Modulators of tissue regeneration

Description

EN 226 205 B1 The invention relates to proteins that are upregulated in damaged or regenerating tissues, as well as to DNA encoding these proteins. The invention also relates to therapeutic compositions containing these proteins and their use. Tissue architecture dynamically remodels during development and tissue repair after injury. This process was studied in a model of renal ischemia-reperfusion injury. The kidney is able to repair damage to the epithelium of the proximal renal tubules through a complex series of processes that include cell death, proliferation of surviving epithelial cells of the proximal renal tubules, formation of poorly differentiated regenerative epithelium on the stripped basement membrane, and differentiation of the regenerative epithelium to form epithelial cells that form fully functional proximal renal tubules [Wallin et al., Leg. Invest. 66, 474-484 (1992); Witzgall et al., Mol. Cell. Biol. 13, 1933-1942 (1994); Ichimura et al., Am. J. Physiol. 269, F653-662 (1995); Thadhani et al., N. Engl. J. Med. 334, 1448-1460 (1996)]. Growth factors such as IGF, EGF and HGF, as well as the endothelial cell-derived adhesion molecule ICAM-1, play a role in this repair process. However, the mechanisms by which these epithelial cells in the renal tubules are repaired are still unclear. To identify molecules involved in renal tubular epithelium injury and repair, we analyzed the difference between mRNA populations from injured / regenerating and normal kidneys using representational difference analysis (RDA). RDA is a PCR-based subtractive method that yields target tissue or cell-specific cDNA fragments by repeated subtraction and amplification [Hubánk and Schutz, Nucl. Acids Res. 22, 5640-5648 (1994)]. The invention generally relates to Kidney Injury-related Molecules (hereinafter abbreviated as "KIMs"), which are upregulated in renal tissue following kidney injury. The KIM proteins and peptides of the invention, as well as their agonists and antagonists, and their analogues, are useful in a variety of therapeutic interventions. The invention relates to a purified and isolated DNA molecule comprising the nucleotide sequence of SEQ ID No: 1, SEQ ID No: 2, SEQ ID No: 4 or SEQ ID No: 6. The invention also relates to strands complementary to these sequences, DNA molecules which are capable of hybridizing to the above-mentioned DNA molecules under stringent conditions, and DNA molecules which, due to the degeneracy of the genetic code, would be capable of hybridizing to any of the DNA molecules defined above. These DNA molecules may be recombinant and may be operably linked to an expression control sequence. The invention also relates to a compound having the nucleotide sequence number 1, 2, 4 or 6 (SEQ ID No: 1, SEQ ID No: 2, SEQ ID No: 4 or SEQ ID No: 6) or a vector comprising one of the other DNA molecules defined above. This vector may be a biologically functional plasmid or a viral DNA vector. According to a preferred embodiment of the invention, the invention relates to a prokaryotic or eukaryotic host cell which is stably transformed or transfected with a vector comprising a DNA molecule having nucleotide sequence number 1, 2, 4 or 6 (SEQ ID No: 1, SEQ ID No: 2, SEQ ID No: 4 or SEQ ID No: 6). According to another preferred embodiment of the invention, the invention relates to a method for producing a KIM polypeptide product encoded by the DNA molecule described above; in the method, prokaryotic or eukaryotic host cells transformed or transfected with a DNA molecule are grown under appropriate culture conditions to allow expression of the DNA molecule and to recover the polypeptide product of expression.The purified and isolated human KIM protein is specifically the result of a process for producing a polypeptide product having substantially all or part of the primary structural conformation of the KIM protein and biological activity, substantially free from other human proteins, in accordance with the present invention. The KIM proteins of the present invention may have a sequence comprising sequence numbers 3, 5 or 7 (SEQ ID No: 3, SEQ ID No: 5 or SEQ ID No: 7), or variants of sequences 3, 5 or 7 (SEQ ID No: 3, SEQ ID No: 5 or SEQ ID No: 7), or may be purified and isolated proteins encoded by DNA having sequence numbers 1, 2, 4 or 6 (SEQ ID No: 1, SEQ ID No: 2, SEQ ID No: 4 or SEQ ID No: 6). These proteins can be produced free of other human proteins. Variants of these proteins, such as soluble variants or fusion proteins, are also provided.The KLM fusion proteins of the invention may comprise an immunoglobulin, a toxin, an imageable compound, or a radioactive nuclide. The invention also provides a monoclonal antibody specific for the KIM proteins described above. The anti-KIM antibody may be associated with a toxin, an imageable compound or a radioactive nuclide. The invention also provides a hybridoma cell line producing such a specific antibody. The invention also provides pharmaceutical compositions. The pharmaceutical composition of the invention may comprise a therapeutically effective amount of a KIM protein or anti-KIM antibody of the invention, together with a pharmacologically acceptable carrier. The invention also provides diagnostic methods, for example, for determining the presence of renal injury or the process of absorption by measuring the concentration of KIM in urine, serum or urinary sediment from a patient suffering from renal disease or at risk of developing renal disease. In the treatment methods of the invention, patients are treated with KIM, KIM variants, KIM analogs, KIM fusion proteins, KIM agonists, KIM-specific antibodies, HU 226 205 β1 tek or KIM ligands are treated with a therapeutically effective amount. Other therapeutic compositions of the invention may be KIM ligands, anti-KIM antibodies, and KIM ligand fusion proteins. These compounds may be useful in therapeutic methods that stimulate or inhibit cellular responses dependent on KIM function. Further methods of the invention inhibit the growth of tumor cells expressing KIM by contacting the cells with a fusion protein comprising a KIM ligand and either a toxin or a radioactive nuclide, or an anti-KIM antibody conjugated to a toxin or a radioactive nuclide. Similarly, the growth of tumor cells expressing KIM ligand can be inhibited by contacting the cells with a fusion protein comprising a KIM and either a toxin or a radioactive nuclide, or an antibody specific for an anti-KIM ligand conjugated to a toxin or a radioactive nuclide. The invention also provides gene therapy methods. These include a method for treating a subject with a kidney disorder, a method for promoting the growth of new tissue in a subject, and a method for promoting the survival of damaged tissue in a subject, comprising administering to the subject a vector comprising DNA comprising sequence number 1, 2, 4, or 6 (SEQ ID No: 1, SEQ ID No: 2, SEQ ID No: 4, or SEQ ID No: 6). The compounds of the invention are also useful for imaging tissues either in vitro or in vivo. In such a method, an imageable compound is introduced into a cell expressing a protein having sequence number 3, 5 or 7 (SEQ ID No: 3, SEQ ID No: 5 or SEQ ID No: 7), whereby the cell is contacted with a monoclonal antibody of the invention fused to an imageable compound or a fusion protein comprising the protein as described above. In in vivo methods, the cell is in the subject to be treated, and the protein or monoclonal antibody is administered to the subject. The invention also provides diagnostic methods, for example, a method for identifying damage or regeneration of kidney cells in a subject, wherein the level of expression of a molecule having sequence number 1, 2, 4 or 6 (SEQ ID No: 1, SEQ ID No: 2, SEQ ID No: 4 or SEQ ID No: 6) in kidney cells of a patient is compared to the level of control expression of a molecule having such sequence in control kidney cells. In another method of the invention, upregulation of a molecule having sequence number 1, 2, 4 or 6 (SEQ ID No: 1, SEQ ID No: 2, SEQ ID No: 4 or SEQ ID No: 6) is identified by contacting the cells with an antisense probe and measuring hybridization to RNA in the cell. In a further preferred embodiment of the diagnostic methods of the invention, the presence or concentration of the molecule of the invention in urine, serum or other body fluid or urinary sediment or tissue samples is determined. The measured lesion-related molecule may correlate with the presence, extent or course of a pathological process. This correlation may also be used to assess the effectiveness of a therapeutic treatment. Figure 1 shows the nucleotide sequence of the rat cDNA clone 3-2, with the putative protein reading frame between positions 615 and 1535. Figure 2 shows the nucleotide sequence of cDNA clone 1-7 from rat, with the putative protein reading frame between positions 145 and 1065. Figure 3 shows the nucleotide sequence of cDNA clone 4-7 from rat, with the putative protein reading frame between positions 107 and 1822. Figure 4 shows the nucleotide sequence and deduced amino acid sequence of the human cDNA clone H13-10-85, with the putative protein reading frame between positions 1 and 1002. The top row of the figure is the cDNA sequence (SEQ ID No: 6) and the bottom row is the deduced amino acid sequence (SEQ ID No: 7). Figure 5 shows a BESTFIT comparison of the nucleotide sequences of the human H13-10-85 and rat 3-2 cDNA clones. KIM genes were identified by analyzing differences in mRNA expression between regenerating and normal kidneys using representation difference analysis (RDA). RDA is a PCR-based subtraction method that generates target tissue- or cell-specific cDNA fragments by repeated subtraction and amplification. cDNA representation of RNA from adult rat kidneys 48 hours after ischemia was subtracted from cDNA representation of normal (sham-operated) adult rat kidneys. This procedure removes sequences that are commonly found in both post-ischemic and normal kidney samples, while retaining sequences that are significantly expressed only in injured kidney tissue. Such genes encode proteins that may have therapeutic benefits in renal disorders or play a role in the damage process. We obtained, sequenced, and characterized numerous clones.We then examined the expression pattern of clones during kidney healing, development, and tissue distribution using Northern analysis and RNA in situ hybridization. Sequence identification numbers (SEQ ID No) The following sequence identification numbers are used throughout this specification to identify nucleotide and amino acid sequences: SEQ ID No: 1 - nucleotide sequence of the 3-2 cDNA insert from rat; SEQ ID No: 2 - nucleotide sequence of the 3-2 cDNA insert from rat. EN 226 205 B1 SEQ ID No: 3 - amino acid sequence of rat KIM-1 encoded by rat cDNAs 3-2 and 1-7. SEQ ID No: 4 - nucleotide sequence of the 3-2 cDNA insert from rat. SEQ ID No: 5 - Amino acid sequence encoded by cDNA insert 4-7. SEQ ID No: 6 - nucleotide sequence of human H13-10-85 cDNA insert. SEQ ID No: 7 - Amino acid sequence encoded by human cDNA clone H13-10-85. A “KIM protein” (used synonymously herein as “KIM”) is a protein whose mRNA encoding it is selectively upregulated following renal injury. A group of KIM proteins in question is encoded by mRNA that is selectively upregulated within a week of any injury that causes damage to renal tissue. Such upregulation can be identified, for example, at 10 hours, 24 hours, 48 ​​hours, or 96 hours after injury. The types of injury may include, for example, ischemic, toxic, or other types of injury. A "KIM agonist" is a molecule that is capable of specifically triggering a cellular response through the interaction between KIM and KIM ligand. A KIM agonist can be a KIM variant or an antibody specific for KIM, or a soluble form of the KIM ligand. A “KIM antagonist” is a molecule that is capable of specifically associating with a KIM ligand or KIM, thereby blocking or otherwise inhibiting KIM from binding to the KIM ligand. Binding of the antagonist blocks or inhibits cellular responses that would otherwise be activated by ligation between the KIM ligand and the KIM or KIM agonist. Examples of KIM antagonists include certain KIM variants, KIM fusion proteins, and antibodies specific for the KIM ligand or KIM. A “KIM ligand” can be any molecule that is capable of non-covalently and specifically binding to a KIM protein. Such a ligand can be a protein, peptide, steroid, antibody, amino acid derivative or other type of molecule, in any form, e.g., naturally occurring, recombinantly produced or otherwise synthetically produced. A KIM ligand can be in any form, e.g., soluble, membrane bound, or part of a fusion construct formed with an immunoglobulin, fatty acid or other group. A KIM ligand can be an integrin. A membrane bound KIM ligand can act as a receptor that, when bound to or associated with KIM, initiates a cellular response. In some interactions, a KIM can associate with more than one KIM ligand or can associate with a KIM ligand that is part of a complex formed with one or more other molecules or cofactors.In situations where both KIM and KIM ligand are bound to cell membranes, KIM may associate or react with a KIM ligand that is bound to the same cell as KIM, or it may associate or react with a KIM ligand that is bound to a second cell. When KIM ligation occurs between molecules bound to different cells, the two cells may be the same or different in terms of their cellular type or origin, their phenotype or metabolic state, or the type or degree of cellular response to a given