Ketone inhibitor compounds of lysine gingipain, compositions comprising same and uses thereof

IL265389A1Pending Publication Date: 2026-07-01LIGHTHOUSE PHARMACEUTICALS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
IL265389
Authority / Receiving Office
IL · IL
Patent Type
Applications
Current Assignee / Owner
Priority Date
2017-02-15
Filing Date
2017-09-15
Publication Date
2026-07-01
Estimated Expiration
2037-09-15

AI Technical Summary

Technical Problem

Current treatments lack effective inhibitors for Porphyromonas gingivalis lysine gingipain (Kgp) and methods for diagnosing and treating diseases associated with Kgp activity, which are necessary for managing periodontal disease, Alzheimer's, cardiovascular disease, and other disorders.

Method used

Development of compounds according to Formula I, which inhibit Kgp activity, and their use in pharmaceutical compositions for treating diseases, as well as methods for detecting Kgp activity in biological samples using reporter moieties.

Benefits of technology

The compounds effectively inhibit Kgp, preventing cell death and inflammation, and are useful in diagnosing and treating various diseases associated with P. gingivalis infection, including Alzheimer's and periodontal disease, by providing increased plasma and brain concentrations and reducing bacterial loads.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000236_0000
    Figure 00000236_0000
  • Figure 00000237_0000
    Figure 00000237_0000
  • Figure 00000237_0001
    Figure 00000237_0001
Patent Text Reader

Abstract

The present invention provides compounds according to Formula (I) as described herein, and their use for inhibiting the lysine gingipain protease (Kgp) from the bacterium Porphyromonas gingivalis. Also described are gingipain activity probe compounds and methods for assaying gingipain activity are also described, as well as methods for the treatment of disorders associated with P. gingivalis infection, including brain disorders such as Alzheimer's disease.
Need to check novelty before this filing date? Find Prior Art

Description

KETONE INHIBITORS OF LYSINE GINGIPAINCROSS-REFERENCES TO RELATED APPLICATIONS10001 J The present application claims priority to U.S. Provisional Pat. Appl. No.62 / 395,938, filed on September 16, 2016, and U.S. Provisional Pat. Appl. No. 62 / 459,456, filed on February 15, 2017, which applications are incorporated herein by reference in their entirety.BACKGROUND OF THE INVENTION10002 J Infection with the bacteria Porphyromonas gingivalis has been linked to the development of periodontal disease, Alzheimer's and other brain disorders, cardiovascular disease, diabetes, cancer, liver disease, kidney disease, preterm birth, arthritis, pneumonia and other disorders. P. gingivalis is an anaerobic asaccharoivtic gram-negative rod bacterium that is known to infect the oral cavity and translocate systemically into coronary arteries, aorta, placental tissue, the brain, the kidneys, and the liver. The bacterium has also been identified in cancerous tissues and a mechanism has been proposed by which gingipains can trigger immortalization and metastasis. See: Gandhimadhi, et al Journal of Indian Society of Periodontology. 2010; 14(2) :1 14-120; Liao, et al, Med Hypotheses, 2009. 72(6): 732-5; Byrne, et al , Oral Microbiol Immunol, 2009. 24(6): 469-77; Mahindra, et al. , J Maxillofac Oral Surg, 2009. 8(2): 108-13; Stelzel, et al , J Periodontal, 2002. 73(8): 868-70; Katz, et al. Journal of Dental Research, 2009. 88(6): 575-578; Poole, et al, J Alzheimers Dis, 2015, 43(1): 67-80; Islnkawa, et al, Biochim Biophys Acta, 2013. 1832(12): 2035-2043; Inaba, et al , Cellular Microbiology, 2014. 16(1): 131-145.

[0003] P. gingivalis produces proteases called gingipains, including Arginine Gingipain A (RgpA), Arginine Gingipain B (RgpB) and Lysine Gingipain (Kgp). Gingipains contribute to many functions of the organism including its survival and virulence. Gingipains can be secreted, transported to outer membrane surfaces of P. gingivalis, or released in outer membrane vesicles by the bacterium. Gingipains degrade a broad range of proteins (e.g., immunoglobulins, proteinase inhibitors, actin, and collagen) which can lead to cytoskeleton collapse and apoptosis in many types of cells, and inhibition of gingipains has been found to prevent P. gingivalis-mduced cell death. See: Travis, et al., Adv Exp Med Biol, 2000. 477:455-65; Sheets, et a!., Infect Immun, 2005. 73(3): 1543-52; Sheets, et al, Infect Immtin, 2006. 74(10): 5667-78; Stathopoulou, et al, BMC Microbiol, 2009. 9: 107. New compounds for the inhibition of gingipain activity and the treatment of diseases associated with gingipain activity and P. gingivalis infection are needed. In addition, compounds for the detection and quantification of gingipain activity are needed in order to effectively diagnose subjects infected with P. gingivalis, to identify new therapeutic agents, and to develop new methods for treating gingipain-mediated diseases. The present invention addresses these needs.BRIEF SUMMARY OF THE INVENTION

[0004] In a first embodiment, the invention provides compounds according to Formula I:or a pharmaceutically acceptable salt thereof, wherein:A is selected from -CH2- and -0-;RL Aand RIare each independently selected from hydrogen, Q-4alkyl, and an amine protecting group;and Rr are each independently selected from hydrogen, halogen, C1-4haloalkyl, and Ci-4haloalkoxy;selected from CVg cycloalkyl, C g alkyl, 3- to 12-membered heterocyclyl,Ce-io aryl, 5- to 12-membered heteroaryl, and a reporter moiety wherein R'' is optionally substituted with one or more R" asubstituents;each RJAis independently selected from halogen, -CN, -NO2, -N3, -OH, Q-4alkyl,C haloalkyl, C1.4alkoxy, C1-4haloalkoxy, -N(RC)2, -N"(RB)3, -(CH2)KC(0)R , -NRC(CH2)UC(0)RB, -0(CH2)UC(0)RB, -(CH2)KCONRCRC, -(CH2)KNRCC(0)RB, -NRC(CH2)TLCONRCRC,-NRC(CH2)LINRCC-(0)RB, -0(CH2)UCONRCRC, and -0(CH2)UNRCC(0)R , and optionally substituted triazolyl;each R is independently selected from Q.4alkyl, Ci_4haloalkyl, andCi-4deuteroalkyl;each RCis independently selected from hydrogen and Ci-8alkyl;each subscript k is independently selected from 0, 1 , 2, 3, 4, 5, and 6;each subscript u is independently selected from 1 , 2, 3, 4, 5, and 6;R4is selected from hydrogen and C1-4alkyl;R5is selected from -CH2R5a, -CHS(0)(R5b)2, and C,-6haloalkyl;R5ais selected from -O-R6, -S-R7, -SO-R7-S02-R7, -N(R8)2,5- to 12-membered heteroaryl, and 3- to 12-membered heterocyclyl, wherein 5- to 12-membered heteroaryl is optionally substituted with one or more members independently selected from halogen, C1- alkyl, and Ci-3 haloalkyl, and3- to 12-membered heterocyclyl is optionally substituted with one or more members independently selected from oxo, halogen, C1- alkyl, and Ci-3 haloalkyl;each R5bis independently selected Ci_6 alkyl;R6and R7are selected from phenyl, Q.6 alkyl, Ci- haloalkyl, and5- to 12-membered heteroaryl,wherein phenyl is substituted with 1-5 halogens, andwherein 5- to 12-membered heteroaryl is optionally substituted with one or more halogen, Ci-3 alkyl, or C1-3 haloalkyl;each R8is independently selected Ci_ alkyl; andR5optionally comprises a quenching moiety R9:provided that R5is other than 2,3,5,6-tetrafiuorophenoxymethyl.

[0005] In a related embodiment, the invention provides pharmaceutical compositions including one or more compounds of the invention and one or more pharmaceutically acceptable excipients.

[0006] In another embodiment, the invention provides methods for treating a disease or condition associated with P. gingivalis infection. The methods include administering an effective amount of a compound or a composition of the invention to a subject in need thereof. In some embodiments, brain disorder (e.g., Alzheimer's disease), periodontal disease, diabetes, a cardiovascular disease, arthritis, rheumatoid arthritis, osteoarthritis, infectious arthritis, psoriatic arthritis, elevated risk of preterm birth, pneumonia, cancer, a kidney disease, a liver disease, a retinal disorder, and glaucoma.

[0007] In another embodiment, the invention provides compounds comprising a reporter moiety and a gingipain-reactive moiety as well as method for detecting gingipain activity in a biological sample. The methods include: forming a mixture comprising the biological sample and a compound as described above under conditions sufficient for a gingipain to react with the gingipain reactive moiety of the compound; detecting the reporter moiety of the compound in the mixture; and determining that a gingipain is present in the biological sample when the reporter moiety is detected.BRIEF DESCRIPTION OF THE DRAWINGS

[0008] FIG. 1 shows that Kgp inhibitors of the invention protect SH-SY5Y neuroblastoma cells from P. gingivalis-'AvCQA cell death.

[0009] FIG. 2 shows that Kgp inhibitors of the invention prevent hemoglobin breakdown and acquisition of iron, a key survival-enhancing mechanism of P. gingiva lis.

[0010] FIG. 3 shows that compounds of the invention provide increased plasma concentrations in mice.

[0011] FIG. 4 shows that compounds of the invention provide increased free brain concentrations in mice.

[0012] FIG. 5A shows that activity probes of the invention are useful for characterization of bacterial smears. A bacterial smear of P. gingivalis exposed to activity probe 15a or 38a can be detected by fluorescence microscopy. The signal is dependent on the presence of Kgp and is not detected in a bacterial smear of P. gingivalis W83 strain with a knockout of the Kgp gene.

[0013] FIG. 5B shows that activity probes of the invention are useful for characterization of tissue shces. A gingival tissue slice from a patient with periodontal disease is stained with immunofluorescence agent CAB 102, a polyclonal antibody to Kgp. A separate sequential tissue section yields a fluorescence signal after incubation with the activity probe 15a.

[0014] FIG. 6A shows a fluorescence image of an SDS-PAGE gel containing samples from human Jurkat cells with or without infection by P. gingivalis W83. Samples were reacted with fluorescent probe 15a or non-fluorescent Kgp inhibitor compound 73 (A-[7- amino-2-oxo- 1 -(2 ,3 ,5 ,6-tetrafluorophenoxy)heptan-3-yl]cyclopentanecarboxamide) prior to SDS-PAGE. Lane 1 : cells only. Lane 2: cells + probe 15a. Lane 3 : cells ÷ probe 15a, P.gingivalis multiplicity of infection (MOI): 100. Lane 4: cells ÷ pre-incubation with compound 73 followed by probe 15a, MOI: 100. Lane 5: cells + probe 15a, MOI: 10. Lane 6: cells + pre-incubation with compound 73 followed by probe 15a, MOI: 10. Lane 7: purified Kgp + probe 15a. Lane 8: purified Kgp + lysis buffer without probe 15a.

[0015] FIG. 6B shows a fluorescence image of an SDS-PAGE gel containing titrated amounts of P. gingivalis W83. Lane A: 10' colony forming units (CFU); Lane B: 106CFU; Lane C: 105CFU; Lane D: 104CFU; Lane E: 103CFU; Lane F: 102CFU: 10; Lane G: purified Kgp. The titrated fluorescence data can be used to quantify P. gingivalis infection in biological samples.

[0016] FIG. 7 shows fluorescence microscope imaging of buccal cells, obtained from the oral cavity of human subjects, incubated with activity probe 15a and analyzed for activity probe binding. Punctate staining with activity probe 15a indicates the presence of Kgp in some cells. The left image shows this punctate staining whereas the cells in the right panel show cells that do not stain with the probe and are presumed to be uninfected with P.gingivalis. The blue dye is a DAPI stain for cell nuclei.

[0017] FIG. 8 shows that biotin activity probe 51a can be used to covalently label Kgp in P. gingivalis lysates for subsequent binding of labeled Kgp to streptavidin beads. After release from the beads, labeled Kgp was analyzed by SDS-PAGE and detected on a Western blot with the polyclonal Kgp antibody CAB 102. Kgp was pulled-down via this method and detected from at least lO6CFU of P. gingivalis. Lane 1 : purified Kgp. Lane 2: P. gingivalis W83, 102CFU. Lane 3: W83, 104CFU. Lane 4: W83, 106CFU. Lane 5: Kgp knockout strain, 106CFU. Lane 6: probe 51a only.

[0018] FIG. 9A shows the visualization of P. gingivalis W83 lysate and a P. gingivalis Kgp knockout strain lysate by SDS-PAGE following incubation with probe compound 71.

[0019] FIG. 9B shows the visualization of P. gingivalis lysate by SDS-PAGE following incubation with probe compound 71 with or without pre-incubation with CAB 102 antibody- conjugated beads.

[0020] FIG. 9C shows the analysis of labeled P. gingivalis W83 lysate by SDS-PAGE and Cy5 signal visualization (top panel) or Western blot with detection by CAB 102 primary antibody and chemiluminescent detection (bottom panel).

[0021] FIG. 10 shows alveolar bone loss in mice infected with P. gingivalis, with or without treatment with Compound 1.

[0022] FIG. 11 shows a reduction of P. gingivalis DNA in the brain tissue of infected mice upon treatment with Compound 1.

[0023] FIG. 12 shows a reduction in hippocampal neuron loss in the brain tissue of infected mice upon treatment with Compound 1.DETAILED DESCRIPTION OF THE INVENTIONI. General

[0024] The present invention provides potent compounds for inhibiting P. gingivalis lysine gingipain (Kgp). The invention is based in part on the surprising discovery that certain mhibitors exhibit increased selectivity for Kgp over endogenous proteases such as cathepsins, while also exhibiting activity that is comparable to previously known compounds.Furthermore, compounds of the invention provide improved pharmacokinetic properties when compared with previously known compounds. The compounds can be used to prevent cell death, inflammation, and other pathological processes in a variety of diseases associated with / 5, gingivalis infection, including aging-related conditions such as Alzheimer's disease.II. Definitions

[0025] As used herein, the terms Porph romonas gingivalis" and "P. gingivalis'' refer to the gram-negative asaccharolytic bacterium that is recognized as a key causative microbe in the pathogenesis of periodontitis and related conditions. "P. gingivalis infection" refers to the invasion and colonization of P. gingivalis in a bodily tissue such as the gums or the brain. P. gingivalis infection is frequently characterized by subsequent tissue injury and disease.

[0026] As used herein, the term "gingipain" refers to cysteine proteases expressed by P. gingivalis having trypsin-like specificity (i.e., Lys-Xaa and Arg-Xaa). Gingipains are recognized as the major virulence factors of P. gingivalis and contribute to bacterial attachment and colonization, nutrient acquisition, evasion of host defenses, and tissue invasion. The terms "arginine gingipain" and "Rgp" are used interchangeably to refer to the P. gingivalis arginine-specific gingipains RgpA and RgpB, classified under EC number EC 3.4.22.37. The rgpA and rgpB gene-translation products, RgpA and RgpB, share a caspase-like protease domain (specific for Arg-Xaa peptide bonds) and an immunoglobulin-like domain. In RgpA, the protease and immunoglobulin-like domains are followed by a large C- terminal extension containing hemagglutinin- adhesin domains.

[0027] As used herein, the term "alkyl," by itself or as part of another substituent, refers to a straight or branched, saturated, aliphatic radical having the number of carbon atoms indicated. Alkyl can include any number of carbons, such as Ci-2, C1.3, Ci-4, Q.s, d-e, C1-7, Ci-s, Ci-9, Ci-io, C2-3, C2-4, C2-5, C2-6, C3-4, C3-5, C3-6, C4-5, C4-6 and C5-6. For example, C] -6alkyl includes, but is not limited to, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, hexyl, etc. Alkyl can also refer to alkyl groups having up to 20 carbons atoms, such as, but not limited to heptyl, octyl, nonyl, decyl, etc. Alkyl groups can be substituted or unsubstituted. Unless otherwise specified, "substituted alkyl" groups can be substituted with one or more groups selected from halo, hydroxy, amino, alkylamino, amido. acyl, nitro, cyano, and alkoxy.

[0028] As used herein, the term "alkoxy," by itself or as part of another substituent, refers to a group having the formula -OR, wherein R is alkyl.

[0029] As used herein, the term "cycloalkyl," by itself or as part of another substituent, refers to a saturated or partially unsaturated, monocyclic, fused bicvclic or bridged polycyclic ring assembly containing from 3 to 12 ring atoms, or the number of atoms indicated.Cycloalkyl can include any number of carbons, such as Cs-g, C4-6, C5-6, C3-&, C4-8, C5.8, Ces, C3-9, C3-10, C3.11, and C3-12. Saturated monocyclic cycloalkyl rings include, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and cyclooctyl. Saturated bicvclic and polycyclic cycloalkyl rings include, for example, norbornane, [2.2.2] bicyclooctane, decahydronaphthalene and adamantane. Cycloalkyl groups can also be partially unsaturated, having one or more double or triple bonds in the ring. Representative cycloalkyl groups that are partially unsaturated include, but are not limited to, cyclobutene, cyclopentene, cyclohexene, cyclohexadiene (1 ,3- and 1,4- isomers), cycloheptene, cycloheptadiene, cyrclooctene, cyclooctadiene (1,3-, 1 ,4- and 1 ,5-isomers), norbornene, and norbornadiene. When cycloalkyl is a saturated monocyclic C3..8 cycloalkyl, exemplary groups include, but are not limited to cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl. When cycloalkyl is a saturated monocyclic C3-6 cycloalkyl, exemplary groups include, but are not limited to cyclopropyl, cyclobutyl, cyclopentyl, and cyclohexyl. Cycloalkyl groups can be substituted or unsubstituted. Unless otherwise specified, "substituted cycloalkyl" groupscan be substituted with one or more groups selected from halo, hydroxy, amino, alkylamino, amido, acyl, nitro, cyano, and aikoxy. The term "lower cycloalkyl" refers to a cycloalkyl radical having from three to seven carbons including, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and cycloheptyl.

[0030] As used herein, the term "alkylene" refers to an alkyl group, as defined above, linking at least two other groups (i.e., a divalent alkyl radical). The two moieties linked to the alkylene group can be linked to the same carbon atom or different carbon atoms of the alkylene group. The term "cycloalkylene" refers to a cycloalkyl group, as defined above, linking at least two other groups (i.e., a divalent cycloalkyl radical). The two moieties linked to the cycloalkylene group can be linked to the same carbon atom or different carbon atoms of the cycloalkylene group.

[0031] As used herein, the term "alkylthio," by itself or as part of another substituent, refers to a group having the formula -S , wherein R is alkyl.

[0032] As used herein, the term "heteroalkyl," by itself or as part of another substituent, refers to an alkyl group of any suitable length and having from 1 to 3 heteroatoms such as N,O and S. For example, heteroalkyl can include ethers, thioethers and alkyl-amines.Additional heteroatoms can also be useful, including, but not limited to, B, Al, Si and P. The heteroatoms can be oxidized to form moieties such as, but not limited to, -S(O)- and -S(0)2-.The heteroatom portion of the heteroalkyl can replace a hydrogen atom of the alkyl group to form a hydroxy, thio or amino group. Alternatively, the heteroatom portion can be the connecting atom, or be inserted between two carbon atoms.

[0033] As used herein, the term "heteroalkyiene" refers to a heteroalkyl group, as defined above, linking at least two other groups (i.e., a divalent heteroalkyl radical). The two moieties linked to the heteroalkyiene group can be linked to the same atom or different atoms of the heteroalkyiene group. The term "heterocyciylene" refers to a cycloalkyl group, as defined above, linking at least two other groups (i.e., a divalent heterocyclyl radical). The two moieties linked to the heterocyciylene group can be linked to the same atom or different atoms of the heterocyciylene group.

[0034] As used herein, the terms "halo" and "halogen," by themselves or as part of another substituent, refer to a fluorine, chlorine, bromine, or iodine atom.

[0035] As used herein, the term "haloalkyl," by itself or as part of another substituent, refers to an alkyl group where some or all of the hydrogen atoms are replaced with halogen atoms. As for alkyl groups, haloalkyl groups can have any suitable number of carbon atoms, such as Ci-6. For example, haloalkyl includes trifluoromethyl, fluoromethyl, etc. In some instances, the term "perfluoro" can be used to define a compound or radical where all the hydrogens are replaced with fluorine. For example, perfluoromethyl refers to1,1 ,1 -trifluoromethyl.

[0036] As used herein, the term "haloalkoxy," by itself or as part of another substituent, refers to an alkoxy group where some or all of the hydrogen atoms are replaced with halogen atoms.

[0037] As used herein, the term "halocycloalkyl," by itself or as part of another substituent, refers to a cycloalkyl group where some or all of the hydrogen atoms are replaced with halogen atoms.

[0038] As used herein, the term "deuteroalkyl," by itself or as part of another substituent, refers to an alkyl group where some or all of the hydrogen atoms are replaced with deuterium atoms. As for alkyl groups, deuteroalkyl groups can have any suitable number of carbon atoms, such as Ci-e. In some instances, the term "perdeutero" can be used to define a compound or radical where all the hydrogens are replaced with deuterium.

[0039] As used herein, the term "aryl," by itself or as part of another substituent, refers to an aromatic ring system having any suitable number of carbon ring atoms and any suitable number of rings. Aryl groups can include any suitable number of carbon ring atoms, such as C6, C7, Cs, Cg, Cio, On, Ci2, Ci3, Ci4, Ci5or Ci6, as well as C6-!0, Ce-12, or C6-i4 · Aryl groups can be monocyclic, fused to form bicyclic (e.g., benzocyclohexyl) or tricyclic groups, or linked by a bond to form a biaryl group. Representative aryl groups include phenyl, naphthyl and biphenyl. Other aryl groups include benzyl, having a methylene linking group. Some aryl groups have from 6 to 12 ring members, such as phenyl, naphthyl or biphenyl. Other aryl groups have from 6 to 10 ring members, such as phenyl or naphthyl. Some other aryl groups have 6 ring members, such as phenyl. Aryl groups can be substituted orunsubstituted. Unless otherwise specified, "substituted aryl" groups can be substituted with one or more groups selected from halo, hydroxy, amino, alkylamino, amido, acyl, nitro, cyano, and alkoxy.

