be deleted, one or more codons can be added, or one or more codons can be replaced by another codon, thereby obtaining sequences that encode analogs containing at least one amino acid difference from the native protein.By suitable analogs we mean analogs that retain at least the property of being able to bind to TRAF2 protein, regardless of whether they mediate other binding or enzymatic activity, for example analogs that bind to TRAF2 protein but are not capable of signaling, i.e. do not associate with a further protein or other factor located downstream in the cascade; or do not catalyze signaling-dependent reactions. As described above, so-called "dominant-negative analogs" can be prepared, namely analogs that are not able to bind to TRAF2 protein; or which are not capable of signaling after the above binding. Such analogs can be used, for example, CD40-, p55-TNF- or p75-TNF-,. HU 226 328 B1 Inhibition of effects mediated through FAS / AP01 receptors and other similar receptors, or inhibition of effects mediated by the various receptor-associated proteins (adaptors) mentioned above, which inhibition is the result of competition between the analogs and the natural TRAF2-binding proteins. Similarly, so-called "dominant-positive" analogs can be prepared, which enhance the effects of the TRAF2 protein. These have TRAF2-binding properties that are the same as or better than the natural TRAF2-binding proteins, and signal transduction properties that are the same as or better than the natural TRAF2-binding proteins. Similarly, taking into account what was mentioned in the preparation of the analogs, biologically active fragments of the clones of the invention can also be prepared.By appropriate fragments of the DNA sequences of the invention is meant DNA sequences encoding proteins or polypeptides that retain TRAF2 binding specificity; or are capable of mediating any of the above binding or enzymatic activities. We can also prepare dominant-negative or dominant-positive fragments of the proteins encoded by the DNA sequences of the invention, using the tags used in the characterization of analogs as appropriate. Similarly, derivatives can be prepared by modifying one or more amino acid side groups of the proteins, analogs or fragments thereof in a known manner; or by conjugating the proteins, analogs or fragments thereof to other molecules, such as antibodies, enzymes, receptors, etc., in a manner well known in the art. In addition to the DNA sequences of the invention encoding TRAF-binding proteins (e.g., TRAF2-binding proteins such as NIK protein), isoforms, analogs, fragments, and derivatives thereof, the invention also provides DNA sequences that hybridize under moderately stringent conditions with cDNA sequences derived from the coding region of a native TRAF-binding protein, such that the hybridizing DNA sequences encode a biologically active TRAF-binding protein.As mentioned above, such DNA sequences capable of hybridization may be, for example, DNA sequences that are relatively highly homologous to the cDNA sequences of native TRAF binding proteins (e.g., the cDNA sequences of TRAF2 binding proteins, such as the cDNA sequence of the NIK protein), and as such, sequences encoding TRAF binding protein-like proteins, such as naturally occurring sequences encoding different TRAF binding protein isoforms; or they may be naturally occurring sequences encoding proteins belonging to the group of TRAF binding protein-like sequences that encode proteins with the same activity as TRAF binding proteins (e.g., TRAF2 proteins, such as the NIK protein). Furthermore, such sequences may be non-naturally occurring, synthetically produced sequences that are similar to, but contain more desired modifications than, the native cDNA sequences encoding TRAF-binding proteins.Such a synthetically produced sequence could therefore be any possible TRAF-binding protein with the same activity as TRAF-binding proteins (e.g. A sequence encoding a TRAF2-binding protein (such as a NIK protein) analog, fragment or derivative. The above-mentioned different naturally occurring TRAF-binding protein-like proteins coding sequences can be obtained by filtering and isolating naturally occurring DNA or RNA samples from various tissues, using the cDNA corresponding to the natural TRAF-binding protein or a portion thereof as a probe (e.g., according to the procedures described in the manual of Sambrook et al. (1989)). Similarly, synthetic TRAF-binding protein-like proteins encoding sequences encoding analogs, fragments or derivatives of the above TRAF-binding protein (e.g., TRAF2-binding protein, such as NIK protein) can be prepared by known methods, such as those described in detail below for the preparation of such analogs, fragments and derivatives. By polypeptides or proteins "substantially corresponding" to a TRAF-binding protein is meant not only TRAF-binding proteins, but also polypeptides and proteins that are analogs of TRAF-binding proteins. By substantially equivalent analogs of TRAF-binding proteins is meant polypeptides in which one or more amino acids have been substituted with another amino acid, or in which one or more amino acids have been deleted, and / or in which one or more amino acids have been inserted, compared to the amino acid sequence of the TRAF-binding proteins; with the proviso that the resulting protein has a biological activity substantially equal to or greater than that of the corresponding TRAF-binding protein. In order to obtain a protein substantially corresponding to a TRAF binding protein, a relatively small number of changes are generally made to the sequence of the TRAF binding proteins, e.g., the sequence of such isoforms. Although the number of changes may exceed ten, preferably no more than ten; more preferably no more than five; and most preferably no more than three. Potentially biologically active proteins corresponding to TRAF binding proteins can be produced by any available technique, preferably by modifying the DNA encoding the protein using known mutagenesis techniques, thereby obtaining proteins that contain only a few modifications.Proteins expressed by such clones can then be screened for their ability to bind to TRAF proteins (e.g., TRAF2 protein) and modulate the activity of TRAF proteins (e.g., TRAF2 protein) through modification / mediation of the above intracellular pathways. “Conservative changes” are changes that are not expected to alter the activity of the protein and are therefore the first changes to test, as they are not expected to significantly alter the size or charge of the protein. HU 226 328 Β1 or its configuration, and thus its biological activity is not expected to be changed either. By molecules containing a conservative substitution compared to the sequence of TRAF-binding proteins, we mean analogs in which at least one amino acid in the polypeptide sequence has been conservatively replaced with an amino acid different from the original. Such substitutions are preferably made based on the list in Table 1A, which substitutions can be determined by routine experiments so as to obtain synthesized polypeptide molecules that have modified structural and functional properties compared to the original, while retaining the biological activity characteristic of TRAF-binding proteins. Table 1A Original amino acid Possible (conservative) substitutions Ala Gly; Ser Arg Lys Asn Gin; His Asp Glu Cys Ser Gin Asn Glu Asp Gly Ala; Pro His Asn; Gin Ile Leu; Val Leu Ile; Val Lys Arg; Gin; Glu Met Leu; Tyr; Ile Phe Met; Leu; Tyr Ser Thr Thr Ser Trp Tyr Tyr Trp; Phe Val Ile; Leu Additional substitutions can be made in TRAF-binding proteins by removing at least one amino acid from the polypeptide and inserting another amino acid in its place, as shown in Table 1B. The type of substitutions that can be made in the polypeptide can be determined based on an analysis of the frequency of amino acid differences in homologous proteins from different species, such as those found in the following literature: Schulz et al.: "Principles of Protein Structure, Tables 1-2, SpringerVerlag, New York, NY. (1978); and Creighton TE: "Proteins: Structure and Molecular Properties, Figures 3-9, WH Freeman & Co., San Francisco, CA (1983). Based on such analyses, additional conservative substitutions can be made by exchanging amino acids belonging to the following groups with each other. Table 1B 1. Small, aliphatic, non-polar or weakly polar amino acids: Ala; Ser; Thr; (Pro; Gly); 2. Polar, negatively charged amino acids and their amides: Asp; Asn; Glu; Gln; 3. Polar, positively charged amino acids: His; Arg; Lys; 4. Large, aliphatic, non-polar amino acids: Met; Leu; Ile; Val; (Cys); and 5. Large aromatic amino acids: Phe; Tyr; Trp. The three amino acids in parentheses play a special role in the structure of proteins. Gly is the only amino acid that does not contain a side chain, which gives the chain flexibility. However, this favors the formation of secondary structures other than α-helices. The Por amino acid, due to its unusual geometry, greatly stiffens the chain and generally promotes the formation of β-sheet-like structures; in some cases, the Cys amino acid can participate in the formation of disulfide bridges, which is important for protein folding. It should be noted that Schulz et al. (see above) discuss groups 1 and 2 together. It is also noteworthy that the Tyr amino acid, due to its hydrogen bond-forming properties, shows a significant degree of similarity to amino acids such as Ser and Thr. Conservative amino acid substitutions of the invention, such as those described above, are known in the art and are not expected to alter the biological and structural properties of the polypeptide containing the amino acid substitution. Most of the deletions and substitutions of the invention do not result in a radical change in the properties of the protein or polypeptide molecule. "Altered properties include, but are not limited to, changes in secondary structure, such as α-helix or β-strand structure; or changes in biological activity, such as the ability to bind to TRAF proteins; and / or changes in the ability of TRAF proteins to mediate cell death-inducing effects." Amino acid substitutions in proteins resulting in TRAF-binding protein analogs of the invention can be made by any known method, for example, by any of the methods described in the following references: Mark et al. U.S. Patent Nos. 4,959,314, 4,588,585 and 4,737,462; Koths et al. U.S. Patent No. 5,116,943; Namen et al. U.S. Patent No. 4,965,195; Chong et al. U.S. Patent No. 4,879,111; and Lee et al. U.S. Patent No. 5,017,691; and lysine-substituted proteins are described in U.S. Patent No. 4,904,584. HU 226 328 B1 in the United States patent specification (inventors: Shaw et al.). In addition to the conservative substitutions discussed above that do not substantially alter the activity of the TRAF-binding proteins, the invention also contemplates conservative substitutions, or less conservative or random changes, that result in increased biological activity of the TRAF-binding protein analogs. In determining the precise effect of substitutions or deletions, it is clear to the skilled person that the effect of the substitution(s), deletion(s), etc. can be determined by known binding assays and cell death monitoring. No additional experiments are required to perform such screening assays according to known assay procedures. At the genetic level, these analogs are generally prepared by site-directed mutagenesis of nucleotides in DNA encoding TRAF-binding proteins, thereby obtaining DNA encoding the analog, then synthesizing the DNA and expressing the polypeptide in recombinant cell culture. The analogs typically have qualitative biological activity that is the same as or greater than that of the naturally occurring protein [Ausubel et al., Current Protocols in Molecular Biology, Greene Publications and Wiley Interscience, New York, NY. (1987-1995); Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. (1989)]. Analogs encoding TRAF-binding proteins or polypeptides corresponding thereto, but having a sequence different from the naturally occurring nucleotide sequence, but containing permissible changes resulting from the known degeneracy of the genetic code, can be prepared by site-directed mutagenesis of DNA encoding a previously prepared analog or a native version of a TRAF-binding protein. The site-directed mutagenesis technique allows us to prepare analogs using specific oligonucleotide sequences that encode the DNA sequence corresponding to the desired mutation, and in addition, contain a sufficient number of adjacent nucleotides flanking the mutation to be created to obtain a primer oligonucleotide of sufficient size and sequence complexity to be capable of forming a stable duplex in both directions from the junctions of the deletion to be bridged.Preferably, a primer of about 20-25 nucleotides is used, which contains 5-10 complementary nucleotides on each side of the sequence to be altered. In general, the technique of site-directed mutagenesis is well known in the art and is described, for example, in the following literature: Adelman et al.: DNA 2, 183 (1993), which is incorporated by reference in its entirety. It is known that the site-directed mutagenesis technique is typically based on the use of phage vectors that occur in both single-stranded and double-stranded forms. A typical phage vector that can be used according to the site-directed mutagenesis technique is, for example, the M13 phage vector [see, for example, Messing et al., Third Cleveland Symposium on Macromolecules and Recombinant DNA, ed. A. Walton, Elsevier, Amsterdam (1981), which is incorporated herein by reference in its entirety]. These phages are readily available commercially and their use is generally well known to those skilled in the art. Plasmid vectors containing a single-stranded phage origin of replication can also be used to produce single-stranded DNA [Veira et al., Meth. Enzymol. 153, 3 (1987)]. In general, site-directed mutagenesis is accomplished by first constructing a single-stranded vector containing the DNA sequence encoding the desired polypeptide. The desired oligonucleotide carrying the mutated sequence is then synthetically constructed using automated DNA / oligonucleotide synthesis techniques. This primer is then annealed to the single-stranded vector containing the protein-coding sequence and contacted with a DNA polymerase enzyme, such as the Klenow fragment of E. coli DNA polymerase I, to complete the synthesis of the strand carrying the mutation. Thus, the mutated sequence and the second strand will contain the desired mutation. The heteroduplex vector is then transformed into appropriate cells, such as E. coli JM101 cells, and clones containing recombinant vectors carrying the mutated sequence are selected. Once suitable clones have been selected, the mutated TRAF-binding protein sequence can be removed and subcloned into a suitable vector, generally a transfer vector or expression vector suitable for transformation of the desired host. As described above, genes or nucleic acids encoding TRAF-binding proteins can be detected, extracted and / or modified in vitro, in situ and / or in vivo using known DNA or RNA amplification techniques, such as PCR and chemical synthesis of oligonucleotides. PCR allows the amplification (multiplication) of specific DNA sequences through repeated DNA polymerase reactions. This reaction can be used instead of cloning; all that is required is knowledge of the nucleic acid sequence. To perform the PCR reaction, primers complementary to the sequence in question must be designed. The primers are then produced by automated DNA synthesis. Since primers that hybridize to any part of the gene can be designed, conditions must be provided that allow hybridization to occur even in the presence of mismatches that interfere with complementary base pairing.Amplification of such regions containing non-complementary bases can yield mutagenized products that result in peptides with novel properties (i.e., modified by site-directed mutagenesis). See also, for example, Ausubel et al., Chapter 16 (see above). The technique of complementary DNA (cDNA) synthesis based on the use of reverse transcriptase and the PCR technique. HU 226 328 By linking β1, we can synthesize the extracellular domain of the prolactin receptor from RNA, without cloning. Furthermore, PCR primers can be designed to contain novel restriction sites or to encode other features, such as a termination codon at the end of the gene segment to be amplified. Restriction sites designed at the 5' and 3' ends of the amplified gene sequence allow the gene segment encoding the TRAF binding protein or fragment thereof to be ligated to other sequences and / or cloning sites in vectors. PCR and other RNA and / or DNA amplification techniques are well known in the art and can be used in the methods of the invention without undue experimentation, given the teachings and guidelines herein. Known DNA or RNA amplification techniques include, but are not limited to, polymerase chain reaction (PCR) and related amplification techniques (see, e.g., U.S. Patent No. 4,683,195, U.S. Patents Nos. 683,202, 4,800,159, 4,965,188, to Mullis et al.; U.S. Patents Nos. 4,795,699 and 4,921,794, to Tabor et al.; U.S. Patent No. 5,142,033, to Innis et al.; U.S. Patent No. 5,122,464, to Wilson et al.; U.S. Patent No. 5,091,310, to Innis et al.; U.S. Patent No. 5,066,584, to Gyllensten et al.; U.S. Patent No. 4,889,818 to Gelfland et al.; U.S. Patent No. 4,994,370 to Silver et al.;U.S. Patent No. 4,766,067 to Biswas et al.; U.S. Patent No. 4,656,134 to Ringold et al.; and Innis et al. (eds.): “PCR protocols: A Guide to Method and Applications”; RNA-mediated amplification methods in which RNA antisense to the target sequence serves as a template for the synthesis of double-stranded DNA (see, for example, U.S. Patent No. 130,238, inventors: Malek et al.); and immuno-PCR methods that combine the use of DNA amplification with antibody labeling [Ruziczka et al.: Science 260, 487 (1993); Sano et al.: Science 258, 120 (1992); Sano et al.: Biotechniques 9, 1378 (1991), which patents and publications are incorporated by reference in their entirety], Similarly, biologically active fragments of TRAF-binding proteins (e.g., such fragments of TRAF2 proteins, such as the NIK protein or isoforms thereof) can be prepared as described above, in a manner similar to that described for the preparation of TRAF-binding protein analogs. Suitable fragments of TRAF-binding proteins are those fragments that retain their TRAF protein binding ability and are capable of mediating the biological activity characteristic of TRAF proteins or other proteins that are directly or indirectly associated with TRAF proteins. Accordingly, in a manner similar to that described for analogs, dominant-negative