stimulus (e.g., growth, differentiation, or apoptosis). The term “KIM ligation” refers to the contact and binding between KIM and KIM ligand. The term "sequence alignment" refers to the placement of one sequence (either nucleotide or amino acid) under another, allowing comparison of the region of interest in one sequence with the region of interest in the other. An example of this method is the method of Needleman et al. [J. Mol. Biol. 48, 443-453 (1970)]. The method can be conveniently carried out using a computer program, for example the "Align program" (DNAstar, Inc.). One skilled in the art will appreciate that homologous or functionally equivalent sequences contain cysteines arranged in a functionally equivalent manner in a conserved cysteine ​​framework, including amino acid insertions or deletions that alter the linear arrangement of these cysteines but do not substantially affect their relative position in the conformational protein structure.Therefore, internal gaps and amino acid insertions in the test sequence are ignored when the procedure is performed to calculate the degree of amino acid sequence homology or identity between the test and reference sequences. A characteristic feature often used to determine protein homology is the similarity in the number and position of cysteines between one protein and another. “Antisense DNA” refers to a chromosomal DNA sequence that is transcribed. An “antisense probe” is a probe that contains at least a portion of antisense DNA corresponding to the nucleic acid sequence of interest. "Cloning" refers to the use of in vitro recombination techniques to insert a specific gene or other DNA sequence into a vector molecule. Successful cloning of the desired gene requires the use of methods for producing DNA fragments, linking the fragments to the vector molecule, introducing the composite DNA molecule into a host cell in which it can replicate, and selecting the clone containing the target gene from the recipient host cells. “cDNA” means complementary or copied DNA produced from an RNA template using RNA-dependent DNA polymerase (reverse transcriptase). Thus, a “cDNA clone” means a double-stranded DNA sequence contained in a cloning vector that is complementary to the RNA molecule of interest. A “cDNA library” is a collection of recombinant DNA molecules containing cDNA inserts that together represent all the types of mRNA molecules present in an entire organism or tissue, depending on the source of the RNA template. Such a cDNA library can be prepared by methods known to those skilled in the art and is described in Maniatis et al.4 HU 226 205 Β1 et al., “Molecular Cloning: A Laboratory Manual” (as above). Usually, RNA is first isolated from the cell of the organism into whose genome the gene is to be cloned. Mammalian, and in particular human, cell lines are preferred for the purposes of the invention. Alternatively, RNA may be isolated from a tumor cell derived from an animal tumor, and preferably a human tumor, so that the library may be prepared from, for example, a human adrenal tumor, but any other tumor may be used. The term "DNA polymorphism" refers to a condition in which two or more different nucleotide sequences can exist at a given position in DNA. The term "expression vector" refers to vectors capable of expressing the DNA sequences they contain, i.e., the coding sequences are operably linked to other sequences capable of influencing their expression. It is understood, although not always explicitly stated, that these expression vectors must be replicable in the host organism, either as episomes or as an integral part of the chromosomal DNA.A useful but not necessary element of an efficient expression vector is a marker coding sequence, which is a sequence coding for a protein that confers phenotypic properties (e.g., tetracycline resistance) on the cell it contains, allowing the cells to be readily identified. In general, the term "expression vector" is a functional definition and may refer to any DNA sequence that is capable of influencing the expression of a specific DNA code it contains when linked to the specific sequence. In the present disclosure, such vectors are often in the form of plasmids, and the terms "plasmid" and "expression vector" are often used interchangeably. It is also intended to utilize such other forms of expression vectors that serve equivalent functions and that are sometimes known to those skilled in the art. "Functional derivatives" are understood to mean "fragments", "variants", "analogs" or "chemical derivatives" of a molecule. A "fragment" of a molecule, e.g., any antigen of the invention, is understood to mean any polypeptide subunit of the molecule. A "variant" of such molecules means a molecule that is substantially similar to the naturally occurring molecule (or the entire molecule or fragment thereof). An "analog" of a molecule is understood to mean a molecule that is not naturally occurring (or the entire molecule or fragment thereof). "Gene" refers to a polynucleotide sequence encoding a peptide. The term "homogeneous" when used with respect to a peptide or DNA sequence means that the primary molecular structure (i.e., amino acid or nucleotide sequence) of substantially all molecules in the composition is, after due consideration, identical. The term "isolated" refers to a protein of the invention, or any gene encoding such a protein, that is substantially free from other proteins or genes, or other contaminants that are normally found under natural conditions, and thus is in a form not found under natural conditions. The term "label" refers to a detectable molecular group, such as radioactive isotopes, enzymes, luminescent agents, and dyes. The term "probe" refers to a ligand of known quality that is capable of selectively binding to the target antiligand. In the case of nucleic acids, a probe refers to a nucleic acid strand that has a base sequence complementary to the target strand. The term "recombinant host cells" refers to cells that have been transformed with vectors produced using recombinant DNA techniques. As described, an antibody or modified version thereof produced by a recombinant host cell is a consequence of the transformation, which would be produced in a lower amount, or more generally, in a less than detectable amount, by a non-transformed host cell. The term "substantially pure" refers to a protein of the invention, or any gene encoding such a protein, that is substantially free of other proteins or genes, or other contaminants that are normally found under natural conditions, and thus means a form not found under natural conditions. A molecule is said to be “substantially similar” to another molecule if the amino acid sequences of both molecules are essentially the same and both molecules have similar biological activity. Thus, provided that two molecules have similar activity, they are considered variants as defined herein even if one molecule contains additional amino acid groups not found in the other, or if the amino acid sequences are not identical. According to the invention, a molecule is said to be a “chemical derivative” of another molecule if it contains added chemical groups that are not normally part of the molecule. Such groups may improve the solubility, absorption, biological half-life, etc. of the molecule. The groups may also reduce the toxicity of the molecule, eliminate or attenuate the undesirable side effects of the molecule, etc.For a description of groups capable of mediating such effects, see, for example, "Remington's Pharmaceutical Sciences", 16th ed. (1980), Mack Publishing Co., Easton, Penn. "Vector" means a DNA molecule derived from a plasmid or bacteriophage into which DNA fragments may be inserted or cloned. A vector contains one or more unique restriction sites and may be capable of autonomous replication in a specific host or carrier microorganism, such that the cloned sequence can be reproduced. EN 226 205 B1 The compounds of the invention The invention relates to cDNAs having sequence numbers 1, 2, 4 or 6 (SEQ ID No: 1, SEQ ID No: 2, SEQ ID No: 4 or SEQ ID No: 6), as well as sequences including sequence numbers 1, 2, 4 or 6 (SEQ ID No: 1, SEQ ID No: 2, SEQ ID No: 4 or SEQ ID No: 6), and derivatives of these sequences. The invention also relates to vectors, liposomes and other carrier materials containing these sequences or derivatives thereof. The invention relates to proteins produced by transcription of sequences 1, 2, 4 or 6 (SEQ ID No: 1, SEQ ID No: 2, SEQ ID No: 4 or SEQ ID No: 6), for example proteins having sequence 3, 5 or 7 (SEQ ID No: 3, SEQ ID No: 5 or SEQ ID No: 7), as well as derivatives and variants thereof. In a preferred embodiment of the invention, a soluble variant of a KIM protein is used, which is usually synthesized as a membrane-associated protein and which is upregulated upon injury. The soluble variants lack at least a portion of the transmembrane region or the intramembrane region of the native KIM protein. In some cases, the soluble variant lacks the entire transmembrane or intramembrane region of the KIM protein. Soluble variants include fusion proteins comprising KIM protein derivatives which lack at least a portion of the transmembrane region or the intramembrane region of the native KIM protein. The invention relates to fusion proteins comprising all types of KIM, particularly those comprising the his-tag, the Ig-tag and the myc-tag of the molecule.These KIM fusions may have therapeutically beneficial properties, such as an increased half-life determined by the Ig tag. The invention also provides fusion proteins that comprise portions derived from selected domains of the KIM protein. Variants may differ from naturally occurring KIM proteins in amino acid sequence, or in properties that are not sequence-related, or both. Amino acid sequence variants may be produced by substituting one or more naturally occurring amino acids in a KIM protein with an amino acid of a different nature, an amino acid derivative, or a non-native amino acid. Particularly preferred are variants in which the sequence of the naturally occurring KIM protein, or a biologically active fragment of the naturally occurring KIM protein, differs from the wild-type sequence by one or more conservative amino acid substitutions, which typically have minimal effects on the secondary structure and hydrophobic nature of the protein or peptide. Variants may also have sequences that differ in one or more non-conservative substitutions, deletions, or insertions that do not abolish the biological activity of the KIM protein.Conservative substitutions typically include substitutions in which one amino acid is substituted for another with similar properties, such as those from the following groups: valine, glycine; glycine, alanine; valine, isoleucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine. Nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine. Polar, neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. Positively charged (basic) amino acids include arginine, lysine, and histidine. Negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Other conservative substitutions can be made according to the table below, and others can be made according to Dayhoff, "Atlas of Protein Sequence and Structure" (1988). Table 1 Conservative amino acid substitutions Aminosav Kód Csere az alábbiak közül bármelyikkel Alanin A D-Ala, Gly, béta-Ala, L-Cys, D-Cys Arginin R D-Arg, Lys, homo-Arg, D-homo-Arg, Met, D-Met, Ile, D-lle, Orn, D-Orn Aszparagin N D-Asn, Asp, D-Asp, Glu, D-Glu, Gin, D-GIn Aszparaginsav D D-Asp, D-Asn, Asn, Glu, D-Glu, Gin, D-GIn Cisztein C D-Cys, S-Me-Cys, Met, D-Met, Thr, D-Thr Glutamin Q D-GIn, Asn, D-Asn, Glu, D-Glu, Asp, D-Asp Glutaminsav E D-Glu, D-Asp, Asp, Asn, D-Asn, Gin, D-GIn Glicin G Ala, D-Ala, Pro, D-Pro, Beta-Ala, Acp Izoleucin I D-lle, Val, D-Val, Leu, D-Leu, Met, D-Met Leucin L D-Leu, Val, D-Val, Met, D-Met Lizin K D-Lys, Arg, D-Arg, homoArg, D-homo-Arg, Met, D-Met, Ile, D-lle, Orn, D-Orn Metionin M D-Met, S-Me-Cys, Ile, D-lle, Leu, D-Leu, Val, D-Val, Norleu Fenil-alanin F D-Phe, Tyr, D-Thr, L-Dopa, His, D-His, Trp, D-Trp, Transz-3,4- vagy 5-fenil-prolin, cisz-3,4- vagy 5-fenilprolin Prolin P D-Pro, L-1-tioazolidin-4-karbonsav, D- vagy L-1-oxazolidin-4-karbonsav HU 226 205 Β1 Table 1 (continued) Amino Acid Code Replace with any of the following Serine S D-Ser, Thr, D-Thr, allo-Thr, Met, D-Met, Met(O), D-Met(O), Val, D-Val Threonine T D-Thr, Ser, D-Ser, allo-Thr, Met, D-Met, Met(O), D-Met(O), Val, D-Val Tyrosine Y D-Tyr, Phe, D-Phe, L-Dopa, His, D-His Valine V D-Val, Leu, D-Leu, Ile, D-lle, Met, D-Met Other variants of the invention are made with modifications that increase the stability of the peptide. Such variants may include, for example, those in which one or more non-peptide bonds (replacing peptide bonds) are present in the peptide sequence. The invention also includes variants that contain non-naturally occurring L-amino acids, such as D-amino acids, or non-naturally occurring or synthetic amino acids, such as beta or gamma amino acids, and cyclic variants. The incorporation of D-amino acids into the polypeptide in place of L-amino acids may increase its resistance to proteases. See, for example, USP. 5,219,990. In general, substitutions are expected to induce changes in the functional properties of KIM polypeptides by (i) substituting a hydrophilic amino acid, such as serine or threonine, for a hydrophobic amino acid, such as leucine, isoleucine, phenylalanine, or alanine; (ii) substituting a cysteine ​​for any other amino acid; (iii) substituting an amino acid containing an electropositive