PRIMARY GENERATION OF HUMAN THRESHER AND NK CELLS DEVELOPED USING CAS9 RIBONUCLEOPROTEIN

Abstract

Disclosed are compositions and methods for genetically engineering NK cells.

Description

Description PRIMARY GENERATION OF HUMAN THRESHER AND NK CELLS DEVELOPED USING CAS9 RIBONUCLEOPROTEIN Background of the Invention Cancer immunotherapy has evolved in recent years. Genetically modified chimeric antigen receptor (CAR) T cells are an excellent example of engineered immune cells successfully used in cancer immunotherapy. These cells were recently approved by the FDA for the treatment of CD19+ B cell malignancies, but success has so far been limited to diseases that carry few targetable antigens, and targeting such a limited antigenic repertoire is prone to immune escape. Furthermore, CAR T cells have focused on the use of autologous T cells due to the risk of graft-versus-host disease caused by allogeneic T cells. In contrast, NK cells are capable of killing tumor targets in an antigen-independent manner and do not cause GvHD, making them good candidates for cancer immunotherapy. CRISPR / Cas9 technology has been used recently to engineer immune cells, but genetically reprogramming NK cells with plasmids has remained challenging. This is due to the difficulty in delivering transgenes through DNA-dependent methods such as lentivirus and retrovirus transduction, which cause substantial NK cell apoptosis, and the limited production of genetically engineered NK cells. New methods for genetically engineering NK cells are needed. Brief Description of the Invention Disclosed are methods and compositions relating to genetically modified NK cells. In one aspect, disclosed herein are methods of genetically modifying an NK cell (such as, for example, a primary or developing NK cell) comprising producing a guide RNA (gRNA) specific for a target DNA sequence in the NK cell (such as, for example, transforming growth factor-β receptor 2 (TGFBR2) or hypoxanthine phosphoribosyltransferase 1 (HPRT1); and b) introducing via electroporation into a target NK cell a ribonucleoprotein (RNP) complex comprising a class 2 CRISPR / Cas endonuclease (Cas9) complexed with the CRISPR / Cas guide RNA that hybridizes to the target sequence in the genomic DNA of the NK cell. Also disclosed herein are methods of any of the foregoing aspects wherein the genome of an NK cell is modified by inserting or deleting one or more base pairs, by inserting a heterologous DNA fragment (e.g., a donor polynucleotide), by deleting an endogenous DNA fragment, by inversion or translocation of an endogenous DNA fragment, or a combination thereof. In one aspect, disclosed herein are methods of genetically modifying NK cells of the preceding aspects, wherein the NK cells (for example, primary or expanded NK cells) are incubated in the presence of IL2 and / or irradiated feeder cells for 4, 5, 6, or 7 days prior to transduction (e.g., electroporation). Also disclosed herein are methods of genetically modifying NK cells of the foregoing aspects, further comprising developing NK cells modified by irradiation of membrane bound interleukin-21 (mbIL-21) expressing feeder cells following electroporation. In one aspect, disclosed herein are modified NK cells prepared by the methods of any of the preceding aspects. In one aspect, the modified NK cells may comprise a threshing gene encoding transforming growth factor-β receptor 2 (TGFBR2) or hypoxanthine phosphoribosyltransferase 1 (HPRT1). Also disclosed herein are methods of treating cancer comprising administering to a subject with cancer the modified NK cells of the preceding aspects. In one aspect, disclosed herein are methods for adoptively transferring engineered NK cells to a subject in need according to methods comprising a) generating a target NK cell (such as a primary NK cell or developing NK cell) to be modified; b) generating gRNA specific for a target DNA sequence; c) introducing via electroporation into the target NK cell, an RNP complex comprising a class 2 CRISPR / Cas endonuclease (Cas9) complexed with CRISPR / Cas gRNA that hybridizes to a target sequence in genomic DNA of the target NK cell creating an engineered NK cell; and d) transferring the engineered NK cell to the subject. Also disclosed herein are methods of adoptively transferring engineered NK cells to a subject in need thereof wherein the NK cell is a primary NK cell (such as, for example, an autologous NK cell, or an NK cell from an allogeneic donor source) that has been modified in vivo and after modification is transferred to the subject. In one aspect, disclosed herein are methods of adoptively transferring engineered NK cells to a subject requiring any of the foregoing aspects, wherein the NK cells are developed by irradiation of mbIL expressing feeder cells or administration of IL21 before, simultaneously with, or after administration of the modified NK cells to the subject. In one aspect, disclosed herein are methods of adoptively transferring engineered NK cells to a subject in need thereof, wherein the subject receiving the adoptively transferred modified NK cells has cancer. Short Description of Image The accompanying drawings, which are incorporated into and form a part of this specification, illustrate certain embodiments and together with such descriptions illustrate the compositions and methods disclosed. Figure 1 shows the electroporation efficiency of siRNA and plasmid DNA expressing GFP in NK cells using the EN-138 program. As seen here, NK cell viability was 77.5% and 35% of the live cells were GFP positive. Figure 2 shows the viability and efficiency of one of the 16 programs (DN-100) tested for electroporation optimization. Figure 3 shows Cas9 / RNPs-mediated TGFBR2 knockdown in (a) Primary NK cells (b) measured by the T7E1 mutation assay. The T7E1 enzyme recognizes and cleaves mismatched DNA. Each small band (blue arrow) represents a digested DNA fragment carrying an indel. Figure 4 shows Cas9 / RNPs - mediated HPRT disruption of NK cells developed as measured by the T7E1 mutation assay. Figure 5 shows the mRNA expression levels of the TGFBR2 ectodomain in CRISPR-modified NK cells introduced by Cas9 / RNPs (gRNA1+gRNA2) using RT-PCR. GAPDH was used as an endogenous control gene. Decreased RNA levels indicate disruption of the TGFBR2 gene. Figure 6A shows a cytotoxicity assay of modified Cas9 / RNP cells (gRNA1+gRNA2, gRNA2 and gRNA3) which shows that overnight incubation of the cells with TGFB did not significantly decrease their ability to lyse DAOY cells. Figure 6B shows that compared to unmodified NK cells, Cas9 / RNP (gRNA2 and gRNA3) modified cells were less sensitive to TGFB. Figure 7 shows Exon 2 of the SOCS3 gene and the gRNA used to target Exon 2 of the SOCS3 gene. Figure 8 shows the relative normalized expression levels of Socs3 in knockout NK cells compared to wild-type NK. Figures 9A, 9B, 9C, and 9D demonstrate the enhanced expansion and cytotoxicity of SOCS3-KO NK cells. Figure 9A shows the inoculation results of SOCS3-KO NK cells against AML. Figures 9B and 9C show the cytotoxicity results of 3 donors against DAOY cells (9B) and the neuroblastoma cell line NB1643 (9C). Figure 9D shows the actual number of dead cells for each cell line and treatment condition in Figures 9B and 9C. Figure 10 shows proliferation analysis demonstrating the effect of SOCS3 KO on NK cell expansion. Figure 11 shows CD38 expression on wild-type and CD38-knockout NK cells. Figure 12 shows daratumumab-mediated resistance to fratricide. Figure 13 shows that the Cas9 / RNP platform successfully targeted the AAVS1 locus in NK cells. Figures 14 show the integration of the mCherry reporter gene into the AAVS1 locus of human primary NK cells evaluated using PCR. Figure 15 shows stable gene expression of mCherry post-expansion and sorting studied using flow cytometry and fluorescent microscopy. * Results are representative of 2 of the 12 designed AAV constructs. Figure 16 shows stable mCherry gene expression after expansion and sorting of primary human NK cells using different culture conditions evaluated using flow cytometry. Primary NK cells were electroporated with CAS9 / RNP and transduced with 300K MOI of AAV6 SS800-mCherry and cultured in RPMI + fetal bovine serum (FBS) or serum-free AIMV media. Complete Description of the Invention Before these compounds, compositions, articles, devices, and / or methods are disclosed and described, it should be understood that they are not limited to specific synthetic methods or specific recombinant biotechnology methods unless otherwise specified, or to specific reagents unless otherwise specified, and thus may, of course, vary. It should also be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. A. Definitions As used in the specification and the accompanying claims, the singular forms a, a and -its include plural references unless the context clearly requires otherwise. Thus, for example, a reference to a pharmaceutical carrier includes a mixture of two or more such carriers, and the like. Ranges may be expressed herein from about one particular value, and / or to about another particular value. When such a range is expressed, other embodiments are included from one particular value and / or to another particular value. Similarly, when values ​​are expressed as approximate, using the antecedent about, it will be understood that the particular value constitutes another embodiment. It will further be understood that the endpoints of each range are significant both in relation to the other endpoints, and independently of the other endpoints. It is also understood that there are a plurality of values ​​expressed herein, and that each value is also expressed herein as about a particular value in addition to itself. For example, if the value “10” is expressed, then about 10 is also expressed.It is also understood that when a value is expressed that is “less than or equal to” that value, Greater than or equal to the value and the possible range between the values ​​are also expressed, as understood by those skilled in the art. For example, if the value “10” is expressed less than or equal to 10 as well as greater than or equal to 10 are also expressed. It is also understood that throughout the application, data is provided in a number of different formats, and that this data represents endpoints and starting points, and ranges for any combination of data points. For example, if a specific data point “10” and a specific data point 15 are expressed, it is understood that greater than, greater than or equal to, less than, less than or equal to, and equal to 10 and 15 are considered to have been expressed as between 10 and 15. It is also understood that any units between two specific units are also expressed.For example, if 10 and 15 are expressed, then 11, 12, 13, and 14 are also expressed. In this specification and the following claims, reference will be made to a number of terms which shall be defined to have the following meanings: Optional or “optionally” means that the event or state described hereinafter may or may not occur, and that the description includes instances where the event or state occurs and instances where it does not occur. "A primer is a portion of a probe that is capable of supporting some type of enzymatic manipulation and that can hybridize with a target nucleic acid so that enzymatic manipulation can occur. A primer can be made from any combination of nucleotides or nucleotide derivatives or analogues available in the art that do not interfere with enzymatic manipulation. Probes are molecules capable of interacting with a target nucleic acid, usually in a sequence-specific manner, for example through hybridization. Nucleic acid hybridization is well understood in the art and is discussed here. Typically, a probe can be made from any combination of nucleotides or nucleotide derivatives or analogs available in the art. A DNA sequence that codes for a particular RNA is a sequence of DNA nucleic acid that is transcribed into RNA. A DNA polynucleotide can code for an RNA (mRNA) that is translated into a protein (and therefore both DNA and mRNA code for proteins), or a DNA polynucleotide can code for an RNA that is not translated into a protein (e.g., tRNA, rRNA, microRNA (miRNA), a non-coding RNA (ncRNA), a guide RNA, etc.). A protein coding sequence, or a sequence that encodes a specific protein or polypeptide, is a nucleic acid sequence that is transcribed into mRNA (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vitro or in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are defined by a start codon at the 5' end (N-terminus) and a nonsense stop codon at the 3' end (C-terminus). A coding sequence may include, but is not limited to, cDNA from prokaryotic or eukaryotic mRNA, genomic DNA sequences from prokaryotic or eukaryotic DNA, and synthetic nucleic acids. A transcription termination sequence is usually located 3' from the coding sequence. The terms naturally occurring or unmodified or wild type as used herein as applied to a nucleic acid, a polypeptide, a cell, or an organism, refer to a nucleic acid, polypeptide, cell, or organism found in nature. For example, a polypeptide or polynucleotide sequence present in an organism (including viruses) that can be isolated from a source in nature and that has not been intentionally modified by humans in the laboratory is wild type (and naturally occurring). Administration to a subject includes any route of introduction or delivery to a subject of an agent. Administration may be by any suitable route, including oral, topical, intravenous, subcutaneous, transcutaneous, transdermal, intramuscular, intra-joint, parenteral, intra-arteriolar, intradermal, intraventricular, intracranial, intraperitoneal, intralesional, intranasal, rectal, vaginal, by inhalation, via an implanted reservoir, parenteral (e.g., subcutaneous, intravenous, intramuscular, intra-articular, intrasynovial, intrasternal, intrathecal, intraperitoneal, intrahepatic, intralesional, and intracranial injection or infusion techniques), and the like. Concurrent administration, administration in combination, simultaneous administration or concurrent administration as used herein, means that the compounds are administered at the same time point or substantially immediately following each other.In the latter case, the two compounds are administered close enough in time that the observed results are indistinguishable from those achieved if the compounds were administered at the same time. “Systemic administration refers to the introduction or delivery to a subject of an agent through a route that introduces or delivers the substance to a large area of ​​the subject’s body (e.g., greater than 50% of the body), for example, through an entrance into the bloodstream or lymphatic system. In contrast, “local administration refers to the introduction or delivery to a subject of an agent through a route that introduces or delivers the substance to an area or areas immediately adjacent to the point of administration and does not introduce the substance systemically in therapeutically significant amounts.”For example, a locally administered substance may be readily detectable near the point of local administration, but may not be detectable or may be detected in negligible amounts distal to the subject's body. Administration includes self-administration and administration by others. “An effective amount of a substance refers to the amount of a substance sufficient to produce a desired effect. An effective amount of a substance will vary from subject to subject, depending on many factors such as the age and general condition of the subject, the specific substance or substances, and the like. Thus, it is not always possible to determine the quantity of an “effective amount.” However, the appropriate “effective amount” in each particular subject’s case can be determined by one skilled in the art using routine experiments. Also, as used herein, and unless specifically stated otherwise, an “effective amount of a substance” may also refer to an amount that includes both a therapeutically effective amount and a prophylactically effective amount. An “effective amount of a substance required to achieve a therapeutic effect may vary according to factors such as the age, sex, and weight of the subject.Dosage guidelines can be adjusted to provide an optimal therapeutic response. For example, several divided doses may be administered daily, or the dose may be reduced proportionally as indicated by the urgency of the therapeutic situation. Pharmaceutically Acceptable Component may refer to a component that is biologically or otherwise undesirable, that is, a component that can be incorporated into a pharmaceutical formulation of the invention and administered to a subject as described herein without causing significant undesirable biological effects or interacting in a