or dominant-positive TRAF-binding protein fragments can be prepared.It is noted that these fragments represent a special group of analogs of the invention, namely those specific portions of TRAF-binding proteins (i.e., a TRAF2-binding protein, such as NIK protein; or isoforms thereof) derived from the entire TRAF-binding protein sequence, which portions or fragments are characterized by one of the above desired activities. Such fragments may be, for example, peptides. Similarly, derivatives can be prepared by modifying the side groups of TRAF-binding proteins, analogs or fragments thereof, according to known methods; or by conjugating TRAF-binding proteins, analogs or fragments thereof to other molecules, such as antibodies, enzymes, receptors, etc., according to methods known in the art. As used herein, "derivatives" are intended to mean derivatives prepared by modifying the functional groups on the side chains of amino acids or the N- or C-terminal groups, according to methods known in the art, and are also included in the present invention. The derivatives may contain chemical moieties, such as carbohydrate or phosphate groups, provided that such moieties have biological activities equal to or greater than those of the TRAF-binding proteins. Derivatives may include, for example, aliphatic esters of the carboxyl group; amides of the carboxyl group obtained by reaction with ammonia or primary or secondary amines; N-acyl derivatives or derivatives of free amino groups of amino acids with acyl groups (e.g. alkanoyl or carbocyclic aroyl groups); or O-acyl derivatives of free hydroxyl groups (e.g. hydroxyl groups of amino acids serine or threonine) with acyl groups. However, the term “derivative” only applies to derivatives in which the twenty most common naturally occurring amino acids are not converted into another such amino acid. The term TRAF-binding protein refers to a protein or polypeptide, i.e. a sequence of amino acids. As used herein, the invention encompasses polypeptides comprising the entire sequence of the TRAF-binding protein, but with a larger sequence, provided that the additions do not affect the old and new characteristics of the polypeptide of the invention, i.e. they retain the biological activity of the TRAF-binding proteins or their active HU 226 328 have a biological activity exceeding that of β1; or can be cleaved so that the cleavage results in a protein or polypeptide having the biological activity of a TRAF-binding protein. For example, the invention relates to fusion proteins of TRAF-binding proteins with other amino acids or peptides. As mentioned above, it is clear that the term "TRAF binding proteins" according to the invention refers to any protein that is capable of binding to a TRAF protein and modulating / mediating its intracellular activity. The term primarily refers to TRAF2 binding proteins that are capable of modulating or mediating intracellular signaling associated with TRAF2 proteins, in particular with respect to the NF-κB activating effect of TRAF2 proteins, more specifically following the interaction between TRAF2 proteins and various members of the TNF / NGF receptor family and / or their associated adaptor proteins, as described in detail above and below. Such TRAF2 binding proteins include, for example, the NIK protein, as well as various analogs, fragments, etc. thereof. (see attached examples), which appear to bind to TRAF2 proteins with high specificity and directly enhance NF-κB activation, while various dominant-negative NIK analogs / mutants inhibit this effect. The invention encompasses all of the above modifications, as long as the proteins, polypeptides, or analogs or derivatives thereof encoded by the sequences thus obtained are still capable of binding to the amino acid sequence of TRAF2 proteins corresponding to at least amino acid positions 222-501. The proteins and polypeptides of the invention, by virtue of their ability to bind to the TRAF2 protein, can be considered as molecules that mediate or modify TRAF2 signaling. As such, the molecules of the invention play a role, for example, in signaling processes in which the binding of the TRAF2 ligand to CD30, CD40, lymphotoxin beta (LT-β) receptor, p55 or p75 TNF receptor or other receptors and other adaptor proteins mentioned above leads to the activation of the transcription factor NF-kB. Of particular interest are the NIK protein and the partial NIK protein encoded by clone 10 of the invention; detailed sequence analysis of the NIK protein and the protein encoded by clone 10 (originally NMPI) revealed that the amino acid sequence encoded by them is typical of Ser / Thr protein kinases, I-XI. It contains conserved sequence elements, designated as , defining the function of the protein. The proteins encoded by the novel clones of the invention, their analogs, fragments and derivatives have numerous applications, for example: (a) they can be used to mimic or enhance the function of NF-κB activity, TRAF2 proteins and their binding receptors, in situations where their enhanced function is desired, for example, to induce antitumor or immunostimulatory effects, where the effects mediated by TRAF2 proteins are beneficial. In such cases, the proteins of the invention, their analogs, fragments or derivatives thereof, which enhance the effect of TRAF2 proteins or their receptors, can be delivered into cells, according to methods known per se. Since the proteins encoded by the clones of the invention act intracellularly and are intended to be delivered only to cells in which the effect of TRAF2 proteins is desired, there is a need for systems suitable for delivering the above proteins to specific cells.They can be introduced, for example, by producing a recombinant animal virus, for example a virus of Vaccinia origin, into the DNA of which the following two genes are inserted: a gene encoding a ligand that binds to cell surface proteins expressed on the surface of specific cells, for example a gene encoding the AIDS (HIV) virus gp120 protein that specifically binds to certain cells (CD4 lymphocytes and leukemia cells bearing such antigen), or a gene encoding any ligand that specifically binds to cells bearing a receptor that binds the TRAF2 protein, whereby the recombinant viral vector binds to such cells; and a gene encoding one of the proteins of the invention.The virus can be delivered specifically to tumor cells or other receptor-bearing cells by means of cell surface binding proteins on the surface of the virus, after which the protein coding sequences are delivered to the cells by the virus and, when expressed therein, enhance the effects of the receptor or TRAF2 proteins, producing the desired immunostimulatory effect in the above cells. Such recombinant animal viruses can be produced according to known methods [see, for example, Sambrook et al. (1989)]. It is also possible to deliver the protein coding sequences in the form of oligonucleotides that the cells can take up and express. (b) They can be used to inhibit NF-κB activity, TRAF2 proteins and the function of their binding receptors, in situations where it is desired to inhibit intracellular signaling, for example in conditions associated with tissue damage, such as AIDS, septic shock or graft versus host rejection. In such cases, we can proceed, for example, by introducing into the cells, by known methods, oligonucleotides with antisense coding sequences to the proteins of the invention, which effectively inhibit the translation of mRNAs corresponding to the proteins, thereby inhibiting the expression of the proteins and the occurrence of unwanted effects. Other oligonucleotides can also be used, for example, those whose encoded proteins have retained their ability to bind to TRAF2 proteins, thereby preventing the binding of other molecules to the above proteins, but at the same time do not have the activating / mediating effect of the molecule.Due to the above properties, the mentioned molecules are able to prevent the interaction between TRAF2 proteins and their natural ligands, thereby acting as inhibitors, blocking the effects mediated by TRAF2 proteins, such as its NF-κB activation. It delivers such oligonucleotides into cells15. HU 226 328 Β1 can be affected by using the above recombinant viruses, in which the second sequence carried by the virus is the said oligonucleotide sequence. In addition, antibodies specific for the proteins of the invention can be used to inhibit intracellular signaling mediated by the proteins. A recently developed approach to inhibit undesired effects can also be used, based on the use of ribozymes. Ribozymes are catalytic RNA molecules that cleave RNA in a specific manner. Ribozymes can be designed to cleave specific target RNA, such as mRNAs encoding proteins of the invention. Such ribozymes contain sequences specific to mRNAs encoding proteins and are able to interact with them (through complementary base pairing) and then cleave the mRNA, thereby reducing (or completely eliminating) the expression of the given protein; the level of reduction in expression depends on the level of ribozyme expression in the given target cell.Ribozymes can be delivered into cells (e.g., cells carrying TRAF2-binding proteins) using vectors commonly used for the above purpose, such as plasmid vectors or animal viral vectors (retroviral vectors) [see also (a) above, where the virus contains a cDNA encoding the selected ribozyme sequence as a second sequence], [For reviews of methods, etc. describing the use of ribozymes, see Chen et al. (1992); and Zhao and Pick (1993)]. (c) They can be used to isolate, identify and clone other proteins capable of binding to them, for example, proteins involved in signal transduction downstream of the TRAF2 proteins in the signal transduction process. For example, DNA sequences encoding the proteins of the invention can be used in the yeast two-hybrid system, in which the encoded proteins are used as "bait" to isolate, clone and identify additional sequences ("preys") from cDNA or genomic libraries that bind to the proteins expressed by the clones. In a similar manner, it can be determined whether the proteins of the invention bind to other intracellular proteins, for example, other receptors belonging to the TNF / NGF receptor superfamily. (d) The encoded proteins, their analogs, fragments or derivatives can also be used to isolate, identify and clone additional proteins of the same class, i.e. proteins that bind to TRAF2 proteins or proteins functionally related thereto and that are involved in signal transduction. The above-mentioned yeast two-hybrid system can be used for this purpose, or a recently developed system based on Southern hybridization under non-stringent conditions followed by PCR cloning is used [Wilks et al. (1989)]. (e) Another possible use of the encoded proteins of the invention, their analogs, fragments or derivatives is to use them in affinity chromatography methods to isolate and identify additional proteins or factors to which they are capable of binding, for example proteins related to TRAF2 proteins or other proteins involved in signal transduction. In the above method of use, the proteins of the invention, their analogs, fragments or derivatives are coupled to an affinity chromatography cartridge and then contacted with cell extracts containing a protein suspected of being involved in intracellular signal transduction, or with such isolated proteins or factors. After the affinity chromatography has been performed, other proteins or factors binding to the proteins of the invention, their analogs, fragments or derivatives can be eluted, isolated and characterized. (f) The proteins of the invention, their analogs, fragments or derivatives as mentioned above can also be used as immunogens (antigens) for the production of specific antibodies directed against them. These antibodies can also be used for the purification of the proteins of the invention from cell extracts or transformed cell lines producing said proteins, their analogs or fragments. In addition, such antibodies can be used for diagnostic purposes to identify conditions associated with abnormal function of the receptor system operating with the assistance of the above proteins, for example to detect cellular effects induced by excessive or insufficient levels of TRAF2 protein. Therefore, if such disorders are associated with insufficient function of an intracellular signaling system in the functioning of which the proteins of the invention play a role, said antibodies can serve as a valuable diagnostic tool."Antibodies" include polyclonal antibodies, monoclonal antibodies (mAbs), chimeric antibodies, and anti-idiotypic (anti-Id) antibodies directed against antibodies, which may be labeled in soluble or bound form; in addition, the term refers to antigen-binding fragments of the above antibodies, such as Fab or F(ab')2 fragments, which lack the Fc fragment of intact antibodies. (g) The antibodies and fragments thereof useful in preferred embodiments of the invention may also be used for the quantitative or qualitative detection of clones of the invention in samples; or for the detection of cells expressing clones of the invention. This may be accomplished by immunofluorescence techniques, using fluorescently labeled antibodies, and light microscopy, flow cytometry, or fluorometry detection methods. In preferred embodiments of the invention, antibodies (or fragments thereof) can be used in histological methods, such as immunofluorescence or immunoelectron microscopy, for in situ detection of clones of the invention. In situ detection can be performed by removing a histological sample from a patient and exposing the sample to the target tissue. HU 226 328 Β1 is contacted with labeled antibodies according to the invention. The antibody (or such fragment) is preferably applied by adding the labeled antibody (or antibody fragment) to or layering it on the biological sample. With the above method, not only the presence of clones can be detected, but also their distribution in the tissue under examination. It is clear to the skilled person, having knowledge of the description, that a wide range of histological procedures (e.g. staining procedures) can be modified so as to be suitable for in situ detection. According to the above methods, the detection of clones of the invention is typically carried out by incubating a biological sample, such as a fluid of biological origin, a tissue extract, freshly collected cells, such as lymphocytes or leukocytes, or cells incubated in tissue culture, with a detectably labeled antibody capable of identifying the encoded proteins, and detecting the antibodies by one of the methods known in the art. (h) The encoded proteins of the invention can also be used to indirectly modify the function of a number of other proteins, through their ability to bind to other intracellular proteins, which in turn bind directly to further intracellular proteins or to intracellular domains of transmembrane proteins. In order to modify said additional intracellular proteins or to modify the intracellular domains of transmembrane proteins, the proteins of the invention can be delivered into cells by various techniques as described in (b). It should also be noted that the isolation, identification and characterization of the proteins of the invention can be carried out by any known screening method. For example, one of the above known screening methods, the so-called yeast two-hybrid method, was used to identify the proteins of the invention. Similarly, for the isolation, identification and characterization of the proteins of the invention; or for the isolation, identification and characterization of further proteins, factors and receptors, etc. capable of binding to the proteins of the invention, other methods well known in the art, such as affinity chromatography or DNA hybridization methods, etc., can be used. In addition to the above, the proteins capable of binding to the proteins of the invention can themselves be used - in a similar manner to that described above and below for the proteins of the invention - to isolate, identify and characterize further proteins, factors, etc. which are capable of binding to the proteins of the invention and which are located further downstream from the proteins so far in the signal transduction process related to the above proteins; or which themselves may also have signal-forming activity and which thus represent proteins playing a role in different signal transduction processes. The DNA sequences of the invention and the proteins encoded by them can be produced by known recombinant DNA techniques [see, for example, Sambrook et al.: (1989)], according to which a suitable eukaryotic or prokaryotic host cell is transformed with suitable eukaryotic or prokaryotic vectors containing sequences encoding the proteins of the invention. The invention therefore also includes such expression vectors and transformed host cells suitable for producing the proteins of the invention. As mentioned, the term protein also refers to biologically active analogues, fragments and derivatives of proteins; vectors encoding such proteins also include vectors encoding analogues or fragments of the above proteins; furthermore, transformed host cells also include host cells producing analogues or fragments of the above proteins. Derivatives of the proteins are obtained by modification of the proteins, analogues or fragments produced in the transformed cells in a known manner. The invention also provides pharmaceutical compositions for modifying TRAF2-mediated effects. The pharmaceutical compositions comprise as active ingredients one of the following: (a) one or more DNA sequences according to the invention, or parts thereof, cloned into a suitable expression vector; (b) one of the proteins according to the invention, a biologically active fragment, analog, derivative thereof; or a mixture thereof; (c) a recombinant animal viral vector encoding one of the proteins according to the invention, a biologically active fragment, analog, or derivative thereof. The pharmaceutical compositions are administered depending on the nature of the disease to be treated, in a dosage advantageous to the patient, taking into account the patient's body weight and other factors, as determined by the physician. As mentioned above, the TRAF2-binding protein designated NIK is included among the TRAF2-binding proteins of the invention. Based on our results, according to which the NIK protein specifically binds to TRAF2 proteins and as such can be considered as a protein that modifies / mediates the action of the TRAF2 protein, which is able to modify / mediate the NF-xB-activating effect of the TRAF2 protein, thereby likely playing a role in the cell survival pathways in which the TRAF2 protein acts independently or in cooperation with other proteins (e.g. p55-TNF and p75-TNF receptors, FAS / APO1 receptor, MORT-1, RIP and TRADD proteins), it would be important to develop drugs that can enhance or inhibit the TRAF2-NIK interaction as desired.For example, if it is desired to enhance TNF-induced cellular cytotoxicity, it is preferred to inhibit NF-xB induction by inhibiting the TRAF2-NIK interaction; or specifically, to inhibit TRAF2 proteins and / or NIK protein. Similarly, if it is desired to inhibit TNF-induced cellular cytotoxicity, it is preferred to enhance NF-xB induction by enhancing the TRAF2-NIK interaction; or to enhance TRAF2 protein and / or NIK protein-specific NF-xB induction. There are many diseases known in which such drugs can be of great help in the treatment. Such diseases include (see also those described above) acute hepatitis, which17. In HU 226 328 Β1, acute liver damage appears to be a consequence of FAS / APO1 receptor-mediated destruction of liver cells following induction by Fas ligand; cell death induced by autoimmune processes, such as destruction of β-Langerhans cells in the pancreas, leading to diabetes; cell death during graft rejection (e.g. in kidney, heart or liver transplants); destruction of brain oligodendrocytes in multiple sclerosis; and inhibition of T-cell destruction in AIDS, leading to proliferation of the AIDS virus and thus the development of AIDS. In such cases, it would be advantageous to inhibit FAS / APO1 receptor-mediated cellular cytotoxicity (apoptosis) and enhance FAS / APO1 receptor-mediated NF-κB activation via TRAF2 proteins and TRAF2-NIK interactions. This can be achieved, for example, by increasing the amount of NIK protein in cells, or by increasing the amount of TRAF2 proteins and NIK protein, thereby also increasing NF-κB activation mediated by NIK protein or TRAF2-NIK interactions, ultimately resulting in higher levels of NF-κB activation and acting in the direction of cell survival; or it can be achieved by enhancing direct or indirect interactions between FAS / APO1 receptor and TRAF2 (or TRAF2-NIK), thereby reducing the possibility of interactions between FAS / APO1 receptors and mediators of cellular cytotoxicity (e.g. MACH, see Figure 2B), ultimately resulting in increased NF-κB activation and acting in the direction of cell survival. In contrast, for example in the case of tumors or infected cells (see also above), it would be advantageous to enhance FAS / APO1 receptor-mediated cell cytotoxicity (apoptosis), thereby inducing increased cell death. In this case, preferably, FAS / APO1 receptor-TRAF2 (or-TRAF2NIK) interactions are inhibited; and / or the NIK protein is directly inhibited, thereby reducing the activation of the NF-κB factor. It is possible that the NIK protein or one or more of its possible isoforms, analogs or fragments is a "natural" inhibitor of the NIK protein or the NIK-TRAF2 interaction and as such inhibits NF-κB activation. Such inhibitors can be used in a similar manner to the specific inhibitors mentioned above, for example, such inhibitors can be used when it is desired to enhance the cellular cytotoxic effects of TNF or FAS / APO1 receptor ligand and to achieve increased cell death.Indeed, as the following examples demonstrate, the methods of the invention have isolated a number of NIK analogs and mutants that are kinase-deficient analogs / mutants that are capable of inhibiting NF-κB activation mediated by TNF receptors, FAS / APO1 receptors, and their associated TRADD, RIP, and MORT-1 proteins; IL-1 receptor-mediated activation (which is also mediated by NIK proteins but independent of TRAF2 proteins); and NF-κB induction by bacterial endotoxins (LPS), phorbol myristate acetate, and the HTLV-1 protein TAX. Similarly, other compounds, such as peptides, organic compounds, antibodies, etc., can be screened for drugs that inhibit TRAF2-NIK interactions or NIK protein activity. Similarly, if it is desired to enhance NF-κB activation - for example, in the cases mentioned above, one can proceed by increasing the amount of NIK protein and / or TRAF2 proteins in the cells, using the methods known in the art, as mentioned above (for example, by introducing DNA encoding NIK protein or TRAF2 proteins into cells, thereby enhancing the expression of said proteins; or by preparing appropriate compositions containing NIK protein and / or TRAF2 protein and introducing them directly into cells; or by any method known to those skilled in the art). Similarly, one can screen other compounds, such as peptides, organic compounds, etc., to identify specific drugs that enhance NIK protein activity or TRAF2-NIK interactions. Peptide inhibitors that inhibit NIK-TRAF2 interactions can be designed and screened, for example, but not limited to, ICE peptide inhibitors or ICE-like protease inhibitors and previous studies of ICE substrate specificity, as well as epitope analysis strategies based on peptide synthesis. As mentioned above, for ICE to efficiently cleave a peptide, the minimum requirement is that the peptide contains a defined sequence of four amino acids to the left of the cleavage site, within which aspartic acid is most frequently present at the P1 position, and a methylamine to the right of the P1 position is appropriate [Sleath et al. (1990); Howard et al. (1991); Thornberry et al. (1992)].Furthermore, the fluorogenic substrate peptide (a tetrapeptide) acetyl-Asp-Glu-ValAsp-a-(4-methyl-coumaryl-7-amide), which corresponds to the sequence of poly(ADP-ribose) polymerase (PARP), and is designated by the abbreviation Ac-DEVD-AMC, has been shown to be cleaved in cells shortly after FAS receptor stimulation and during other apoptosis-related processes [Kaufmann: (1989); Kaufmann et al.: (1993); Lazebnik et al.: (1994)], and is efficiently cleaved by CPP32 (a member of the CED3 / ICE protease family) and MACH proteases. Since the presence of Asp at the P1 position of the substrate seems to be essential, tetrapeptides containing Asp at the fourth amino acid position and various combinations of amino acids at the first three positions can be quickly screened for their ability to bind to the active site of proteases; for example, we can proceed according to the procedure developed by Geysen [Geysen: (1985); Geysen et al.: (1987)]; according to the above procedure, a large number of peptides bound to a solid support were screened for their ability to specifically interact with proteases. HU 226 328 Β1 materials. Whether MACH proteases have bound to specific peptides can be detected by detection methods well known to those skilled in the art, for example by using radioactive labeling, etc. With the above method of Geysen, at least 4000 peptides can be tested in a single working day. Similarly, one can identify the actual binding region or homologous region that determines the interaction between TRAF2 and NIK proteins (or any other TRAF protein and TRAF-binding protein) and then screen peptides for their ability to inhibit these interactions, for example, identifying peptides that share sequence similarity with or complement the binding region, thereby competing with the native NIK protein (or TRAF-binding proteins) for binding to TRAF2 proteins (or TRAF proteins). Since it would be advantageous to design peptide inhibitors that selectively inhibit TRAF2-NIK (or TRAF-TRAF-binding protein) interactions without interfering with other intracellular signaling pathways that ultimately lead to cell death, such as the cell death pathways mediated by MACH proteases of the CDE3 / ICE protease family, a mixture of peptides that bind to TRAF2 proteins (or TRAF proteins) or NIK protein (or other TRAF-binding proteins) can be prepared as fluorogenic substrate peptides using assays similar to those described above, and then tested for selective binding to additional proteins to select those that are specific for the TRAF2 / NIK (or TRAF2 / TRAF-binding protein) interaction.For example, peptides specific for the TRAF2 / NIK interaction can then be modified to increase cell permeability and to inhibit TRAF2 and / or NIK proteins reversibly or irreversibly. Thornberry et al. (1994) reported that a tetrapeptide (acyloxy)methyl ketone, Ac-Tyr-Val-Ala-Asp-CH2OC(O)-[2,6(CF3)2]Ph, was a potent inhibitor of ICE protease. Similarly, Milligan et al. (1995) reported that tetrapeptide inhibitors containing chloromethyl ketone or aldehyde groups inhibited ICE protease (the former irreversibly, the latter reversibly). In addition, benzoylcarboxyl-Asp-CH2OC(O)-2,6-dichlorobenzene (DCB) has been shown to inhibit ICE [Mashima et al. (1995)]. Tetrapeptides that selectively bind to TRAF2 proteins or NIK protein as described above can be modified with, for example, aldehyde, chloromethyl ketone, (acyloxy)methyl ketone or CH2OC(O)-DCB groups to provide peptide inhibitors that inhibit TRAF2 / NIK activity.Furthermore, in order to improve permeability, peptides can be chemically modified or their derivatives can be prepared, for example, to enhance the passage of peptides across the cell membrane and to facilitate the transport of such peptides across the membrane into the cytoplasm. Muranishi et al. modified thyrotropin-releasing hormone with lauric acid, thereby obtaining a lipophilic lauryl derivative with improved membrane penetration properties. Zacharia et al. (1991) achieved the enhancement of the transport of peptides across the cell membrane by oxidizing methionine to a sulfoxide and replacing the peptide bond with its ketomethylene isoester (COCH2). The above are only a few of the modifications and derivatives well known to those skilled in the art. Furthermore, drugs or peptide inhibitors that can inhibit the activity of, for example, the NIK protein through inhibition of the NIK-TRAF2 interaction or through inhibition of interactions between other TRAF proteins and TRAF-binding proteins can be conjugated or assembled with molecules that facilitate the entry of said drugs or inhibitors into cells. U.S. Patent No. 5,149,782 describes a method of conjugating molecules to be delivered across cell membranes with membrane blending agents, such as fusion-inducing polypeptides or ion channel-forming polypeptides, other membrane polypeptides, or long-chain fatty acids, such as myristic acid or palmitic acid. These membrane blending agents insert the molecular conjugates into the lipid bilayer of cell membranes and facilitate their entry into the cytoplasm. Low et al., U.S. Patent No. 5,108,921, summarizes available receptor-mediated endocytotic activity-based methods for transporting molecules, such as, but not limited to, proteins and nucleic acids across membranes. Such receptor systems include, for example, galactose, mannose, mannose-6-phosphate, transferrin, asialoglycoprotein, transcobalamin (vitamin B12), α-2-macroglobulins, insulin, and other peptide growth factors, such as epidermal growth factor (EGF).According to Low et al., nutrient receptors, such as biotin or folate receptors, are advantageously used to enhance transport across the cell membrane, since biotin or folate receptors are abundant on the surface of most cell membranes and are associated with receptor-mediated transport processes that facilitate transmembrane transport. Complexes formed by the drug to be delivered into the cytoplasm and a ligand, such as biotin or folate, are therefore brought into contact with the cell membrane bearing the biotin or folate receptors, so that receptor-mediated transmembrane transport mechanisms are initiated and the desired drug enters the cells. ICE protease is known to tolerate non-conservative (“liberal”) substitutions at the P2 position, and this broad substitution potential has been exploited to create an efficient and highly selective affinity tag containing a biotin tag [Thornberry et al. (1994)]. Consequently, HU 226 328 β1 is the P2-position, and presumably the N-terminal end of the tetrapeptide inhibitor can be modified or derivatized, for example by adding a biotin molecule, to enhance the penetration of the above peptide inhibitors across the cell membrane. Furthermore, it is known in the art that a desired peptide sequence can be fused with a leader / signal peptide, thereby obtaining "chimeric peptides", which can be delivered through the cell membrane into the cytoplasm by transport processes. It will be apparent to one skilled in the art of peptides that peptide inhibitors of TRAF / TRAF-binding protein interactions, such as the peptide inhibitors of TRAF-NIK interactions of the invention, also include peptide-like (peptidomimetic) drugs or inhibitors, which can also be rapidly screened, for example, for their ability to bind to TRAF2 / NIK proteins; based on the results obtained, perhaps even more stable inhibitors can be designed. It is further understood that the methods described above for facilitating or enhancing the transport of peptide inhibitors across the cell membrane can also be applied to TRAF-binding proteins, such as NIK protein, analogs, fragments or isoforms thereof, or other peptides and proteins that influence the intracellular effects of the above. As used herein, the term "antibody" includes polyclonal antibodies, monoclonal antibodies (mAbs), chimeric antibodies, and anti-idiotypic (anti-Id) antibodies directed against antibodies, which may be labeled in soluble or bound form; in addition, the term refers to fragments prepared from antibodies by methods known in the art, such as enzymatic cleavage, peptide synthesis techniques, or recombinant techniques. Polyclonal antibodies comprise a heterogeneous population of antibody molecules, such as those obtained from the serum of animals immunized with an antigen. Monoclonal antibodies represent a substantially homogeneous population of antibodies specific for a given antigen, which population of antibodies carries substantially similar epitope binding sites. MAbs can be prepared by methods known to those skilled in the art. See, for example, Kohler and Milstein, Nature 256, 495 (1975); U.S. Patent No. 4,376,110; Harlow and Lane, Antibodies: A Laboratory Manual, eds. Ausubel et al., Cold Spring Harbor Laboratory (1988); and "Current Protocols in Immunology", eds.: Colligan et al., Green Publishing Assoc. and Wiley Interscience NY (1992-1996), the entire contents of which are incorporated herein by reference. Such antibodies may belong to any immunoglobulin class, e.g., IgG, IgM, IgE, IgA, GILD, or any subclass thereof.Hybridomas producing mAbs of the invention can be propagated in vitro, in situ or in vivo. Since high titers of mAb can be achieved in vivo or in situ, they are preferably used to produce antibodies of the invention. Chimeric antibodies are molecules whose parts are derived from different animal species, for example, those whose variable region is derived from a mouse mAb and whose constant region is derived from a human immunoglobulin. Chimeric antibodies are primarily produced with the aim of reducing the immunogenicity of the antibodies during use and / or increasing the efficiency of antibody production; for example, in the case where mouse mAbs can be produced more efficiently in hybridomas but have increased immunogenicity in humans, human / mouse chimeric mAbs are preferably used. Chimeric antibodies and methods for their production are known in the art [Cabilly et al.: Proc. Natl. Acad. Sci. USA 81, 3273 (1984); Morrison et al.: Proc. Natl. Acad. Sci. USA 81, 6851 (1984); Boulianne et al.: Natúré 312, 643 (1984); Cabily et al.: European Publication No. 125 023 (published: 14 November 1984)); Neuberger et al.: Nature 314, 268 (1985); Taniguchi et al.: European Publication No. 171,496 (published February 19, 1985); Morrison et al.: European Publication No. 173,494 (published March 5, 1986); Neuberger et al.: PCT Publication No. WO 8601533 (published March 13, 1986); Kudo et al.: European Publication No. 184,187 (published June 11, 1986); Sahagan et al.: J. Immunol. 137, 1066 (1986); Robinson et al.: International Publication No. WO 8702671 (published May 7, 1987); Liu et al., Proc. Natl. Acad. Sci. USA 84, 3439 (1987); Sun et al., Proc. Natl. Acad. Sci. USA 84, 214 (1987); Better et al., Science 240, 1041 (1988); and Harlow and Lane, “Antibodies: A Laboratory Manual” (supra). The above references are incorporated by reference in their entirety. "Anti-idiotypic antibodies" (anti-Id antibodies) are antibodies that generally recognize unique determinants associated with antigen-binding sites of antibodies. Anti-Id antibodies can be produced by immunizing an animal of the same species and genetic type (e.g., the same mouse strain) as the mAb against which the anti-Id antibody is to be produced. The immunized animal recognizes the idiotypic determinants of the immunizing antibody and responds by producing antibodies (anti-Id antibodies) directed against said idiotypic determinants. See, for example, U.S. Patent No. 4,699,880, which is incorporated herein by reference in its entirety. Anti-Id antibodies can also be used as "immunogens" to elicit an immune response in a further animal, thereby producing so-called anti-anti-Id antibodies. The epitopes of the anti-anti-Id antibodies may be identical to the epitope of the original mAb that elicited the production of the anti-Id. Thus, by using antibodies directed against the idiotype determinants of the mAbs, further clones expressing antibodies with the same specificity can be identified. HU 226 328 B1 As described above, mAbs produced against TRAF binding proteins, analogs, fragments or derivatives thereof (e.g., NIK protein, isoforms, analogs, fragments or derivatives thereof) of the invention can be used to induce the production of anti-Id antibodies in suitable animals, such as BALB / c mice. Spleen cells from such immunized mice can be used to produce anti-Id hybridomas secreting anti-Id mAb antibodies. Furthermore, the anti-Id mAb antibodies can be coupled to a carrier, such as keyhole limpet hemocyanin (KLH), and additional BALB / c mice can be immunized with the resulting molecules. The serum from such mice will contain anti-anti-Id antibodies that have binding properties similar to those of the original mAbs specific for an epitope of the TRAF binding protein, analog, fragment or derivative thereof. Anti-ld mAbs therefore have their own idiotype epitope, or an "idiotope" structurally similar to the epitope under investigation, such as the GRB protein. Antibody also includes intact molecules and fragments thereof, such as Fab or F(ab')2 fragments capable of binding to antigen. Fab and F(ab')2 fragments lack the Fc fragment of intact antibodies, are cleared from the circulation more rapidly, and exhibit less nonspecific tissue binding than intact antibodies [Wahl et al.; J. Nucl. Med. 24, 316(1983)]. It is understood that Fab, F(ab')2 or other fragments of the antibodies of the invention can be used to detect the presence of TRAF binding proteins and to quantify them, according to the methods described for intact antibody