side chain, such as lysine, arginine, or histidine, for an amino acid containing an electronegative side chain, such as glutamic acid or aspartic acid; or (iv) substituting an amino acid containing a bulky side chain, such as phenylalanine, for an amino acid lacking such a side chain, such as glycine. The peptides of the invention may also be modified by various changes such as insertions, deletions and substitutions, both conservative and non-conservative, which changes provide certain advantages in their use. Splicing variants are a particular subject of the invention. In other preferred embodiments of the invention, variants created by less conservative amino acid substitutions can also result in derivatives with desired properties, such as changes in charge, conformation, or other biological properties. Such substitutions may include, for example, the substitution of hydrophilic amino acids for hydrophilic amino acids, the substitution of cysteine ​​or proline for other amino acids, the substitution of an amino acid containing a small side chain for an amino acid containing a large side chain, or the substitution of an amino acid with a net positive charge for an amino acid with a net negative charge. If the outcome of a given substitution cannot be determined with complete certainty in advance, the derivatives can be readily screened using the methods described herein to determine the presence or absence of the desired properties. Variants within the claimed scope of the invention include proteins and peptides that have an amino acid sequence that shows at least 80% homology to the KIM protein. More preferably, the sequence homology is at least 90% or at least 95%. For the purpose of determining homology, the length of the compared sequences is generally at least 8 amino acids, usually at least 20 amino acids. Variants of the compounds of the invention include any protein that 1) has an amino acid sequence that has at least 40% homology to the KIM protein of the invention, and 2) has a sequence that is optimally aligned to the KIM sequence (shown in Figure 5 for human and rat ΚΙΜ-1), and the positions of its cysteines are at least 80% identical to the positions of the cysteines of the KIM protein of the invention. Just as backbone substituents can be replaced, functional groups attached to the backbone can be substituted with groups with similar properties. These substitutions are conservative in nature, meaning that the replacement group has approximately the same size, shape, hydrophobicity, and charge as the original group. Non-sequence modifications include, for example, in vivo or in vitro chemical derivatization of portions of the naturally occurring KIM protein, as well as changes in acetylation, methylation, phosphorylation, carboxylation, or glycosylation. The invention also provides agents capable of specifically binding to the protein (SEQ ID No: 3, 5 or 7) or a fragment of the protein. These agents may be ligands and antibodies (including monoclonal, single chain, double chain antibodies, Fab fragments and others, whether native, human, humanized, primatized or chimeric antibodies). For further description of these concepts, see PCT Publication No. 95 / 16709, which is incorporated herein by reference. Example 1 RNA production from ischemic and normal kidneys of adult rats Ischemic rat kidneys were obtained as described by Witzgall et al. [J. Clin. Invest. 93, 2175-2188 (1994)]. Briefly, the renal artery and vein in the kidney of an adult Sprague-Dawley rat are clamped for 40 minutes and then reperfused (reperfusion). Injured kidneys are removed from the rats 24 hours and 48 hours after the start of perfusion. Normal (sham-operated) kidneys are also removed from adult, normal Sprague-Dawley rats. Total RNA was prepared from the organs according to the method of Glysin et al. [Biochemistry 13, 2633 HU 226 205 Β1 (1974)]. Briefly, the removed organs are immediately placed in GNC buffer (4 M guanidium thiocyanate, 0.5% SDS, 25 mM sodium citrate, 0.1% Sigma antifoam) and disrupted on ice using a “polytron”. Cell debris is removed in a clinical centrifuge at low speed and the supernatant is placed on a pad containing 5.7 M cesium chloride, 25 mM sodium acetate and 1 mM EDTA. The RNA is sedimented through the pad in a SW40Ti rotor at 22K for 15 hours. The RNA is suspended in sterile DEPC-treated water, precipitated twice with 1 / 10 volume of 3 M sodium acetate and 2.5 volumes of ethanol. (PolyA+RNA) was isolated using an mRNA purification kit (Pharmacia catalog number 27-9258-02). Example 2 Representation difference analysis (RDA) method for the production of RDA fragments 1-7, 3-2 and 4-7 Double-stranded cDNA is synthesized from (polyA+RNA) from sham-operated (normal) and 48-hour post-ischemia kidneys using the Gibco BRL “Superscript Choice™ System cDNA Synthesis Kit” (cat. no. 18090). Oligo-dT primers and “Superscript II™” reverse transcriptase are used to synthesize the first strand. The second strand is obtained using DNA polymerase-1 and RNase-H from E. coli, followed by T4 DNA polymerase (under conditions recommended by BRL). RNA analysis was performed essentially as described by Hubánk and Schatz [Nucleic. Acid. Research 22, 5640-48 (1994)]. Briefly, cDNA from a kidney 48 hours after ischemia was digested with the restriction enzyme Dpnll and ligated to R-BgL-12 / 24 oligonucleotides (for the exact sequence, see reference). PCR amplification of the linker-ligated cDNA (performed using Perkin-Elmer Taq polymerase in the appropriate buffer) was used to generate the initial representation. The PCR product was called the “tester amplicon”. The same procedure was used to generate the “driver amplicon” for cDNA from sham-operated (normal) rat kidneys. Hybridization of the "tester" and "driver" amplicons is followed by selective amplification, which is performed three times to produce the first (DPI), second (DP2), and third (DP3) difference products. The production of the DPI product is carried out as described by Hubánk and Schatz [Nucleic Acid Research 22, 5640-48 (1994)]. The production of DP2 and DP3 is also carried out as described by Hubánk and Schatz [supra], except that the "driver:tester" ratio is changed to 5.333:1 for DP2 and to 40,000:1 or 4,000:1 for DP3. Three RDA products were cloned from DP3 into the cloning vector pUC18. RDA products 1-7 (252 bp) were obtained when DP3 was prepared using a 40,000:1 ratio, and RDA products 3-2 (445 bp) and 4-7 (483 bp) were obtained when DP3 was prepared using a 4,000:1 ratio. The DNA fragments were subcloned using the Pharmacia Sureclone™ kit (catalog number 27-9300-01) to repair the ends of the PCR fragments with Klenow enzyme and to facilitate blunt-end ligation of the fragments into the pUC18 vector. Example 3 Northern analysis 2.5 pg (polyRNA) from adult normal (sham-operated) rat kidneys, injured adult rats and 18-day embryonic kidneys, taken 48 hours after ischemia, were electrophoresed and Northern blotted [Cate, Cell 45, 685 (1986)] onto GeneScreen™ membranes (Dupont). Hybridization was performed in PBS buffer (50 mM TRIS pH=7.5, 1 M NaCl, 0.1% sodium pyrophosphate, 0.2% PVP, 0.2% Ficoll, 0.2% BSA, 1% SDS) containing 10% dextran sulfate and 100 pg / ml tRNA at 65°C using three different probes: 1-7-RDA product, 3-2-product and 4-7-RDA product. All are radiolabeled using Pharmacia “Ready to Go™” random priming labeling kit (catalog number 27-9251-01). The 1-7, 3-2, and 4-7 RDA products hybridize to mRNA in all three samples, but most intensely to RNA samples from injured kidneys taken 48 hours after ischemia. Northern blot analysis of tissues from adult rats indicates that the 1-7 gene is expressed at high and low levels in normal adult kidney, testis, spleen, and lung. The 3-2 gene is expressed in liver, kidney, spleen, and brain. The 4-7 gene is expressed in spleen, kidney, lung, testis, heart, brain, liver, and skeletal muscle. The presence of mRNAs of different sizes in the 1-7 and 3-2 blots in some tissues indicates that alternative splicing and / or polyadenylation may occur in the primary transcription products of the 1-7 and 3-2 genes. Example 4 Isolation of cDNA clones 3-2 and 4-7 A cDNA library was prepared from 4 g (poHA+RNA) from injured kidneys taken 1 hour after ischemia, using the “BRL Superscript Choice™ system and “Stratagene™ Lambda Zapll cloning kit” (catalog number: 236201) for cDNA synthesis, according to the recipe recommended by the manufacturers. 105 clones were screened using the 3-2 RDA product as a probe (labeled with random priming as described above). Eight positive clones were selected and four were randomly selected for a second analysis to produce pure phage plaques. After the third screening, four pure phage clones were isolated. The cloned inserts were isolated from the phage by in vivo excision using the Stratagene™ Lambda Zapll cloning kit. The largest insert (cDNA clone 3-2) of approximately 2.6 kb in size was subjected to DNA sequencing. The sequence of the insert (SEQ ID No: 1) is shown in Figure 1. The 3-2 cDNA clone (E. coli K-12, SOLR / p3-2#5-1) was deposited under ATCC Accession No. 98061. The sequence of cDNA clone 3-2 is identical to that of cDNA clone 1-7 (SEQ EN 226 205 B1 ID No: 2), except that nucleotides 136-605 of sequence number 1 (SEQ ID No: 1) correspond to an insertion. Thus, sequence number 2 (SEQ ID No: 2) is a splice variant of sequence number 1 (SEQ ID No: 1). Clone 1-7 (E. coli K-12, SOLR / pl7#3-1) was deposited under ATCC accession number 98060. 105 clones were screened using the 1-7-RDA product as a probe (labeled with random chain priming as described above). Eight positive clones were selected and four were randomly selected for a second analysis to produce pure phage plaques. After the third screening, four pure phage clones were isolated. The cloned inserts were isolated from the phage by in vivo excision using the Stratagene™ Lambda Zapll cloning kit. The largest insert of approximately 2.0 kb in size (cDNA clone 1-7) was subjected to DNA sequencing. The sequence of the insert (SEQ ID No: 2) is shown in Figure 2. 105 clones were screened using the 4-7-RDA product as a probe (labeled with random priming as described above). Eight positive clones were selected and four were randomly selected for a second analysis to produce pure phage plaques. After the second screening, two pure phage clones were isolated. The cloned inserts were isolated from the phage by in vivo excision using the Stratagene™ Lambda Zapll cloning kit. The largest insert (cDNA clone 4-7) of approximately 2.4 kb in size was subjected to DNA sequencing. The sequence of the insert (SEQ ID No: 4) is shown in Figure 3. Clone 4-7 (E. coli K-12, SOLR / p4-7#1-1) was deposited under ATCC Accession No. 98062. Example 5 Characterization of cDNA clones 1-7, 3-2 and 4-7 A) DNA and protein sequences The 3-2 cDNA sequence (Figure 1; SEQ ID No: 1) contains an open reading frame of 307 amino acids (Figure 1; SEQ ID No: 3). Von Heijne analysis [Von Heijne et al., Nucl. Acid. Res. 14, 14683 (1986)] suggests a signal sequence of 21 amino acids and a transmembrane region of approximately 235-237 amino acids indicating that the 3-2 product is a cell surface protein. The sequence of the 1-7 cDNA (Figure 2; SEQ ID No: 2) contains an open reading frame of 307 amino acids, which is identical to the open reading frame of the 3-2 cDNA (SEQ ID No: 3). The sequence of the 4-7 cDNA (Figure 3; SEQ ID No: 4) contains an open reading frame of 572 amino acids (SEQ ID No: 5). The transmembrane region is located between approximately amino acids 501-521. 6) In situ analysis of 1-7, 3-2 and 4-7 mRNA from contralateral and post-ischemic kidneys of adult rats In situ hybridization was performed according to the procedure described by Finch et al. [Dev. Dynamics 203, 223-240 (1995)]. Briefly, contralateral and postischemic kidneys were perfusion-fixed with 4% paraformaldehyde in PBS. The kidneys were further fixed overnight at 4°C and processed. Paraffin sections were deparaffinized and rehydrated, fixed with 4% paraformaldehyde in PBS, digested with proteinase K, refixed, and then acetylated with acetic anhydride in triethanolamine buffer. The sections are then re-dehydrated and hybridized with 32P-labeled riboprobes at 55°C overnight, the 32P-labeled riboprobes being prepared from the 3-2-RDA or 1-7-RDA product subcloned into the BamHI site of pGEM-11Z. After hybridization, the sections are washed under high stringency conditions (2xSSC, 50% formamide 65°C). The sections are finally dehydrated, mounted in emulsion (NBT-2) for autoradiography, and subjected to autoradiography for at least one week.The silver grains are developed and the sections are counterstained with toluidine blue and photographed on microfilm. Analysis of 1-7 and 3-2 mRNA expression by in situ hybridization indicates that these genes are significantly upregulated in damaged kidney cells compared to normal kidney sections. Expression is seen in regenerative cells of the cortex and outer medulla, the majority of which appear to be proximal renal tubule cells. Analysis of the in situ RNA expression pattern of 4-7 also revealed that gene expression is increased in the injured, ischemic kidney compared to the normal, adult kidney. The expression is seen in infiltrative cells. Example 6 Isolation of a human cDNA clone cross-hybridizing to rat 3-2 cDNA The insert of clone 3-2 shown in Figure 1 A 32P-labeled DNA probe containing nucleotides 546-969. is prepared and used to screen a lambda-gt10 cDNA library (Clontech cat. no. HL5003a) from human embryonic liver. 