deleterious manner with any of the components of the formulation contained therein. When used in reference to human administration, the term generally implies the component has met the required toxicology standards and manufacturing testing or is included in the Inactive Ingredients Guide prepared by the U.S. Food and Drug Administration. Pharmaceutically acceptable carrier (sometimes referred to as a carrier) means a carrier or excipient useful in the preparation of a pharmaceutical or therapeutic composition that is generally safe and non-toxic, and includes a carrier acceptable for veterinary and / or human pharmaceutical or therapeutic use. The terms pharmaceutically acceptable carrier or carrier may include, but are not limited to, phosphate buffered saline, water, emulsions (such as an oil / water or water / oil emulsion) and / or various types of wetting agents. As used herein, the term carrier includes, but is not limited to, any excipient, diluent, filler, salt, buffer, stabilizer, solvent, lipid, stabilizer, or other material known in the art for use in pharmaceutical formulations and as further described herein. “Pharmacologically active (or sufficiently active), as in a derivative or analog “Pharmacologically active, may refer to a derivative or analog (e.g., a salt, ester, amide, conjugate, metabolite, isomer, fragment, etc.) that has the same pharmacological activity as the parent compound and is approximately equivalent in degree. Therapeutic agent refers to any composition that has a beneficial biological effect. Beneficial biological effects include both therapeutic effects, e.g., treatment of a disorder or other undesirable physiological condition, and prophylactic effects, e.g., prevention of a disorder or other undesirable physiological condition (e.g., a non-immunogenic cancer). The terms also include pharmaceutically acceptable, pharmacologically active derivatives of the beneficial substances specifically mentioned herein, including, but not limited to, salts, esters, amides, proagents, active metabolites, isomers, fragments, analogs, and the like.When the terms “therapeutic agent” are used, then, or when a particular agent is specifically identified, it should be understood that the term includes the agent itself as well as pharmaceutically acceptable, pharmacologically active salts, esters, amides, proagents, conjugates, active metabolites, isomers, fragments, analogs, etc. “Therapeutically effective amount or “therapeutically effective dose of a composition (e.g., a composition comprising a substance) refers to an amount that is effective for achieving a desired therapeutic outcome. In some embodiments, a desired therapeutic outcome is control of type I diabetes. In some embodiments, a desired therapeutic outcome is control of obesity. The therapeutically effective amount of a therapeutic agent administered will typically vary with factors such as the type and severity of the disorder or disease being treated and the age, gender, and weight of the subject. The term may also refer to an amount of a therapeutic agent, or a rate of delivery of a therapeutic agent (e.g., amount over time), effective for facilitating a desired therapeutic effect, such as pain relief.The exact desired therapeutic effect will vary according to the condition to be treated, the subject's tolerance, the substance and / or formulation of the substance to be administered (e.g., the potency of the therapeutic agent, the concentration of the agent in the formulation, and the like), and various other factors appreciated by those skilled in the art. In some cases, a desired biological or medical response is achieved after administration of multiple doses of the composition to a subject over a period of days, weeks, or years. Throughout this application, various publications are referenced. The disclosures of these publications as a whole are hereby incorporated by reference into this application to more fully describe the state of the art to which they relate. Disclosed references are also incorporated individually and specifically by reference herein to the material contained therein discussed in the sentence in which such reference is relied upon. B. Methods for genetically modifying NK cells Genetic reprogramming of NK cells with plasmids has always been challenging due to the difficulty in delivering transgenes by a DNA-dependent method such as lentivirus and retrovirus transduction that causes NK cell apoptosis, the substantial procedure involved, and the limited production of genetically engineered NK cells. Methods are described herein for using a DNA-free primary genome editing and developing human NK cells that utilize ribonucleoprotein endonuclease complexes (such as, for example, Cas9 / RNPs) to reprogram (i.e., engineer or modify) NK cells. Endonucleases / RNPs (for example, a Cas9 / RNP) consist of three components, a recombinant endonuclease protein (for example, a Cas9 endonuclease) complexed with a CRISPR locus. The endonuclease complexed to the CRISPR locus can be called a CRISPR / Cas guide RNA. The CRISPR locus consists of a synthetic single guide RNA (gRNA) consisting of an RNA that can hybridize to a target sequence of a complex complementary repeat RNA (crRNA) and a trans-complementary repeat RNA (tracrRNA). Therefore, the CRISPR / Cas guide RNA hybridizes to a target sequence in the genomic DNA of the cell. In some cases, class 2 CRISPR / Cas endonucleases are type II CRISPR / Cas endonucleases. In some cases, the class 2 CRISPR / Cas endonuclease is a Cas9 polypeptide and the corresponding CRISPR / Cas guide RNA is a Cas9 guide RNA.This Cas9 / RNP is capable of cleaving genomic targets with higher efficiency compared to approaches relying on foreign DNA due to its delivery as a functional complex. In addition, the rapid clearance of Cas9 / RNP from cells can reduce off-target effects such as induction of apoptosis. Therefore, in one aspect, disclosed herein are methods of genetically modifying NK cells comprising a) generating a guide RNA (gRNA) specific for a target DNA sequence in the NK cell; and b) transducing (for example, introducing via electroporation) into a target NK cell a ribonucleoprotein (RNP) complex comprising a class A endonuclease. CRISPR / Cas (Cas9) complexed with CRISPR / Cas guide RNA hybridizes to a target sequence in the genomic DNA of NK cells. It is understood and therefore considered that to target the Cas9 nuclease activity to the target site and also to cleave the donor plasmid to allow recombination of the donor transgene into host DNA, a crispr RNA (crRNA) is used. In some cases, the crRNA is combined with a tracrRNA to form a guide RNA (gRNA). Plasmids expressed using AAV integration utilize intron 1 of the protein phosphatase 1 regulatory subunit 12C (PPP1R12C) gene on human chromosome 19, designated AAVS1, as the target site for transgene integration. This locus is a safe harbor gene and allows stable, long-term transgene expression in many cell types. Because PPP1R12C disruption is not associated with any known disease, the AAVS1 locus is often considered a safe harbor for transgene targeting. Since the AAVS1 site is used as the target site, the crispr RNA (crRNA) must target that DNA.Hereby, the guide RNA used in the disclosed plasmids comprises GGGGCCACTAGGGACAGGAT (SEQ ID NO: 9) or any 10 nucleotide sense or antisense adjacent fragment thereof. While AAVS1 is used for exemplary purposes herein, it is understood and hereby considered that “other safe harbor genes may be used with equivalent results and may be substituted for AAVS1 if more appropriate to the particular transfected cell type or transgene. Examples of other safe harbor genes include but are not limited to CC chemokine receptor type 5 (CCR5), the ROSA26 locus, and TRAC. It is understood and therefore taken into account that there may be size limitations on the size of the donor transgene construct delivered to the target genome. One method to increase the allowable transgene size is to create additional space by swapping the normally used Cas9 from Streptococcus pyogenes (SpCas9) for a synthetic Cas9, or Cas9 from a different bacterial source. Substitution of Cas9 can also be used to increase targeting specificity so that fewer gRNAs need to be used. For example, Cas9 can be derived from Staphylococcus aureus (SaCas9), Acidaminococcus sp. (AsCpf1), Lachnospiracase bacterium (LbCpf1), Neisseria meningitidis (NmCas9), Streptococcus thermophilus (StCas9), Campylobacter jejuni (CjCas9), enhanced SpCas9 (eSpCas9), SpCas9HF1, Fokl-Fused dCas9, enhanced Cas9 (xCas9), and / or catalytically dead Cas9 (dCas9). It is understood and hereby considered that the use of a particular Cas9 may alter the PAM sequence used by the Cas9 endonuclease (or alternatives) to screen targets. As used herein, the corresponding PAM sequences consist of NGG (SpCas9 PAM) NNGRRT (SaCas9 PAM) NNNNGATT (NmCAs9 PAM), NNNNRYAC (CjCas9 PAM), NNAGAAW (St), TTTV (LbCpf1 PAM and AsCpf1 PAM); TYCV (LbCpf1 PAM variant and AsCpf1 PAM variant); where N can be any nucleotide; V = A, C, or G; Y = C or T; W = A or T; and R = A or G. To prepare the RNP complex, crRNA and tracrRNA may be mixed at a ratio of 1:1, 2:1, or 1:2 of a concentration between about 50μΜ and about 500μΜ (for example, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 35, 375, 400, 425, 450, 475, or 500μΜ), preferably between 100μΜ and about 300μΜ, most preferably about 200μΜ at 95C for about 5 minutes to form a crRNA:tracrRNA complex (i.e., guide RNA). The crRNA:tracrRNA complex can then be mixed between about 20μΜ and about 50μΜ (for example 21, 22, 23,24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47 48, 49, or 50μΜ) final dilution of a Cas endonuclease (such as, for example, Cas9). After binding to a target sequence in a target cell, the CRISPR locus can modify the genome by introducing into the target DNA an insertion into the target DNA genome by inserting into the target DNA or deleting one or more base pairs, by inserting a heterologous DNA fragment (e.g., a donor polynucleotide), by deleting an endogenous DNA fragment, by inversion or translocation of an endogenous DNA fragment, or a combination thereof. Thus, the disclosed methods can be used to generate knock-ins or knock-ins when combined with DNA for homologous recombination. It is demonstrated herein that transduction via Cas9 / RNPs electroporation is a simple and relatively efficient method that overcomes previous genetic modification obstacles in NK cells. It is understood and hereby considered that the disclosed methods can be used with all types of cells including natural killer cells (NK cells), T cells, B cells, macrophages, fibroblasts, osteoblasts, hepatocytes, neuronal cells, epithelial cells, and / or muscle cells. Human NK cells are a subset of peripheral blood lymphocytes defined by the expression of CD56 or CD16 and the absence of the T cell receptor (CD3). NK cells sense and target killer cells that lack major histocompatibility complex (MHC)-class I molecules. NK cell activation receptors include, among others, natural cytotoxicity receptors (NKp30, NKp44 and NKp46), and lectin-like receptors NKG2D and DNAM-1. Their ligands are expressed on stressed, transformed, or infected cells but not on normal cells, rendering normal cells resistant to NK cell killing.NK cell activation is negatively regulated through inhibitory receptors, such as killer immunoglobulin (Ig)-like receptors (KIRs), NKG2A / CD94, TGFp, and leukocyte Ig-like receptor-1 (LIR-1). In one aspect, the target cells may be primary NK cells from a donor source (such as, for example, an allogeneic donor source for adoptive transfer therapy or an autologous donor source (i.e., the ultimate recipient of the modified NK cells), NK cell lines (including, but not limited to NK RPMI8866; HFWT, K562, and EBV-LCL), or from a source of NK cell development derived from a primary NK cell source or NK cell line. Prior to NK cell transduction, the NK cells may be incubated in a medium suitable for NK cell proliferation. It is understood and hereby contemplated that the culture conditions may include the addition of cytokines, antibodies, and / or feeder cells. Thus, in one aspect, disclosed herein are methods for genetically modifying an NK cell, further comprising incubating the NK cell for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days prior to cell transduction in a medium that supports NK cell proliferation; wherein the medium further comprises cytokines, antibodies, and / or feeder cells. For example, the medium may comprise IL-2, IL-12, IL-15, IL-18, and / or IL-21. In one aspect, the medium may also comprise anti-CD3 antibodies. In one aspect, feeder cells may be purified from feeder cells that stimulate NK cells.NK cell stimulated feeder cells for use in the claimed invention, disclosed herein may be irradiated autologous or allogeneic peripheral blood mononuclear cells (PBMCs) or nonirradiated autologous or PBMCs; RPMI8866; HFWT, K562; K562 cells transfected with membrane bound IL-15, and 41BBL, or IL-21 or any combination thereof; or EBV-LCL. In some aspects, NK cell stimulated feeder cells are provided in combination with a solution of IL-21, IL-15, and / or 41BBL. Feeder cells may be seeded in culture of NK cells at a ratio of 1:2, 1:1, or 2:1. It is understood and hereby contemplated that the culturing period may be between 1 and 14 days post-electroporation (i.e., 1, 2, 3, 4,. 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days), preferably between 3 and 7 days, preferably between 4 and 6 days. It is understood and hereby considered that the incubation conditions for primary NK cells and developing NK cells may differ. In one aspect, culturing of primary NK cells prior to electroporation comprises media and cytokines (such as, for example, IL-2, IL-12, IL-15, IL-18, and / or IL-21) and / or anti-CD3 antibody for less than 5 days (for example, 1, 2, 3, or 4 days). To develop NK cells, culturing may occur in the presence of feeder NK cells (for example, at a 1:1 ratio) in addition to or instead of cytokines (such as, for example, IL2, IL-12, IL-15, IL-18, and / or IL-21) and / or anti-CD3 antibody. Culturing of developing NK cells may occur for 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days prior to transduction.Thus, in one aspect, disclosed herein are methods for genetically modifying an NK cell comprising incubating primary NK cells for 4 days in the presence of IL-2 prior to electroporation or incubating developing NK cells in the presence of irradiated feeder cells for 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 30, 36, 42, 48, 54, 60 hours, 3, 4, 5, 6, or 7 days prior to electroporation. It is understood and hereby considered that the methods of transduction for NK cell modification in the disclosed methods are limited. Due to their immune function, NK cells are resistant to viral and bacterial vectors and to the induction of NK cell apoptosis by such vectors. Therefore, prior methods of CRISPR / Cas modification of NK cells were unsuccessful. To circumvent the problem with viral vectors, the disclosed methods modify target NK cells using electroporation. Electroporation is a technique in which an electric field is applied to a cell to increase the permeability of the cell membrane. The application of the electric field creates a charge gradient across the membrane that attracts charged molecules, such as nucleic acids, across the cell membrane.Thus, in one aspect, disclosed herein are methods for genetically modifying an NK cell comprising producing a guide RNA (gRNA) specific for a target DNA sequence in the NK cell; and b) introducing via electroporation into a target NK cell a ribonucleoprotein (RNP) complex comprising a class 2 CRISPR / Cas endonuclease (Cas9) complexed with the CRISPR / Cas guide RNA that hybridizes to the target sequence in the genomic DNA of the NK cell. Following transduction (e.g., electroporation) of NK cells, the modified NK cells can now be propagated in a medium comprising feeder cells that stimulate the modified NK cells. Thus, the modified cells retain viability and proliferative potential, as they can be expanded after electroporation using irradiated feeder cells. The NK cell stimulated feeder cells for use in the claimed invention, disclosed herein, can be irradiated autologous or allogeneic peripheral blood mononuclear cells (PBMCs) or non-irradiated autologous or PBMCs; RPMI8866; HFWT, K562; K562 cells transfected with membrane-bound IL-15, and 41BBL, or IL-21 or any combination thereof; or EBV-LCL. In some aspects, the NK cell feeder cells are provided in combination with a solution of IL-21, IL-15, and / or 41BBL. Feeder cells can be seeded in culture of NK cells at a ratio of 1:2, 1:1, or 2:1.It is understood and hereby considered that the culturing period may be between 1 and 14 days post-electroporation (i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days), preferably between 3 and 7 days, more preferably between 4 and 6 days. In some aspects, the medium for culturing the modified NK cells may further comprise cytokines such as, for example, IL-2, IL-12, IL15, IL-18, and / or IL-21. In one aspect, it is understood and hereby considered that one of the purposes of the disclosed methods for genetically modifying NK cells is to produce a modified NK cell. Therefore, what is disclosed herein is a modified NK cell prepared by the disclosed methods. As mentioned above, NK cell activation is negatively regulated through inhibitory receptors, such as killer immunoglobulin (Ig)-like receptors (KIRs), NKG2A / CD94, TGFp, and leukocyte Ig-like receptor-1 (LIR-1). Engagement of a single inhibitory receptor may be sufficient to prevent target lysis. Therefore, NK cells efficiently target cells expressing multiple stress-induced ligands, and some MHC class I ligands. TGFp is a major immunosuppressive cytokine that inhibits NK cell activation and function. Thus, it is understood and therefore considered that one modification of NK cells that would be beneficial is suppression of inhibitory receptors, such as killer immunoglobulin (Ig)-like receptors (KIRs), NKG2A / CD94, TGFp, and leukocyte Ig-like receptor-1 (LIR-1) so that the negative regulation of NK cells will be suppressed.Such modified cells would be very useful in immunotherapy of any disease or condition that could be treated with the addition of NK cells. Thus, in one aspect, what is disclosed herein are genetically modified NK cells comprising a knockout of the gene encoding transforming growth factor-β receptor 2 (TGFBR2) or hypoxanthine phosphoribosyltransferase 1 (HPRT1). As mentioned throughout this disclosure, the disclosed modified NK cells are ideal for use in immunotherapies such as modified adoptive transfer (i.e., engineered NK cells for a subject in need thereof). Thus, in one aspect, disclosed herein are methods for adoptively transferring engineered NK cells to a subject in need according to methods comprising a) generating a target NK cell to be modified; b) generating gRNA specific for a target DNA sequence; c) introducing via electroporation into the target NK cell an RNP complex comprising a class 2 CRISPR / Cas endonuclease (Cas9) complexed with CRISPR / Cas gRNA that hybridizes to a target sequence in the genomic DNA of the target NK cell creating an engineered NK cell; and d) transferring the engineered NK cell to the subject. In one aspect, the modified NK cells used in the disclosed immunotherapy methods can be primary NK cells from a donor source (such as, for example, an allogeneic donor source for adoptive transfer therapy or an autologous donor source (i.e., the ultimate recipient of the modified NK cells), NK cell lines (including, but not limited to NK RPMI8866; HFWT, K562, and EBV-LCL), or from a source of NK cell development derived from a primary NK cell source or NK cell line. Since primary NK cells can be used, it is understood and hereby contemplated that the disclosed modifications of the NK cells can occur in vivo or in vitro for example. Following transduction of NK cells, modified NK cells can be developed and stimulated prior to administration of the modified (i.e., engineered) NK cells to a subject. For example, disclosed herein are methods for adoptively transferring NK cells to a subject in need thereof wherein the NK cells are developed with irradiated mbIL21 expressing feeder cells prior to administration to the subject. In some aspects, it is understood and hereby contemplated that stimulation and development of the modified (i.e., engineered) NK cells may occur in vivo following or concomitantly with administration of the modified NK cells to the subject. Therefore, disclosed herein are immunotherapy methods wherein NK cells are developed in a subject following transfer of the NK cells to the subject via administration of IL-21 or irradiated mbIL-21 expressing feeder cells. It has been shown that targeting the TGF-β pathway can enhance immune cell function. The region encoding the TGF-β-binding ectodomain of TGBR2 was targeted. Representative results showed a significant decrease in mRNA expression levels of this gene and further demonstrated that the modified NK cells were resistant to TGF-β. Therefore, immunotherapy methods in which RNP complexes target the TGF-β2 or HPRT1 genes are disclosed herein. It is understood and hereby considered that the disclosed modified NK cells and methods of adoptive transfer of modified NK cells may be effective immunotherapies against cancer. The disclosed methods and compositions may be used to treat any disease in which uncontrolled cellular proliferation occurs such as cancer. A non-limiting list of various types of cancer is as follows: lymphoma (Hodgkins and non-Hodgkins), leukemia, carcinoma, carcinoma of solid tissue, squamous cell carcinoma, adenocarcinoma, sarcoma, glioma, high-grade glioma, blastoma, neuroblastoma, plasmacytoma, histiocytoma, melanoma, adenoma, hypoxic tumor, myeloma, AIDS-related lymphoma or sarcoma, metastatic cancer, or cancer in general. A representative but not limiting list of cancers that the disclosed compositions may be used to treat is as follows: lymphoma, B-cell lymphoma, T-cell lymphoma, mycosis fungoides, Hodgkin's disease, myeloid leukemia, bladder cancer, brain cancer, 4 nervous system cancers, head and neck cancers, squamous cell carcinoma of the head and neck, lung cancers such as small cell lung cancer and non-small cell lung cancer, neuroblastoma / glioblastoma, ovarian cancer, skin cancer, liver cancer, melanoma, squamous cell carcinoma of the mouth, throat, larynx, and lung, cervical cancer, cervical carcinoma, breast cancer, and epithelial cancers, kidney cancer, genitourinary cancer, lung cancer, esophageal carcinoma, head and neck carcinoma, colon cancer, hematopoietic cancer; testicular cancer; colon cancer, rectal cancer, prostate cancer, or pancreatic cancer. Therefore, disclosed herein, in one aspect, are methods of treating cancer in a subject comprising administering to the subject a modified NK cell comprising a knockout of the TGFBR2 gene. Treating, curing, medication, and grammatical variations thereof as used herein, include the administration of a composition with the intent or purpose of partially or completely preventing, delaying, preserving, curing, alleviating, eliminating, modifying, ameliorating, ameliorating, enhancing, stabilizing, alleviating, and / or reducing the intensity or frequency of one or more diseases or conditions, a symptom of a disease or condition, or a cause of a disease or condition. The treatments according to the invention may be applied preventively, prophylactically, palliatively, or remedially. Prophylactic treatment is administered to a subject before the onset (e.g., before obvious signs of cancer), during the early onset (e.g., after the initial signs and symptoms of cancer), or after the development of established cancer. Prophylactic administration may occur from days to years before the manifestation of symptoms of an infection. .Hybridization / selective hybridization The term hybridization usually refers to a sequence-driven interaction between at least two nucleic acid molecules, such as a primer or a probe and a gene. A sequence-driven interaction refers to an interaction that occurs between two nucleotides or nucleotide analogs or nucleotide derivatives in a nucleotide-specific manner. For example, G interacting with C or A interacting with T are sequence-driven interactions. Typically, sequence-driven interactions occur at WatsonCrick or Hoogsteen sites of nucleotides. Hybridization of two nucleic acids is influenced by a number of conditions and parameters known to those skilled in the art. For example, salt concentration, pH, and reaction temperature all influence whether two nucleic acid molecules will hybridize. The parameters for selective hybridization between two nucleic acid molecules are well known to those skilled in the art. For example, in some embodiments the selective hybridization conditions may be defined as stringent hybridization conditions. For example, the stringency of hybridization is controlled by both the temperature and the salt concentration of one or both of the hybridization and washing steps. For example, hybridization conditions to achieve selective hybridization may involve hybridization in a high ionic strength solution (6X SSC or 6X SSPE) at a temperature approximately 12-25°C below the Tm (the melting temperature at which half the molecules dissociate from their hybridization partners) followed by washing with a combination of temperature and salt concentration selected so that the washing temperature is approximately 5°C to 20°C below the Tm.Temperature and salt conditions are easily determined empirically in preliminary experiments where DNA reference samples immobilized on filters are hybridized to a labeled nucleic acid of advantage and then washed under conditions of varying stringency. Hybridization temperatures are typically higher for DNA-RNA and RNA-RNA hybridizations. Conditions can be used as described above for achieving stringency, or as known in the art. A preferred stringency hybridization condition for a DNA:DNA hybridization may be around 68°C (in aqueous solution) in 6X SSC or 6X SSPE followed by washing at 68°C. The stringency of hybridization and washing, if desired, can therefore be reduced as the desired level of complementarity decreases, and further, depending on the GC or AT richness in any area where variability is sought.Similarly, the stringency of hybridization and washing, if desired, can therefore be increased as the desired homology increases, and further, depending on the GC or AT richness in any area where high homology is desired, all as is known in the art. Another way to define selective hybridization is by looking at the amount (percentage) of one of the nucleic acids bound to the other nucleic acid. For example, in some embodiments the condition for selective hybridization would be when at least about, 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 percent of the limiting nucleic acid is bound to the non-limiting nucleic acid. In particular, the non-limiting primer is in for example, 10 or 100 or 1000 fold excess. This type of assay can be performed under conditions where both the limiting and non-limiting primers are for example, 10-fold or 100-fold or 1000-fold below their kd, or where only one of the nucleic acid molecules is 10-fold or 100-fold or 1000-fold or where one or both nucleic acid molecules are above their kd. Another way to define selective hybridization is to look at the percentage of primers that are enzymatically manipulated under certain conditions where hybridization is required to induce the desired enzymatic manipulation. For example, in some embodiments the selective hybridization conditions will be when at least about, 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 percent of the primers are enzymatically manipulated under conditions that promote enzymatic manipulation, for example if the enzymatic manipulation is DNA extension, then the selective hybridization conditions will be when at least about, 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 percent of the primary molecule is expanded.Preferred conditions also include those suggested by the manufacturer or indicated in the art as being suitable for the enzyme performing the manipulation. As with homology, it is understood that various methods are disclosed herein for determining the degree of hybridization between two nucleic acid molecules. It is understood that these methods and conditions may yield different percentages of hybridization between two nucleic acid molecules, but unless otherwise stated, meeting the parameters of any one of these methods will be sufficient. For example, if 80% hybridization is required and as long as the hybridization occurs within the parameters required by one of these methods, it is deemed to be disclosed herein. It is understood that those skilled in the art understand that if a composition or method meets any of these criteria for determining hybridization either collectively or singly it is a composition or method as disclosed herein. .Nucleic acids There are various molecules disclosed herein that are based on nucleic acids, including for example nucleic acids encoding, for example, TGFpR2, or any nucleic acid disclosed herein for making knockdowns of TGFRp2, or fragments thereof, as well as various functional nucleic acids. The disclosed nucleic acids comprise, for example, nucleotides, nucleotide analogs, or nucleotide substitutions. Non-limiting examples of these and other molecules are discussed herein. It is understood that, for example, when a vector is expressed in a cell, that the expressed mRNA typically comprises A, C, G, and U. Similarly, it is understood that if, for example, an antisense molecule is introduced into a cell or the cellular environment through, for example, exogenous delivery, it is advantageous that the antisense molecule comprises a nucleotide analog that reduces the degradation of the antisense molecule in the cellular environment. a) Nucleotides and related molecules A nucleotide is a molecule containing a base group, a sugar group, and a phosphate group. Nucleotides can be linked together through their phosphate groups and sugar groups, creating an internucleoside chain. The base group of a nucleotide can be adenine-9-yl (A), cytosine-1-yl (C), guanine-9-yl (G), uracil-1-yl (U), and thymine-1-yl (T). The sugar group of a nucleotide is either a ribose or a deoxyribose. The phosphate group of a nucleotide is pentavalent phosphate. A non-limiting example of a nucleotide would be 3'-AMP (3'-adenosine monophosphate) or 5'-GMP (5'-guanosine monophosphate). There are many variations of this type of molecule available in the art and available here. A nucleotide analog is a nucleotide containing some type of modification at one of the base, sugar, or phosphate groups. Modifications to nucleotides are well-known in the art and include, for example, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, and 2-aminoadenine, as well as modifications at the sugar or phosphate groups. There are many variations of this type of molecule available in the art and available here. Nucleotide substitutions are molecules that have functional properties similar to nucleotides, but that do not contain a phosphate group, such as peptide nucleic acids (PNAs). Nucleotide substitutions are molecules that will recognize nucleic acids by the Watson-Crick or Hoogsteen method, but that are linked together by a group other than a phosphate group. Nucleotide substitutions are able to conform to a double helix-type structure when interacting with the appropriate nucleic acid target. There are many variations of this type of molecule available in the art and available here. It is also possible to link other types of molecules (conjugates) to nucleotides or nucleotide analogs to enhance, for example, cellular uptake. Conjugates can be chemically linked to nucleotides or nucleotide analogs. Such conjugates include, but are not limited to, lipid moieties such as a cholesterol moiety. (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556). There are many variations of this type of molecule available in the art and available here. A Watson-Crick interaction is at least one interaction with a Watson-Crick moiety of a nucleotide, nucleotide analog, or nucleotide substitution. The Watson-Crick moiety of a nucleotide, nucleotide analog, or nucleotide substitution includes the C2, N1, and C6 positions of a purine-based nucleotide, nucleotide analog, or nucleotide substitution and the C2, N3, C4 positions of a pyrimidine-based nucleotide, nucleotide analog, or nucleotide substitution. A Hoogsteen interaction is an interaction that occurs at the Hoogsteen site of a nucleotide or nucleotide analog, which is exposed in the major groove of duplex DNA. The Hoogsteen site includes the N7 position and the reactive group (NH2 or O) at the C6 position of a purine nucleotide. b) Sequence There are a variety of sequences related to protein molecules involved in the signaling pathways disclosed herein, for example, TGFpR2, all of which are encoded by nucleic acids. Sequences for human analogs of these genes, as well as other analogs, alleles of these genes, and splice variants and other types of variants, are available in various protein and gene databases, including Genbank. Those skilled in the art understand how to resolve sequence discrepancies and differences and to adapt compositions and methods related to a particular sequence to other related sequences. Primers and / or probes may be designed for a given sequence in accordance with information disclosed herein and known