[0040] As used herein, the term "arylene" refers to an aryl group, as defined above, linking at least two other groups (i. e., a divalent aryl radical).

[0041] As used herein, the term "heteroaryl," by itself or as part of another substituent, refers to a monocyclic or fused bicyclic or tricyclic aromatic ring assembly containing 5 to 16 ring atoms, where from 1 to 5 of the ring atoms are a heteroatom such as N, O or S.Additional heteroatoms can also be useful, including, but not limited to, B, Al, Si and P. The heteroatoms can be oxidized to form moieties such as, but not limited to, -S(O)- and -8(0 ):-. Heteroaryl groups can include any number of ring atoms, such as C5.6, Cs-s, C4-8,C3.9,€3.10, C3.11, or C3.12, wherein at least one of the carbon atoms is replaced by a heteroatom. Any suitable number of heteroatoms can be included in the heteroaryl groups, such as 1, 2, 3, 4; or 5, or 1 to 2, 1 to 3, 1 to 4, 1 to 5, 2 to 3, 2 to 4, 2 to 5, 3 to 4, or 3 to 5. For example, heteroaryl groups can be C5-8 heteroaryl, wherein 1 to 4 carbon ring atoms are replaced with heteroatoms; or C5.S heteroaryl, wherei 1 to 3 carbon ring atoms are replaced with heteroatoms; or C5_6 heteroaryl, wherein 1 to 4 carbon ring atoms are replaced with heteroatoms; or C5.6 heteroaryl, wherein 1 to 3 carbon ring atoms are replaced with heteroatoms. The heteroaryl group can include groups such as pyrrole, pyridine, imidazole, pyrazole, triazole, tetrazole, pyrazine, pyrimidine, pyridazine, triazine (1 ,2,3-, 1,2,4- and 1,3,5-isomers), thiophene, furan, thiazole, isothiazole, oxazole, and isoxazole. The heteroaryl groups can also be fused to aromatic ring systems, such as a phenyl ring, to form members including, but not limited to, benzopyrroles such as indole and isoindole, benzopyridines such as quinoline and isoquinoline, benzopyrazine (quinoxaline), bcnzopyrimidinc (quinazoline), benzopyridazines such as phthalazine and cinnoline, benzothiophene, and benzo uran. Other heteroaryl groups include heteroaryl rings linked by a bond, such as bipyridine. Heteroaryl groups can be substituted or unsubstituted. Unless otherwise specified, "substituted heteroary l" groups can be substituted with one or more groups selected from halo, hydroxy, amino, alkylamino, amido, acyl, nitro, cyano, and alkoxy.

[0042] The heteroaryl groups can be linked via any position on the ring. For example, pyrrole includes 1-, 2- and 3-pyrrole, pyridine includes 2-, 3- and 4-pyridine, imidazole includes 1-, 2-, 4- and 5-imidazole, pyrazole includes 1-, 3-, 4- and 5-pyrazole, triazole includes 1-, 4- and 5-triazole, tetrazole includes 1- and 5-tetrazole, pyrimidine includes 2-, 4-, 5- and 6- pyrimidine, pyridazine includes 3- and 4-pyridazine, 1 ,2,3-triazine includes 4- and 5-triazine, 1,2,4-triazine includes 3-, 5- and 6-triazine, 1 ,3,5-triazine includes 2-triazine, thiophene includes 2- and 3-thiophene, furan includes 2- and 3-furan, thiazole includes 2-, 4-and 5-thiazole, isothiazole includes 3-, 4- and 5 -isothiazole, oxazole includes 2-, 4- and 5- oxazole, isoxazole includes 3-, 4- and 5-isoxazoie, indole includes 1-, 2- and 3-indole, isoindole includes 1- and 2-isoindole, quinoline includes 2-, 3- and 4-quinoline, isoquinoline includes 1-, 3- and 4-isoquinoline, quinazoline includes 2- and 4-quinoazohne, cinnoline includes 3- and 4-cinnoline, benzothiophene includes 2- and 3 -benzothiophene, and benzofuran includes 2- and 3-benzofuran.

[0043] Some heteroaryl groups include those having from 5 to 10 ring members and from 1 to 3 ring atoms including N, O or S, such as pyrrole, pyridine, imidazole, pyrazole, triazole, pyrazine, pyrimidine, pyridazine, triazine (1 ,2,3-, 1,2,4- and 1,3,5-isomers), thiophene, furan, thiazole, isothiazole, oxazole, isoxazole, indole, isoindole, quinoline, isoquinoline, quinoxaline, quinazoline, phthalazine, cinnoline, benzothiophene, and benzofuran. Other heteroaryl groups include those having from 5 to 8 ring members and from 1 to 3heteroatoms, such as pyrrole, pyridine, imidazole, pyrazole, triazole, pyrazine, pyrimidine, pyridazine, triazine (1,2,3-, 1,2,4- and 1 ,3,5-isomers), thiophene, furan, thiazole, isothiazole, oxazole, and isoxazole. Some other heteroaryl groups include those having from 9 to 12 ring members and from 1 to 3 heteroatoms, such as indole, isoindole, quinoline, isoquinoline, quinoxaline, quinazoline, phthalazine, cinnoline, benzothiophene, benzofuran and bipyridine. Still other heteroaryl groups include those having from 5 to 6 ring members and from 1 to 2 ring atoms including N, O or S, such as pyrrole, pyridine, imidazole, pyrazole, pyrazine, pyrimidine, pyridazine, thiophene, furan, thiazole, isothiazole, oxazole, and isoxazole.

[0044] Some heteroaryl groups include from 5 to 10 ring members and only nitrogen heteroatoms, such as pyrrole, pyridine, imidazole, pyrazole, triazole, pyrazine, pyrimidine, pyridazine, triazine (1,2,3-, 1 ,2,4- and 1,3,5-isomers), indole, isoindole, quinoline, isoquinoline, quinoxaline, quinazoline, phthalazine, and cinnoline. Other heteroaryl groups include from 5 to 10 ring members and only oxygen heteroatoms, such as furan and benzofuran. Some other heteroaiyl groups include from 5 to 10 ring members and only sulfur heteroatoms, such as thiophene and benzothiophene. Still other heteroaryl groups include from 5 to 10 ring members and at least two heteroatoms, such as imidazole, pyrazole, triazole, pyrazine, pyrimidine, pyridazine, triazine (1 ,2,3-, 1,2,4- and 1,3,5-isomers), thiazole, isothiazole, oxazole, isoxazole, quinoxaline, quinazoline, phthalazine, and cinnoline.

[0045] As used herein, the term "heteroarylene" refers to a heteroaryl group, as defined above, linking at least two other groups (i.e., a divalent heteroaryl radical).

[0046] As used herein the term "heterocyclyl," by itself or as part of another substituent, refers to a saturated ring system having from 3 to 12 ring members and from 1 to 4 heteroatoms of N, O and S. Additional heteroatoms can also be useful, including, but not limited to, B, Al, Si and P. The heteroatoms can be oxidized to form moieties such as, but not limited to, -S(O)- and -S(0)2-. Heterocyclyl groups can include any number of ring atoms, such as, Cs-e, C4-6, C5-6,€3.8, C4-s. C .s, C6-8,€3. , Cs-io, C3.11, or C3-12, wherein at least one of the carbon atoms is replaced by a heteroatom. Any suitable number of carbon ring atoms can be replaced with heteroatoms in the heterocyclyl groups, such as 1 , 2, 3, or 4, or 1 to 2, 1 to 3, 1 to 4, 2 to 3, 2 to 4, or 3 to 4. The heterocyclyl group can include groups such as aziridine, azetidine, pyrrolidine, piperidine, azepane, azocane, quinuclidine, pyrazolidine, imidazolidine, piperazine (1,2-, 1,3- and 1 ,4-isomers), oxirane, oxetane, tetrahydrofuran, oxane (tetrahydropyran), oxepane, thiirane, thietane, thiolane (tetrahydrothiophene), thiane (tetrahydrothiopyran), oxazolidine, isoxazolidine, thiazolidine, isothiazolidine, dioxolane, dithiolane, morpholine, thiomorpholine, dioxane, or dithiane. The heterocyclyl groups can also be fused to aromatic or non-aromatic ring systems to form members including, but not limited to, indoline. Heterocyclyl groups can be unsubstituted or substituted. Unless otherwise specified, "substituted heterocyclyl" groups can be substituted with one or more groups selected from halo, hydroxy, amino, oxo (=0), alkylamino, amido, acyl, nitro, cyano, and alkoxy.

[0047] The heterocyclyl groups can be linked via any position on the ring. For example, aziridine can be 1 - or 2-aziridine, azetidine can be 1- or 2- azetidine, pyrrolidine can be 1-, 2- or 3-pyrrolidine, piperidine can be 1-, 2-, 3- or 4-piperidine, pyrazolidine can be 1-, 2-, 3-, or 4-pyrazolidine, imidazolidine can be 1-, 2-, 3- or 4-imidazolidine, piperazine can be 1-, 2-, 3- or 4-piperazine, tetrahydrofuran can be 1- or 2-tetrahydrofuran, oxazolidine can be 2-, 3-, 4- or 5 -oxazolidine, isoxazolidine can be 2-, 3-, 4- or 5-isoxazolidine, thiazolidine can be 2-, 3-, 4- or 5-thiazolidine, isothiazolidine can be 2-, 3-, 4- or 5- isothiazolidine, and morpholine can be 2-, 3- or 4-morpho!inc.

[0048] When heterocyclyl includes 3 to 8 ring members and 1 to 3 heteroatoms, representative members include, but are not limited to, pyrrolidine, piperidine,tetrahydrofuran, oxane, tetrahydrothiophene, thiane, pyrazolidine, imidazolidine, piperazine, oxazolidine, isoxazolidine, thiazolidine, isothiazolidine, morpholine, thiomorpholine, dioxane and dithiane. Heterocyclyl can also form a ring having 5 to 6 ring members and 1 to 2 heteroatoms, with representative members including, but not limited to, pyrrolidine,piperidine, tetrahydiOfuran, tetrahydrothiophene, pyrazolidine, imidazolidine, piperazine, oxazolidine, isoxazolidine, thiazolidme, isothiazolidine, and morpholine.

[0049] As used herein, the term "amine protecting group" refers to a chemical moiety that renders an amino group unreactive, but is also removable so as to restore the amino group. Examples of amine protecting groups include, but are not limited to, benzyloxycarbonyl; 9-fluorenylmethyloxycarbonyl (Fmoc); / er -butyloxycarbonyl (Boc); allyloxycarbonyl (Alloc); / ^-toluene sulfonyl (Tos); 2,2,5,7,8-pentamethylchroman-6-sulfonyl (Pmc); 2,2,4,6,7- pen ta mcthyl-2 ,3-di hy drobcnzofu ran-5-su 1 fony 1 (Pbf); mesityl-2-sulfonyl (Mts); 4-methoxy- 2,3,6-trimethylphenylsulfonyl (Mtr); acetamido; phthalimido; and the like. Other amine protecting groups are known to those of skill in the art including, for example, those described by Green and Wuts (Protective Groups in Organic Synthesis, 4tnEd. 2007, Wiley- Interscience, New York).

[0050] As used herein, the term "carbonyl," by itself or as part of another substituent, refers to -C(O)-, i.e., a carbon atom double-bonded to oxygen and bound to two other groups in the moiety having the carbonyl.

[0051] As used herein, the term "amino" refers to a moiety -NR¾wherein each R group is H or alkyl. An amino moiety can be ionized to form the corresponding ammonium cation. "Dialky amino" refers to an amino moiety wherein each R group is alkyl.

[0052] As used herein, the term "sulfonyl" refers to a moiety -SO2R, wherein the R group is alkyl, haloalkyl, or aryl. An amino moiety can be ionized to form the corresponding ammonium cation. "Alkylsulfonyl" refers to an amino moiety wherein the R group is alkyl.

[0053] As used herein, the term "hydroxy" refers to the moiety -OH.

[0054] As used herein, the term "cyano" refers to a carbon atom triple-bonded to a nitrogen atom {i.e., the moiety -C≡N).

[0055] As used herein, the term "carboxy" refers to the moiety -C(0)OH. A carboxy moiety can be ionized to form the corresponding carboxylate anion.

[0056] As used herein, the term "amido" refers to a moiety -NRC(0)R or -C(0)NR2, wherein each R group is H or alkyl.

[0057] As used herein, the term "nitro" refers to the moiety -NO2.

[0058] As used herein, the term "oxo" refers to an oxygen atom that is double-bonded to a compound (i.e., 0=).

[0059] As used herein, the term "pharmaceutically acceptable excipient" refers to a substance that aids the administration of an active agent to a subject. By "pharmaceutically acceptable," it is meant that the excipient is compatible with the other ingredients of the formulation and is not deleterious to the recipient thereof. Pharmaceutical excipients useful in the present invention include, but are not limited to, binders, fillers, disintegrants, lubricants, glidants, coatings, sweeteners, flavors and colors.

[0060] As used herein, the term "salt" refers to acid or base salts of the compounds of the invention. Illustrative examples of pharmaceutically acceptable salts are mineral acid (hydrochloric acid, hydrobromic acid, phosphoric acid, and the like) salts, organic acid (acetic acid, propionic acid, glutamic acid, citric acid and the like) salts, quaternary ammonium (methyl iodide, ethyl iodide, and the like) salts. It is understood that the pharmaceutically acceptable salts are non-toxic.

[0061] Pharmaceutically acceptable salts of the acidic compounds of the present in vention are salts formed with bases, namely cationic salts such as alkali and alkaline earth metal salts, such as sodium, lithium, potassium, calcium, magnesium, as well as ammonium salts, such as ammonium, trimethyl-ammonium, diethylammonium, and tris-(hydroxymethyl)-methyl- ammoniuin salts.

[0062] Similarly acid addition salts, such as of mineral acids, organic carboxylic and organic sulfonic acids, e.g., hydrochloric acid, methanesulfonic acid, maleic acid, are also possible provided a basic group, such as pyridyl, constitutes part of the structure.

[0063] The neutral forms of the compounds can be regenerated by contacting the salt with a base or acid and isolating the parent compound in the conventional manner. The parent form of the compound differs from the various salt forms in certain physical properties, such as solubility in polar solvents, but otherwise the salts are equivalent to the parent form of the compound for the purposes of the present invention.

[0064] In addition to salt forms, the present invention provides compounds which are in a prodrug form. Prodrugs of the compoimds described herein are those compounds that readily undergo chemical changes under physiological conditions to provide the compounds of the present invention. Additionally, prodrugs can be converted to the compounds of the presentinvention by chemical or biochemical methods in an ex vivo environment. For example, prodrugs can be slowly converted to the compounds of the present invention when placed in a transdermal patch reserv oir with a suitable enzyme or chemical reagent.

[0065] As used herein, the term "gingipain reactive moiety" refers to a chemical functional group in a compound that reacts with a gingipain active site thiol so as to form a covalently modified gingipain, or to a chemical functional group in a compound that interacts with a gingipain so as to form a non-covalent gingipam / compound complex. Examples of gingipain reactive moieties include, but are not limited to, haloacetamide groups (including chloroacetamides and iodoacetamides), maleimide groups, benzothiazolyl-carbonyl groups, and phenoxymethyl groups (including halogenated phenoxymethyl groups).

[0066] As used herein, the term "reporter moiety" refers to a chemical functional group in compound that can be detected using techniques including, but not limited to, optical methods (e.g., fluorescence or UV-vis absorbance) and biochemical methods (e.g., with immunochemical reagent such as an antibody).

[0067] As used herein, the terms "treat," "treatment," and "treating" refer to any indicia of success in the treatment or amelioration of an injury, pathology, condition, or symptom (e.g., cognitive impairment), including any objective or subjective parameter such as abatement; remission; diminishing of symptoms or making the symptom, injury, pathology or condition more tolerable to the patient; reduction in the rate of symptom progression; decreasing the frequency or duration of the symptom or condition; or, in some situations, preventing the onset of the symptom. The treatment or amelioration of symptoms can be based on any objective or subjective parameter; including, e.g., the result of a physical examination.

[0068] As used herein the terms "effective amount" and "therapeutically effective amount" refer to a dose of a compound such as a Kgp inhibitor that produces therapeutic effects for which it is administered. The exact dose will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques (see, e.g., Lieberman, Pharmaceutical Dosage Forms (vols. 1-3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); Pickar, Dosage Calculations (1999); Goodman & Oilman 's The Pharmacological Basis of Therapeutics , 11thEdition, 2006, Brunton, Ed., McGraw-Hill; and Remington: The Science and Practice of Pharmacy, 21rtEdition, 2005, Hendrickson, Ed., Lippincott, Williams & Wilkins).

[0069] As used herein, the term "Alzheimer's disease" refers to a progressive disease of the central nervous system in humans and other mammals. It is manifested by dementia (especially in the elderly); disorientation; loss of memory; difficulty with language, calculation, or visual-spatial skills; and psychiatric manifestations. Alzheimer's disease is associated with progressive neurodegeneration and characteristic pathology, namely beta amyloid plaques and tau tangles.

[0070] As used herein, the term "osteoarthritis" refers to a chronic degenerative joint disease that results from breakdown of joint cartilage, synovial tissue, and underlying bone.

[0071] As used herein, the term "subject" refers to animals such as mammals, including, but not limited to, primates (e.g., humans), cows, sheep, goats, horses, dogs, cats, rabbits, rats, mice and the like.III. Inhibitors of Lysine Gingipain

[0072] The present invention provides compounds for inhibition of P. gingivalis. In a first embodiment, the invention provides compounds according to Formula I:or a pharmaceutically acceptable salt thereof, wherein:selected from -CH2- andRlaand R,bare each independently selected from hydrogen, C1-4alkyl, and an amine protecting group;and R2bare each independently selected from hydrogen, halogen, CM haloalkyl, and Ci-4haloalkoxy;RJis selected from C3-8cycloalkyl, C3-8alkyl, 3- to 12-membered heterocyclyl,Ce-io aryl, 5- to 12-membered heteroaryl, and a reporter moiety wherein R"is optionally substituted with one or more R1substituents;R 'ais independently selected from halogen, -CN, -NO2, -Nhaloalkyl, C alkoxy,CM haloalkoxy, -N(RC)2, -^(R )3, -(CH2)!fC(0)Rb, -NRc(CH2)uC(0)R ,-0(CH2,C(0)Rb, -(CH2)kCONRcRc, -(CH2)kNRcC(0)Rb, -NRc(CH2)uCONRcR\ -NRc(CH2)uNRcG(0)R , -0(CH2)uCONR¾c, and -0(CH2)uNRcC(0)Rb, and optionally substituted triazolyl;each Rbis independently selected from Ci_4 alkyl, G-4 haloalkyl, andG-4 deuteroalkyl;each Rcis independently selected from hydrogen and G-8 alkyl:each subscript k is independently selected from 0, 1, 2, 3, 4, 5, and 6;each subscript u is independently selected from 1, 2, 3, 4, 5, and 6;R4is selected from hydrogen and G-4 alkyl;R5is selected from -CH2R5a, -CHS(0)<¾5b)2, and C!-6haloalkyl;R5ais selected from -O-R6, -S-R7, -SO-R7,-S02-R7, -N(RS)2,5- to 12-membered heteroaryl, and 3- to 12-membered heterocyclyl, wherein 5- to 12-membered heteroaryl is optionally substituted with one or more members independently selected from halogen, G_3 alkyl, and Ci-3 haloalkyl and3- to 12-membered heterocyclyl is optionally substituted with one or more members independently selected from oxo, halogen, C1-3 alkyl, and G-3 haloalkyl;each RDis independently selected Ci_6 alkyl;R6and R' are selected from phenyl, G-6 alkyl, G_ haloalkyl, and5- to 12-membered heteroaryl,wherein phenyl is substituted with 1-5 halogens, andwherein 5- to 12-membered heteroaryl is optionally substituted with one or more halogen, G-3 alkyl, or G-3 haloalkyl;each Rsis independently selected G-6 alkyl; andR2optionally comprises a quenching moiety R9;provided that R~is other than 2,3,5,6-tetrafluorophenoxymethyl.In some embodiments:A is selected from -CH2- and -0-;R!aand Rlbare each independently selected from hydrogen, G-4 alkyl, and an amine protecting group;R2aand R2are each independently selected from hydrogen, halogen, G-4 haloalkyl, and G-4 haloalkoxy;R is selected from C3-8 cycloalkyl,€3.$. alkyl, Ce-io aryl, C5-12 heteroaryl, andC3- 12 heterocyclyl, wherein R3is optionally substituted with one or more R3asubstituents;each Rjais independently selected from halogen, -CN, -NO2, -N3, -OH, CM alkyl, Q.4 haloalkyl, Q.4alkoxy, C1-4haloalkoxy, -N(Rc)2,-(CH2)kC(0)Rh,-NRc(CH2) (0)Rb, -0(CH2)UC(0)R , -(CH2)kCONRcRc,-(CH2)kNRCC(0)Rb, -NRc(CH2)tlCONRcRc, -NRc(CH2)tlNRcC(0)Rb, -0(CH2)uCONRcRc, and -0(CH2)uNRcC(0)Rb, and optionally substituted triazolyl; each R is independently selected from CM alkyl, CM haloalkyl, andCi-4 deuteroalkyl;each Rcis independently selected from hydrogen and Ci-g alkyl;each subscript k is independently selected from 0, 1 , 2, 3, 4, 5, and 6;each subscript u is independently selected from I, 2, 3, 4, 5, and 6;R4is selected from hydrogen and C alkyl;R5is selected from Q-e haloalkyl and -CH2R~ a;R5ais selected from -O-R6, -S-R7, -SO-R7,-S02-R7, -N(R8)2, and C5-12 heteroaryl;R(is selected from phenyl, Ci-6 alkyl, Ci-6 haloalkyl, and C5-12 heteroaryl, wherein phenyl is substituted with 1 -5 halogens, andwherein C5.12 heteroaryl is optionally substituted with halogen or C-i-3 haloalkyl; R' is selected from phenyl, Q.6 alkyl, Ci-6 haloalkyl, and C5.12 heteroaryl, wherein phenyl is optionally substituted with 1-5 halogens, andwherein Cs-n heteroaryl is optionally substituted with halogen or d-3 haloalkyl; and each R8is independently selected Ci_ alkyl;provided that when R5is other than 2,3,5,6-tetrafluorophenoxymethyl.

