Novel antiangiogenic peptides polynucleotides encoding same and methods for inhibiting angiogenesis
Patent Information
- Application Number
- HU1999003530
- Authority / Receiving Office
- HU · HU
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 1997-05-05
- Filing Date
- 1997-05-05
- Publication Date
- 2001-12-28
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
Current treatments for angiogenic diseases, such as arthritis, macular degeneration, diabetic retinal damage, and cancer, lack safe and effective angiogenesis inhibitors that selectively target pathological conditions while minimizing toxicity to normal cells and are easy to produce.
Development of kringle-5 peptide compounds and fusion proteins based on the kringle-5 region of mammalian plasminogen, which inhibit endothelial cell proliferation and are derived through enzymatic cleavage or solid-phase synthesis, combined with methods for gene therapy using polynucleotides encoding these peptides.
The kringle-5 peptides and fusion proteins effectively inhibit angiogenesis, offering therapeutic potential for various diseases by selectively targeting pathological conditions with minimal toxicity to normal cells and are relatively easy to produce.
Description
The solution according to the invention is suitable for the detection and measurement of angiostatin, as well as for the treatment of cytotoxic agents linked to angiostatin proteins, as well as diseases induced or aggravated by angiogenesis, such as arthritis, macular degeneration or diabetic retinal damage, or cancer. HU 224 827 B1 The description is 46 pages long (including 10 pages of illustrations). HU 224 827 B1 The invention relates to peptide chemistry. More particularly, the invention relates to peptides, their preparation and uses, which contain amino acid sequences substantially similar to those corresponding to the kringle-5 region of mammalian plasminogen. The invention also relates to compositions containing said peptides and nucleic acids encoding them, as well as vectors containing the nucleic acids, host cells carrying them, and methods for producing the peptides. The solution according to the invention is suitable for the detection and measurement of angiostatin, as well as for the treatment of cytotoxic agents linked to angiostatin proteins, as well as diseases induced or aggravated by angiogenesis, such as arthritis, macular degeneration or diabetic retinal damage, or cancer. Angiogenesis - the process leading to the formation of new blood vessels - is essential for normal life functions, such as reproduction, development and wound healing. Although the process is not fully understood, it is known to be based on a complex interaction of molecules that regulate the proliferation of endothelial cells (the primary cells of capillary blood vessels). These molecules normally maintain the microvascular system in a quiescent state (i.e., no capillary growth) for extended periods of time - weeks or even decades. When needed (for example, during wound healing), these same cells undergo rapid proliferation and can be replaced ("turnover") within 5 days [Folkman, J. and Shing, Y.: The Journal of Biological Chemistry 267(16), 10 931-10 934; Folkman, J. and Klagsbrun, M.: Science 235, 442-447 (1987)]. Although angiogenesis is a tightly regulated process under physiological conditions, persistent, uncontrolled angiogenesis underlies many diseases (called angiogenic diseases). In other words, uncontrolled angiogenesis can either directly cause a given disease or exacerbate an existing disease. For example, neovascularization of the eye is the most common cause of blindness and is a dominant symptom in about 20 eye diseases. In certain established conditions, such as arthritis, newly formed capillary blood vessels invade the joint and destroy cartilage. In diabetes, new capillaries formed in the retina mesh with the vitreous, causing hemorrhage and blindness. The growth of solid tumors and metastases is also an angiogenesis-dependent phenomenon [Folkman, J.: Cancer Research 46, 467-473 (1986); Folkman, J.: Journal of the National Cancer Institute 82, 4-6 (1989)].For example, it has been shown that tumors that grow larger than 2 mm in diameter require their own blood supply, and this is achieved by inducing the growth of new capillary blood vessels. Once these new blood vessels are embedded in the tumor, they allow tumor cells to enter the circulation and metastasize to distant sites such as the liver, lung, or bone [Weidner, N. et al.: The New England Journal of Medicine 324(1), 1-8 (1991)]. To date, a number of naturally occurring angiogenic factors have been described and characterized [Fidler, JI and Ellis, LM: Cell. 79, 185-189 (1994)]. Recently, O'Reilly et al. isolated and purified a 38 kilodalton (hereinafter: kDa) protein from the serum and urine of tumor-bearing mice, which inhibited endothelial cell proliferation [O'Reilly et al.: Cell. 79, 315-328 (1994) and WO 95 / 29242, filed November 2, 1995]. This endothelial cell inhibitory protein, according to microsequence analysis, shows 98% sequence homology to an internal fragment of mouse plasminogen. Angiostatin, as the mouse inhibitory fragment was named, is a peptide containing the first four kringle regions of mouse plasminogen. A peptide fragment derived from the same region of human plasminogen (i.e., kringle regions 1-4) also potently inhibited capillary endothelial cell proliferation, both in vitro and in vivo.Intact plasminogen, from which this peptide fragment was derived, did not show such a strong inhibitory effect. Currently, a number of antiangiogenic agents are under development for the treatment of angiogenic diseases [Gasparini, G. and Harris, AL: J. Clin. Oncol 13(3), 765-782 (1995)], but these compounds also have disadvantages. For example, Suramin has a strong antiangiogenic effect, but in humans, when used in doses required to achieve an antitumor effect, it causes severe systemic toxic symptoms. For example, retinoids, interferons and antiestrogens are safe for human use, but have weak antiangiogenic effects. Other compounds are difficult or expensive to produce. Accordingly, there is a need for compounds that are useful in the treatment of angiogenic diseases in mammals. In particular, there is a need for angiogenesis inhibitors that are safe for therapeutic use and that exhibit selective toxicity with respect to the pathological condition, for example, by selectively inhibiting endothelial cell proliferation while being non-toxic or only slightly toxic to normal (i.e., non-cancerous) cells. It is also desirable for such compounds to be readily and inexpensively prepared. The essence of the invention is summarized below. In the most general embodiment of the invention, the invention provides kringle-5-peptide compounds of the general structural formula ABCXY (I), and their pharmaceutically acceptable salts, esters or prodrugs, wherein A is optionally absent or represents a nitrogen protecting group; Y is optionally absent or represents a carboxylic acid protecting group; B is optionally absent or represents a naturally occurring amino acid from about amino acid position 334 to about amino acid position 530 of SEQ ID NO: 1, numbered from about 1 to about 197. HU 224 827 B1 amino acid; C represents a group of the general formula R1-R2-R3-R4, where R1 is a lysyl group; R2 is a leucyl or arginyl group; R3 is a tyrosyl, 3-l-tyrosyl or phenylalanyl group; R4 is an aspartyl group; X is optionally absent or is a naturally occurring amino acid corresponding to the sequence from amino acid position 535 to about amino acid position 546 of SEQ ID NO: 1, numbered from about 1 to about 12; and homologues and analogues thereof. The invention also provides kringle-5-peptide compounds of the general structural formula A-B1-C1-X1-Y (II), or pharmaceutically acceptable salts, esters or prodrugs thereof, wherein A is optionally absent or represents a nitrogen protecting group; Y is optionally absent or represents a carboxylic acid protecting group; Bt is optionally absent or represents about 1-176 naturally occurring amino acids having a sequence corresponding to the sequence from amino acid position 334 to amino acid position 513 of SEQ ID NO: 1; Ct is the sequence from amino acid position 514 to amino acid position 523 of SEQ ID NO: 1; and Xt is optionally absent or is about 1 to about 10 amino acids corresponding to the sequence from amino acid position 524 to amino acid position 533 of SEQ ID NO: 1; and homologues and analogs thereof. The invention also provides methods for treating an individual in need of antiangiogenesis therapy, comprising administering to the individual a compound comprising a kringle-5 peptide fragment or kringle-5 fusion protein. The invention also provides compositions for treating an individual in need of antiangiogenesis therapy, comprising a kringle-5 peptide fragment or kringle-5 fusion protein, kringle-5 antiserum, kringle-5 receptor agonists or antagonists, or kringle-5 antagonists linked to a cytotoxic agent, alone or in combination with a pharmaceutically acceptable carrier and / or, optionally, with compounds that aid in delayed absorption, to form a therapeutic composition. The invention also provides compositions comprising a compound comprising a kringle-5 peptide fragment or a kringle-5 fusion protein, which are useful for treating diseases such as cancer, arthritis, macular degeneration or diabetic retinopathy. The invention also provides compositions comprising an isolated single-stranded or double-stranded polynucleotide sequence encoding a kringle-5 peptide fragment or fusion protein. Preferably, such polynucleotide is a DNA molecule. The invention also provides vectors comprising a DNA sequence encoding a kringle-5 peptide fragment or fusion protein, which when introduced into cells are capable of expressing a kringle-5 peptide fragment or kringle-5 fusion protein. The invention also provides compositions comprising a cell comprising a vector carrying DNA encoding a kringle-5 peptide fragment or kringle-5 fusion protein. The invention also provides gene therapy methods comprising delivering a DNA sequence encoding a kringle-5 peptide fragment or kringle-5 fusion protein or kringle-5 peptide fragment conjugate to an individual to modify the level of kringle-5 peptides therein in vivo. The invention also provides a method for producing a kringle-5 peptide fragment, comprising: (a) mixing mammalian plasminogen and human or porcine elastase in a ratio of about 1:100 to 1:300 to obtain a mixture of plasminogen and elastase; (b) incubating the mixture; and then isolating kringle-5 peptide fragments from the mixture. The invention also provides a method for producing a kringle-5 peptide fragment, characterized in that: (a) mixing mammalian plasminogen and human or porcine elastase in a ratio of about 1:100 to 1:300 elastase:plasminogen to obtain a mixture of plasminogen and elastase; (b) incubating said mixture, and then (c) isolating a protein conjugate of the kringle5 peptide fragment from said mixture; (d) mixing said protein conjugate of the kringle5 peptide fragment with pepsin in a ratio of about 1:0.2 to obtain a mixture of said pepsin and said plasminogen, and then (e) isolating kringle-5 peptide fragments from said mixture.Alternatively, a kringle-5 peptide fragment of a kringle-5 fusion protein can be prepared by a process comprising the steps of: (a) isolating a polynucleotide encoding said kringle-5 peptide fragment or kringle-5 fusion protein; (b) cloning the polynucleotide into an expression vector; transforming the vector into a suitable host cell; and (d) culturing the host cell under conditions suitable for the expression of a soluble kringle-5 peptide fragment or kringle-5 fusion protein. Below is a brief description of the figures attached to the description. Figure 1 shows the amino acid sequence of human plasminogen (SEQ ID NO: 1). Figure 2 shows the homology between the amino acid sequences of human (SEQ ID NO: 34), mouse (SEQ ID NO: 35), rhesus monkey (SEQ ID NO: 36), bovine (SEQ ID NO: 37) and porcine (SEQ ID NO: 38) kringle-5 regions. Figure 3 shows the DNA sequence of human plasminogen (SEQ ID NO: 12). The bar graph in Figure 4 illustrates the antiproliferative effect of a single dose of different kringle fragments on bovine capillary endothelial cells (BCE) using an in vitro cell proliferation assay. HU 224 827 B1 Figure 5 shows a map of the pHil-D8 expression vector containing a leader sequence that promotes secretion of recombinant protein. Figure 6 shows the results of SDS-PAGE analysis of the supernatants of Pichia pastoris cells expressing a kringle-5 peptide fragment or fusion protein. The photograph shows an SDS-PAGE gel developed with Coomassie-Blue. Lanes 1, 6 and 10 contained negative controls; lanes 2, 3 and 4 contained supernatants from three different clones expressing the K5A protein, lane 5 contained supernatants from the K5F protein, lanes 7 and 8 contained supernatants from the K4-5A protein, and lane 9 contained supernatants from the K4-5F protein. The arrows indicate the positions of the K5A (approximately 11 kDa) and K4-5F (approximately 20 kDa) protein bands. Molecular weight markers were run in the lanes preceding lanes 1 and 10. Figure 7 shows the results of SDS-PAGE of E. coli strains expressing kringle-5 peptide fragments or fusion proteins. The gels were developed with Coomassie Blue. Unless otherwise indicated, each lane contained 10 μΙ of culture at a density of 10 Agoo. Lane 1 contains low molecular weight markers, lane 2 contains the whole K5A / pET32a culture, lane 3 contains the whole K5A / pET32a culture (one-tenth of the amount loaded in lane 2), lane 4 contains the soluble fraction of K5A / pET32a, Lane 5 contained the K5A / pET32a insoluble fraction, lane 6 contained the K4-5A / pET32a whole culture, lane 7 contained the K4-5A / pET32a whole culture (one tenth of the amount applied to lane 6), lane 8 contained the K4-5A / pET32a soluble fraction, lane 9 contained the K4-5A / pET32a insoluble fraction, lane 10 contained the K4-5A / pGEX-4T-2 whole culture, lane 11 contained the K4-5A / pGEX-4T-2 soluble fraction, lane 12 contained the K4-5A / pGEX-4T-2 insoluble fraction, lane 13 contained kringle-5 standard, lane 14 contained high molecular weight markers. The essence of the solution according to the invention is described in detail below. In the description, the "kringle-5" region (hereinafter referred to as K5) of mammalian plasminogen is understood to mean the region with three disulfide bonds, which disulfide bonds contribute to the formation of the three-dimensional conformation of the mammalian plasminogen molecule, defined by its fifth kringle region. One such disulfide bond connects the cysteine amino acids at positions 462 and 541, and a second disulfide bond connects the cysteine amino acids at positions 483 and 524. amino acids located at positions 512 and 536, while a third disulfide bond connects the cysteine amino acids located at positions 512 and 536. As used herein, the term "kringle-5 peptide fragment" refers to a peptide of between 4 and 104 amino acids that shows substantial sequence homology to the corresponding peptide fragment of mammalian plasminogen, the α-N-terminus of which peptide fragment corresponds to about amino acid position 443 and the α-C-terminus to about amino acid position 546 of intact mammalian plasminogen. The overall length of the kringle-5 peptide fragment may vary depending on the method of its preparation, or its sequence may vary to some extent depending on the species from which it is prepared. For example, certain forms of the kringle-5 peptide fragment may be prepared by proteolytic cleavage of glu-plasminogen, lys-plasminogen, or miniplasminogen using human or porcine elastase enzymes. The α-C-terminal end of the peptide thus produced corresponds to approximately amino acid 543 of SEQ ID NO: 1, but the α-N-terminal end may start at amino acid position 443, 449 or 454.Accordingly, when glu-plasminogen, lys-plasminogen or miniplasminogen are digested with human or porcine elastase, the resulting kringle-5 peptide fragment may have a total length of 101, 95 or 90 amino acids. Such kringle-5 peptide fragments are listed in Table 1. Using the above procedure, a mixture of the three fragments is obtained, in which about 60% of the fragments are 95 amino acids long, 35% are 101 amino acids long and about 5% are 90 amino acids long. If desired, the various fragments may be further purified by methods well known to those skilled in the art, such as HPLC. Regardless of the differences in fragment length, the K5 peptide fragment of the invention comprises either the sequence Lys-Leu-Tyr-Asp (i.e., the sequence from amino acid position 531 to amino acid position 534 of SEQ ID NO: 1) or Asn-Pro-Asp-Gly-Asp-Val-GlyGly-Pro-Trp (i.e., the sequence from amino acid position 514 to amino acid position 523 of SEQ ID NO: 1).sequence extending to amino acid position); or analogs thereof. As used herein, the term "kringle-5 fusion protein" refers to a polypeptide comprising the amino acid sequences of two or more individual proteins, one of which is a K5 peptide fragment. A fusion protein is produced by expressing a polynucleotide in which a sequence encoding a kringle-5 peptide fragment is linked to at least one sequence encoding another polypeptide such that the two (or more) reading frames are in phase. Preferably, kringle-5 fusion proteins are produced in which a kringle-5 peptide fragment is fused to a suitable human plasminogen sequence, such as kringle-4 (K4), kringle-3-4 (K3-4), kringle-2-4 (K2-4) or kringle-1-4 (K1-4). Preferably, the K5 fusion protein is a protein comprising the kringle-4-5 (K4-5) fragment. The kringle-5 fusion proteins of the invention may further comprise a K5 peptide fragment or a K4-5-pep4 HU 224 827 β1 tid fragment linked to an additional biologically active tag. Such fusion proteins may or may not be cleaved into their original protein components. As used herein, a "K5 peptide fragment conjugate" refers to a kringle-5 peptide fragment to which another protein has been chemically linked to form a conjugate. A kringle-5 peptide fragment conjugate is, for example, a kringle-5 peptide fragment linked to albumin or a peptide fragment derived from another kringle region of mammalian plasminogen. Kringle-5 peptide fragment conjugates may have a molecular weight of about 1,000 to about 25,000 kDa. As used herein, the term "substantially homologous sequence" refers to about 60% amino acid identity; preferably at least about 70% amino acid identity; more preferably about 80% amino acid identity; even more preferably about 95% amino acid identity, with the corresponding peptide sequence of human plasminogen. Sequences that have a sequence that is substantially homologous to the human plasminogen protein are referred to as "homologues." In addition to having a substantially homologous sequence, the homologs of the invention exhibit biological activity (i.e., antiangiogenic activity) similar to the disclosed K5 peptide fragments. Since the amino acid sequence of a kringle-5 peptide or the number of amino acids that make it up may vary depending on the species from which it is derived or the method by which it was produced, the number of amino acids that make up a kringle-5 peptide fragment cannot be precisely determined in some cases.Since these sequences show at least 73% amino acid identity, it is evident that the amino acid sequences of kringle-5 peptide fragments from different species are substantially similar, and methods for preparing kringle-5 peptide fragments result in a sequence substantially homologous to the corresponding amino acid sequences of human plasminogen. Figure 2 shows the amino acid sequence of a 95 amino acid human kringle-5 peptide fragment (SEQ ID NO: 34) compared to the sequences of kringle-5 peptide fragments from mouse (SEQ ID NO: 35), rhesus monkey (SEQ ID NO: 36), bovine (SEQ ID NO: 37), and porcine (SEQ ID NO: 38) plasminogen. The invention also includes amino acid sequences that are analogous to the sequences disclosed herein, insofar as such sequences (i.e., analogs) exhibit similar biological activity to the kringle-5 peptide fragments and fusion proteins thereof of the invention. It is well known in the art that modifications and alterations can be made (in the sequence of a peptide) without substantially altering the biological properties of the peptide. Such alterations may involve substitution of similar amino acids based on the relative similarity of side chain groups, such as their size, charge, hydrophobicity or hydrophilicity, and the like. Such alterations may be made to enhance the activity of the peptide, to increase its stability against enzymatic degradation, or for pharmacokinetic reasons.Accordingly, the invention also encompasses analogous sequences characterized by an amino acid substitution or change in amino acid type in their amino acid sequence, but the change does not affect the essential nature and biological activity of the above K5 peptide fragments and / or fusion proteins. The K5 peptide fragment or K5 fusion protein of the invention can be characterized by its ability to inhibit the growth of bovine capillary cells (BCE cells) in vitro. Table 1 and Figure 4 show that the K5 peptide fragment having the sequence from amino acid position 443 to amino acid position 543 of SEQ ID NO: 1 exhibits an approximately 300-fold increase in activity (i.e., BCE cell growth inhibition) over the K5 peptide fragment having the sequence from amino acid position 443 to amino acid position 546 of SEQ ID NO: 1 and an approximately 800-fold increase in activity over the kringle 1-4 peptide fragments. As used herein, the term "isolated" refers to a substance that has been removed from its original environment (i.e., its natural environment, if it occurs in nature). For example, a polynucleotide or polypeptide that occurs naturally in a living animal is not isolated, but if the same polynucleotide or DNA or polypeptide is separated from some or all of the substances with which it is found in its natural environment, it becomes isolated. Such a polynucleotide may be a component of a vector and / or such a polynucleotide or polypeptide may be a component of a composition and yet be isolated in the sense that the vector or composition is not part of its natural environment. As used herein, the term "primer" refers to a specific oligonucleotide sequence complementary to a target nucleotide sequence, which is hybridized to the target nucleotide sequence, thereby serving as a starting point for nucleotide polymerization catalyzed by DNA polymerase, RNA polymerase, or reverse transcriptase. In the description, a "probe" is understood to mean a defined nucleic acid segment (or nucleotide analog segment, i.e. PNA) that can be used to identify specific DNA carrying a complementary sequence in a sample. As used herein, the term "recombinant polypeptide" refers to at least one polypeptide that, by origin or manipulation, is not associated with the polypeptide or part thereof with which it occurs in nature and / or is linked to a polypeptide other than that with which it occurs in nature. A recombinant or derived polypeptide is not necessarily translated from a given nucleic acid sequence. It may be produced by any other method, such as chemical synthesis or expression in a recombinant expression system. HU 224 827 B1 As used herein, the term "synthetic peptide" refers to a polymer of amino acids of any length that can be synthesized by chemical methods well known to those skilled in the art. These synthetic peptides can be used for a variety of purposes. As used herein, the term "purified polynucleotide" refers to a given polynucleotide or fragment thereof that is substantially free of the protein with which it is naturally associated (i.e., less than about 50%, preferably less than about 70%, more preferably less than about 90%). Methods for purifying polynucleotides are well known, including, for example, disrupting a cell containing the given polynucleotide with a chaotropic agent and then separating the polynucleotide(s) and proteins by ion exchange chromatography, affinity chromatography, or density gradient sedimentation.Accordingly, as used herein, the term "purified polypeptide" refers to a polypeptide or fragment thereof that is substantially free of (i.e., less than about 50%, preferably less than about 70%, more preferably less than about 90%) cellular components with which the polypeptide of interest is associated in nature. Methods for purifying polypeptides are well known. As used herein, the term "polypeptide" refers to a molecule consisting of a chain of amino acids, regardless of its length. Accordingly, the term "polypeptide" refers to peptides, oligopeptides, and proteins. This term also refers to polypeptides that have undergone post-expression modifications, such as glycosylation, acetylation, phosphorylation, and the like. In the description, the terms "recombinant host cells", "host cells", "cells", "cell lines", "cell cultures" and other terms denoting microorganisms or higher eukaryotic cell lines cultured in a single-cell form are intended to mean cells that can be used or have been used as recipients for receiving a recombinant vector or other transferred DNA, as well as the original progeny of the original transfected cell. As used herein, the term "replicon" refers to a genetic unit, such as a plasmid, chromosome, or virus, that acts as a self-contained unit of polynucleotide replication within a cell. As used herein, a "vector" is a replicon to which another polynucleotide segment has been linked for the purpose of replicating and / or expressing the linked polynucleotide. As used herein, the term "control sequence" refers to polynucleotide sequences that are necessary for regulating the expression of coding sequences to which they are linked. The nature of such control sequences depends on the host cell. In general, in prokaryotes, such control sequences may be promoters, ribosomal binding sites, and terminator sequences; in eukaryotic cells, such control sequences may generally be promoters, terminators, and in some cases enhancer sequences. The term "control sequence" is therefore intended to mean, at a minimum, the genetic elements necessary for expression, and may also include additional elements, such as leader sequences, the presence of which is advantageous for expression. As used herein, the term "operably linked" refers to a state in which the disclosed components are in a relationship that enables them to function as intended. Accordingly, for example, a control sequence is "operably linked" to a coding sequence in such a way that expression of the coding sequence occurs under conditions compatible with the control sequences. As used herein, the term "open reading frame" (ORF) refers to a region of a polynucleotide sequence that encodes a polypeptide; this region may be a portion of a coding sequence or an entire coding sequence. As used herein, the term "coding sequence" refers to polynucleotide sequences that are transcribed into mRNA and translated into a polypeptide when placed under the control of appropriate control sequences. The boundaries of a coding sequence are defined by a translation start codon in the 5' direction and a translation stop codon in the 3' direction. A coding sequence may be, but is not limited to, mRNA, cDNA, or recombinant polynucleotide sequences. As used herein, "transformation" refers to the introduction of an exogenous polynucleotide into a host cell, regardless of the method used for introduction. For example, direct uptake, transduction, or f-mating may be used. The exogenous polynucleotide may persist as a non-integrated vector, such as a plasmid, or may integrate into the host genome. As used herein, the term "purified product" refers to the preparation of a product that has been isolated from cellular components with which it is normally associated under natural conditions; or its separation from other types of cells that may be present in the sample in question. All peptide sequences are designated according to the generally accepted convention that the α-N-terminal amino acid is on the left and the α-C-terminal amino acid is on the right. In the specification, the term “α-Ν-terminus” refers to the free alpha-amino group of an amino acid in a peptide, and the term “α-C-terminus” refers to the free alpha-carboxylic acid group of an amino acid in a peptide. In the present specification, the term "N-protecting group" refers to groups which are suitable for protecting the α-Ν-terminus of an amino acid or peptide, or which are otherwise capable of protecting the amino group of an amino acid or peptide from undesired reactions during synthetic procedures. Commonly used N-protecting groups are described in Greene's "Protective Groups In Organic Synthesis" [John Wiley & Sons, New York (1981)] HU 224 827 Β1 dalmi site, which is incorporated by reference in its entirety. It is also possible to use protecting groups in the form of prodrugs which are readily cleaved in vivo, for example by enzymatic hydrolysis, thereby releasing the biologically active parent drug. As N-protecting groups, it is possible to use a low molecular weight alkanoyl group, for example formyl, acetyl ("Ac"), propionyl, pivaloyl, t-butylacetyl and the like; further acyl groups, for example 2-chloroacetyl, 2-bromoacetyl, trifluoroacetyl, trichloroacetyl, phthalyl, o-nitrophenoxyacetyl, α-chlorobutyryl, benzoyl, 4-chlorobenzoyl, 4-bromobenzoyl, 4-nitrobenzoyl and the like; sulfonyl groups, for example benzenesulfonyl, p-toluenesulfonyl and the like;carbamate-forming groups, such as benzyloxycarbonyl, p-chlorobenzyloxycarbonyl, ρ-methoxybenzyloxycarbonyl, p-nitrobenzyloxycarbonyl, 2-nitrobenzyloxycarbonyl, pbromobenzyloxycarbonyl, 3,4-dimethoxybenzyloxycarbonyl, 3,5-dimethoxybenzyloxycarbonyl, 2,4-dimethoxybenzyloxycarbonyl, 4-methoxybenzyloxycarbonyl, 2-nitro-4,5-dimethoxybenzyloxycarbonyl, 3,4,5-trimethoxybenzyloxycarbonyl, 1-(p-biphenyl)-1-methylethoxycarbonyl, a,a-dimethyl-3,5-dimethoxybenzyloxycarbonyl, benzhydryloxycarbonyl, t-butyloxycarbonyl, diisopropylmethoxycarbonyl, isopropyloxycarbonyl, ethoxycarbonyl, methoxycarbonyl, allyloxycarbonyl, 2,2,2-trichloroethoxycarbonyl, phenoxycarbonyl, 4-nitrophenoxycarbonyl, fluorenyl-9-methoxycarbonyl, cyclopentyloxycarbonyl, adamantyloxycarbonyl, cyclohexyloxycarbonyl, phenylthiocarbonyl and the like;arylalkyl groups, such as benzyl, triphenylmethyl, benzyloxymethyl, 9-fluorenylmethyloxycarbonyl (Fmoc) and the like, and silyl groups, such as trimethylsilyl and the like. As N-protecting groups, formyl, acetyl, benzoyl, pivaloyl, t-butylacetyl, phenylsulfonyl, benzyl, t-groups (Cbz) can be preferably used. For example, the α-N-terminus of lysine can be protected with an acid-labile group (e.g. Boc group) and the ε-N-terminus can be protected with a base-labile group (e.g. Fmoc group), and the protection can then be selectively removed during synthesis.; As used herein, the term "carboxy protecting group" refers to an ester or amide group protecting a carboxylic acid, which is useful for blocking carboxylic acid functions or for protecting the group so that reactions involving other functional groups of the compound can occur. Carboxy protecting groups are described in Greene's "Protective Groups in Organic Synthesis" [pp. 152-186 (1981)], which is incorporated herein by reference in its entirety. Carboxy protecting groups may also be used as prodrugs, in which the carboxy protecting group is readily cleaved in vivo, for example by enzymatic hydrolysis, to release the biologically active parent drug. Such carboxy protecting groups are well known to those skilled in the art, as they are widely used to protect carboxyl groups in the preparation of penicillins and cephalosporins, as disclosed in U.S. Patents 3,840,556 and 3,719,667,which descriptions are incorporated by reference in their entirety. As carboxy protecting groups, there may be used a C1-C8 lower alkyl group (e.g., methyl, ethyl, t-butyl, and the like); arylalkyl groups, such as phenethyl or benzyl, and their substituted derivatives, such as alkoxybenzyl or nitrobenzyl, and the like; arylalkenyl groups, such as phenylethenyl, and the like; aryl and its substituted derivatives, such as 5-indanyl, and the like; dialkylaminoalkyl, such as dimethylaminoethyl, and the like; alkanoyloxyalkyl groups, such as acetoxymethyl, butyryloxymethyl, valeryloxymethyl, isobutyryloxymethyl, isovarelyloxymethyl, 1-(propionyloxy)-1-ethyl, 1-(pivaloyloxy)1-ethyl, 1-methyl-1-(propionyloxy)-1-ethyl, pivaloyloxymethyl, propionyloxymethyl and the like; cycloalkanoyloxyalkyl groups,for example, cyclopropylcarbonyloxymethyl, cyclobutylcarbonyloxymethyl, cyclopentylcarbonyloxymethyl, cyclohexylcarbonyloxymethyl and the like; aroyloxyalkyl groups, for example, benzoyloxymethyl, benzoyloxyethyl and the like; arylalkylcarbonyloxyalkyl groups, for example, benzylcarbonyloxymethyl, 2-benzylcarbonyloxyethyl and the like; alkoxycarbonylalkyl or cycloalkoxycarbonylalkyl groups, for example, methoxycarbonylmethyl, cyclohexyloxycarbonylmethyl, 1-methoxycarbonyl-1-ethyl and the like; alkoxycarbonyloxyalkyl or cycloalkoxycarbonyloxyalkyl groups, such as methoxycarbonyloxymethyl, t-butyloxycarbonyloxymethyl, 1-ethoxycarbonyloxy-1-ethyl, 1-cyclohexyloxycarbonyloxy-1-ethyl and the like; aryloxycarbonyloxyalkyl groups, such as 2-(phenoxycarbonyloxy)ethyl, 2-(5-indanyloxycarbonyloxy)ethyl and the like; alkoxyalkylcarbonyloxyalkyl groups,for example, 2-(1-methoxy-2-methyl-propan-2-oyloxy)-ethyl and the like; aryl-alkyloxycarbonyloxy-alkyl groups, for example, 2-(benzyloxycarbonyl)-ethyl and the like; aryl-alkenyloxycarbonyloxy-alkyl groups, for example, 2-(3-phenyl-propen-2-yloxycarbonyloxy)-ethyl and the like; alkoxycarbonylamino-alkyl groups, for example, t-butyloxycarbonylamino-methyl and the like; alkylamino-carbonylamino-alkyl groups, for example, methylamino-carbonylamino-methyl and the like; alkanoylamino-alkyl groups, for example, acetylamino-methyl and the like; heterocyclic carbonyloxy-alkyl groups, for example, 4-methyl-piperazinylcarbonyloxymethyl and the like; dialkylaminocarbonylalkyl groups, such as dimethylaminocarbonylmethyl, diethylaminocarbonylmethyl and the like; [5-(lower alkyl)]-2-oxo-1,3-dioxolen-4-yl)alkyl groups, (5-t-butyl-2-oxo-1,(3-dioxolen-4-yl)methyl and the like; and (5-phenyl-2-oxo-1,3-dioxolen-4-yl)alkyl groups, such as (5-phenyl-2-oxo-1,3-dioxolen-4-yl)methyl and the like., Examples of amide-linked carboxy-protecting groups that can be used include aminocarbonyl and lower alkylaminocarbonyl groups. Preferred carboxy-protected compounds of the invention are compounds in which the protected carboxy group is HU 224 827 B1 port lower alkyl, cycloalkyl or arylalkyl esters, such as methyl ester, ethyl ester, propyl ester, isopropyl ester, butyl ester, sec-butyl ester, isobutyl ester, amyl ester, isoamyl ester, octyl ester, cyclohexyl ester, phenylethyl ester and the like, or alkanoyloxyalkyl, cycloalkanoyloxyalkyl, aroyloxyalkyl or arylalkylcarbonyloxyalkyl esters. Preferred amide carboxy protecting groups are lower alkylaminocarbonyl groups. For example, aspartic acid can be protected at its α-C-terminus with an acid-labile group (e.g., t-butyl group) and at its β-C-terminus with a hydrogenation-labile group (e.g., benzyl group), and then the protection can be selectively deprotected during synthesis. In the specification, the term "lower alkylaminocarbonyl group" refers to a -C(O)NHR10 group capped at the α-C-terminus of a synthetic kringle-5 peptide fragment, where R10 is C1-C4 alkyl. In the specification, the term "aminocarbonyl group" refers to a -C(O)NH2 group that covers the α-C-terminus of a synthetic kringle-5 peptide fragment. As used herein, the term "prodrug" refers to compounds that are rapidly converted to the parent drug in vivo, for example by enzymatic hydrolysis in blood. This topic is discussed in detail in T. Higuchi and V. Stella ["Prodrugs as Enhanced Delivery Systems", ACS Symposium Series 14] and Edward B. Roche (eds.) ["Bioreversible Carriers in Drug Design", American Pharmaceutical Association and Permagon Press (1987)], which are incorporated by reference in their entirety. As used herein, the term "pharmaceutically acceptable prodrug" means: (1) prodrugs of the compounds of the invention which, according to rational medical judgment, are suitable for contact with human and lower animal tissues without undue toxicity, irritation, allergic reaction, or the like, meet the accepted benefit-risk ratio, and are effective for the intended purpose, and (2) where possible, the zwitterionic form of the parent drug. As used herein, the term "activated ester derivative" refers to acid halides, such as acid chlorides, as well as activated esters, which may include, but are not limited to, anhydrides derived from formic acid and acetic acid, anhydrides derived from alkoxycarbonyl halides, such as isobutyloxycarbonyl chloride and the like, esters derived from N-hydroxysuccinimide, esters derived from N-hydroxyphthalimide, esters derived from N-hydroxybenzotriazole, esters derived from N-hydroxy-5-norbornene-2,3-dicarboxamide, esters derived from 2,4,5-trichlorophenol, and the like. We say that a molecule has “antiangiogenesis activity” if it is able to inhibit the growth of blood vessels. As used herein, the term "endothelial inhibitory activity" refers to the property of a molecule to generally inhibit angiogenesis and, for example, to inhibit the proliferation or migration of bovine capillary endothelial cells in cell culture in the presence of fibroblast growth factor or other known growth factors. In the specification, the term "ED50" is an abbreviation that refers to the concentration of kringle-5 peptide fragment or fusion protein that effectively inhibits blood vessel growth, or inhibits the proliferation of bovine endothelial cells in culture in the presence of fibroblast growth factor or other known growth factors, or inhibits the migration of endothelial cells by reducing it to half the extent that growth / proliferation or migration would occur in the absence of the inhibitor. In general, the naming convention recommended by the IUPAC Committee on Organochemical Nomenclature and the IUPAC-IUB Committee on Biochemical Nomenclature for naturally occurring amino acids and amino-acyl groups in this specification has been followed [,,Nomenclature of α-Amino Acids” (Recommendations, 1974) Biochemistry 14(2), (1975)]. Accordingly, the abbreviations “Ala”, “Arg”, “Asn”, “Asp”, “Cys”, “Gin”, “Glu”, “Gly”, “His”, “Ile”, “Leu, “Lys”, “Met”, “Phe”, “Pro”, “Ser”, “Thr”, “Trp”, “Tyr” and “Val” are used for alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, refers to the amino acids tryptophan, tyrosine and valine, and their corresponding aminoacyl groups occurring in peptides, in their L-, D- or D,L-configuration.Where the specific configuration is not indicated, it is clear to one skilled in the art that the stereochemical configuration of the α-carbon atom of amino acids and amino-acyl groups corresponds to the naturally occurring, i.e. L-configuration, except for the achiral glycine molecule, and any achiral amino acids, or those designated as having the “D” configuration in relation to the peptides of our description and in the appended claims. In the specification, the term "3-l-Tyr" refers to an L-, D- or D,L-tyrosyl group in which the hydrogen atom ortho to the phenolic hydroxyl group is replaced by an iodine atom. The iodine atom may be radioactive or non-radioactive. The invention also relates to amino acid groups having non-naturally occurring side chain groups, such as homophenylalanine, phenylglycine, norvaline, norleucine, ornithine, thiazoylalanine (2-, 4- and 5-substituted) and similar amino acid groups. Accordingly, the invention encompasses all derivatives of kringle-5 peptide fragments and kringle-5 fusion proteins that have antiangiogenic activity, and the entire class of kringle-5 peptide fragments and fusion proteins described herein, as well as homologues and analogues of these fragments and proteins. The scope of the invention is also independent of the method of preparation of the kringle-5 peptide fragment or fusion protein, i.e., whether (1) by proteolytic cleavage of isolated mammalian plasminogen, (2) by kringle-5 peptide fragment or fusion protein, HU 224 827 They were produced by expressing a recombinant molecule containing a polynucleotide encoding the amino acid sequence of the β1 protein, or (3) by a solid-phase synthetic method well known to those skilled in the art. According to a preferred embodiment of the invention, the invention relates to peptides of the general formula BCX, where B is an 88-membered peptide starting with amino acid Val443 of SEQ ID NO: 1 and ending with amino acid Arg530; C is a 4-membered peptide, where R1 and R4 are as defined above, R2 is a leucyl group, R3 is a tyrosyl group; and X is a 9-membered peptide starting with amino acid Tyr535 of SEQ ID NO: 1 and ending with amino acid Ala543. According to a further embodiment of the invention, the invention provides peptides of the general formula BCX, wherein B is an 82-membered peptide starting with amino acid Val449 of SEQ ID NO: 1 and ending with amino acid Arg530; C is a 4-membered peptide, wherein R1 and R4 are as defined above, R2 is leucyl, R3 is tyrosyl; and X is a 9-membered peptide starting with amino acid Tyr535 of SEQ ID NO: 1 and ending with amino acid Ala543. According to a further embodiment of the invention, the invention provides peptides of the general formula BCX, wherein B is a 77-membered peptide starting with amino acid Val454 of SEQ ID NO: 1 and ending with amino acid Arg530; C is a 4-membered peptide, wherein R1 and R4 are as defined above, R2 is leucyl, R3 is tyrosyl; and X is a 9-membered peptide starting with amino acid Tyr535 of SEQ ID NO: 1 and ending with amino acid Ala543. According to a further embodiment of the invention, the invention provides peptides of the general formula BCX, wherein B is an 88-membered peptide starting with amino acid Val443 of SEQ ID NO: 1 and ending with amino acid Arg530; C is a 4-membered peptide, wherein R1 and R4 are as defined above, R2 is a leucyl group, R3 is a tyrosyl group; and X is a 12-membered peptide starting with amino acid Tyr535 of SEQ ID NO: 1 and ending with amino acid Phe546. According to a further embodiment of the invention, the invention provides peptides of the general formula BCX, wherein B is an 82-membered peptide starting with amino acid Val443 of SEQ ID NO: 1 and ending with amino acid Arg530; C is a 4-membered peptide, wherein R1 and R4 are as defined above, R2 is a leucyl group, R3 is a tyrosyl group; and X is a 12-membered peptide starting with amino acid Tyr535 of SEQ ID NO: 1 and ending with amino acid Phe546. According to a further embodiment of the invention, the invention provides peptides of the general formula BCX, wherein B is a 77-membered peptide starting with amino acid Val454 of SEQ ID NO: 1 and ending with amino acid Arg530; C is a 4-membered peptide, wherein R1 and R4 are as defined above, R2 is leucyl, R3 is tyrosyl; and X is a 12-membered peptide starting with amino acid Tyr535 of SEQ ID NO: 1 and ending with amino acid Phe546. According to a further embodiment of the invention, the invention provides peptides of the general formula BCX, wherein B is a 176-membered peptide starting with amino acid Val355 of SEQ ID NO: 1 and ending with amino acid Arg530; C is a 4-membered peptide, wherein R1 and R4 are as defined above, R2 is leucyl, R3 is tyrosyl; and X