in the art. c) Primary and secondary Disclosed are compositions including primers and quarks, capable of interacting with disclosed nucleic acids, such as TGFpR2 and / or HPRT1 as disclosed herein. In certain embodiments the primers are used to support DNA amplification reactions. The primers in particular may be extended in a sequence-specific manner. Extension of a primer in a sequence-specific manner includes any method in which the sequence and / or composition of the nucleic acid molecule to which the primer is hybridized or otherwise linked directs or influences the composition or sequence of the product produced by extension of the primer. Extension of a primer in a sequence-specific manner therefore includes, but is not limited to, PCR, DNA sequencing, DNA extension, DNA polymerization, RNA transcription, or reverse transcription. Techniques and conditions that amplify the primer in a sequence-specific manner are preferred.In certain embodiments primers are used for DNA amplification reactions, such as PCR or direct sequencing. It is understood that in certain embodiments primers may also be extended using non-enzymatic techniques, whereby, for example, the nucleotides or oligonucleotides used to extend the primers are modified such that they chemically react to extend the primers in a sequence-specific manner. In particular, the disclosed primers hybridize with the disclosed nucleic acid or a region of the nucleic acid or they hybridize with a complement of the nucleic acid or a complement of a region of the nucleic acid. The size of the primers or probes for interaction with nucleic acids in certain embodiments can be any size that supports the desired enzymatic manipulation of the primers, such as DNA amplification or simple hybridization of the probes or primers. A typical primer or probe will be at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42,43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57,58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72,73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87,88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 125,150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425,450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950,1000, 1250, 1500, 1750, 2000, 2250, 2500, 2750, 3000, 3500, or 4000 nucleotides long. In other embodiments a primary or probe can be less than or equal to 6, 7, 8, 9, 10, 11, 12 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1250, 1500, 1750, 2000, 2250, 2500, 2750, 3000, 3500, or 4000 nucleotides long. Primers for the TGFpR2 and HPRT1 genes will be used to generate an amplified DNA product containing a region of the TGFpR2 and HPRT1 genes or the complete gene. In general, the size of the product will be such that its size can be accurately determined to within 3, 2, or 1 nucleotide. In certain embodiments of this product at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35,36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50,51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65,66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80,81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95,96, 97, 98, 99, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1250, 1500, 1750, 2000, 2250, 2500, 2750, 3000, 3500, or 4000 nucleotides long. In other embodiments the product is less than or equal to 20 , 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1250, 1500, 1750, 2000, 2250, 2500, 2750, 3000, 3500, or 4000 nucleotides long. 3. Expression systems Nucleic acids delivered to cells typically contain expression control systems. For example, genes inserted into viruses and retroviruses typically contain stimulants and / or enhancers to help control the expression of the desired gene product. A stimulant is generally a sequence or sequences of DNA that function while in a relatively fixed location relative to the transcription start site. A stimulant contains core elements necessary for the basic interaction of RNA polymerase and transcription factors, and may also contain upstream and response elements. a) Virus Stimulants and Amplifiers Stimulants that preferentially control transcription from vectors in mammalian host cells can be obtained from various sources, for example, genomes from viruses such as: polyoma, Simian Virus 40 (SV40), adenovirus, retrovirus, hepatitis-B virus and most preferably cytomegalovirus, or from heterologous mammalian stimulants, for example beta-actin stimulants. Early and late stimulants from the SV40 virus are easily obtained as an SV40 restriction fragment that also contains the SV40 viral origin of replication (Fiers et al., Nature, 273: 113 (1978)). The immediate early stimulant from human cytomegalovirus is easily obtained as a HindIII E restriction fragment (Greenway, PJ et al., Gen 18: 355-360 (1982)). Of course, stimulants from the host cell or related species are also useful here. An enhancer generally refers to a sequence of DNA that functions at an indeterminate distance from the transcription start site and can be 5' (Laimins, L. et al., Proc. Natl. Acad. Sci. 78: 993 (1981)) or 3' (Lusky, M.L., et al., Mol. Cell Bio. 3: 1108 (1983)) to the transcription unit. Furthermore, enhancers can be within an intron (Banerji, J.L. et al., Cell 33: 729 (1983)) as well as within the coding sequence itself (Osborne, T.F., et al., Mol. Cell Bio. 4: 1293 (1984)). They are typically between 10 and 300 bp in length, and they function in cis. Enhancers function to enhance transcription from nearby stimuli. Enhancers also often contain response elements that mediate transcriptional regulation. Stimuli can also contain response elements that mediate transcriptional regulation. Enhancers often determine the regulation of a gene's expression.While many enhancer sequences are now known from mammalian genes (globin, elastase, albumin, α-fetoprotein, and insulin), one would typically use an enhancer from a eukaryotic cell virus for general expression. Preferred examples are the SV40 enhancer at the late site of the origin of replication (bp 100-270), the cytomegalovirus early stimulatory enhancer, the polyoma enhancer at the late site of the origin of replication, and the adenovirus enhancer. Stimulants and / or enhancers can be specifically activated by light or specific chemical events that trigger their function. These systems can be modulated by reagents such as tetracycline and dexamethasone. There are also ways to enhance viral vector gene expression by exposure to irradiation, such as gamma irradiation, or alkylating chemotherapy drugs. In certain embodiments, the stimulator and / or enhancer region may act as a constitutive stimulator and / or enhancer to maximize expression of the region of the transcription unit to be transcribed. In certain constructs, the stimulator and / or enhancer region becomes active in all eukaryotic cell types, even if it is only expressed in a particular cell type at a particular time. A preferred stimulator of this type is the CMV stimulator (650 bases). Other preferred stimulators are the SV40 stimulator, cytomegalovirus (complete stimulator), and the LTR of retrovirus vectors. It has been shown that all specific regulatory elements can be cloned and used to construct expression vectors that selectively express specific cell types, such as melanoma cells. Glial fibrillation-stimulating protein acetylation (GFAP) has been used to selectively express genes in glial cells. Expression vectors used in eukaryotic host cells (yeast, fungi, insects, plants, animals, humans, or nucleated cells) may also contain sequences required for transcription termination that can affect mRNA expression. These regions are transcribed as polyadenylated segments in the untranslated portion of mRNAs encoding tissue factor proteins. The 3' untranslated region also includes the transcription termination site. It is preferable that the transcription unit also contain a polyadenylated region. One advantage of this region is that it increases the likelihood that the transcribed unit will be processed and transported like mRNA. The identification and use of polyadenylation signals in expression constructs is well established. It is preferable that a homologous polyadenylation signal be used in transgene constructs. In certain transcription units, the polyadenylated region is derived from the SV40 early polyadenylation signal and contains approximately 400 bases.It is also preferred that the transcribed unit contain other standard sequences alone or in combination with the above sequences that enhance the expression of, or stability of, the construct. b) Marker Viral vectors can include nucleic acid sequences that encode a marker product. This marker product is used to determine whether the gene has been delivered to the cell and is being expressed after delivery. Preferred marker genes are the E. coli lacZ gene, which encodes β-galactosidase, and green fluorescent protein. In some embodiments, the marker may be a selectable marker. Examples of suitable mammalian cell markers that may be selected are dihydrofolate reductase (DHFR), thymidine kinase, neomycin, the neomycin analog G418, hydromycin, and puromycin. When the selectable marker is successfully transferred into a mammalian host cell, the transformed mammalian host cell can survive when placed under selective pressure. There are two distinct categories of selective regimes that are widely used. The first category is based on a cell metabolism and the use of a mutant cell line that lacks the ability to grow independently of an additional medium. Two examples are: DHFR- CHO cells and LTK- mouse cells. These cells lack the ability to grow without the addition of nutrients such as thymidine or hypoxanthine.Because these cells lack certain genes required for a complete nucleotide synthesis pathway, they cannot survive unless the missing nucleotides are provided in supplemented media. An alternative to supplementing the media is to introduce an intact DHFR or TK gene into cells lacking the respective gene, thus altering their growth requirements. Individual cells not modified with the DHFR or TK gene will not be able to survive in unadjusted media. The second category is dominant selection which refers to a selection scheme used in all cell types and does not require the use of a mutant cell line. These schemes typically use a drug to stop the growth of a host cell. Those cells that have a new gene will express a protein that carries drug resistance and will survive selection. Examples of such dominant selection use the drugs neomycin, (Southern P. and Berg, P., J. Molec. Appl. Genet. 1: 327 (1982)), mycophenolic acid, (Mulligan, R.C. and Berg, P. Science 209: 1422 (1980)) or hygromycin, (Sugden, B. et al., Mol. Cell. Biol. 5: 410-413 (1985)). These three examples use bacterial genes under eukaryotic control to confer resistance to the corresponding G418 drug or neomycin (geneticin), xgpt (mycophenolic acid), or hygromycin, respectively. Others include the neomycin analogues G418 and puramycin. 4. Peptides a) Protein variants Protein variants and their derivatives are well understood by those skilled in the art and can involve modifications of amino acid sequences. For example, amino acid sequence modifications typically fall into one or more of three classes: substitutional variants, insertions, or deletions. Insertions include amino- and / or carboxyl-terminal fusions as well as insertions within sequences of single or multiple amino acid residues. Insertions will typically be smaller insertions than such amino- or carboxyl-terminal fusions, for example, in sequences of one to four residues. Immunogenic fusion protein derivatives, as described in the examples, are prepared by fusing a polypeptide large enough to confer immunogenicity to the target sequence by cross-linking in vitro or by culturing recombinant cells modified with DNA encoding the fusion.Deletions are characterized by the removal of one or more amino acid residues from a protein sequence. Typically, no more than about 2 to 6 residues are deleted at any one site in the protein molecule. These variants are usually created by site-specific mutagenesis of nucleotides in the protein-coding DNA, thus producing DNA encoding the variant, and then expressing the DNA in recombinant cell cultures. Techniques for creating substitution mutations at predetermined sites in DNA of a well-known sequence include M13 primer mutagenesis and PCR mutagenesis. Amino acid substitutions are typically of single residues, but can occur at many different locations simultaneously; insertions will typically range from at least 1 to 10 amino acid residues; and deletions will range from at least 1 to 30 residues.Deletions or insertions are preferably made in adjacent pairs, i.e., a deletion of two residues or an insertion of two residues. Substitutions, deletions, insertions, or any combination thereof can be combined to arrive at a final construct. Mutations should not place the sequence outside the reading frame and should not create complementary regions that could produce secondary mRNA structure. Substitutional variants are those in which at least one residue has been deleted and a different residue inserted in its place. Such substitutions are generally made according to Tables 1 and 2 below and are referred to as conservative substitutions. TABLE 1: Amino Acid Abbreviations Amino acid abbreviation Alanine Ala A allosoleucine AIle Arginine Arg R asparagine Asn N aspartic acid Asp D Cysteine ​​Cys C glutamic acid Glu E Glutamine Gln Q Glycine Gly G Histidine His H Isolelucin Ile I Leucine Leu L Lysine Lys K phenylalanine Phe F proline Pro P pyroglutamic acid pGlu Serine Ser S Threonine Thr T Tyrosine Tyr Y Tryptophan Trp W Valine Val V TABLE 2: Amino Acid Substitutions Conservative Substitution Residue Example Original, others are known in his field. Ala Ser Arg Lys; Gln Asn Gln; His Asp Glu Cys Ser Gln Asn, Lys Glu Asp Gly Pro His Asn;Gln Ile Leu; Val Leu Ile; Val Lys Arg; Gln Met Leu; Ile Phe Met; Leu; Tyr Ser Thr Thr Ser Trp Tyr Tyr Trp; Phe Val Ile; Leu Substantial changes in immunological function or identity are made by selecting substitutions that are less conservative than those in Table 2, that is, selecting residues that differ significantly in their effect on the maintenance of (a) the structure of the polypeptide backbone at the site of substitution, for example as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site or (c) the bulk of the side chain.The substitutions which would generally be expected to produce the greatest changes in protein properties would be those in which (a) a hydrophilic residue, e.g., seryl or threonyl, is substituted by (or with) a hydrophobic residue, e.g., leucyl, isoleucyl, phenylalanyl, valyl or alanyl; (b) a cysteine ​​or proline is substituted by (or with) another residue; (c) a residue having an electropositive side chain, e.g., lysyl, arginyl, or histidyl, is substituted by (or with) an electronegative residue, e.g., glutamyl or aspartyl; or (d) a residue having a large side chain, e.g., phenylalanine, is substituted by (or with) one lacking a side chain, e.g., glycine, in this case, (e) by increasing the number of sites for sulfation and / or glycosylation. For example, the replacement of one amino acid residue with another biologically and / or chemically similar one is known to those skilled in the art to be a conservative substitution. For example, a conservative substitution would substitute one hydrophobic residue for another, or one polar residue for another. Such substitutions include combinations such as, for example, Gly, Ala; Val, Ile, Leu; Asp, Glu; Asn, Gln; Ser, Thr; Lys, Arg; and Phe, Tyr. Conservatively substituted variations of each explicitly disclosed sequence are included in the mosaic polypeptides provided herein. Substitutional or deletion mutagenesis can be used to insert sites for N-glycosylation (AsnX-Thr / Ser) or O-glycosylation (Ser or Thr). Removal of cysteine ​​or other labile residues may also be desirable. Deletion or substitution of potential proteolytic sites, such as Arg, is achieved, for example, by deleting one of the basic residues or substituting one with a glutamyl or histidyl residue. Certain post-translational derivatizations result from the action of the recombinant host cell on the expressed polypeptide. Flutaminyl and asparaginyl residues are often post-translationally deamidated to the corresponding glutamyl and aspartyl residues. Alternatively, these residues are deamidated under mildly acidic conditions. Other post-translational modifications include hydroxylation of proline and lysine, phosphorylation of the hydroxyl groups of seryl or threonyl residues, methylation of the o-amino groups of the side chains of lysine, arginine, and histidine (T.E. Creighton, Proteins: Structure and Molecular Properties, W.H. Freeman & Co., San Francisco pp. 79-86