[0074] Compounds of the invention can be prepared in protected form (i.e., compounds wherein at least one of Rlaand R!is an amine protecting group). A number of suitable protecting groups— as described, for example, by Green and Wuts (Protective Groups in Organic Synthesis, 4thEd. 2007, Wiley-Interscience, New York)— can be used. In some embodiments, Rldis H and Ribis selected from benzyloxycarbonyl; 9-fluorenylmethyl- oxycarbonvl; tert-butyloxycarbonyl; and allvloxycarbonyl. In some embodiments, Rlais H and RIis rt-butyloxycarbonyl. Compounds can also be prepared in alkylated form (i.e., compounds wherein at least one of R!aand Rlbis an alkyl group). One or both of Rland RIbcan be, for example, methyl, ethyl, «-propyl, isopropyl, «-butyl, or i-butyl.

[0075] In some embodiments, Rlaand R!are H; R'aand R2bare independently selected from hydrogen and fluoro; and A is -C¾-.

[0076] In some embodiments, Riaand R1are H; R2aand R'bare independently selected from hydrogen and fluoro; A is -CH2-; and R4is selected from hydrogen and Ci-4alkyl. In some such embodiments, R4is selected from hydrogen and methyl. In some such embodiments, R4is hydrogen.

[0077] In some embodiments, A is -CH2-: R"ais hydrogen; R2is hydrogen or fluoro; and Rlaand Rlare H. In some embodiments, A is -CH2-; R2ais hydrogen; Riis fluoro; and Rlaand Rlbare H.

[0078] In some embodiments, the invention provides compounds having a structure according to Formula la:and pharmaceutically acceptable salt thereof.

[0079] In some embodiments, the invention provides compound of Formula I or Formula la and pharmaceutically acceptable salts thereof, wherein R3is selected from C3.s cycloaikyL C3-8 alkyl, C6-!o aryl,€5-12 heteroaryl, and€3.12 heterocyclyl, each of which is optionally substituted with one or more Rasubstituents. For example, R3can be cyclopropyl, cyclobutyl, cyclopentyl, cyciohexyl, cycloheptyl, or cyclooctyl. R3can be n-propyl, isopropyl, H-butyl, isobutyl, sec-butyl, tert-but l, H-pentyl, branched pentyl, n-hexyl, branched hexyl, n-heptyl, branched heptyl, n-octyl, or branched octyl. In some embodiments, R3is selected from unsubstituted or substituted cyclobutyl, unsubstituted or substituted cyclopentyl, and unsubstituted or substituted cyciohexyl. In some embodiments, RJis unsubstituted or substituted isopropyl.

[0080] In some embodiments, R3is selected from unsubstituted or substituted phenyl and unsubstituted or substituted naphthyl. In some embodiments, R3is selected fromunsubstituted or substituted pyrrolyl, unsubstituted or substituted pyridinyl, unsubstituted or substituted imidazoiyl, unsubstituted or substituted pyrazolyl, unsubstituted or substitutedtriazolyl, unsubstituted or substituted pyrazinyl, unsubstituted or substituted triazinyl, imsubstituted or substituted indolyi, unsubstituted or substituted isoindolyl, and unsubstituted or substituted quinolinyl.

[0081] In some embodiments, R3is selected from cyclopentyl and phenyl, each of which is optionally substituted with one or more R',asubstituents. In some such embodiments, each R3ais independently selected from halogen, -N3, Ci_4 alkyl, C1-4 haloaikyl, Ci-4 alkoxy, Ci_ 4 haloalkoxy, and -NR C(0)R . In some embodiments, R"' is cyclopentyl.

[0082] In some embodiments, the invention provides compound of Formula I or Formula la and pharmaceutically acceptable salts thereof, wherein R' is selected from€3.8 alkyl, Cs-s cycloalkyl, Ce-io aryl,€ .12 heteroaryl, and C3.12 heterocyclyl, each of which is optionally substituted with one or more R3asubstituents. In some such embodiments, R3is selected from isopropyl, cyclopentyl, phenyl, pyridin-2-yl, pyridin-3-yl, and pyridin-4-yl, each of which is optionally substituted with one or more R,asubstituents. In some suchembodiments, each R3ais independently selected from halogen, -N3, Ci-4 alkyl,Ci-4 haloaikyl, Ci-4 alkoxy, C1-4 haloalkoxy, C1-4 alkoxy, C1-4 haloalkoxy, -N(RC)2, -N"(Rb)3, and -NRcC(0)R .

[0083] In some embodiments, R3is cyclopentyl. In some embodiments, R3is cyclopentyl and R5is selected from the substituents in embodiments (A), embodiments (B), embodiments (C), embodiments (D), embodiments (E), embodiments (F), embodiments (G), embodiments (H), embodiments (J), or embodiments (K) as set forth below.

[0084] In some embodiments, R3is C3-8 alkyl (e.g., 72-propyl, isopropyl, 72-butyl, isobutyl, sec-butyl, tert-b tyl, n-pentyl, and the like) substituted with Ci_4 alkoxy (e.g., methoxy, ethoxy, isopropoxy, iert-butoxy, and the like). In some embodiments, R is methoxypropyl. In some embodiments, R~is (2-methoxy)-propan-2-yl. In some embodiments, R" is (2- methoxy )propan-2-yi and R5is selected from the substituents in embodiments (A), embodiments (B), embodiments (C), embodiments (D), embodiments (E), embodiments (F), embodiments (G), embodiments (H), embodiments (J), or embodiments (K) as set forth below.

[0085] In some embodiments, R3is unsubstituted phenyl or R'' is phenyl substituted with one or more halogen, -N3, Ci-4haloalkoxy, and / or -NRcC(0)Rb. In some such embodiments, R5is selected from the substituents in embodiments (A), embodiments (B), embodiments (C),embodiments (D), embodiments (E), embodiments (F), embodiments (G), embodiments (H), embodiments (J), or embodiments (K) as set forth below.

[0086] In some embodiments, R3is unsubstituted pyridinyl (i.e., pyridin-2-yl, pyridin-3-yl, or pyridin-4-yl) or pyridinyl substituted with one or more halogen, -N(RC)2, and / or -N+(Rb)3. In some such embodiments, R5is selected from the substituents in embodiments (A), embodiments (B), embodiments (C), embodiments (D), embodiments (E), embodiments (F), embodiments (G), embodiments (H), embodiments (J), or embodiments (K) as set forth below.

[0087] Compounds containing azide groups (e.g., compounds wherein R 'ais -N3) can be modified with further functional groups via reaction with a complementary reaction partner such as an alkyne-bearing compound or a phosphine-bearing compound. Reaction of azides and alkynes via [3+2] cvcloaddition, commonly referred to as "click chemistry," can be used to install a variety of substituted triazole groups in the compounds of the invention.Accordingly, some embodiments of the invention provide compounds wherein linking moiety -L1- is an optionally substituted triazolyl moiety according to the formula:wherein the wavy line is point of connection to R3aand the dashed line is the point of connection to R,c.

[0088] In some embodiments, the linking moiety L3ahas a structure -LJ0-L3c-, wherein Ljband L3tare independently selected from a bond, a divalent polymer moiety, and linear or branched, saturated or unsaturated Ci-30 alkyl;wherein one or more carbon atoms in the Ci-3o alkyl are optionally and independently replaced by O, S, NR ;wherein two or more groupings of adjacent carbon atoms in the Ci-30 alkyl are optionally and independently replaced by -NRa(CO)- or -(CO)NRa-; andwherein two or more groupings of adjacent carbon atoms in the Ci-30 alkyl are optionally and independently replaced by a 4- to 8-membered, divalent carbocycle or a 4- to 8-membered, divalent heterocycle having one to four heteroatoms selected from O, S, and N:and wherein each Rais independently selected from H and Ci-6 alkyl.

[0089] In some embodiments, the functional group R3cis selected from a chromophore, a fluorophore, and a binding moiety {e.g., biotin, glutathione, and the like), as described in more detail below.

[0090] In certain embodiments, R' and the carbonyl to which it is bonded form a moiet other than a naturally-occurring amino acid residue (an L amino acid residue) or an isomer of a naturally-occurring amino acid residue (a D amino acid residue). In some embodiments, R3and the carbonyl to which it is bonded form a moiety other than asparaginyl, substituted asparaginyl, glutaminyl {i.e., a glutamine residue), substituted glutaminyl (i.e., a substituted glutamine residue), glutamyl (i.e., a glutamic acid residue), substituted glutamyl (i.e., a substituted glutamic acid residue), isoleucmyl, substituted isoleucmyl, ieucinyl, substituted leucinyl, lysinyl, substituted lysinyl, methioninyl, substituted methioninyl, prolinyl, substituted prolinyl, threoninyl, substituted threoninyl, valinyl, or substituted valinyl. The substituted amino acid residues may be present in larger peptide groups having two or more amino acid residues linked via amine bonds.

[0091] In some embodiments, the invention provides compounds of Formula I or Formula la and pharmaceutically acceptable salts thereof, wherein R4is hydrogen or methyl. In some such embodiments, R3is -CFkR5"1and R5ais selected from C5-12 heteroaryl and -O-R6. In some such embodiments, R5ais -O-phenyl wherein phenyl is substituted with 1-5 halogens. In some such embodiments, R4is hydrogen.

[0092] In some embodiments, R5ain compounds of Formula I or Formula la is selected from -S-R7, -SO-R7-SO2-R', C5-12heteroaryl, and -N-Rs. In some embodiments, R5ais selected from -O-R6, C5.12heteroaryl, and -N-R\ In some embodiments, RMis selected from -O-R6, -S-R7, -SO-R7-SO2-R7, and -N-Rs. In some embodiments, R5ais selected from -O-R6, -S-R7, -SO-R7-SO2-R7, and C5-12 heteroaryl.

[0093] In some embodiments (A), R5ain compounds of Formula I or Formula la is selected from Ci-6 haloalkoxy (i.e., -O-R6wherein R6is Ci-6 haloalkyl), Ci-6 alkylthio (i.e., -S-R7wherein R' is G-e alkyl), G-6 haloalkythio (i.e., -S-R' wherein R' is G-6 haloalkyl) ,Ci- 6 alkylsufonyl (i.e., -SO2-R' wherein R' is Ci-6 alkyl), (G-6 dialkyl)amino (i.e., -NR8),-i2heteroaryl, 3- to 12-membered heterocyclyl, -O-phenyl wherein phenyl is substituted with 1-5 halogens, and-S-phenyl wherein phenyl is optionally substituted with 1-5 halogens. In embodiments (A), R3can be any of the substituents or groups of substituents set forth above.

[0094] In some embodiments (B), Rain compounds of Formula I or Formula la is selected from Ci-6 alkoxy, Ci-6 alkylthio, Q-c, haloalkythio, Ci-e alkylsufonyl, (Ci-6 dialkyi)amino, C5-12 heteroaryl, 3- to 12-membered heterocyclyl, -O-phenyl wherein phenyl is substituted with 1 -5 halogens, and-S-phenyl wherein phenyl is optionally substituted with 1 -5 halogens. In embodiments (B), R3can be any of the substituents or groups of substituents set forth above.

[0095] In some embodiments (C), R5ain compounds of Formula I or Formula la is selected from Ci-6 alkoxy, Ci-6 haioaikoxy, Ci-6 haloalkythio, Ci-c, alkylsufonyl, (Ci-6 dialkyl)amino, C5_i2 heteroaryl, 3- to 12-membered heterocyclyl, -O-phenyl wherein phenyl is substituted with 1 -5 halogens, and-S-phenyl wherein phenyl is optionally substituted with 1 -5 halogens. In embodiments (C), R3can be any of the substituents or groups of substituents set forth above.

[0096] In some embodiments (D), R5ain compounds of Formula I or Formula la is selected from Ci-6 alkoxy, Ci-6 haioaikoxy, Ci-6 alkylthio, Ci-6 alkylsufonyl, (Ci-e dialkyl)amino, C5-12 heteroaryl, 3- to 12-membered heterocyclyl, -O-phenyl wherein phenyl is substituted with 1 -5 halogens, and-S-phenyl wherein phenyl is optionally substituted with 1 -5 halogens. In embodiments (D), R3can be any of the substituents or groups of substituents set forth above.

[0097] In some embodiments (E), R5ain compounds of Formula I or Formula la is selected from Ci-e alkoxy, Ci-6 haioaikoxy, Ci-6 alkylthio, Ci-β haloalkythio, (O-e dialkyl)amino,C5.12 heteroaryl, 3- to 12-membered heterocyclyl, -O-phenyl wherein phenyl is substituted with 1 -5 halogens, and-S-phenyl wherein phenyl is optionally substituted with 1 -5 halogens. In embodiments (E), RJcan be any of the substituents or groups of substituents set forth above.

[0098] In some embodiments (F), R5ain compounds of Formula I or Formula la is selected from Ci-e alkoxy, Ci-6 haioaikoxy, Ci-6 alkylthio, Ci-6 haloalkythio, Ci-e alkylsufonyl, C5-12 heteroaryl, 3- to 12-membered heterocyclyl, -O-phenyl wherein phenyl is substituted with 1 -5 halogens, and-S-phenyl wherein phenyl is optionally substituted with 1 -5 halogens. In embodiments (F), R3can be any of the substituents or groups of substituents set forth above.

[0099] In some embodiments (G), R5ain compounds of Formula I or Formula la is selected from Ci- alkoxy, Ci_ haioaikoxy, Q_6 alkylthio, Q-6 haloalkythio, Q.e alkylsufonyl, (Q.dialkyl)amino, 3- to 12-membered heterocyclyl, -O-phenyl wherein phenyl is substituted with 1-5 halogens, and-S-phenyl wherein phenyl is optionally substituted with 1-5 halogens. In embodiments (G), RJcan be any of the substituents or groups of substituents set forth above.

[0100] In some embodiments (H), R5ain compounds of Formula I or Formula la is selected from Ci-6 alkoxy, Q-6 haloaikoxy, Ci-6 alkyithio, Ci-6 haloalkythio, Ci-6 aikylsufonyl, (Ci_ 6 dialkyl)amino, C5.12 heteroaryl, 3- to 12-membered heterocyclyl, and-S-phenyl wherein phenyl is optionally substituted with 1-5 halogens. In embodiments (H), R3can be any of the substituents or groups of substituents set forth above.

[0101] In some embodiments (J), R5£1in compounds of Formula I or Formula la is selected from Ci-6 alkoxy, Q-6 haloaikoxy, Q-e alkyithio, Q-6 haloalkythio, C\. aikylsufonyl, (Ci_ 6 dialkyl)amino,€5.12 heteroaryl, 3- to 12-membered heterocyclyl, and -O-phenyl wherein phenyl is substituted with 1 -5 halogens. In embodiments (J), R' can be any of the substituents or groups of substituents set forth above.

[0102] In some embodiments (K), Rain compounds of Formula I or Formula la is selected from Cj-6 alkoxy, C e haloaikoxy, Ci-6 alkyithio, Q-6 haloalkythio, C c, aikylsufonyl, (Ci_ 6 dialkyl)amino,€5-12 heteroaryl, -O-phenyl wherein phenyl is substituted with 1 -5 halogens, and-S-phenyl wherein phenyl is optionally substituted with 1-5 halogens. In embodiments (K), R"1can be any of the substituents or groups of substituents set forth above.

[0103] In some embodiments, each halogen in Rais independently selected from F and CI. In some embodiments, each halogen in R5ais F.

[0104] In some embodiments, R5ais a moiety having the structure:wherein R5, R5c, R5d, R¾, and R5fare independently selected from hydrogen and halogen, and the wavy line represents the point of connection to the compound.

[0105] In some embodiments:R5cis halogen, R5dis H, R5eis H, R5fis H, and R5gis H; orR5cis H, R5dis halogen, R5eis H, R5fis H, and R5gis H; orR5cis H, R5dis H, R5eis halogen, R5fis H, and R5gis H; orR5cis H, R5dis H, R5eis H, R5fis halogen, and R5gis H; orR5cis H, R5dis H, R5eis H, R5fis H, and R5gis halogen; orR5cis halogen, R5dis halogen, R5eis H, R5fis H, and R5gis H; orR5cis halogen, R5dis H, R5eis halogen, R5fis H, and R5gis H; orR5cis halogen, R5dis H, R5eis H, R5fis halogen, and R5gis H; orR5cis halogen, R5dis H, R5eis H, R5fis H, and R5gis halogen; orR5cis H, R5dis halogen, R5eis halogen, R5fis H, and R5gis H; orR5tis H, R5dis halogen, R5eis H, R5fis halogen, and R5gis H; orR5cis H, R5dis halogen, R5eis H, R5fis H, and R5gis halogen; orR5cis H, R5dis H, R5eis halogen, R5fis halogen, and R5gis H; orR5cis H, R5dis H, R5eis halogen, R5fis H, and R5gis halogen; orR5cis H, R5dis H, R5eis H, R51is halogen, and R5gis halogen; orR5is halogen, R5dis halogen, R3eis halogen, R is H, and R5gis H; orR5cis halogen, R5dis halogen, R36is H, R3fis halogen, and R5gis H; orR" cis halogen, R5uis halogen, R,eis H, Rrfis H, and R5gis halogen; orR5is halogen, R'dis H, R5eis halogen, R5tis halogen, and R5sis H; orR=cis halogen, R3' is H, R5eis halogen, R5' is H, and R^8is halogen; orR5cis halogen, R5dis H, R5eis H, R5fis halogen, and RDgis halogen; orR5cis H, R5dis halogen, R?eis halogen, R is halogen, and R,gis H; orR5is H, R5dis halogen, R3eis halogen, R is H, and R5gis halogen; orR5cis H, R5dis halogen, R36is H, R3fis halogen, and R5gis halogen; orR" cis H, R~ dis H, R'eis halogen, R2fis halogen, and R5gis halogen; orR5is H, R5dis halogen, R5eis halogen, R5tis halogen, and R^ is halogen; orR=cis halogen, R3dis H, R5eis halogen, R5' is halogen, and R,gis halogen; orR5cis halogen, R5dis halogen, R5eis halogen, RSlis H, and RDgis halogen; orR5cis halogen, R5dis halogen, R5eis halogen, RSlis halogen, and R5gis H. e embodiments:R5cis F or CI, R5dis H, R5eis H, R5fis H, and R5gis H; orR5cis H, R5dis F or CI, R5eis H, R5fis H, and R5gis H; orR5cis H, R5dis H, R5eis F or CI, R5fis H, and R5gis H; orR5cis H, R5dis H, R5eis H, R5fis F or CI, and R5gis H; orR5cis H, R5dis H, R5eis H, R51is H, and R5gis F or CI; orR5cis F or CI, R5dis F or CI, R5eis H, R5fis H, and R5gis H; orR5cis F or CI, R5dis H, R5eis F or CI, R5fis H, and R5gis H; orR5cis F or Ci, R5dis H, R5eis H, R5fis F or Ci, and R5gis H; orR5cis F or CI, R5dis H, R5eis H, R5fis H, and R5gis F or CI; orR5cis H, R5dis F or CL R5eis F or CI, R5fis H, and R5gis H; orR5cis H, R5dis F or CL R5eis H, R5fis F or C , and R5gis H; orR5cis H, R5dis F or CI, R5eis H, R5fis H, and R5gis F or CI; orR5cis H, R5dis H, R5eis F or CL R5fis F or CI, and R5gis H; orR5cis H, R5dis H, R5eis F or CI, R5fis H, and R5gis F or CI; orR5cis H, R5dis H, R5eis H, R5fis F or CL and R5gis F or CI; orR5cis F or CI, R5dis F or CI, R5eis F or CI, R5fis H, and R5gis H; or R5cis F or CI, R5dis F or CL R5eis H, R5fis F or CL and R5gis H; or R5cis F or C , R5dis F or CL R5eis H, R5fis H, and R5gis F or CI; or R5cis F or CI, R5dis H, R5eis F or CI, R5fis F or CI, and R5gis H; or R5cis F or CI, R5dis H, R5eis F or CI, R5fis H, and R5gis F or CI; orR5cis F or CI, R5dis H, R5eis H, R5fis F or CI, and R5gis F or CI; or R5cis H, R5dis F or CI, R5eis F or CI, R5fis F or CI, and R5gis H; or R5cis H, R5dis F or CI, R5eis F or CI, Rsfis H, and R5gis F or CI; or R5cis H, R5dis F or CL R5eis H, R5fis F or CI, and R5gis F or CI; or R5cis H, R5dis H, R5eis F or Ci, R5fis F or C , and R5gis F or CI; orR5cis H, R5dis F or CI, R5eis F or CI, R5fis F or CI, and R5gis F or CI; or R5cis F or CI, R5dis H, R5eis F or CI, R5fis F or CI, and R5gis F or CI; or R5cis F or CI, R5dis F or CI, R5eis F or CI, R5fis H, and R5gis F or CI; or R5cis F or CI, R5dis F or CI, R5eis F or CI, R5fis F or CI, and R5gis H.