molecules. Such fragments are typically prepared by proteolytic cleavage, for example, using papain (to produce Fab fragments) or pepsin (to produce F(ab')2 fragments). An antibody is said to be “capable of binding” to a molecule if it is able to react specifically with that molecule, thereby binding the molecule to the antibody. An “epitope” is a part of a molecule that antibodies can recognize and bind. Epitopes or “antigenic determinants” generally refer to chemically active surface groups of molecules, such as amino acids or sugar side chains, that are characterized by a specific three-dimensional structure and charge. An “antigen” is a molecule or part of a molecule that can be bound by an antibody and that can induce the production of antibodies in an animal that bind to an epitope of the antigen. Antigens can contain one or more epitopes. By specific reaction we mean that the antigen reacts very selectively with the corresponding antibody, but does not react with a large number of other antibodies directed against other antigens. The antibodies of the invention, including fragments thereof, can be used to determine the amount of TRAF-binding proteins (e.g., NIK protein) or to detect their presence in samples; or to detect cells expressing TRAF-binding proteins of the invention. This can be done by immunofluorescence techniques, using antibodies labeled with a fluorescent label, and using light microscopy, flow cytometry, or fluorometry detection methods. The antibodies (or fragments thereof) of the invention can be used in histological procedures, such as immunofluorescence or immunoelectron microscopy, for the in situ detection of TRAF-binding proteins of the invention. In situ detection can be performed by removing a histological sample from a patient and contacting the sample with labeled antibodies of the invention. The antibody (or such fragment) is preferably used by adding or coating the labeled antibody (or antibody fragment) to the biological sample. The above method can detect not only the presence of TRAF-binding proteins, but also their distribution in the tissue under examination. It will be clear to those skilled in the art, having knowledge of the disclosure, that a wide range of histological procedures (e.g., staining procedures) can be modified to be suitable for in situ detection. Detection of TRAF-binding proteins according to the invention is typically carried out by incubating a biological sample, such as a biological fluid, a tissue extract, freshly collected cells, such as lymphocytes or leukocytes, or cells incubated in tissue culture, with detectably labeled antibodies capable of identifying TRAF-binding proteins, and detecting the antibodies by one of the methods well known in the art. The biological sample is contacted with a solid phase support or other carrier, such as nitrocellulose, or other solid support or carrier suitable for immobilizing cells, cell particles, or soluble proteins. The support or carrier is then washed with a suitable buffer and then treated with a detectably labeled antibody according to the methods of the invention, as described above. The solid phase support or carrier is then washed a second time with buffer to remove unbound antibodies. The amount of label bound to the solid support or carrier can then be detected by known methods. By "solid phase support", "solid phase carrier", "solid carrier", "solid carrier", "carrier" or "carrier" is meant a carrier or vehicle capable of binding antigens or antibodies. Well-known carriers or carriers include, for example, glass, polystyrene, polypropylene, polyethylene, dextran, nylon amylases, natural and modified celluloses, polyacrylamides, gabbros, and magnetite. In preferred embodiments of the invention, the carrier may be soluble to some extent or may be insoluble. The carrier material may assume any possible structural configuration, provided that it is HU 226 328 β1 linked molecules are capable of binding antigens or antibodies. The carrier or vehicle may therefore be spherical, for example a bead; cylindrical, for example the inner surface of a test tube; or it may be the outer surface of a stick. Furthermore, the surface may be flat, for example a plate or test strip, etc. According to a preferred embodiment of the invention, polystyrene beads are used as the carrier or vehicle. Other carriers suitable for binding antibodies or antigens are known to the skilled person or can be identified by routine experimentation. The determination of the binding activity of the above antibody preparations of the invention can be carried out according to well-known methods. One skilled in the art is able to develop, through routine experiments, optimal assay conditions for each determination. Additional steps such as washing, mixing, shaking, filtering, and the like may be used during the testing procedures, according to the desired practices and needs of the given situation. In a preferred embodiment of the invention, antibodies can be detectably labeled, for example, by coupling them to an enzyme and using them in an enzyme immunoassay (EIA). This enzyme, in turn, reacts with the substrate upon subsequent contact with a suitable substrate to form a chemical group that can be detected, for example, by spectrophotometric, fluorometric or visual methods. Examples of enzymes that can be used to detectably label antibodies include, but are not limited to, malate dehydrogenase, staphylococcal nuclease, delta-5-steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase and acetylcholinesterase.Detection can be performed by a colorimetric method based on the use of a chromogenic substrate of the enzyme. Detection can also be performed by comparing the intensity of the enzyme reaction resulting in substrate conversion with that of similarly treated standards. Detection can also be performed by other immunoassay methods. For example, by radioactively labeling antibodies or antibody fragments, R-PTPase can be detected by radioimmunoassay (RIA). A detailed description of the RIA method can be found, for example, in the following literature: Work, T. S. et al.: “Laboratory Techniques and Biochemistry in Molecular Biology, North Holland Publishing Company, NY (1978), more specifically in the following chapter: Chard T.: “An Introduction to Radioimmune Assay and Related Techniques”, which is part of the teaching in its entirety. The radioactive isotope can be detected, for example, by a counter, a scintillation counter or autoradiography. In a preferred embodiment of the invention, the antibodies can also be labeled with a fluorescent compound. When antibodies labeled with a fluorescent compound are exposed to light of a suitable wavelength, their presence can be detected by fluorescence. The most commonly used fluorescent labeling compounds include, for example, fluorescent isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthalaldehyde, and fluorescamine. Antibodies can also be detectably labeled with fluorescent metals, such as 152E, or other compounds of the lanthanide series. These metals can be linked to the antibodies using metal chelating groups, such as diethylenetriaminepentaacetic acid (ETPA). In addition, antibodies can be detectably labeled by attaching them to chemiluminescent compounds. The presence of antibodies with a chemiluminescent tag can then be confirmed by detecting the luminescence produced during a chemical reaction. As chemiluminescent marker, one of the following is particularly preferably used: luminol, isoluminol, thermal acridinium ester, imidazole, acridinium salts or oxalate ester. Similarly, a bioluminescent compound can be used to label the antibodies of the invention. Bioluminescence is a manifestation of chemiluminescence in biological systems, in which a catalytic protein enhances the efficiency of the chemiluminescent reaction. The presence of bioluminescent proteins can be detected by the luminescence produced. Important bioluminescent compounds that can be used for labeling include luciferin, luciferase, or aequorin. The antibody molecules of the invention can be modified to be useful in immunometric assays, also known as "two-site" or "sandwich" assays. A typical immunometric assay involves binding an unlabeled antibody (or antibody fragment) to a solid support or vehicle, followed by the addition of detectably labeled antibody to detect the presence and / or amount of a ternary complex formed by the antibody, antigen, and labeled antibody bound to the solid phase. Typically and preferably, a so-called “forward” immunometric procedure is performed, in which the antibody bound to the solid phase is first contacted with the sample to be tested, whereby the antigens are extracted from the sample by forming a binary, solid phase antibody-antigen complex. After an appropriate incubation period, the solid support or vehicle is washed to remove the remainder of the liquid sample, including any unreacted antigens, and then contacted with a solution containing an unknown amount of labeled antibody (which acts as a “reporter molecule” in the reaction). After a second incubation, which allows the labeled antibody to pass through the unlabeled antibody to the antigen bound to the solid support or vehicle22 HU 226 328 Β1, the solid support or vehicle is washed a second time to remove unreacted labeled antibodies. "Sandwich" assays that can also be used to detect antigens according to the invention are the so-called "simultaneous" and "reverse" assays. The "simultaneous" assay is based on the use of a single incubation step, during which antibodies bound to a solid support or vehicle and labeled antibodies are added to the sample to be tested at the same time. After an appropriate incubation period, the solid support or vehicle is washed to remove the remainder of the liquid sample and any remaining, unreacted labeled antibodies. Subsequently, in a manner similar to conventional "forward" sandwich assays, the amount of labeled antibodies bound to the solid support or vehicle is determined. In the “reverse” assays, a solution containing labeled antibody is first added to the liquid sample, and then, after incubation for a suitable period of time, unlabeled antibody bound to a solid support or vehicle is added. After another incubation, the solid phase is washed in the usual way to remove the remainder of the sample to be tested and any unreacted labeled antibodies. The amount of labeled antibodies bound to the solid support or vehicle is then determined in a manner similar to that of the “simultaneous” or “forward” assays. As mentioned above, the invention also provides pharmaceutical compositions comprising recombinant animal viral vectors encoding TRAF-binding proteins, which vectors also encode viral surface proteins capable of binding to proteins found on the surface of specific target cells (e.g. tumor cells), thereby delivering the TRAF-binding protein coding sequences into the cells. In addition, the pharmaceutical compositions of the invention may contain, as active ingredients, for example: (a) oligonucleotide sequences encoding an antisense sequence to the TRAF-binding protein coding sequence; (b) agents inhibiting the TRAF-binding protein-TRAF-protein interaction. The pharmaceutical compositions of the invention contain an amount of the active ingredient sufficient to produce the desired effect. In addition, the pharmaceutical compositions may contain suitable pharmaceutically acceptable carriers known to those skilled in the art, including excipients and other materials which facilitate the formulation of the active ingredients into a composition and which are pharmaceutically acceptable and which stabilize such compositions for administration to the subject to be treated. The expression of TRAF-binding proteins, isoforms and isotypes is likely to differ substantially in different tissues, and the distribution of individual isotypes is likely to differ as well, similar to what we have observed when examining the expression of proteins involved in other intracellular signaling pathways; see the aforementioned, also pending patent applications, also owned by the applicant. These differences presumably contribute to the tissue-specific response of individual tissues to the presence of Fas / APO1 ligand and TNF factor. With respect to other CED3 / ICE homologues [Wang et al. (1994); Alnemri et al. (1995)], it has been previously shown (see the aforementioned patents) that MACH isoforms containing an incomplete CDE3 / ICE region (e.g. MACHa3) inhibit the activity of co-expressed MACHal or MACHal molecules; in addition, they inhibit cell death induced by the FAS / APO1 receptor and p55-R receptors. The expression of such inhibitory isoforms in cells may be part of the cell's self-defense mechanisms against cytotoxicity mediated by FAS / APO1 and TNF.The heterogeneity of MACH isoforms, which greatly exceeds that of other proteases in the CDE3 / ICE family, may provide extremely fine-grained regulation of the function of active MACH isoforms. In a preferred embodiment of the invention, analogs / mutants of a TRAF-binding protein, namely the TRAF2-binding NIK protein, have also been isolated. These NIK analogs / mutants (described above and in the attached examples) inhibit NIK-mediated NF-κB activation, as well as NF-κB activation induced by TNF receptors, FAS / APO1 receptor, proteins associated with the aforementioned, IL-1 receptor and other molecules. As mentioned above, TRAF-binding proteins or their possible isoforms may behave differently in different tissues, with respect to their interaction with TRAF proteins, thereby affecting the activity of TRAF-binding proteins, or with respect to intracellular signaling mediated by TRAF proteins. It is also possible that some TRAF-binding protein isoforms have other functions. For example, NIK protein, some NIK analogs or NIK isoforms may occupy the binding sites of molecules that, for example, FAS / APO1 or TNF receptors, play a role in mediating other non-cytotoxic effects through interaction with TRAF2 protein or independently of TRAF2 proteins. Due to the special properties of FAS / APO1 and TNF receptors, which are capable of inducing cell death, and due to the property of TNF receptors, which are also capable of inducing other tissue-damaging effects, dysfunction of these receptors can be particularly detrimental to the organism. In fact, both excessive and insufficient functioning of these receptors leads to pathological processes manifested in various diseases [Vassalli: (1992); Nagata and Golstein: (1995)]. The identification of molecules involved in the signaling activity of the receptors and the regulation of the activity of these molecules may open up new therapeutic approaches. Considering the presumably essential role that TRAF proteins, such as TRAF2 proteins, and thus the TRAF-TRAF binding protein HU 226 328 β1 interactions, such as TRAF2-NIK interactions, play a role in FAS / AP01 and TNF-mediated NF-κB activation, it seems particularly important to design therapeutic agents that - if we want to induce increased cell death (through inhibition of NF-κB activation) - are able to inhibit TRAF-TRAF binding protein interactions, such as TRAF2NIK interactions; or conversely, if we want to preserve the integrity of cells - are able to enhance the above interactions (thereby enhancing NF-κB activation). The invention also provides other proteins or ligands capable of binding to the TRAF-binding proteins of the invention, which are capable of modifying / mediating the activity of the TRAF-binding proteins by binding. Such proteins or ligands can be screened, isolated and produced according to any of the above methods. For example, a number of novel ligands, e.g. novel proteins, can be isolated that are capable of binding to the NIK protein of the invention (such novel protein / ligand can be any protein / ligand except for the known TRAF2 proteins and presumably I-kB factor, if the NIK protein actually binds to I-kB factor). As described in detail above, such novel TRAF binding proteins / ligands, e.g., NIK binding proteins, can inhibit or enhance, e.g., NIK-mediated activity, or e.g., TRAF2-NIK interaction-mediated activity, and as such, play an essential role in various pathological and other conditions detailed above. Such TRAF binding proteins / ligands can also be used to purify TRAF binding proteins, e.g., by affinity chromatography, which involves coupling the novel binding proteins / ligands to a suitable chromatographic support to provide a solid or affinity support / support through which a solution, extract, or the like containing TRAF binding proteins, e.g., NIK protein, is passed to facilitate purification. Such affinity chromatography methods are well known and are commonly used in the art. Similarly, all of the aforementioned TRAF binding proteins, their analogs, fragments, isoforms or derivatives, can be used to purify TRAF proteins to which they are capable of binding, by affinity chromatography methods. For example, TRAF2 binding proteins, such as the NIK protein, its analogs, fragments or mutants (see the attached examples) can be used to purify TRAF2 protein, by affinity chromatography methods. Proceeding in a manner similar to that described for the NIK protein and its analogs / mutants of the invention (see the attached examples), any other TRAF2 binding protein can be isolated and prepared using the methods already described or other equivalent methods known to those skilled in the art (discussed in detail above).Such TRAF binding proteins, such as TRAF2 binding proteins, can be identified and produced by performing a screening assay in which a TRAF protein (e.g., TRAF2 protein) or at least a portion thereof (e.g., the portion corresponding to amino acid positions 222-501 of the TRAF2 protein) is used as a substrate or "bait" to obtain proteins or other ligands capable of binding thereto; then identifying and characterizing the proteins / ligands thus obtained; finally, preparing the above proteins / ligands in substantially isolated and pure form. These steps are well known to those skilled in the art and are described in detail above and below. We intend to illustrate the solution according to the invention below, through specific implementation examples and the attached figures, without, however, limiting our claim to what has been described. It should be noted that the implementation of the methods listed below and other methods used in the examples have been described in detail in our previous publications in relation to other intracellular signaling proteins and signaling pathways [see, for example, Boldin et al. 1995a, 1995b; and Boldin et al. (1996)]: (a) two-hybrid screening and two-hybrid β-galactosidase expression assay; (b) induced expression, metabolic labeling and immunoprecipitation of proteins; (c) in vitro binding assays; (d) cytotoxicity assays; and (e) Northern blot and sequence analyses. A detailed description of the above methods can also be found in International Publication No. WO 97 / 03998. The cited publications and patent applications are therefore incorporated by reference in their entirety, and at least insofar as the detailed description of the experiments is concerned. The materials and methods used in the experiments are described below. 