1*10® plaques are filtered in duplicate using standard conditions as described above, but the temperature used for the filtration is 55 °C. For washing under high stringency conditions, the filters are washed in 2*SSC at 55 °C. Fifty positive phage are identified and plaque purified, and DNA is prepared. The phage DNAs are subjected to Southern analysis using the probe described above. The Southern blot filter is subjected to a final wash with 0.5> <SSC-ben, 55 °C-on. Két kiónt azonosítunk pozitívként. A H13-10-85-klón inszertjét szekvenáljuk, és egy olyan régiót találunk, amely a It encodes a protein that is largely identical to the 3-2 protein shown in Figure 3. The nucleotide sequence (SEQ ID No: 6) and predicted amino acid sequence (SEQ ID No: 7) of the human 3-2 protein are shown in Figure 4. The best-fit analysis shown in Figure 5 showed that the human 3-2 protein is 43.8% identical and 59.1% similar to the rat 3-2 protein. Both contain IgG, mucin, transmembrane and cytoplasmic domains. The six cysteines in the IgG domain of both proteins are conserved. EN 226 205 B1 Example 7 Production of ΚΙΜ-1-Ig fusion protein A fusion protein consisting of the extracellular domain of KIM and the Fc region of immunoglobulin (Ig) is a useful tool for studying the molecular and cellular biology of the injured / regenerating kidney and can be used as a therapeutic molecule. To produce a KIM-Ig fusion protein with the extracellular domain of human and rat KIM-1 protein, a fragment of the extracellular domain of KIM-1 cDNA is amplified by PCR and cloned into the Biogen expression vector pCA125 for transient expression in COS cells. The pCA125 expression vector produces a fusion protein whose structure is formed by the gene cloned at the N-terminus and the human Ig-Fc region cloned at the C-terminus. COS cells are transfected with plasmid SJR 103 or 104; these plasmids express fusion proteins derived from the extracellular domain of human KIM 263-1147 (SEQ ID No: 6; SJR 103) or rat KIM 599-1319.(SEQ ID No: 1; SJR 104) fused to a human Ig-Fc region. Cells are grown in DMEM supplemented with 10% FBS at the “cell factory” (Nunc, Naperville, IL). Two to three days after transfection, the medium is separated, concentrated using an Amicon concentrator, and the fusion protein is purified on a Protein-A Sepharose column. After purification, the purity of the fusion protein is examined by SDS-PAGE. Diagnostic use of the compounds of the invention Anti-KIM antibodies capable of specifically binding to proteins of SEQ ID No: 3, SEQ ID No: 5 or SEG ID No: 7 or fragments thereof of the invention are useful in a variety of diagnostic procedures. These agents can be labeled with detectable markers, such as fluorescent or radioactively detectable materials, and administered to a subject to allow imaging of tissues expressing the KIM protein. The agents can also be conjugated to materials, such as horseradish peroxidase, which can be used as immunocytochemical stains to allow visualization of KIM protein-positive cells on histological sections. The specific antibody can be used alone as described above, and the sites where it is bound can be visualized in a sandwich manner using an anti-immunoglobulin antibody bound to the detectable marker. Antibodies specific for KIM protein can also be used in immunoassays for the detection or determination of KIM concentration in body tissue and body fluid samples. The concentrations can be consistent with various disease states. In a particularly preferred embodiment of the invention, the invention provides a method for diagnosing kidney injury or monitoring kidney healing by measuring the concentration of KIM or KIM fragments in the urine, plasma or serum of a patient. Similarly, KIM can be measured in urine sediment, particularly in cellular debris in the urine sediment. The remnants of renal tubule cells, which may be present in the urine sediment of patients with advanced kidney disease, may contain elevated levels of KIM protein and mRNA. Antibodies specific for KIM protein can also be bound to a solid support, such as beads or microtiter plates, and used to remove the ligand from solution, either for measurement or purification and characterization of the protein or modified versions thereof (e.g., post-translational modifications). Such characterization of KIM protein in a patient may be useful for identifying deleterious mutants or detective processes that disrupt KIM function and are associated with abnormal patient phenotypes. Each of these techniques is routine for one skilled in the art of immunology. Further imaging methods employ KIM or KIM fragments fused to imageable moieties for diagnostic imaging of tissues, particularly tumors, that express KIM ligands. Additional diagnostic techniques are based on the detection of upregulated KIM mRNA as an indication of injury-related processes. These techniques were tested and found to be functional in a rat model of ischemic injury, as described below. To determine whether KIM-1 protein levels increase after injury, renal homogenates from contralateral and post-ischemic kidneys were examined 24 and 48 hours after the renal artery and vein in one kidney of each rat were clamped for 40 minutes. KIM-1 protein was determined in the renal homogenate. In the post-ischemic sample, three proteins were identified by Western blot analysis using two different antibodies that were not detectable in homogenates from contralateral kidneys not subjected to ischemic injury. The apparent molecular weights of the bands were approximately 40 kDa, 50 kDa, and 70-80 kDa. The three types of proteins detected by Western blotting may represent glycosylated forms of the same protein, which has specific potential N- and O-glycosylation sites.The fact that each of these proteins reacts with two different sets of polyclonal antibodies supports the theory that they are structurally related to KIM-1 and are not cross-reacting bands. This assumption was confirmed by the results of partial CNBr digestion of the proteins, which showed that they share CNBr fragments. Since the cytoplasmic domain of the KIM-1 protein was previously assumed to contain no significant post-translational modifications, the two smaller products of the digestion (4.7 kDa and 7.4 kDa) (detected with antibodies specific for the cytoplasmic domain of KIM-1) had the same mass10. HU 226 205 Β1 should be the same for the three different KIM-1 protein bands if they originate from the same protein. We observed that the fragments generated from the 40 kDa and 70-80 kDa KIM-1 proteins migrated according to the previously assumed size. The digestion of the 50 kDa protein band resulted in a peptide with the same C-terminal pattern. The ΚΙΜ-1 sequence contains two putative N-glycosylation sites and a mucin domain, where O-glycosylation may cover the polypeptide chain. The three KIM-1 bands detected in postischemic kidney correspond to glycosylation variants of the same core protein. N-deglycosylation with PNGase-F resulted in a shift of all three bands towards lower molecular weight, corresponding to a loss of approximately 3 kDa, indicating that all three proteins are N-glycosylated. Differences in O-glycosylation may explain the difference in size of the three bands. Therapeutic Use of the Compounds of the Invention In the therapeutic methods of the invention, cellular responses dependent on KIM ligation are selectively promoted or inhibited. If KIM and KIM ligand are both membrane-bound and expressed by different cells, signal transduction may occur in the cell expressing KIM, the cell expressing KIM ligand, or both. A KIM ligation-induced response can be induced in a cell expressing a KIM ligand by contacting the cell with exogenous KIM, KIM fusion proteins, or activating antibodies specific for the KIM ligand, in vitro or in vivo. Furthermore, responses in cells expressing a KIM ligand (which can otherwise be initiated by endogenous KIM) can be blocked by contacting the cells expressing the KIM ligand with a KIM ligand antagonist (e.g., an antagonist antibody that is capable of binding to a KIM ligand), or by contacting endogenous KIM with an anti-KIM antibody or other molecule capable of binding KIM, which prevents efficient ligation between KIM and KIM ligand. Similarly, in cells expressing KIM, responses elicited by KIM ligation can be promoted or inhibited by exogenous compounds. For example, a KIM ligation response can be induced in a KIM-expressing cell by contacting the cell with a soluble KIM ligand or with a specific anti-KIM activating antibody. Furthermore, responses in KIM-ligand-expressing cells (which may otherwise be initiated by interaction with endogenous KIM ligand) can be blocked by contacting KIM-expressing cells with a KIM antagonist (e.g., a blocking antibody that binds to KIM in a manner that prevents efficient, signaling-producing KIM ligation), or by contacting endogenous KIM ligand with an antibody specific for KIM ligand or other molecule capable of binding KIM ligand, thereby preventing efficient ligation between KIM and KIM ligand. The interventions described above are particularly effective in therapeutic applications based on the pathologic mechanism of the subject pathological process to be inhibited or a medically desirable process to be promoted, as will be apparent to one skilled in the art of medical practice. For example, if KIM ligation results in desired cellular growth, maintenance of a differentiated phenotype, resistance to apoptosis induced by various stimuli, or other medically beneficial responses, one of the interventions described above can be used to promote the response initiated by ligation. Alternatively, an inhibitory intervention may be effective when KIM ligation results in undesirable consequences, such as neoplastic growth, deleterious loss of cellular function, susceptibility to apoptosis, or promotion of inflammatory processes. The following are examples of the methods of the invention described above. One therapeutic use of the KIM-related compounds of the invention is for treating a subject suffering from kidney disease, by promoting the growth of new tissue in the subject or by promoting the survival of damaged tissue in the subject, which method comprises administering to the subject an effective amount of a KIM protein of the invention or a pharmaceutical composition comprising the protein of the invention. The protein used in the methods may be a fragment of a full-length KIM protein, a soluble KIM ligand protein or fusion fragment, or a KIM agonist. These methods may also be carried out by administering to the subject a therapeutically effective amount of an agonist antibody of the invention or a pharmaceutical composition comprising an agonist antibody of the invention.KIM protein can be administered in combination with a therapeutically effective amount of a second compound that provides a medically desirable adjunctive effect. While these methods can be used to treat any tissue, for example, renal tissue, liver, neural tissue, heart, stomach, small intestine, spinal cord or lung tissue can be treated. In particular, the kidney in abnormal conditions can be beneficially treated with the compounds of the invention, for example, in cases of acute renal failure, acute nephritis, chronic renal failure, nephrotic syndrome, renal tubular defects, kidney transplants, toxic injury, hypoxic injury and trauma. Renal failure can be hereditary or acquired in nature, for example, polycystic kidney, cystic kidney and spongy kidney. This list is not exhaustive and may include many other renal disorders [see, for example, Harrison's Principles of Internal Medicine, 13th edition (1994), which is incorporated herein by reference]. In the procedures, the treatment can also be performed on humans. A therapeutic intervention for inhibiting the unwanted growth of KIM ligand-expressing tissue in a subject comprises administering to the subject a therapeutically effective amount of a KIM antagonist (e.g., an antagonist antibody capable of binding to KIM ligand), or administering to the subject a therapeutically effective amount of an anti-KIM antibody or other KIM-binding molecule that blocks the binding of KIM to tissue expressing KIM ligand. The invention In a preferred embodiment, the KIM antagonist or anti-KIM antibody can be used therapeutically to inhibit or block the growth of tumors that depend on KIM protein for their growth. In other methods of the invention, tumor cells expressing KIM ligand are killed or their growth is inhibited by contacting the cells with a fusion protein comprising KIM and a toxin or radioactive nuclide, or an antibody specific for KIM ligand conjugated to a toxin or radioactive nuclide. The cell may be in the subject, and the protein or conjugated antibody may be administered to the subject. The invention also provides a method for targeting a toxin or radionuclide to cells expressing KIM, comprising contacting the cell with a fusion protein comprising a KIM ligand and a toxin or radionuclide, or an antibody specific for KIM conjugated to a toxin or radionuclide. In another preferred embodiment of the invention, the invention provides a method for suppressing the growth of a tumor cell expressing KIM, comprising contacting the cell with a fusion protein comprising a KIM ligand and a toxin or radionuclide, or an antibody specific for KIM conjugated to a toxin or radionuclide; the cell may be in the subject, and the protein may be administered to the subject. The term "subject" can mean any mammal to which a KIM is administered. Specific subjects treated by the method of the invention can include humans, as well as non-human