[0107] In some embodiments:R5cis F, R5dis H, R5eis H, R5iis H, and R5gis H; orR5cis H, R5dis F, R¾is H, R5fis H, and R5is H; orR5cis H, R5dis H, R5eis F, R5fis H, and R5gis H; orR5cis H, R5dis H, R5eis H, R5fis F, and R5gis H; orR5cis H, R5dis H, R5eis H, R5fis H, and R5gis F; orR5cis F, R5dis F, R5eis H, R5fis H, and R5gis H; orR5cis F, R5dis H, R5eis F, R5fis H, and R5gis H; orR5cis F, R5dis H, R5eis H, R5fis F, and R5gis H; orR5cis F, R5dis H, R5eis H, R5fis H, and R5gis F; orR5cis H, R5dis F, R5eis F, R5fis H, and R5gis H; orR5cis H, R5dis F, R5eis H, Rsfis F, and R5gis H; orR5cis H, R5dis F, R5eis H, R5fis H, and R5gis F; orR5cis H, R5dis H, R5eis F, R5fis F, and R5gis H; orR5cis Ft, R5dis H, R5eis F, R5fis Ft, and R5gis F; orRScis Ft, R5dis H, R5eis H, R5fis F, and R5is F; orR5cis F, R5dis F, R5eis F, R5fis H, and R5gis H; orR5cis F, R5dis F, R5eis H, R5fis F, and R5gis H; orR5cis F, R5dis F, RSeis H, R5fis H, and R5gis F; orR5cis F, R5dis Ft, R5eis F, R5fis F, and R5gis H; orR5cis F, R5dis H, R5eis F, R5fis Ft, and R5gis F; orR5cis F, R5dis FL R5eis FL R5fis F, and R5gis F; orRScis H, R5dis F, R5eis F, R5fis F, and R5gis H; orR5cis H, R5dis F, R5eis F, R5fis H, and R5gis F; orR5cis H, R5dis F, R5eis H, R5fis F, and R5gis F; orR5cis H, R5dis H, R5eis F, R5fis F, and R5gis F; orR5cis H, R5dis F, R5eis F, R5fis F, and R5gis F; orR5cis F, R5dis H, R5eis F, R5fis F, and R5gis F; orR5cis F, R5dis F, R5eis F, R5fis Ft, and R5gis F; orRScis F, R5dis F, R5eis F, R5fis F, and R5gis Ft.

[0108] In certain embodiments, RDais not 2,3,5,6-tetrafluorophenoxy.

[0109] In some embodiments, the invention provides compound of Formula I and pharmaceutically acceptable salts thereof, wherein R5ais selected from 2-fluorophenoxy; 3- fluorophenoxy; 4-fluorophenoxy; 2,3-difluorophenoxy; 2,4-difluorophenoxy; 2,5- difluorophenoxy; 2,6-difiuorophenoxy; 3,4-difluorophenoxy; 3,5-difluorophenoxy; 2,3,6- trifluorophenoxy; and 2,3,5-trifluorophenoxy. In some such embodiments, R5ais selected from 2-fluorophenoxy; 3 fluorophenoxy; 2,3-difluorophenoxy; 2,5-difiuorophenoxy: 2,6- difluorophenoxy; 3,5-difluorophenoxy: 2,3,6-trifluoi phenoxy; and 2,3,5-trifluorophenoxy. In some such embodiments, R"ais selected from 2,6-difluorophenoxy and 2,3,6- trifluorophenoxy.

[0110] In some embodiments, the invention provides compound of Formula la and pharmaceutically acceptable salts thereof, wherein R5ais selected from 2-fluorophenoxy; 3- fluorophenoxy; 4-fluorophenoxy; 2,3-difluorophenoxy; 2,4-difluorophenoxy; 2,5- difluorophenoxy; 2,6-difluorophenoxy; 3,4-difluorophenoxy; 3,5-difluorophenoxy; 2,3,6- trifluorophenoxy; and 2,3,5-trifluorophenoxy. In some such embodiments, RMis selected from 2-fluorophenoxy: 3 fluorophenoxy: 2,3-difluorophenoxy; 2,5-difluorophenoxy; 2,6- difluorophenoxy; 3,5-difluorophenoxy; 2,3,6-trifluorophenoxy; and 2,3,5-trifluorophenoxy. In some such embodiments, R5ais selected from 2,6-difluorophenoxy and 2,3,6- trifluorophenoxy.

[0111] In some embodiments, the invention provides compounds of Formula I or Formula la and pharmaceutically acceptable salts thereof, wherein R5ais selected from -N(R*)2, 5- to 12-membered heteroaryl, and 3- to 12-membered heterocyclyl,wherein - to 12-membered heteroaryl is optionally substituted with one or more members independently selected from halogen, Q-3 alkyl, and C1-3 haloalkyl, and3- to 12-membered heterocyclyl is optionally substituted with one or more members independently selected from oxo, halogen, Ci-3 alkyl, and Q-3 haloalkyl.

[0112] In some embodiments, RMis 5- to 12-membered heteroaryl or3- to 12-membered heterocyclyl. R33can be, for example, pyrrolyl, pyridinyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, pyrazinyl, triazinyl, indolyl, isoindolyl, or quinolinyl. In some embodiments, R"1is tetrazolyl (e.g., lH-tetrazol-l-yl or 2H-tetrazol-2-yl). In some embodiments, R5ais 6-oxopyrimidin-l(6H)-yl. In some embodiments, R,dis tetrazolyl or 6- oxopyrimidin- 1 (6H)-yl, and R3is selected from (2-methoxy)propan-2-yl, unsubstituted phenyl, phenyl substituted with one or more halogen, -N3, C1.4 haloalkoxy,and / or -NRcC(0)Rb, unsubstituted pyridinyl, and pyridinyl substituted with one or more halogen, -N(RC)2, and / or -N+(Rb)3.

[0113] In some embodiments, R5ais -N(R8)2, wherein each R8is independently selected Ci-6 alkyl. In such embodiments, each R8can independently be, e.g., methyl, ethyl, w-propyl, isopropyl, «-butyl, isobutyl, sec-butyl, ferf-butyl, «-pentyl, isopentyl, or «-hexyl. In some embodiments, R5ais dimethylamino. In some embodiments, R" ais dimethylamino and R3is selected from (2-methoxy)propan-2-yL unsubstituted phenyl, phenyl substituted with one or more halogen, -N3, C1.4 haloalkoxy, and / or -NRcC(0)Rb, unsubstituted pyridinyl, and pyridinyl substituted with one or more halogen, -N(RC)2, and / or -N^(R )3.

[0114] In some embodiments, R5Ais -O-R6, wherein R6is C-i-6 haloalkyl. In such embodiments, R6can be, e.g., chloromethyl, dichloromethyl, trichloromethyl, fluoromethyl, difluoromethyl, trifluoromethyl, 2,2,2-trichloroethyl, 2,2,2-trifluoroethyl, pentachloroethyl, pentafluoroethyl, 1 , 1,1, 3,3 ,3-hexachloropropyl, 1 ,1,1 ,3,3,3-hexafluoropropyl, or the like. In some embodiments, R5Ais selected from 2,2,2-trifluoroethoxy and 1 ,1,1,3,3,3- hexafluoroisopropoxy. In some such embodiments, R3is selected from (2-methoxy)propan- 2-yl, unsubstituted phenyl, phenyl substituted with one or more halogen, -N3, C1-4 haloalkoxy, and / or -NR C(0)R , unsubstituted pyridinyl, and pyridinyl substituted with one or more halogen, -N(RC)2, and / or ->f (RB)3.

[0115] In some embodiments, R5Ais -O-R6, and R6is 5- to 12-membered heteroaryl, which is optionally substituted with one or more members independently selected from halogen, Ci-3 alkyl, and C1-3 haloalkyl. When R5Ais -O-R6, for example, R6can be isoxazolyl, oxazolyl, imidazolyl, pyrazolyl, pyridinyl, oxazinyl, pyrimidinyl, pyrazinyl, pyridazinyl. In some embodiments, R5Ais -O-R6and R6is selected from pyridin-2-yL pyridin-3-yl, pyridin-4- yl, isoxazol-3-yl, isoxazol-4-yl, isoxazol-5-yl, pyrimidin-2-yl, pyrimidin-4-yl, pyrimidin-5-yl, and pyrimidin-6-yl. In some embodiments, R5 Ais -O-R6and R6is selected from isoxazoi-3- yl, pyridin-3-yl, pyridin-4-yl, 2,6-dimethyipyridin-5-yl, and 2-methylpyrimidin-5-yl. In some embodiments, R,Ais -O-R6, R6is selected from isoxazol-3-yl, pyridin-3-yl, pyridin-4-yl, 2,6- dimethylpyridin-5-yl, and 2-methylpyrimidin-5-yl, and R'!is selected from (2- methoxy)propan-2-yl, unsubstituted phenyl, phenyl substituted with one or morehalogen, -N3, Ci-4haloalkoxy, and / or -NRCC(0)R\ unsubstituted pyridinyl, and pyridinyl substituted with one or more halogen, -N(RC)2, and / or -N*(RB)3

[0116] In some embodiments, R5is selected from -CH2R5Aand -CHS(0)(R5)2. In some embodiments, R5is -CHS(0)(RDB)2 (e.g., dimethyl(oxo)-6-sulfanylidene). In some embodiments, R5is -CH2R5A, R5Ais selected from -S-R7and -S02-R7, and R7is Ci-6alkyl. In such embodiments, R7can be, e.g., methyl, ethyl, κ-propyl, isopropyl, κ-butyl, isobutyl, sec- butyl, teri-butyl, n-pentyi, isopentyl, or n-hexyl. In some embodiments, R5Ais methylthio. In some embodiments, RMis methylsulfonyl. In some embodiments, RMis methylthio or methylsulfonyl, and RJis selected from (2-methoxy)propan-2-yL unsubstituted phenyl, phenyl substituted with one or more halogen, -N3, C1.4 haloalkoxy, and / or -NRCC(0)RB, unsubstituted pyridinyl, and pyridinyl substituted with one or more halogen, -N(RC)2, and / or -N+(R )3.

[0117] In some embodiments, R5ais -S-R7, and R7is 5- to 12-membered heteroaryl, which is optionally substituted with one or more members independently selected from halogen, Ci-3 alkyl, and C1.3 haloalkyl. When R3ais -S-R7, for example, R'can be isoxazolyl, oxazolyl, imidazolyl, pyrazolyl, pyridinyl, oxazinyl, pyrimidinyl, pyrazinyl, pyridazinyl. In some embodiments, R5ais -S-R' and R' is selected from pyridin-2-yl, pyridin-3-yl, pyridin-4- yl, isoxazol-3-yl, isoxazol-4-yl, isoxazol-5-yl, pyrimidin-2-yl, pyrimidin-4-yl, pyrimidin-5-yl, and pyrimidin-6-yl. In some embodiments, R5ais -S-R7and R7is selected from isoxazol-3- yl, pyridin-3-yl, pyridin-4-yl, 2,6-dimethylpyridin-5-yl, and 2-methylpyrimidin-5-yl. In some embodiments, R5dis -S-R', R7is selected from pyridin-3-yl, pyridin-4-yl, 2,6- dimethylpyridin-5-yl, and 2-methylpyrimidin-5-yl, and R3is selected from (2- methoxy)propan-2-yl, unsubstituted phenyl, phenyl substituted with one or morehalogen, -N3, Ci_4 haloa!koxy, and / or -NRcC(0)R°, unsubstituted pyridinyl, and pyridinyl substituted with one or more halogen, -N(RC)2, and / or -N+(Rbk

[0118] In some embodiments, R5is Ci_<s haloalkyl. R5can be, e.g., chloromethyl, dichloromethyl, trichloromethyl, fluoromethyl, difluoromethyl, trifluoromethyl, 2,2,2- trichloroethyl, 2,2,2-trifluoroethyl, pentachloroethyl, pentafluoroethyl, 1, 1,1,3,3,3- hexachloropropyl, 1, 1 ,1 , 3,3, 3-hexafluoropropyl, or the like. In some embodiments, R5is difluoromethyl. In some embodiments, RDis difluoromethyl and RJis selected from (2- methoxy)propan-2-yl, unsubstituted phenyl, phenyl substituted with one or morehalogen, -N3, Q-4 haloalkoxy, and / or -NRcC(0)R°, unsubstituted pyridinyl, and pyridinyl substituted with one or more halogen, -N(RC)2, and / or -N (R )3.

[0119] In some embodiments, the invention provides compounds of Formula I or Formula la and pharmaceutically acceptable salts thereof, wherein R5is haloalkyl. For example, R5can be chloromethyl, dichloromethyl, trichloromethyl, difluoromethyl, or trifluoromethyl.

[0120] In some embodiments, the invention provides a compound as set forth in Table 1 below or a pharmaceutically acceptable salt thereof.Table 1. Lysine gingipain inhibitors.4143525355the compound is selected from:the compound is selected from:and pharmaceutically acceptable salts thereof.

[0123] The compounds described herein and methods of using them encompass the preparation and use of therapeutically active enantiomers or diastereomers of the described compounds. All such enantiomers and diastereomers of these compounds are included in the scope of the invention. Such compounds can be used as mixtures (e.g., racemic mixtures) or as isolated enantiomers or diastereomers.

[0124] Compounds of the invention can be prepared so as to include radionuclides for use in diagnostic imaging application such as positron emission tomography (PET) and single-photon emission computed tomography (SPECT). For example, Kgp inhibitors as described herein can be prepared so as to include one or more radionuclides selected from oxygen- 15 (150), nitrogen- 13 (I3N), carbon-1 1 (HC), iodine-131 (I3 ,I), and fluorine-18 (I8F). Such radiolabeled compounds can be used for PET imaging. Compounds of the invention can also be prepared in deuterated form (i.e., having one or more deuterium atoms, Ή, in place of one more hydrogen atoms), tritiated form (i.e., having one or more tritium atoms,3H, in place of one more hydrogen atoms), or '4C-labeled form (i.e., having one or morei4C atoms in place of one more carbon atoms).

[0125] Compounds of the invention can be prepared using starting materials Al as shown in Scheme 1. In Al, preferred R9and R,cgroups can be manipulated using chemical conditions that do not affect the other. For example, Rlc= benzyl can be removed by hydrogen and a palladium-carbon catalyst, but Ricis not affected by trifluoroacetic acid, whereas R = t-butyl can be removed by trifluoroacetic acid but R9is not affected by hydrogen and a palladium-carbon catalyst. Other appropriate, complimentary combinations of R9and Ricand methods for their selective modification are known in the art.Scheme 1A4 A5 A6

[0126] Al can be treated with a carboxylic acid R C02H, and a racemization inhibitor (for example HOBt), and a dehydrating agent (for example EDAC), in an organic solvent (forexample DMF), generating A2. Alternatively, Al can be treated with R COX, wherein X is a leaving group (for example chloride), and an organic base (for example EtjN), in an organic solvent (for example CH2CI2), generating A2. A variety of applicable carboxylic acids (R'CChH) and derivatives thereof (R'COX) are commercially available, or can be prepared according to known methods. R9can be removed by appropriate chemical conditions generating A3. A3 can be reacted with a chloroformate (e.g., isobutyl chloroformate, ethyl chloroformate, and the like) followed by diazomethane to provide A4. A4 can be converted to A5 via treatment with a hydrohalic acid (i.e., HX wherein X is a halogen such as CI, Br, or I). Displacement of the halide from A5 using a compound R5a-H (e.g., a halogenated phenol or a heteroaromatic compound) in the presence of a base can provide protected compound A6, which can be deprotected provide the product of Formula I. Alternatively, carboxylic acid A3 can be N-acylated and cyclized to afford the corresponding 5(4H)-oxazolone. The oxazolone can be further reacted with an anhydride of an -fluorinated carboxylic acid (e.g., trifluoroacetic anhydride) to provide a C-acylated 5(4H)-oxazolone which is decarbonylated using oxalic acid to form compounds of Formula I wherein R5is haloalkyl (see, Kolb, et al. Liebigs. Ann. Chem., 1990, pp. 1-6; Kolb, et al. Tel. Lett. 1986, (27): pp. 1579-1582 and pp. 4437-4440).

[0127] Preparation of certain examples of Formula (I) will require initial preparation of unnatural amino acids that feature side-chains that are not present in any of the amino acids that occur in proteins. A wide variety of methods have been published for preparation of amino acids that feature unnatural side-chains, including the most useful and important methods Fl-4 as summarized below.

[0128] Although not illustrated in Fl-3, the amine and carboxylate groups are typically protected before application of these methods, and the protection is removed after construction of the unnatural side-chain. In Fl, a natural side-chain (R) is modified to form an unnatural side-chain (R'). The natural amino acids serine, glutamic acid, and methionine would be especially for preparation of certain examples of Formulas (I) and (II). In F2, a metalated glycine derivative is treated with an alleviating agent (R'X) to install the unnatural side-chain (R'). In some instances, the metalated glycine derivative is generated by treating a glycine derivative with a strongly basic metalating agent (for example lithiumdiisopropylamide or potassium t-butoxide). In other instances, the starting glycine derivative is sufficiently acidic that a muchless basic metalating agent (for example potassium carbonate) is satisfactory. In the latter instances the metaiated glycine derivative may exist as a dissociated ion pair, rather than as the covalently bonded species illustrated in F2. In F3, a metaiated alanine derivative is treated with an alkylating agent (R'X) to install the unnatural side-chain (R'). In most instances, the metaiated alanine derivative is generated by treating a halogenated alanine derivative with a low valent metal (for example zinc dust ). In many instances, a soluble palladium catalyst is utilized to facilitate F3. In F4, an aldehyde (R'CHO) is reacted with a source of ammonia and a source of cyanide, to generate an amino-nitrile, which is subsequently hydrolyzed to generate an arnino-acid featuring an unnatural sidechain (R").

[0129] Although not illustrated in Fl-3, the amine and carboxylate groups are typically protected before application of these methods, and the protection is removed after construction of the unnatural side-chain. In Fl, a natural side-chain (R) is modified to form an unnatural side-chain (R'). The natural amino acids serine, glutamic acid, and methionine would be especially for preparation of certain examples of Formulas (I) and (II). In F2, a metaiated glycine derivative is treated with an alkylating agent (R'X) to install the unnatural side-chain (R'). In some instances, the metaiated glycine derivative is generated by treating a glycine derivative with a strongly basic metalating agent (for example lithiumdiisopropylamide or potassium t-butoxide). In other instances, the starting glycine derivative is sufficiently acidic that a much less basic metalating agent (for example potassiumcarbonate) is satisfactory. In the latter instances the metalated glycine derivative may exist as a dissociated ion pair, rather than as the covalently bonded species illustrated in F2. In F3, a metalated alanine derivative is treated with an alkylating agent (R'X) to install the unnatural side-chain (R'). In most instances, the metalated alanine derivative is generated by treating a halogenated alanine derivative with a low valent metal (for example zinc dust). In many instances, a soluble palladium catalyst is utilized to facilitate F3. In F4, an aldehyde (R'CHO) is reacted with a source of ammonia and a source of cyanide, to generate an amino- nitrile, which is subsequently hydrolyzed to generate an amino-acid featuring an unnatural sidechain (R').

[0130] After application of appropriate methods to prepare amino acids that feature unnatural sidechains, these amino acids can be appropriately protected, as described above, and then appropriate methods can be applied to generate intermediates and products wherein the lysine side-chain has been replaced with an unnatural side-chain. Thus, suitable methods are available to provide the variations of CH2AC(R2a)(R2b)CH2N(Rla)(Rlb) that are specified for Formula (I).IV. Pharmaceutical Compositions and Administration of Lysine GingipainInhibitors

[0131] In a related aspect, the invention provides a pharmaceutical composition comprising a compound of Formula I and a pharmaceutically acceptable excipient.

[0132] The pharmaceutical compositions can be prepared by any of the methods well known in the art of pharmacy and drug delivery. In general, methods of preparing the compositions include the step of bringing the active ingredient into association with a carrier containing one or more accessor ingredients. The pharmaceutical compositions are typically prepared by uniformly and intimately bringing the active ingredient into association with a liquid carrier or a finely divided solid carrier or both, and then, if necessaiy, shaping the product into the desired formulation. The compositions can be conveniently prepared and'Or packaged in unit dosage form.

[0133] Pharmaceutical compositions containing compounds of the invention can be formulated for oral use. Suitable compositions for oral administration include, but are not limited to, tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules, symps, elixirs, solutions, buccal patches, oral gels,chewing gums, chewable tablets, effervescent powders, and effervescent tablets.Compositions for oral administration can be formulated according to any method known to those of skill in the art. Such compositions can contain one or more agents selected from sweetening agents, flavoring agents, coloring agents, antioxidants, and preserving agents in order to provide pharmaceutically elegant and palatable preparations.

[0134] Tablets generally contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients, including: inert diluents, such as cellulose, silicon dioxide, aluminum oxide, calcium carbonate, sodium carbonate, glucose, mannitol, sorbitol, lactose, calcium phosphate, and sodium phosphate; granulating and disintegrating agents, such as corn starch and alginic acid; binding agents, such as polyvinylpyrrolidone (PVP), cellulose, polyethylene glycol (PEG), starch, gelatin, and acacia; and lubricating agents such as magnesium stearate, stearic acid, and talc. The tablets can be uncoated or coated, enterically or otherwise, by known techniques to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period. For example, a time delay material such as glyceryl monostearate or glyceryl distearate can be employed. Tablets can also be coated with a semi-permeable membrane and optional polymeric osmogents according to known techniques to fonn osmotic pump compositions for controlled release.

[0135] Compositions for oral administration can be formulated as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent (such as calcium carbonate, calcium phosphate, or kaolin), or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium (such as peanut oil, liquid paraffin, or olive oil).

[0136] Kgp inhibitors can also be administered topically as a solution, ointment, cream, gel, or suspension, as well as in mouth washes, eye-drops, and the like. Still further, transdermal delivery of Kgp inhibitors can be accomplished by means of iontophoretic patches and the like.

[0137] Pharmaceutical compositions containing Kgp inhibitors can also be in the form of a sterile injectable aqueous or oleaginous solutions and suspensions. Sterile injectable preparations can be formulated using non-toxic parenterally-acceptable vehicles including water, Ringer's solution, and isotonic sodium chloride solution, and acceptable solvents such as 1 ,3-butane diol. In addition, sterile, fixed oils can be used as a solvent or suspendingmedium. For this purpose any bland fixed oil can be employed including synthetic monoglycerides, diglycerides, or triglycerides.

[0138] In some embodiments, a Kgp inhibitor can be formulated with a polymer such as Pluronic F127 and delivered subcutaneously. Pluronic is a hydrogel that solidifies at body temperature and can provide extended drug delivery over periods of time lasting from days to weeks.