1. cDNA libraries a) B-cheese-derived cDNA library A human B-cell-derived gene library prepared by chain extension of oligo-dT oligonucleotides was used [Durfee et al. (1993)]. The cDNAs constituting the gene library were inserted into the XhoI site of the pACT-based vector pSE1197, fused to the GAL4 activation domain. b) Testicular cDNA library produced in Lgt10 vector A cDNA library derived from human testis was used. The library was generated by chain extension of random hexanucleotides and contained inserts with an average size of 200-400 base pairs (bp). 2. Yeast strains Two yeast strains were used as hosts in the transformation experiments and screening assays: the HF7c strain was used in the two-hybrid screening assays, and the SFY526 strain was used in the β-galactosidase assays. Both strains carry the auxotrophic markers trp1 and leu, i.e. the aforementioned strains are unable to grow on synthetic minimal medium lacking tryptophan and leucine unless transformed with plasmids carrying the wild-type versions of the above genes (TRP1, LEU2). The two yeasts24 Strain HU 226 328 Β1 carries a deletion in the GAL4 and GAL80 genes (i.e., they contain mutations gal4-542 and gal80-538). Strains SFY526 and HF7c contain the lacZ reporter in their genome; in strain SFY526 it is fused to the UAS and TATA regions of the GAL1 promoter, and in strain HF7c it is fused to three copies of the 17-nucleotide consensus sequence of GAL4 and the TATA region of the CYC1 promoter with lacZ. Both the GAL1-UAS and GAL4 17-nucleotide sequences are sensitive to the GAL4 transcriptional activator. In addition, strain HF7c contains the HIS3 reporter fused to the UAS and TATA regions of the GAL1 promoter. 3. Cloning of human TRAF2 protein The human TRAF2 protein was cloned by PCR from an HL60 cDNA library [for the TRAF2 sequence and further details see Rothe et al. (1994); Rothe et al. (1995a); Cheng et al. (1996); Hsu et al. (1996); and Wallach (1996)]. The following primers were used: a) a 30-nucleotide forward primer: CAGGATCCTCATGGCTGCAGCTAGCGTGAC, which matched the hTRAF2 coding sequence from the first methionine codon (underlined in the sequence) and contained a BamHI site for a coding linker; b) a 32 nucleotide “reverse primer” oligonucleotide: ggtcgacttagagccctgtcaggtccaCAATG, which contained the stop codon of the hTRAF2 gene (indicated by an underline in the sequence), and also contained a SalI restriction site in its linker sequence.The PCR program was performed as follows: first, the DNA was denatured for 2 minutes at 94 °C; then, the following incubation parameters were used for 30 cycles: 1 minute at 94 °C; 1 minute at 64 °C; 1 minute, 40 seconds at 72 °C. The amplified human TRAF2 protein was then inserted between the BamHI-Sall sites of the pGBT7 vector, fused to the GAL4 DNA binding domain. 4. Screening of a B-cell-derived gene library using the two-hybrid method The two-hybrid screening technique is used to identify factors associated with a given molecule, in which the said molecule serves as a "bait" (for further details, see the publications and patent applications cited above). In our experiments, TRAF2 protein cloned into the pGBT9 vector was used as a bait. TRAF2 protein was co-expressed with the filtered B-cell-derived cDNA library in the yeast strain HF7c. The PCR-cloned TRAF2 protein was expressed as a recombinant fusion protein fused to the GAL4 DNA binding domain, and the filtered cDNA library was fused to the GAL4 activation domain in the pSE1107 vector. In the HF7c strain, the HIS3 gene was used as a reporter gene, which was fused to the GAL4 transcriptional activator-responsive activation sequence (UAS) 5' downstream of the GAL1 promoter in the vector.Transformants containing both pGBT9 and pSE1107 plasmids were selected based on growth on plates lacking tryptophan and leucine. In the next step, positive clones expressing two interacting hybrid proteins that activate the GAL1-HIS3 gene were collected from plates lacking tryptophan, leucine and histidine but containing 50 mmol / l 3-aminotriazole (3AT). 5. β-Galactosidase assay procedure Positive clones collected in the two-hybrid screening assay were subjected to the lacZ color reaction test in SFY526 yeast cells according to the instructions in the Clontech Laboratories manual (for further details, see the publications and patent applications cited above). Briefly, transformants were grown for 2-4 days at 30°C until they reached a diameter of approximately 2 mm and were then transferred to Whatman filters. The filters were freeze-dried to increase cell permeability and then soaked in a buffer containing 0.33 mg / ml X-gal substrate and 0.35 mmol / l β-mercaptoethanol with the following composition [16.1 mg / ml Na2HPO4*7 H2O; 5.5 mg / ml NaH2PO4*H2O; 0.75 mg / ml KCl; 0.75 mg / ml MgSO4x7 H2O (pH=7). The colonies were examined for the appearance of a blue color reaction, which color reaction indicated β-galactosidase induction. 6. Expression of cloned cDNAs Two types of expression vectors were used. a) pUHD10-3-based vectors containing the open reading frames (ORFs) of clones 9, 10 or 15 fused to the Hemagglutinin (HA) epitope; b) pUHD10-3-based vectors into which a FLAG octapeptide sequence was inserted immediately preceding the cloned TRAF2 sequence, and which are referred to herein as FLAG / B6 / TRAF2 vectors. Constructs containing the open reading frames of clones 9, 10 or 15 were transfected into HeLa-Bujard cells (for a description of the above cells, see Gossen M. and Bujard M. (1992)), alone or together with the FLAG / B6 / TRAF2 construct, according to a known calcium phosphate precipitation procedure (for a description of the procedure, see, for example, Ausubel FM et al. (eds.): “Current Protocols in Molecular Biology”]. 7. Luciferase assay procedure Typically, 5*10® transfected cells were harvested by washing the cells three times with cold PBS and then suspended in 400 μΙ extraction buffer [0.1 mol / l K2HPO4 / KH2PO4(pH=7.8); 1 mmol / l DTT]. The cells were lysed by freezing and thawing them three times in liquid nitrogen. Cell debris was removed by centrifugation (5 min, 10,000 g). For the luciferase assay, 50 μΙ of lysate was added to 200 μΙ of luciferase buffer [25 mmol / l glycylglycine, 15 mmol / l K2HPO4 / KH2PO4(pH=7.8); 15 mmol / l MgSO4; 4 mmol / l EGTA; 2 mmol / l ATP; 1 mmol / l DDT], and then added to the reaction mixture. EN 226 328 B1 100 μΙ of a solution with the following composition was added: 0.2 mmol / l D-luciferin; 25 mmol / l glycylglycine; 1 mmol / l DTT. Luciferase activity was determined based on the light emission readout using a Lumitron luminometer set to sum light emission measured over 10 seconds (further details in the publications and patent applications cited above). Example 1 Identification of new clones labeled 9, 10, and 15 A B-cell-derived cDNA library was screened for TRAF2-associated proteins using the two-hybrid technique described in Materials and Methods, Section 4. The DNA-binding domain and transcriptional activator domain of GAL4 could only bind in transformants that expressed both TRAF2 and its interacting protein. As a result, the reporter gene, in this case the HIS3 gene fused to the UAS and TATA regions of the GAL1 promoter, was activated and expressed. The screening yielded approximately 2000 clones that were able to grow on Trp, Leu, His, 3AT plates. DNA was isolated from one hundred and sixty-five (165) randomly selected positive clones and transiently transfected into yeast strain SFY526, along with the TRAF2 sequence cloned into the pGBT9 vector. Transformed SFY526 yeast colonies were tested for β-galactosidase activity as described in Section 5 of the Materials and Methods section. A blue color reaction indicated the presence of yeast colonies containing cDNA expressing a protein or polypeptide that binds to TRAF2. The results of the two-hybrid screening assay, the ability of isolated colonies to grow on 3AT plates, and their LacZ gene-containing property, as determined by the color reaction, are summarized in Table 1. Of the positive clones tested, two clones contained cDNA encoding known proteins, namely TRAF2 protein, which is able to self-associate to form homodimers, and lymphotoxin beta receptor, whose intracellular domains have been shown to bind to TRAF2 proteins. Three cloned cDNAs (cDNAs in clones 9, 10, and 15) encoded novel proteins. The positive clones were further tested for the specificity of their binding, i.e., they were tested for interactions with other decoys. As summarized in Table 2, clones 9 and 10 reacted only with TRAF2 and did not bind to any of the other proteins tested. Clone 15 did not bind to MORT1 or the intracellular domains of p55 and p75 TNF receptors, but it bound weakly to Lamin and Cyclin D. In order to better define the region of the TRAF2 molecule that interacts with clones 9, 10 and 15, two additional constructs were generated. One construct contained the N-terminal part of the TRAF2 molecule, corresponding to amino acid positions 1-221, which is the region where the ring finger sequence element and zinc finger elements of the molecule are located. The second construct contained only the C-terminal part of the molecule, corresponding to amino acid positions 222-501, which region overlaps the “TRAF domain” and an additional 42 amino acids. These two constructs were used as “bait” in two-hybrid assays. The results clearly show that while constructs 9, 10 and 15 do not interact with the construct containing the region corresponding to amino acid positions 1-221 of the TRAF2 molecule, all of the aforementioned clones bind with the same efficiency to the construct containing the C-terminal region corresponding to the “TRAF domain” as to the full-length TRAF2 molecule. Table 2 Summary of the results of the two-hybrid screening assay using TRAF2 as a “bait” that led to the identification of clones labeled 9, 10 and 15 Growth on 50 mmol / l 3AT-containing medium Appearance of color reaction (min) Clone name / identifier based on sequence determination Number of clones isolated independently +++ 10 min TRAF2 150 ++ 20 min New clone 9 6 +++ 15 min New clone 10 2 ++++ 10 min Lymphotoxin- beta-receptor 2 + 15 min New clone 15 5 Table 3 Specificity tests (interaction with other “decoys” based on the two-hybrid test) "Bait Clone Clone 9 Clone 10 Clone 15 LAMIN - - + Cyclin-D - - + p75-IC - - - p55-IC - - - M0RT1 - - - TRAF2 +++ +++ +++ Using cDNA clone 10 as a template, we performed a few cycles of PCR, and then, based on the resulting sequence, cloned the full-length cDNA from cDNA libraries prepared from human tissue RNA. The encoded protein was named NIK protein, referring to the protein's “NF-xB-inducing kinase” activity, after it was shown to contain a protein kinase region (see above). Note26 HU 226 328 Β1 It is worth noting that clone 10 was shown during the first analyses (before the identification of NIK protein by PCR technique) to encode a protein that we originally named NMPI protein. The NMPI protein encoded by clone 10 contained conserved sequence elements I–XI, characteristic of Ser / Thr protein kinases. Example 2 Sequencing of new clones Three of the new cDNA clones (clone 9, 10 and 15) were purified, amplified in E. coli and the DNA sequences contained therein were analyzed. All three clones were found to be partial cDNA clones. The total length of clones 9, 10, and 15 was approximately 2000, 2700, and 1300 bp, respectively. The sequence of the sequenced portion of clones 9 and 15 is shown in Figures 3 and 5, and the complete sequence of clone 10 is shown in Figure 4. The complete nucleotide sequence of clone 15, obtained from both the 5' and 3' ends, is shown in Figure 5A; the amino acid sequence deduced from the above sequence is shown in Figure 5B. Clone 15, a partial cDNA clone, encoded a protein of 172 amino acids. Clones 9 and 15 are partial cDNA clones lacking the 5' end of the coding DNA sequence. The deduced amino acid sequences shown in Figures 3B, 4B, and 5B begin at the first nucleotide of each clone. The most thoroughly studied clone 10 (a partial cDNA clone) encodes the NMPI protein containing the aforementioned Ser / Thr protein kinase sequence elements. The full-length cDNA clone obtained by PCR from clone 10 encodes a novel TRAF2-binding kinase, the so-called NIK protein. The complete nucleic acid sequence of NIK and the deduced amino acid sequence are shown in Figure 6, where the ATG start codon starting at nucleotide 232 is underlined and the stop codon starting at nucleotide 3073 is marked with an asterisk. The sequence of the complete sequenced NIK clone shown in Figure 6 is 4596 nucleotides long, within which the NIK coding sequence encodes a protein of 947 amino acids. Database searches revealed that the new amino acid sequence of the NIK protein shows a particularly high degree of homology to a group of kinases, several of which are known to function as MAP kinase kinase kinases. In Figure 7, we compared the sequences of the following proteins: mouse MEKKK (S1); BYR2 (S3); Tpl-2 (S3); Ewing sarcoma oncogene (S4); SS3 (S5); (STE11) (S6); (NPK1) (S7); (BCK1) (S8); and (NIK) (S9). Several of the above kinases were identified based on their oncogenic activity in mutant forms. Example 3 Expression of cloned cDNAs and coimmunoprecipitation with TRAF2 protein HeLa-Bujard cells were transformed with a pUHD10-3 vector-based expression vector encoding FLAG-tagged TRAF2 and constructs containing ORFs from clones 9, 10 or 15 fused to an HA epitope, as described in section 4 of the Materials and Methods section. The cells were then cultured for 24 hours in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum, to which 35S-Methionine and 35S-Cysteine ​​had been added. After incubation, the cells were lysed in radioimmunoprecipitation buffer [10 mmol / l Tris-HCl (pH=7.5); 150 mmol / l NaCl; 1% Nonident-P-40; 1% deoxycholate; 0.1% SDS; and 1 mmol / l EDTA], and the lysate was precleared by incubation with nonspecific rabbit antiserum and Protein-G-Sepharose beads (Pharmacia, Sweden).Immunoprecipitation was performed by incubating the lysate sample with anti-FLAG (Eastman Kodak Co.) or anti-HA [clone 12CA5, Field J. et al. (1988)] monoclonal antibodies for 1 h at 4 °C. The expressed proteins were analyzed by running on SDS-PAGE gels and then by autoradiography. According to the results of the above experiment, cDNA clones 9, 10 and 15 encoded proteins with molecular weights of approximately 50-65, 45 and 26 kDa, respectively. No interaction between clone 15 and TRAF2 protein was detected, but proteins encoded by clones 9 and 10 (NIK) and the full-length NIK protein co-immunoprecipitated with TRAF2 protein. SDS-PAGE analysis of samples of cells co-transfected with the TRAF2-encoding construct and one of the above two clones, immunoprecipitated with anti-FLAG or anti-HA antibodies, revealed three bands in each lane: one band corresponding to proteins encoded by clones 9 or 10, and a double band consisting of proteins with molecular weights of 42 and 44 kDa, respectively, corresponding to TRAF2 protein. Example 4 Functional tests NIK protein was shown to be an NF-κB inducer by gel retardation assay. Typically, 0.5-1*106293-EBNA cells were transfected with 10 pg of pcDNA3 construct containing cDNA from clone 10 (Figure 7, lane 1); 3 pg of pcDNA3 construct containing cDNA encoding p75-TNF receptor (Figure 7, lane 3); or a pcDNA3 construct containing both cDNA from clone 10 (10 pg) and DNA encoding p75-TNF receptor (3 pg) (Figure 7, lane 2). During the transfections, the total amount of DNA was supplemented with “empty” (insert-free) pcDNA3 vector to 15 pg. As a control, 15 pg of pcDNA3 vector HU 226 328 Β1 transfected 293-EBNA cells were used (Figure 7, Lane 4). Cells were cultured in DMEM supplemented with 10% fetal calf serum for 24 hours, then harvested and treated according to the method of Schreiber et al. [Schreiber E. et al. (1989)]. Samples were run on 5% polyacrylamide gels. NF-κB was detected using 32P-radiolabeled oligonucleotide probes corresponding to the NF-κB binding site (the following oligonucleotides were used as probes: GATGCCATTGGGGATTTCCTCTTT and CAGTAAAGAGGAAATCCCCAATGG). According to the results summarized in Table 4, NIK protein induced NF-κB factor even more effectively than TRAF2 protein. In contrast, clone 10 had no such effect at all. The assay procedure based on the detection of reporter gene function was performed as follows: 293-EBNA cells were transfected with a pcDNA3 vector containing the HIV-LTR fused to a luciferase reporter gene and a pcDNA3 plasmid containing the cDNA encoding the p75-TNF receptor; a pcDNA3 plasmid containing the cDNA from clone 10; or a pcDNA3 plasmid containing the DNA encoding the p75-TNF receptor and one of the pcDNA3 plasmids described in Tables 4 and 5. According to the results summarized in Table 5: a) transfection with cDNA corresponding to clone 10 did not activate NF-κB induction, while NIK protein strongly activated it; b) clone 10, as well as a NIK protein in which the lysine in the active site was replaced with alanine (NIK*), strongly inhibited NF-κB induction via the cDNAs listed in the first column of Table 4. Deletion of the 3'-UTR region of NIK (ΝΙΚ-3'UTR) 10 greatly increased its expression, consequently expressing a mutated form with its ability to inhibit NF-κB induction. Table 4 NF-κB activation using NIK protein. Gel retardation assay. Values ​​correspond to counts representing radioactive decay events determined with a phosphoimager plate. Transfected cDNA Number of hits Area (mm2) Empty vector 327 70.7 TRAF2 3411 70.7 NIK 6532 70.7 Clone 10 343 70.7 Table 5 The dominant-negative effect of clone 10 and the NIK K->A mutant, the effect of high-level expression of TRAF2, TRADD, MORT1 / FADD, TNFR-I, TNFR-II proteins, TNFR-l / FAS chimera or RIP protein on NF-κB induction, and the NF-κB activating effect of NIK protein. Luciferase assay NF-κB-inducing protein Empty vector NIK NIK-3-UTR 10th clone NIK* NIK*-3'UTR TRAF2 region corresponding to amino acids 225501 TRAF2 300 1000 25 30 ND TRADD 300 800 1000 100 100 5 ND MORT1 / FADD 300 1000 25 80 90 TNFR-I 200 800 1000 50 100 5 ND TNFR-II 200 750 800 20 90 6 ND FAS-chimera 300 1200 25 50 30 RIP 300 800 75 50 ND NIK 500 100 10 ND TNF 200 80 RelA 1000 ND ND 1000 ND ND ND Example 5 Additional Characteristics of the NIK Protein In addition to the specificity tests described above in Example 2, additional two-hybrid assays performed to determine the binding