is a 12-membered peptide starting with amino acid Tyr535 of SEQ ID NO: 1 and ending with amino acid Ala543. According to a further embodiment of the invention, the invention provides peptides of the general formula BCX, wherein B is a 176-membered peptide starting with amino acid Val443 of SEQ ID NO: 1 and ending with amino acid Arg530; C is a 4-membered peptide, wherein R1 and R4 are as defined above, R2 is a leucyl group, R3 is a tyrosyl group; and X is a 12-membered peptide starting with amino acid Tyr535 of SEQ ID NO: 1 and ending with amino acid Phe546. According to a further embodiment of the invention, the invention provides peptides of the general formula ACY, where A represents an acetyl group; C is a 4-membered peptide, where R1 and R4 are as defined above, R2 represents a leucyl group, R3 represents a tyrosyl group; and Y represents an aminocarbonyl group. According to a further embodiment of the invention, the invention provides peptides of the general formula ACXY, where A represents an acetyl group; C is a 4-membered peptide, where R1 and R4 are as defined above, R2 represents a leucyl group, R3 represents a tyrosyl group; X represents a tyrosyl group; and Y represents an aminocarbonyl group. According to a further embodiment of the invention, the invention provides peptides of the general formula ABCY, where A represents an acetyl group; B represents a dipeptide starting at amino acid Pro529 and ending at amino acid Arg530 of SEQ ID NO: 1; C is a 4-membered peptide, where R1 and R4 are as described above, R2 represents a leucyl group, R3 represents a tyrosyl group; and Y represents an aminocarbonyl group. According to a further embodiment of the invention, the invention provides peptides of the general formula ABCXY, where A represents an acetyl group; B represents a hexapeptide starting at amino acid Tyr525 and ending at amino acid Arg539 of SEQ ID NO: 1; C is a 4-membered peptide, where R1 and R4 are as described above, R2 represents a leucyl group, R3 represents a tyrosyl group; X represents a tyrosyl group; and Y represents an aminocarbonyl group. According to a further embodiment of the invention, the invention provides peptides of the general formula ABCXY, where A represents an acetyl group; B represents an arginyl group; C is a 4-membered peptide, where R1 and R4 are as defined above, R2 represents a leucyl group, R3 represents a tyrosyl group; X represents a tyrosyl group; and Y represents an aminocarbonyl group. HU 224 827 B1 According to a further embodiment of the invention, the invention provides peptides of the general formula ABCXY, where A represents an acetyl group; B represents a dipeptide starting at amino acid Pro529 and ending at amino acid Arg530 of SEQ ID NO: 1; C is a 4-membered peptide, where R1 and R4 are as described above, R2 represents a leucyl group, R3 represents a tyrosyl group; X represents a 3-l-tyrosyl group; and Y represents an aminocarbonyl group. According to a further embodiment of the invention, the invention provides peptides of the general formula ABCXY, where A represents an acetyl group; B represents a dipeptide starting at amino acid Pro529 and ending at amino acid Arg530 of SEQ ID NO: 1; C is a 4-membered peptide, where R1 and R4 are as described above, R2 represents a leucyl group, R3 represents a tyrosyl group; X represents a tyrosyl group; and Y represents an aminocarbonyl group. According to a further embodiment of the invention, the invention provides peptides of the general formula AB^C^X^Y, where A represents an acetyl group; B-] and X-, are absent; C-ι represents a 10-membered peptide starting at amino acid Arg514 and ending at amino acid Trp523 according to SEQ ID NO: 1; and Y represents an aminocarbonyl group. In a preferred embodiment, in the compounds of the invention, A is absent or represents a nitrogen protecting group, preferably an acetyl group; Y is optionally absent or represents a carboxyl protecting group, preferably an aminocarbonyl group; and BCX represents any of the following: (a) the sequence corresponding to amino acids 355-543 of SEQ ID NO: 1; (b) the sequence corresponding to amino acids 355-546 of SEQ ID NO: 1; (c) the sequence corresponding to amino acids 443-543 of SEQ ID NO: 1; (d) the sequence corresponding to amino acids 449-543 of SEQ ID NO: 1; (e) the sequence corresponding to amino acids 454-543 of SEQ ID NO: 1; (f) the sequence corresponding to amino acids 443-546 of SEQ ID NO: 1; (g) according to SEQ ID NO: 1 a sequence corresponding to amino acids 449-546; (h) the sequence corresponding to amino acids 454-546 of SEQ ID NO: 1; (i) the sequence corresponding to amino acids 525-535 of SEQ ID NO: 1; (j) according to SEQ ID NO: 1 a sequence corresponding to amino acids 529-535; (k) according to SEQ ID NO: 1 a sequence corresponding to amino acids 530-535; (l) according to SEQ ID NO: 1 a sequence corresponding to amino acids 529-534; (m) according to SEQ ID NO: 1 the sequence corresponding to amino acids 530-534; or (n) the sequence according to SEQ ID NO: 1 sequence corresponding to amino acids 450-543. A further preferred compound is a compound wherein A represents an acetyl group; Y represents an aminocarbonyl group; and B1-C1-X1 represents the sequence corresponding to amino acids 514-523 of SEQ ID NO:1. K5 fragments or K5 fusion proteins can be produced by expressing a recombinant molecule containing a polynucleotide sequence encoding a protein comprising a kringle-5 peptide fragment and purifying the expressed product [Menhart et al., Biochemistry 32, 8799-8806 (1993)]. The DNA sequence of human plasminogen is known [Browne, MJ et al., Fibrinolysis 5(4), 257-260 (1991)] and is set forth in Figure 3 (AB) (see SEQ ID NO: 12). A polynucleotide sequence encoding a kringle-5 region begins at about nucleotide position 1421 and ends at about nucleotide position 1723 of SEQ ID NO: 12. A K5 peptide fragment or K5 fusion protein can be produced from cells or tissues expressing a high amount of the gene, human plasminogen or K5 fusion proteins by: (1) isolating mRNA from the tissue or cells, (2) preparing the appropriate DNA sequence using reverse transcriptase, and (3) amplifying the DNA sequence encoding the active K5 amino acid sequence or its fusion protein using polymerase chain reaction (PCR) using appropriate primers. In addition, a polynucleotide encoding a K5 peptide fragment or K5 fusion protein can be cloned into any commercially available expression vector (e.g., pBR322, pUC vectors, and the like) or expression / purification vector (e.g., GST fusion vector (Pharmacia®, Piscataway, NJ, USA)) and then expressed in a suitable prokaryotic, viral, or eukaryotic host.Purification can be performed using standard procedures or in a commercial expression / purification system, following the manufacturer's instructions. K5 peptide fragments or fusion proteins can also be synthesized by solid phase chemical methods known to those skilled in the art. For example, kringle-5 peptide fragments can be synthesized by the solid phase chemical methods described by Steward and Young [Steward, JM and Young, JD: Solid Phase Peptide Synthesis, 2nd ed., Pierce Chemical Company, Rockford, IL, USA (1984)], using an Applied Biosystem synthesizer. Similarly, multiple small fragments can be synthesized and then linked together to form larger fragments. These synthetic peptides can also be prepared by making amino acid substitutions at specific sites and assayed for antiangiogenic activity in vitro and in vivo. Several methods suitable for solid phase peptide synthesis are described by JM Stewart and JD Young [“Solid Phase Peptide Synthesis” WH Freeman Co., San Francisco, USA, (1963)] and J. Meinhofer [“Hormonal Proteins and Peptides” 2.46, Academic Press, New York, USA (1973)]. Classical methods that can be carried out in solution are described by G. Schröder and K. Lupke [“The Peptides” vol. 1, Acade10. HU 224 827 Β1 mic Press, New York, USA], In general, according to the above methods, one or more amino acids or amino acids with a suitable protecting group are added to a growing peptide chain. Usually, either the amino or carboxyl group of the first amino acid is provided with a suitable protecting group. The protected or derivatized amino acid is then reacted, either attached to an inert solid support or in solution, under conditions favorable for the formation of an amide bond with the next amino acid in the sequence, the complementary (amino or carboxyl) group of which has been suitably protected. The protecting group is then removed from the newly added amino acid group, followed by the addition of the next (suitably protected) amino acid, and so on. After all the desired amino acids have been linked in the correct order, the remaining protecting groups (and solid support) are removed stepwise or simultaneously to produce the final polypeptide.By simple modification of the above general procedure, multiple amino acids can be added to the growing chain at once, for example by coupling a protected tripeptide with a protected dipeptide (under conditions that do not result in racemization of the chiral centers), thereby obtaining a pentapeptide after removal of the protecting groups. Particularly preferably, the compounds of the invention are prepared by solid phase peptide synthesis by protecting the α-Ν-terminus of the amino acid with an acid- or base-labile group. Such protecting groups have in common that they are stable under the conditions used to form peptide bonds, while being readily removable without damaging the growing peptide chain or causing racemization of any chiral centers of the peptide chain. Suitable protecting groups include, for example, 9-fluorenylmethyloxycarbonyl (Fmoc), t-butyloxycarbonyl (Boc), benzyloxycarbonyl (Cbz), biphenylisopropyloxycarbonyl, t-amyloxycarbonyl, isobornyloxycarbonyl, α,α-dimethyl-3,5-dimethoxybenzyloxycarbonyl, ο-nitrophenylsulfenyl, 2-cyano-t-butyloxycarbonyl, and the like. A particularly preferred protecting group for the synthesis of kringle-5 peptide fragments is the 9-fluorenylmethyloxycarbonyl (Fmoc) group.Side chain protecting groups that are preferably used for the protection of amino acids with side chains, such as lysine and arginine, include 2,2,5,7,8-pentamethylchroman6-sulfonyl (pmc), nitro, ρ-toluenesulfonyl, 4-methoxybenzenesulfonyl, Cbz, Boc and adamantyloxycarbonyl; tyrosine can be protected by benzyl, o-bromobenzyloxycarbonyl, 2,6-dichlorobenzyl, isopropyl, t-butyl (t-Bu), cyclohexyl, cyclopentyl and acetyl(Ac); serine can be protected by t-butyl, benzyl and tetrahydropyranyl groups; histidine can be protected by trityl, benzyl, Cbz, p-toluenesulfonyl and 2,4-dinitrophenyl groups; tryptophan can be protected by formyl, for example; Benzyl and t-butyl groups may be suitable for protecting aspartic acid and glutamic acid, and triphenylmethyl (trityl) groups may be suitable for protecting cysteine.In the solid phase peptide synthesis process, the α-C-terminal amino acid is coupled to a suitable solid support or resin. For the above synthesis process, substances (protecting groups) can be used which are inert to the reagents and reaction conditions required for the stepwise condensation and deprotection operations ("condensation / deprotection") and are insoluble in the medium used. A preferred solid support for the synthesis of α-C-terminal carboxypeptides is, for example, 4-hydroxymethyl-phenoloxymethyl-copoly(styrene-1% divinylbenzene). A preferred solid support for the synthesis of α-C-terminal amide peptides is, for example, a. 4-(2',4'-Dimethoxyphenyl-Fmoc-aminomethyl)-phenoxyacetamidoethyl resin, available from Applied Biosystems (Foster City, CA, USA). The α-C-terminal amino acid is coupled to the resin using Ν,Ν'-dicyclohexylcarbodiimide (DCC), N,N'-diisopropylcarbodiimide (DIC) or O-benzotriazol-1-ylΝ,Ν,Ν',Ν'-tetramethyluronium hexafluorophosphate (HBTU), with or without the addition of 4-dimethylaminopyridine (DMAP), 1-hydroxybenzotriazole (HOBT), benzotriazol-1 -yloxytris(dimethylamino)phosphonium hexafluorophosphate (BOP) or bis(2-oxo-3-oxazolidinyl)phosphate chloride (BOPC1), for a coupling time of about 124 hours at a temperature between 10-50 °C, e.g. in dichloromethane or DMF solvent. If 4-(2',4'-dimethoxyphenyl-Fmoc-aminomethyl)-phenoxyacetamidoethyl resin is used as the solid support, the Fmoc group is cleaved with a secondary amine, preferably piperidine, before coupling it to the appropriate C-terminal amino acid as described above.The deprotected 4-(2', 4'-dimethoxyphenyl-Fmoc-aminomethyl)-phenoxyacetamido-ethyl resin is preferably coupled to the (aC-terminus) using O-benzotriazol-1-yl-N,N,N',N'-tetramethyluronium hexafluorophosphate (HBTU, 1 equivalent) and 1-hydroxybenzotriazole (HOBT, 1 equivalent) dissolved in DMF. The sequential coupling of protected amino acids can be performed in an automated polypeptide synthesizer, as is well known to those skilled in the art. In a preferred embodiment of the invention, the α-N-terminal groups of the growing peptide chain are protected with an Fmoc group. The Fmoc protecting group is removed from the α-N-terminal end of the growing peptide by treatment with a secondary amine, preferably piperidine. The individual protected amino acids are added to the mixture in a three-fold molar excess, the coupling is preferably carried out in DMF.The coupling reagent is usually O-benzotriazol1-yl-N,N,N',N'-tetramethyluronium hexafluorophosphate (HBTU, 1 equivalent) and 1-hydroxybenzotriazole (HOBT, 1 equivalent). At the end of the solid phase synthesis, the polypeptide is removed from the resin and the protection is then resolved either in successive steps or in one operation. The removal of the polypeptide and the resolution of the protection can be accomplished in one operation by treating the resin-bound peptide with a cleavage mixture containing thianisole, water, ethanedithiol and trifluoric acid. If the α-C-terminus of the polypeptide is an alkylamide, the polypeptide is removed from the resin by aminolysis with an alkylamine. Alternatively, the peptide can be removed. HU 224 827 B1 by transesterification, for example using methanol, which can then be followed by aminolysis or direct transamidation. The protected peptide can be purified at this point or directly subjected to the next step. The side chain protecting groups can be removed using the cleavage mixture described above.The fully deprotected peptide can be purified by a series of chromatographic steps, for example, using one or all of the following types of methods: ion exchange chromatography on a mildly basic (acetate type) resin; hydrophobic adsorption chromatography on an underivatized polystyrene-divinylbenzene (e.g., Amberlite XAD) resin; silica gel adsorption chromatography; ion exchange chromatography on a carboxymethylcellulose resin; partition chromatography, for example, on Sephadex-G25, LH-20 gel, or countercurrent partition; High Performance Liquid Chromatography (HPLC), in particular reversed phase HPLC on a column packed with octyl or octadecyl silyl silica. The molecular weight of the kringle-5 peptide fragments was determined by fast atom bombardment (FAB) mass spectroscopy. The solid phase synthesis of kringle-5 peptide fragments is illustrated in Examples 1-12.Depending on their preparation, K5 peptide fragments or K5 fusion proteins may contain the aforementioned disulfide bonds of the kringle-5 region of mammalian plasminogen or may exist in a form lacking them; or fusion proteins formed with other mammalian kringle regions may exist in a form containing or without the disulfide bonds characteristic of the corresponding regions; or may exist in a form containing disulfide bonds forming a tertiary structure that differs from the tertiary structure characteristic of native mammalian plasminogen.Kringle-5 peptide fragments produced by enzymatic cleavage of Glu, Lys, or miniplasminogen by elastase and / or pepsin digestion (these enzymes cleave at sites removed from cysteine bonds) contain the native tertiary kringle-5 protein structure; kringle-5 peptide fragments produced by solid-phase peptide synthesis either contain or do not contain cysteine aminoacyl groups; and kringle-5 peptide fragments produced by expression may contain disulfide bonds at different positions than kringle-5 peptide fragments obtained by enzymatic cleavage. The compounds of the invention (such as, but not limited to, the compounds described in the Examples) have antiangiogenic activity. As angiogenesis inhibitors, these compounds are useful for the treatment of, for example, primary and metastatic solid tumors and carcinomas listed below, as well as other pathologies listed below: breast; colon; rectum; lung; middle pharynx; lower pharynx; esophagus; stomach; pancreas; liver; gallbladder; tumors and carcinomas of the bile ducts and small intestine; tumors and carcinomas of the urinary tract, such as kidney, bladder and urothelium; female genital tract, such as cervix, uterus, ovaries, choriocarcinoma, gestational trophoblastic disease; and male genital tract, such as prostate, seminal vesicle, testicular tumors and carcinomas and germ cell tumors; tumors and carcinomas of endocrine glands, such as thyroid, adrenal, and pituitary;skin conditions such as hemangiomas, melanomas, sarcomas of bone or soft tissue origin and Kaposi's sarcoma; brain, nerve, eye and meningeal tumors such as astrocytomas, gliomas, glioblastomas, retinoblastomas, neuromas, neuroblastomas, schwannomas and meningiomas; solid tumors arising from hematopoietic malignancies such as plaques and tumors from leukemias including chloromas, plasmacytomas, mycosis fungoides and cutaneous T-cell lymphoma / leukemia; lymphomas such as Hodgkin's and non-Hodgkin's lymphomas; prevention of autoimmune diseases such as rheumatoid, immune and degenerative arthritis; eye diseases such as diabetic retinopathy, retinopathy of prematurity, corneal transplant rejection, posterior lens fibroplasia, neovascular glaucoma, rubeosis, retinal neovascularization due to hypoxia and macular degeneration; cases involving abnormal neovascularization of the eye; skin diseases such as psoriasis;diseases of blood vessels, such as hemangiomas and capillary proliferation within atherosclerotic plaques; Osler-Webber syndrome; myocardial angiogenesis; plaque neovascularization; telangiectasia; hemophilic joints; angiofibroma; wound granulation; diseases involving excessive or abnormal stimulation of endothelial cells, such as intestinal adhesions, Crohn's disease, atherosclerosis, scleroderma and hypertrophic scars (i.e. keloids), and diseases whose pathological consequence is angiogenesis, such as cat scratch disease (Rochele minalia quintosa) and ulcers (Helicobacter pylori). They can also be used as contraceptive agents to inhibit ovulation and placental formation.; The compounds of the invention may be useful for preventing metastases from the above tumors alone or in combination with radiation therapy and / or other treatments, such as chemotherapy, which are commonly used in individuals suffering from angiogenic diseases. For the treatment of solid tumors, the compounds of the invention can be administered in combination with chemotherapeutic agents such as alpha-interferon, COMP (cyclophosphamide, vincristine and prednisone), etoposide, mBACOD (methotrexate, bleomycin, doxorubicin, cyclophosphamide, vincristine and dexamethasone), PRO-MACE / MOPP [prednisone, methotrexate (w / leucovin rescue), doxorubicin, cyclophosphamide, taxol, etoposide / mechlorethamine, vincristine, prednisone and procarbazine], vincristine, vinblastine, angioinhibins, TNP-470, pentosan polysulfate, platelet 4.factor, angiostatin, LM-609, SU-101, CM-101, Techgalan, thalidomide, SP-PG and the like, chemotherapeutic agents may be alkylating agents, for example nitrogen mustards such as mecloethamine, melphan, chloram12. HU 224 827 β1 butyl, cyclophosphamide and ifosfamide; nitrosourea derivatives such as carmustine, lomustine, semustine and streptozocin; alkyl sulfonates such as busulfan; triazines such as dacarbazine; ethienimines such as thiotepa and hexamethylmelamine; folic acid analogues such as methotrexate; pyrimidine analogues such as 5-fluoroacyl, cytosine arabinoside; purine analogues, e.g. 6-mercaptopurine and 6-thioguanine; antitumor antibiotics such as actinomycin-D; anthracyclines such as doxorubicin, bleomycin, mitomycin-C and metramycin; hormones and hormone antagonists such as tamoxifen and corticosteroids, and various other agents such as cisplatin and brequinar. A tumor may be treated, for example, by conventional surgery, radiation and / or chemotherapy, and by administration of kringle-5, which may be followed by further administration of kringle-5, to prolong the quiescence of micrometastases and to maintain any remaining primary tumor in a quiescent state and to inhibit its growth. Kringle-5 peptide fragments can be coupled to cytotoxic agents, such as ricin, to provide a means of killing cells that bind kringle-5 peptide. Peptides coupled to cytotoxic agents can be infused in a manner that optimizes drug delivery to the desired site. For example, a high-affinity kringle-5 fragment coupled to ricin can be delivered directly to the target (e.g., a primary tumor or surgical site) or to a blood vessel supplying the desired target site via a cannula. Such agents can also be delivered in a controlled manner using osmotic pumps connected to an infusion cannula. Combinations of kringle-5 antagonists can be used simultaneously with angiogenesis stimulators to improve tissue vascularization. This type of therapeutic approach may be an effective way to kill cancer metastases. The compounds of the invention may be used in the form of pharmaceutically acceptable salts derived from inorganic or organic acids. In the present specification, the term "pharmaceutically acceptable salt" refers to salts which, according to