primates, sheep, horses, cattle, goats, pigs, dogs, cats, rabbits, guinea pigs, hamsters, mice, rats and mice, as well as organs, tumors and cells derived from or derived from these hosts. Use of the compounds of the invention in gene therapy The KIM genes of the invention are introduced into damaged tissue or tissue for which stimulated growth is desired. Such gene therapy stimulates the production of KIM proteins by transfected cells, promoting cell growth and / or survival of cells expressing the KIM protein. In a preferred embodiment of the invention, using a gene therapy method, a gene encoding a KIM protein can be introduced into a kidney target tissue. The KIM protein can be stably expressed and stimulates cell growth, division or differentiation, or allows the cell to survive. Furthermore, the KIM gene can be delivered into the target cell by a variety of known methods, using viral or non-viral based strategies. Nonviral methods include electroporation, membrane fusion with liposomes, high-velocity particle bombardment with DNA-coated microparticles, incubation with calcium phosphate DNA precipitation, DEAE-dextran-mediated transfection, and direct microinjection into a single cell. The KIM gene can be introduced into a cell, for example, by co-precipitation with calcium phosphate [Pillicer et al., Science 209, 1414-1422 (1980)]; by mechanical microinjection and / or particle acceleration [Anderson et al., Proc. Nat. Acad. Sci. USA 77, 5399-5403 (1980)]; by liposome-based DNA transfer [e.g., LIPOFECTIN-mediated transfection, Fefgner et al., Proc. Nat. Acad. Sci. USA 84, 471-477 (1987); Gao and Huang, Biochim. Biophys. Res. Comm. 179, 280-285 (1991)]; by DEAE-dextran-mediated transfection; by electroporation (US Patent No. 4,956,288); or polylysine-based methods in which the DNA is conjugated to a targeting DNA, which is preferably suitable for targeting to liver hepatocytes [Wolff et al., Science 247, 465-468 (1990); Curie et al., Human Gene Therapy 3, 147-154 (1992)]. Target cells can be transfected with the genes of the invention by direct gene transfer, see, for example, Wolff et al., "Direct Gene Transfer Into Moose Muscle In Viv", Science 247, 1465-68 (1990). In many cases, vector-mediated transfection is desirable. Any method known to those skilled in the art for inserting polynucleotide sequences into a vector can be used [see, for example, Sambrook et al., "Molecular Cloning: A Laboratory Manual", Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989); and Ausubel et al., Current Protocols in Molecular Biology, J. Wiley & Sons, NY (1992), both incorporated by reference], Promoter activation may be tissue-specific, or may be induced by a metabolic product or administered substance. Promoter / enhancers include, for example, the promoter derived from native c-ret ligand protein, the immediate early promoter / enhancer derived from cytomegalovirus [Karasuyama et al., J. Exp. Med. 169, 13 (1989)], the promoter derived from human beta-actin [Gunning et al., Proc. Natl. Acad. Sci. USA 84, 4831 (1987)]; long terminal repeat sequence of glucocorticoid-inducible promoter (MMTV LTR) in murine mammary tumor virus [Weiss et al., “RNA Tumor Viruses,” Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1985)]; SV40 early region promoter [Bernoist and Chambon, Nature 290, 304 (1981)]; Rous sarcoma virus (RSV) promoter [Yamamoto et al., Cell 22, 787 (1980)]; herpes simplex virus (HSV) thymidine kinase promoter [Wagner et al., Proc. Natl. Acad. Sci. USA 78, 1441 (1981)]; adenovirus promoter [Yamada et al., Proc. Natl. Acad. Sci. USA 82, 3567 (1985)]. KIM genes can also be introduced with specific viral vectors for use in gene transfer systems, which are well known to those skilled in the art. See, for example, Madzak et al., J. Gen. Virol. 73, 1533-36 (1992) (papovavirus SV40); Berkner et al., Curr. Top. Microbiol. Immunol. 158, 39-61 (1992) (adenovirus); Hofmann et al., Proc. Natl. Acad. Sci. USA 92, 10099-10103 (1995) (baculovirus); Moss et al., Curr. Top. Microbiol. Immunol. 158, 25-38 (1992) (vaccinia virus); Muzyczka, Curr. Top. Microbiol. Immunol. 758, 97-123 (1992) (adeno-associated virus); Margulskee, Curr. Top. Microbiol. Immunoi. 158, 67-93 (1992) [herpes simplex virus and Epstein-Barr virus (HBV)]; Miller, Curr. Top. Microbiol. Immunoi. 158, 1-24 (1992) (retrovirus); Brandyopad12 HU 226 205 Β1 hyay et al., Mol. Cell. Biol. 4, 749-754 (1984) (retrovirus); Miller et al., Natúré 357, 455-450 (1992) (retrovirus); Anderson, Science 256, 808-813 (1992) (retrovirus); “Current Protocols in Molecular Biology: Sections 9.10-9.14” (ed. Ausubel et al.), Greene Publishing Associates (1989), all of which are incorporated herein by reference. Preferred vectors are DNA viruses, such as adenoviruses (preferably Ad-2 or Ad-5-based vectors), baculoviruses, herpesviruses (preferably herpes simplex virus-based vectors), and parvoviruses (preferably "defective or non-autonomous parvovirus-based vectors, more preferably adeno-associated virus-based vectors, most preferably AAV-2-based vectors). See, for example, Ali et al., Gene Therapy 1, 367-384 (1994); U.S. Patent Nos. 4,797,368 and 5,399,346 and the discussion below. The choice of a particular vector system for delivery, such as a KIM sequence, depends on a variety of factors. An important factor is the nature of the target cell population. Although retroviral vectors have been extensively studied and have been used in a number of gene therapies, they are generally not suitable for infecting cells that are not dividing, but they are useful in cancer therapy because they only integrate and express their genes in replicating cells. They are useful for ex vivo approaches and are attractive for use in this context because they are stably integrated into the target cell genome. Adenoviruses are eukaryotic DNA viruses that can be engineered to efficiently deliver therapeutic or reporter transgenes to a variety of cell types. The common adenoviruses, types 2 and 5 (Ad2 and Ad5, respectively), cause respiratory disease in humans and are currently being developed for gene therapy of Duchenne muscular dystrophy (DMD) and cystic fibrosis (CF). Ad2 and Ad5 both belong to a subclass of adenoviruses that is not associated with human malignancies. Adenovirus vectors are capable of delivering transgenes to virtually all cell types, regardless of their mitotic state, with remarkable efficiency. High titer (1013plaque forming units / ml) recombinant virus can be easily produced in 293 cells (adenovirus-transformed, complementing human embryonic kidney cell line: ATCC CRL1573) and stored in a cryostat for extended periods without significant loss.The effectiveness of the system has been demonstrated in animal models for the in vivo delivery of therapeutic transgenes to complement genetic deficiencies in a variety of disorders. See Watanabe, Atherosclerosis 36, 261-268 (1986); Tanzawa et al., FEBS Letters 118 (1), 81-84 (1980); Golasten et al., New Engl. J. Med. 309, 288-296 (1983); Ishibashi et al., J. Clin. Invest. 92, 883-893 (1993); and Ishibashi et al., J. Clin. Invest. 93, 1889-1893 (1994), all of which are incorporated herein by reference. Indeed, a recombinant, replication-deficient adenovirus encoding the cystic fibrosis transmembrane regulator (CFTR) cDNA has been shown to be suitable for use in at least two clinical trials in humans with CF. See Wilson, Nature 365, 691-692 (1993). The safety of recombinant adenoviruses for gene therapy is further supported by the extensive experience with live adenoviruses in human populations. First-generation, recombinant, replication-deficient adenoviruses developed for gene therapy of DMD and other inherited disorders contain deletions of the entire E1a and part of the E1b region. This replication-deficient virus is grown in 293 cells that contain a functional E1a gene from adenovirus, which ensures the presence of a functional E1a protein. Viruses containing the E1 deletion are able to replicate and produce infectious viruses in 293 cells that provide the gene product of the E1a and E1b regions "in trans". The resulting virus is capable of infecting many cell types and is able to express the introduced gene (provided it contains its own promoter), but is unable to replicate in cells that do not contain E1 region DNA unless the cell is infected at a very high copy number.Adenoviruses have the advantage of being able to infect a wide range of hosts, of being able to infect quiescent or terminally differentiated cells such as neurons, and of being essentially non-oncogenic. Adenoviruses do not appear to integrate into the host genome. Because they exist extrachromosomally, the risk of insertional mutagenesis is greatly reduced (Ali et al., supra, at 373). Recombinant adenoviruses (rAdV) are produced at very high titers, have tolerably stable viral particles, high levels of expression, and can infect a wide range of cells. Their natural host cells are the epithelium of the airways, making them useful in the therapy of lung cancer. Baculovirus-mediated delivery has several advantages. Baculovirus gene delivery can occur in replicating and non-replicating cells, and can occur in kidney cells, as well as hepatocytes, neurons, spleen, skin, and muscle cells. Baculovirus does not replicate and is not pathogenic in mammalian cells. Humans do not have pre-existing antibodies to recombinant baculoviruses that would block infection. Furthermore, baculovirus is capable of incorporating and transducing very large DNA inserts. Adeno-associated viruses (AAV) are also used as vectors for somatic gene therapy. AAV is a small, single-stranded (ss) DNA virus with a simple genomic organization (4–7 kb in size), which makes it ideal for genetic engineering. It encodes a series of two open reading frames, rep cap polypeptides. The rep polypeptides (rep78, rep68, rep62, and rep40) play a role in the replication, repair, and integration of the AAV genome. The cap proteins (VP1, VP2, and VP3) form the virion capsid. The 5' and 3' flanking regions of the rap and cap open reading frames are 145 bp inverted terminal repeats (ITRs), the first 125 bp of which can form Y- or T-shaped duplex structures. The significance of the development of AAV vectors is that the entire rep and HU 226 205 The β1 cap domain can be deleted and replaced with a therapeutic or reporter transgene. See BJ Carter, Handbook of Parvoviruses, ed. P. Tijsser, CRC Press, pp. 155-168 (1990). It has been shown that the ITRs contain the minimal sequence required for replication, rescue, packaging, and integration into the AAV genome. Adeno-associated viruses (AAV) hold significant potential for gene therapy. The viral particles are very stable, and recombinant AAVs (rAAV) have “drug-like” characteristics, as rAAV can be purified by centrifugation or cesium chloride gradient. They are heat-stable and can be lyophilized to a powder and rehydrated to full activity. Their DNA is stably integrated into the host chromosome, allowing for long-term expression. They can be derived from a wide range of hosts, and AAV does not cause any known diseases, so recombinant vectors are nontoxic. Once introduced into the target cell, the sequences of interest can be identified using conventional techniques, such as nucleic acid hybridization using sequences that are homologous / complementary to the inserted gene sequences of the vector as probes. Alternatively, the sequences can be identified by the presence or absence of a "marker gene" function (e.g., thymidine kinase activity, antibiotic resistance, and the like) that is caused by the introduction of the expression vector into the target cell. Pharmaceutical forms and their administration The compounds of the invention may be formulated according to standard practice, for example, by being prepared in a carrier vehicle. The term "pharmaceutically acceptable carrier" refers to one or more organic or inorganic, natural or synthetic additives with which the mutant proto-oncogene or mutant oncoprotein is combined to facilitate administration. A suitable carrier includes sterile sodium chloride solution, although other aqueous or non-aqueous, isotonic, sterile solutions and sterile suspensions are known to those skilled in the art as pharmaceutically acceptable carriers. In this context, the term "carrier" includes liposomes and HIV-1 tat protein [see Chan et al., Anal. Biochem. 