[1983] ), acetylation of the N-terminal amine, and, in some cases, amidation of the C-terminal carboxyl. It is understood that one way to determine variants and derivatives of the proteins disclosed herein is to define the variants and derivatives in terms of homology / identity to certain known sequences. Specifically disclosed are variants of these proteins and other proteins described herein that have at least 70%, 75%, 80%, 85%, 90%, or 95% homology to the stated sequence. Those skilled in the art readily understand how to determine the homology of two proteins. For example, homology can be calculated after aligning two sequences to the highest level of homology. Other methods for calculating homology can be done with published algorithms. Optimal sequence alignment for comparison can be done by the local homology algorithm of Smith and Waterman Adv. Appl. Math. 2: 482 (1981), by the homology alignment algorithm of Needleman and Wunsch, J. MoL Biol. 48: 443 (1970), by the similarity search method of Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85: 2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetic Computer Group, 575 Science Dr., Madison, WI), or by inspection. The same type of homology can be generated from nucleic acids by, for example, the algorithm described in Zuker, M. Science 244:48-52, 1989, Jaeger et al. Proc. Natl. Acad. Sci. USA 86:7706-7710, 1989, Jaeger et al. Methods Enzymol. 183:281-306, 1989. It is understood that the descriptions of conservative and homologous mutations can be combined together in any combination, such as embodiments having at least 70% homology to a particular sequence where the variant is a conservative mutation. As this specification discusses various proteins and protein sequences, it is understood that nucleic acids that may encode such protein sequences are also disclosed. This will include all degenerately related sequences for a specific protein sequence, i.e., all nucleic acids having a sequence encoding a specific protein sequence as well as all nucleic acids, including degenerate nucleic acids, encoding variants and derivatives of the disclosed protein sequence. Thus, while each specific nucleic acid sequence may not be described herein, it is understood that each and every sequence is actually disclosed and described herein through the disclosed protein sequence.It is also understood that while no amino acid sequence indicates what particular DNA sequence encodes that protein in an organism, where particular variants of a protein are disclosed as disclosed herein, the known nucleic acid sequences that encode that protein are also known and are disclosed and described herein. It is understood that there are many amino acid and peptide analogs that can be incorporated into the disclosed compositions. For example, there are many D-amino acids or amino acids having a different functional substituent then the amino acids shown in Tables 1 and 2. Opposite stereo isomers of naturally occurring peptides are disclosed, as well as stereo isomers of peptide analogs. These amino acids can be readily incorporated into polypeptide chains by loading tRNA molecules with the amino acids of choice and engineering genetic constructs that utilize, for example, amber codons, to insert analog amino acids into a peptide chain in a site-specific manner. Molecules can be produced that resemble peptides, but are not linked through a natural peptide linkage. For example, linkages for amino acids or amino acid analogs can include CH2NH—, —CH2S —, —CH2—CH2 —, —CH=CH— (cis and trans), -COCH2 —, —CH(OH)CH2—, and —CHH2SO— (These and others can be found in Spatola, A.F. in Chemistry and Biochemistry of Amino Acids, Peptides, and Proteins, B. Weinstein, eds., Marcel Dekker, New York, p. 267 (1983); Spatola, A.F., Vega Data (March 1983), Vol. 1, Number 3, Peptide Backbone Modifications (an overview); Morley, Trends Pharm Sci (1980) pp. 463-468; Hudson, D. et al., Int J Pept Prot Res 14:177-185 (1979) (—CH2NH—, CH2CH2—); Spatola et al. Life Sci 38:1243-1249 (1986) (—CH H2—S); Hann J. Chem. Soc Perkin Trans. I 307-314 (1982) (—CH—CH—, cis and trans); Almquist et al. J. Med. Chem. 23:1392-1398 (1980) (--COCH2--); Jennings-White et al. Tetrahedron Lett 23:2533 (1982) (--COCH2--); Szelke et al. European Appln, EP 45665 CA (1982): 97:39405 (1982) (-CH(OH)CH2--); Holladay et al. Tetrahedron. Lett 24:4401-4404 (1983) (--C(OH)CH2--); and Hruby Life Sci 31:189-199 (1982) (-CH2--S--); each of which is incorporated herein by reference. A particularly preferred non-peptide linkage is --CH2NH--. It is understood that peptide analogs may have more than one atom between the bonding atoms, such as b-alanine, g-aminobutyric acid, and the like. Amino acid analogs and peptide analogs often have improved or desirable properties, such as, more economical production, better chemical stability, improved pharmacological properties (half-life, absorption, potency, efficacy, etc.), altered specificity (e.g., a broad spectrum of biological activities), reduced antigenicity, etc. D-amino acids can be used to produce more stable peptides, as they are not recognized by peptidases and the like. Systematic substitution of one or more amino acids of a consensus sequence with D-amino acids of the same type (e.g., D-lysine replacing L-lysine) can be used to produce more stable peptides. Cysteine ​​residues can be used to cyclize or attach two or more peptides together. This can be useful for restricting peptides to specific conformations. 5. Pharmaceutical carrier / Pharmaceutical product delivery As described above, the compositions may also be administered in vivo in a pharmaceutically acceptable carrier. Pharmaceutically acceptable means a material that is not biologically desirable or otherwise, that is, the material may be administered to a subject, in conjunction with a nucleic acid or vector, without causing undesirable biological effects or interacting in a detrimental manner with the other components of the pharmaceutical composition therein. The carrier will be chosen to be natural to minimize degradation of any active ingredient and to minimize adverse side effects in the subject, as will be known to one skilled in the art. These compositions may be administered orally, parenterally (e.g., intravenously), by intramuscular injection, by intraperitoneal injection, transdermally, extracorporeally, topically, or the like, including topical intranasal administration or inhalant administration. As used herein, topical intranasal administration means delivery of the compositions into the nose and nasal passages through one or both nostrils and may comprise delivery by a spraying or drop mechanism, or by aerosolization of nucleic acid or vector. Inhalant administration of the compositions may be through the nose or mouth via delivery by a spraying or drop mechanism. Delivery may also be direct to any area of ​​the respiratory system (e.g., the lungs) via intubation.The exact amounts of the components required will vary from subject to subject, depending on the subject's species, age, weight, and general condition, the severity of the allergic disorder being treated, the specific nucleic acid or vector used, the route of administration, and the like. Therefore, it is impossible to determine an exact amount for each component. However, appropriate amounts can be determined by one of ordinary skill in the art using only the routine experiments taught here. Parenteral administration of the composition, if used, is generally characterized by injection. Injections may be prepared in conventional forms, either as a liquid solution or suspension, a solid form suitable for suspension in a liquid prior to injection, or as an emulsion. A more recent approach to parenteral administration involves the use of a slow-release or sustained-release system so that a constant dose is maintained. See, for example, U.S. Patent No. 3,610,795, which is incorporated by reference herein. The materials can be in the form of solutions, suspensions (for example, incorporated into microparticles, liposomes, or cells). They can be targeted to specific cell types via antibodies, receptors, or ligand receptors. The following references are examples of the use of this technology to target specific proteins to tumor tissue (Senter, et al., Bioconjugate Chem., 2:447-451, (1991); Bagshawe, KD, Br. J. Cancer, 60:275-281, (1989); Bagshawe, et al., Br. J. Cancer, 58:700-703, (1988); Senter, et al., Bioconjugate Chem., 4:3-9, (1993); Battelli, et al., Cancer Immunol. Immunother., 35:421-425, (1992); Pietersz and McKenzie, Immunolog. Reviews, 129:57-80, (1992); and Roffler, et al., Biochem. Pharmacol, 42:2062-2065, (1991)).Carriers such as stealth and other antibody-conjugated liposomes (including lipid-mediated drug targeting of colon carcinoma), receptor-mediated targeting of DNA via cell-specific ligands, lymphocyte-directed tumor targeting, and highly specific therapeutic retrovirus targeting of murine glioma cells in vivo. The following references are examples of the use of these technologies to target specific proteins to tumor tissue (Hughes et al., Cancer Research, 49:6214-6220, (1989); and Litzinger and Huang, Biochimica et Biophysica Acta, 1104:179-187, (1992)). In general, receptors are involved in endocytosis pathways, either constitutive or ligand-induced. These receptors cluster in clathrin-coated niches, enter the cell via clathrin-coated vesicles, pass through an acidified endosome where the receptors are sorted, and then either recycle to the cell surface, are stored intracellularly, or are degraded in lysosomes.Internalization pathways serve a variety of functions, such as nutrient uptake, removal of activated proteins, clearance of macromolecules, opportunistic entry of viruses and toxins, ligand dissociation and degradation, and regulation of receptor levels. Many receptors follow more than one intracellular pathway, depending on the cell type, receptor concentration, ligand type, ligand valence, and ligand concentration. The molecular and cellular mechanisms of receptor-mediated endocytosis have been reviewed (Brown and Greene, DNA and Cell Biology 10:6, 399-409 (1991)). C. Examples The following examples are presented to provide those skilled in the art with a complete disclosure and description of how the compounds, compositions, articles, apparatus and / or methods claimed herein are prepared and evaluated, and are intended to be merely exemplary and are not intended to limit the disclosure. Every effort has been made to ensure accuracy with regard to figures (e.g., quantities, temperatures, etc.), but some errors and deviations must be taken into account. Unless otherwise noted, parts are parts by weight, temperatures are in °C or are at room temperature, and pressures are at or near atmospheric. Example 1 a) Methods (1) Purification and development of human NK cells Healthy donor buffy coats were obtained as source material from the American Red Cross Central Ohio Region. This study was designated as exempt by the Nationwide Children's Hospital Institutional Review Board. Separate PBMCs from the Buffy Coat. Briefly, coat 35 mL of the buffy coat sample in 15 mL of Ficoll-Paque. Centrifuge at 400 x g for 20 minutes without brake. Wash the recovered PBMCs three times with PBS. NK cells can be isolated at this stage with RosettesSep. Develop NK cells by stimulating with irradiation 10 x 106 feeder cells expressing mbIL21 on days 0, 7, and 14. Replace the media with fresh AIMV or RPMI containing 10% FBS, 1% Glutamine, 1% Streptomycin penicillin and 100 IU / mL of IL-2 for the entire media volume every other day IL-2 for the entire media volume every day. (2) Design and selection of gRNA Select a specific genomic locus to target, using online tools such as NCBI, Ensemble. For