[0139] Aqueous suspensions can contain one or more Kgp inhibitors in admixture with excipients including, but not limited to: suspending agents such as sodiumcarboxymethylcellulose, methylcellulose, oleagino-propylmethylcellulose, sodium alginate, polv vinyl-pyrrol idone, gum tragacanth and gum acacia; dispersing or wetting agents such as lecithin, polyoxyethylene stearate, and polyethylene sorbitan monooleate; and preserv atives such as ethyl, w-propyl, and J-hydroxybenzoate. Dispersible powders and granules (suitable for preparation of an aqueous suspension by the addition of water) can contain one or more Kgp inhibitors in admixture with a dispersing agent, wetting agent, suspending agent, or combinations thereof. Oily suspensions can be formulated by suspending an Kgp inhibitor in a vegetable oil (e.g., arachis oil, olive oil, sesame oil or coconut oil), or in a mineral oil (e.g., liquid paraffin). Oily suspensions can contain one or more thickening agents, for example beeswax, hard paraffin, or cetyl alcohol. These compositions can be preserved by the addition of an anti-oxidant such as ascorbic acid.

[0140] The pharmaceutical compositions of the invention can also be in the form of oil-in- water emulsions. The oily phase can be a vegetable oil, for example olive oil or arachis oil, or a mineral oil, for example liquid paraffin or mixtures of these. Suitable emulsifying agents can be naturally-occurring gums, such as gum acacia or gum tragacanth; naturally-occurring phospholipids, such as soy lecithin; esters or partial esters derived from fatty acids and hexitol anhydrides, such as sorbitan monooleate; and condensation products of said partial esters with ethylene oxide, such as polyoxyethylene sorbitan monooleate.

[0141] The use of hybrid molecules to promote active transport or nanoparticles can be used in certain embodiments to increase blood brain barrier transport. For example liposomes, proteins, engineered peptide compounds or antibodies that bind to the receptors that transport proteins across the blood brain barrier including LPR-1 receptor, transferrin receptor, EGF-like growth factor or glutathione transporter can be used to increase penetration into the brain. Physical techniques including osmotic opening, ultrasound, lasers,sphenopalantine ganglion stimulation, direct intracranial, intrathecal, or intraventricular delivery via a pump can be used.

[0142] Pharmaceutical compositions according to the invention can also include one or more additional active agents useful in the treatment of conditions associated with P.gingivalis infection. In certain embodiments, the invention provides a pharmaceutical composition comprising one or more Kgp inhibitors as described herein in combination with one or more additional active agents for treatment of Alzheimer's disease. Several therapeutics are in development and in clinical use for treatment of Alzheimer's disease. Therapeutic strategies include lowering circulating levels of β-amyloid and tau (as described in more detail below), stabilizing microtubules, removing atherosclerotic plaques, modulating autophagy, modulating neurotransmitter levels, and inhibiting GABA(A) ci5 receptors. Such therapeutics can maintain and / or restore cognitive function in subjects with Alzheimer's disease; slow the decline of cognitive function; and promote neuroplasticity and recover}' of the brain.

[0143] Active agents that can be combined with Kgp inhibitors in pharmaceutical compositions include, but are not limited to, antibiotics {i.e., bacteriocidal compounds and bacteriostatic compounds), cholinesterase inhibitors, alpha-7 nicotinic receptor modulators, serotonin modulators, NMD A modulators, Αβ-targctcd therapies, ApoE-targeted therapies, microglia-targeted therapies, blood brain barrier-targeted therapies, tau-targeted therapies, complement-targeted therapies, and anti-inflammatories.

[0144] Any suitable antibiotic can be combined with one or more Kgp inhibitors in the pharmaceutical compositions of the invention. In certain embodiments, the invention provides a pharmaceutical composition containing one more Kgp inhibitors and an antibiotic having a P. gingivalis MIC50 of less than 25 μg / ml. For example, the P. gingivalis MIC50 of the antibiotic can be less than 20 μ Ινα\, less than 15 μ§ / ηι1, less than 10 μ / ηι1, less than 8 ug / ml, less than 6 g / ml, or less than 5 μ§ / ιη1. In some embodiments, the P. gingivalis MIC50of the antibiotic is less than 1 ug / ml. In some embodiments, the P. gingivalis MIC50of the antibiotic is less than 0.2 g / ml.

[0145] Examples of bacteriocidal and bacteriostatic compounds include, but are not limited to: quinolones (e.g., moxifloxacin, gemifloxacin, ciprofloxacin, ofiaxacin, trovafioxacin, sitafloxacin, and the like), β-lactams (e.g., penicillins such as amoxicillin, amoxacilin- clavulanate, piperacillin-tazobactam, penicillin G, and the like; and cephalosporins such asceftriaxone and the like), macrolides (e.g., erymrornycin, azithromycin, clarithromycin, and the like), carbapenems (e.g., doripenem, imipenem, meropinem, ertapenem, and the like), thiazolides (e.g., tizoxanidine, nitazoxanidine, RM 4807, RM 4809, and the like), tetracyclines (e.g., tetracycline, minocycline, doxycycline, eravacycline, and the like), clindamycin, metronidazole, and satranidazole. Bacteriocidal and bacteriostatic compounds also include agents that inhibit or othenvise interfere with formation of biofilms by anaerobic, gram-negative bacteria; such agents include oxantel, morantel, thiabendazole, and the like. Compositions of the invention can contain one or more Kgp inhibitors with one or more (e.g., two, three, four, five, six, or more) bacteriocidal / bacteriostatic compounds. Compositions containing bacteriocidal / bacteriostatic compounds can further contain a chlorhexidine (e.g., chlorhexidine di gluconate) alone or in combination with a zinc compound (e.g., zinc acetate), can also be used in combination with the administered antibiotics.

[0146] In some embodiments, a combination of a penicillin (e.g., amoxicillin) and metronidazole or a combination of penicillin (e.g. , amoxicillin), metronidazole and a tetracycline is used. In some embodiments, the antibiotic is selected from minocycline, doxycycline, metronidazole, amoxicillin, clindamycin, augmentin, satranidazole, and combinations thereof.

[0147] Examples of suitable cholinesterase inhibitors include, but are not limited to, donepezil, donepezil / memantine, galantamine, rivastigmine, and tacrine, as well as pharmaceutically acceptable salts thereof. Examples of suitable serotonin modulators include, but are not limited to, idalopirdine, RVT-IOl, citalopram, escitalopram, fluoxetine, fluvoxamine, paroxetine, and sertraline, as well as pharmaceutically acceptable salts thereof. Examples of suitable alpha-7 nicotinic receptor modulators include, but are not limited to, alpha-7 agonists such as encenicline and APNl 125. Suitable NMDA modulators include, but are not limited to, NMDA receptor antagonists such as memantine and derivatives thereof.

[0148] Pharmaceutical compositions of the invention can also contain active agents that are directed to biomolecular targets associated with neurological diseases. Such targets include beta amyloid peptides (also referred to as beta amyloid, abeta, or Αβ), apolipoprotein E (also referred to as ApoE), and microtubule- associated tau (also referred to as tau proteins, or simply as tau).

[0149] Αβ-targeted therapies include inhibitors of Αβ production (such as beta-secretase inhibitors, gamma-secretase inhibitors, alpha-secretase activators), inhibitors of Αβaggregation, inhibitors of Αβ oligomerization, and up-regulators of Αβ clearance, among others (see, e.g., Jia, et al. BioMed Research International, 2014. Article ID 837157, 22 pages). Examples of Αβ-targeted therapies include but are not limited to, antibodies, pioglitazone, begacestat, atorvastatin, simvastatin, etazolate, and tramiprosate, as well as pharmaceutically acceptable salts thereof.

[0150] Examples of ApoE-targeted therapies include, but are not limited to retinoid X receptor agonists (see, Cramer, et al. Science 2012. 335(6075): 1503-1506) and others described by Liu et al. (Nat Rev Neurol . 2013. 9(2): 106-1 18). Tau-targeted therapies include, but are not limited to, methylthioninium, leuco-methylthioninium, antibodies and those described by Lee, et al. (Cold Spring Harb Perspect Med 2011 ; 1 :a006437).

[0151] Pharmaceutical compositions of the invention can also contain complement-targeted therapies. Such therapies target components of the complement system involved in the innate immune response. Complement targeted therapies include, but are not limited to, those described by Ricklin and Lambris (Nat. Biotechnology 2007. 25(1 1): 1265-1275).

[0152] Examples of suitable anti-inflammatories include, but are not limited to, NSAIDs such as apazone, diclofenac, ibuproien, indomethacin, ketoprofen, nabumetone, naproxen, piroxicam, and sulindac, as well as pharmaceutically acceptable salts thereof.V. Methods for Inhibiting Gingipains and Treating Conditions Associated with P.Gingivalis Infection

[0153] In another embodiment, the invention provides a method of inhibiting a gingipain. The method includes contacting the gingipain with an effective amount of a compound as described herein. In certain embodiments, the gingipain is a lysine gingipain (i.e., Kgp or a variant containing one or more amino acid substitutions, deletions, and / or other peptide sequence variations). Inhibiting the gingipain generally includes contacting the gingipain with an amount of the compound sufficient to reduce the activity of the gingipain as compared to the gingipain activity in the absence of the compound. For example, contacting the gingipain with the gingipain inhibitor can result in from about 1% to about 99% gingipain inhibition (i.e., the activity of the inhibited gingipain ranges from 99% to 1% of the gingipain activity in the absence of the compound). The level of gingipain inhibition can range from about l%o to about 10%o, or from about 10% to about 20%, or from about 20% to about 30%, or from about 30% to about 40%, or from about 40% to about 50%, or from about 50% toabout 60%, or from about 60% to about 70%, or from about 70% to about 80%, or from about 80% to about 90%, or from about 90% to about 99%. The level of gingipain inhibition can range from about 5% to about 95%, or from about 10% to about 90%, or from about 20% to about 80%, or from about 30% to about 70%, or from about 40% to about 60%. In some embodiments, contacting the gingipain with a compound as described herein will result in complete (i.e., 100%) gingipain inhibition.

[0154] As described above, infection with P. gingivalis and gingipain activity have been linked to the development of periodontal disease, Alzheimer's and other brain disorders, cardiovascular disease, diabetes, cancer, liver disease, kidney disease, preterm birth, arthritis, pneumonia and other disorders. See: Bostanci, et al. FEMS Microbiol Lett, 2012. 333(1): 1- 9; Ghizoni, et al. JAppl Oral Sci, 2012. 20(1): 104- 12; Gatz, et al. Alzheimers Dement, 2006. 2(2): 1 10-7; Stein, et al J Am Dent Assoc, 2007. 138(10): 1314-22; quiz 1381-2; Noble, et al. J Neurol Neurosurg Psychiatry, 2009. 80(11): 1206- 11 ; Sparks Stein, et al Alzheimers Dement, 2012. 8(3): 196-203; Velsko, et al. PLoS ONE, 2014. 9(5): e97811; Demmer, et al. J Dent Res, 2015. 94(9S): 201-S-l IS; Atanasova and Yilmaz. Molecular Oral Microbiology, 2014. 29(2): 55-66; Yoneda, et al. BMC Gastroenterol, 2012. 12: 16.

[0155] Extracellular proteases produced by P. gingivalis, including Arginine Gingipain A (RgpA), Arginine Gingipain B (RgpB), and Lysine Gingipain ( gp), can also degrade a broad range of proteins in connective tissue and plasma (e.g., collagen, immunoglobulins, and proteinase inhibitors, etc.). Gingipains can enter systemic circulation and / or synoviocytes and chondrocytes, and they can also cause disruption to the kallikrein-kinin cascade, blood coagulation, and host defense systems. Patients with gingipains in their joints and circulatory system may be subject to gingipain-induced death of synovial cells and / or chondrocytes, contributing to osteoarthritis.

[0156] It has recently been discovered that RgpB and Kgp can infiltrate human and dog joints, contributing to the development of osteoarthritis. It is believed that P. gingivalis and gingipains can infiltrate joint tissues via a number of routes. Gingipains can be secreted, transported to outer membrane surfaces of P. gingivalis, or released in outer membrane vesicles by the bacterium. P. gingivalis has previously been identified in periodontal tissues, coronary arteries, aorta, and recently, the liver— release of P. gingivalis and'Or gingipains from any of these niches into the systemic circulation could result in translocation of P. gingivalis and / or gingipains to the joints. See: Travis, et al. Adv Exp Med Biol, 2000. 477:455-65; Byrne, et al. Oral Microbiol Immunol, 2009. 24(6): 469-77; Mahendra, et al. J Maxillofac Oral Surg, 2009. 8(2): 108-13; Stelzel. Periodontal, 2002. 73(8): 868-70;Ishikawa, et al. Biochim Biophys Acta, 2013. 1832(12): 2035-2043.

[0157] P. gingivalis and / or gingipains may also enter joints by degrading the endothelial cells protecting the bloodjoint barrier, or by a traumatic event to the joint, such as a meniscus injury, which permanently or transiently reduces the integrity of the joint tissues. Such a disruption in traumatic joint injury for example, may contribute to the infiltration of P.gingivalis and / or gingipains in infected individuals and subsequent development of chronic osteoarthritis. People who are at a high risk of traumatic joint injury, including athletes in contact sports like football, could be preventatively treated with gingipain inhibitors to reduce the risk of trauma-related osteoarthritis.

[0158] P. gingivalis and gingipains may also reach the joint through other mechanisms including active transport, passive transport or macrophage delivery. Osteoarthritis resulting from any of these mechanisms can be limited to a single joint or present in multiple joints.

[0159] Similar to humans, P. gingivalis infection and periodontal disease is one of the most common infectious diseases affecting adult dogs and cats. Dogs and cats with P. gingivalis infection and gingipains in their joints and circulatory system may experience periodontal disease and osteoarthritis due to gingipain-induced cell death, which could be treated or prevented according to the methods of the invention. Aged dogs spontaneously develop many features of osteoarthritis, including a common inflammatory knee arthritis associated with degeneration of the anterior cruciate ligament (ACL). A study by Muir et al. of dogs with inflammatory knee arthritis and ACL degeneration detected DNA from a range of bacterial species in 37% of knee joints from affected dogs. Muir et al. hypothesized that bacteria may be an important causative factor in the pathogenesis of inflammatory arthritis in dogs. In the Muir et al. study, DNA from P. gingivalis was not detected in the dog joints. See, Muir, et al. Microb Pathog, 2007. 42(2-3): 47-55. However, similar to humans, P. gingivalis is a common oral pathogen affecting adult dogs, and could potentially translocate from the oral cavity to joint tissues as a result of bacteremia. P. gingivalis has been demonstrated to infect chondrocytes in vitro causing chondrocyte apoptosis, indicating a pathway for cartilage loss in osteoarthritis of both dogs and humans. See: ohner, et al.Calcif Tissue Int, 2010. 87(4): p. 333-40; Houle, et al. FEMS Microbiol Lett, 2003. 221(2): p.181-5; Kataoka, et al. FASEB J, 2014. 28: 3564-3578; Pischon, et al. Ann Rheum Dis, 2009. 68(12): p. 1902-7.

[0160] Kgp inhibitors can therefore be used to treat diseases and conditions, such as brain disorders, caused by or otherwise affected by P. gingivalis. Accordingly, another aspect of the invention provides a method of treating a disease or condition associated with P.gingivalis infection. The method includes administering an effective amount of a compound or a composition of the invention, as described above, to a subject in need thereof.

[0161] In certain embodiments, compounds of the invention inhibit active Kgp in the brain of a mammal, e.g., a human or an animal (e.g., a dog), and are cytoprotective or neuroprotective. By "neuroprotective," it is meant that the compounds prevent aberrant changes to neurons or death of neurons. Compounds of the invention are therefore useful, e.g., in treatment of a brain disorder (e.g., a neurodegenerative disease (e.g., Alzheimer's disease, Down's syndrome, epilepsy, autism, Parkinson's disease, essential tremor, fronto- temporal dementia, progressive supranuclear palsy, amyotrophic lateral sclerosis,Huntington's disease, multiple sclerosis, mild cognitive impairment, age associated memory impairment, chronic traumatic encephalopathy, stroke, cerebrovascular disease, Lewy Body disease, multiple system atrophy, schizophrenia and depression, etc.), diabetes,cardiovascular disease, arthritis, rheumatoid arthritis, osteoarthritis, infectious arthritis, psoriatic arthritis, retinal disorders (e.g., age related macular degeneration) and glaucoma.

[0162] In some embodiments, the disease or condition is selected from a brain disorder, periodontal disease, diabetes, a cardiovascular disease, arthritis, rheumatoid arthritis, osteoarthritis, preterm birth, pneumonia, cancer, a kidney disease, a liver disease, a retinal disorder, and glaucoma.

[0163] In some embodiments, the disease or condition is a brain disorder.

[0164] In some embodiments, the brain disorder is selected from Alzheimer's disease, Down's syndrome, epilepsy, autism, Parkinson's disease, essential tremor, fronto-temporal dementia, progressive supranuclear palsy, amyotrophic lateral sclerosis, Huntington's disease, multiple sclerosis, mild cognitive impairment, age associated memory impairment, chronic traumatic encephalopathy, stroke, cerebrovascular disease, Lewy Body disease, multiple system atrophy, schizophrenia, and depression.

[0165] In some embodiments, the brain disorder is Alzheimer's disease.

[0166] In some embodiments, the method further includes administering to the subject one or more active agents selected from a cholinesterase inhibitor, a serotonin modulator, an NMDA modulator, an Αβ targeted therapy, an ApoE targeted therapy, a microglia targeted therapy, a blood brain barrier targeted therapy, a tau targeted therapy, a complement targeted therapy, and an anti-inflammatory.

[0167] In some embodiments, the disease or condition is periodontal disease. In some embodiments, the disease or condition is a liver disease. In some embodiments, the liver disease is non-alcoholic steatohepatitis. In some embodiments, the disease or condition is a retinal disorder. In some embodiments, the retinal disorder is age-related macular degeneration.

[0168] In some embodiments, the disease or condition is cancer. In some embodiments, the cancer is breast cancer, oral cancer, pancreatic cancer, or glioblastoma multiforme.

[0169] Kgp inhibitors as described herein can be administered at any suitable dose in the methods of the invention. In general, a Kgp inhibitor is administered at a dose ranging from about 0.1 milligrams to about 1000 milligrams per kilogram of a subject's body weight (i.e., about 0.1-1000 mg / kg). The dose of Kgp inhibitor can be, for example, about 0.1-1000 mg / kg, or about 1-500 mg / kg, or about 25-250 mg / kg, or about 50-100 mg / kg. The dose of Kgp inhibitor can be about 1 , 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950 or 1000 mg / kg. The dosages can be varied depending upon the requirements of the patient, the severit of the disorder being treated, and the particular formulation being administered. The dose administered to a patient should be sufficient to result in a beneficial therapeutic response in the patient. The size of the dose will also be determined by the existence, nature, and extent of any adverse side-effects that accompany the administration of the drug in a particular patient. Determination of the proper dosage for a particular situation is within the skill of the typical practitioner. The total dosage can be divided and administered in portions over a period of time suitable to treat to the seizure disorder.

[0170] Kgp inhibitors can be administered for periods of time which will vary depending upon the nature of the particular disorder, its severity, and the overall condition of the subject to whom the Kgp inhibitor is administered. Administration can be conducted, for example, hourly, every 2 hours, three hours, four hours, six hours, eight hours, or twice daily including every 12 hours, or any intervening interval thereof. Administration can be conducted oncedaily, or once every 36 hours or 48 hows, or once every month or several months. Following treatment, a subject can be monitored for changes in his or her condition and for alleviation of the symptoms of the disorder. The dosage of the Kgp inhibitor can either be increased in the event the subject does not respond significantly to a particular dosage level, or the dose can be decreased if an alleviation of the symptoms of the disorder is observed, or if the disorder has been remedied, or if unacceptable side effects are seen with a particular dosage.

[0171] A therapeutically effective amount of a Kgp inhibitor can be administered to the subject in a treatment regimen comprising intervals of at least 1 hour, or 6 hours, or 12 hours, or 24 hours, or 36 hours, or 48 hours between dosages. Administration can be conducted at intervals of at least 72, 96, 120, 144, 168, 192, 216, or 240 hours (i.e., 3, 4, 5, 6, 7, 8, 9, or 10 days). In certain embodiments, administration of one or more Kgp inhibitors is conducted in a chronic fashion over periods ranging from several months to several years. Accordingly, some embodiments of the invention provide a method of treating a disease or condition associated with P. gingivalis infection as described above, wherein the compound is administered to the subject for at least one year. In some embodiments, the compound is administered to the subject for at least 10 years. In some embodiments, the compound is administered to the subject for at least 60 years.

[0172] Administration of Kgp inhibitors according to the methods of the invention typically results in the reduction of circulating levels of active Kgp in a subject and / or the reduction of active Kgp in the brain. In certain embodiments, administration of a Kgp inhibitor according to the methods of the invention results in at least a 20% reduction of circulating levels of active Kgp and / or at least a 20% reduction of active Kgp in the brain. For example, the circulating levels of Kgp and / or the levels of Kgp in the brain are preferably reduced by from about 25% to about 95%, or from about 35% to about 95%, or from about 40% to about 85%, or from about 40% to about 80% as compared to the corresponding levels of Kgp 24 hours prior to the first administration of the Kgp inhibitor.

[0173] Kgp inhibitors can be administered alone or in combination with one or more additional therapeutically active agents, as described above. The one or more additional therapeutically effective agents include, e.g., : (i) a pharmaceutically acceptable agent which inhibits RgpA, RgpB, and / or Kgp production, translocation of RgpA, RgpB, and'Or Kgp into systemic circulation or brain, and / or pathological (e.g., neurotoxic effects) of RgpA, RgpB, and / or Kgp in a mammal; (ii) an antibacterial agent which is bacteriostatic or bacteriocidalwith respect to P. gingivalis; (iii) one or more antibodies which bind to RgpA, RgpB and / or Kgp (e.g., 18E6, which binds to the first half of the immunoglobulin domain of RgpB; Kgp- specific monoclonal antibody, 7B9, which recognizes an epitope within the Kgp catalytic domain; the RgpA antibody 61Bg 1.3, humanized versions of any of the foregoing, etc.); (iv) epitopes of antibodies which bind to RgpA, RgpB and / or Kgp or other proteins expressed by P. gingivalis; and (v) combinations of any of the foregoing.