227, 168-175 (1995)], as well as any plasmids and viral expression vectors. Any of the novel polypeptides of the invention may be used in the form of a pharmaceutically acceptable salt. Suitable acids and bases capable of forming salts with the polypeptides of the invention are known to those skilled in the art, for example, inorganic and organic acids and bases. The compounds of the invention are administered to a subject in a therapeutically effective amount, which is that amount of the compound that achieves a medically desirable result or effect on the particular condition being treated. An effective amount of a compound of the invention is capable of attenuating or delaying the progression of a disease, degenerative or impaired condition. The effective amount may be determined on an individual basis and is based in part on consideration of the physical condition of the subject, the symptoms being treated, and the results being achieved. A therapeutically effective amount can be determined by one skilled in the art using such factors and routine experimentation. The liposome delivery system for the compounds of the invention may be any variation of unilamellar, multilamellar or stable plurilamellar vesicles and may be prepared and administered by methods known to those skilled in the art, for example as taught in USP 5,169,637, 4,762,915, 5,000,958 or 5,185,154. It may also be desirable to express the novel polypeptides of the invention, as well as other selected polypeptides, such as lipoproteins, in order to enhance their binding to liposomes. For example, treatment of human acute renal failure with liposome-encapsulated KIM protein may be accomplished in vivo by introducing KIM protein into cells in need of such treatment using liposomes. The liposomes may be delivered via a catheter to the renal artery.The recombinant KIM protein is purified from CHO cells, for example, by immunoaffinity chromatography or any other suitable method, then mixed with liposomes and delivered thereto with high efficiency. The encapsulated protein can be tested in vitro for its cell growth stimulating effect. The compounds of the invention may be administered by any medically acceptable route. This may be by injection, parenterally, e.g., intravenously, intravascularly, intraarterially, subcutaneously, intramuscularly, intratumorally, intraperitoneally, intraventricularly, intraepidurally, or otherwise, e.g., orally, nasally, ophthalmically, rectally, or topically. Delayed absorption after administration is also specifically contemplated by the invention, for example, by injections containing a reserve or by degradable implants. The invention particularly contemplates localized delivery, for example, via a catheter to one or more arteries, such as the renal artery or a vessel supplying a localized tumor. Although the above invention has been described in some detail for the purpose of illustration and the examples are provided for a clear understanding, it is evident that those skilled in the art will be able to make certain changes and modifications which do not exceed the claimed scope of the invention, which is limited only by the appended claims. Sequence listing SEQUENCE LISTING (2) INFORMATION FOR SEQ ID No: 1 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 2566 base pairs (Β) ΤΥΡΕ: nucleic acid HU 226 205 Β1 (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: (A) NAME / KEY: CDS (B) LOCATION: 615..1535 (xi) SEQUENCE DESCRIPTION: SEQ ID No: 1 GCGGCCGCGT CGACGGTGCC TGTGAGTAAA TAGATCAGGG TCTCCTTCAC AGCACATTCT 60 CCAGGAAGCC GAGCAAACAT TAGTGCTATT TTACCCAGGA GGAAATCTAG GTGTAGAGAG 120 CTCTACGGAT CTAAGGTTTG GATCTGTACC CAGTGCTTTT TTAGGTGTCT TTAGACATTT 180 CTCAGGAAGA TGTAGTCTCT GTCACCATGT GTGGCTGAAT TCTAGCTCAG TCCATCTTAT 240 TGTGTTTAAG GTAGTTGAAG TTTAGGAACC AACCAGTATG TCTCTGAGCA GAAGAGTACA 300 GTGTCCATCT TGAGGACAAG CTCATCTTTA CCATTAGAGG GCTGGCCTTG GCTTAGATTC 360 TACCGAGAAC ATACTCTCTA ATGGCTGCCC TCAGTTTTCT CTGTTTGCTG TCTTATTTGT 420 GTCATGGCCA GAAGTCATAT GGATGGCTCT ATGTGAGCAA GGACCCAGAT AGAAGAGTGT 480 ATTTGGGGGA ACAGGTTGCC CTAACAGAGA GTCCTGTGGG ATTCATGCAG TCAGGATGAA 540 GACCTGATCA GACAGAGTGT GCTGAGTGCC ACGGCTAACC AGAGTGACTT GTCACTGTCC 600 TTCAGGTCAA CACC ATG Met 1 GTT Val CAA CTT CAA GTC TTC Phe ATT Ile TCA Ser GGC Gly 10 CTC Leu CTG Leu 650 Gin Leu Gin 5 Val CTG CTT CTT CCA GGC TCT GTA GAT TCT TAT GAA GTA GTG AAG GGG GTG 698 Leu Leu Leu Pro Gly Ser Val Asp Ser Tyr Glu Val Val Lys Gly Val 15 20 25 GTG GGT CAC CCT GTC ACA ATT CCA TGT ACT TAC TCA ACA CGT GGA GGA 746 Val Gly His Pro Val Thr Ile Pro Cys Thr Tyr Ser Thr Arg Gly Gly 30 35 40 ATC ACA ACG ACA TGT TGG GGC CGG GGG CAA TGC CCA TAT TCT AGT TGT 794 Ile Thr Thr Thr Cys Trp Gly Arg Gly Gin Cys Pro Tyr Ser Ser Cys 45 50 55 60 CAA AAT ATA CTT ATT TGG ACC AAT GGA TAC CAA GTC ACC TAT CGG AGC 842 Gin Asn Ile Leu Ile Trp Thr Asn Gly Tyr Gin Val Thr Tyr Arg Ser 65 70 75 AGC GGT CGA TAC AAC ATA AAG GGG CGT ATT TCA GAA GGA GAC GTA TCC 890 Ser Gly Arg Tyr Asn Ile Lys Gly Arg Ile Ser Glu Gly Asp Val Ser 80 85 90 TTG ACA ATA GAG AAC TCT GTT GAT AGT GAT AGT GGT CTG TAT TGT TGC 938 Leu Thr Ile Glu Asn Ser Val Asp Ser Asp Ser Gly Leu Tyr Cys Cys 95 100 105 CGA GTG GAG ATT CCT GGATGG TTC AAC GAT CAG AAA ATG ACC TTT TCA 986 Arg Val Glu Ile Pro Gly Trp Phe Asn Asp Gin Lys Met Thr Phe Ser 110 115 120 TTG GAA GTT AAA CCA GAA ATT CCC ACA AGT CCT CCA ACA AGA CCC ACA 1034 Leu Glu Val Lys Pro Glu Ile Pro Thr Ser Pro Pro Thr Arg Pro Thr 125 130 135 140 ACT ACA AGA CCC ACA ACC ACA AGG CCC ACA ACT ATT TCA ACA AGA TCC 1082 Thr Thr Arg Pro Thr Thr Arg Pro Thr Thr Ile Ser Thr Arg Ser 145 150 155 HU 226 205 B1 ACA Thr CAT His GTA Val CCA Pro 160 ACA TCA ACC Thr AGA Arg GTC Val 165 TCC Ser ACC Thr TCT Ser ACT Thr CCA Pro 170 ACA Thr CCA Pro 1130 Thr Ser GAA CAA ACA CAG ACT CAC AAA CCA GAA ATC ACT ACA TTT TAT GCC CAT 1178 Glu Gin Thr Gin Thr His Lys Pro Glu Ile Thr Thr Phe Tyr Ala His 175 180 185 GAG ACA ACT GCT GAG GTG ACA GAA ACT CCA TCA TAT ACT CCT GCA GAC 1226 Glu Thr Thr Ala Glu Val Thr Glu Thr Pro Ser Tyr Thr Pro Ala Asp 190 195 200 TGG AAT GGC ACT GTG ACA TCC TCA GAG GAG GCC TGG AAT AAT CAC ACT 1274 Trp Asn Gly Thr Val Thr Ser Ser Glu Glu Ala Trp Asn Asn His Thr 205 210 215 220 GTA AGA ATC CCT TTG AGG AAG CCG CAG AGA AAC CCG ACT AAG GGC TTC 1322 Val Arg Ile Pro Leu Arg Lys Pro Gin Arg Asn Pro Thr Lys Gly Phe 225 230 235 TAT GTT GGC ATG TCC GTT GCA GCC CTG CTG CTG CTG CTG CTT GCG AGC 1370 Tyr Val Gly Met Ser Val Ala Ala Leu Leu Leu Leu Leu Leu Ala Ser 240 245 250 ACC GTG GTT GTC ACC AGG TAC ATC ATT ATA AGA AAG AAG ATG GGC TCT 1418 Thr Val Val Val Thr Arg Tyr Ile Ile Ile Arg Lys Lys MetGly Ser 255 260 265 CTG AGC TTT GTT GCC TTC CAT GTC TCT AAG AGT AGA GCT TTG CAG AAC 1466 Leu Ser Phe Val Ala Phe His Val Lys Ser Arg Ala Leu Gin Asn 270 275 280 GCTAA GGTAC GACAT CCG ATT ATT ATT GAA 1514 Ala Ala Ile Val His Pro Arg Ala Glu Asp Asn Ile Tyr Ile Ile Glu 285 290 295 300 GAT AGA TCT CGA GGT GCA GAA TGAGTCCCAG AGGCCTTCTG TGGGGCCTTC 15 Ser65 Ar65 Asp Arg 305 TGCCTGGGAT TACAGAGATC GTGACTGATT TCACAGAGTA AAATACCCAT TCCAGCTCCT 1625 GGGAGATTTT GTGTTTTGGT TCTTCCAGCT GCAGTGGAGA GGGTAACCCT CTACCCTGTA 1685 TATGCAAAAC TCGAGGTTAA CAATGCAATCCATCCATCCTT TCAGTGTCTC 1745 CACTCACTGC AGCGATTCTC TCAAATGTGA ACATTTTAGA AGTTTGTGTT TCCTTTTGTC 1805 CATGTAATCA TTGGTAATAC AAGAATTTTA TCTTGTTTAT TAAAACCATT AATGAGAGGG 1865 GAATAGGACTG TAGAAGGAGGG CTCCTGAATT TAGAAGCACT TCATGATTGT 1925 GTTTATCTCT TTTATTGTAA TTTGAAATGT TACTTCTATC CTTCCCAAGG GGCAAAATCA 1985 TGGGAGCATG GAGGTTTTAA TTGCCCTCAT AGATAAGTAG AAGAAGAGAG TCCAATA20GCTAGATG5 TGGTTATGCT TTCTCACAGC TCTGGAAATA TGATCATTTA TTATGCAGTT 2105 GATCTTAGGA TGAGGATGGG TTTCTTAGGA GGAGAGGTTA CCATGGTGAG TGGACCAGGC 2165 ACACATCAGG GGAAGAAAAC AATGGATCGATTGATTGATTGACTCATTCATTCATT 2225 CCACTTCTGT CTTGATGCTC AGTGTTCCTA AACTCACCCA CTGAGCTCTG AATTAGGTGC 2285 AGGGAGGAGA CGTGCAGAAA CGAAAGAGGA AAGAAAGGAG AGAGAGCAGG ACACAGGCTT 2345 TCTGCTGAGA TGAGGTTCGTGTTGTT GGACTACCAC GGGTTTCCTT 2405CAGACTTCTA AGTTTCTAAA TCACTATCAT GTGATCATAT TTATTTTTAA AATTATTTCA 2465 GAAAGACACC ACATTTTCAA TAATAAATCA GTTTGTCACA ΑΤΤΑΑΤΆΑΑΑ TATTTTGTTT 2525 GCTAAGAAGT AAAAAAAAAA AAAAAAAGTC GACGCGGCCG C2566 HU 226 205 Β1 (2) INFORMATION FOR SEQ ID No: 2 (I) SEQUENCE CHARACTERISTICS: (A) LENGTH: 2084 base pairs (Β) ΤΥΡΕ: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (li) ΤΥΡΕ MOLECULE: cDNA (ix) FEATURE: (A) NAME / KEY: CDS (B) LOCATION: 145..1065 (xi) SEQUENCE DESCRIPTION: SEQ ID No: 2 GCGGCCGCGT CGACGGTGCC TGTGAGTAAA TAGATCAGGG TCTCCTTCAC AGCACATTCT 60 CCAGGAAGCC GAGCAAACAT TAGTGCTATT TTACCCAGGA GGAAATCTAG GTGTAGAGAG CTCTACGGAT CTAAGGTCAA CACC ATG GTT CAA CTT CAA GTC TTC ATT TCA 171 Click Download to save Met Val Gin Leu Gin Val Phe Ile Ser mp3 youtube com 5 GGC Gly 10 CTC Leu CTG CTG CTT Leu CTT Leu 15 CCA Pro GGC Gly TCT Ser GTA Val GAT Asp 20 TCT Ser TAT Tyr GAA Glu GTA Val GTG Val 25 219 Leu Leu AAG GGG GTG GTG GGT CAC CCT GTC ACA ATT CCA TGT ACT TAC TCA ACA 267 Lys Gly Val Val Gly His Pro Val Thr Ile Pro Cys Thr Tyr Ser Thr 30 35 40 CGT GGA GGA ATC ACA ACG ACA TGT TGG GGC CGG GGG CAA TGC CCA TAT 315 Arg Gly Gly Ile Thr Thr Thr Cys Trp Gly Arg Gly Gin Cys Pro Tyr 45 50 55 TCT AGT TGT CAA AAT ATA CTT ATT TGG ACC AAT GGA TAC CAA GTC ACC 363 Ser Ser Cys Gin Asn Ile Leu Ile Trp Thr Asn Gly Tyr Gin Val Thr 60 65 70 TAT CGG AGC AGC GGT CGA TAC AAC ATA AAG GGG CGT ATT TCA GAA GGA 411 Tyr Arg Ser Ser Gly Arg Tyr Asn Ile Lys Gly Arg Ile Ser Glu Gly 75 80 85 GAC GTA TCC TTG ACA ATA GAG AAC TCT GTT GAT AGT GAT AGT GGT CTG 459 Asp Val Ser Leu Thr Ile Glu Asn Ser Val Asp Ser Asp Ser Gly Leu 90 95 100 105 TAT TGT TGC CGA GTG GAG ATT CCT GGA TGG TTC AAC GAT CAG AAA ATG 507 Tyr Cys Cys Arg Val Glu Ile Pro Gly Trp Phe Asn Asp Gin Lys Met 110 115 120ACC TTT TCA TTG GAA GTT AAA CCA GAA ATT CCC ACA AGT CCT CCA ACA 555 Thr Phe Ser Leu Glu Val Lys Pro Glu Ile Pro Thr Ser Pro Pro Thr 125 130 135 AGA CCC ACA ACT ACA AGA CCC ACA ACC ACA AGG CCC ACA ACT ATT TCA 603 Arg Pro Thr Thr Arg Pro Thr Thr Arg Pro Thr Thr Ile Ser 140 145 150 HU 226 205 B1 ACA AGA Thr Arg TCC Ser ACA Thr CAT His GTA Val CCA Pro 160 ACA TCA ACC AGA Arg GTC Val 165 TCC Ser ACC Thr TCT Ser ACT Thr 651 Thr Ser Thr 155 CCA ACA CCA GAA CAA ACA CAG ACT CAC AAA CCA GAA ATC ACT ACA TTT 699 Pro Thr Pro Glu Gin Thr Gin Thr His Lys Pro Glu Ile Thr Thr Phe 170 175 180 185 TAT GCC CAT GAG ACA ACT GCT GAG GTG ACA GAA ACT CCA TCA TAT ACT 747 Tyr Alá His Glu Thr Thr Alá Glu Val Thr Glu Thr Pro Ser Tyr Thr 190 195 200 CCT GCA GAC TGG AAT GGC ACT GTG ACA TCC TCA GAG GAG GCC TGG AAT 795 Pro Alá Asp Trp Asn Gly Thr Val Thr Ser Ser Glu Glu Alá Trp Asn 205 210 215 AAT CAC ACT GTA AGA ATC CCT TTG AGG AAG CCG CAG AGA AAC CCG ACT 843 Asn His Thr Val Arg Ile Pro Leu Arg Lys Pro Gin Arg Asn Pro Thr 220 225 230 AAG GGC TTC TAT GTT GGC ATG TCC GTT GCA GCC CTG CTG CTG CTG CTG 891 Lys Gly Phe Tyr Val Gly Met Ser Val Alá Alá Leu Leu Leu Leu Leu 235 240 245 CTT GCG AGC ACC GTG GTT GTC ACC AGG TAC ATC ATT ATA AGA AAG AAG 939 Leu Alá Ser Thr Val Val Val Thr Arg Tyr Ile Ile Ile Arg Lys Lys250 255 260 265 ATG GGC TCT CTG AGC TTT GTT GCC TTC CAT GTC TCT AAG AGA GCT 987 Met Gly Ser Leu Ser Phe Val Alá Phe His Val Ser GGC GGTCAG CAG GAA GAC AAC ATC TAC 1035 Leu Gin Asn Alá Alá Ile Val His Pro Arg Alá Glu Asp Asn Ile Tyr 285 290 295 ATT ATT GAA GAT AGA TCT CGA GGT GCA GAA TGAGTCCCAG AGGCCTTCTG 1 Serág Argle Argle Gly Asp Ile 300 305 TGGGGCCTTC TGCCTGGGAT TACAGAGATC GTGACTGATT TCACAGAGTA AAATACCCAT 1145 TCCAGCTCCT GGGAGATTTT GTGTTTTGGT TCTTCCAGCT GCAGTGGAGA GGGTAACCCT 1205 CTACCCTGTA TATGCAAAAC CAGCAACACC 1265 TCAGTGTCTC CACTCACTGC AGCGATTCTC TCAAATGTGA ACATTTTAGA AGTTTGTGTT 1325 TCCTTTTGTC CATGTAATCA TTGGTAATAC AAGAATTTTA TCTTGTTTAT TAAAACCATT 1385 AATGAGAGGGAT TAGAAGGAGGACTGTT TGGGAAGGGC CTCCTGAATT TAGAAGCACT 1445 TCATGATTGT GTTTATCTCT TTTATTGTAA TTTGAAATGT TACTTCTATC CTTCCCAAGG 1505 GGCAAAATCA TGGGAGCATG GAGGTTTTAA TTGCCCTCAT AGATAAGTAG AAGGAAGTCAT655 CCAATAGAGG TGGTTATGCT TTCTCACAGC TCTGGAAATA TGATCATTTA 1625 TTATGCAGTT GATCTTAGGA TGAGGATGGG TTTCTTAGGA GGAGAGGTTA CCATGGTGAG 1685 TGGACCAGGC ACACATCAGG GGAAGAAAGAGATCGATCGATTGAGTTAA 1745 CATTTCCACT CCACTTCTGT CTTGATGCTC AGTGTTCCTA AACTCACCCA CTGAGCTCTG 1805 AATTAGGTGC AGGGAGGAGA CGTGCAGAAA CGAAAGAGGA AAGAAAGGAG AGAGAGCAGG 1865 ACACAGGCTT TGAGAGCGTTGATTGA GGACTACCAC 1925GGGTTTCCTT CAGACTTCTA AGTTTCTAAA TCACTATCAT GTGATCATAT TTATTTTTAA 1985 AATTATTTCA GAAAGACACC ACATTTTCAA TAATAAATCA GTTTGTCACA ATTAATAAAA 2045 TATTTTGTTT GCTAAGAAGT AAAAAGTCGA CGCGGCCGC 2084 HU 226 205 Β1 (2) INFORMATION FOR SEQ ID No: 3 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 307 amino acids (Β) ΤΥΡΕ: amino acid (D) TOPOLOGY: linear (ii) MOLECULAR ΤΥΡΕ: protein (xi) SEQUENCE DESCRIPTION: SEQ ID No: . Met 1 Val Gin Leu Gin 5 Val Phe Ile Gly Ser Val Asp 20 Ser Tyr Glu Val Val Thr Ile 35 Pro Cys Thr Tyr Ser 40 Cys Trp 50 Gly Arg Gly Gin Cys 55 Pro Ile 65 Trp Thr Asn Gly Tyr 70 Gin Val Asn Ile Lys Gly Arg 85 Ile Ser Glu Asn Ser Val Asp 100 Ser Asp Ser Gly Pro Gly Trp 115 Phe Asn Asp Gin Lys 120 Pro Glu 130 Ile Pro Thr Ser Pro 135 Pro Thr 145 Thr Thr Arg Pro Thr 150 Thr Ile Thr Ser Thr Arg Val 165 Ser Thr Ser Thr His Lys Pro 180 Glu Ile Thr Thr Glu Val Thr 195 Glu Thr Pro Ser Tyr 200 Val Thr 210 Ser Ser Glu Glu Alá 215 Trp Leu 225 Arg Lys Pro Gin Arg 230 Asn Pro Ser Val Alá Alá Leu Leu Leu Leu 245 Ser Gly Leu Leu Leu Leu Leu Pro 10 15 Val Lys Gly Val Val Gly His Pro 25 30 Thr Arg Gly Gly Ile Thr Thr Thr 45 Tyr Ser Ser Cys Gin Asn Ile Leu 60 Thr Tyr Arg Ser Ser Gly Arg Tyr 75 80 Gly Asp Val Ser Leu Thr Ile Glu 90 95 Leu Tyr Cys Cys Arg Val Glu Ile 105 110 Met Thr Phe Ser Leu Glu Val Lys 125 Thr Arg Pro Thr Thr Thr Arg Pro 140 Ser Thr Arg Ser Thr His Val Pro 155 160 Thr Pro Thr Pro Glu Gin Thr Gin 170 175 Phe Tyr Alá His Glu Thr Thr Alá 185 190 Thr Pro Alá Asp Trp Asn Gly Thr 205 Asn Asn His Thr Val Arg Ile Pro 220 Thr Lys Gly Phe Tyr Val Gly Met 235 240 Leu Leu Ala Ser Thr Val Val Val HU 226 205 Β1 Thr Arg Tyr Ile Ile Ile Arg Lys Lys Met Gly Ser Leu Ser Phe Val 260 265 270 Alá Phe His Val Ser Lys Ser Arg Alá Leu Gin Asn Alá Alá Ile Val 275 280 285 His Pro Arg Alá Glu Arg Arg Asp Ile Asn Gly Tyr Ile 295 300 Gly Ala Glu 305 (2) INFORMATION FOR SEQ ID No: 4 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 2303 base pairs (Β) ΤΥΡΕ: nucleic acid (C) STRANDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE ΤΥΡΕ: cDNA (ix) FEATURE: (A) NAME / KEY: CDS (B) LOCATION: 107..1822 (xi) SEQUENCE DESCRIPTION: SEQ ID No: 4 GCGGCCGCGT CGACTCGCAG GAGGCCGGCA CTCTGACTCC TGGTGGATGG GACTAGGGAG 60 TCAGAGTCAA GCCCTGACTG GCTGAGGGCG GGCGCTCCGA GTCAGC ATG GAA AGT 115 Met Glu Ser 1 CTC Leu TGC Cys 5 GGG GTC Gly Val CTG Leu GTA Val TTT Phe 10 CTG Leu CTG Leu CTG Leu GCT Alá GCA Alá 15 GGA Gly CTG Leu CCG Pro CTC Leu 163 CAG GCG GCC AAG CGG TTC CGT GAT GTG CTG GGC CAT GAG CAG TAT CCG 211 Gin Alá Alá Lys Arg Phe Arg Asp Val Leu Gly His Glu Gin Tyr Pro 20 25 30 35 GAT CAC ATG AGG GAG AAC AAC CAA TTA CGT GGC TGG TCT TCA GAT GAA 259 Asp His Met Arg Glu Asn Asn Gin Leu Arg Gly Trp Ser Ser Asp Glu 40 45 50 AAT GAA TGG GAT GAA CAG CTG TAT CCA GTG TGG AGG AGG GGA