example, using the transforming growth factor beta receptor 2 (TGFBRR2) ectodomain. See record: PF08917; See InterPro: IPR015013; Position: 49-157 aa. Target Sequence: Exon 4 of the TGFBR2 gene (ENSG00000163513) To design your gRNA, use a CRISPR design web tool such as http: / / crispr.mit.edu and 'Benchling.com'. Enter your DNA sequence selected in step 2.1. Select human (hg 19) as a target genome. The CRISPR guide (20 nucleotides followed by a PAM sequence: NGG) is scanned against the previously entered sequence. It also shows possible off-target matches across the selected genome. Select the three best gRNAs that have the highest scores, based on their on-target and off-target rates. Table 1, shows the CRISPR RNA designed to target exon 4 of the TGFBR2 gene indicated by the CRISPR design web tool. Table 1. Three gRNAs designed to target exon 4 of the TGFBR2 ectodomain as synthetic crRNAs. NO. gRNA sequence gRNA Sequenced as synthetic crRNA gRNAl 5 CCCCTACCATGACTTTATTC 3 (SEQ ID NO: 1) / AltRl / rArGrUrCrArUrGrGrUr ArGrGrGrGrArGrCrUrUrGrGrUr UrUrUrArGrArGrCrUrArUrGrCr U / AltR2 / (SEQ ID NO: 4) gRNA2 5 ATTGCACTCATCAGAGCTAC 3 (SEQ ID NO: 2) / AltRl / rArUrUrGrCrArCrUrCr ArUrCrArGrArGrCrUrArCrGrUr UrUrArGrArGrCrUrArUrGrCr U / AltR2 / (SEQ ID NO: 5) gRNA3 5 AGTCATGGTAGGGGAGCTTG 3 (SEQ ID NO: 3) / AltRl / rArG rUrCrA rUrGrG rUrArGrGrGrG rArGrC rUrUrG rGrUrUrUrUrA rGrArG rCrUrA rUrGrCrU / AltR2 / (SEQ ID NO: 6) CRISPR RNA messages as specific sequences of synthetic crRNA and transactivating RNA messages (trackerRNA) are conserved to interact through partial homology with your crRNA. (3) Design Elimination Screening Primers Design primers covering the gRNA cleavage site for the T7E1 mutation assay. Using primers at least 100 bp from the predicted cleavage site ensures that small deletions (indels) at the target sgRNA site appear on a 1.5% agarose gel after the mutation assay. Table 2 shows the primers used to amplify the TGFBR2 ectodomain. Table 2. Primers used to amplify ectodomain genes TGFBR2 Ectodomain TGFBR 2 Primary FWD 5 GTC TGC TCC AGG TGA TGT TTA T3 (SEQ ID NO: 7) Ectodomain TGFBR2 Primary REV 5 GGG CCT GAG AAT CTG CAT TTA 3 (SEQ ID NO: 8) (4) Transduction of Human Primary and developed NK cells Transduction of Cas9 / RNP elements into NK was performed by electroporation using the 4D Nucleofector System as follows: (5) Preparation of cell preparations For primary NK cells, incubate freshly isolated NK cells in RPMI or AIMV medium in the presence of 100 lU / mL of IL-2 for 4 days and electroporate on day 5 (Change the medium every other day as described previously and the day before transduction). This can be modified to develop NK cells. To develop NK cells, stimulate cells on day 0 by irradiating feeder cells at a 1:1 ratio and electroporate on day 5 or 6 or 7. (Change the medium every other day as described previously and the day before transduction). On the day of electroporation, prepare a T25 flask filled with 8 ml of fresh RPMI containing 100 lU / mL of IL-2 for the cells undergoing electroporation and pre-incubate the flask in a humidified 37°C / 5% CO2 incubator. Thawed cells or cells that have undergone a 2nd or 3rd stimulation can be electroporated at any time after their recovery as described.Take 3-4 χ 106 cells per condition for a 26pL transduction mixture as a very high concentration of NK cells in the Nucleofector Solution increases the transduction rate. Cells can be washed 3 times with PBS to remove all FBS, which usually contains RNase activity. Spin each time at 300g for 8 minutes. Consider 7 Cas / RNP electroporation conditions as single gRNA (gRNAl, gRNA2, gRNA3) and a combination of two gRNAs (gRNAl+gRNA2, gRNAl+gRNA3, gRNA2+gRNA3) and one control without Cas9 / RNP. (6) crRNA:tracerRNA / complex form Resuspend crRNA (gRNAl, gRNA2 and gRNA3) and TracerRNA in IX TE solution to a final concentration of 200μΜ. Mix 2.2μl of each 200μΜ gRNA with 200μΜ TracerRNA as shown in Table 3. Heat the sample at 95°C for 5 minutes and let it cool on the bench to room temperature (15-25°C). Store the resuspension RNA and crRNA:tracerRNA / complex at -20°C for later use. Table 3. Forms of crRNA:tracerRNA / complexes using 200 μΜ RNA Component Quantity (uL) 200 μΜ crRNA 2.2 200 μΜ Quar RNA 2.2 IDTE Buffer 5, 6 Final product 10 (7) RNP complex form To save time, form the RNP complex during the washing step. For single crRNA:tracrRNA duplex reactions, dilute the Cas9 endonuclease to 36 μΜ as mentioned in Table 4. Table 4. For the single crRNA:tracrRNA duplex reaction, Dilute Cas9 endonuclease to 36 μΜ. Component Quantity (pL) PBS 1 Duplex crRNA:tracrRNA (from step 4.2) 2 (200 pmol) Alt-R endonuclease Cas9 (stock 61 μΜ) 2 Total volume 5 ul For combinatorial transduction of crRNA:tracrRNA duplex dilute Cas9 Endonuclease to 36 μΜ as shown in Table 5. Table 5. For combinatorial transduction of crRNA:tracrRNA duplex dilute Cas9 endonuclease to 36 μΜ. Component Quantity (pL) PBS 1 crRNA:tracrRNA duplex (e.g. gRNAl) 1 (100 pmol) crRNA:tracrRNA duplex (e.g. gRNA2) 1 (100 pmol) Alt-R endonuclease Cas9 2 Total volume 5 pL Slowly add Cas9 endonuclease to the crRNA:tracrRNA duplex while rotating the pipette tip for 30 seconds to 1 minute. Incubate the mixture at room temperature for 15–20 minutes. If you are not ready to use the mixture after 15 minutes of incubation, store it on ice until use. (8) Electroporation Add all additives to Nucleofector Solution P3 and store at room temperature. Resuspend the pelleted cells (3-4 χ 106 cells) in 20μl of Nucleofector Solution 4D Primer P3. Avoid air bubbles when pipetting. Cells should not be left in solution P3 for extended periods. Immediately add 5pL of RNP complex to the cell suspension. Add ^l of 100μΜ of Cas9 electroporation enhancer to the Cas9 / RNP / cell mixture. Transfer the Cas9 / RNP / cell mixture to a 20μ1 Nucleocuvette Strip. Gently touch the Nucleocuvette Strip to ensure the sample covers the bottom of the strip. Start the Nucleofector System 4D and select Program EN-138. (9) Post-Transduction Let the cells rest for 3 minutes in the strip. Add 80 pL of pre-equilibrated culture medium to the cuvette and gently transfer the sample to the flask. 48 hours after transduction, extract genomic DNA from 5 x 105 cells for gene deletion screening. Amplify your gene of interest using the primers designed in step 3.2 with the Taq DNA polymerase kit. Form heteroduplex PCR amplicons for T7EI digestion and incubate the product for 30-60 minutes with a T7EI enzyme at 37°C. The T7EI assay is preferred for screening because it is fast, easy, and provides clean electrophoretic results compared to using the Surveyor assay. However, this method cannot detect insertions and deletions of <2 bases generated by non-homologous end joining (NHEJ) activity in Cas9 RNP experiments. Run the digested DNA on a 1.5% agarose gel at 110 V for 30 - 45 minutes, visualizing your gel every 15 minutes. Stimulate the remaining cells with mbIL21-expressing feeder cells at a 1:1 ratio. Five days after stimulation, extract RNA for gene expression levels using qPCR. Perform the Calcein assay as previously reported. Briefly, load target cells with calcein AM (in the example shown, 3 pg / mL / 1,000,000 DAOY cells were used). Prepare NK cells for cytotoxicity testing by resting them overnight in IL2 (100 IU / mL) plus or minus 10 ng / mL TGF-β solution. Perform the Calcein assay in the same cytokines as the overnight-rested NK cells. b) RESULTS: (1) EFFICIENCY of electroporation: To optimize 4D-Nucleofection of Cas9 / RNP electroporation, 16 different programs were tested with GFP transduction, non-targeting siRNA, and plasmid DNA into NK cells. Flow cytometry assays showed that EN-138 had the highest percentage of cell viability and transduction efficiency (35% live GFP-positive cells) for both particles. (Figure 1 & Figure 2). Interestingly, the efficiency of using this program for Cas9 / RNP electroporation was higher as a 60% decrease in TGFBR2 mRNA expression levels (Figure 5) was observed. (2) Mutation test Cas9 / RNP containing gRNA2, gRNA1+gRNA2 and gRNA3 had successful knockdown of the TGFBR2 ectodomain gene, but single gRNA1 did not create a detectable indel T7E1 (Figure 3). In addition, Figure 4 shows successful knockdown of Human HPRT1 (hypoxanthine phosphoribosyltransferase 1) in human NK cells developed using commercially provided gRNA. (3) Test gene expression levels As a representative result, Figure 5 shows the effect of Cas9 / RNP (gRNA1+gRNA2) on mRNA production levels of the TGFBR2 ectodomain, analyzed by RT-PCR. As seen in the graph, mRNA expression levels of the targeted gene were significantly decreased. (4) Cytotoxicity As shown in Figure 6, after incubation of gRNA1+gRNA2, gRNA2 and gRNA3 Cas9 / RNP modified cells with TGFB, co-cultured with DAOY cells, the modified cells did not show a significant decrease in their cytotoxicity levels compared to the control group that had IL-2 in the medium overnight. These results indicate that Cas9 / RNP modified cells retain their cytotoxic function in the presence of TGFB and indicate that the modified cells are resistant to TGFB. (5) RNA sequence analysis RNA sequencing analysis in naive and developing NK cells highlights active DNA repair and replication machinery in IL-21-promoting NK cells. This suggests that developing NK cells may be more open to genetic manipulation using the Cas9 / RNP system. c) DISCUSSION: Cas9-mediated genome engineering has revolutionized experimental and clinical medicine. Using this technique in T cells has been successful, but DNA-dependent modification of NK cells has been challenging. In the CRISPR / Cas9 system, the DNA vector carrying the coding sequence for the sgRNA is under the control of the U6 or H1 stimulator, as the resulting transcription process is required or desired. DNA-dependent transgene delivery, such as lentivirus and retrovirus transfection, is poorly managed due to the substantial NK cell apoptosis associated with the procedure, which limits the production efficiency of genetically engineered NK cells. Therefore a synthetically formed ribonucleoprotein (RNP) complex and Cas9 protein were introduced as purified proteins into primary and developing NK cells. This method allows for the removal of capping, waste products, and other transcriptional and translational processes initiated by RNA polymerase II that can lead to substantial procedure-related NK cell apoptosis as thought to occur in DNA-dependent transduction methods. In addition, the method reported here utilizes purified Cas9 protein, enhancing on-target effects and reducing off-target effects because Cas9 / RNP is active immediately after electroporation and rapidly degraded, providing an improvement over current protocols. In summary, Cas9 / RNP can be used to genetically modify human primary and developing NK cells for cancer immunotherapy using the method described above. These results also demonstrate that successful knockdown of the TGFBR2 ectodomain gene renders these modified NK cells TGFB-resistant. Combining RNP delivery with a source of DNA template (such as a naturally recombinogenic adeno-associated virus (AAV) donor vector) can enable site-specific gene insertion by homologous recombination. Example 2: suppressor of cytokine signaling 3 (SOCS3) Genetic modification of NK cells to enhance cancer immunotherapy has potential applications in the treatment of various cancers. Recently, a novel strategy was developed in which CRISPR / Cas9 elements were introduced into NK cells as ribonucleoproteins (RNPs) via electroporation, followed by expansion of feeder cells expressing 4-1BBL and membrane-bound IL-21 to generate large numbers of genetically modified NK cells. This method was used to genetically modify several genes in primary and expanded NK