properties of the NIK protein (data not shown) showed that the first isolated partial NIK clone (NIK 624-947.) specifically binds to the C-terminal region of the TRAF2 protein (C-TRAF domain), while the full-length NIK protein binds to both the C-TRAF domain and a region 5' downstream of it (N-TRAF domain). Furthermore, the NIK protein does not bind to the TRAF3 protein. Furthermore, a chimeric molecule containing the C-TRAF domain of the TRAF2 protein and the N-terminal part of the TRAF3 protein is able to bind to the partial NIK molecule (NIK 624-947.) but is unable to bind to the full-length EN 226 328 B1 to bind to NIK protein, according to which the full-length NIK protein requires the co-presence of the C-TRAF and N-TRAF domains of the TRAF2 protein for binding to the TRAF2 protein. Furthermore, NIK protein does not associate with itself, does not bind to the intracellular domains of p55 or p75 TNF receptors, the CD40 receptor (a member of the TNF / NGF receptor family) or the FAS / APO1 receptor (a CD95 receptor). NIK protein also does not bind to intracellular proteins associated with these receptors, such as TRADD, MORT1 or RIP proteins. The above results are consistent with the data on the binding specificity of the proteins encoded by clones 9, 10 and 15 summarized in Table 2. The interactions between the different receptors and proteins are outlined in Figures 2A and 2B; of these, more detailed relationships are depicted in Figure 2B. Northern blot analysis revealed a single NIK transcript, expressed in varying amounts in different tissues, which is approximately 5000 nucleotides in size, which is essentially the same size as the cloned NIK cDNA (see above and Figure 6). Furthermore, as mentioned above in relation to the protein encoded by clone 10 (originally named NMPI), the full-length NIK protein, similar to several MAP kinase kinase kinases (MAPKKKs), contains a serine / threonine protein kinase sequence element, which is also evident from the sequence alignment shown in Figure 7. In vitro testing of NIK kinase activity showed that the NIK protein can be autophosphorylated, but this does not occur when the active site lysine and the adjacent lysine are replaced with alanine (see the NIK KK429-430AA analog or mutant, whose name refers to the substitution of lysines at positions 429 and 430 with alanines). This is also consistent with the results described in Example 4 and Table 4 for the NIK* mutant. As mentioned above, high-level expression of NIK protein in 293EBNA cells induced NF-κB activity to a greater extent than similar expression of TRAF2 protein, but high-level expression of partial NIK protein (NIK 624-947.) did not lead to NF-κB activation. Furthermore, high-level expression of the aforementioned NIK analog / mutant designated NIK KK429-430AA did not induce NF-κB activation either. Therefore, for NF-κB to be inducible by NIK protein, the kinase function of NIK protein must be intact. In contrast, RIP protein (see Fig. 2A and 2B), which also contains a kinase domain, is able to induce NF-κB activation even if its kinase function is abolished by a mutation. NF-κB activation induced by high levels of NIK protein activation was indistinguishable from activation induced by treatment of cells with TNF or by high levels of TNF or TRAF2 protein expression; NIK-activated NF-κB factor consisted essentially of p50 and p65 components. High-level expression of NIK protein resulted in degradation of ΙκΒα factor, inhibition of the above degradation process with N-acetyl-Leu-Leu-norleucine (ALLN) (similar to TNF factor), led to the accumulation of ΙκΒ molecules migrating more slowly on SDS-PAGE gel, indicating the presence of phosphorylated Ι-κΒα factors. Further studies have shown that NF-κB can be activated in 293-EBNA cells by TNF, p55 or p75 TNF receptors, or by high-level expression of a p55 TNF receptor whose intracellular domain was replaced by the corresponding domain of the FAS / APO1 receptor. NF-κB can also be activated by high levels of TRAF2, TRADD, RIP or MORT1 proteins, but not by a MORT-1 deletion mutant that lacks the region 5' to the MORT-1 "death domain". As shown above, full-length NIK protein induced NF-κB activation, but not NIK mutant NIK KK429-430AA or partial NIK protein (NIK 624-947.). Furthermore, if NIK mutant NIK KK429-430AA or NIK 624-947.When partial NIK protein was co-expressed in 293-EBNA cells with one of the above-mentioned molecules, i.e. the aforementioned receptors or their associated proteins, we found that NF-κB activation otherwise induced by all of the above molecules was inhibited, suggesting that NIK activity plays a direct role in NF-κB induction. Similarly, the inhibition observed with the use of inactive NIK molecules is consistent with a smaller reduction in Ι-κΒ factor. NF-κB can also be activated by IL-1 (see the schematic in Figure 2B). This effect appears to be independent of TRAF2 (IL-1 does not bind to TRAF2 proteins, and the effect of IL-1 is not inhibited by the expression of TRAF2 dominant-negative mutants). However, the above IL-1 effect was inhibited by the expression of NIK mutants. Furthermore, NF-κB activation induced by high levels of p65Rel homologue expression in 293-EBNA cells was not affected by coexpression of kinase-deficient NK mutants, suggesting that NIK protein does not play a direct role in the function of Rel proteins, but is involved in their receptor-induced activation. The cytotoxic activity of TNF (mediated by the MORT-1-associated MACH protease, see Figure 2B) is negatively regulated by NF-κB-inducible genes. The opposing consequences of NF-κB-mediated gene induction and MACH activation may explain how TNF itself and IL-1 confer resistance to TNF cytotoxicity in cells. In line with this, we found that expression of dominant-negative mutants of NIK in 293-EBNA cells significantly increased their sensitivity to TNF cytotoxicity29 In contrast to HU 226 328 Β1, moreover, high-level expression of native (full-length, wild-type) NIK protein inhibited cell death induced by TNF factor or by high-level expression of p55-TNF receptor [the latter receptor contains an intracellular domain carrying a region called “death domain” which, when expressed in cells, can induce cell cytotoxicity in the absence of TNF; see our publications cited above and the patent applications also owned by the applicant, which are also pending], Example 6 Additional functional assays to characterize the biological activity of NIK protein We also found that expression of NIK dominant-negative mutants can also inhibit NF-κB activation induced by other inducing agents in 293EBNA cells, such as: (a) the well-known bacterial endotoxin, lipopolysaccharide (LPS); (b) a well-known phorbol myristate acetate, which is a known protein kinase C activator; and (c) the HTLV-1 protein TAX. Furthermore, expression of dominant-negative mutants of NIK protein in 293-EBNA cells had essentially no effect on TNF-induced Jun kinase activation, indicating that NIK protein specifically and presumably directly enhances the phosphorylation of I-κB factor without affecting MAP kinases involved in Jun phosphorylation. In light of the above, it can be stated that the kinase activity of NIK protein is part of the signaling cascade responsible for NF-κB activation, which cascade is a common continuation of the activation of the two TNF receptors, the FAS / APO1 receptor and the IL-1 receptor. NIK seems to play a specific role in this cascade. The fact that NIK protein binds to TRAF2 protein allows its activity to be influenced by both TNF receptors and FAS / APO1 receptor. In a similar way to the MAP kinase cascades, NIK protein can serve as a substrate for kinases (MAPKKKK) after being recruited by TRAF2 protein to stimulated receptors; NIK protein can phosphorylate and activate additional kinases (or directly induce NF-κB activation by directly phosphorylating the Ι-κΒ factor).IL-1-induced NF-κB activation is independent of TRAF2 proteins, since activation of NIK via IL-1 receptors is presumably mediated by an additional protein called IRAK, a serine / threonine kinase recruited to the IL-1 receptor upon receptor stimulation [Cao et al. (1996b)], and by TRAF6, which can bind to IRAK [see Cao et al. (1996a) and the schematic in Figure 2B]. As mentioned above, the target of NIK, or the target of the cascade of kinases it activates, is likely I-κB. In addition, NIK can phosphorylate TRAF proteins or regulatory proteins that bind to them, such as TANK-I / TRAF [see Cheng and Baltimore (1996); Rothe et al. (1996)], forming binding sites for other proteins. REFERENTIALIST 1. Adelman et al., (1983) DNA 2, 183. 2. Alnemri, ES et al. (1995) J. Biol. Chem. 270, 4312-4317. 3. Ausubel, FM et al. eds., Current Protocols in Molecular Biology. 4. Baeuerle, PA, and Henkel, T. (1994) Annu. Freeze. Immune. 5. Bazan, JF (1993). Current Biology 3, 603-606. 6. Berberich, I., Shu, GL, and Clark, EA (1994). J. Immunol. 153, 4357-66. 7. Beutler, B., and van Huffel, J. (1994). Science 264, 667-8. 8. Blank, V., Kourilsky, P., and Israel, A. (1992). Trends Biochem. Sci 17, 135-40. 9. Boldin, Μ. P. et al. (1995a) J. Bioi. Chem. 270 , 337 – 341 . 10. Boldin, Μ. P., Varfolomeev, EE, Pancer, Z., Mett, IL, Camonis, J. H„ and Wallach, D. (1995b) J. Bioi. Chem. 270, 7795-7798. 11. Boldin, Μ. P. etal. (1996) Cell. 85 , 803 – 815 . 12. Cao, Z. et al. (1996a) Nature 383, 443-446. 13. Cao, Z. etal. (1996b) Science 271, 1128-1131. 14. Chen, CJ et al. (1992) Ann. Ν. Y. Acad. Sci. 660: 271-273. 15. Cheng, G., Cleary, A. M., Ye, Z-s., Hong, D. I., Lederman, S. and Baltimore, D. (1995) Science 267: 1494-1498. 16. Cheng, G. and Baltimore, D. (1996) Genes Dev. 10, 963-973. 17. Chinnalyan, A. M„ O’Rourke, K., Tewari, M., and Dixit, V. M. (1995) Cell 81, 505-512. 18. Creighton, T. E., Proteins: Structure and Molecular Properties, W. H. Freeman & Co., San Francisco, Ca. 1983. 19. Croston, G. E., Cao, Z., and Goeddel, D. V. (1995). J. Bioi. Chem. 270, 16514-7. 20. DiDonato, J. A., Mercurio, F., and Karín, M. (1995). Mól. Cell. Bioi. 15, 1302-11. 21. Durfee, T. etal. (1993) Genes Dev. 7: 555-569. 22. Field, J. et al. (1988) Mól. Cell Bioi. 8: 2159-2165. 23. Geysen, Η. M. (1985) Immunoi. Today 6, 364-369. 24. Geysen, Η. M. et al. (1987) J. Immunoi. Meth. 102, 259-274. 25. Gilmore, T. D., and Morin, P. J. (1993). Trends Génét 9, 427-33. 26. Gossen, M. and Bujard, M. (1992) PNAS 89: 5547-5551. 27. Grell, M., Douni, E., Wajant, H., Lohden, M., Clauss, M., Baxeiner, B., Georgopoulos, S., Lesslauer, W., Kollias, G„ Pfizenmaier, K., and Scheurich, P. (1995).Cell 83, 2003-83. 28. Grilli, M„ Chiu, J. J„ and Lenardo, MJ (1993).Int. Rev. Cytol. 29. Hanks, SK, Quinn, AM, and Hunter, T. (1988). Science 241,42-52. HU 226 328 Β1 30. Howard, AD et al. (1991) J. Immunoi. 147, 2964-2969. 31. Hsu, H., Shu, H.-B., Pan, M.-G., and Goeddel, DV (1996). Cell 84, 299-308. 32. Hsu, K, Xiong, J., and Goeddel, DV (1995). Cell 81,495–504. 33. Kaufmann, SH (1989) Cancer Res. 49, 5870-5878. 34. Kaufmann, SH (1993) Cancer Res. 53, 3976-3985. 35. Lalmanach-Girard, AC, Chiles, TC, Parker, D. C„ and Rothstein, TL (1993).J. Exp. Med. 177, 1215-1219. [ PubMed ] 36. Lazebnik, Y, A. et al. (1994) Nature 371, 346–347 [ PubMed ] 37. Mashima, T. et al. ( 1995 ) Biochem. Biophys. Response. Commun. 209 , 907–9 38. McDonald, PP, Cassatella, MA, Bald, A, Maggi, E, Romagnani, S, Gruss, HJ, and Pizzolo, G. (1995). Eur. J. Immunoi. 25, 2870-6 39. Messing et al., Third Cleveland Symposium on Macromolecules and Recombinant DNA, Ed. A. Walton, Elsevier, Amsterdam (1981). [ PubMed ] 40. Milligan, CE et al. (1995) Neuron 15, 385–393. 41. G. Mosialos, M. Birkenbach, R. Yaramanchili, T. VanArsdale, C. Ware, and E. Kieff. Cell 80, 389–399. 42. Muranishi, S. et al. ( 1991 ) Pharm . Research 8 , 649 . 43. Nagata, S. and Golstein, P. (1995) Science 267, 1449–1456. 44. Rensing-Ehl, A., Hess, S., Ziegler-Heitbrock, HWL, Riethmüller, G., and Engelmann, H. (1995). J. Inlamm. 45, 161-1 Cell 83, 1243-1252, 45. Rothe, M., Pan, MG., Henzel, WJ, Ayres, T. M„ and Goeddel, DV (1995b). 46. ​​Rothe, M., Sarma, V., Dixit, VM, and Goeddel, DV (1995a). Science 269, 1424–1427. 47. Rothe, M., Wong, SC, Henzel, W. J„ and Goeddel, DV (1994).Cell 78, 681-692. [ PubMed ] 48. Rothe, M. et al. ( 1996 ) Proc . Natl. Acad. Sci. U.S.A. 93, 8241–8246. Science 260 , 487 , Google Scholar Crossref , CAS 49. Ruzicka et al. 50. Sambrook et al. (1989) Molecular cloning: a laboratory manual, Cold Spring. Harbor Laboratory Press, Cold Spring Harbor, Ν. Y. Science 258 , 120 . Biotechniques 9, 1378, 52. Sano et al. 53. Schreiber , E , Matthias , P , Muller , Μ . M. and Schaffher , W. ( 1989 ), Nuc. Acids Res. 17 : 6419 . 54. Schulz et al., GE, Principles of Protein Structure, Springer-Verlag, New York, Ν. Y. 1798. [ PubMed ] 55. Sleath, PR et al. (1990) J. Bioi. Chem. Rev. 265, 14526–1 56. Smith, CA, Farrah, T., and Goodwin, RG (1994). Cell 76, 959-962. 57. Stanger, Β. Z. et al. (1995) Cell 81, 513-523. 58. Thornberry, NA et al. (1992) Nature 356, 768-774. 59. Thornberry, NA et al. (1994) Biochemistry 33, 3934-3940. 60. Vandenabeele, P., Declercq, W., Beyaert, R., and Fiers, W. (1995). Trends Cell Bioi. 5, 392-400. 61. Bartholomew, Ε. E., Boldin, Μ. P., Goncharov, Τ. M., and Wallach, D. (1996). J. Exp. Med. in press. 62. Vassalli, P. (1992) Ann. Freeze. Immune. 10, 411-452. 63. Veira et al., (1987) Meth. Enzymol. 153, 3. 64. Wallach, D. (1996) Eur. Cytokine Net. 7, 713-724. 65. Wang, L. et al. (1994) Cell 78, 739-750. 66. Wilks, AF et al. (1989) Proc. Natl. Acad. Sci. USA, 86: 1603-1607. 67. Zacharia, S. et al. (1991) Eur. J. Pharmacol. 203, 353-357. 68. Zhao, JJ and Pick, L. (1993) Nature 365: 448-451. SEQUENTIALIST DATA FOR SEQUENCING IDENTIFICATION NUMBER 1: SEQUENCE CHARACTERISTICS: LENGTH: 1906 base pairs TYPE: nucleic acid HOW MANY STRINGS: one TOPOLOGY: linear MOLECULE TYPE: cDNA DESCRIPTION OF SEQUENCE IDENTIFICATION NUMBER 1: CATTGGGTCA CGCGGTGGCG GCGCTCTAGA ATAGTGGATC CCCCGGGCTG CAGGAATTCG 60 ATTCGAGGCC ACGAAGGCCG GCGGCGCGGC GCANGCACCG GCCCGGGGAN AGGCNCCATG 120 AGCGGATCNC NGAACNATGA CAAAAGACAA TTTCTGCTGG AGCGACTGCT GGATGCAGTG 180 AAACAGTGCC AGATCCGCTT TNGAGGGAGA AAGGAGATTG CCTCGGATTC CGACAGCAGG 240 GTCACCTGTC TGTGTGCCCA GTTTGAAGCC GTCCTGCAGC ATGGCTTGAA GAGGAGTCGA 300 GGATTGGCAC TCACAGCGGC AGCGATCAAG CAGGCAGCGG GCTTTGCCAG CAAACCGAA 360 ACAGAGCCCG TGTTCTGGTA CTACGTGAAG GAGGTCCTCA ACAAGCACGA GCTGCAGCGC 420 TTCTACTCCC TGCGCCACAT CGCCTCAGAC GTGGGCCGGG GTCGCGCCTG GCTGCGCTGT 480 GCCCTCAACG AACACTCCCT GGAGCGCTAC CTGCACATGC TCCTGGCCGA CCGCTGCAGG 540 CTGAGCACTT TTTATGAAGA CTGGTCTTTT GTGATGGATG AAGAAAGGTC CAGTATGCTT 600 HU 226 328 Β1 CCTACCATGG CAGCAGGTCT GAACTCCATA CTCTTTGCGA TTAACATCGA CAACAAGGAT 660 TTGAACGGGC AGAGTAAGTT TGCTCCCACC GTTTCAGACC TCTTAAAGGA GTCAACGCAG 720 AACGTGACCT CCTTGCTGAA GGAGTCCACG CAAGGAGTGA GCAGCCTGTT CAGGGAGATC 780 ACAGCCTCCT CTGCCGTCTC CATCCTCATC AAACCTGAAC AGGACCGA CCCTTGCCTG 840 TCGTGTCCAG GAATGTCAGT GCTGATGCCA AATGCAAAAA GGAGCGGAAG AAGAAAAAGA 900 AAGTGACCAA CATAATCTCA TTTGAATGATG AGGAAGATGA GCAGAACTCT GGGGACGTGT 960 TTAAAAAGAC ACCTGGGGCA GGGGAGAGCT CAGAGGACAA CTCCGACCGC TCCTCTGTCA 1020 ATATCATGTC CGCCTTTGAA AGCCCCTTCG GGCCTAACTC CAATGGAATC AGAGCAGCAA 1080 CTCATGGAAA ATTGATTCCC TGTCTTTGAA CGGGGAGTTT GGGTACCAGA AGCTTGATGT 1140 GAAAAGCATC GATGATGAAG ATGTGGATGA AAACGAAGAT GACGTGTATG GAAACTCATC 1200 AGGAAGGAAG CACAGGGGCC ACTCGGAGTC GCCCGAGAAG CCACTGGAAG GGAACACCTG 1260 CCTCTCCCAG ATGCACAGCT GGGCTCCGCT GAAGGTGCTG CACAATGACT CCGACATCCT 1320 CTTCCCTGTC AGTGGCGTGG GCTCCTACAG CCCAGCAGAT GCCCCCCTCG GAAGCCTGGA 1380 GAACGGGACA GGACCAGAGG ACCACGTTCT CCCGGATCCT GGACTTCGGT ACAGTGTGGA 1440 AGCCAGCTCTCCAGGCCACG GAAGTCCTCT GAGCAGCCTG TTACTTCTGC CTCAGTGCCA 1500 GAGTCCATGA CAATTAGTGA ACTGCGCCAG GCCACTGTGG CCATGATGAA CAGGAAGGAT 1560 GAGCTGGAGG AGGAGAACAG ATCACTGCGA AACCTGCTCG ACGGTGAGAT GGAGCACTCA 1620 GCCGGCCTCC GGCAAGAGGT GGACACCTTG AAAAGGAGG TGGCTGAACA GGAGGAGCGG 1680 CAGGGCATGA AGGTCCAGGC GCTGGCCAGC TATCTTTGCT ATTTTTGTGAG GAGATTCTAA 1740 CCCCACGTGA GAACCATGTG GTGGAGAAAT GGAGGGAGAG AGAAATCCAA CAGTTCCTGA 1800 TAGTCTCATT TGAGCTCCTG GATCCAGTCT TTCCTGAAGC TGTGTTTCCT CTGGACTTTT 1860 CATGTATGTG AGCCAATAAA TTGCTTTCAT TCCTTGAAAA AAAAA 1906 DATA OF SEQUENCE IDENTIFICATION NUMBER 2: SEQUENCE CHARACTERISTICS: LENGTH: 604 base pairs TYPE: amino acid HOW MANY STRINGS: one TOPOLOGY: linear MOLECULAR TYPE: protein DESCRIPTION OF SEQUENCE IDENTIFICATION NUMBER 2: Xaa Thr Gly Pro Gly Xaa Gly Xaa Met Ser Gly Ser Xaa Asn Xaa Asp 1 5 10 15 Lys Arg Gin Phe Leu Leu Glu Arg Leu Leu Asp Ala Val Lys Cys Th 20 25 30 Gin Ile Arg Phe Xaa Gly Arg Lys Arg 4 Ser Gly Ser 4 Asp Cys Leu Cys Ala Gin Phe Glu Ala Val Leu Gin His Gly 50 55 60 Leu Lys Arg Ser Arg Gly Leu Ala Leu Thr Ala Ala Ala Ala Ile Lys Gin 65 70 75 80 Ala Ala Gly Phe Ala Ser Lys Thr Glu Thr Glu Pro Val Phe Trp Val0 Lys Tyr 85 His Glu Leu Gin Arg Phe Tyr Ser 100 105 110 Leu Arg His Ile Ala Ser Asp Val Gly Arg Gly Arg Ala Trp Leu Arg 115 120 125 Cys Ala Leu Asn Glu His Ser Leu Glu Arg Tyr Leu His Met 1 30 1 Leu HU 226 328 Β1 Alá Asp Arg Cys Arg Leu Ser Thr 145 150 Met Asp Glu Glu Arg Ser Ser Met 165 Asn Ser There Is There Is Asn Gin Ser Lys Phe Alá Pro Thr Val 195 200 Gin Asn Val Thr Ser Leu Leu Lys Leu Phe Arg Glu Ile Thr Ala Ser 225 230 Pro Glu Gin Glu Thr Asp Pro Cys 245 Leu Met Pro Asn Alá Lys Arg Ser 260 Thr Xaa Ser His Leu Met Met Arg 275 280 Cys Leu Lys Arg His Leu Gly Gin 290 295 Thr Alá Pro Leu Ser Ile Ser Cys 305 310 Leu Thr Pro Met Glu Ser Glu Gin 325 Val Phe Glu Arg Gly Val Trp Val 340 Arg X X Arg Cys Gly X Lys 355 360 Ile Arg Lys Glu Alá Gin Gly Pro 370 375 Gly Arg Glu His Leu Pro Leu Pro 385 390 Gly Ala Ala Gin Xaa Leu Arg His 405 Leu Leu Gin Pro Ser Arg Cys Pro 420 Arg Thr Arg Gly Pro Arg Ser Pro 435 440 Gly Ser Gin Leu Ser Arg Pro Arg 450 455 Phe Tyr Glu 155 Leu Pro Thr 170 With Asp Asn 185 Dear Asp Leu Glu Ser Thr Being There Val 235 Leu Ser Cys 250 Gly Arg Arg 265 Lys Master Dear Gly Arg Ala Pro Pro Leu 315 Gin Leu Met 330 Pro Glu Alá 345 Arg Arg Xaa Leu Gly Val Asp Alá Gin 395 Pro Leu Pro 410 Pro Arg Lys 425 Gly Ser Trp Lys Ser Ser Asp Trp Ser Phe Val 160 Met Alá Alá Gly Leu 175 Lys Asp Leu Asn Gly 190 Leu Lys Glu Ser Thr 205 Gin Gly Val Ser Ser 220 Ser Ile Leu Ile Lys 240 Pro Gly Met Ser Val 255 Lys Arg Lys Xaa Pro 270 Arg Thr Leu Gly Thr 285 Gin Arg Thr Thr Pro 300 Lys Alá Pro Ser Gly 320 Glu Asn Xaa Phe Pro 335 Xaa Cys Glu Lys His 350 Arg Val Trp Lys Leu 365 Allah Arg Glu Allah Thr 380 Leu Gly Ser Alá Glu 400 Cys Gin Trp Arg Gly 415 Pro Gly Glu Arg Asp 430 Thr Ser Val Gin Cys 445 Glu Gin Pro Val Thr 460 HU 226 328 B1 Ser Ala Ser Val Pro Glu Ser Met Thr Ile Ser Glu Leu Arg Gin Ala 465 470 475 480 Thr Val Ala Met Met Asn Arg Lys Asp Glu Leu Glu Glu Glu Asn Arg 485 490 495 Ser Leu Arg Asn Leu Leu Asp Gly Glu Met Glu His Ser Ala Ala Leu 500 505 510 Arg Gin Glu Val Asp Thr Leu Lys Arg Lys Val Ala Glu Gin Glu Glu 515 520 525 Arg Gin Gly Met Lys Val Gin Ala Leu Ala Ser Tyr Leu Cys Tyr Phe 530 535 540 Val Arg Arg Phe Xaa Pro