rational medical judgment, are suitable for contact with human and lower animal tissues without causing undue toxicity, irritation, allergic response and the like, and which meet the accepted benefit-risk ratio requirements. Pharmaceutically acceptable salts are well known to those skilled in the art. For example, SM Berge et al. [J. Pharmaceutical Sciences 66, 1 ff seq. (1977)], the entire contents of which are incorporated by reference herein, describe pharmaceutically acceptable salts in detail. The salts may be prepared in situ during the final isolation and purification of the compounds of the invention, or in a separate operation by reacting a suitable organic acid with a free basic functional group.Acid addition salts include, but are not limited to, acetate, adipate, alginate, citrate, aspartate, benzoate, benzenesulfonate, bisulfate, butyrate, camphorate, camphorsulfonate, digluconate, glycerophosphate, hemisulfate, heptanoate, hexanoate, fumarate, hydrochloride, hydrobromide, hydroiodide, 2-hydroxyethanesulfonate (isethionate), lactate, maleate, methanesulfonate, nicotinate, 2-naphthalenesulfonate, oxalate, pamoate, pectinate, persulfate, 3-phenylpropionate, picrate, pivalate, propionate, succinate, tartrate, thiocyanate, phosphate, glutamate, bicarbonate, p-toluenesulfonate, and undecanoate.Additionally, basic nitrogen-containing groups can be quaternized with reagents such as lower alkyl halides, such as methyl, ethyl, propyl, and butyl chlorides, bromides, and iodides; dialkyl sulfates, such as dimethyl, diethyl, dibutyl, and diamyl sulfates; higher halides, such as decyl, lauryl, myrtle, and stearyl chlorides, bromides, and iodides; aryl alkyl halides, such as benzyl and phenethyl bromides, and the like. This can produce a water- or oil-soluble or dispersible product. A pharmaceutically acceptable acid addition salt can be prepared from inorganic acids such as hydrochloric, hydrobromic, sulfuric, and phosphoric acids, and organic acids such as oxalic, maleic, succinic, and citric acids. Base addition salts can be prepared in situ during the final isolation and purification of kringle-5 peptide fragments by reacting a carboxylic acid-containing group with a suitable basic group, such as a pharmaceutically acceptable metal cation hydroxide, carbonate or bicarbonate, or ammonia, or an organic primary, secondary or tertiary amine. Pharmaceutically acceptable salts include, but are not limited to, alkali metal cations or alkaline earth metal cations such as salts formed by lithium, sodium, potassium, calcium, magnesium and aluminum and the like, and non-toxic quaternary ammonia and amine cations such as ammonia, tetramethylammonia, tetraethylammonia, methylamine, dimethylamine, trimethylamine, triethylamine, diethylamine, ethylamine and the like. Other suitable organic amines formed by addition of alkali include, for example, ethylenediamine, ethanolamine, diethanolamine, piperidine, piperazine, and the like.Preferably, the phosphate, tris and acetate salts of the compounds of the invention are used. Kringle-5 peptide fragments, antisera to kringle-5 peptide fragments, kringle-5 receptor agonists, kringle-5 receptor antagonists, or mixtures thereof, can be combined with a pharmaceutically acceptable matrix suitable for sustained release of the active ingredients, such as a biodegradable polymer, to obtain therapeutic compositions. As used herein, the term "matrix suitable for sustained release of the active ingredients" refers to a matrix made of materials, generally polymers, which degrade by enzymatic or acid-base hydrolysis or by dissolution. When placed in the body of the individual to be treated, the matrix is exposed to the action of enzymes and body fluids.The matrix material suitable for the sustained delivery of active ingredients is preferably a biocompatible material, such as liposome, polylactide (lactic acid polymer), polyglycolide (glycolic acid polymer), polylactide-coglycolide (lactic acid and glycolic acid copolymer), polyanhydrides, poly(ortho)esters, polypeptides, hyaluronic acid, collagen, chondroitin sulfate, carboxylic acids, fatty acids, phospho13. HU 224 827 Β1 lipids, polysaccharides, nucleic acids, polyamino acids, amino acids such as phenylalanine, tyrosine, isoleucine, polynucleotides, poly(vinylpropylene), poly(vinylpyrrolidone) and silicone. The biodegradable matrix material is preferably polylactide, polyglycolide or polylactide-coglycolide (lactic acid and glycolic acid copolymer). Kringle-5 peptide fragments, kringle-5 fusion proteins, kringle-5 receptor agonists, kringle-5 receptor antagonists or mixtures thereof can be combined with a pharmaceutically acceptable carrier or vehicle to obtain therapeutic compositions. By pharmaceutically acceptable carrier or excipient is meant a non-toxic, solid, semi-solid or liquid filler, diluent, capsule filler, or any other material that aids in formulation.The preparations can be administered parenterally, sublingually (under the tongue), intracisternaly, intravaginally (into the vagina), intraperitoneally (into the abdominal cavity), rectally (into the rectum), buccally (into the lips or under the oral mucosa), or can be applied topically (as a dusting powder, ointment, drop, transdermal patch or in an iontophoresis device). As used herein, the term "parenteral" refers to routes of administration including intravenous, intramuscular (into a muscle), intraperitoneal (into the abdominal cavity), intrasternal (into the sternum), subcutaneous (under the skin), and intraarticular (into a joint cavity) injection, as well as infusion. Pharmaceutical compositions prepared for parenteral injection may be pharmaceutically acceptable, sterile, aqueous or non-aqueous solutions, dispersions, suspensions, or emulsions, or sterile powders which are reconstituted into sterile, injectable solutions or dispersions immediately prior to use. Suitable aqueous and non-aqueous carriers, diluents, vehicles or solvents include, for example, water, ethanol, polyols (e.g., glycerin, propylene glycol, polyethylene glycol and the like), carboxymethylcellulose and suitable mixtures thereof, vegetable oils (e.g., olive oil) and injectable organic esters such as ethyl oleate.The proper fluidity can be maintained by the use of a coating agent (e.g., lecithin), by achieving the desired particle size in the case of dispersions, and by the use of a surfactant (surface tension reducing) agent. These compositions may further contain adjuvants, such as preservatives, wetting agents, emulsifiers, and dispersants. The action of microorganisms can be prevented by the use of various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, and the like. It may also be necessary to add isotonic agents, such as sugars, table salt, and the like. Prolonged absorption of an injectable pharmaceutical composition can be brought about by the addition of agents that delay absorption, such as aluminum monostearate and gelatin.Injectable depot formulations are prepared by forming a microencapsulated matrix of the drug in a biodegradable polymer, such as polylactide-polyglycolide, poly(orthoesters) and poly(anhydrides). Depending on the ratio of drug to polymer and the properties of the polymer used, the release of the active ingredient(s) can be controlled. Injectable depot formulations can also be prepared by encapsulating the drug in tissue-friendly liposomes or microemulsions. Injectable formulations can be sterilized, for example, by filtration through a bacteria-retaining filter, or by adding a sterilizing agent to a sterile, solid formulation, which is then dissolved or dispersed in sterile water or other sterile injectable fluid immediately prior to use. Topical administration includes, for example, application to the skin, mucous membranes, and the surface of the lungs and eyes. Compositions for topical use, including compositions suitable for inhalation, may be in powder form, which may be pressurized if desired. In non-pressurized powder compositions, the fine particles of active ingredient may be mixed with a larger particle size of a pharmaceutically acceptable inert carrier having a diameter of up to 100 pm. A sugar such as lactose may be used as the inert carrier. Preferably, 95% by weight of the active ingredient particles have a particle size of substantially between 0.01 and 10 pm.For topical ocular administration, the compounds of the invention are administered in a pharmaceutically acceptable ophthalmic vehicle such that the compound remains in contact with the surface of the eyeball for a sufficient period of time to penetrate the corneal and internal regions of the eye, such as the anterior chamber, posterior chamber, vitreous, aqueous humor, vitreous humor, cornea, iris / ciliary body, lens, choroid / retina, and choroid. Examples of pharmaceutically acceptable ophthalmic vehicles include ointments, vegetable oils, or encapsulating materials. Alternatively, the compounds of the invention may be injected directly into the aqueous humor or vitreous humor. The composition may be pressurized and may contain a compressed gas, such as nitrogen or a liquid gas propellant. The liquid propellant - and in fact the entire composition - is preferably such that the active ingredient is substantially insoluble in it. The pressurized composition may further contain a surfactant, such as a liquid or solid nonionic surfactant or a solid anionic surfactant. Preferably, the sodium salt of a solid anionic surfactant is used. Formulations for rectal or vaginal administration are preferably suppositories, which may be prepared by mixing the compounds of the invention with a suitable non-irritating vehicle or carrier, which may be cocoa butter, polyethylene glycol or suppository wax, and which is solid at room temperature but becomes liquid at body temperature, and accordingly melts in the rectum or vagina, releasing the active ingredient. The compounds of the invention may also be used in the form of liposomes. As is known in the art, HU 224 827 B1, liposomes can generally be prepared from phospholipids or other lipid materials. Liposomes are composed of mono- or multilamellar, hydrated liquid crystals dispersed in an aqueous medium. Any non-toxic, physiologically acceptable and metabolizable lipid suitable for the preparation of liposomes can be used. The compositions prepared in liposome form according to the description may contain, in addition to the compounds of the invention, stabilizers, preservatives, carriers and the like. Preferred lipids may be both natural and synthetic phospholipids and phosphatidylcholines (lecithins). Methods for the preparation of liposomes are well known in the art. See, for example, Prescott (ed.): Methods in Cell. Biology XIV, Academic Press, New York, NY USA, 33 et seq. (1976), which is incorporated herein by reference in its entirety. When used in the above-mentioned or other treatments, a therapeutically effective dose of any compound of the invention may be used in its pure form or, if any, in the form of a pharmaceutically acceptable salt, with or without a pharmaceutically acceptable carrier. As used herein, a "therapeutically effective dose" of the compounds of the invention is an amount of the compounds sufficient to treat angiogenic diseases (e.g., an amount sufficient to limit tumor growth or to slow or prevent the formation of tumor metastases) that is useful in any medical treatment with an acceptable benefit-risk ratio. It is understood, however, that the total daily dosage of the compounds and compositions will be determined by the attending physician, in accordance with established medical judgment.The therapeutically effective dose level for a given individual will depend on various factors, such as the disorder being treated and its severity; the activity of the compound employed; the formulation employed; the age, weight, general condition, sex, and diet of the individual being treated; the time of administration; the route of administration; the rate of excretion of the compound employed; the duration of treatment; drugs used in combination or concomitantly with the compound, and similar factors known in the medical art. For example, it is well known to those skilled in the art to start the compounds at a lower starting dose than that required to produce the desired therapeutic effect and then gradually increase the dose until the desired effect is achieved.The total dose of Kringle-5 peptide fragments or fusion proteins administered locally or systemically to a human or other mammal, in single or divided doses, may be, for example, 0.0001-200 mg / kg body weight per day, generally 1-300 mg / kg body weight per day. If desired, the effective daily dose to be administered may be divided into multiple doses. Accordingly, a single dose formulation may contain the daily dose or a fraction of the daily dose. It is understood that the agents that can be combined with the compounds of the invention to inhibit, treat or prevent angiogenic diseases are not limited to those listed above; in principle, any agent suitable for treating or preventing angiogenic diseases can be used. The invention also provides isolated polynucleotides encoding a mammalian kringle-5 peptide fragment or fusion protein having angiogenesis inhibitory activity. Such polynucleotides can be used to express recombinant kringle-5 peptide fragments or for gene therapy purposes (as described below). The polynucleotide of the invention may be mRNA or DNA. The invention includes polynucleotides consisting of DNA, cDNA, genomic DNA and synthetic DNA. The DNA may be double-stranded or single-stranded, and if single-stranded, it may be a coding ("sense") strand or a non-coding ("antisense") strand. The polynucleotides of the invention may be in unmodified form or may contain modifications such as methylation or capping. The sequences encoding the polypeptides may be identical to the sequences of the invention, or they may be different coding sequences, which different coding sequences encode the same polypeptide as the DNA of the invention due to the redundancy or degeneracy of the genetic code. This polynucleotide may comprise only the polypeptide coding sequence; or the polypeptide coding sequence and additional coding sequences, such as a leader or secretory sequence, or a proprotein sequence; or it may comprise the polypeptide coding sequence (and optionally additional coding sequences) and non-coding sequences, such as non-coding sequences located 5' and / or 3' from the polypeptide coding sequence. The invention also includes polynucleotide variants that include modifications such as polynucleotide deletions, substitutions, and additions; and any polypeptide modifications resulting from the variant polynucleotide sequence. The polynucleotides of the invention may also include a coding sequence that is an allelic variant of a naturally occurring sequence. Additionally, the sequence encoding the polypeptide may be fused in frame to a polynucleotide sequence that facilitates expression and secretion of the polypeptide from the host cell, such as a leader sequence that functions as a secretory sequence and regulates transport of the polypeptide from the cell. A polypeptide with a leader sequence is called a preprotein; the leader sequence may be cleaved by the cell, resulting in the production of the polypeptide. Polynucleotides may also encode proproteins, which means that additional amino acids are attached 5' to the protein sequence. A protein with a prosequence is called a proprotein, which may be an inactive form of the protein. Cleavage of the prosequence yields the active protein. Accordingly, the polynucleotides of the invention may encode a protein, a protein spliced with a prosequence, or a protein spliced with both a presequence (leader sequence) and a prosequence. HU 224 827 B1 The polynucleotides of the invention may further comprise marker sequences fused in frame to the coding sequence to allow purification of the polypeptides of the invention. The marker sequence may be a GST tag from a pGEX vector when a bacterial host cell is used, which allows purification of the polypeptides fused to the marker, or, for example, a hemagglutinin (HA) tag when a mammalian cell (e.g., COS-7 cells) is used. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein. See, for example, I. Wilson et al., Cell. 37, 767 (1984). Polynucleotides may be prepared by any means, including, but not limited to, chemical synthesis, replication, reverse transcription, or transcription based on the information provided by the base sequence of the regions from which the polynucleotide is derived; as such, they may correspond to either the sense or antisense orientation of the original polynucleotide. The polymerase chain reaction method described in U.S. Patents 4,683,195 and 4,683,202, which are incorporated herein by reference in their entirety, is advantageously used to prepare polynucleotides. A polynucleotide is said to hybridize with a sequence according to the invention if at least 50%, preferably at least 70%, identity can be demonstrated between the polynucleotide and the given sequence. The invention also provides vectors comprising polynucleotides of the invention; host cells genetically engineered with vectors of the invention; and methods for recombinantly producing polypeptides of the invention. Such methods comprise culturing host cells under conditions suitable for expressing kringle-5-derived polynucleotides and recovering kringle-5-derived polypeptides from the cell culture. The polynucleotides of the invention can be used to produce polypeptides by recombinant methods. Accordingly, the polynucleotide sequences can be incorporated into any of a number of expression vehicles, in particular vectors or plasmids suitable for expressing polypeptides. Such vectors can include chromosomal, non-chromosomal and synthetic DNA sequences, i.e. SV40 derivatives; bacterial plasmids; phage DNAs; yeast plasmids; vectors derived from a combination of plasmids and phage DNA; viral DNA, e.g. vaccinia, adenovirus, fowlpox virus and pseudorabies virus. In fact, any other plasmid or vector can be used, as long as it is capable of replication and is viable in the host. The appropriate DNA sequence can be introduced into the vector by a number of methods. In general, a DNA sequence is inserted into appropriate restriction endonuclease cleavage sites by methods well known in the art. These and other methods are known to those skilled in the art.In the expression vector, the DNA sequence is operably linked to appropriate expression control sequence(s) (promoter) that directs mRNA synthesis. Such promoters include, but are not limited to, the LTR or SV40 promoter, the E. coli lac or trp, the lambda phage PL promoter, and other promoters known to control genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also contains a ribosome binding site for initiating translation and a transcription terminator. The vector may also contain appropriate expression enhancing sequences. In addition, the expression vectors contain a gene carrying a phenotypic characteristic on the basis of which the transformed cells can be selected, which can be a dihydrofolate reductase gene or a gene encoding neomycin resistance in the case of eukaryotic cell culture, or a tetracycline or ampicillin resistance marker in the case of E. coli. A suitable host can be transformed with a vector comprising the appropriate DNA sequence described above and a suitable promoter or regulatory sequence, thereby allowing expression of the protein in the host. Suitable hosts include bacterial cells, such as E. coli, Salmonella typhimurium; Streptomyces subspecies; fungal cells, such as yeast cells; insect cells, such as Drosophila (fruit fly) cells and Sf9 cells; animal cells, such as CHO, COS or Bowes cells, and the like. The skilled artisan will be able to select a suitable host based on the teachings herein. In particular, the invention provides recombinant constructs comprising one or more of the sequences outlined above. The constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in either a forward or reverse orientation. In a preferred embodiment of the invention, the construct also comprises regulatory sequences, such as a promoter operably linked to the sequence of the invention. A number of suitable vectors and promoters are known to those skilled in the art and are commercially available.For example, the following vectors are available: available bacterial vectors are pSPORTI (GIBCO BRL, Gaithersburg, MD), pQE70, PQE60, pQE9 (Qiagen), pBs, phagescript, psiX174, pBluescript SK, pBsKS, pNH8a, pNH16a, pNH18a (Stratagene®, La Jolla, CA, USA), pTrc99A, ρΚΚ223-3, pKK233-3, pDR540, pRIT5 (Pharmacia®); available eukaryotic vectors are pWLneo, pSV2cat, pOG44, pXT1, pSG (Stratagene®), pSVK3, pBPV, pMSG, pSVL (Pharmacia®). However, any plasmid or vector can be used as long as it is capable of replication in the host and is viable. A promoter region can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers. Two such vectors are pKK232-8 and pCM7. Uniquely named bacterial promoters include lacI, lacZ, T3, SP6, T7, HU 224 827 Β1 gpt-, lambda PR-, PL- and frp-promoters. As eukaryotic promoters, we can use, for example, cytomegalovirus (CMV) immediate early, herpes simplex virus (HSV), thymidine kinase, SV40 early and late promoters, promoters of retrovirus-derived LTRs, and mouse metallothionein-l. promoters. Selection of a suitable vector and promoter does not cause difficulties for a person skilled in the art. In a further preferred embodiment of the invention, the invention provides host cells comprising the above construct. The host cell may be a higher eukaryotic cell, such as a mammalian cell; or a lower eukaryotic cell, such as a yeast cell; or a prokaryotic cell, such as a bacterial cell. The construct may