GAG GGC 307 Asn Glu Trp Asp Glu Gin Leu Tyr Pro Val Trp Arg Arg Gly Glu Gly 55 60 65 AGA TGG AAG GAC TCC TGG GAA GGA GGC CGT GTG CAG GCA GCC CTA ACC 355 Arg Trp Lys Asp Ser Trp Glu Gly Gly Arg Val Gin Alá Alá Leu Thr 70 75 80 AGT GAT TCA CCG GCC TTG GTG GGT TCC AAT ATC ACC TTC GTA GTG AAC 403 Ser Asp Ser Pro Alá Leu Val Gly Ser Asn Ile Thr Phe Val Val Asn 85 90 95 CTG GTG TTC CCC AGA TGC CAG AAG GAA GAT GCC AAC GGC AAT ATC GTC 451 Leu Val Phe Pro Arg Cys Gin Lys Glu Asp Alá Asn Gly Asn Ile Val 100 105 110 115 HU 226 205 B1 TAT Tyr GAG AGG AAC Glu Arg Asn TGC Cys 120 AGA Arg AGT Ser GAT Asp TTG Leu GAG Glu 125 CTG Leu GCT Alá TCT Ser GAC Asp CCG Pro 130 TAT Tyr 499 GTC TAC AAC TGG ACC ACA GGG GCA GAC GAT GAG GAC TGG GAA GAC AGC 547 Val Tyr Asn Trp Thr Thr Gly Alá Asp Asp Glu Asp Trp Glu Asp Ser 135 140 145 ACC AGC CAA GGC CAG CAC CTC AGG TTC CCC GAC GGG AAG CCC TTC CCT 595 Thr Ser Gin Gly Gin His Leu Arg Phe Pro Asp Gly Lys Pro Phe Pro 150 155 160 CGC CCC CAC GGA CGG AAG AAA TGG AAC TTC GTC TAC GTC TTC CAC ACA 643 Arg Pro His Gly Arg Lys Lys Trp Asn Phe Val Tyr Val Phe His Thr 165 170 175 CTT GGT CAG TAT TTT CAA AAG CTG GGT CGG TGT TCA GCA CGA GTT TCT 691 Leu Gly Gin Tyr Phe Gin Lys Leu Gly Arg Cys Ser Alá Arg Val Ser 180 185 190 195 ATA AAC ACA GTC AAC TTG ACA GTT GGC CCT CAG GTC ATG GAA GTG ATT 739 Ile Asn Thr Val Asn Leu Thr Val Gly Pro Gin Val Met Glu Val Ile 200 205 210 GTC TTT CGA AGA CAC GGC CGG GCA TAC ATT CCC ATC TCC AAA GTG AAA 787 Val Phe Arg Arg His Gly Arg Alá Tyr Ile Pro Ile Ser Lys Val Lys215 220 225 GAC GTG TAT GTG ATA ACA GAT CAG ATC CCT ATA TTC GTG ACC ATG TAC 835 Asp Val Tyr Val Ile Thr Asp Gin Ile Pro Ile Phe Val Thr Met Tyr 230 235 240 CAG AAG AAT GAC CGG AAC TCG TCT GAT GAA ACC TTC CTC AGA GAC CTC 883 Gin Lys Asn Asp Arg Asn Ser Ser Asp Glu Thr Phe Leu Arg Asp Leu 245 250 255 CCC ATT TTC TTC GAT GTC CTC ATT CAC GAT CCC AGT CAT TTC CTC AAC 931 Pro Ile Phe Phe Asp Val Leu Ile His Asp Pro Ser His Phe Leu Asn 260 265 270 275 TAC TCT GCC ATT TCC TAC AAG TGG AAC TTT GGG GAC AAC ACT GGC CTG 979 Tyr Ser Alá Ile Ser Tyr Lys Trp Asn Phe Gly Asp Asn Thr Gly Leu 280 285 290 TTT GTC TCC AAC AAT CAC ACT TTG AAT CAC ACG TAT GTG CTC AAT GGA 1027 Phe Val Ser Asn Asn His Thr Leu Asn His Thr Tyr Val Leu Asn Gly 295 300 305 ACC TTC AAC TTT AAC CTC ACC GTG CAA ACT GCA GTG CCG GGA CCA TGC 1075 Thr Phe Asn Phe Asn Leu Thr Val Gin Thr Alá Val Pro Gly Pro Cys 310 315 320 CCC TCA CCC ACA CCT TCG CCT TCT TCT TCG ACT TCT CCT TCG CCT GCA 1123 Pro Ser Pro Thr Pro Ser Pro Ser Ser Ser Thr SerPro Ser Pro Alá 325 350 335 TCT TCG CCT TCA CCC ACA TTA TCA ACA CCT AGT CCC TCT TTA ATG CCT 1171 Ser Ser Pro Ser Pro Thr Leu Ser Thr Pro Ser Pro Ser Leu Met Pro 340 345 350 355 HU 226 205 Β1 ACT Thr GGC Gly CAC His AAA Lys TCC Ser 360 ATG Met GAG Glu CTG Leu AGT Ser GAC Asp 365 ATT Ile TCC Ser AAT Asn GAA Glu AAC Asn 370 TGC Cys 1219 CGA ATA AAC AGA TAT GGT TAC TTC AGA GCC ACC ATC ACA ATT GTA GAT 1267 Arg Ile Asn Arg Tyr Gly Tyr Phe Arg Alá Thr Ile Thr Ile Val Asp 375 380 385 GGA ATC CTA GAA GTC AAC ATC ATC CAG GTA GCA GAT GTC CCA ATC CCC 1315 Gly Ile Leu Glu Val Asn Ile Ile Gin Val Alá Asp Val Pro Ile Pro 390 395 400 ACA CCG CAG CCT GAC AAC TCA CTG ATG GAC TTC ATT GTG ACC TGC AAA 1363 Thr Pro Gin Pro Asp Asn Ser Leu Met Asp Phe Ile Val Thr Cys Lys 405 410 415 GGG GCC ACT CCC ACG GAA GCC TGT ACG ATC ATC TCT GAC CCC ACC TGC 1411 Gly Alá Thr Pro Thr Glu Alá Cys Thr Ile Ile Ser Asp Pro Thr Cys 420 425 430 435 CAG ATC GCC CAG AAC AGG GTG TGC AGC CCG GTG GCT GTG GAT GAG CTG 1459 Gin Ile Alá Gin Asn Arg Val Cys Ser Pro Val Alá Val Asp Glu Leu 440 445 450 TGC CTC CTG TCC GTG AGG AGA GCC TTC AAT GGG TCC GGC ACG TAC TGT 1507 Cys Leu Leu Ser Val Arg Arg Alá Phe Asn Gly Ser Gly ThrTyr Cys 455 460 465 GTG AAT TTC ACT CTG GGA GAC GAT GCA AGC CTG GCC CTC ACC AGC GCC 1555 Val Asn Phe Thr Leu Gly Asp Asp Alá Ser Leu Alá GC Leu Thr Ser Alá 470 TCT GCTA ACTG ATC480 GGC TCC CCT CTG AGA ACA GTG 1603 Leu Ile Ser Ile Pro Gly Lys Asp Leu Gly Ser Pro Leu Arg Thr Val 485 490 495 AAT GGT GTC CTG ATC TCC ATT GGC TGC CTG GCC ATG ITT GTC Ser Gly Gly ACC ATG Leu Alá Met Phe Val Thr Met 500 505 510 515 GTT ACC ATC TTG CTG TAC AAA CAC AAG ACG TAC AAG CCA ATA GGA 1699 Val Thr Ile Leu Leu Tyr Lys A Lys His 03 Thr CC 5 Tyr 5 AC T GC Pro G AGG AAC GTG GTC AAG GGC AAA GGC CTG AGT GTT TTT CTC 1747 Asn Cys Thr Arg Asn Val Val Lys Gly Lys Gly Leu Ser Val Phe Leu 535 540 545 AGC CAT GCA AAA GCC CCG TAG TAG AAG7 CGA His Ser GGA GAC Lys Alá Pro Phe Ser Arg Gly Asp Arg Glu Lys Asp Pro 550 555 560 CTG CTC CAG GAC AAG CCA TGG ATG CTC TAAGTCTTCA CTCTCACTTC 1842 Leu Leu Gin Asp Lys Pro Trp Met Leu 565 570 TGACTGGGAA CCCACTCTTC TGTGCATGTA TGTGAGCTGT GCAGAAGTAC ATGACTGGTA 1902 GCTGTTGTTT TCTACGGATT ATTGTAAAAT GTATATCATG GTTTAGGGAG CGTAGTTAAT 1962 TGGCATTTTA GTGAAGGAGGTTCA GTAGGACTGTTCA GTGGTTTTTA 2022 TACTGTTAAT AGGGTGGGCA CATTGTGTCT GAAGGGGGAG GGGGAGGTCA CTGCTACTTA 2082 HU 226 205 Β1 AGGTCCTAGG TTAACTGGGA GAGGATGCCC CAGGCTCCTT AGATTTCTAC ACAAGATGTG CCTGAACCCA GCTAGTCCTG ACCTAAAGGC CATGCTTCAT CAACTCTATC TCAGCTCATT GAACATACCT GAGCACCTGA TGGAATTATC ATGGAACCATTTAGGGTTACTAGTGGGGTTTAGT GATACTCATT AAAAAGACAG TCTATTAAAA A (2) INFORMATION FOR SEQ ID No: 5 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 572 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID No: 5 Met Glu Ser Leu Cys Gly Val Leu Val Phe Leu Leu Leu Ala Ala Gly 15 10 15 Leu Pro Leu Gin Ala Ala Lys Arg Phe Arg Asp Val Leu Gly His Glu 20 25 30 Gin Tyr Pro Asp His Met Arg Glu Asn Asn Gin Leu Arg Gly Trp Ser 35 40 45 Ser Asp Glu Asn Glu Trp Asp Glu Gin Leu Tyr Pro Val Trp Arg Arg 50 55 60 Gly Glu Gly Arg Trp Lys Asp Ser Trp Glu Gly Gly Arg Val Gin Alá 65 70 75 80 Alá Leu Thr Ser Asp Ser Pro Alá Leu Val Gly Ser Asn Ile Thr Phe 85 90 95 Val Val Asn Leu Val Phe Pro Arg Cys Gin Lys Glu Asp Alá Asn Gly 100 105 110 Asn Ile Val Tyr Glu Arg Asn Cys Arg Ser Asp Leu Glu Leu Alá Ser 115 120 125 Asp Pro Tyr Val Tyr Asn Trp Thr Thr Gly Alá Asp Asp Glu Asp Trp 130 135 140 Glu Asp Ser Thr Ser Gin Gly Gin His Leu Arg Phe Pro Asp Gly Lys 145 150 155 160 Pro Phe Pro Arg Pro His Gly Arg Lys Lys Trp Asn Phe Val Tyr Val 165 170 175 Phe His Thr Leu Gly Gin Tyr Phe Gin Lys Leu Gly Arg Cys Ser Alá 180 185 190 Arg Val Ser Ile Asn Thr Val Asn Leu Thr Val Gly Pro Gin Val Met 195 200 205 Glu Val Ile Val Phe Arg Arg His Gly Arg Alá Tyr Ile Pro Ile Ser 210 215 220 Lys Val Lys Asp Val Tyr Val Ile Thr Asp Gin Ile Pro Ile Phe Val 225 230 235 240 2142 2202 2262 2303 HU 226 205 Β1 Thr Met Tyr Gin Lys Asn Asp Arg Asn Ser Ser Asp Glu Thr Phe Leu 245 250 255 Arg Asp Leu Pro Ile Phe Phe Asp Val Leu Ile His Asp Pro Ser His 260 265 270 Phe Leu Asn Tyr Ser Alá Ile Ser Tyr Lys Trp Asn Phe Gly Asp Asn 275 280 285 Thr Gly Leu Phe Val Ser Asn Asn His Thr Leu Asn His Thr Tyr Val 290 295 300 Leu Asn Gly Thr Phe Asn Phe Asn Leu Thr Val Gin Thr Alá Val Pro 305 310 315 320 Gly Pro Cys Pro Ser Pro Thr Pro Ser Pro Ser Ser Ser Thr Ser Pro 325 330 335 Ser Pro Alá Ser Ser Pro Ser Pro Thr Leu Ser Thr Pro Ser Pro Ser 340 345 350 Leu Met Pro Thr Gly His Lys Ser Met Glu Leu Ser Asp Ile Ser Asn 355 360 365 Glu Asn Cys Arg Ile Asn Arg Tyr Gly Tyr Phe Arg Alá Thr Ile Thr 370 375 380 Ile Val Asp Gly Ile Leu Glu Val Asn Ile Ile Gin Val Alá Asp Val 385 390 395 400 Pro Ile Pro Thr Pro Gin Pro Asp Asn Ser Leu Met Asp Phe Ile Val 405 410 415 Thr Cys Lys Gly Alá Thr Pro Thr Glu Alá Cys Thr Ile Ile Ser Asp 420 425 430 Pro Thr Cys Gin Ile Alá Gin Asn Arg Val Cys Ser Pro Val Alá Val 435 440 445 Asp Glu Leu Cys Leu Leu Ser Val Arg Arg Alá Phe Asn Gly Ser Gly 450 455 460 Thr Tyr Cys Val Asn Phe Thr Leu Gly Asp Asp Alá Ser Leu Alá Leu 465 470 475 480 Thr Ser Alá Leu Ile Ser Ile Pro Gly Lys Asp Leu Gly Ser Pro Leu 485 490 495 Arg Thr Val Asn Gly Val Leu Ile Ser Ile Gly Cys Leu Alá Met Phe 500 505 510 Val Thr Met Val Thr Ile Leu Leu Tyr Lys Lys His Lys Thr Tyr Lys 515 520 525 Pro Ile Gly Asn Cys Thr Arg Asn Val Val Lys Gly Lys Gly Leu Ser 530 535 540 Val Phe Leu Ser His Ala Lys Ala Pro Phe Ser Arg Gly Asp Arg Glu 545 550 555 560 HU 226 205 Β1 Lys Asp Pro Leu Leu Gin Asp Lys Pro Trp Met Leu 565 570 (2) INFORMATION FOR SEQ ID No: 6 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1795 base pairs (Β) ΤΥΡΕ: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE ΤΥΡΕ: cDNA (ix) FEATURE: (A) NAME / KEY: CDS (B) LOCATION: 278..1279 (xi) SEQUENCE DESCRIPTION: SEQ ID No: 6 GCGGCCGCGT CGACGAAGCT GGGAAGTCAG GGGCTGTTTC TGTGGGCAGC TTTCCCTGTC 60 CTTTGGAAGG CACAGAGCTC TCAGCTGCAG GGAACTAACA GAGCTCTGAA GCCGTTATAT 120 GTGGTCTTCT CTCATTTCCA GCAGAGCAGG CTCATATGAA TCAACCAACT GGGTGAAAAG 180 ATAAGTTGCA ATCTGAGATT TAAGACTTGA TCAGATACCA TCTGGTGGAG GGTACCAACC 240 AGCCTGTCTG CTCATTTTCC TTCAGGCTGA TOCCATA ATG CAT CCT CAA GTG GTC 295 Met His Pro Gin Val Val 1 5 ATC TTA AGC CTC ATC CTA CAT CTG GAT GAT Ile Leu Ser Leu 10 Ile Leu His Leu Ala 15 Asp AAG GTT GGT GGA GAG GCA GGT CCA TCT GTC Lys Val Gly 25 Gly Glu Ala Gly Pro 30 Ser Val AGT GGA T Val GCT GATG Ala TGC ACA Thr Ser Met 45 Cys Trp Asn TTC ACA TGC CAA AAT GGC ATT GTC TGG ACC Phe 55 Thr Cys Gin Asn Gly 60 Ile Val Trp Thr TAT CGG AAG GAC ACA CGC TAT AAG CTA TTG Tyr Arg Lys CT Le Asp Gt TC Le CC LysG Tyr 75 Tyr Arg ATA GAA AAT ACA GCT Asp Val Ser Leu 90 Thr Ile Glu Asn Thr 95 Ala TAT TGT TGC CGT GTT GAG CAC CGT GGG TGT Tyr Cys Cys 105 Arg Val Glu His Arg 110 Gly Trp ACC GTA TCA TTAG IthG Thr GAG CAG ATT Val 125 Pro Pro Lys TCT GTA GCT GGT TCT GTA 343 Ser Val Ala Gly Ser Val ACA CTA CCC TGC CAC TAC 391 Thr Leu Pro How His Tyr AGA GGC TCA TGT TCT CTA 439 Arg Gly Ser Cys Ser Leu AAT GGA ACC CAC GTC ACC 487 Asn Gly Thr His Val Thr 70 GGG GAC CTT TCA AGA AGG 535 Gly Asp Leu Ser Arg Arg GTG TCT GAC AGT GGC GTA 583 Val Ser Asp Ser Gly Val 100 TTC AAT GAC ATG AAA ATC 631 Phe Asn Asp Met Lys Ile 115 GTC ACG ACT ACT CCA ATT 679 Val Thr Thr Thr Pro Ile 130 HU 226 205 Β1 GTC Val 135 ACA ACT GTT Val CCA Pro ACC Thr 140 GTC Val ACG Thr ACT Thr GTT Val CGA Arg 145 ACG Thr AGC Ser ACC Thr ACT Thr GTT Val 150 727 Thr Thr CCA ACG ACA ACG ACT GTT CCA ACG ACA ACT GTT CCA ACA ACA ATG AGC 775 Pro Thr Thr Thr Thr Val Pro Thr Thr Thr Val Pro Thr Thr Met Ser 155 160 165 ATT CCA ACG ACA ACG ACT GTT CCG ACG ACA ATG ACT GTT TCA ACG ACA 823 Ile Pro Thr Thr Thr Thr Val Pro Thr Thr Met Thr Val Ser Thr Thr 170 175 180 ACG AGC GTT CCA ACG ACA ACG AGC ATT CCA ACA ACA ACA AGT GTT CCA 871 Thr Ser Val Pro Thr Thr Thr Ser Ile Pro Thr Thr Thr Ser Val Pro 185 190 195 GTG ACA ACA ACG GTC TCT ACC TTT GTT CCT CCA ATG CCT TTG CCC AGG 919 Val Thr Thr Thr Val Ser Thr Phe Val Pro Pro Met Pro Leu Pro Arg 200 205 210 CAG AAC CAT GAA CCA GTA GCC ACT TCA CCA TCT TCA CCT CAG CCA GCA 967 Gin Asn His Glu Pro Val Alá Thr Ser Pro Ser Ser Pro Gin Pro Alá 215 220 225 230 GAA ACC CAC CCT ACG ACA CTG CAG GGA GCA ATA AGG AGA GAA CCC ACC 1015 Glu Thr His Pro Thr Thr Leu Gin Gly Alá Ile Arg Arg Glu ProThr 235 240 245 AGC TCA CCA TTG TAC TCT TAC ACA ACA GAT GGG AAT GAC ACC GTG ACA 1063 Ser Ser Pro Leu Tyr Ser Tyr Thr Asp Gly Asn Asp Thr Val Thr 250 255 GAT TCA T60 GAT GAG TGC ACT CAA CTG TTC CTA 1111 Glu Ser Ser Asp Gly Leu Trp Asn Asn Asn Gin Thr Gin Leu Phe Leu 265 270 275 GAA CAT AGT CTA CTG ACG AAT ACC ACT AAA GGA ATC TAT GGA Thr Thary Thár Lyu Aslu Asp Ile Tyr Alá Gly 280 285 290 GTC TGT ATT TCT GTC TTG GTG CTT CTT GCT CTT TTG GGT GTC ATC ATT 1207 Val Cys Ile Ser Val Leu Val Leu Alá Leu Leu Gly Val Ile 295 A GCC5 ATC 300 ATC AAG GAG GTT CAA CAA CTA AGA CCC CAT 1255 Alá Lys Lys Tyr Phe Phe Lys Glu Val Gin Leu Arg Pro His 315 320 325 AAA TCC TGT ATA CAT CAA AGA GAA TAGTCCCTGG AAACATAGCAACTS Hig1 CAA30Ys 330 TATCTTGGCC ATCACAGCTG TCCAGAAGAG GGGAATCTGT CTTAAAAACC AGCAAATCCA 1369 ACGTGAGACT TCATTTGGAA GCATTGTATG ATTATCTCTT GTTTCTATGT TATACTTCCA 1429 AATGTTGCAT TTCCTATGTT TTCCAAAGGT GTTGTTTTAT TTCCTCCGTG 1489 GGGAAACAAA GTGAGTCTAA CTCACAGGTT TAGCTGTTTT CTCATAACTC TGGAAATGTG 1549 ATGCATTAAG TACTGGATCT CTGAATTGGG GTAGCTGTTT TACCAGTTAA AGAGCCTACA 1609 ACGTACGTGAGGAGGAGGA GAAAATCATT TGCCAGGTGA TTTAACATAT 1669 TTATGCAATTTTTTTTTTTTTTTGAGAT GGAGCTTTGC TCTTGTTGCC CAGGCTGGAG 1729 HU 226 205 Β1 TGCGATGGTG AAATCTCGGC TCACTGTAAC CTCCACCTTC CGGGTTCAAG CAATTCTCCC GTCGAC (2) INFORMATION FOR SEQ ID No: 7 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 334 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID No: 7 Met His Pro Gin Val Val Ile Leu Ser Leu Ile Leu His Leu There Asp 15 10 15 Ser Val Ala Gly Ser Val Lys Val Gly Gly Glu Ala Gly Pro Ser Val 20 25 30 Thr Leu Pro Cys His Tyr Ser Gly Alá Val Thr Ser Met Cys Trp Asn 35 40 45 Arg Gly Ser Cys Ser Leu Phe Thr Cys Gin Asn Gly Ile Val Trp Thr 50 55 60 Asn Gly Thr His Val Thr Tyr Arg Lys Asp Thr Arg Tyr Lys Leu Leu 70 75 80 Gly Asp Leu Ser Arg Arg Asp Val Ser Leu Thr Ile Glu Asn Thr Alá 90 95 Val Ser Asp Ser Gly Val Tyr Cys Cys Arg Val Glu His Arg Gly Trp 100 105 110 Phe Asn Asp Met Lys Ile Thr Val Ser Leu Glu Ile Val Pro Pro Lys 115 120 125 Val Thr Thr Thr Pro Ile Val Thr Thr Val Pro Thr Val Thr Thr Val 130 135 140 Arg Thr Ser Thr Thr Val Pro Thr Thr Thr Thr Val Pro Thr Thr Thr 145 150 155 160 Val Pro Thr Thr Met Ser Ile Pro Thr Thr Thr Thr Val Pro Thr Thr 165 170 175 Met Thr Val Ser Thr Thr Thr Ser Val Pro Thr Thr Thr Ser Ile Pro 180 185 190 Thr Thr Thr Ser Val Pro Val Thr Thr Thr Val Ser Thr Phe Val Pro 195 200 205 Pro Met Pro Leu Pro Arg Gin Asn His Glu Pro Val Alá Thr Ser Pro 210 215 220 Ser Ser Pro Gin Pro Ala Glu Thr His Pro Thr Thr Leu Gin Gly Ala 225 230 235 240 1789 1795 HU 226 205 Β1 Ile Arg Arg Glu Pro 245 Thr Ser Ser Pro Gly 260 Asn 265 Asp 27 Thr Val Thr Glu Ser Ser Gin Thr Gin 275 Leu Phe Leu Glu His 280 Ser Lys Gly Gin Gin Leu Arg Pro 325 His Lys Ser Cys Tyr Ser Tyr Thr Thr 255 Asp Gly Leu Trp Asn Asn Asn Leu Thr Alá 285 Asn Thr Thr Val Leu 300 Val Leu Leu Alá Phe 315 Phe Lys Lys Glu Val 320 His Gin Arg Glu SZABADALMI IGÉNYPONTOK