His Val Arg Thr Met Trp Trp Arg Asn Gly 545 550 555 560 Gly Arg Glu Lys Ser Asn Ser Ser Xaa Xaa Ser His Leu Ser Ser Trp 565 570 575 Ile Gin Ser Phe Leu Lys Leu Cys Phe Leu Trp Thr Phe His Val Cys 580 585 590 Glu Pro Ile Asn Cys Phe His Ser Leu Lys Lys Lys 595,600 DATA OF SEQUENCE IDENTIFICATION NUMBER 3: SEQUENCE CHARACTERISTICS: LENGTH: 2631 base pairs TYPE: nucleic acid HOW MANY STRINGS: one TOPOLOGY: linear MOLECULAR TYPE: cDNA DESCRIPTION OF SEQUENCE IDENTIFICATION NUMBER 3: CCCCTCTCAC AGCCCAGGCC ATCCAAGAGG GGCTGAGGAA AGAGCCCATC CACCGCGTGT 60 CTGCAGCGGA GCTGGGAGGG AAGGTGAACC GGGCACTACA GCAAGTGGGA GGTCTGAAGA 120 GCCCTTGGAG GGGAGAATAT AAAGAACCAA GACATCCACC GCCAAATCAA GCCAATTACC 180 ACCAGACCCT CCATGCCCAG CCGAGAGAGC TTTCGCCAAG GGCCCCAGGG CCCCGGCCAG 240 CTGAGGAGAC AACAGGCAGA GCCCCTAAGC TCCAGCCTCC TCTCCCACCA GAGCCCCCAG 300 AGCCAAACAA GTCTCCTCCC TTGACTTTGA GCAAGGAGGA GTCTGGGATG TGGGAACCCT 360 TACCTCTGTC CTCCCTGGAG CCAGCCCCTG CCAGAAACCC CAGCTCACCA GAGCGGAAAG 420 CAACCGTCCC GGAGCAGGAA CTGCAGCAGC TGGAAATAGA ATTATTCCTC AACAGCCTGT 480 CCCAGCCATT TTCTCTGGAG GAGCAGGAGC AAATTCTCTC GTGCCTCAGC ATCGACAGCC 540 TCTCCCTGTC GGATGACAGT GAGAAGAACC CATCAAAGGC CTCTCAAAGC TCGCGGGACA 600 CCCTGAGCTC AGGCGTACAC TCCTGGAGCA GCCAGGCCGA GGCTCGAAGC TCCAGCTGGA 660 ACATGGTGCT GGCCCGGGGG CGGCCCACCG ACACCCCAAG CTATTTCAAT GGTGTGAAAG 720 TCCAAATACA GTCTCTTAAT GGTGAACACC TGCACATCCG GGAGTTCCAC CGGGTCAAAG 780 TGGGAGACAT CGCCACTGGC ATCAGCAGCC AGATCCCAGC TGCAGCCTTC AGCTTGGTCA 840 CCAAAGACGG GCAGCCTGTT CGCTACGACA TGGAGGTGCC AGACTCGGGC ATCGACCTGC 900 AGTGCACACT GGCCCCTGAT GGCAGCTTCG CCTGGAGCTG GAGGGTCAAG CATGGCCAGC 960 TGGAGAACAG GCCCTAACCC TGCCCTCCAC CGCCGGCTCC ACACTGCCGG AAAGCAGCCT 1020 TCCTGCTCGG TGCACGATGC TGCCCTGAAA ACACAGGCTC AGCCGTTCCC AGGGGATYTG 1080 NCCAGCCCCC CGGCTCARCA GNTGGGAACC AGGGCCTCGN CAGCNAGCNA AGGTNGGGGG 1140 CAAGCNAGAA TGCCTCCCAG GATTTCACAN CCTGAGCCCN TGCCCCANCC CTGCTGAADA 1200 AAACAYTNCC GCCACGTGAA GAGACAGAAG GAGGATGGNC AGGAGTTNNA CCTYGGGGAA 1260 ACAAAACAGG GATCTTTNTT CTGCCCCTGC TCCAGTNCGA GTTGGCCTGN ACCCGCTTGG 1320 ANTCAGTGAC CATTTGTTGG CAGANCAGGG GAGAGCAGCT TCCAGCCTGG GTCAGAAGGG 1380 GTGGGCGAGC CCTTCGGCCC CTCACCCTNC CAGGCTGCTG TGNAGAGTGT CAAGTGTGTA 1440 HU 226 328 Β1 AGGGNCCCAA ANCTCAGGNT TCAGTGCAGA ACCAGGTNCA GCAGGTATGC CCGCCCGNTA 1500 GGTTAANNGG GGGCCCTCTN AAACCCCTTG CCTNGGCCTN CACCTNGGCC AGCTCANCCC 1560 CTTTTGGGTG TAGGGGAAAA GAATGCCTGA CCCTGGGAAG GCTWCCCTGG TAGAATACAC 1620 CACACTTTTC AGGTTGTTGC AACACAGGTC CTGAGTTGAC CTCTGGTTCA GCCAAGGACC 1680 AAAGAAGGTG TGTAAGTGAA GTGGTTCTCA GTNCCCCAGA CATGTGCCCC TTTGCTGCTG 1740 GCTACCACTC TTCCCCAGAG CAGCAGGCCC CGAGCCCCTT CAGGCCCAGC ACTGCCCCAG 1800 ACTCGCTGGC ACTCAGTTCC CTCATCTGTA AAGGTGAAGG GTGATGCAGG ATATGCCTGA 1860 CAGGAACAGT CTGTGGATGG ACATGATCAG TGCTNAAGGN AAAGCAGCAG AGAGAGACGY 1920 TCCGGCGCCC CAGNCCCCAC TNATCAGTGT NCCAGCGTGC TNGGTTNCCC CAGNAGCA 1980 GCTNCAGNCA TCANCACTGA CACTNCACCC TNGCCCTGCC CCTNGGCCAN GAGGGTACTG 2040 CCGNACGGCA CTTTGCACNT CTGATGNACC TCAAAGCACT TTCATGGCTN GCCCTCTNNG 2100 GCAGGGNCAG GGNCAGGGNC AGTGACANCT GTAGGNAGCA TANGCAANGC CAGGAGATGG 2160 GGTGNAAGGG ANCACAGTCT TGAGCTGTCC ANCATGCATG TGACTNCCTC AAACCTCTTN 2220 NCCAGNATTT CTCTAAGAAT AGCANCCCCC TTNCCCCATT GCCCCAGCTT AGCCTCTTCT 2280CCCAGGGGAG CTANCTCAGG ACTCACGTAG CATTAAATCA GCTGTGNAAT CGTCAGGGGG 2340 TGTCTGCTAG CCTCAACCTC CTGGGGCAGG GGACGCCGAG ACTCCGTGGG AGAAGCTCAT 2400 TCCCACATCT TGCCAAGACA GCCTTTNGTC CAGCTGTCCA CATTGAGTCA GACTGCTCCC 2460 GGGGAGAGAG CCCCGGCCCC CAGCACATAA AGAACTGCAG CCTTGGTACT GCAGAGTCTG 2520 GGTTGTAGAG AACTCTTTGT AAGCAATAAA GTTTGGGGTG ATGACAAATG TTAAAAAAAG 2580 GCCTTCGTGG CCTCGAATCA AGCTTATCGA TACCGTCGAC CTCGAGGGGG G 2631 DATA OF SEQUENCE IDENTIFICATION NUMBER 4: SEQUENCE CHARACTERISTICS: LENGTH: 1253 base pairs TYPE: nucleic acid NUMBER OF STRANDS: single TOPOLOGY: linear MOLECULE TYPE: cDNA DESCRIPTION OF SEQUENCE IDENTIFICATION NUMBER 4: CATTGGAGTC ACGCGGTGGC GGCGCTCTAG AATAGTGGAT CCCCGGGCTG CANGGAATTC 60 GATTCGAGCC CACGAAGGCC CCTTCTTCTG TGGTCGCGGC ACGTTTACAG CCGCAAGCAC 120 CCAGCGGCAG CTGAAGGAGACCAG CAGTCGAGCCG CAGTTGAGCTT 180 GGCCATCCGC GCCGCTCAGG TGGAGCGCTA TGTGCCCGAA CACGAGCGAT GCTGGCTGGTG 240 CCTGTGCTGC GGCTGTGAGG TGCGGGAACA CCTGAGCCAT GGAAACCTGA CGGTGCTGTA 300 CGGCCTC TGGAGGGCCAGCAG AAAGCAACCA ACAAATTCTG 360 GTGGGAGAAC AAAGCTGAGG TCCAGATGAA AGAGAGTTT CTGGTCACTC CCCAGGATTA 420 TGCCGATTC AAGAAATCCA TGGTGAAAGG TTTGGATTCC TATGAAGAGAA AGAGAGAT AGGA8GGATA CTCAGATCCG TGAGGTGGAG CAGAGCCGAC AGGAGGTGGT 540 TCGGTCTGTC TTAGAGCCTC AGGCAGTGCC AGACCCAGAA GAGGGCTCTT CAGCACCTAG 600 AAGCTGGAAA GGGATGAACA GCCAAGTAGC TTGCCAGCT6CAGCAA CAGCAA GCTCCAGAGC TTGACTGGAT GGAGACAGGA CCATCTCTGA CATTCATTGG 720 CCATCAGGAT ATACCAGGAG TTGGTAACAT CCACTCAGGT GCCACACCTC CCTGGATGAT 780 CCAAGATGAA GAATACATTAGAA CTGATCATTTGAACCA GAAAAAAG GAAAAACAGAAGTTGAAAAA ACTCCCCCCA GACCGAGTTG GGGCCAACTT 900 TGATCACAGC TCCAGGACCA GTGCAGGCTG GCTGCCCTCT TTTGGGCCGC GTCTGGAATA 960 ATGGACGCCG CTGGCAGTCC AGACATCAAC TCCAAAACTG AAGCTGCAGC AATGAAGAAG 1020 CAGTCACATA CAGAAAAAAG CTAATCATGC TCTCTACCAA CTACCATGAG GCTAAAAGCC 1080 AAAGTCAAAC AAACCCCTAT TATACCTTCC ACCCAAATTC TTTATCATTG TCTTTCTTAG 1140 GAAACAGACA TACTCATTCA TTTGATTTAA TAAAGTTTTA TTTTTCGGCC TTCGTGGCCT 1200 CGAATCAAGC TTATCGATAC CGTCGACCTC GAGGGGGGGC CGTACCCACT TTT 1253 DATA OF SEQUENCE IDENTIFICATION NUMBER 5: SEQUENCE CHARACTERISTICS: LENGTH: 417 base pairs TYPE: amino acid NUMBER OF STRANDS: one TOPOLOGY: linear MOLECULE TYPE: protein EN 226 328 B1 DESCRIPTION OF SEQUENCE IDENTIFICATION NUMBER 5: Ile Gly Val Thr Arg Trp Arg Arg 1 5 Ala Xaa Asn Ser Ile Arg Ala His 20 Gly Thr Phe Thr Ala Ala Ser Thr 35 40 Glu Arg Leu Leu Pro Gin Val Glu 50 55 Under Gin Val Glu Arg Tyr Val Pro 65 70 Leu Cys Cys Gly Cys Glu Val Arg 85 Thr Val Leu Tyr Gly Gly Leu Leu 100 Lys Lys Ala Thr Asn Lys Phe Trp 115 120 Met Lys Glu Lys Phe Leu Val Thr 130 135 Lys Ser Met Val Lys Gly Leu Asp 145 150 Val Ile Lys Glu Met Ala Ala Gin 165 Gin Glu Val Val Arg Ser Val Leu 180 Glu Glu Gly Ser Ser Wing Pro Arg 195 200 Val Alá Ser Ser Leu Gin Gin Pro 210 215 Pro Glu Leu Asp Trp Met Glu Thr 225 230 His Gin Asp Ile Pro Gly Val Gly 245 Pro Trp Met Ile Gin Asp Glu Glu 260 Gly Pro Ser Tyr Glu Glu Phe Leu 275 280 Lys Lys Leu Pro Pro Asp Arg Val 290 295 Ser Arg Ile Val Asp Pro Arg Ala 15 Glu Gly Pro Phe Phe Cys Gly Arg 25 30 Gin Arg Gin Leu Lys Glu Alá Phe 45 Ala Ala Arg Lys Ala Ile Arg Ala 60 Glu His Glu Arg Cys Cys Trp Cys 75 80 Glu His Leu Ser His Gly Asn Leu 90 95 Glu His Leu Allah Ser Pro Glu His 105 110 Trp Glu Asn Lys Alá Glu Val Gin 125 Pro Gin Asp Tyr Allah Arg Phe Lys 140 Ser Tyr Glu Glu Lys Glu Asp Lys 155 160 Ile Arg Glu Val Glu Gin Ser Arg 170 175 Glu Pro Gin Allah Val Pro Asp Pro 185 190 Ser Trp Lys Gly Met Asn Ser Gin 205 Ser Asn Leu Asp Leu Pro Pro Alá 220 Gly Pro Ser Leu Thr Phe Ile Gly 235 240 Asn Ile His Ser Gly Allah Thr Pro 250 255 Tyr Ile Allah Gly Asn Gin Glu Ile 265 270 Lys Glu Lys Glu Lys Gin Lys Leu 285 Gly Alá Asn Phe Asp His Ser Ser 300 HU 226 328 B1 Arg Thr Ser Alá Gly Trp Leu Pro Ser Phe Gly Pro Arg Leu Glu Xaa 305 310 315 320 Trp Thr Pro Leu Alá Val Gin Thr Ser Thr Pro Lys Leu Lys Leu Gin 325 330 335 Gin Xaa Arg Ser Ser His Ile Gin Lys Lys Allah Asn His Allah Leu Tyr 340 345 350 Gin Leu Pro Xaa Gly Xaa Lys Pro Lys Ser Thr Lys Pro Leu Leu Tyr 355 360 365 Leu Pro Pro Lys Phe Phe Ile Ile Val Phe Leu Arg Lys Gin Thr Tyr 370 375 380 Ser Phe Ile Xaa Phe Asn Lys Val Leu Phe Phe Gly Leu Arg Gly Leu 385 390 395 400 Glu Ser Ser Leu Ser Ile Pro Ser Thr Ser Arg Gly Gly Arg Thr His 405 410 415 Phew DATA OF SEQUENCING IDENTIFICATION NUMBER 6: SEQUENCE CHARACTERISTICS: LENGTH: 4596 base pairs TYPE: nucleic acid HOW MANY STRINGS: one TOPOLOGY: linear MOLECULE TYPE: cDNA DESCRIPTION OF SEQUENCE IDENTIFICATION NUMBER 6: AGCGGGGGGA CTGTGCCGTG TGGAACGTGT AGCTGTTGAA GGTGGACTCT GTTACCATTG 60 AGGATGTTTG GAGGATGAGT ATGTGTGGCA GAGGCACACA TAAACAGGCA GAGACCGCGTTT 120 GCCCAGCTGCTT ACCACTCAGCCCA TGGGATTCTA 180 AGTGACCTGC TCTGTGTTTG GTCTCTCTCA GGATGAGCAC AAGCCTGGGA GATGGCAGTG 240 ATGGAAATGG CCTGCCCAGG TGCCCCTGGC TCAGCAGTGG GGCGCAGCAGAA GGAACTGACCGACC AAGGCCAGG0 AAGAAACAGA GCTCCGTCTA CAAGCTTGAG 360 GCCGTGGAGA AGAGCCCTGT GTTCTGCGGA AAGTGGGAGA TCCTGAATGA CGTGATTACC 420 AAGGGCAGCTG CCAAGGAAGG CTCCGAGGTCA GGGCCAGCTG CCATCTGAGCTAT 8 CATCCGAG AGAGTTCAGC CCCACCTTTT CAGAACGCAT TTTCATCGCT 540 GGGTCCAAAC AGTACAGCCA GTCCGAGAGT CTTGATCAGA TCCCCAACAA TGTGGCCCAT 600 GCTACAGAGG GCAAAATGGC CCGTGTGTGT TGGAAGGAGGAA CAAACGTCGCGA6 AGAAGAAGAG CTCAAAGTCC CTGGCTCATG CAGGAGTGGC CTTGGCCAAA 720 CCCCTCCCCA GGACCCCTGA GCAGGAGAGC TGCACCATCC CAGTGCAGGA GGATGAGTCT 780 CCACTCGGCG CCCCCAATGT TAGAAACTCATTGA80CCGAACACTTGA GGCCCTTGGGC AACTCTGTTTTAAGCAGCTT GGCGAGGGCC TACGGCCGGC TCTGCCTCGA 900 TCAGAACTCC ACAAACTGAT CAGCCCCTTG CAATGTCTGA ACCACGTGTG GAAACTGCAC 960 CACCCCCAGG ACGGAGGCCC CCTGCCCCTG CCCACGCACC CCTTCCCCTA TAGCAGACTG 1020 CCTCATCCCT TCCCATTCCA CCCTCTCCAG CCCTGGAAAC CTCACCCTCT GGAGTCCTTC 1080 CTGGGCAAAC TGGCCTGTGT AGACAGCCAG AAACCCTTGC CTGACCCACA CCTGAGCAAA 1140 CTGGCCTGTG TAGACAGTCC AAAGCCCCTG CCTGGCCCAC ACCTGGAGCC CAGCTGCCTG 1200 TCTCGTGGTG CCCATGAGAA GTTTTCTGTG GAGGAATACC TAGTGCATGC TCTGCAAGGC 1260 AGCGTGAGCT CAAGCCAGGC CCACAGCCTG ACCAGCCTGG CCAAGACCTG GGCAGCACGG 1320 GGCTCCAGAT CCCGGGAGCC CAGCCCCAAA ACTGAGGACA ACGAGGGTGT CCTGCTCACT 1380 GAGAAACTCA AGCCAGTGGA TTATGAGTAC CGAGAAGAAG TCCACTGGGC CACGCACCAG 1440 CTCCGCCTGG GCAGAGGCTC CTTCGGAGAG GTGCACAGGA TGGAGGACAA GCAGACTGGC 1500 TTCCAGTGCG CTGTCAAAAA GGTGCGCCTG GAAGTATTTC GGGCAGAGGA GCTGATGGCA 1560 TGTGCAGGAT TGACCTCACC CAGAATTGTC CCTTTGTATG GAGCTGTGAG AGAAGGGCCT 1620 TGGGTCAACA TCTTCATGGA GCTGCTGGAA GGTGGCTCCC TGGGCCAGCT GGTCAAGGAG 1680 HU 226 328 Β1 CAGGGCTGTC TCCCAGAGGA CCGGGCCCTG TACTACCTGG GCCAGGCCCT GGAGGGTCTG 1740 GAATACCTCC ACTCACGAAG GATTCTGCAT GGGGACGTCA AAGCTGACAA CGTGCTCCTG 1800 TCCAGCGATG GGAGCCACGC AGCCCTCTGT GACTTTGGCC ATGCTGTGTG TCTTCAACCT 1860 GATGGCCTGG GAAAGTCCTT GCTCACAGGG GACTACATCC CTGGCACAGA GACCCACATG 1920 GCTCCGGAGG TGGTGCTGGG CAGGAGCTGC GACGCCAAGG TGGATGTCTG GAGCAGCTGC 1980 TGTATGATGC TGCACATGCT CAACGGCTGC CACCCCTGGA CTCAGTTCTT CCGAGGGCCG 2040 CTCTGCCTCA AGATTGCCAG CGAGCCTCCG CCTGTGAGGG AGATCCCAC CTCCTGCGCC 2100 CCTCTCACAG CCCAGGCCAT CCAAGAGGGG CTGAGGAAAG AGCCCATCCA CCGCGTGTCT 2160 GCAGCGGAGC TGGGAGGGA GGTGAACCGG GCACTACAGC AAGTGGGAGG TCTGAAGAGC 2220 CCTTGGAGGG REQUIREMENTS CATCCACCGC CAAATCAAGC CAATTACCAC 2280. CCTTGGAGGG CAGACCCTCC ATGCCCAGCC GAGAGAGCTT TCGCCAAGGG CCCCAGGGCC CCGGCCAGCT 2340 TOTAL CAGGCAGAGC CCCTAAGTC CAGCCTCCTC TCCCACCAGA GCCCCCAGAG 2400 CCAAACAAGT CTCCTCCCTT GACTTTGAGC AAGGAGGAGT CTGGGATGTG GGAACCCTTTA 2460 CCTCTGTCCT CCCTGGAGCC AGCCCCTGCC AGAAACCCCA GCTCACCAGA GCGGAAAGCA 2520 ACCGTCCCGG AGCAGGAACT GCAGCAGCTG GAATAGAAT TATTCCTCAA CAGCCTGTCC 2580 CAGCCATTTT CTCTGGAGGA GCAGGAGCAA ATTCTCTCGT GCCTCAGCAT CGACAGCCTC 2640 TCCCTGTCGG ATGACAGTGA GAAGAACCCA TCAAAGGCCT CTCAAAGCTC GCGGGACACC 2700 CTGAGCTCAG GCGTACACTC CTGGAGCAGC CAGGCCGAGG CTCGAAGCTC CAGCTGGAAC 2760 ATGGTGCTGG CCCGGGGGCG GCCCACCGAC ACCCAAGCT ATTTCAATGG TGTGAAAGTC 2820 CAAATACAGT CTCTTAATGG TGAACACCTG CACATCCGGG AGTTCCACCG GGTCAAAGTG 2880 GGAGACATCG CCACTGGCAT CAGCAGCCAG ATCCCAGCTG CAGCCTTCAG CTTGGTCACC 2940 AAAGACGGGC AGCCTGTTCG CTACGACATG GAGGTGCCAG ACTCGGGCAT CGACCTGCAG 3000 TGCACACTGG CCCCTGATGG CAGCTTCGCC TGGAGCTGGA GGGTCAAGCA TGGCCAGCTG 3060 GAGAACAGGC CCTAACCCTG CCCTCCACCG CCGGCTCCAC ACTGCCGGAA AGCAGCCTTC 3120 CTGCTCGGTG CACGATGCTG CCCTGAAAAC ACAGGCTCAG CCGTTCCCAG GGGATTGCCA 3180 GCCCCCCGGC TCACAGTGGG AACCAGGGCC TCGCAGCAGC AAGGTGGGGG CAAGCAGAAT 3240 GCCTCCCAGG ATTTCACACC TGAGCCCTGC CCCACCCTGC TGAAAAAAA TCCGCCACGT 3300 GAAGAGACAG AAGGAGGATG GCAGGAGTTA CCTGGGGAAA CAAAACAGGG ATCTTTTTCT 3360 GCCCCTGCTC CAGTCGAGTT GGCCTGACCC GCTTGGATCA GTGACCATTT GTTGGCAGAC 3420 AGGGGAGAGC AGCTTCCAGC CTGGGTCAGA AGGGGTGGGC GAGCCCTTCG GCCCCTCACC 3480 CTCCAGGCTG CTGTGAGAGT GTCAAGTGTG TAAGGGCCCA AACTCAGGTT CAGTGCAGAA 3540 CCAGGTCAGC AGGTATGCCC GCCCGTAGGT TAAGGGGGCC CTCTAAACCC CTTGCCTGGC 3600 CTCACCTGGC CAGCTCACCC CTTTTGGGTG TAGGGGAAA GAATGCCTGA CCCTGGGAAG 3660 GCTCCCTGGT AGAATACACC ACACTTTTCCA GGTTGTTGCA ACACAGGTCC TGAGTTGACC 3720 TCTGGTTCAG CCAAGGACCA AAGAAGGTGT GTAAGTGAAG TGGTTCTCAG TCCCCAGACA 3780 TGTGCCCCTT TGCTGCTGGC TACCACTCTT CCCCAGAGCA GCAGGCCCCG AGCCCCTTCA 3840 GGCCCAGCAC TGCCCCAGAC TCGCTGGCAC TCAGTTCCCT CATCTGTAAA GGTGAAGGGT 3900 GATGCAGGAT ATGCCTGACA GGAACAGTCT GTGGATGGAC ATGATCAGTG CTAAGGAAAG 3960 CAGCAGAGAG AGACGTCCGG CGCCCCAGCC CCACTATCAG TGTCCAGCGT GCTGGTTCCC 4020 CAGGCACAG CTCAGCATCA CACTGACACT CACCCTGCCC TGCCCCTGGC CAGAGGTAC 4080 TGCCGACGGC ACTTTGCACT CTGATGACCT CAAAGCACTT TCATGGCTGC CCTCTGGCAG 4140 GGCAGGGCAG GGCAGTGACA CTGTAGGAGC ATAGCAAGCC AGGAGGG GTGAAGGGAC 4200 ACAGTCTTGA GCTGTCCACA TGCATGTGAC TCCTCAAACC TCTTCCAGAT TTCTCTAAGA 4260 ATAGCACCCC CTTCCCCATT GCCCCAGCTT AGCCTCTTCT CCCAGGGGAG CTACTCAGGA 4320 CTCACGTAGC ATTAAATCAG CTGTGAATCG TCAGGGGGTG TCTGCTAGCC TCAACCTCCT 4380 GGGGCAGGGG ACGCCGAGAC TCCGTGGGAG AAGCTCATTC CCACATCTTG CCAAGACAGC 4440 CTTTGTCCAG CTGTCCACAT TGAGTCAGAC TGCTCCCGGG GAGAGCCC CGGCCCCCAG 4500. CACATAAAGA ACTGCAGCCT TGGTACTGCA GAGTCTGGGT TGTAGAAC TCTTTGTAAG 4560 CAATAAAGTT TGGGGTGATG ACAAATGTTA AAAAAA 45 96 DATA OF SEQUENCING IDENTIFICATION NUMBER 7: SEQUENCE CHARACTERISTICS: LENGTH: 947 base pairs TYPE: amino acid HOW MANY STRINGS: one TOPOLOGY: linear MOLECULAR: protein HU 226 328 B1 DESCRIPTION OF SEQUENCE IDENTIFICATION NUMBER 7: Met Low Val Met Glu Met Low Cys Pro Gly Low Pro Gly Ser Low Val 15 10 15 Gly Gin Gin Lys Glu Leu Pro Lys Pro Lys Glu Lys Thr Pro Pro Leu 20 25 30 Gly Lys Lys Gin Ser Ser Val Tyr Lys Leu Glu Under Val Glu Lys Ser 35 40 45 Pro Val Phe Cys Gly Lys Trp Glu Ile Leu Asn Asp Val Ile Thr Lys 50 55 60 Gly Thr Ala Lys Glu Gly Ser Glu Ala Gly Pro Ala Ala Ile Ser Ile 65 70 75 80 Ile Below Gin Below Glu Cys Glu Asn Ser Gin Glu Phe Ser Pro Thr Phe 85 90 95 Ser Glu Arg Ile Phe Ile Under Gly Ser Lys Gin Tyr Ser Gin Ser Glu 100 105 110 Ser Leu Asp Gin Ile Pro Asn Asn Val Ala His Ala Thr Glu Gly Lys 115 120 125 Met Ala Arg Val Cys Trp Lys Gly Lys Arg Arg Ser Lys Ala Arg Lys 130 135 140 Lys Arg Lys Lys Lys Be Be Lys Be Leu Ala His Ala Gly Val Ala 145 150 155 160 Leu Alá Lys Pro Leu Pro Arg Thr Pro Glu Gin Glu Ser Cys Thr Ile 165 170 175 Pro Val Gin Glu Asp Glu Ser Pro Leu Gly Ala Pro Tyr Val Arg Asn 180 185 190 Thr Pro Gin Phe Thr Lys Pro Leu Lys Glu Pro Gly Leu Gly Gin Leu 195 200 205 Cys Phe Lys Gin Leu Gly Glu Gly Leu Arg Pro Ala Leu Pro Arg Ser 210 215 220 Glu Leu His Lys Leu Ile Ser Pro Leu Gin Cys Leu Asn His Val Trp 225 230 235 240 Lys Leu His His Pro Gin Asp Gly Gly Pro Leu Pro Leu Pro Thr His 245 250 255 Pro Phe Pro Tyr Ser Arg Leu Pro His Pro Phe Pro Phe His Pro Leu 260 265 270 Gin Pro Trp Lys Pro His Pro Leu Glu Ser Phe Leu Gly Lys Leu Allah 275 280 285 Cys Val Asp Ser Gin Lys Pro Leu Pro Asp Pro His Leu Ser Lys Leu 290 295 300 HU 226 328 B1 Allah Cys Val Asp Ser Pro Lys Pro Leu Pro Gly Pro His Leu Glu Pro 305 310 315 320 Ser Cys Leu Ser Arg Gly Allah His Glu Lys Phe Ser Val Glu Glu Tyr 325 330 335 Leu Val His Alá Leu Gin Gly Ser Val Ser Ser Ser Gin Alá His Ser 340 345 350 Leu Thr Ser Leu Allah Lys Thr Trp Allah Allah Arg Gly Ser Arg Ser Arg 355 360 365 Glu Pro Ser Pro Lys Thr Glu Asp Asn Glu Gly Val Leu Leu Thr Glu 370 375 380 Lys Leu Lys Pro Val Asp Tyr Glu Tyr Arg Glu Glu Val His Trp Allah 385 390 395 400 Thr His Gin Leu Arg Leu Gly Arg Gly Ser Phe Gly Glu Val His Arg 405 410 415 Met Glu Asp Lys Gin Thr Gly Phe Gin Cys Allah Val Lys Lys Val Arg 420 425 430 Leu Glu Val Phe Arg Allah Glu Glu Leu Met Allah Cys Allah Gly Leu Thr 435 440 445 Ser Pro Arg Ile Val Pro Leu Tyr Gly Allah Val Arg Glu Gly Pro Trp 450 455 460 Val Asn Ile Phe Met Glu Leu Leu Glu Gly Gly Ser Leu Gly Gin Leu 465 470 475 480 Val Lys Glu Gin Gly Cys Leu Pro Glu Asp Arg Allah Leu Tyr Tyr Leu 485 490 495 Gly Gin Allah Leu Glu Gly Leu Glu Tyr Leu His Ser Arg Arg Ile Leu 500 505 510 His Gly Asp Val Lys Alá Asp Asn Val Leu Leu Ser Ser Asp Gly Ser 515 520 525 His Alá Alá Leu Cys Asp Phe Gly His Alá Val Cys Leu Gin Pro Asp 530 535 540 Gly Leu Gly Lys Ser Leu Leu Thr Gly Asp Tyr Ile Pro Gly Thr Glu 545 550 555 560 Thr His Met Alá Pro Glu Val Val Leu Gly Arg Ser Cys Asp Alá Lys 565 570 575 Val Asp Val Trp Ser Ser Cys Cys Met Met Leu His Met Leu Asn Gly 580 585 590 Cys His Pro Trp Thr Gin Phe Phe Arg Gly Pro Leu Cys Leu Lys Ile 595 600 605 Ala Ser Glu Pro Pro Pro Val Arg Glu Ile Pro Pro Ser Cys Ala Pro 610 615 620 HU 226 328 B1 Leu Thr Ala Gin Ala Ile Gin Glu Gly Leu Arg Lys Glu Pro Ile His 625 630 635 640 Arg Val Ser Ala Ala Glu Leu Gly Gly Lys Val Asn Arg Ala Leu Gin 645 650 655 Gin Val Gly Gly Leu Lys Ser Pro Trp Arg Gly Glu Tyr Lys Glu Pro 660 665 670 Arg His Pro Pro Pro Asn Gin Ala Asn Tyr His Gin Thr Leu His Ala 675 680 685 Gin Pro Arg Glu Leu Ser Pro Arg Ala Pro Gly Pro Arg Pro Ala Glu 690 695 700 Glu Thr Thr Gly Arg Ala Pro Lys Leu Gin Pro Pro Leu Pro Glu 705 710 715 720 Pro Pro Glu Pro Asn Lys Ser Pro Pro Leu Thr Leu Ser Lys Glu Glu 725 730 735 Ser Gly Met Trp Glu Pro Leu Pro Leu Ser Ser Leu Glu Pro Ala Pro 740 745 750 Allah Arg Asn Pro Ser Ser Pro Glu Arg Lys Allah Thr Val Pro Glu Gin 755 760 765 Glu Leu Gin Gin Leu Glu Ile Glu Leu Phe Leu Asn Ser Leu Ser Gin 770 775 780 Pro Phe Ser Leu Glu Glu Gin Glu Gin Ile Leu Ser Cys Leu Ser Ile 785 790 795 800 Asp Ser Leu Ser Leu Ser Asp Asp Ser Glu Lys Asn Pro Ser Lys Alá 805 810 815 Ser Gin Ser Ser Arg Asp Thr Leu Ser Ser Gly Val His Ser Trp Ser 820 825 830 Ser Gin Alá Glu Alá Arg Ser Ser Ser Trp Asn Met Val Leu Alá Arg 835 840 845 Gly Arg Pro Thr Asp Thr Pro Ser Tyr Phe Asn Gly Val Lys Val Gin 850 855 860 Ile Gin Ser Leu Asn Gly Glu His Leu His Ile Arg Glu Phe His Arg 865 870 875 880 Val Lys Val Gly Asp Ile Alá Thr Gly Ile Ser Ser Gin Ile Pro Alá 885 890 895 Allah Allah Phe Ser Leu Val Thr Lys Asp Gly Gin Pro Val Arg Tyr Asp 900 905 910 Met Glu Val Pro Asp Ser Gly Ile Asp Leu Gin Cys Thr Leu Under Pro 915 920 925 HU 226 328 B1 Asp Gly Ser Phe Alá Trp Ser Trp Arg Val Lys His Gly Gin Leu Glu 930 935 940 Asn Arg Pro 945 DATA OF SEQUENCE IDENTIFICATION NUMBER 8: SEQUENCE CHARACTERISTICS: LENGTH: 30 base pairs TYPE: nucleic acid HOW MANY STRINGS: one TOPOLOGY: linear MOLECULAR TYPE: other nucleic acid TAG: / desc=“oligonucleotide PCR primer” DESCRIPTION OF SEQUENCE IDENTIFICATION NUMBER 8: CAGGATCCTC ATGGCTGCAG CTAGCGTGAC DATA OF SEQUENCE IDENTIFICATION NUMBER 9: SEQUENCE CHARACTERISTICS: LENGTH: 32 base pairs Type: nucleic acid HOW MANY STRINGS: one TOPOLOGY: linear MOLECULAR TYPE: other nucleic acid TAG: / desc=„oligonucleotide PCR primer DESCRIPTION OF SEQUENCE IDENTIFICATION NUMBER 9: GGTCGACTTA GAGCCCTGTC AGGTCCACAA TG DATA OF SEQUENCE IDENTIFICATION NUMBER 10: SEQUENCE CHARACTERISTICS: LENGTH: 24 base pairs TYPE: nucleic acid NUMBER OF STRANDS: single TOPOLOGY: linear MOLECULAR TYPE: other nucleic acid DESIGNATION: / desc=„oligonucleotide probe” DESCRIPTION OF SEQUENCE IDENTIFICATION NUMBER 10: GATGCCATTG GGGATTTCCT CTTT DATA OF SEQUENCING IDENTIFICATION NUMBER 11: SEQUENCE CHARACTERISTICS: LENGTH: 24 base pairs TYPE: nucleic acid NUMBER OF STRANDS: single TOPOLOGY: linear MOLECULE TYPE: other nucleic acid DESIGNATION: / desc=„oligonucleotide probe” DESCRIPTION OF SEQUENCE IDENTIFICATION NUMBER 11: CAGTAAAGAG GAAATCCCCA ATGG