be introduced into the host cell, for example, by calcium phosphate transfection, DEAE-dextran-mediated transfection, or electroporation [Davis L. et al., Basic Methods in Molecular Biology, 2nd ed., Appleton and Lang, Paramount Publishing, East Norwalk, CT (1994)]. The constructs introduced into host cells can be used in conventional manner to produce the gene product encoded by the recombinant sequence. Alternatively, the polypeptides of the invention can be produced synthetically using peptide synthesis equipment. Proteins can be expressed in mammalian cells, yeast, bacteria or other cells under the control of suitable promoters. Cell-free translation systems can also be used to produce such proteins using RNA molecules derived from the DNA constructs of the invention. Suitable cloning and expression vectors for use in prokaryotic and eukaryotic hosts are described in Sambrook et al. [Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor, NY, USA (1989); the entire contents of which are incorporated herein by reference]. Transcription of the DNA encoding the polypeptides of the invention in higher mammalian cells can be enhanced by the use of enhancer sequences inserted into the vector. Enhancers are DNA c / sz-acting elements, usually 10-300 bp in size, which act on a promoter to increase its transcriptional activity. Such enhancer sequences include, for example, the enhancer located late on the SV40 replication origin (100-270 bp region), the cytomegalovirus early promoter enhancer, the polyoma enhancer located late on the replication origin, and adenovirus enhancers. In general, recombinant expression vectors contain an origin of replication and selectable markers that allow transformation of host cells - such sequences include, for example, the E. coli ampicillin resistance gene and the S. cerevisiae TRP1 gene - and additionally contain a promoter derived from a highly expressed gene to direct transcription of a 3'-directed structural sequence. Such promoters may be derived from operons encoding glycolytic enzymes, such as those encoding 3-phosphoglycerate kinase (PGK), alpha factor, acid phosphatase or heat shock proteins, and others. The heterologous structural sequences are linked to translation initiation and termination sequences, and preferably to a leader sequence capable of directing secretion of the translated polypeptide into the periplasmic space or extracellular medium, so that they are in the same reading frame.Alternatively, the heterologous sequence may encode a fusion protein that contains an N-terminal recognition peptide that has a desired property, such as a property that facilitates stabilization or easy purification of the expressed recombinant product. Expression vectors for use in bacteria are prepared by inserting a structural DNA sequence encoding a desired protein together with appropriate translation initiation and termination signals so that they are in frame with a functional promoter. The vector should contain one or more phenotypic selectable markers and an origin of replication to ensure the maintenance of the vector and, if desired, its amplification within the host cell. Examples of suitable prokaryotic host cells for transformation include E. coli, Bacillus subtilis, Salmonella typhimurium, and various species of the genera Pseudomonas, Streptomyces, and Staphylococcus, although other species may also be used. Vectors for use in bacteria contain a selectable marker and a bacterial origin of replication derived from plasmids containing the genetic elements of the well-known pBR322 cloning vector (ATCC 37,017). Other vectors include, but are not limited to, PKK223-3 (Pharmacia® Fine Chemicals, Uppsala, Sweden) and GEM1 vectors (Promega Biotec, Madison, WI, USA). These pBR322 framework sequences are combined with a suitable promoter and the structural sequence to be expressed. Suitable expression vectors may also contain a fusion partner to facilitate purification of the desired polypeptide of the invention or to provide a soluble polypeptide. Commercially available fusion vectors include, but are not limited to, pET32a (Novagen, Madison, WI, USA), pGEX-4T-2 (Pharmacia®), and pCYB3 vectors (New England Biolabs, Beverly, MA, USA). Expression vectors that avoid the use of a fusion partner can also be constructed, particularly when high-level expression of kringle-5 peptide fragments or fusion proteins in bacterial cells is desired. For example, vectors can be constructed to optimize translational coupling, e.g., according to the method of Pilot-Matias TJ et al. [Gene 128, 219 (1993)], which is incorporated herein by reference in its entirety.Alternatively, the polynucleotide of the invention may be co-expressed with another accessory plasmid encoding a protein or peptide that promotes solubilization of the first protein. HU 224 827 Β1 [see e.g. Mekrides SC: Microbiological Reviews 60, 512 (1996)]. For example, certain kringle-5 peptide fragments [which have been shown to be soluble fusion proteins with thioredoxin (see Example 20)], can also be expressed from a non-fusion vector, in parallel (i.e. in the same host cell) with the expression of a second vector expressing thioredoxin. After transformation of cells of a suitable host strain and expansion of the host strain to a suitable cell density, the selected promoter is derepressed by suitable methods (e.g., by temperature shift or chemical induction) and the cells are further cultured for a specified period of time. The cells are harvested, typically by centrifugation, disrupted by physical or chemical methods, and the resulting crude extract is set aside for further purification. Microbial cells used for protein expression can be disrupted by any conventional method, such as freeze-thaw cycling, sonication, mechanical disruption, or the use of agents that cause cell lysis; such methods are well known to those skilled in the art. Various mammalian cell culture systems can be used to express recombinant proteins. Mammalian expression systems include, for example, the monkey kidney fibroblast-derived COS-7 cell line [Gluzman: Cell. 23, 175 (1981)]; or other cell lines capable of expressing compatible vectors, such as the C127, 3T3, CHO, HeLa, and BHK cell lines. Mammalian expression vectors typically contain the following: an origin of replication, a suitable promoter and enhancer, as well as the necessary ribosome binding sites, a polyadenylation site, donor and acceptor sites involved in splicing (mRNA maturation), transcription termination sequences, and 5'-terminal flanking, non-transcribed sequences. The desired non-transcribed genetic elements may include, for example, DNA sequences derived from the SV40 viral genome, such as the SV40 origin of replication, early promoter, enhancer, splice and polyadenylation sites.For example, pRc / CMV or pcDNA3 vectors (available from Invitrogen; San Diego, CA, USA) can be used as vectors. The invention also provides gene therapy methods, in which the expression of a gene encoding kringle-5 peptide fragments or kringle-5 peptide fragment conjugates is regulated in a patient. Various methods for delivering or transporting DNA to cells for the purpose of expressing a protein gene product, also known as gene therapy methods, are described in the following literature: “Gene Transfer in Mammalian Somatic Cells in vivo”, Yang N.: Crit. Rev. Biotechn. 12(4), 335 (1992)], which is incorporated herein by reference in its entirety. In so-called gene therapy methods, polynucleotide sequences are introduced into cell lines of somatic or germ cell origin, ex vivo or in vivo, for the purpose of gene therapy. Gene therapy can be used to replace genes, enhance their normal or abnormal function, or combat the development of infectious diseases and other pathological conditions. Strategies for solving medical problems with gene therapy can be therapeutic strategies, for example, identifying the abnormal gene and introducing a functional gene that can replace the function of the abnormal gene or enhance the function of a gene that is functioning at a low level; or prophylactic (preventive) strategies, for example, introducing a gene that is used to treat the given condition; or that makes the tissue or organ more susceptible to the applied treatment. According to such a prophylactic strategy, for example, a gene encoding a kringle-5 peptide fragment or kringle-5 peptide fragment conjugate is introduced into a patient, thereby preventing angiogenesis; or a gene is inserted that makes tumor cells more sensitive to radiation so that irradiation of the tumor results in increased destruction of the tumor cells. The present invention provides a variety of methods for introducing DNA encoding a kringle-5 peptide fragment or a kringle-5 fusion protein; or a method for introducing DNA encoding regulatory sequences for a kringle-5 peptide fragment (or its fusion partner). Gene therapy methods include transfection of promoter sequences other than the promoter sequence naturally associated with the kringle-5 peptide fragment or other sequences that enhance the production of the kringle-5 peptide fragment. An example of the use of such technology is provided by TranskaryoticTherapies, Inc. of Cambridge, Massachusetts, which uses homologous recombination to insert a "genetic switch" that causes the erythropoietin gene to function in cells, as described in Genetic Engineering News, April 15, 1994, which is incorporated herein by reference in its entirety.Such "gene switches" can be used to activate kringle-5 peptide fragments (or kringle-5 receptors) in cells that do not originally express these proteins. Gene transfer methods for gene therapy can be divided into three broad groups: (1) methods based on physical methods (e.g. electroporation, direct gene transfer, and particle bombardment); (2) methods based on chemical methods (e.g. using lipid-based carriers or other non-viral vectors); (3) biological methods (e.g. using viral vectors). For example, non-viral vectors, such as DNA-encapsulated liposomes, can be injected directly into a patient intravenously. The liposome / DNA complexes are thought to concentrate in the liver, where they deliver the DNA to macrophages and Kupffer cells. Vectors or “naked” DNA corresponding to the gene can also be injected directly into the desired organ, tissue, or tumor for targeted delivery of therapeutic DNA. Gene therapy procedures can also be characterized according to the site of administration. Genes are basically HU 224 827 Β1 can be introduced by ex vivo, in vivo or in vitro gene transfer. In ex vivo gene transfer, cells are removed from the treated individual and then cultured in cell culture. The DNA is transfected into the cells, the transfected cells are expanded and then returned to the patient. In vitro gene transfer uses cells grown in cell culture, such as tissue culture cells, and not specific cells from a given patient, as transformed cells. These “laboratory” cells are transfected, the transfected cells are selected, expanded and then used for administration to the patient or for other purposes. In vivo gene transfer involves introducing DNA into the patient’s cells so that the cells remain in the patient. All three of the above broad categories can be used to induce in vivo, ex vivo or in vitro gene transfer.Mechanical DNA delivery can be achieved by microinjection of DNA into gametes or somatic cells; DNA-coated particles, such as gold particles used in the “gene gun” technique, can be delivered pneumatically; and inorganic chemical approaches, such as calcium phosphate transfection, can be used. Physical injection of plasmid DNA into muscle cells has been shown to result in a high rate of cells that are transfected and can persistently express marker genes. Plasmid DNA can be incorporated into the cell genome or remain outside it. The presence of transfected DNA outside the genome allows for the persistent expression of gene product proteins in terminally differentiated, non-proliferative tissues without the risk of insertions or deletions or other changes in the cellular or mitochondrial genome that result in mutations.Long-term, but not necessarily permanent, transfer of therapeutic genes into specific cells may be useful for the treatment of genetic diseases; or for the prevention of such diseases. The DNA may be injected repeatedly at intervals to maintain the level of the gene product without introducing mutations into the genome of the recipient cells. Exogenous DNAs remaining outside the genome may allow for the simultaneous presence of several different exogenous DNA constructs in a cell, each expressing a different gene product. Particle-mediated gene transfer can also be used to inject DNA into cells, tissues, or organs. A particle bombardment device or "gene gun" generates a driving force that accelerates high-density particles (such as gold or tungsten particles) coated with DNA to high speeds, allowing them to enter target organs or tissues or cells. The electroporation method for inducing gene transfer is based on the application of an electric current to sensitize cells or tissues to electroporation-mediated gene transfer. A short electrical pulse of a defined voltage is used to increase membrane permeability so that DNA molecules can enter the cells. Particle-mediated gene transfer and electroporation methods are well known to those skilled in the art. A chemical method used for gene therapy is carrier-mediated gene transfer based on the use of fusogenic lipid vesicles, such as liposomes or other vesicles capable of forming membrane fusion. The carrier carrying the DNA in question can be simply introduced into body fluids or the bloodstream and then directed in a specific manner within the body to the target organ or tissue. For example, cell- or organ-specific DNA-carrying liposomes can be developed so that the foreign DNA carried by the liposomes is taken up by said specific cells. Injection of immunoliposomes targeting specific receptors on certain cells is a simple method for delivering DNA into cells bearing the given receptor. Another carrier system is the asialoglycoprotein / polylysine conjugate system, which has been used to deliver DNA to liver cells for in vivo gene transfer. Transfected DNA can also be used as a complex with other types of carriers, so that the DNA reaches recipient cells and is then stored in the cytoplasm or nucleoplasm. DNA can be linked to carrier nuclear proteins, in specifically engineered vesicle complexes, and delivered directly into the nucleus. Carrier-mediated gene transfer can be performed using lipid-based compounds that are not liposomes. For example, lipofectins and cytofectins are lipid-based positive ions that bind to negatively charged DNA and form a complex that can transport the DNA across the cell membrane. Another method of carrier-mediated gene transfer is receptor-mediated endocytosis. In this method, a ligand specific for a cell surface receptor and the gene of interest are complexed and injected into the bloodstream. Target cells with cell surface receptors specifically bind the ligand, and the ligand-DNA complex is delivered into the cell. Biological gene therapy methods use viral vectors or non-viral vectors (such as the ligand-DNA conjugates, liposomes, and lipid-DNA complexes described above) to insert genes into cells. The transfected cells may be derived from normal tissue of the individual to be treated, diseased tissue, or cells not derived from the individual. It may be convenient to operably link a recombinant DNA molecule comprising a DNA sequence encoding a kringle-5 peptide fragment or a DNA sequence encoding a kringle-5 fusion protein to an expression control sequence, thereby providing an expression vector capable of expressing a kringle-5 peptide fragment or fusion protein. Alternatively, gene regulation of kringle-5 peptide fragments or kringle-5 fusion proteins may be achieved by using compounds that bind to the kringle-5 gene, the fusion partner gene, or a protein associated with the kringle-5 gene or fusion partner gene. HU 224 827 Β1 cial regulatory region, or their corresponding RNA transcript (either), to modify the rate of transcription or translation. Viruses used for gene therapy procedures include, but are not limited to, retroviruses, other RNA viruses such as poliovirus or Sindbis virus, adenoviruses, adeno-associated viruses, herpesviruses, SV40, vaccinia viruses, and other DNA viruses. Retroviral vectors of murine origin, which are incapable of autonomous replication, are the most widely used gene transfer vectors. Murine leukemia retroviruses contain single-stranded RNA, which is complexed with nucleoproteins (“core proteins”) and polymerase (po!) enzymes, enclosed in an inner protein coat (gag), and surrounded by an outer glycoprotein coat (env) that determines the host spectrum. The genomic structure of retroviruses includes the gag, pol, and env genes, which are flanked by 5' and 3' long terminal repeats (LTRs). Retroviral vector systems exploit the fact that a minimal vector containing only the 5' and 3' LTR sequences and the packaging signal is sufficient for vector packaging, infection and integration into target cells, provided that the structural proteins of the virus are provided in trans (from a different nucleotide sequence) in the packaging cell line.The use of retroviral vectors for gene transfer has the following major advantages: they efficiently induce infection and gene expression in most cell lines; the vectors integrate precisely, in a single copy, into the chromosomal DNA of target cells; and the retroviral genome is easy to manipulate. For example, modified retroviral vectors have been used ex vivo to deliver genes into peripheral and tumor-infiltrating lymphocytes, liver cells, epidermal cells, muscle cells, or other somatic cells (which can then be transferred into the patient to ensure the presence of the gene product generated from the inserted DNA). Adenoviruses contain linear, double-stranded DNA, which forms a complex with internal proteins (“core”) and is surrounded by capsid proteins. Progress in molecular virology has led to the use of the biological properties of the above organisms to produce vectors that can be used to deliver novel genetic sequences into target cells in vivo. Adenovirus-based vectors are capable of high-level expression of gene product peptides. Adenovirus vectors infect cells with high efficiency, even with low virus titers. In addition, the virus retains its full infectivity as a cell-free virion, so there is no need to inject a producer cell line. A further advantage of using adenovirus vectors is that they can be used to achieve sustained expression of heterologous genes in vivo. Viral vectors have also been used to insert genes into cells, in vivo. Tissue-specific expression of foreign genes can be achieved by using cis-acting regulatory elements or tissue-specific promoters. Alternatively, the above goal can be achieved by delivering the DNA or viral vector in situ to specific anatomical sites, in vivo. For example, in vivo gene transfer into blood vessels has been achieved by implanting endothelial cells transduced in vitro into specific sites in arterial walls. Surrounding cells infected with the virus have also been shown to express the gene product. Viral vectors can be delivered directly to the in vivo site (e.g., via catheter), thereby ensuring that the virus only causes infection in certain areas and that sustained, site-specific gene expression occurs.In vivo gene transfer, also based on the use of retroviral vectors, was induced in mammalian tissues and liver tissue by injecting the modified viruses into the blood vessels leading to the organs. Furthermore, kringle-5 peptide fragments can be prepared and used for various purposes. For example, various kringle-5 peptide fragments can be used as: (1) agonists or antagonists active at kringle-5 binding sites; (2) antigens to elicit the production of specific antisera; (3) peptides for use in diagnostic kits; or (4) peptides linked to or used in combination with cytotoxic agents to target cells that bind kringle-5 peptide fragments. Considerations in selecting amino acid sequences comprising the above peptide fragments include whether they are located in external surface regions of the molecule that are accessible for binding to antisera; or whether they have the ability to inhibit processes resulting from or exacerbated by peptide fragment angiogenesis.In addition, the above peptide sequences can be compared with known sequences using a protein sequence database, such as "GenBank", "Brookhaven Protein", "SWISS-PROT" or "PÍR", to find potential sequence homologies. The information thus obtained helps us to eliminate sequences showing a high degree of sequence homology with other molecules and increases the chance of developing highly specific antisera, agonists and antagonists. Kringle-5 peptide fragments or fusion proteins can also be used to isolate kringle-5 receptor by immobilizing the kringle-5 peptide fragment or fusion protein on a solid support, such as an affinity column, and then passing an extract or membrane extract of cultured endothelial cells thereon. As is known in the art, after isolation and purification of kringle-5 receptor, amino acid sequencing can be performed, and then isolated polynucleotides encoding kringle-5 receptor can be identified based on this. Such polynucleotides can then be cloned into a suitable expression vector and transfected into tumor cells. Expression of the receptor in the transfected tumor cells enhances the sensitivity of said cells to HU 224 827 β1 sensitivity to endogenous or exogenous kringle-5 peptide fragments, thereby reducing the rate of metastasis growth. Furthermore, recombinant expression of the above receptor allows it to be produced in larger quantities, for