cells, including suppressor of cytokine signaling 3 (SOCS3). SOCS3 negatively regulates cytokine signaling through the JAK / STAT pathway. It was hypothesized that disrupting SOCS3 in primary NK cells using Cas9 / RNPs could maintain STAT3 signaling levels and subsequently enhance their proliferative and cytotoxic functions. gRNA was designed to target exon 2 (Figure 7) of the SOCS3 gene and electroporated along with Cas9 protein as Cas9 / RNP into primary NK cells using a Lonza 4D electroporator. Six different gRNA conditions were tested alone or in combination. NK cells in the control group were electroporated without Cas9 / RNP. After electroporation, cells were rested in culture medium supplemented with 100 IU of human IL-2 for 48 hours and then expanded using feeder cell irradiation. On day 7, equal numbers of cells were re-stimulated with feeder cell irradiation to test the effect of SOCS3 knockout on proliferation. Western blot was used to test the knockout efficacy at the protein level. Calcein and IncuCyte Zoom assays (Essen) were performed to measure cytotoxicity against two cancer cell lines, K562 and Daoy. The results showed a significant decrease in SOCS3 protein levels in 3 conditions (gRNA1, gRNA3 and gRNA1+gRNA3) compared to the control group. The relative normalized SOCS3 expression is shown in Figure 8. Calcein and IncuCyte zoom assays showed that modified SOCS3 KO NK cells could kill tumors more efficiently compared to the control in AML and Daoy cancer cell lines (Figures 9A, 9B, 9C, and 9D). gRNA 1 (G1) showed twice the killing of the negative control (NC). Specifically, NC showed 80% killing at 10:1 while G1 showed 80% killing at 5:1 (Figures 9B and 9D). Neuroblastoma cells were not killed at a faster rate in SOCS3 knockout (Figures 9C and 9D). Proliferation data showed that SOCS3 KO cells could grow faster compared to the control group (Figure 10). In conclusion, the data demonstrate a role for SOCS3 and the JAK / STAT pathway in NK cell function and suggest that SOCS3 is a good target for genetic modification to enhance cancer immunotherapy using NK cells. Example 3: Generating CD38-KO NK cells to overcome fratricide and enhance ADCC Natural killer cells play a crucial role in targeting CD38-expressing multiple myeloma (MM) by the anti-CD38 monoclonal antibody daratumumab (DARA). To overcome NK cell fratricide in DARA therapy, NK cell knockdown using Cas9 / RNP was developed. Combination therapy in vivo demonstrated a significant increase in DARA-induced tumor cell killing (Figures 11 and 12). Example 4: AAVS1 This methodology is used to target the AAVS1 gene as a safe site for integration of all genes of interest including CAR and reporter genes into the genome of primary NK cells. ICE (Interference of CRISPR Edit) demonstrated high efficiency in targeting genes of interest using Cas9 / RNP. Targeting AAVS1 did not alter the cytotoxic effect of primary NK cells (Figure 13). gRNA used: GGGGCCACTAGGGACAGGAT (SEQ ID NO: 9) Example 5: Generating mCherry Positive primary NK cells as a proof of concept for CAR-NK production using Cas9 / RNP donor mCherry expressing primary human NK cells were generated using this approach. Subsequently, these modified primary NK cells were expanded by stimulating with irradiated mbIL21 expressing feeder cells and demonstrated stable expression of a reporter gene (Figures 14, 15, and 16). This confirmed the generation of primary and expanded CAR-NK cells. gRNA used: GGGGCCACTAGGGACAGGAT (SEQ ID NO: 9) Example 6: Testing off-target effects To identify off-target effects after using Cas9 / RNP in NK cells, whole genome sequencing of normal and modified NK cells (CD38-KO) was performed. WGS revealed no or very few (2 genes) off-targets based on the algorithm used to predict candidate genes. The list of candidate off-target genes generated by Benching.com was investigated for the gRNA used to target CD-38. (5' — CTGAACTCGCAGTTGGCCAT - 3' (SEQ ID NO: 11)) and did not reveal any off-target genes. (The list of candidate off-target genes is as shown in Table 6) PAM Sequence Gene Value Chromosome Strand Position Mismatch Correct Target CTGAACTCGCAGT TGGCCAT (SEQ ID NO: 12) AGG 100 ENSG0000 0004468 Chr4 -1 15778418 0 TRUE gRNA used to target CD38 CTGTGCGTGCAGT TGGCCAT (SEQ ID NO: 13) CAG 0.946 76556 4 chr12 -1 67239819 4 WRONG GTTAACTTACAGT TGGCCAT (SEQ ID NO: 14) AGG 0.945 46866 7 chr7 -1 46392546 4 WRONG TGGACCTCTCAGT TGGCCAT (SEQ ID NO: 15) AGG 0.942 28896 1 chr1 -1 11519575 6 4 FALSE CTGAACACTGAGT TGGCCAT (SEQ ID NO: 16) GGG 0, 932 63859 3 chr4 1 13597480 7 3 FALSE TTGAACTTGTAGT TGGCCAA (SEQ ID NO: 17) AAG 0.819 28327 1 chr4 -1 18768688 1 4 SALAH CCGACCTGGCAGT TGGCCCT (SEQ ID NO: 18) GGG 0.634 00423 7 ENSG0000 0115649 chr2 -1 21917338 1 4 SALAH CCCACCTCGCAGG TGGCCAT (SEQ ID NO: 19) CGG 0.632 2725 chr20 1 61651638 4 SALAH CCCACCTCGCAGG TGGCCAT (SEQ ID NO: 20) CGG 0.632 2725 chr20 1 61648949 4 SALAH CTCATCTGGCAGT TGGCCTT (SEQ ID NO: 21) GGG 0, 604 63217 2 chr8 -1 22092249 4 SALAH CCTAACTCCCAGT TGGCCAG (SEQ ID NO: 22) TGG 0,542 40677 9 chr1 -1 17578887 3 4 SALAH CTGTCTTCTCAGT TGGCCAT (SEQ ID NO: 23) GGG 0,520 51222 8 chr10 -1 99880660 4 SALAH CAGAAATGGCAGT TGGCCAG (SEQ ID NO: 24) GAG 0.519 51752 2 chr12 -1 11909563 6 4 SALAH ATGGACTCACATT TGGCCAT (SEQ ID NO: 25) CAG 0.512 40681 8 ENSG0000 0174720 chr4 -1 11264455 6 4 SALAH CTTCACTCCCAGT TGGTCAT (SEQ ID NO: 26) TGG 0.432 61379 2 chr13 -1 39496822 4 SALAH CTGGACTCCTATT TGGCCAT (SEQ ID NO: 27) AAG 0.419 71351 5 chrX 1 6970537 4 SALAH CTCAACGTGCAGC TGGCCAT (SEQ ID NO: 28) GAG 0.416 35002 4 ENSG0000 0100665 chr14 -1 94563541 4 SALAH TTGGACTCGCTGT TGGCCTT (SEQ ID NO: 29) GGG 0.382 09451 7 ENSG0000 0170291 chr17 1 7252571 4 SALAH TTGAACTGGCTGG TGGCCAT (SEQ ID NO: 30) CAG 0.369 64809 8 chr8 1 11820961 1 4 SALAH CTGACCTGTCAGC TGGCCAT (SEQ ID NO: 31) GGG 0.358 45875 chr6 -1 17050535 8 4 SALAH CAGAACCCACAGT TGGCCAC (SEQ ID NO: 32) AGG 0.358 34944 7 chr10 -1 31315629 4 SALAH CTGATGTCGCAGT TGTCCAT (SEQ ID NO: 33) GGG 0.334 54145 5 chr10 1 14397447 3 SALAH GTGAAGTCTCAGT TGGACAT (SEQ ID NO: 34) AGG 0.277 05187 8 chr5 1 66748005 4 SALAH CTGAGCTGGCAGA TGGACAT (SEQ ID NO: 35) CAG 0.261 47521 6 chr19 1 30385960 4 SALAH CTGAACTGGAAGG TGGCCAG (SEQ ID NO: 36) GAG 0.255 79448 6 chr6 -1 45577144 4 SALAH CTGAACTTGGAGC TGGCCAA (SEQ ID NO: 37) GGG 0.255 79448 6 chr10 -1 48635391 4 SALAH CTGAAGTCGAGGT TGGCCAC (SEQ ID NO: 38) AAG 0.230 85848 4 chr20 -1 1301156 4 SALAH CTGACGTCCCAGG TGGCCAT (SEQ ID NO: 39) GAG 0.220 62282 6 chr12 -1 8382561 4 SALAH CTGCAATCACAGT TGGCCCT (SEQ ID NO: 40) AGG 0.219 48265 6 chr6 -1 16903564 8 4 SALAH CAGAACATGCAGT TGTCCAT (SEQ ID NO: 41) GAG 0.210 30565 3 chr12 -1 83067661 4 SALAH CTCAACTCCCTGG TGGCCAT (SEQ ID NO: 42) GGG 0,208 58576 8 chr18 1 45200028 4 SALAH CTGAAGCTCCCTGC TGGCCAT (SEQ ID NO: 44) GGG 0,200 65228 5 chr1 1 11638036 4 4 SALAH TTGAGCTCCCAGT TGCCCAT (SEQ ID NO: 45) AAG 0.200 20869 chr12 1 45093567 4 SALAH CTGAAATGGCTGA TGGCCAT (SEQ ID NO: 46) AAG 0.195 32860 6 chr5 1 17724691 8 4 SALAH CTGAATGCACAGT TGGCCAA (SEQ ID NO: 47) TGG 0.190 38906 chr4 -1 93982926 4 SALAH CTGACCTCCCAGA TGGCCAC (SEQ ID NO: 48) CAG 0.187 84580 3 chr8 -1 10268566 0 4 SALAH CTGAAATCCTAGT TGGCCCT (SEQ ID NO: 49) AGG 0, 186 36647 1 chr1 1 24015665 7 4 SALAH CTGGACTCCCACA TGGCCAT (SEQ ID NO: 50) CAG 0, 184 20000 3 chr16 -1 85987471 4 SALAH CTGATGTCGCACG TGGCCAT (SEQ ID NO: 51) GGG 0, 182 39116 5 chr5 -1 17200909 4 SALAH CTGAAACAGCAGT TAGCCAT (SEQ ID NO: 52) GAG 0, 172 27817 5 chr3 -1 67113967 4 SALAH CTGAAACCTCAGT TGGTCAT (SEQ ID NO: 53) CAG 0, 161 06249 8 chr5 1 15344039 5 4 SALAH CTGAACTAGTGGT TGGCAAT (SEQ ID NO: 54) GAG 0, 160 05111 2 chr1 -1 23488027 9 4 SALAH CAGAACTAGCAGT TGGTAAT (SEQ ID NO: 55) AAG 0, 157 20833 3 chr18 1 27784733 4 SALAH CTCAGCTCACAGT GGGCCAT (SEQ ID NO: 56) GAG 0, 151 55728 3 chr14 -1 10125195 8 4 SALAH CTCAAATGGCAGT GGGCCAT (SEQ ID NO: 57) CAG 0, 147 27701 4 chr5 1 78106566 4 SALAH CTGAACTGTGAGT TGTCCAT (SEQ ID NO: 58) GAG 0, 146 72911 5 chr22 1 27483121 4 SALAH CTGAACTGGAACT TGGCGAT (SEQ ID NO: 59) AGG 0, 143 16715 8 chr1 1 CTGAACTCCCAGT TGG 0, 122 chr20 -1 GGGCCAC (SEQ 04771 ID NO: 60) 5 CTGAACTTGAATT GAG 0, 119 ENSG0000 chr1 1 TGCCCAT (SEQ 16593 0175984 ID NO: 61) 7 20458993 2 4 SALAH 34536827 3 SALAH 11458348 1 4 SALAH Table 6: Target analysis: D. Referensi Alici, E., Sutlu, T. & Sirac Dilber, M. Retroviral gene transfer into primary human natural killer cells. Methods Mol Biol. 506 127-137, doi:10.1007 / 978-1-59745-409-4_10, (2009). Carlsten, M. & Childs, R.W. Genetic Manipulation of NK Cells for Cancer Immunotherapy: Techniques and Clinical Implications. Front Immunol. 6 266, doi:10.3389 / fimmu.2015.00266, (2015). Chmielecki, J. et al. Genomic Profiling of a Large, Diverse Set of Pediatric Cancers Identified Known and Novel Mutations Across the Tumor Spectrum. Cancer Res. 77 (2), 509-519, doi:10.1158 / 0008-5472.can-16-1106, (2017). DeWitt, MA, Corn, JE & Carroll, D. Genome editing through delivery of the Cas9 ribonucleoprotein. Methods. 121122 9-15, (2017). Eyquem, J. et al. Targeting a CAR to the TRAC locus with CRISPR / Cas9 enhances tumor rejection. Nature. 543 (7643), 113-117, doi:10.1038 / nature21405, (2017). Guven, H. et al. Efficient gene transfer into primary human natural killer cells by retroviral transduction. Exp Hematol. 33 (11), 1320-1328, doi:10.1016 / j.exphem.2005.07.006, (2005). Kim, S., Kim, D., Cho, S.W., Kim, J. & Kim, J.S. Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoprotein. Genome Res. 24 (6), 1012-1019, doi:10.1101 / gr.171322.113, (2014). Lee, DA, Verneris, MR & Campana, D. Acquisition, preparation, and functional assessment of human NK cells for adoptive immunotherapy. Methods Mol Biol. 651 61-77, doi:10.1007 / 978-1-60761-786-0_4, (2010). Liang, X. et al. Rapid and highly efficient mammalian cell engineering through Cas9 protein transfection. J Biotechnol. 208 4453, doi:10.1016 / j.jbiotec.2015.04.024, (2015). Liang, Z. et al. Efficient DNA-free genome editing of bread wheat using the CRISPR / Cas9 ribonucleoprotein complex. Nat Commun. 8 14261, doi:10.1038 / ncomms14261, (2017) . Mehta, RS & Rezvani, K. Chimeric Antigen Receptor Expressing Natural Killer Cells for Cancer Immunotherapy. Front Immunol. 9 283, doi:10.3389 / fimmu.2018.00283, (2018). Rezvani, K., Rouce, R., Liu, E. & Shpall, E. Engineering natural killer cells for cancer immunotherapy. Mol Ther. 25 (8), 1769-1781, doi:10.1016 / j.ymthe.2017.06.012, (2017). Schultz, L.M., Majzner, R., Davis, K.L. & Mackall, C. New developments in immunotherapy for pediatric solid tumors. Curr Opin Pediatr. 30 (1), 30-39, doi:10.1097 / mop.0000000000000564, (2018). Somanchi, SS, Senyukov, VV, Denman, CJ & Lee, DA Expansion, purification, and functional assessment of human peripheral blood NK cells. J Vis Exp. (48), doi:10.3791 / 2540, (2011). Sutlu, T. et al. Inhibition of intracellular antiviral defense mechanisms enhances lentivirus transduction of human natural killer cells: implications for gene therapy. Hum Gen Ther. 23 (10), 1090-1100, doi:10.1089 / hum.2012.080, (2012). Viel, S. et al. TGF-beta inhibits the activation and function of NK cells by suppressing the mTOR pathway. Sci Signal. 9 (415), ra19, doi:10.1126 / scisignal.aad1884, (2016). Vouillot, L., Thelie, A. & Pollet, N. Comparison of the T7E1 cleavage and surveyor mismatch assays for detecting mutations induced by engineered nucleases. G3 (Bethesda). 5 (3), 407-415, doi:10.1534 / g3.114.015834, (2015). Wang, M. et al. Efficient delivery of genome-editing proteins using naturally occurring reducible lipid nanoparticles. Proc Natl Acad Sci USA. 113 (11), 2868-2873, doi:10.1073 / pnas.1520244113, (2016). Zuris, JA et al. Cationic lipid-mediated delivery of proteins enables efficient 5-protein-based genome editing in vitro and in vivo. Nat Biotechnol. 33 (1), 73-80, doi:10.1038 / nbt.3081, (2015).