Claims

1. A polypeptide having at least 90% amino acid sequence identity to sequence number 3, 5 or 7 (SEQ ID No: 3, SEQ ID No: 5 or SEQ ID No: 7), which is a kidney injury-associated molecule (KIM), which KIM is a cell surface protein selectively expressed in post-ischemic renal tissues of mammals.

2. The polypeptide of claim 1, wherein the amino acid sequence is at least 95% identical to sequence number 3, 5 or 7 (SEQ ID No: 3, SEQ ID No: 5 or SEQ ID No: 7), and which is a kidney injury-associated molecule (KIM), which KIM is a cell surface protein selectively expressed in post-ischemic renal tissues of mammals.

3. The polypeptide of claim 1, comprising sequence number 3, 5 or 7 (SEQ ID No: 3, SEQ ID No: 5 or SEQ ID No: 7).

4. A polypeptide according to claim 1, which consists of sequence number 3, 5 or 7 (SEQ ID No: 3, SEQ ID No: 5 or SEQ ID No: 7).

5. A polypeptide which is a soluble variant of the polypeptide of any one of claims 1-4.

6. A fusion protein comprising the extracellular domain of a polypeptide according to any one of claims 1-4 and the Fc region of an immunoglobulin.

7. A nucleic acid encoding a polypeptide according to any one of claims 1-5.

8. A nucleic acid encoding the fusion protein of claim 6.

9. The nucleic acid of claim 7, which nucleic acid comprises sequence number 1, 2, 4 or 6 (SEQ ID No: 1, SEQ ID No: 2, SEQ ID No: 4 or SEQ ID No: 6), or which nucleic acid hybridizes under stringent conditions to sequence number 1, 2, 4 or 6 (SEQ ID No: 1, SEQ ID No: 2, SEQ ID No: 4 or SEQ ID No: 6), and which encodes a kidney injury-associated molecule (KIM), which KIM is a cell surface protein selectively expressed in post-ischemic renal tissues of mammals, and the hybridization conditions comprise washing in 2*SSC at 55 °C and washing in 0.5*SSC at 55 °C.

10. A vector comprising the nucleic acid of any one of claims 7-9.

11. A host cell comprising the vector of claim 10.

12. A method for producing a polypeptide, characterized in that a host cell according to claim 11 is cultured in a cell culture medium and the polypeptide expressed by the vector in the host cell is recovered.

13. An antibody that binds to the polypeptide of claim 4.

14. The antibody of claim 13, wherein the antibody is conjugated to a toxin or a radioactive nuclide.

15. The antibody of claim 13, wherein the antibody is a monoclonal antibody.

16. The antibody of claim 13, wherein the antibody is a humanized antibody, human antibody, single chain antibody, FAB fragment, or chimeric antibody.

17. A hybridoma that produces the antibody of claim 13.

18. A pharmaceutical composition comprising a polypeptide according to any one of claims 1-5, a fusion protein according to claim 6, or an antibody according to any one of claims 13-16, and a pharmaceutically acceptable carrier.

19. Use of a polypeptide according to any one of claims 1-5, a fusion protein according to claim 6, or an antibody according to any one of claims 13-16 for the manufacture of a pharmaceutical composition for treating kidney injury or kidney disease in a subject suffering from kidney injury or kidney disease.

20. Use of a polypeptide according to any one of claims 1-5, a fusion protein according to claim 6 or an antibody according to any one of claims 13-16 for the preparation of a diagnostic composition for determining the presence or progression of kidney injury or kidney disease in a subject suffering from kidney injury or kidney disease.

21. The use according to claim 19 or 20, wherein the subject is a human. HU 226 205 Β1 22. Use of an antibody according to any one of claims 13-16 for the preparation of a diagnostic composition for imaging cells or tissue expressing the polypeptide according to claim 4.

23. Use of the antibody of claim 14 for the manufacture of a pharmaceutical composition for targeting a toxin or radioactive nuclide to cells expressing the polypeptide of claim 4.

24. A polypeptide according to any one of claims 1-5, a fusion protein according to claim 6 or an antibody according to any one of claims 13-16 for use in medicine or diagnostics.