example, in quantities sufficient for use in high-throughput screening assays, whereby smaller antagonists that mimic the action of kringle-5 can be identified. By systematically substituting amino acids in the above synthesized peptides, high affinity peptide agonists and antagonists of the kringle-5 receptor can be identified that enhance or prevent the binding of the kringle-5 peptide fragment to its receptor. Such antagonists can be used to inhibit the growth of micrometastases, thereby limiting tumor spread. In cases of inadequate vascularization, antagonists of kringle-5 peptide fragments can be used to block the inhibitory effect of kringle-5 peptide fragments and promote angiogenesis. Such a type of treatment may, for example, have a therapeutic effect in promoting wound healing in diabetic patients. The kringle-5 peptide fragments or fusion proteins or conjugates of the invention can also be used as antigens for the production of polyclonal or monoclonal antibodies specific for kringle-5 inhibitor. Such antibodies can be used in diagnostic methods and reagent kits for the detection or quantification of kringle-5 peptide fragments in body fluids or tissues. The results of the above tests can be used to detect or determine the prognostic significance of kringle-5 peptide fragments. Kringle-5 peptide fragments or kringle-5 fusion proteins can be labeled with radioactive isotopes (see Example 13) or chemically linked to proteins to form conjugates. Conjugates can include enzymes, carrier proteins, cytotoxic agents; fluorescent, chemiluminescent or bioluminescent molecules; which facilitate testing of kringle-5 peptide fragment-containing compounds for their ability to bind to kringle-5 antiserum; facilitate detection of cell types bearing kringle-5 peptide fragment receptors; or facilitate purification of kringle-5 peptide fragments. The choice of method for effecting the linkage is determined by the functional groups available on the amino acids of the kringle-5 peptide fragment sequence; such groups include, but are not limited to, alkyl, amino, sulfhydryl, carboxyl, amide, phenol, indolyl and imidazole groups.Various reagents can be used for coupling, including glutaraldehyde, diazotized benzidine, carbodiimides, or p-benzoquinoline. The efficiency of the coupling reaction can be determined by various methods, depending on the reaction in question. For example, kringle-5-peptide or a biologically active fragment thereof can be radioactively labeled with the isotope 125 using chloramine-T and high specific activity Nal125. The reaction is stopped by adding sodium metabisulfite, and the salts are removed from the mixture using a disposable column. The labeled peptide is eluted from the column and the fractions are collected. A sample of each fraction is taken and its radioactivity is determined in a gamma counter. The above procedure yields a radioactively labeled kringle-5-peptide fragment free of unreacted Nal125.Alternatively, blood or tissue extract containing kringle-5 peptide fragment linked to kringle-4 fragment can be purified on a polylysine affinity column, in which case the kringle-4-kringle-5 peptide fragment is bound to the column by the affinity of the kringle-4 peptide fragment for lysine. Purified kringle-4-kringle-5 peptide fragment is obtained by elution of the bound protein. Peptide conjugation can also be used to produce polyclonal antisera. Antisera directed against kringle-5 peptide fragments, kringle-5 peptide fragment analogs, or kringle-5 receptor can be prepared by methods well known to those skilled in the art. For example, kringle-5 peptide fragments containing lysine residues can be coupled to purified bovine serum albumin (BSA) using glutaraldehyde. The efficiency of the above reaction can be determined by the incorporation of radioactively labeled peptide. Unreacted glutaraldehyde and peptide are removed by dialysis, and the conjugate can be used to induce the production of polyclonal antisera in rabbits, sheep, goats, or other animals.Kringle-5 peptide fragments conjugated to a carrier molecule, such as BSA, can be combined with an adjuvant mixture, emulsified, and injected subcutaneously (under the skin) into a suitable host at multiple sites, such as the back, neck, thighs, and occasionally the soles of the feet. Booster injections are generally given at regular intervals, such as every 2-4 weeks. Blood samples are taken by venipuncture about 7-10 days after each injection, such as from the marginal ear vein after inducing vasodilation. The blood samples are allowed to clot overnight at 4°C and then centrifuged at about 2400 g at 4°C for about 30 minutes. The serum is removed, weighed, and stored at 4°C for immediate use or at -20 to -90°C for later analysis. Samples of the polyclonal antiserum produced, or in the case of monoclonal antiserum, samples of the culture medium, are analyzed for antibody titer; and are tested for the detection of particularly high titer antiserum. The highest titer antisera directed against the kringle-5 peptide fragment are then tested for the following: a) determining the optimal antiserum dilution that produces the highest specific antigen binding with the lowest nonspecific binding; b) determining the binding capacity of the antibodies by recording a standard displacement curve using increasing amounts of kringle-5 peptide fragment; c) determining, HU 224 827 Β1 whether they show cross-reactivity with similar peptides and proteins, including plasminogen and kringle-5 peptide fragments from related species; d) testing the ability of the antibodies to detect kringle-5 peptide fragments in cell culture supernatants, plasma extracts, urine and tissues. The titers can be determined by various methods known in the art, for example by dot blot or density analysis; or by precipitation of radioactively labeled peptide-antibody complexes, whereby the complexes are precipitated using, for example, protein A, secondary antiserum, cold ethanol or activated carbon-dextran, and the activity is then determined by gamma counter. If desired, the highest titer antiserum can be purified on an affinity column.For example, kringle-5 peptide fragments can be coupled to a commercially available packing and used to prepare an affinity chromatography column. Antiserum samples can then be passed through the column, whereby kringle-5 antibodies (via the kringle-5 peptide fragments) bind to the column. These bound antibodies are then eluted, collected, and analyzed for titer and specificity. In addition to the above, the invention also provides reagent kits for the determination of kringle-5 peptide fragments and kringle-5 receptors. The highest titer, specificity, and antisera capable of detecting kringle-5 peptide fragments in plasma extracts, urine, tissues, and cell culture supernatants can be used to develop reagent kits for the rapid, reliable, sensitive, and specific determination and localization of kringle-5 peptide fragments.Such kits may be based on, for example, but not limited to, the following methods: competitive or non-competitive assays; radioimmunoassays; bioluminescent and chemiluminescent assays; fluorometric assays; sandwich assays; immunoradiometric assays; dot-blot assays; enzyme-linked immunosorbent assays, such as ELISA; microtiter plates; immunocytochemical assays; and antibody-coated strips or dipsticks for rapid testing of urine or blood. For each kit, the range of applicability of the assay, its sensitivity, accuracy, reliability, specificity, and reproducibility of the results are determined by methods well known to those skilled in the art. One commonly used reagent kit in research and clinical practice is a reagent kit based on the radioimmunoassay (RIA). An RIA suitable for the detection of kringle-5 peptide fragments can be developed as follows: after successful labeling and purification of kringle-5 peptide fragments with radioactive iodine, tubes containing a relatively constant amount of radioactivity, e.g. 10,000 cpm, are added with antiserum containing the highest titer of anti-kringle-5 peptide fragment antibodies, at various dilutions, in a suitable buffer system. (Buffer or preimmune serum is added to other tubes to determine nonspecific binding.) After incubation at four (4) °C for 24 hours, protein A is added to each tube, the contents of the tubes are mixed by vortexing, incubated for 90 minutes at room temperature, and centrifuged at approximately 2000-2500 g at 4 °C to precipitate complexes formed by antibody bound to the labeled antigen.The supernatants are removed by aspiration and the radioactivity of the pellet is determined in a gamma counter. The antiserum dilution that binds approximately 10-40% of the labeled peptide according to the above test, after subtraction of nonspecific binding, is selected for further testing. The dilution series of kringle-5 peptide fragment used to prepare the antiserum (containing approximately 0.1 pg-10 ng of peptide fragment) is then tested by adding a known amount of peptide to tubes containing radiolabeled peptide and antiserum. After a suitable incubation time (e.g. 24-48 hours), protein-A is added to the tubes, the tubes are centrifuged, the supernatants are removed, and the radioactivity remaining in the pellet is determined. The displacement of the radiolabeled kringle-5 peptide fragment from the binding is plotted against the unlabeled kringle-5 peptide fragment (standard) to obtain a standard curve. Additionally, dilutions of other kringle-5 peptide fragments, plasminogen, kringle-5 peptide fragments from other species, or homologous peptides at different concentrations can be added to the test tubes to characterize the specificity of the antiserum directed against the kringle-5 peptide fragment. Extracts are then prepared from various tissues, such as, but not limited to, primary and secondary tumors, Lewis lung carcinoma, kringle-5 peptide fragment-producing cell cultures, placenta, uterus, and other tissues, such as brain, liver, and intestine, according to extraction methods that have been successfully used to extract kringle-5 peptide fragments. After the tissue extracts are prepared, assay buffer is added to them and various amounts of samples are measured in RIA tubes. Extracts from cells known to produce kringle-5 peptide fragments produce a suppression curve parallel to the standard curve, while extracts from tissues that do not produce kringle-5 peptide fragments do not result in the suppression of radiolabeled kringle-5 peptide fragments from antiserum directed against kringle-5 peptide fragments.According to such suppression curves, the kringle-5-peptide fragment assay method can be used to determine kringle-5-peptide fragments in tissues and body fluids. Tissue extracts containing kringle-5 peptide fragments can be further characterized by subjecting the samples to a reverse-phase HPLC method. HU 224 827 Β1. Eluted fractions are collected, dried in a “SpeedVac” device, taken up in RIA buffer and then analyzed by kringle-5-RIA. In this case, the highest amount of kringle-5-peptide fragment immunoreactivity is found in the fractions corresponding to the elution of the kringle-5-peptide fragment. The assay kit described above comprises the following: instructions for performing the procedure, antiserum, kringle-5 peptide fragment and optionally radiolabeled kringle-5 peptide fragment and / or reagents for precipitating bound kringle-5 peptide fragment / kringle-5 antibody complexes. Such kits can be used to determine the amount of kringle-5 peptide fragments in biological fluids and tissue extracts from animals and humans with or without tumors. Additional reagent kits may be suitable for visual detection or localization of kringle-5 peptide fragments in tissues and cells. For example, immunohistochemical methods and reagent kits based on such methods are well known to those skilled in the art. As is known in the art, immunohistochemical reagent kits should include antiserum directed against kringle-5 peptide fragments and, optionally, blocking antiserum, and a secondary antiserum conjugated to a fluorescent molecule, such as fluorescein isothiocyanate or other reagent suitable for detecting the primary antiserum. According to the above methods, tumor biopsy samples can be examined for the site of kringle-5 peptide fragment production or the kringle-5 peptide fragment receptor site. In addition, the reagent kit may contain radioactively labeled nucleic acids as probes suitable for in situ hybridization with messenger RNA encoding kringle-5 peptide fragments. The compounds of the invention can be prepared by methods well known to those skilled in the art [see, for example, Sottrup-Jensen et al.: Progress in Chemical Fibrinolysis and Thrombolysis, Vol. 3, eds.: Davidson JF, Rowan RM, Samama Μ. M, and Desnoyers PC, Raven Press, New York (1878)]. Kringle-5 peptide fragments can be prepared, for example, by enzymatic cleavage of the native protein (g / u-plasminogen); or by enzymatic cleavage of a variant thereof (e.g., truncated forms of the full-length protein that are enzymatically cleavable and contain at least one kringle-5 sequence as defined above, e.g., lys-plasminogen or miniplasminogen). To do this, we first isolate the protein from human plasma in a form free from plasmin inhibitors and facilitate the conversion of ag / u-plasminogen to / ys-plasminogen [see Novokhatny V. and Kudinov SA: J. Mol. Biol. 179, 215 (984)].The truncated molecule is then treated with a proteolytic enzyme at a concentration sufficient to cleave kringle-5 peptide fragments from the polypeptide, and then purified from other fragments by methods known to those skilled in the art. The proteolytic enzyme is preferably human or porcine elastase, which cleaves plasminogen and cleaves its truncated forms between kringle regions 3-4 and 4-5 (resulting in the formation of kringle-1-3, kringle-1-4 or kringle-4 and kringle-5 peptide fragments only). For example, β-plasminogen or g / u-plasminogen can be treated with porcine or human neutrophil elastase, using a ratio of β-plasminogen:elastase of about 1:100-1:300 (preferably 1:150-1:250, and most preferably 1:150), in a buffer solution (e.g., a solution containing Tris-HCl, NaCl, sodium phosphate, or the like).Alternatively, the elastase is first immobilized (e.g., on a support) to facilitate purification of the cleavage product. Treatment of the / ys-plasminogen or g / u-plasminogen with human or porcine elastase is generally carried out at a temperature of about 10-40°C for a period of time ranging from 4 to about 24 hours, depending on the degree of cleavage desired. In order to completely digest / ys-plasminogen, g / u-plasminogen or miniplasminogen with human or porcine elastase, the polypeptides are contacted with the enzyme for at least about 12 hours at room temperature. By varying the pH and the incubation time with the enzyme, a lesser or partial cleavage occurs at one or more of the sensitive cleavage sites. The cleavage products can then be purified by any method known in the art (e.g., column chromatography).A preferred purification procedure, in which the cleavage products are applied to a lysine-Sepharose column, is described in Example 14. Solid-phase synthesis of kringle-5 peptide fragments The preparation of the compounds of the invention is illustrated by the following examples. Example 1 Preparation of N-Ac-Val-Leu-Leu-Pro-Asp-Val-Glu-Thr-Pro-SerGlu-Glu-Asp-NH2-peptide An amide peptide synthesis column (Applied Biosystems) was placed in the peptide synthesis column holder of a Perkin-Elmer Applied Biosynthesis “Synergy” type peptide synthesizer, and synthesis was performed according to the following sequence: 1. The resin was washed with DMF solvent for 5 minutes; 2. The Fmoc group was removed from the α-Ν-terminus of the resin-bound amino acid by exposing it to 20% piperidine in DMF solvent for 15 minutes; 3. The resin was washed with DMF for 5 minutes; 4. The α-C-terminus of amino acid number 1 was activated with [FmocAsp (β-0'Bu); 25 pmol], 0.2 mol / l HBTU (25 pmol), HOBT (25 pmol) dissolved in DMSO-NMP (N-methylpyrrolidone) solvent and 0.4 mol / l diisopropylethylamine (25 pmol) dissolved in DMSO-NMP solvent, then the activated amino acid was bound to the resin; 5. Add the activated Fmoc-protected amino acid (prepared in step 5)23 HU 224 827 B1 The title compound was prepared in the synthesis described in Example 1 using the following amino acids: N-Ac-Met-Phe-Gly-Asn-Gly-Lys- 6. Washing was carried out in DMF solvent for 5 minutes; Gly-Tyr-Arg-Gly-Lys-Arg-Ala-Thr-Thr-Val-Thr- 7. Steps 3-6 were repeated, using the following amino acids in the synthesis sequence, using a Fmoc-Pro group as the first amino acid. The following amino acids were used, under the conditions already mentioned: 2. Fmoc-Glu (yO'Bu) 3. Fmoc-Glu (γ-O'Bu) Amino acid number 4. Fmoc-Ser ('Bu) 10 2. Fmoc-Thr ('Bu) 5. Fmoc-Pro 3. Fmoc-Gly 6. Fmoc-Thr ('Bu) 4. Fmoc-Thr (*Bu) 7. Fmoc-Glu (γ-O'Bu) 5. Fmoc-Val 8. Fmoc-Val 6. Fmoc-Thr ('Bu) 9. Fmoc-Asp (3-O'Bu) 15 7. Fmoc-Thr ('Bu) 10. Fmoc-Pro 8. Fmoc-Ala 11. Fmoc-Leu 9. Fmoc-Arg (Pmc) 12. Fmoc-Leu 10. Fmoc-Lys (Boc) 13. Fmoc-Val 11. Fmoc-Gly 8.Acetic acid was coupled to the N-terminus of the resin-bound peptide under the same conditions as in steps 4 and 5; 14. Fmoc-Gly 9. The resin was washed with THF for about 5 minutes to remove DMF and shrink the resin, 15. Fmoc-Lys (Boc) and then dried with argon for 10 minutes and nitrogen for 10 minutes to obtain pure resin-bound peptide 18. Fmoc-Gly; 19. Fmoc-Phe 10. In cleavage reagent [freshly prepared thioanisole 20. Fmoc-Met,. (100 μΙ), water (50 μΙ), ethanediol (50 μΙ) with trifluoroacetic acid (1.8 ml) solution, which were mixed in this order], the peptide was cleaved from the resin, simultaneously removing the protection of the amino acid side chains. The mixing was carried out between -5 -10 °C, for 10-15 minutes, and then at room temperature for an additional 1.75 hours [for each Arg(Pmc) group - if present - an additional 0.5 hour]. The amount of cleavage reagent was determined according to the following formula: Resin-bound peptide (mg) Cleavage reagent (μΙ) 0-10 100 10-25 200 25-50 400 50-100 700 100-200 1200 11. The product was filtered and rinsed with concentrated trifluoroacetic acid, the filtrate was divided into 0.5 ml portions into centrifuge tubes containing 8 ml of cold diethyl ether, centrifuged and decanted, repeating this operation until all the peptide precipitated. If the peptide did not precipitate upon addition of ether, the mixture was extracted with 30% aqueous acetic acid (3*1 ml), and the combined aqueous extract was lyophilized to obtain the finished product; 12. The peptide was used in crude form or purified by HPLC on a “7 pm Symmetry Prep C18” column using a 5-100% acetonitrile (water, 0.1% TFA) gradient over 50 minutes, then the finished product was lyophilized; using the above procedure, 35 mg of N-Ac-Val-Leu-LeuPro-Asp-ValGlu-Thr-Pro-Ser-Glu-Glu-Asp-NH2-peptide was obtained. that 35 mg of N-Ac-Met-Phe-Gly-Asn-Gly-Lys-Gly- 30 Tyr-Arg-Gly-Lys-Arg-Ala-Thr-Thr-Val-Thr-Gly-Thr-ProNH2-peptide is obtained. Example 3 Preparation of N-Ac-GIn-Asp-Trp-Ala-Ala-GIn-Glu-Pro-His-Arg-His- 35 Ser-Ile-Phe-Thr-Pro-Glu-Thr-Asn-Pro-Arg-Ala-Gly- Leu-Glu-Lys-Asn-Tyr-NH2-peptide The title compound was prepared according to the synthesis sequence described in Example 1, using Fmoc-Tyr ('Bu) as the first amino acid. The following amino acids were used, under the conditions already mentioned; Sequence number Amino acid 2. Fmoc-Asn (Trt) 3. Fmoc-Lys (Boc) 4. Fmoc-Glu (γ-O'Bu) 45 5. Fmoc-Leu 6. Fmoc-Gly 7. Fmoc-Ala 8. Fmoc-Arg (Pmc) 9. Fmoc-Pro 50 10. Fmoc-Asn (Trt) 11. Fmoc-Thr ('BU) 12. Fmoc-Glu (γ-0'Bu) 13. Fmoc-Pro 14. Fmoc-Thr ('BU) 55 15. Fmoc-Phe 16. Fmoc-lle 17. Fmoc-Ser ('BU) 18. Fmoc-His (Trt) 19. Fmoc-Arg (Pmc) 60 20. Fmoc-His (Trt) HU 224 827 B1 Serial number Amino acid using Fmoc-Tyr ('Bu) group. The following amino acids were used, under the conditions already mentioned: 21. Fmoc-Pro 22. Fmoc-Glu (yO'Bu) 23. Fmoc-GIn (Trt) 2. Fmoc-Asp (β-0'Bu) 24. Fmoc-Ala 5 3. Fmoc-Tyr ('BU) 25. Fmoc-Ala 4. Fmoc-Leu 26. Fmoc-Trp 5. Fmoc-Lys (Boc) 27. Fmoc-Asp (8-O*Bu) 6. Fmoc-Arg (Pmc) 28. Fmoc-GIn (Trt), 7. Fmoc-Pro, to 40 mg N-Ac-GIn-Asp-Trp-Ala-Ala-GIn-Glu-Pro- 10 to 4 mg N-Ac-Pro-Arg-Lys-Leu-Tyr-Asp- Peptide His-Arg-His-Ser-lle-Phe-Thr-Pro-Glu-Thr-Asn-Pro-ArgAla-Gly-Leu-Glu-Lys-Asn-Tyr-NH2 is obtained. Tyr-NH2-peptide is obtained. MS (FAB) m / z 995 (M+H) + . Example 7 Example 4 Preparation of N-Ac-Pro-Arg-Lys-Leu-Tyr-Asp-NH2-peptide Preparation of N-Ac-Arg-Asn-Pro-Asp-Gly-Asp-Val-Gly-Gly-Pro- Trp-NH2-peptide The title compound was prepared according to the synthesis sequence described in Example 1. The title compound was prepared according to the synthesis sequence described in Example 1. The following amino acid sequence was used as the first amino acid, under the conditions already mentioned: using an Fmoc-Trp group. The following amino acids were used under the conditions mentioned above: 20 2. Fmoc-Tyr ('Bu) 3. Fmoc-Leu 2. Fmoc-Pro 4. Fmoc-Lys (Boc) 3. Fmoc-Gly 5. Fmoc-Arg (Pmc) 4. Fmoc-Gly 6. Fmoc-Leu, 5. Fmoc-Val 25 to obtain 6 mg of the peptide N-Ac-Pro-Arg-Lys-Leu-Tyr-Asp-NH2- 6. Fmoc-Asp (p-OlBu). MS (ESI) m / z 832 (M+H)+. 7. Fmoc-Gly 8. Fmoc-Asp (p-OlBu) Example 8 9. Preparation of Fmoc-Pro N-Ac-Pro-Glu-Lys-Arg- Tyr-Asp- Tyr-NH2 10. Fmoc-Asn (Trt) 30 The title compound was synthesized as described in Example 1. 