[0174] The additional therapeutically active agents also include Αβ peptides level reducers, pathogenic level tau reducers, microtubule stabilizers, agents capable or removing atherosclerotic plaques, agents that lower circulating levels of β-amyloid and tau, modulators of autophagy, neurotransmitter level regulators, GABA(A) a5 receptors inhibitors, and additional agents that help maintain and / or restore cognitive function and functional deficits of Alzheimer's disease, and / or slow down decline in cognitive functions and functional deficits in Alzheimer's disease.

[0175] Pharmaceutical compositions of the invention can contain one or more Kgp inhibitors as described herein in combination with ritonavir (RTV), which can increase bioavailability and increase blood brain barrier penetration. For example, ritonavir is commonly combined with oral peptidic HIV protease inhibitors to increase plasma levels by inhibiting the P450 3A4 enzyme and thus decreasing first-pass metabolism (see, Walmsley, et al. , NEngl JMed, 2002. 346(26): 2039-46). In addition, RTV binds to P-glycoprotein, a transmembrane efflux pump that is found in many tissues, including the blood brain barrier, allowing co-administered compounds better access to the brain (see, Marzolini, et al. Mo I Pharm, 2013. 10(6): 2340-9). Therefore, a combination of RTV and Kgp inhibitors can be used to increase plasma concentrations and brain levels of the gingipain inhibitors. As described in U.S. Pat. Appl. No. 14 / 875,416, oral administration of RTV 15 minutes prior to the Kgp inhibitor Kyt-36 increases the half- life therefore it is expected that RTV will also increase the half-life of other Kgp inhibitors.

[0176] In some embodiments, compounds of the invention can be administered with natural gingipain inhibitors including melabaricone C, isolated from nutmeg or polyphenol ic compounds derived from plants, such as cranberry, green tea, apple, and hops can be administered in conjunction for treatment or prevention of brain disorders. Naturally and unnaturally occurring antimicrobial peptides including: κ-casein peptide (109-137) 34, histatin 5, and CL( 14-25), CL(K25A) and CL(R24A, K25A), can also be administered inconjunction with the Kgp inhibitors of the invention, (see, e.g., Taniguchi et al,Biopotymers, 2014. 102(5): 379-89).

[0177] Kgp inhibitors as described herein can be administered with antibodies targeting gingipains or other P. gingiva lis proteins. Antibodies may rely on damage to the blood brain barrier for access to the brain or peripheral interference with gingipains and P. gingivalis propagation. Antibodies can also help to stimulate the efficacy of the immune system in clearing the bacteria. New or existing antibodies to RgpA, RgpB, or Kgp can be utilized including 18E6 and 7B9. An RgpA antibody 61BG 1.3 has previously demonstrated efficacy topically in prevention of recolonization by P. gingivalis after periodontal treatment. See, Booth et al, Infect Immurt, 1996. 64(2): 422-7. Antibodies would preferably be humanized for use in humans. Methods known to those in the field for delivery of biologies to improve half- life and brain penetration can be used including, but not limited to, intravenous delivery, subcutaneous delivery, intranasal deliver}', intrathecal delivery, intra-articular delivery, vector transport, and direct brain deliver}'.

[0178] The methods of the invention also encompass administration of Kgp inhibitors as described herein with one or more of the following additional therapeutically active agents or pharmaceutically acceptable salts thereof: an arginine derivative; histatin 5; baculovirus p35; a single point mutant of cowpox viral cytokine-response modifier (CrmA (Asp > Lys)); phenyiaianyl-ureido-citrullinyl-valyi-cycloarginal (FA-70C 1); (acycloxy)methyl ketone (Cbz-Phe-Lys-CH2OCO-2,4,6-Me3Ph); peptidyl chloro-methyl ketones (e.g., chloromethyl ketone derivatives of arginine, chloromethyl ketone derivatives of lysine, and the like):fluoro-methyl ketones; bromo-methyl ketones; ketopeptides; l-(3- phenylpropionyr)piperidine-3(R,S)-carboxylic acid [4-amino-l(S)-(benzothiazole-2- carbonyl)butyl]arnide (A71561); azapeptide fumaramide; aza-peptide Michael acceptors; benzamidine compounds; acyclomethylketone; activated factor X inhibitors (e.g., DX-9065a); cranberry nondialyzable fraction; cranberry polyphenol f action; pancreatic trypsin inhibitor; Cbz-Phe-Lys-CH20-CO-2,4,6-Me3-Ph; E-64; chlorhexidine; zinc (e.g., zinc acetate); or a combination of two, three or more of any of foregoing. In some of these embodiments, Zn can enhance potency and selectivity of the compounds (e.g., chlorhexidine, benzamidine, etc.) used in the methods of the invention.

[0179] A Kgp inhibitor of the invention can be administered in the same composition as an additional therapeutically active agent. Alternatively, the additional therapeutically activeagent can be administered separately before, concurrently with, or after administration of the Kgp inhibitor.VI. Gingipain Activity Probes

[0180] In a related embodiment, the invention provides a compound comprising a reporter moiety and a gingipain-reactive moiety, or a pharmaceutically acceptable salt thereof. In some embodiments, the gingipain-reactive moiety is a Kgp-reactive moiety. I some embodiments, the gingipain-reactive moiety is an Rgp-reactive moiety.

[0181] In some embodiments, the gingipain-reactive moiety binds reversibly to a target gingipain. In some embodiments, the gingipain-reactive moiety binds irreversibly to a target gingipain.

[0182] In some embodiments, the Kgp-reactive moiety further comprises a quenching moiety.

[0183] In some embodiments, the reporter moiety is selected from a fluorophore, a fluorogenic moiety, a chroinophore, a chromogenic moiety, a biotin, a digoxigenin, a peptide tag such as a FLAG peptide, an oligonucleotide, and a polynucleotide.

[0184] As used herein, the term "FLAG peptide" refers to an oligopeptide or a polypeptide containing the amino acid sequence Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys {i.e.,DYKDDDDK). FLAG peptides and variants thereof are described for example, in U.S. Pat. No. 4,703,004 to Hopp, et ah, which patent is incorporated herein by reference. Other peptides that can be used in place of a FLAG peptide include, but are not limited to, HA peptide tags containing the sequence Tyr-Pro-Tyr-Asp-Val-Pro-Asp-Tyr-Ala (i.e.,YPYDVPDYA), Hiss peptide tags containing the sequence His-His-His-His-His-His (i.e., HHFIHHH), and Myc peptide tags containing the sequence Glu-Gln-Lys-Leu-Ile-Ser-Glu- Glu-Asp-Leu (i.e., EQKLISEEDL). The peptide tags can be recognized by antibodies or other binding moieties for use with colorimetric reagents, chemiluminescent reagents, or the like for convenient identification and / or quantification. Likewise, the reporter moiety can contain a nucleotide (e.g., RNA, single-stranded DNA, or double-stranded DNA) which can be recognized by a complementary primar or other complementary nucleotide for detection by a PGR technique (e.g., quantitative PGR) as described, for example, in WO 2016 / 019929 (Navratil, et al), which publication is incorporated herein by reference. Useful DNA sequences include, but are not limited to,CCTGCCAGTTGAGCATTTTTATCTGCCACCTTCTCCACCAGACAAAAGCTGGAAA; CACTCTGTGCTCGTTGCTACAC; and CAGACAGCAAGCAGCACTACAC.

[0185] As used herein, the term "digoxigenin" refers to 3-[(3S,5R,8R,9S,10S,12R,13S, 14S,17R)-3,12,14-trihyiOxy-10,13-dimethyl-l,2,3,4,5,6,7,8,9,l 1 , 12,15,16,17- tetradecahydrocyclopenta[a]phenanthren-17-yl]-2H-furan-5-one (CAS Registiy No. 1672-46- 4) and substituted analogs thereof. As used herein, the term "biotin" refers to 5- [(3aS,4S,6aR)-2-oxohexahydro-lH-thieno[3,4-d]imidazol-4-yl]pentanoic acid (CAS Registry No. 58-85-5) and substituted analogs thereof.

[0186] In some embodiments, the compound has a structure according to Formula I set forth above, wherein R3is a reporter moiety. In some embodiments, the compound has a structure according to Formula II:or a pharmaceutically acceptable salt thereof, wherein:RAis a sidechain Ila:or a sidechain lib:wherein the wavy line represents the point of connection to Formula II;A is selected from -CH2- and -0-;Rla, Rlb, Rlc, Rld, and Rleare each independently selected from hydrogen, C1.4 alkyl, and an amine protecting group;R"aand R" are each independently selected from hydrogen, halogen, C1.4 haloalkyl, and Ci-4 haloalkoxy;R3is the reporter moiety;R4is selected from hydrogen and CM alkyl; andR5is the gingipain-reactive moiety, wherein the gingipain-reactive moiety optionally comprises a quenching moiety R9.

[0187] Compounds of the invention can be prepared in protected form (i.e., compounds wherein at least one of RIa, Rib, Rlc, Rld, and Rieis an amine protecting group). A number of suitable protecting groups— as described, for example, by Green and Wuts (Protective Groups in Organic Synthesis, 4"'' Ed. 2007, Wiley-Interscience, New York)— can be used. In some embodiments, Rlais H and R!bis selected from benzyloxycarbonyl; 9-fluorenylmethyl- oxycarbonyl; tert-butyloxycarbonyl; and ailvloxycarbonyl. In some embodiments, Riais H and RIis tert-butyloxycarbonyl. Compounds can also be prepared in alkylated form (i.e., compounds wherein at least one of R!aand Rlbis an alkyl group). One or both of Rlaand RIbcan be, for example, methyl, ethyl, «-propyl, isopropyl, H-butyl, or i-butyl.

[0188] In some embodiments, the compound has a structure according to Formula III:or a pharmaceutically acceptable salt thereof.

[0189] In some embodiments:R5is selected from Cwhaloalkyl, -CH2-0-R6, -CH2-S-R7,-CH2-SO-R7, -CH2-S02-R7, -CH2-N(R8)2, and -CH2-C5-i2heteroaryl;R and R6are selected from phenyl, Ci_6alkyl, Q.e haloalkyl, and Cs_i2heteroaryl, wherein phenyl is substituted with 1-5 halogens, andwherein Cs-n heteroaryl is optionally substituted with halogen orCi-3haloalkyl; andR8is independently selected Ci-6alkyl.

[0190] In some embodiments the gingipain reacti ve moiety R5is -CH2-0-phenyl, and phenyl is substituted with 1-5 halogens. In some embodiments, phenyl is optionally substituted with a quenching moiety R9. In some embodiments, the gingipain reactive moiety has the formula:wherein the wavy line represents the point of connect to Formula II orFormula III.

[0191] In some embodiments:R5Cis halogen, R5Dis H, R5Eis H, R5fis H, and R5Gis H; orR5is H, R5Dis halogen, R5Eis H, R5fis H, and R5Gis H; orRScis H, R5Dis H, R5Eis halogen, R5Fis H, and R5Gis H; orR5Cis H, R5Dis H, R5Eis H, R5Fis halogen, and R5Gis H; orRDCis H, R5Dis H, R5Eis H, R5Fis H, and R~ Gis halogen; orR5Cis halogen, R5Dis halogen, R5Eis H, R5Fis H, and R~ Gis H; or R5Cis halogen, R5Dis H, R5Eis halogen, R5Fis H, and R5Gis H; orR5Cis halogen, R5Dis H, R5Eis H, R5fis halogen, and R5Gis H; orR5Cis halogen, R5Dis H, R5Eis H, R5fis H, and R5Gis halogen; orR" Cis H, R" Dis halogen, R5Eis halogen, R51is H, and R5Gis H; orR5Cis H, R5Dis halogen, R5Eis H, R5Fis halogen, and R5Gis H; orR5Cis H, R5Dis halogen, R5Eis H, R5Fis H, and R5Gis halogen; or R5Cis H, R5Dis H, R5Eis halogen, R5Fis halogen, and R5Gis H; or R5Cis H, R5Dis H, R5Eis halogen, R5Fis H, and R5Gis halogen; or R5lis Ft, R5Dis H, R3Eis H, R3Iis halogen, and R5Gis halogen; or> 5dR5lis halogen, R" Ais halogen, R3Eis halogen, R31is H, and RD5Gg is H; or R" Cis halogen, R5Dis halogen, R5Eis H, RRFis halogen, and R5Gis H; or R5is halogen, R,Dis halogen, R5Eis H, R5Fis H, and R^8is halogen; or> 5eR3Cis halogen, R3dis H, R"eis halogen, R"!is halogen, and R3gis H; or> 5eRDCis halogen, RDis H, R^ is halogen, R^1is H, and R' eis halogen; or R5Cis halogen, R5Ais H, R5Eis H, R5Fis halogen, and R5Gis halogen; or R5lis H, R5Dis halogen, R,Eis halogen, R5iis halogen, and R,Gis H; or R5Cis H, R5Dis halogen, R,Eis halogen, R,!is H, and R5Gis halogen; or R5Cis H, R5Dis halogen, R36is H, R3Fis halogen, and R5Gis halogen; or R5Tis H, R5Dis H, R5Eis halogen, R5Fis halogen, and R5Gis halogen; or R3Cis H, R5Dis halogen, R5Eis halogen, R5' is halogen, and R^ is halogen; orR" cis halogen, R5dis H, R5eis halogen, R51is halogen, and R5gis halogen; or R5is halogen, R,dis halogen, R5eis halogen, R5tis H, and R5sis halogen; or R3Cis halogen, R3dis halogen, R5eis halogen, R5' is halogen, and R'gis H; wherein H or halogen in one of R5c, R5d, R5e, R5f, and R5gis optionallyreplaced with a quenching moiety R9. e embodiments:R5cis F or CI, R5dis H, R5eis H, R5fis H, and R5gis H; orR5cis H, R5dis F or CI, R5eis H, R5fis H, and R5gis H; orR5cis H, R5dis H, R5eis F or CI, R5fis H, and R5gis H; orR5cis H, R5dis H, R5eis H, R5fis F or CI, and R5gis H; orR5cis H, R5dis H, R5eis H, R5fis H, and R5gis F or CI; orR5cis F or CI, R5dis F or CI, R5eis H, R5fis H, and R5gis H; orR5cis F or CI, R5dis H, R5eis F or CI, R5fis H, and R5gis H; orR5cis F or CI, R5dis H, R5eis H, R5fis F or CI, and R5gis H; orR5cis F or CI, R5dis H, R5eis H, R5fis H, and R5gis F or CI; orR5cis H, R5dis F or CI, R5eis F or CI, R5fis H, and R5gis H; orR5cis H, R5dis F or CI, R5eis H, R5fis F or CI, and R5gis H; orR5cis H, R5dis F or CI, R5eis H, R5fis H, and R5gis F or CI; orR5cis H, R5dis H, R5eis F or CL R5fis F or CI, and R5gis H; orR5cis H, R5dis H, R5eis F or CI, R5fis H, and R5gis F or CI; orR5is H, R5dis H, R5eis H, R5fis F or CI, and R5gis F or Ci; orRScis F or CI, R5dis F or CI, R5eis F or CI, R5fis H, and R5gis H; or R5cis F or CI, R5dis F or CI, R5eis H, R5fis F or CI, and R5gis H; or R5cis F or CI, R5dis F or CI, R5eis H, R5fis H, and R5gis F or CI; or R5cis F or CI, R5dis H, R5eis F or CI, R5fis F or CI, and R5gis H; orR5cis F or CI, R5dis H, R5eis F or Ci, R5fis H, and R5gis F or CI; or R5cis F or CI, R5dis H, R5eis H, R5fis F or CI, and R5gis F or CI; or R5cis H, R5dis F or CI, R5eis F or CI, R5tis F or CI, and R5gis H; or R5cis H, R5dis F or CI, R5eis F or CI, R5fis H, and R5gis F or CI; or R5cis H, R5dis F or CI, R5eis H, R5fis F or CI, and R5gis F or CI; orR5cis H, R5dis H, R5eis F or CI, R5fis F or CI, and R5gis F or CI; or R5cis H, R5dis F or CI, R5eis F or CI, R5fis F or CI, and R5gis F or CI; or R5cis F or CI, R5dis H, R5eis F or Ci, R5fis F or CI, and R5gis F or CI; orR5cis F or CI, R5dis F or CI, R5eis F or CI, R5iis H, and R5gis F or CI; or R5cis F or CI, R5dis F or CI, R5eis F or C , R5fis F or CI, and R5gis H; wherein H, F, or CI in one of R5c, R5d, R5e, R5f, and R5gis optionally replaced with a quenching moiety R9. e embodiments:R5Cs F, R5dis H, R5eis H, R is H, and R5§is H; orR5cs H, R5dis F, R5eis H, R5fis H, and R5gis H; orR5cs H, R5dis H, R5eis F, R5fis H, and R5§is H; orR5cs H, R5dis H, R5eis H, R5fis F, and R5gis H; orR5c s H, R5dis H, R5eis H, R5fis H, and R5gis F; orR5cs F, R5dis F, R5eis H, R5fis H, and R5gis H; orR5c s F, R5dis H, R5eis F, R5fis Ft, and R5gis H; orR5c s F, R5dis H, R5eis H, R5fis F, and R5gis H; orR5cs F, R5dis H, R5eis H, R5fis H, and R5gis F; orR5cs H, R5dis F, R5eis F, R5fis H, and R5is H; orR5cs H, R5dis F, R5eis H, R5fis F, and R5gis H; orR5c s H, R5dis F, R5eis H, R5fis H, and R5gis F; orR5c s H, R5dis H, R5eis F, R5fis F, and R5gis H; orR5c s H, R5dis H, R5eis F, R5fis Ft, and R5gis F; orRSc s Ft, R?ais H, R3eis H, R5iis F, and R,gis F; orR5cs F, R5dis F, R5eis F. R5fis H, and R5gis H; orR5c s F, R5dis F, R5eis H, R5fis F, and R5gis H; orR5cs F, R5dis F, R5eis H, R5fis H, and R5gis F; orR5c s F, R5dis H, R5eis F, R5fis F, and R5gis H; orR5c s F, R5dis H, R5eis F, R5fis H, and R5gis F; orR5c s F, R5dis FL R5eis H, R5fis F, and R5gis F; orRSc s H, R5dis F, R5eis F, R5fis F, and R5gis H; orR5<s H, R5dis F, R5eis F, R5fis H, and R5gis F; orR5cs H, R5dis F, R5eis H, R5fis F, and R5gis F; orR5cs FL R5dis H, R5eis F, R5fis F, and R5gis F; orR5c > 5es H, R5dis F, Rjeis F, R'51f i :s F, and R3gis F; orR5c s F, R5dis H, R5eis F, R5fis F, and R5gis F; orR5c s F, R5dis F, R5eis F, R5fis Ft, and R5gis F; orR5cis F, R5dis F, R5eis F, R5fis F, and R5gis H;wherein H or F, or CI in one of R5c, R5d, R5e, R5f, and R5gis optionallyreplaced with a quenching moiety R9.

[0194] In certain embodiments, the gingipain reactive moiety is not 2,3,5,6- tetrafluorophenoxymethyl.

[0195] In some embodiments, the compound has a structure according to Formula Ilia:or a pharmaceutically acceptable salt thereof, wherein:one of R'0, R5a, R" e, RDf, and R5gis selected from hydrogen, halogen, and a quenching moiety; andfour of R5c, R3'', R5e, R5f, and R¾are independently selected from hydrogen and halogen;provided that at least one of R5'', R5d, R,e, R5i, and3Sis halogen.

[0196] In some embodiments, the invention provides compounds with quenching moieties included in R\ Such compounds include, but are not limited to:and pharmaceutically acceptable salts thereof. 0197] In some embodiments, the compound has a structure according to Formula IV:or a pharmaceutically acceptable salt thereof, wherein:R5eis selected from H and a quenching moiety -L9-R9a;L9is a linking moiety; andR9ais selected from an azobenzene, a xanthylium, an anthroquinone, and a viologen.

[0198] In some embodiments, the reporter moiety R ' is -Rb-L3-R~1c, wherein:Rjbis selected from C3.§ alkylene, C3-8 cycloalkylene, C3-12 heterocyclylene,Cfi-io arylene, and C5-12 heteroarylene;L3is a linking moiety; andRcis selected from a chromophore or a fluorophore.

[0199] Reporting moieties containing a chromophore or a fluorophore can be useful for detecting labeled gingipains using UV-visible absorption spectroscopy or fluorimetry as described below. Any suitable chromophore or fluorophore can be used in the compounds of the invention. In general, suitable chromophores and fluorophores have a reactive group (e.g., a carboxvlate moiety, an amino moiety, a haloalkyl moiety, or the like) that can becovalently bonded to the compounds of Formula II directly or via one or more linking groups. Examples of suitable chromophores and fluorophores include, but are not limited to, those described in U.S. Pat. Nos. 7,687,282; 7,671 ,214; 7,446,202; 6,972,326; 6,716,979;6,579,718; 6,562,632; 6,399,392; 6,316,267; 6, 162,931 ; 6,130,101 ; 6,005,1 13; 6,004,536; 5,863,753; 5,846,737; 5,798,276; 5,723,218; 5,696, 157; 5,658,751 ; 5,656,449; 5,582,977; 5,576,424; 5,573,909: and 5, 187,288, which patents are incorporated herein by reference in their entirety.

[0200] In some embodiments, R,cis a boron-dipyrromethene moiety having the structure:whereinsix of R3d, Rs, R3f, R3, R3h, R3i, and R3' are independently selected from H, halogen, Ci- alkyl, C3-8 cycloalkyl, Ce-io a d, C7-i6 arylalkyl, Ci-6 acyl, and -SO3H; and whereinone of R3d, R3e, R3f, R3g, R3h, R3i, and R3jis the linking moiety -L3-.