Claims

Claim 1. A method of genetically modifying NK cells comprising a) generating a guide RNA (gRNA) specific for a DNA target sequence; and b) introducing via electroporation into a target NK cell a ribonucleoprotein (RNP) complex comprising a class 2 CRISPR / Cas endonuclease (Cas9) complexed with an appropriate CRISPR / Cas guide RNA that hybridizes to a target sequence in the genomic DNA of the NK cell.

2. The method of claim 1, wherein the genome of the NK cell is modified by inserting or deleting one or more base pairs, by inserting a heterologous DNA fragment (e.g., a donor polynucleotide), by deletion of an endogenous DNA fragment, by inversion or translocation of an endogenous DNA fragment, or a combination thereof.

3. The method of claim 1, wherein the NK cells are primary or expanded NK cells.

4. The method of claim 3, wherein the primary NK cells are incubated for 2, 3, or 4 days in the presence of IL-2 prior to electroporation.

5. The method of claim 3, wherein the primary NK cells are grown for 4 days in the presence of irradiated feeder cells prior to electroporation.

6. The method of claim 1, further comprising developing modified NK cells with irradiated mbIL-21 expressing feeder cells following electroporation.

7. The method of claim 1, wherein the method further comprises forming an RNP complex by diluting 36μΜ cas9 into a solution of 200μΜ crRNA and Kuar RNA.

8. An NK cell modified by the method of claim 1.

9. A genetically modified NK cell containing a gene encoding transforming growth factor-β receptor 2 (TGFBR2) or hypoxanthine phosphoribosyltransferase 1 (HPRT1).

10. A method for adoptively transferring engineered NK cells to a subject in need according to a method comprising a) generating a target NK cell to be modified; b) generating gRNA specific for a target DNA sequence; c) introducing via electroporation into the target NK cell, an RNP complex comprising a class 2 CRISPR / Cas endonuclease (Cas9) complexed with a suitable CRISPR / Cas guide RNA that hybridizes to a target sequence in the genomic DNA of the target NK cell creating an engineered NK cell; and d) transferring the engineered NK cell to the subject.

11. The method of claim 10, wherein the subject has cancer.

12. The method of claim 10, wherein the NK cell is a primary NK cell that has been modified in vivo and after modification is transferred into the subject.

13. The method of claim 10, wherein the NK cells are autologous NK cells.

14. The method of claim 10, wherein the NK cells are derived from an allogeneic donor source.

15. The method of claim 10, wherein the NK cells are expanded with irradiated mbIL-21 expressing feeder cells prior to administration to the subject.

16. The method of claim 10, wherein the NK cells are developed in the subject following transfer of the NK cells to the subject via administration of IL-21 or irradiation of mbIL-21 expressing feeder cells.

17. The method of claim 10, wherein the RNP complex targets the TGFRB2 or HPRT1 gene.

18. A method of treating cancer in a subject comprising administering to the subject an NK cell that has been modified to produce a knockout of the TGFBR2 gene.

Images