11.Fmoc-Arg (Pmt); was prepared in the order of 20 mg of N-Ac-Arg-Asn-Pro-Asp-Fmoc-Tyr ('Bu)-group as the first amino acid according to the above procedure. The following ami- Gly-Asp-Val-Gly-Gly-Pro-T rp-N H2-peptide was obtained. The following amino acids were used, under the conditions already mentioned: Example 5 35 Amino acid N-Ac-Tyr-Thr-Thr-Asn-Pro-Arg-Lys-Leu-Tyr-Asp- 2. Preparation of Fmoc-Asp (β-0'Bu) Tyr-NH2-peptide 3. Fmoc-Tyr ('Bu) The title compound was prepared according to the synthesis sequence described in Example 1, using the Fmoc-Lys (Boc) Fmoc-Tyr ('Bu)-group as the first amino acid. The following amino acids were used, under the conditions already mentioned: 7. Fmoc-Pro, Amino acid 40 6. Fmoc-Glu to obtain 6 mg of N-Ac-Pro-Glu-Lys-Arg-Tyr-Asp- 2. Fmoc-Asp (β-Ο*Βυ) Tyr-NH2-peptide. MS (FAB) m / z (1101) 3. Fmoc-Tyr ('BU) (M+H) + . 4. Fmoc-Leu 45 5. Fmoc-Lys (Boc) Example 9 6. Preparation of Fmoc-Arg (Pmc) N-Ac-Arg-Lys-Leu-Tyr-Asp-Tyr-NH2-peptide 7. Fmoc-Pro 8.Fmoc-Asn (Trt) The title compound was prepared according to the synthesis sequence described in Example 1, using the Fmoc-Thr ('BU) 50 group as the first amino acid. The following amino acids were used, under the conditions mentioned above: 10. Fmoc-Thr ('BU) 50 acids, to obtain 10 mg of N-Ac-Tyr-Thr-Thr-Asn-Pro-Arg- Amino acid Lys-Leu-Tyr-Asp-Tyr-NH2-peptide. 2. Fmoc-Asp (8-O'Bu) 55 3. Fmoc-Tyr ('Bu) Example 6 4. Fmoc-Leu N-Ac-Pro-Arg-Lys-Leu-Tyr-Asp-Tyr-NH2-peptide preparation 5. Fmoc-Lys (Boc) preparation 6. Fmoc-Arg (Pmc),. The title compound was prepared according to the synthesis sequence described in Example 1, starting with 60 as the first amino acid to give 8 mg of N-Ac-Arg-Lys-Leu-Tyr-Asp-Tyr-NH2 peptide. MS (ESI) m / z 898 (M+H)+. HU 224 827 B1 Example 10 Preparation of the peptide N-Ac-Pro-Arg-Lys-Leu-3-Ι-Tyr-Asp-Tyr-NH2- (SEQ ID NO: 13) The title compound was prepared according to the synthesis sequence described in Example 1, using Fmoc-Tyr (lBu) as the first amino acid. The following amino acids were used, under the aforementioned conditions: Number Amino acid 2. Fmoc-Asp (β-O'Bu) 3. Fmoc-3-l-Tyr (*Bu) 4. Fmoc-Leu 5. Fmoc-Lys (Boc) 6. Fmoc-Arg (Pmc) 7. Fmoc-Pro to give 2 mg N-Ac-Pro-Arg-Lys-Leu-3-l-TyrAsp-Tyr-NH2 peptide. MS (ESI) m / z (1121) (M+H) + . Example 11 Preparation of N-Ac-Pro-Arg-Lys-Leu-Tyr-Asp-3-l-Tyr-NH2- (SEQ ID NO: 14) peptide The title compound was prepared according to the synthesis sequence described in Example 1, using Fmoc-3-l-Tyr ('Buj group) as the first amino acid. The following amino acids were used, under the aforementioned conditions: Number Amino acid 2. Fmoc-Asp (β-ΟιΒυ) 3. Fmoc-Tyr (*Bu) 4. Fmoc-Leu 5. Fmoc-Lys (Boc) 6. Fmoc-Arg (Pmc) 7. Fmoc-Pro to give 2.5 mg N-Ac-Pro-Arg-Lys-Leu-Tyr-Asp-3l-Tyr-NH2 peptide. MS (ESI) m / z 1121 (M+H) + . Example 12 Preparation of N-Ac-Lys-Leu-Tyr-Asp-NH2-peptide The title compound was prepared according to the synthesis sequence described in Example 1, using Fmoc-Asp ^-CXBuX as the first amino acid. The following amino acids were used, under the conditions already mentioned: Number Amino acid 2. Fmoc-Tyr ('Bu) 3. Fmoc-Leu 4. Fmoc-Lys to obtain 2 mg N-Ac-Lys-Leu-Tyr-Asp-NH2 peptide. Example 13 N-Ac-Pro-Arg-Lys-Leu-Tyr-Asp-3-l125-Tyr535-NH2 (SEQ ID NO: 13) and Preparation and separation of a mixture of N-Ac-Pro-Arg-Lys-Leu-3-l125-Tyr633-Asp-Tyr-NH2 (SEQ ID NO: 14) To a solution of 30 pg of N-acetyl-prolyl-arginyl-lysyleucyl-tyrosyl-aspartyl-tyrosylamide peptide dissolved in 80 μΙ of phosphate-buffered saline (PBS), a lodobead (Pierce, Rockford, IL, USA) and 100 pCi of Nal125 was added. After 10 minutes, excess Nal125 was removed by applying the reaction mixture to a Waters C18-Light SepPack column, eluting with water followed by 0.1% TFA in 1:1 CH3CN / water, and collecting 3x200 μΙ fractions to obtain a mixture of peptides labeled at Tyr533 and Tyr535. The warm (labeled) peptide mixture was injected onto a C18 HPLC column together with equimolar amounts of the cold (non-labeled) peptides N-AcPro-Arg-Lys-Leu-Tyr-Asp-3-l-Tyr-NH2 and N-Ac-ProArg-Lys-Leu-3-l-Tyr-Asp-Tyr-NH2; the elution times of the cold peptides were determined to be 36 and 38 minutes, respectively. After repeated elution with the solvents described in Example 1 and subsequent lyophilization of the combined appropriate fractions, the desired N-Ac-Pro-Arg-Lys-Leu-Tyr-Asp-3-1125-Tyr535-NH2 peptide was obtained with minimal N-Ac-Pro-Arg-Lys-Leu-3-l125-Tyr533-Asp-Tyr-NH2 contamination. Example 14 Isolation and purification of kringle-5 peptide fragments Kringle-5 peptide fragments were prepared by digestion of Lys-plasminogen (Lys-HPg, Abbott Laboratories, Abbott Park, IL, USA) with porcine elastase (SIGMA, St. Louis, MO, USA) using a modification of the procedure described by Powell et al. [Arch. Biochem. Biophys. 248, 390-400 (1986)], which is incorporated herein by reference in its entirety. Porcine elastase (1.5 mg) was incubated with 200 mg of Lys-HPg protein in 50 mM Tris-HCl (pH 8.0) buffer overnight at room temperature with shaking. The reaction was stopped by the addition of DPF (diisopropylfluorophosphate, SIGMA) to a final concentration of 1 mM. The mixture was shaken for an additional 30 minutes, dialyzed against 50 mmol / L Tris buffer (pH 8.0) overnight, and concentrated. The cleaved plasminogen was applied to a 2.5 x 15 cm lysine-Sepharose 4B column [Brockway, WJ and Castellino, FJ: Arch. Biochem. Biophys.151, 194-199 (1972), which is incorporated herein by reference in its entirety] and equilibrated with 50 mmol / l Tris buffer (pH 8.0) until an absorbance (OD) of 0.05 at 280 nm was reached. This was done to remove fragments containing kringle-1 and / or kringle-4 regions (both types of fragments bind to lysine). Unbound kringle-5 peptide fragments were dialyzed against 50 mmol / l Na2PO4 buffer (pH=5) and then applied to a BioRad Mono-S column equilibrated with the same buffer. The cleaved kringle-5 fragment, the uncleaved mini-HPg and the remaining protease domain fraction were eluted with a step gradient of 0-20%, 20-50% and 50-70% of 20 mmol / L phosphate / 1 mol / L KCl (pH=5). Gel electrophoresis showed that the kringle-5 peptide fragments eluted at the 50% elution step. The peptides belonging to the elution peak were collected and dialyzed against 20 mmol / L Tris buffer (pH=8.0) overnight. According to FPLC chromatography analysis and SDS-PAGE analysis followed by silver staining (Coomassie Blue), the HU 224 827 B1 purified kringle-5 peptide fragments showed a degree of purity of at least 95%. Sequence analysis of the amino-terminal part of the purified fragments revealed the presence of three polypeptides with the N-terminal sequences VLLPDVETPS, VAPPPWLL and VETPSEED, which correspond to amino acid positions Val^-Ser458, Val^-Leu450 and Val454-Asp461 of SEQ ID NO: 1. Example 15 Endothelial cell proliferation assays In vitro proliferation of endothelial cells was performed according to the procedure described by Lingen et al. [Laboratory Investigation 74, 476-483 (1996), which is incorporated herein by reference in its entirety] using the Cell. Titer 96 Aqueous Non Radioactive Cell. Proliferation Assay kit (Promega Corp. Madison, WI, USA). Capillary endothelial cells from bovine adrenal glands were plated at a density of 1000 cells / well in 96-well plates in Dulbecco's Modified Eagle Medium (DMEM) containing 10% donor calf serum and 1% BSA (bovine serum albumin, GIBCO BRL, Gaithersburg, MD, USA). Cells were incubated for 8 hours and then starved overnight in DMEM medium containing 0.1% BSA. The next day, the medium was replaced with medium containing the given concentration of inhibitor and 5 ng / ml bFGF (basic fibroblast growth factor).The results of the assay were corrected for the proliferation value of unstimulated (i.e. bFGF-free) cells as the lower value and for the proliferation value of cells stimulated with bFGF alone (i.e. inhibitor-free) as the maximum proliferation value. When comparing the results of multiple assays, the results were expressed as a percentage change in cell number relative to cultures stimulated with bFGF alone. Example 16 In vitro endothelial cell migration assay Endothelial cell migration assays are essentially [Methods Enzymol. 198, 440-450 (1991), which is incorporated herein by reference in its entirety]. Briefly, bovine adrenal capillary endothelial cells (BCE, Judah Folkman, Harvard University Medical School) were starved overnight in DMEM containing 1% BSA. The cells were harvested after trypsinization and resuspended in DMEM containing 0.1% BSA at a density of 1.5*106 cells / ml. The cells were plated in 48-well modified Boyden chambers (Nukleopore Corp., Cabin John, MD, USA). The chamber was assembled, inverted, and cells were allowed to adhere to 5 μm pore polycarbonate chemotaxis membranes that had been soaked in gelatin overnight and dried for 2 hours at 37°C. The chamber was then inverted and test substances were added to the wells of the upper chamber (50 μl final volume). The device was then incubated for 4 hours at 37°C.The membranes were removed, fixed and stained (DiffQuick, Fisher Scientific, Pittsburgh, PA, USA), and the number of cells that migrated into the upper chamber per 10 fields of view examined at high magnification (400*) was counted. The background migration value for DMEM+0.1% BSA medium was subtracted, and the measurement result was the number of cells that migrated per 10 fields of view examined at high magnification (400*), or, if the results of several tests were compared, the percentage of migration inhibition compared to the positive control. Example 17 Effect of Kringle-5 peptide fragments on endothelial cell proliferation in vitro The effect of kringle-5 peptide fragments on endothelial cell proliferation was determined in vitro using the endothelial cell proliferation assay described above. For these assays, kringle-5 peptide fragments were prepared as illustrated in Examples 1-14 and tested at concentrations ranging from about 100 to 1000 pmol / l, using bFGF as the maximum proliferation control. The kringle-5 peptide fragment of SEQ ID NO:3 effectively inhibited BCE cell proliferation in a dose-dependent manner. The concentration of kringle-5 peptide fragment of SEQ ID NO:3 required to achieve 50% inhibition (ED50) was determined to be about 300 pmol / l. In contrast, the ED50 of kringle-1-4 peptides was 135 nmol / l. Table 1 summarizes the antiproliferative effects of other kringle peptide fragments on BCE cells. Kringle-3 peptide fragment had the least inhibitory effect on BCE cell proliferation (ED50=460 nmol / l), followed by kringle-1 peptide fragment (ED50=320 nmol / l), kringle-1-kringle-4 peptide fragment (ED50=135 nmol / l) and kringle-1-kringle-3 peptide fragment (ED50=75 nmol / l). Kringle-5 peptide fragment was the most effective in inhibiting BCE cell proliferation with an ED50 of 0.3 nmol / l. Example 18 Effect of Kringle-5 peptide fragments on endothelial cell migration in vitro The effect of kringle-5 peptide fragments on endothelial cell migration in vitro was also determined in the endothelial cell migration assay described above. Kringle-5 peptide fragments inhibited BCE cell migration in a dose-dependent manner with an ED50 of approximately 300 pmol / l. At the concentration at which kringle-5 peptide fragments maximally inhibited BCE cell migration, they also inhibited PC-3 cells and MDA 486 cells. This result, when compared with the results of Example 2, shows that the inhibition of stimulated BCE cell proliferation and migration by kringle-5 peptide fragments is potent and specific for endothelial cells and does not extend to normal or tumor cells. The above description merely illustrates the inventive concept and does not limit the scope of the invention to the compounds of the invention. The skilled person will be aware of the following: HU 224 827 B1 Now obvious variations and modifications are included within the scope of the invention, which are defined by the claims. Table 1 shows the ED50 values of various kringle peptide fragments for in vitro inhibition of BCE cell proliferation and migration. In the table, kringle peptide fragments are designated based on sequence homology to SEQ ID NO: 1. The designation indicates data from Marti et al. [Eur. J. Biochem., 219, 455-462 (1994), which is incorporated by reference in its entirety], the designation indicates the absence of data. Table 1 Antiproliferative activity (ED50) of the protein fragment from SEQ ID NO: 1 on BCE cells Inhibition of migration (ED50) on HMVEC cells Kringle-1-kringle-4 (angiostatin)* 135 nM 160 nM Kringle-1 (Tyr80-Glu163)* 320 nM - Kringle-2 (Glu161-Thr243)* no activity - Kringle-3 (Thr253-Ser335)* 460 nM - Kringle-4 (Val354-Val443)* no activity - Kringle-1 -kringle-3 (Tyr80-Pro353)* 75 nM 60 nM Kringle-2-kringle-3 (Glu161-Ser335)* - - Kringle-5 (Val443-Ala543) 250 pM 200 pM Kringle-5 (Val449-Ala543) - 240 pM Kringle-5 (Val434-Ala543) - 220 pM Kringle-5 (Val443-Phe546) 60 nM 55 pM Kringle-5 (Val449-Phe546) - - Kringle-5 (Val454-Phe546) - - Kringle-4-kringle-5 (VaPSS-Ala543) - 280 pM Kringle-4-kringle-5 (Val355-Phe546) - - N-Ac-Val449-Asp461-NH2 - >1 mM N-Ac-Met463-Pro482-NH2 - >1 mM N-Ac-Gln484-Tyr511-NH2 - >100 μΜ N-Ac-Arg513-Trp523-NH2 - 500 pM N-Ac-Tyr525-Tyr535-NH2 - 200 pM N-Ac-Pro529-Ty r535-N H2 - 120 pM N-Ac-Arg529-Asp534-NH2 - 123 pMN-Ac-Pro150-Tyr156-NH2 - 160 pM N-Ac-Arg530-Tyr535-NH2 - 80 pM N-Ac-Pro-Arg-Lys-Leu-Tyr-Asp-3-l-Tyr-NH2 - >100 nM N-Ac-Pro-Arg-Lys-Leu-Tyr-Asp-3-l-Tyr-NH2 - 400 pM N-Ac-Lys531-Tyr534-NH2 - - Example 19 50 Recombinant expression of Kringle-5 fragments Pichia pastoris in the organism A) Production of cDNA molecules encoding Kringle-5 fragments by PCR PCR was used to generate cDNA fragments encoding kringle-5 peptide fragments with (1) amino acid sequence 450-543 of SEQ ID NO: 1 (hereinafter: K5A), (2) amino acid sequence 450-546 of SEQ ID NO: 1 (hereinafter: K5F), (3) amino acid sequence 355-543 of SEQ ID NO: 1 (hereinafter: K4-5A), and amino acid sequence 355-546 of SEQ ID NO: 1 (hereinafter: K4-5F), for cloning and expression in eukaryotic and prokaryotic cells. The DNA fragments were prepared using cDNA encoding human plasminogen (Dr. E. Reich, State University of New York, Stony Brook, NY, USA) as a template and the following forward and reverse primer oligonucleotides (Operon Technologies Inc., Alameda, CA, USA): HU 224 827 B1 5'-ATTAATGGATCCTTGGACAAGAGGCTGCTTCCAGATGTAGAGACT-3' SEQ ID NO: 2 5'-ATTAATGGATCCTTGGACAAGAGGGTCCAGGACTGCTACCATGGT-3' SEQ ID NO: 3 5'-ATTAATCTCGAGGCATGCTTAGGCCGCACACTGATGGACA-3' SEQ ID NO: 4 5'-ATTAATCTCGAGGCATGCTTAAAATGAAGGGGCCCGCACACT-3' SEQ ID NO: 5 PCR amplification was performed using primers SEQ ID NO:2 and SEQ ID NO:4 (K5A), primers SEQ ID NO:2 and SEQ ID NO:5 (K5F), primers SEQ ID NO:3 and SEQ ID NO:8 (K4-5A), and primers SEQ ID NO:3 and SEQ ID NO:5 (K45A), under standard PCR conditions, i.e. in a total reaction volume of 100 µl, containing each dNTP - where N is A, T, G and C - at a final concentration of 200 pmol / l; It contained each primer oligonucleotide at a final concentration of 0.2 pmol / L, and also contained approximately 10 ng of template DNA and 1 unit of Vént® DNA polymerase (New England Biolabs). Amplification was performed for a total of 25 cycles (1 cycle with the following parameters: 94 °C for 1 min; 48 °C for 2 min; 72 °C for 1 min), and amplification was performed in a “Thermal Cycler 480” automated heating block (Perkin-Elmer, Foster City, CA, USA). Following amplification, the PCR products were gel purified, digested with BamHI and XhoI enzymes (New England Biolabs), ligated into a modified Pichia expression vector cleaved with the aforementioned enzymes (pHil-D8, see below), and then transformed into HB101 cells (Bio Rád) by electroporation. DNA was isolated from individual clones, digested with restriction enzymes, and analyzed by sequencing to identify clones containing the correct sequence in the correct orientation. Plasmid DNA from positively identified clones was then transformed into Pichia pastoris strain GS115 (Invitrogen, Carlsbad, CA, USA), according to the manufacturer's instructions. Positive Pichia clones were identified by growing cells overnight at 29 °C in 5 ml of BMGY medium (Invitrogen), then collecting them by centrifugation and suspending them in 0.5 ml of BMMY medium (Invitrogen) for expression. After incubation for two days at 29 °C, the culture supernatants were collected and samples were subjected to SDS-PAGE and Western blot analysis according to known methods. A typical SDS-PAGE gel is shown in Figure 6. B) Production of the pHil-D8 expression vector The expression vector pHil-D8 was obtained by modifying the pHil-D2 vector (Invitrogen) by incorporating a synthetic leader sequence controlling the secretion of recombinant proteins into the latter (see Figure 5). The leader sequence [5'-ATGTTCTCTCCAATTTTGTCCTTG-GAAATTATTTTAGCTTT-GGCTACTTTGCAATCTGTCTTCGCTCAGCCAGTTATCTGCACTACCGTTGGTTCCGCTGCCGAGGGATCC-3' (SEQ ID NO: 9)] encodes a PHO1 secretion signal (underlined in the sequence) operably linked to a propeptide sequence accessible for KEX2 cleavage (highlighted in the sequence in bold). The pHil-D8 vector was constructed using: the pHil-S1 vector (Invitrogen) as a template, as this vector contains the coding sequence for the PHO signal; a forward primer corresponding to nucleotides 509-530 of the pHII-S1 vector (see SEQ ID NO: 7); and a reverse primer oligonucleotide (see SEQ ID NO: 8) with a nucleotide sequence encoding the later part of the PHO1 secretion signal (nucleotides 45-66 of SEQ ID NO: 9) and the propeptide sequence (nucleotides 67-108 of SEQ ID NO: 9). The following primer oligonucleotide sequences [from Operon Technologies, Inc. (Alameda, CA)] were used: 5'-GAAACTTCCAAAAGTCGCCATA-3' SEQ ID NO: 7 5'-ATTAATGAATTCCTCGAGCGGTCCGGGATCCCTCGGCAGCGGAACCAACGG -TAGTGCAGATAACTGGCTGAGCGAAGACAGATTGCAAAGTA-3' SEQ ID NO: 8 Amplification was performed for 25 cycles as described in Example 19. The PCR product (consisting of approximately 500 base pairs) was gel purified, digested with BlpI and EcoRI, and ligated into the pHil-D2 vector digested with the same enzymes. The DNA was transformed into E. coli HB101 cells, and positive clones were identified by restriction enzyme digestion and sequence analysis. A clone containing the correct sequence was designated pHil-D8 clone. 60 Example 20 Recombinant Expression of Kringle-5 Peptide Fragments in Bacteria All restriction enzymes, other modifying enzymes and other reagents used were obtained from commercially available sources. The primers were synthesized for us by Abbott Laboratories on an automatic synthesizer according to methods known in the art. HU 224 827 B1 DNAs encoding kringle-5 peptide fragments for cloning and expression in bacterial host cells (E. coli cells) were also prepared by PCR amplification. The general approach was to generate PCR fragments corresponding to the desired coding regions, with or without a termination codon, treat the ends of the fragments with kinase, and clone the fragments directly into the selected vector. The vector constructs were then transformed into appropriate host cells, and colonies were screened by PCR using vector-specific primers to confirm the presence of the insert. The orientation of the insert was determined by subjecting clones containing the insert in the PCR reaction to directional PCR using a vector-specific primer and an insert-specific primer. A) Production of blunt-ended, phosphatase-treated vectors Expression vectors suitable for bacterial production of kringle-5 peptide fragments are described in Table 2. Table 2 Vector Source Restriction enzyme Fusion EpET Abbott-modified pET21d Sápi None EpET-HTh Abbott-modified pET21d Sápi N-terminal His6-thrombin recognition site EpET-Ubi Abbott-modified pET21d Sápi N-terminal His6-ubiquitin recognition site pET32a Novagen Ncol+Xhol Thioredoxin, enterokinase recognition site PGEX-4T-2 Pharmacia® EcoRI+Wofl GST pCYB3 New England Biolabs Ncol+Sapl C-terminal intein All vectors were first purified using Qiagen columns according to the manufacturer's instructions (QIAGEN, Inc. Santa Clarita, CA, USA). Vector DNA (1 pg) was digested with appropriate restriction enzymes (see Table 2) in 20 µl of NEB4-35 buffer (New England Biolabs) containing 100 µg / ml bovine serum albumin (BSA). The reaction was centrifuged briefly, 20 µl of distilled water, 0.4 µl of dNTP mix (Pharmacia®; containing 20 mmol / l of each dNTP); and 0.25 µl of cloned pfu DNA polymerase (Stratagene®; 2.5 units / µl) were added, and the reaction mixture was incubated for 20 min at 65°C to fill in the ends of the vector. The reaction mixture was then centrifuged briefly again and 4 µl of diluted calf intestinal phosphatase (GIBCO BRL, Gaithersburg, MD; 5 units of enzyme in total) was added. The mixture was then incubated for one hour at 50°C.Then, 5 μl of 10% SDS, 2 μl of 5 mol / l NaCl, 2 μl of 0.5 mol / l EDTA and 45 μl of H2O were added to this mixture; the reaction mixture was centrifuged briefly and then incubated for 20 minutes at 65 °C. The reaction mixture was extracted three times with buffer-saturated phenol-chloroform (GIBCO BRL) and once with chloroform. The aqueous phase was purified on a “CHROMA SPIN™1000TE” column (Clontech, Palo Alto, CA USA). B) Preparation of DNA fragments by PCR PCR primer oligonucleotides were designed and ordered based on the sequence of human plasminogen published in the literature (see SEQ ID NO: 12); their sequences are described below: 5'-GTCCAGGACTGCTACCAT-3' SEQ ID NO: 10 5'-CTGCTTTCCAGATGTAGAGA-3' SEQ ID NO: 11 5'-TTATTAGGCCGCACACTGAGGGA-3' SEQ ID NO: 13 Unless otherwise stated, all PCR reactions were performed using pfu DNA polymerase and the corresponding buffer (Stratagene®), using 200 pmol of each dNTP and 1 pmol / l of each primer. The following primer combinations were used: primers according to SEQ ID NO: 11 and 13 (for the production of the K5A fragment); primers according to SEQ ID NO: 10 and 13 (for the production of the K4-5A fragment). The pHil-D8 vector containing the K4-K5A fragment was used as a template (see Example 19 for a description). This DNA was digested with Dral enzyme (which results in multiple cleavages in sequences outside the kringle regions) prior to use as a template to eliminate background resulting from the use of the pHil-D8 vector during subsequent transformations. HU 224 827 B1 Approximately 10 ng of template was used in PCR reactions with a total volume of 50 μΙ. The PCR reactions were performed according to the following parameters: 94 °C for 2 min; then 15 cycles of 94 °C for 30 s; 49 °C for 1 min; °C for 4 min; finally 72 °C for 7 min. After the PCR reaction, 0.5 μl of 1100 mmol / l ATP and 5 units of T4 kinase were added to the reaction mixtures and incubated for 20 min at °C for kinase treatment of the ends. The reactions were then heated at 68 °C for 15 min, purified on an S400-HR spin column (Pharmacia®), and then used for ligation. C) Ligation of PCR fragments into expression vectors Six recombinant constructs [in detail, (i) a construct containing the K5A fragment cloned into the UpET-PS3 vector; (ii) a construct containing the K5A fragment cloned into the pET32a vector; (iii) a construct containing the K4-5A fragment cloned into the UpET-PS3 vector; (iv) a construct containing the K4-5A fragment cloned into the UpET-Ubi vector; (v) the construct containing the K4-5A fragment cloned into the pET3-20 2a vector, and (vi) the construct containing the K4-5A fragment cloned into the pGEX-4T-2 vector] were prepared as follows: blunt-ended, phosphatase-treated vector [1 μΙ from step A) above] and PCR fragment [1 μΙ from step B) above] were ligated in a total reaction volume of 5.5 μΙ using the “Rapid Ligation Kit” according to the manufacturer’s (Boehringer Mannheim Corp., Indianapolis, IN, USA) instructions.The ligation mixture ('μΙ) was used to transform 20 μΙ of competent cells [“XL1-Blue Supercompetent” cells or “XL2-Blue Ultracompetent” cells; Stratagene®] according to the manufacturer’s instructions. Recombinant cells were selected on LB-Amp agar plates (MicroDiagnostics, Lombard, IL). 