Claims

PATENT CLAIMS 1. A DNA sequence encoding a NIK protein capable of binding to tumor necrosis factor receptor-associated factor (TRAF), which sequence is 60 (a) the cDNA sequence of clone 10 as defined herein, which comprises the nucleotide sequence shown in Figure 4; (b) the cDNA sequence comprising the nucleotide sequence shown in Figure 6; HU 226 328 Β1 (c) a fragment of the sequence according to (a) or (b) which encodes a biologically active protein capable of binding to the region of TRAF2 comprising at least amino acids 222-501; (d) a DNA sequence capable of hybridizing to the sequence of any one of (a)-(c) under moderately stringent conditions, which encodes a biologically active protein capable of binding to at least the 222-501 region of TRAF2.(e) a DNA sequence that is degenerate relative to any of the sequences according to any of (a)-(d), due to the degeneracy of the genetic code, and that encodes a biologically active protein capable of binding to a region of TRAF2 containing at least amino acids 222-501.

2. The DNA sequence of claim 1, which encodes a NIK protein capable of binding to a TRAF2 molecule.

3. The DNA sequence of claim 1, which encodes a protein capable of modulating NF-κB activity.

4. The DNA sequence of claim 3, which encodes a NIK isoform or analog, which isoform or analog is capable of binding to a TRAF2 molecule and is capable of modulating the activity of NF-κΒ.

5. A vector comprising a DNA sequence according to any one of claims 1-4.

6. The vector of claim 5, which is capable of expression in a eukaryotic host cell.

7. The vector of claim 5, which is capable of expression in a prokaryotic host cell.

8. A transformed eukaryotic or prokaryotic host cell comprising a vector according to any one of claims 5-7.

9. A NIK protein, isoform, fragment, analog or derivative encoded by the DNA sequence of any one of claims 1-4, which is capable of binding to the region of the TRAF2 protein bounded by at least amino acids 222-501.

10. A method for producing a protein, isoform, fragment, analog or derivative according to claim 9, characterized in that the transformed host cells according to claim 8 are cultured under conditions conducive to the expression of the protein, isoform, analog, fragment or derivative; post-translational modification of the protein, isoform, analog, fragment or derivative is optionally allowed; and the expressed protein, isoform, analog, fragment or derivative is then isolated.

11. An antibody, active fragment or derivative thereof, specific for a NIK protein, isoform, analogue, fragment or derivative according to claim 9.

12. A method for isolating and identifying a protein capable of directly binding to TRAF2 according to claim 9, characterized in that a yeast-based two-hybrid method is used, wherein the first hybrid vector carries the sequence encoding TRAF2 and the second hybrid vector carries a sequence derived from a cDNA or genomic DNA gene library, yeast host cells are transformed with the vectors, the positively transformed cells are isolated, and then the second hybrid vector is isolated, thereby obtaining a sequence encoding a protein capable of binding to TRAF2.

13. The method according to claim 12, characterized in that the protein isolated is NIK or an isoform, analog, fragment or derivative thereof.

14. A pharmaceutical composition comprising as active ingredient at least one NIK protein, biologically active fragment, analogue, derivative or mixture thereof according to claim 9.

15. A pharmaceutical composition comprising, as an active ingredient, a protein capable of binding to a cell surface receptor, and a recombinant animal viral vector encoding at least one NIK protein, isoform, active fragment or analogue according to claim 9.

16. A pharmaceutical composition comprising, as an active ingredient, an oligonucleotide sequence encoding an antisense sequence with respect to an mRNA sequence corresponding to the sequence encoding the TRAF2-binding protein according to any one of claims 1-4.

17. A pharmaceutical composition comprising an effective amount of a protein encoded by clone 10 or a DNA sequence encoding the protein and comprising the sequence shown in Figure 4.

18. A method for screening a ligand capable of binding to a protein according to claim 9, characterized in that an affinity chromatography cartridge to which the protein has been attached is contacted with a cell extract, whereby the ligand binds to the cartridge, and the ligand is then eluted, isolated and analyzed.

19. A method for screening a DNA sequence encoding a ligand capable of binding to a protein according to claim 9, characterized in that a yeast-based two-hybrid method is used, wherein the first hybrid vector carries the sequence encoding the protein and the second hybrid vector carries sequences derived from a cDNA or genomic DNA gene library; yeast host cells are transformed with the vectors; the positively transformed cells are isolated; the second hybrid vector is recovered from the clone, and thus the sequence encoding the desired ligand is isolated.

20. Use of at least one NIK protein, biologically active fragment, analog, derivative or mixture thereof according to claim 9 for the preparation of a pharmaceutical composition suitable for modulating an effect on cells modified / mediated by TRAF2 protein.

21. Use of a recombinant animal-derived viral vector encoding a protein capable of binding to a cell surface receptor and at least one NIK protein, isoform, active fragment or analogue according to claim 9, for the preparation of a pharmaceutical composition suitable for modulating an effect on cells modified / mediated by TRAF2 protein.

22. Use of an oligonucleotide sequence encoding an antisense sequence to the mRNA sequence corresponding to the TRAF2-binding protein coding sequence according to any one of claims 1-4, for the preparation of a pharmaceutical composition suitable for modulating an effect on cells modified / mediated by TRAF243 HU 226 328 B1 protein.

23. Use of a NIK protein, isoform, fragment, analogue or derivative thereof according to claim 9, or a DNA molecule encoding any of them, for the manufacture of a pharmaceutical composition suitable for the prevention or treatment of pathological conditions associated with NF-κB induction or any activity mediated by TRAF2 or other activity mediated by a molecule that binds to the protein according to claim 9. a) A region that does not interact with clones 10 (NMP1), 9 and 15 in the 2-hybrid test HU 226 328 Β1 Int. CI.-.C12N 15 / 09 b) a region that interacts with the above clones with the same strength as full-length TRAF2