[0201] In some embodiments, R3dand R3fare independently selected Ci_6 alkyl (e.g., methyl or ethyl), and one of R3h, RJ1, and R3' is the linking moiety -L'-. In someembodiments, RJ<Iand R',£are methyl and Rjis the linking moiety -LJ-.

[0202] In some embodiments, R,cis a cyanine moiety having the structure:whereinRkand R31are independently selected from H, Ci-6alkyl, (CH2)tCOOH,and linking moiety L3;each subscript t is independently an integer from 1 to 10;R3mand R3nare independently selected from H, halogen, Q.e alkyl, -SO3H,-PO3H2, -OPO3H2, -COOH, and linking moiety L3;each Y is independently selected from O, S, C(R"1P)2, -CH=CH-, and NR3p, where eachR3pis independently H or Q-e alkyl; andsubscript n is an integer from 1 to 6, provided that one and only one of R'lk, R31, Rjm, and R3nis the linking moiety

[0203] In some embodiments, R3cis a coumarin moiety having the structure:whereinW is N or CR3";Z is O, S, or NR3v; andeach of R3q, R3s, R3t, R3uis independently selected from H, halogen, d-6alkyl, -CN,-CF3, -COOR3v, -CON(Rv)2, -OR3v, and linking moiety -L3-; R3ris selected from -OR3vand -N(R3v)2each RJVis independently selected from H, Ci-6 alkyl, and linking moiety -ΙΛ;provided that one and only one of Rjq, R3\ R3t, R3u, and R3vis the linking moiety -ΙΛ.

[0204] In some embodiments, R3cis a xanthene moiety having the structure:wherein:T is selected from O, S, C(R3z)2, and NR3z;U is O or (Rz)2;each Rwis independently selected from H, halogen, Ci-6 alkyl, -SO3H, and linking moiety -L3-:R3xis selected from H, -OH, -ORz, -N(R3z)2. and linking moiety -L3-;R3is selected from H, Ci-c, alkyl, R3aa, and linking moiety -L3-;each RJZis independently H or Ci.f, alkyl; andR3aais selected fromwherein:each Rais independently selected from H and linking moiety -L3-;3ab ·provided that one and only one of RW, Rx, Rjy, and RjaDis linking moiety -L -

[0205] In some embodiments, R'' is a fluorescein, wherein T and U are O; R3xis OH, and R3yis:

[0206] In some embodiments, the xanthene moiety is an eosin, wherein T and U are O; R 3x is OH, each R3wis halogen (e.g., bromo), and R3is:

[0207] In some embodiments, the xanthene moiety is a rhodamine, wherein T is O; U is N(R3z)2(e.g., =NH2+); R3xis -N(R3z)2(e.g., -NH2), and R3is:

[0208] In some embodiments, the xanthene moiety is a rhodamine having the structure:wherein R~'adis selected fromone R3abis H, and the other R3abis linking moiety -I -.

[0209] In some embodiments, the invention provides compounds according to Formula II wherein the reporter moiety R3is -R,-I -R3<", wherein:R3bis selected from C3-8 alkylene, C3.8 cycloalkylene, C3-12 heterocyclylene,Ce-io aryiene, and C5-12 heteroaiylene;L3is a linking moiety; andRJCis selected from a biotin, a digoxigenin, and an antibody epitope.

[0210] In some embodiments, the reporter moiety R3is -R' -L3-R3L, wherein:R3is selected from€3.8 alkylene, C3-8 cycloalkylene, C2-12 heterocyclylene,Ce-io arylene, and€5.12 heteroarylene;L'!is a linking moiety; andRJCis selected from a fluorescein, a rhodamine, an eosin, a cyanine, a boron- dipyrromethene, a coumarin, a biotin, a digoxigenin, a FLAG peptide (or other peptide tag), an oligonucleotide, and a polynucleotide.

[0211] One of skill in the art will appreciate that compounds containing azide groups (e.g., compounds wherein R3ais -N3) can be modified with further functional groups via reaction with a complementary reaction partner such as an alkyne- bearing compound or a phosphine- bearing compound. Reaction of azides and alkynes via [3÷2] cycloaddition, commonly referred to as "click chemistry," can be used to install a variety of substituted triazole groups in the compounds of the invention. Accordingly, some embodiments of the invention provide compounds wherein linking moiety -L3- is an optionally substituted triazolyl moiety according to the formula:wherein the wavy line is point of connection to R"'aand the dashed line is the point of connection to R \

[0212] In some embodiments, L3ahas a structure -L~'b-L3c-, wherein:L'1and Icare independently selected from a bond, a divalent polymer moiety, and linear or branched, saturated or unsaturated Q-ao alkyl:one or more carbon atoms in the Ci-3o alkyl is optionally and independently replaced by O, S, Na;two or more groupings of adjacent carbon atoms in the Ci-so alkyl are optionally and independently replaced by -NRa(CO)- or -(CO)NRa-;two or more groupings of adjacent carbon atoms in the Ci-30 alkyl are optionally and independently replaced by a 4- to 8-membered, divalent carbocycle or a 4- to8-membered, divalent heterocycle having one to four heteroatoms selected from O, S, and N; andeach Rais independently selected from H and Ci-6 alkyl.

[0213] In some embodiments, the compound has a structure according to Formula V:or a pharmaceutically acceptable salt thereof, wherein:R5eis selected from H and -€(0)NH-(CH2)x-R9a; andsubscript x is an integer ranging from 1 to 4.

[0214] 95

[0215] In99VII. Methods for Probing Gingipain Activity

[0216] In another embodiment, the invention provides a method of detecting gingipain activity in a biological sample. The method includes: forming a mixture comprising the biological sample and a compound as described above under conditions sufficient for a gingipain to react with the gingipain reactive moiety of the compound; detecting the reporter moiety of the compound in the mixture; and determining that a gingipain is present in the biological sample when the reporter moiety is detected. In some embodiments, the method further includes removing unreacted compound from the mixture prior to detecting the reporter moiety of the compound in the mixture.

[0217] Any suitable biological sample can be assayed using the methods of the invention. Examples of suitable biological samples include, but are not limited to, tissue samples (e.g., gingival tissue samples or brain tissue samples), cell samples (e.g., mammalian cells obtained via buccal swab in the mouth of a patient or bacterial cells cultured from a human sample), blood or serum samples, and saliva samples.

[0218] The manner in which the biological sample and a gingipain activity probe are brought into contact with each other will depend, in part, on factors such as the type ofsample being assayed and the method by which the reporter moiety in the activity probe is detected. When gingipain activity is to be detected in a cell sample, for example, cells can be suspended in an aqueous buffer (e.g., phosphate-buffered saline, citrate-phosphate buffers, and the like) and combined in a mixture containing the gingipain activity probe and an optional co-solvent (e.g., dimethylsulfoxide, NN-dimethylfonnarnide, and the like) such that the activity probe reacts with gingipains present in the cell sample. The activity probe will typically be used in concentrations ranging from around 1 μΜ to around 5 mM, and the cells will be incubated at temperatures ranging from around 4 °C to around 40 °C for a period of time ranging from a few minutes to several hours, or longer. The cells can be collected from the mixture via centrifiigation after the incubation period, and unreacted activity probe can be removed from the mixture by repeated resuspension and centrifugation of the cells in a suitable volume of buffer. The cells can then be examined with a light microscope or fluorescence microscope, and detection of a colorimetric or fluorescent reporter moiety can be used to determine the presence and / or localization of gingipains in the cells.

[0219] The wavelength or wavelengths at which a colorimetric or fluorescent reporter moiety is detected will depend on factors including, but not limited to, the structure of the activity probe and the conditions under which the sample is analyzed. UV-visible absorption by reporter moieties can be measured, for example, at wavelengths ranging from about 190 nm to about 1100 nm (e.g., between 190 and 380 nm, or between 380 and 750 nm).Fluorescent reporter moieties can be excited at wavelengths ranging from about 300 nm to about 800 nm, and the resulting fluorescence emission can be detected as wavelengths ranging from about 350 nm to about 800 nm. Other absorption wavelengths, excitation wavelengths, and emission wavelengths can be used for detection of labeled gingipains, depending on the particular activity probe or sample employed. The reporter moiety can be detected by means that include visible inspection, photographic film, or use ofinstrumentation such as fluorimeters, quantum counters, plate readers, microscopes and flow cytometers. Instrumentation for UV'-vis absorption-based and fluorescence-based methods, as well as optical properties of colorimetric and fluorescent moieties, are known to those of skill in the art as described, for example, in The Molecular Probes™ Handbook, 11thEdition (2010).

[0220] In certain embodiments, a gingipain activity probe contains a quenching moiety that prevents detection of an absorbance signal and / or a fluorescence signal from a reporter moiety on the probe prior to binding a gingipain. For example, an activity probe with afluorescein, rhodamine, or cyanine reporter moiety can contain a gingipain-reactive moiety comprising an aminobenzene quenching moiety such as dabcyl. The proximity of the reporter moiety and the quenching moiety prior to reaction with a target gingipain will prevent fluorescence detection, which can advantageously reduce background signal.Release of the quenching moiety upon reaction of the gingipain-reactive moiety with the target gingipain then allows for detection of the fluorescent reporter moiety.

[0221] A biological sample obtained from a subject can be used to prepare a cell lysate or tissue lysate, and the lysate can be combined with an activity probe as described above such that gingipains in the lysate react with the probe. Unreacted activity probe may be removed from the lysate mixture via gel filtration, and gingipains can be identified in the mixture via detection of the reporter moiety via UV-vis absorption spectroscopy or fluorimetry.Alternatively, labeled gingipains can be separated from unreacted activity probe and other mixture components via electrophoresis (e.g., SDS-PAGE, capillary' electrophoresis, isoelectric focusing, and the like). Labeled gingipains can be detected in a resolved sample such as a polyacrylamide gel by detecting a colorimetric or fluorescent activity probe. If a biotin, a FLAG peptide, or another affinity-based reporter moiety is used, the gel can be probed with a labeled binding partner such as streptavidin-fluorescein or a labeled antibody (or a primary / secondary antibody pair) to detect labeled gingipains in the resolved sample. If necessary, labeled gingipains can be transferred by electroblotting from a polyacrylamide gel or other resolved sample to a suitable support material such as nitrocellulose, polyvinylidene fluoride (PVDF), or the like prior to the detection step.

[0222] A tissue sample can be obtained from a subject, sectioned, and mounted for treatment with a gingipain activity probe. The sample may be freshly frozen, and optionally fixed with ethanol, formalin, or another suitable fixative prior to treatment with the gingipain activity probe. Unreacted activity probe may be removed from the tissue sample by immersing the mounted sample in one or more portions of water or buffer prior to detection of the reporter moiety. The use of probes with a quenching moiety can enable the detection of a signal in tissue samples without the necessity to remove any unreacted activity probe. Labeled gingipains can be detected using a light microscope or fluorescence microscope as described above in conjunction with one or more labeled binding partners if necessary.

[0223] When gingipains are labeled with an activity probe having an affinity-based reporter moiety (e.g., a biotin, a digoxigenin, a FLAG peptide, or other epitope), labeled gingipainscan be separated from complex mixtures (e.g., a cell lysate or tissue lysate) using a binding partner immobilized on a suitable support. As a non-limiting example, gingipains can be modified with a biotin activity probe and bound to streptavidin beads (e.g., crosslinked polysaccharides, porous silica gel, magnetic particles, or the like bearing covalently or non- covalently bound streptavidin). The beads with bound gingipains can be isolated from the mixture via physical means such as centrifugation or filtration prior to detection of the reporter moiety in the activity probe. Surfaces bearing antibodies specific for a reporter moiety epitope (e.g., a FLAG peptide) can be used for binding and detecting labeled antibodies via techniques including, but not limited to, ELISA (including sandwich ELISA and competitive ELISA) and surface plasmon resonance analysis.VIII. ExamplesExample 1. Preparation of (S)-N-(7-amino-2-oxo-l-(2,3,6-trifluorophenoxy)heptan-3- yl)cyclopentanecarboxamide (1) hydrochloride1.4 1.3

[0224] To a mixture of compound 1.4 (23.0 g, 67.2 mmol, 1.00 eq) in TH F (200 mL) was added NMM (6.79 g, 67.2 mmol, 7.38 mL, 1.00 eq), isobutyl carbonochloridate (9.17 g, 67.2 mmol, 8.82 mL, 1.00 eq), and diazomethane (5.65 g, 134 mmol, 2.00 eq) at -40 °C under N2(15 psi). The mixture was stirred at 0 °C for 30 min. LCMS showed the reaction was completed. FLO (200 mL) was added to the reaction and extracted with two 300-mL portions of ethyl acetate. The combined organic phase was washed with two 200-mL portions of brine (200, dried with anhydrous N2SC>4, filtered and concentrated under vacuum to provide crude compound 1.3 (30.0 g, crude) as a yellow oil.1.3 1.2

[0225] To a mixture of compound 1.3 (20.0 g, 54.6 mmol, 1.00 eq) in EtOAc (300 mL) was added hydrogen bromide (29.8 g, 121.7 mmol, 20.0 mL, 33% purity, 2.23 eq) at -20 °C under N2 (15 psi). The mixture was stirred at -20 °C for 10 min. TLC (petroleum ether : ethyl acetate = 0:1) showed the reaction was completed. The reaction was basified by addition of saturated NaHCOs until the pH of the mixture reached 8, and the mixture was extracted with three 500-mL portions of EtOAc. The combined organic phase was washed with two 200- mL portions of brine, dried over anhydrous Na S04, filtered and concentrated under vacuum to afford crude compound 1.2 (15.0 g, crude) as a yellow solid.

[0226] To a mixture of compound 1.2 (4.00 g, 9.54 mmol, 1.00 eq) in DMF (40.0 mL) was added 2,6-difluorophenol (1.49 g, 11.4 mmol, 1.20 eq) and KF (1.66 g, 28.6 mmol, 670 μί, 3.00 eq) at 25 °C. The mixture was stirred at 25 °C for 3 h. TLC (petroleum ether: ethyl acetate = 1 : 1 ) showed the reaction was completed. ¾0 ( 150 mL) was added to the mixture and extracted with two 200-mL portions of ethyl acetate. The combined organic phase was washed with two 100-mL portions of brine, dried with anhydrous2S04, filtered, and concentrated under vacuum. The residue was purified by silica gel chromatography(petroleum ether: ethyl acetate = 100: 1, 5: 1) to afford compound 1.1 (2.50 g, 5.35 mmol, 56.1 % yield) as a yellow solid.1.1 1

[0227] To a mixture of compound 1.1 (4.00 g, 8.22 mmol, 1.00 eq) in EtOAc (3.00 mL) was added HCl / EtOAc (40.0 mL) at 25 °C. The mixture was stirred at 25 °C for 2 h. TLC (petroleum ether : ethyl acetate=2: 1) showed the reaction was completed. The mixture was concentrated in reduced pressure to provide (.S)-N-(7-amino-2-oxo-l-(2,3,6- trifluorophenoxy)heptan-3-yl)cyclopentanecarboxamide 1 hydrochloride salt (1.34 g, 3.16 mmol) as a light yellow solid. LCMS (ESI): m / z [M + H] calcd for CwH^ zFsC . 387.2; found 387.1 ; RT=2.508 min. 'H MR (400 MHz, DMSO-<¾) δ ppm 1.21 - 1.83 (m, 15 H) 2.60 - 2.81 (m, 3 H) 4.30 (ddd, .7=9.70, 7.17, 4.52 Hz, 1 H) 5.02 - 5.22 (m, 2 H) 7.12 - 7.24 (m, 2 H) 7.98 (br s, 3 H) 8.32 (d, J=7.28 Hz, 1 H).Example 2. Preparation of (lV)-^Y-(7-amino-l-(2,6-difluorophenoxy)-2-oxoheptan-3- yl)cyclopentanecarboxamide (2) hydrochloride

[0228] Compound 1.2 (4.00 g, 9.54 mmol, 1.00 eq) was prepared as described above and combined with DMF (40.0 mL), 2,6-difluorophenol ( 1.49 g, 11.5 mmol, 1.20 eq), and KF (1.66 g, 28.6 mmol, 670 μΤ, 3.00 eq) at 25 °C. The mixture was stirred at 25 °C for 3 h. TLC (petroleum ether: ethyl acetate = 1 : 1) showed the reaction was completed. H?0 (150 mL) was added to the mixture and extracted with ethyl acetate (100 mL*2). The combined organic phase was washed with brine (100 mL*2), dried with anhydrous Na2SC»4, filtered and concentrated under vacuum. The residue was purified by silica gel chromatography(petroleum ether: ethyl acetate = 100:1, 5: 1) to afford compound 2.1 (2.50 g, 5.35 mmol, 56.1 % yield) as a yellow solid.2.1 2

[0229] To a mixture of compound 2.1 (3.50 g, 7.47 mmol, 1.00 eq) in EtOAc (2.00 mL) was added HCl / EtOAc (20.0 mL) at 25 °C. The mixture was stirred at 25 °C for 1 h. TLC (petroleum ether : ethyl acetate=l : 1) showed the reaction was completed. The residue was pre-purified by prep-HPLC (acid) to afford (1S -N-(7-amino-l-(2,6-difluorophenoxy)-2- oxoheptan-3-yl)cyclopentanecarboxamide 2 hydrochloride salt (1.13 g, 2.79 mmol) as a light yellow solid. LCMS (ESI): m / z: [M + H] calcd for C19H26 2F2O3: 369.2; found 369.1 ; RT=2.439 min. Ή NMR (400 MHz, DMSO-c¾) δ ppm 1.18 - 1.84 (m, 15 H) 2.56 - 2.82 (m, 3 H) 4.25 - 4.39 (m, 1 H) 4.92 - 5.13 (m, 2 H) 7.02 - 7.18 (m, 3 H) 7.91 (br s, 3 H) 8.27 (br d, J=7.28 Hz, 1 H).Example 3. Preparation of racemic A-(7-amino-2-oxo-l-(2,3,6-trif iorophenoxy)- heptan-3-yl)cyclopentanecarboxamideBoc1b.5 1b.4

[0230] To a mixture of cyclopentanecarboxylic acid (4.40 g, 38.6 mmol, 4.19 mL, 0.95 eq) in DCM (50.0 mL) was added (COCl)2 (5.87 g, 46.3 mmol, 4.05 mL, 1.14 eq) at 15 °C. The mixture was stirred at 15 °C for 30 min. Then it was concentrated under vacuum to form a residue which was dissolved in EtOAc (40.0 mL). The resulting solution was added dropwise to a mixture of compound lb.5 (10.0 g, 40.6 mmol, 1.00 eq), NaiCO, (5.16 g, 48.7mmol, 1.20 eq), and NaOH (1.64 g, 41.0 mmol, 1.01 eq) in H20 (80.0 mL) at 0 °C. Then the mixture was stirred at 15 °C for 14 hours. LCMS showed the reaction was completed. The ethyl acetate was removed, and the remaining solution was cooled to 0 °C prior to adjustment of the pH to 6-7 with solid KHS04. The mixture was filtered to collect compound lb.4 (12.0 g, 35.0 mmol, 86.3% yield) as a white solid.1 b.4 1b.3

[0231] To a mixture of compound lb.4 ( 12.0 g, 35.0 mmol, 1.00 eq) in THF (300 mL) was added NMM (3.54 g, 35.0 mmol, 3.85 mL, 1.00 eq) isobutyl carbonochloridate (4.79 g, 35.0 mmol, 4.61 mL, 1.00 eq), and diazomethane (2.95 g, 70.1 mmol, 2.00 eq)at -40 °C under N2(15 psi). The mixture was stirred at 0 °C for 30 min. TLC (petroleum ether: ethyl acetate=0: 1) showed the reaction was completed. H20 (100 mL) was added to the reaction and extracted with two 200-mL portions of ethyl acetate. The combined organic phase was washed with two 100-niL portions of brine, dried with anhydrous Na:SO.i. filtered, and concentrated under vacuum to provide compound lb.3 (13.7 g, crude) as a yellow oil.c1b.3 1b.2

[0232] To a mixture of compound lb.3 (13.7 g, 37.4 mmol, 1.00 eq) in EtOAc (140 mL) was added hydrogen bromide (20.9 g, 85.3 mmol, 14.0 mL, 33% purity, 2.28 eq) at -20 °C under N2(15 psi). The mixture was stirred at -20 °C for 10 min. TLC (petroleum ether: ethyl acetate=2: 1) showed the reaction was completed. The reaction was basified by sat. NaHCo3 until the pH reach 8, and the mixture was extracted with three 200-mL portions of EtOAc.The combined organic phase was washed with two 100-mL portions of brine, dried over anhydrous Na?SC>4, filtered, and concentrated under vacuum to afford compound lb.2 (8.80 g, crude) as a yellow solid.1b.2 21.1

[0233] To a mixture of compound lb.2 (400 mg, 954 μηιοΐ, 1.00 eq) in DMF (10.0 iitL) was added KF (166 mg, 2.86 mmol, 67.0 μL, 3.00 eq) and 2,3,6-trifluorophenol (170 mg, 1.14 mmol, 1.20 eq) at 25CC. The mixture was stirred at 25CC for 10 h. TLC (petroleum ether: ethyl acetate=2: l) showed the reaction was completed. Then the mixture was diluted with H20 (10 niL) and extracted with three 10-mL portions of EtOAc. The organic layers were combined, washed with brine (10 niL), dried over"Na.-;S04. filtered, and concentrated under reduced pressure to afford compound 21.1 (400 mg, 822 μηιοΐ, 86.2% yield) as a yellow oil.21.1 21

[0234] To a mixture of compound 21.1 (400 mg, 822 μηιοΐ. 1.00 eq) in EtOAc (5.00 inL) was added HCl / EtOAc (822 μτηοΐ, 15.0 mL, 1.00 eq) at 25 °C, The mixture was stirred at 25CC for 30 min. TLC (petroleum ether : ethyl acetate=2: l ) showed the reaction was completed. The reaction was concentrated under reduced pressure. The residue was purified by prep-HPLC to provide compound 21 trifluoroacetate salt (90.0 mg, 213 μηιοΐ, 25.9% yield) as a light yellow solid.