35. D) Expression assays pGEX vectors were expressed in E. coli “XL1-Blue” or “XL2-Blue” cells. All other vectors were isolated and transformed into E. coli BL21(DE3)-(Novagen) cells according to the manufacturer’s instructions. Individual colonies were inoculated into 2.5 ml of LB / Amp medium and the cultures were shaken at 225 rpm at 37 °C overnight. The overnight cultures (0.5 ml) were inoculated into 50 ml of LB / Amp medium in 250 ml culture flasks and shaken at 225 rpm at 37 °C until an OD of 0.5-0.6 was obtained at 600 nm. Isopropyl-1-thio-3-D-galactopyranoside (IPTG, 100 mmol / l) was added to the cultures to a final concentration of 1 mmol / l. The culture was shaken at 225 rpm for 3 h at 30 °C and then centrifuged. Samples were prepared for SDS-PAGE analysis according to known methods.Preliminary experiments showed that cells containing the K5A / pET32a, K4-5A / pET32a and K4-5A / pGEX constructs produced the most recombinant protein. Cultures of these clones were analyzed on SDS-PAGE gels to determine whether they expressed soluble or insoluble product. As can be seen in Figure 7, the clone containing the K5A / pET32a construct produced almost entirely soluble recombinant protein (see lanes marked S and P corresponding to Trx-K5A), while cells containing the K4-5A / pET32a and K4-5A / pGEX constructs produced approximately 75% soluble protein. E) Production of Abbott-modified vectors i) Production of VB1, VB2, VB3 and VB4 cassettes VB1, VB2, VB3 and VB4 cassettes are produced synthetically They were prepared as DNAs, according to methods well known to those skilled in the art. The sequences of synVB1, synVB2, synVB3 and synVB4 are described below: synVBI 5'-AGCGTCTCATGAAGAGCTGGCTCACCTTCGGGTGGGCCTTTCTGGC GCCTTGGCGCCAACCTTAACCGGGAGCCCCGCCTAATGAGCGG GCTTTTTTTGCTCTTCATAGTGACTGAGACGTCG-3' SEQ ID NO: 14 synVB2 5'-AGCGTCTCAGGTGGTGGTCATCACCATCACCATCACGGTGGTGGT CTGGTGCCGCGCGGCAGCTGAAAGAGCTGGCTCACCTTTCGGGTGGCCCT TTCTGCGCCTTGGCGCGCCAACCTTAACCGGGAGCCCCGCCTAAT GAGCGGGCTTTTTGCTCTTACGAGAGGTCG-3' SEQ ID NO: 15 synVB3 5'-AGCGTCTCAGGTGGTGGTCATCACCATCACCATCACGGTGGT TGAAGAGCTGGCTCACCTTTCGGTGGGCTTTTCTGCGCCTTGGCGCGCGC CAACCTTAATTAACCGGGAGCCCCGCCTAATGAGCGGGCTTTTTTTTGC TCTTCACGAGACGTC-3' SEQ ID NO: 16 synVB4 5'-AGCGTCTCAGGTGGTGGTCATCACCATCACCATCACGGTGGTGGT GATGACGATGACAAGTGAAGAGCTGGCTCACCTTCGGGTGGGCCTTTC TGCGCCTTGGCGCGCCAACCTTAACCGGGAGCCCCGCCTAATGAG CGGGCTTTTTTGCTCTTCACGAGACGTCG-3' SEQ ID NO: 17 Each synthetic sequence was made double-stranded and cloned into the pCR-SriptCam™ vector (Stratagene) according to the manufacturer's instructions; clones containing the correct sequence were isolated using standard methods, and five (5) pg of purified DNA was digested with 8 units of BsmBI enzyme at 55°C in 20 μΙ of reaction mixture in 1xNEB4 buffer containing 100 pg / ml BSA. The reactions were centrifuged briefly, 20 µl of distilled H2O, 0.4 µl of dNTP mix (Pharmacia®; containing 20 mmol / l of each dNTP), and 0.25 µl of cloned pfu DNA polymerase (Stratagene®; 2.5 units / μΙ) were added, and the reaction was incubated for 20 min at 65 °C to fill in the ends. The DNA was then run on 3% “MetaPhor”™ agarose gels (FMC, Rockland, Maine) in 0.5x Tris-acetate-EDTA (TAE) buffer. HU 224 827 B1 The bands corresponding to the cassette were excised and the DNA was eluted by freezing the gel and removing the buffer by centrifugation through an “Ultrafree™Probind” (Millipore Corp., Bedford, MA, USA) exchangeable cartridge, followed by isopropanol precipitation using “Pellet Paint”™ (Novagen) as a carrier. The DNA (cfVB1, cfVB2, cfVB3 and cfVB4) was washed with 70% ethanol, briefly dried and suspended in 25 μΙ Tris-EDTA (TE) buffer. ii) Production of the UpET vector The pET21d vector (Novagen) was digested with Spal, treated with T4 DNA polymerase in the presence of dGTP, treated with soybean nuclease, DNA polymerase I Klenow fragment, and religated. Individual colonies were screened for plasmids in which the original SapI site had been deleted. This DNA was then digested with NcoI and BamHI, and ligated with oligonucleotides 5'-CATGTGAAGAGC-3' (SEQ ID NO: 19) and 5'-GATCGCTCTTCA-3' (SEQ ID NO: 20) to create a unique SapI site in the vector. Purified, confirmed correctly cloned DNA was digested with Sapi and HindIII enzymes, blunt-ended, and phosphatase-treated as described above, then ligated with the cfVB1 cassette, transformed into E. coli cells, and the cells were plated on LB-Amp plates.Colonies were picked from LB-Amp agar plates with a sterile pipette tip and transferred to “Coster Thermowell” plates, 20 μΙ of “AmpliTaq®PCR” mix (Perkin-Elmer) containing the following vector-specific primers at 1-1 pmol / l: 5'-AGATCTCGATCCCGCGAA-3' (forward primer; SEQ ID NO: 21) and 5'-ATCCGGATATAGTTCCTC-3' vector-specific primer (SEQ ID NO: 22). The reactions were heated at 94 °C for 5 min and then amplified in a “GeneAmp 9600” automated heating block for 30 cycles, according to the following parameters: 30 seconds at 94 °C; 1 minute at 40 °C; and 2 minutes at 72 °C. A sample volume of 10-10 μΙ of each reaction was run on an agarose gel.To determine the orientation of the cassette, a 0.25 μΙ sample containing the appropriate size PCR product was added to a fresh reaction mixture containing the vector-specific reverse primer and the cassette-specific primer with the following sequence: 5-CGGGCTTTTTTTTGCTCTTCA-3' (SEQ ID NO: 23). The reactions were amplified for an additional 10 cycles, proceeding as described above. The resulting vector was sequenced using known methods, and one of them was designated the UpET clone. iii) Production of UpET-HTh vector The UpET vector was digested with SapI, blunt-ended, and treated with phosphatase to facilitate cloning. It was ligated with the cfVB2 cassette, transformed into cells, the resulting colonies were screened, and the clones were sequenced as described previously for cfVB1 ligation. iv) Production of the UpET-H vector The UpET vector was digested with SapI, blunt-ended, and treated with phosphatase to facilitate cloning. It was ligated with the cfVB3 cassette, transformed into cells, the resulting colonies were screened, and the clones were sequenced as previously described for cfVB1 ligation. v) Production of the UpET-Ubi vector The DNA fragment encoding S. cerevisiae ubiquitin was prepared using “Ultma DNA polymerase” and appropriate buffer (Perkin-EImer), in a reaction mixture with the following composition: 40 pmol / l concentration of each dNTP; pmol / l concentration of each primer; [5'-CAGATTTTCGTCAAGACTT-3' (Ubi-5p; SEQ ID NO: 24) and 5'-ACCACCTCTTAGCCTTAG-3' (Ubi-3p; SEQ ID NO: 25)]; and 1.75 pg yeast DNA; the reaction was performed according to the following parameters: 2 min at 94 °C; then 25 cycles of 1 min at 94 °C; 1 min at 40 °C; and 2 min at 72 °C; finally 7 min at 72 °C. A PCR fragment was generated based on 20 ng of pET 15b vector (Novagen) using the following primers: 5'-CATGGTATATCTCCTTCTT-3' (pET3p-ATG; SEQ ID NO: 26) and 5'-TGAGCAATAACTAGCATAAC-3' (T7-RevTerm; SEQ ID NO: 27).(SEQ ID NO: 1); the reaction was carried out according to the following parameters: 2 min at 94 °C; then 10 cycles of 45 s at 94 °C; 1 min at 42 °C; and 15 min at 72 °C; finally 7 min at 72 °C. The ubiquitin and pET15b-derived PCR fragments were gel purified and ligated together using BRL T4 ligase and appropriate ligase buffer. Subsequently, a T7-promoter-ubiquitin (T7-ubiquitin) PCR fragment was prepared using the above ligation product as a primer, and using the enzyme “Ultma DNA polymerase” and the primers 5'-AGATCTCGATCCCGCGAA-3' (pET5p; SEQ ID NO: 28) and SEQ ID NO: 25, according to the following parameters: 2 min at 94 °C; then 25 cycles of 30 s at 94 °C; 1 min at 42 °C; and 3 min at 72 °C; finally 7 min at 72 °C. The T7-promoter-ubiquitin PCR fragment was gel purified. A PCR fragment encoding mature human stomelysin was generated using the enzyme “Ultma DNA polymerase” (see above), the 5'-TTAGGTCTCAGGGGAGT-3' primer (Stom-3p; SEQ ID NO: 29), the 5'-TTCAGAACCTTTCCTGGCA-3' kinased primer, and approximately 20 ng of template [i.e. stomelysin cloned into pET3b vector (Novagen)], according to the following parameters: min at 94 °C; then 15 cycles of 1 min at 94 °C; 1 min at 44 °C; and 2 min at 72 °C; finally 7 min at 72 °C. The stomelysin PCR reaction mixture (10 μΙ) was ligated with 100 pmol / l of the following hybridized oligonucleotides: 5'-AGCGGCGACGACGACAAG-3' (Ek-Cut-5p; SEQ ID NO: 31) and 5'-CTTGTCGTCGTCGTCGCCGCT-3' (Ek-Cut-3p, which encodes an enterokinase cleavage site; SEQ ID NO: 32), 40 μΙ, in buffer containing BRL ligase. Mature stomeli32 containing an enterokinase recognition site HU 224 827 A PCR fragment encoding Β1 zin (Ek-Stomelizin) was prepared using the above ligation mixture as a template, in the presence of the primer oligonucleotide according to SEQ ID NO: 29 and the kinased primer oligonucleotide according to SEQ ID NO: 31, using the enzyme “Ultma DNA polymerase” and appropriate buffer, according to the following parameters: 2 minutes at 94 °C; then 10 cycles of 1 minute at 94 °C; 1 minute at 44 °C; and 1 minute at 72 °C; finally 7 minutes at 72 °C. The Ek-Stomelizin PCR fragment was gel purified. The T7-ubiquitin and Ek-Stomelizin PCR fragments were ligated using BRL ligase and appropriate buffer. Subsequently, T7-ubiquitin-Ek-Stomelizin PCR fragments were prepared using the above ligation product as a template, adding the enzyme “Ultma DNA polymerase” and appropriate buffer, in the presence of primers according to SEQ ID NO: 28 and 29, according to the following parameters: 2 min at 94 °C; then 25 cycles of 30 sec at 94 °C; 1 min at 42 °C; 6 min at 72 °C; finally 7 min at 72 °C. PCR fragments were generated from the stomelysin pET3b plasmid template using primers SEQ ID NO: 26 and 30, using KlenTaq (AB Peptides, St Louis, MO, USA) and pfu DNA polymerases, according to the following parameters: 2 min at 94 °C; then 15 cycles of 30 s at 94 °C; 2 min at 42 °C; 20 min at 68 °C. This PCR fragment was mixed with T7-ubiquitin-Ek-Stomelizin PCR fragments and transformed into BRL-DH5a maximum efficiency competent cells. The corresponding clones were identified by isolating plasmid DNA and transforming them into BL21(DE3) cells, and expression was assayed as described above. Based on the T7-ubiquitin-Ek-Stomelizin expression plasmid containing the correct sequence, a PCR fragment encoding ubiquitin-Ek was generated, and the 24th and using primers according to SEQ ID NO: 32 and pfu-DNA polymerase, according to the following parameters: 2 min at 94 °C; then 20 cycles of 30 sec at 94 °C; 1 min at 40 °C; 3 min at 72 °C; finally 7 min at 72 °C. The fragments were purified on a “Pharmacia S-400-HR” spin column and then ligated with the VBC1 cassette using the “Rapid DNA Ligation” reagent kit. A PCR fragment was generated using the ligation product as a template, using the primer oligonucleotide of SEQ ID NO: 24 and the sequence 5'-TGAAGAGCAAAAAAAGCCCG-3' (SEQ ID NO: 33), using pfu-DNA polymerase enzyme, according to the following parameters: 2 min at 94 °C; then 20 cycles of 30 sec at 94 °C; 1 min at 40 °C; 2 min at 72 °C; finally 7 min at 72 °C.The PCR fragments were kinased and ligated with a blunt-ended Upet-H fragment treated with phosphatase to facilitate cloning. Competent cells were transformed with the ligation mixture, and colonies were formed as described above, We screened by PCR. Plasmid DNA was sequenced and correct UpET-Ubi clones were identified. Brief description of the sequences: SEQ ID NO: 1: amino acid sequence of human plasminogen, SEQ ID NO: 2: “for the production of cDNA molecules encoding a forward primer kringle-5 fragment, SEQ ID NO: 3: “forward” primer for the production of cDNA molecules encoding the kringle-5 fragment, SEQ ID NO: 4: reverse primer for the production of cDNA molecules encoding the kringle-5 fragment, SEQ ID NO: 5: reverse primer for the production of cDNA molecules encoding kringle-5 fragment, SEQ ID NO: 7: forward primer oligonucleotide corresponding to nucleotides 509-530 of pHil-S1 vector for the production of pHil-D8 vector, SEQ ID NO: 8: reverse primer oligonucleotide with nucleotide sequence encoding propeptide sequence (nucleotides 67-108 of SEQ ID NO: 9) for the production of pHil-D8 vector, SEQ ID NO: 9: synthetic leader sequence for the production of the expression vector designated pHil-D8 from the pHil-D2 vector (Invitrogen), SEQ ID NO: 10: forward primer oligonucleotide for the production of the K4-5A fragment, SEQ ID NO: 11: forward primer for the production of the K5A fragment, SEQ ID NO: 12: DNA sequence of human plasminogen, SEQ ID NO: 13: reverse primer for the production of the K4-5A fragment and the K5A fragment, Sequence ID No. 14: the sequence of synVBI, SEQ ID NO: 15: the sequence of synVB2, SEQ ID NO: 16: the sequence of synVB3, SEQ ID NO: 17: the sequence of synVB4, SEQ ID NO: 19: oligonucleotide for SapI site formation by ligation, SEQ ID NO: 20: oligonucleotide for creating a SapI site by ligation, SEQ ID NO: 21: vector-specific forward primer oligonucleotide for the production of UpET vector, SEQ ID NO: 22: vector-specific reverse primer oligonucleotide for the production of UpET vector, SEQ ID NO: 23: cassette-specific forward primer oligonucleotide for the production of the UpET vector, HU 224 827 B1 SEQ ID NO: 24: Ubi-5p primer oligonucleotide for the production of a DNA fragment encoding S. cerevisiae ubiquitin, SEQ ID NO: 25: Ubi-3p primer oligonucleotide for the production of a DNA fragment encoding S. cerevisiae ubiquitin, SEQ ID NO: 26: pET3p-ATG primer oligonucleotide for the production of a PCR fragment derived from pET15b vector (Novagen), SEQ ID NO: 27: T7-RevTerm primer oligonucleotide for the production of a PCR fragment derived from pET15b vector (Novagen), SEQ ID NO: 28: pET5p primer oligonucleotide for the production of T7 promoter-ubiquitin PCR fragment during the production of UpET-Ubi vector, SEQ ID NO: 29: Stom-3p oligonucleotide for the production of a PCR fragment encoding mature human stomelysin, starting from stomelysin cloned into the pET3b vector (Novagen), SEQ ID NO: 30: kinase-treated primer oligonucleotide for the production of a PCR fragment encoding mature human stomelysin, SEQ ID NO: 31: Ek-Cut-5p oligonucleotide for the production of Ek-Stomelizin PCR fragment by ligation, SEQ ID NO: 32: Ek-Cut-3p oligonucleotide encoding an enterokinase cleavage site, ligated to produce Ek-Stomelizin PCR fragment, SEQ ID NO: 33: primer for PCR fragment preparation using SEQ ID NO: 24, for ligation with Upet-H fragment to produce UpET-Ubi vector, SEQ ID NO: 34: amino acid sequence of human kringle-5 region, SEQ ID NO: 35: amino acid sequence of mouse kringle-5 region, SEQ ID NO: 36: amino acid sequence of the rhesus monkey kringle-5 region, SEQ ID NO: 37: amino acid sequence of bovine kringle-5 region, SEQ ID NO: 38: amino acid sequence of porcine kringle-5 region.
Claims
CLAIMS 1. A compound of formula (I) ABCXY (I) or a pharmaceutically acceptable salt or ester thereof, wherein in the formula: A is absent or represents a nitrogen protecting group; Y is optionally absent or represents a carboxylic acid protecting group; and BCX is any of the following sequences defined by the amino acids at the following positions in SEQ ID NO: 1: a sequence corresponding to (a) amino acids 355-543 of SEQ ID NO: 1; (b) amino acids 355-546 of SEQ ID NO: 1; (c) amino acids 443-543 of SEQ ID NO: 1; (d) amino acids 449-543 of SEQ ID NO: 1; (e) amino acids 454-543 of SEQ ID NO:
1. (f) a sequence corresponding to the sequence of amino acids 443-546; (g) a sequence corresponding to the sequence of amino acids 449-546; (h) a sequence corresponding to the sequence of amino acids 454-546; (i) a sequence corresponding to the sequence of amino acids 525-535.a sequence corresponding to the sequence of amino acids 529-535; (j) a sequence corresponding to the sequence of amino acids 529-535; (k) a sequence corresponding to the sequence of amino acids 530-535; (l) a sequence corresponding to the sequence of amino acids 529-534; (m) a sequence corresponding to the sequence of amino acids 530-534; or (n) a sequence corresponding to the sequence of amino acids 450-543.
2. A compound according to claim 1, wherein A is NAC and Y is -NH2.
3. The compound of claim 1, having an ED50 for inhibition of endothelial cell migration of between 100 and 500 pmol / l.
4. The compound of claim 1, having an ED50 for inhibition of endothelial cell proliferation of between 100 and 500 pmol / l.
5. Use of a compound according to claim 1 or 2 for the preparation of a medicament for treating a pathological condition in a patient in need of antiangiogenesis therapy.
6. Use according to claim 5, for the preparation of a medicament for the treatment of a pathological condition selected from cancer, arthritis, macular degeneration or diabetic retinopathy.
7. Use according to claim 6 for the preparation of a medicament for the treatment of cancer as a pathological condition.
8. The use according to claim 7, for the treatment of a primary or metastatic solid tumor, carcinoma, sarcoma, lymphoma, psoriasis or hemangioma as a cancerous condition.
9. A composition comprising a compound according to claim 1 and a pharmaceutically acceptable excipient.
10. A composition comprising an isolated single- or double-stranded polynucleotide sequence encoding a compound according to claim 1.
11. The composition of claim 10, wherein the nucleotide sequence is a DNA sequence.
12. The composition of claim 11, wherein the DNA sequence encodes any of the following amino acid sequences: (a) a sequence corresponding to amino acids 443-543 of SEQ ID NO: 1; (b) a sequence corresponding to amino acids 449-543 of SEQ ID NO: 1; (c) a sequence corresponding to amino acids 454-543 of SEQ ID NO: 1; (d) a sequence corresponding to amino acids 355-543 of SEQ ID NO:
1.
13. The composition of claim 10, comprising a polynucleotide sequence encoding the amino acid sequence of SEQ ID NO: 34, 35, 36 or 37.
14. A cell implantable into a human or non-human animal, comprising a vector comprising a DNA sequence encoding a compound according to claim 1.
15. A method for preparing a compound according to claim 1, comprising (a) contacting mammalian plasminogen with elastase to form a mixture of plasminogen and elastase in a ratio of about 1:100 to about 1:300; (b) incubating the mixture; and (c) isolating the compound from the mixture.
16. An isolated single- or double-stranded polynucleotide encoding a compound according to claim 1 for use as an angiogenesis inhibitor.
17. The polynucleotide of claim 16, which is a DNA molecule.
18. The polynucleotide of claim 16, which is an RNA molecule.
19. A vector comprising a polynucleotide encoding a compound according to claim 1 for use as an angiogenesis inhibitor.
20. The vector of claim 19, which is an expression vector.
21. The vector of claim 20, which is a pHil-D8 vector, a pET32a vector, a pGEX-4T-2 vector, a Up-ET vector or a pCYB3 vector.
22. A host cell transformed with the vector of claim 20.
23. The vector of claim 22, wherein a eukaryotic cell has been transformed with the vector.
24. The vector of claim 23, wherein a eukaryotic cell of the species Pichia pastoris has been transformed with the vector.
25. The vector of claim 22, wherein the vector has been transformed into an E. coli prokaryotic host cell.
26. A method for producing a soluble compound according to claim 1, comprising the steps of (a) isolating a polynucleotide encoding the compound, (b) cloning the polynucleotide into an expression vector, (c) transforming the vector into a suitable host cell, and (d) propagating the host cell to express the compound.
27. A compound having the formula: (a) A-Pro-Arg-Lys-Leu-Tyr-Asp-3-Ι-Τyr-Y; (b) A-Pro-Arg-Lys-Leu-3-l-Tyr-Asp-Tyr-Y; (c) A-Pro-Glu-Lys-Arg-Tyr-Asp-Tyr-Y; or (d) A-GIn-Asp-Trp-Ala-Ala-GIn-Glu-Pro-His-ArgHis-Ser-lle-Phe-Thr-Pro-Glu-Thr-Asn-Pro-ArgAla-Gly-Leu-Glu-Lys-Asn-Tyr-Y, wherein A is absent or represents a nitrogen protecting group, and Y is absent or represents a carboxylic acid protecting group.