[0235] Compound 1 (36 mg) and compound 21 (36 mg) were mixed with water (2 mL) and MeOH (0.5 mL). Then, the solvent was removed by lyophilization to provide racemic N-(7- amino-2-oxo-i-(2,3,6-frifluorophenoxy)heptan-3-yl)cyclopentanecarboxamidetrifluoroacetate salt (72 mg). Example 4. Preparation of racemic V-(7-amino-l-(2,6-difluorophenoxy)-2-oxoheptan-3- yl)cyclopentanecarboxamide1b.2 2b.1

[0236] Compound lb.2 (400 mg, 954 μηιοΐ, 1.00 eq), prepared as described above, was combined with DMF (10.0 mL) KF (166 mg, 2.86 mmol, 67.0 μΐ., 3.00 eq), and 2,6- difluorophenoi (149 mg, 1.14 mmol, 1.20 eq) at 25 °C. The mixture was stirred at 25 °C for 10 h. TLC (petroleum ether: ethyl acetate=2:l) showed the reaction was completed. The mixture was diluted with ¾0 (10 mL) and extracted with three 10-mL portions of EtOAc. The organic layers were combined, washed with brine (10 mL), dried over NaiSC , filtered, and concentrated under reduced pressure to provide crude 2b.1 (400 mg, crude) as a yellow oil.2b.1 2b

[0237] To a mixture of 2b.l (400 mg, 856 μηιοΐ, 1.00 eq) in EtOAc (5.00 mL) was added HCl / EtOAc (856 μιηοΐ, 15.0 mL, 1.00 eq) at 25 °C. The mixture was stirred at 25 °C for 30 rnin. TLC (petroleum ether: ethyl acetate=2: 1) showed the reaction was completed. The mixture was concentrated under reduced pressure, and the resulting residue was purified byprep-HPLC to afford compound 2b trifluoroacetate salt (70.0 mg, 173 μτηοΐ, 20.2% yield) as a light yellow solid.

[0238] A racemic mixture of N-(7-amino-l-(2,6-difluorophenoxy)-2-oxoheptan-3- yl)cyclopentanecarboxamide trifluoroacetate salt (55 mg) was prepared by combining compound 2 and compound 2b as described above for compound 1 and compound 21.Example 5. Preparation of (.V)-A'-(7-amino-l-(2-fluorophenoxy)-2-oxoheptan-3-vI)cyclo- pentanecarboxamide (3)Boc1.5 1.4

[0239] To a mixture of compound 1.5 (10.00 g, 40.60 mmol, 1.00 eq) andcyclopentanecarbonyl chloride (5.92 g, 44.66 mmol, 5.43 mL, 1.10 eq) in EtOAc (20.00 mL) was added Na2C03(5.16 g, 48.72 mmol, 1.20 eq) and NaOH (1.64 g, 41.01 mmol, 1.01 eq) in 3¾0 (80.00 mL) at 0°C under N?. The mixture was stirred at 10°C for 3 hours. EtOAc was removed and then the solution was cooled to 0 °C, and the pH was adjusted to 6-7 with HCl (IN). The suspension was filtered, and the filter cake was washed with 50 mL of PE and dried under vacuum to afford compound 1.4 (10.60 g, 30.96 mmol, 76.26% yield) as a white solid. LCMS (ESI): m / z: [M + H] calcd for C7H30 2O5: 343.4: found 343.2; RT=1.022 min.c1.4 1.3

[0240] To a mixture of compound 1.4 (2.00 g, 5.84 mmol, 1.00 eq) in THF (20.00 mL) was added NMM (708.86 mg, 7.01 mmol, 770.50 ,uL, 1.20 eq) and isobutyl carbonochloridate (797.61 mg, 5.84 mmol, 766.93 μί, 1.00 eq) in one portion at -20°C under N2. The mixture was stirred at -20 °C for 1 hour. A diazomethane solution in Et20 (20ml) was added at 0 °C and stirred for 2 hours. The mixture was diluted with H20 (20 mL) and extracted withEtOAc (3 x 20 niL). The organic layers were combined, dried over Na2S04, filtered, and concentrated under reduced pressure to give a residue, which was purified by silica gel chromatography (PE EtOAc= 1 / 1) to afford compound 1.3 (130.00 mg, 354.76 μιηοί) as a yellow solid. LCMS (ESI): m / ∑: [M + H] calcd for ('< , ,0,: 367.4; found 339.2;RT=0.772 mm.1.3 1.2

[0241] To a mixture of compound 1.3 (130.00 mg, 354.75 μιηοΐ, 1.00 eq) in EtOAc ( 1.00 mL) was added HBr / AcOH ( 1 0.00 μΐ^, 33% purity) in one portion at -20°C under N?.The mixture was stirred at -20 °C for 10 mins under N2, basified with sat. NaHCO.-i to pH = 8, and extracted with EtOAc (3 x 10 mL). The organic layers were combined, dried over Na2S04, filtered, and concentrated to afford compound 1.2 (100.00 mg, 238.46 μηιοΐ, 67.22% yield) as a white solid. LCMS (ESI): m / z [M + H] calcd for C18H31N2O4: 420.3; found 316.2; RT=0.709 min.1.2 3.1

[0242] To a mixture of compound 1.2 (50.00 mg, 119.23 μιηοί, 1.00 eq) and 2- fluorophenol (13.37 mg, 1 19.23 μηιοΐ, 1 1.05 μί, 1.00 eq) in DMF (1.00 mL) was added KF (20.78 mg, 357.69 μιηοΐ, 8.38 μί, 3.00 eq) in one portion at 20°C under N2. The mixture was stirred at 20 °C for 15 hours. The aqueous phase was extracted with EtOAc (3 x 5 mL 3). The combined organic phase was washed with brine (3 mL), dried with anhydrous a S04, filtered, and concentrated under vacuum. Then the residue was purified by prcp- HPLC (TFA condition) to afford compound 3.1 (15.00 mg, 33.29 μιηοΐ, 27.92% yield) as ayellow oil LCMS (ESI): m / z: [M + H] calcd for C24H36N2O5F: 451.5; found 451.4;T=0.929 min.3.1 3

[0243] A mixture of compound 3.1 ( 15.00 mg, 33.29 μηιοΐ, 1.00 eq) in HCl / EtOAc ( 1.00 mL) was stirred at 20 °C for 3 hoiirs. The solution was evaporated to remove organic solvents. The residual aqueous solution was lyophilized to afford compound 3 hydrochloride salt (2.00 mg, 5.71 μιηοΐ, 17.14% yield) as a white solid. LCMS (ESI): m / z [M + H] calcd for Ci9H28N203F: 351.4; found 351.3; RT=2.477 mm. Ή NMR (400 MHz, DMSO- .) δ ppm 1.25 - 1.83 (m, 17 H) 2.61 - 2.87 (m, 4 H) 4.24 - 4.43 (m, 1 H) 4.95 - 5.13 (m, 2 H) 6.87 - 7.27 (m, 4 H) 7.83 (br s, 3 H) 8.31 (d, J=6.90 Hz, I H).Example 6. Preparation of (.S')- \-(7-amino-2-oxo-l-(2,3,5-trifluorophenoxy)heptan-3- yl)cyclopeiitaiiecarboxamide (4)1.2 4.1

[0244] To a mixture of compound 1.2 (100.00 mg, 238.46 μιηοΐ, 1.00 eq) and 2,3,5- trifluorophenol (42.37 mg, 286.15 μηιοΐ, 1.20 eq) in DMF (1.00 mL) was added KF (41.56 mg, 715.38 μιηοΐ, 16.76 μΕ, 3.00 eq) in one portion at 25°C under N2. The mixture was stirred at 25°C for 15 hours. The reaction mixture was poured into H20 (50mL), and the aqueous phase was extracted with EtOAc (3 x 20mL). The combined organic phase was washed with brine (5 mL), dried with anhydrous Na2SC>4, filtered, and concentrated under vacuum. Then the residue was purified by prep-HPLC (TFA condition) to afford compound4.1 (50.00 mg, 102.77 μηιοΐ, 43.10% yield) as a white solid. LCMS (ESI): m / z\ [M + H] calcd for C24H33N2F3O5: 487.2; found 487.3; RT=0.936 min.4.1 4

[0245] A mixture of compound 4.1 (50.00 mg, 102.77 μιηοΐ, 1.00 eq) in HCl / EtOAc (2.00 mL) was stirred under N2at 20 °C for 15 hours. The solution was evaporated to remove organic solvents. The residual aqueous solution was lyophiiized to afford compound 4 hydrochloride salt (30.00 mg, 77.64 μηιοΐ, 75.55% yield) as a white solid. LCMS (ESI): m / r. [M + H] calcd for C19H25N2F3O3: 387.2; found 387.2; RT=2.32I min. ¾ NMR (400 MHz, DMSO-i / e) δ ppm 1.24 - 1.85 (m, 15 H) 2.63 - 2.83 (m, 3 H) 4.20 - 4.35 (m, 1 H) 5.18 (d, J=1.32 Hz, 2 H) 6.83 - 7.14 (m, 2 H) 7.98 (br s, 3 H) 8.44 (d, J=6.62 Hz, 1 H).Example 7. Preparation of (5)-7V-(7-amino-l-(2,3-difluorophenoxy)-2-oxoheptan-3- yl)cyclopentanecarboxamide (5)1.2 5.1

[0246] To a mixture of compound 1.2 ( 100.00 mg, 238.46 μιηοΐ, 1.00 eq) in DMF ( 1.00 mL) was added KF (41.56 mg, 715.38 μιηοΐ, 16.76 μΐ., 3.00 eq) and 2,3-difluorophenol(37.23 mg, 286.15 μηιοΐ, 1.20 eq) in one portion at 20°C under N2. The mixture was stirred at 20°C for 15 hours. The reaction mixture was poured into H20 (5mL), and the aqueous phase was extracted with EtOAc (3 x 5mL). The combined organic phase was washed with brine (3 mL), dried with anhydrous Na2SC»4, and filtered and concentrated under vacuum.Then the residue was purified by prep-HPLC (TFA condition) to afford compound 5.1 (50.00 mg, 106.72 μηιοΐ, 44.75% yield) as a white solid.5.1 5

[0247] A mixture of compound 5.1 (50.00 mg, 106.72 μηωΐ, 1.00 eq) in HCl / EtOAc (2.00 mL) was stirred under N2 at 20 °C for 15 hows. The solution was evaporated to remove organic solvents. The residual aqueous solution was lyophilized to afford compound 5 hydrochloride salt (15.00 mg, 40.71 μιηοΐ, 38.15% yield) as a white solid. LCMS (ESI): m / r. [M + H] calcd for C^h NbFO,: 369.2; found 369.2; RT=2.246 min. Ή NMR (400 MHz, DMSO / 6) δ ppm 1.23 - 1.83 (m, 15 H) 2.62 - 2.83 (m, 3 H) 4.32 (ddd, J=9.59, 6.73, 4.63 Hz, 1 H) 5.03 - 5.19 (m, 2 H) 6.77 - 7.14 (m, 3 H) 7.90 (br s, 3 H) 8.36 (d, J=6.83 Hz, 1 H).Example 8. Preparation of (5)-A-(7-amino-l-(2,5-difluorophenoxy)-2-oxoheptan-3- yl)cyelopentanecarboxamide (6)1.2 6.1

[0248] To a mixture of compound 1.2 (100.00 mg, 238.46 μηιοΐ, 1.00 eq) in DMF ( 1.00 mL) was added KF (41.56 mg, 715.38 μηιοΐ, 16.76 \L, 3.00 eq) and 2,5-difluorophenol(37.23 mg, 286.15 μηιοΐ, 1.20 eq) in one portion at 20°C under N2. The mixture was stirred at 20°C for 15 hours. The reaction mixture was poured into ¾0 (5mL), and the aqueous phase was extracted with EtOAc (5mL*3).The combined organic phase was washed with brine (3 mL), dried with anhydrous NaiSC , filtered, and concentrated under vacuum. Then the residue was purified by prep-HPLC (TFA condition) to afford compound 6.1 (41.00 mg, 87.51 μηιοΐ, 36.70% yield) as a white solid.6.1 6

[0249] A mixture of compound 6.1 (41.00 mg, 87.51 μηιοΐ, 1.00 eq) in HCl / EtOAc (2.00 mL) was stirred under N2at 20 °C for 15 hours. The solution was evaporated to remove organic solvents. The residual aqueous solution was lyophilized to afford compound 6 hydrochloride salt (17.00 mg, 46.14 μιηοΐ, 52.73% yield) as a white solid. LCMS (ESI): m / z: [M + H] calcd for Ci9H26N2F203: 369.2; found 369.2; RT=2.239 mm. Ή NMR (400 MHz, DMSO6) δ ppm 1.10 - 1.85 (m, 16 H) 2.62 - 2.84 (m, 3 H) 4.31 (br t, J=10.23 Hz, 1 H) 5.02 - 5.18 (m, 2 H) 6.69 - 7.33 (m, 3 H) 7.85 (br s, 3 H) 8.35 (br d, J=6.65 Hz, 1 H).Example 9. Preparation of (.V)-A'-(7-aiiiino-l-(3-fluorophenox )-2-oxoheptaii-3- yl)cyclopentanecarboxamide (7)1.2 7.1

[0250] To a mixture of compound 1.2 (100.00 mg, 238.46 μ ιηοΐ, 1.00 eq) in DMF (1.00 mL) was added KF (41.56 mg, 715.38 μηιοΐ, 16.76 μί, 3.00 eq) and 3-fluorophenol (32.08 mg, 286.15 μιηοΐ, 26.30 μL, 1.20 eq) in one portion at 20°C under N2. The mixture was stirred at 20°C for 15 hours. The reaction mixture was poured into H20 (5mL), the aqueous phase was extracted with EtOAc (3 x 5mL).The combined organic phase was washed with brine (3 mL), dried with anhydrous Na2SC>4, filtered and concentrated under vacuum. Then the residue was purified by prep-HPLC (TFA condition) to afford compound 7.1 (47.00 mg, 104.32 μιηοΐ, 43.75% yield) as a white solid.7.1 7

[0251] A mixture of compound 7.1 (47.00 mg, 104.32 μηιοΐ, 1.00 eq) in HCl / EtOAc (2.00 mL) was stirred under N2at 20 °C for 15 hours. The solution was evaporated to remove organic solvents. The residual aqueous solution was lyophilized to afford compound 7 hydrochloride salt (20.00 mg, 57.07 μιηοΐ, 54.71% yield) as a white solid. LCMS (ESI): m / z: [M + H] calcd for C19H27 2FO3: 351.2; found 351.2; T=2.205 min.!H NMR (400 MHz, DMSO-6) δ ppm 1.19 - 1.85 (m, 15 H) 2.60 - 2.87 (m, 3 H) 4.33 (ddd, J=9.43, 6.67, 4.85 Hz, 1 H) 4.93 - 5.13 (m, 2 H) 6.61 - 6.88 (m, 3 H) 7.68 (br s, 3 H) 8.27 (d, J=6.84 Hz, 1 H).Example 10. Preparation of (iS')-A-(7-amino-l-(3,5-difluorophenoxy)-2-oxoheptan-3- yl)cyclopentaiiecarboxamiik (8)1.2 8.1

[0252] To a mixture of compound 1.2 (100.00 mg, 238.46 μιηοΐ, 1.00 eq) in DMF (1.00 mL) was added KF (41.56 mg, 715.38 μιηοΐ, 16.76 μΕ, 3.00 eq) and 3,5-difluorophenol (37.23 mg, 286.15 μιηοΐ, 1.20 eq) in one portion at 20°C under N2. The mixture was stirred at 20°C for 15 hours. The reaction mixture was poured into H2O (5mL), and the aqueous phase was extracted with EtOAc (3 x 5mL).The combined organic phase was washed with brine (3 mL), dried with anhydrous Na2SC>4, filtered, and concentrated under vacuum. Then the residue was purified by prep-HPLC (TFA condition) to afford compound 8.1 (50.00 mg, 106.72 μηιοΐ, 44.75% yield) as a white solid.8.1 8

[0253] A mixture of compound 8.1 (50.00 mg, 106.72 μηιοΐ, 1.00 eq) in HCl / EtOAc (2.00 mL) was stirred under N2at 20 °C for 4 hours. The solution was evaporated to remove organic solvents. The residual aqueous solution was lyophilized to afford compound 8 hydrochloride salt (20.00 mg, 54.29 Limol, 50.87% yield) as a white solid. LCMS (ESI): m / z: [M + H] calcd for C19H26N2F2O3: 369.2; found 369.1 ; T=2.750 min. 'H NMR (400 MHz, DMSO-£¾) δ ppm 1.24 - 1.82 (m, 15 H) 2.61 - 2.83 (m, 3 H) 4.32 (ddd, J=9.43, 6.67, 4.85 Hz, 1 H) 4.96 - 5.08 (m, 2 H) 6.67 (dd, J=9.48, 2.21 Hz, 2 H) 6.79 (tt, J=9.43, 2.26 Hz, 1 H) 7.67 (br s, 3 H) 8.26 (d, J=6.84 Hz, 1 H). Example 11. Preparation of (R)-3-(acetamido-2,2,2-d3)-N-(7-amino-l-(2,6-difluoro- phenoxy)-2-oxoheptan-3-yI)beiizamide (10)10.7 10.6

[0254] To a solution of compound 10.7 (10.00 g, 72.92 mmol, 1.00 eq) in MeOH (100.00 mL) was added SOCl2(17.35 g, 145.84 mmol, 10.58 mL, 2.00 eq) in one portion at 0°C under N2. The mixture was stirred at 65°C for 15 hours. The reaction mixture was poured into H2O (20mL), and the aqueous phase was extracted with EtOAc (3 x lOmL). The combined organic phase was washed with brine (5 mL), dried with anliydrous Na2SC>4, filtered, and concentrated under vacuum to afford compound 10.6 (13.10 g, crude) as a white solid.LCMS (ESI): m / z: [M + H] calcd for C8H9N02: 152.1 ; found 152.2; RT=1.191 min. ¾ NMR (400 MHz, methanol-<¾) δ ppm 3.35 (s, 3 H) 3.95 (s, 3 H) 7.65 - 7.72 (m, 2 H) 8.07 (s, 1 H) 8.10 - 8.16 (m, 1 H)10.6 10.5

[0255] To a mixture of compound 10.6 (3.77 g, 24.97 mmol, 1.00 eq), HOBt (3.71 g, 27.47 mmol, 1.10 eq), and EDCI (4.79 g, 24.97 mmol, 1.00 eq) in DMF (50.00 mL) was added DIEA (16.14 g, 124.85 mmol, 21.80 mL, 5.00 eq) and deuterio 2,2,2-trideuterioacetate (1.60 g, 24.97 mmol, 1.00 eq) in one portion at 0°C under N2. The mixture was stirred at 15 °C for 15 hours. The reaction mixture was poured into H20 (20mL), and the aqueous phase was extracted with EtOAc (3 x lOmL). The combined organic phase was washed with brine (5 mL), dried with anhydrous a2SC>4, filtered, and concentrated under vacuum. The residue was purified by column chromatography (S1O2, petroleum ether / ethyl acetate=10:l to 2: 1) to afford compound 10.5 (2.90 g, 14.78 mmol 59.19% yield) as a colorless oil. LCMS (ESI): m / z: [M + H] calcd for Ci0H8D3NO3: 197.1 ; found 197.2; RT=0.634 min. *H NMR (400 MHz, chloroform-i δ ppm 3.91 (s, 3 H) 7.41 (t, J=7.94 Hz, 1 H) 7.51 (br s, 1 H) 7.78 (d, J=7.72 Hz, 1 H) 7.92 (br d, J=8.16 Hz, 1 H) 8.01 (s, 1 H).10.5 10.4

[0256] To a solution of compound 10.5 (2.90 g, 14.78 mmol, 1.00 eq) m MeOH (36.00 mL) was added NaOH (1.18 g, 29.56 mmol, 2.00 eq) in H20 (12.00 mL) in one portion at 15°C under N?. The mixture was stirred at 15 °C for 15 hours. EtOAc was removed and then the solution was cooled to 0 °C, and the pH was adjusted to 6-7 with HC1 (lN).The suspension was filtered and the filter cake was washed with 50 rnL of PE and dried under vacuum to afford compound 10.4 (2.10 g, crude) as a w hite solid. Ή NMR (400 MHz, methanol-^) δ ppm 7.41 (t, J=7.94 Hz, 1 H) 7.75 (dt, J=7.72, 1.32 Hz, 1 H) 7.82 (ddd, J=8.05, 2.21, 0.99 Hz, 1 H) 8.21 (t, J=1.87 Hz, 1 H).10.3

[0257] To a mixture of compound 10.4 (1.00 g, 5.49 mmol 1.00 eq), HOBt (815.81 mg, 6.04 mmol, 1.10 eq), and EDCI (1.16 g, 6.04 mmol, 1.10 eq) in DMF (2.00 mL) was added DIEA (2.84 g, 21.96 mmol, 3.83 mL, 4.00 eq) and methyl (2,S')-2-amino-6-(tert- butoxycarbonylamino)hexanoate (1.43 g, 5.49 mmol, 1.00 eq) in one portion at 0CC under N2. The mixture was stirred at 15 °C for 15 hours. The reaction mixture was poured into H20 (30mL), the aqueous phase was extracted with EtOAc (3 x 30mL). The combined organic phase was washed with brine (5 mL), dried with anhydrous a2S() , filtered and concentrated under vacuum. The residue was purified by column chromatography (Si02, petroleum ether / ethyl acetate=4: l to 0:1) to afford compound 10.3 (1.90 g, 4.48 mmol, 81.53% yield) as a light yellow solid. LCMS (ESI): m / z: [M + H] calcd for C2iH2SD3 306: 425.2; found 325.3; T=0.757 mm. Ή NMR (400 MHz, chloroform-; / ) δ ppm 1.31 - 1.54 (m, 14 H) 1.70 - 1.97 (m, 2 H) 2.11 - 2.19 (m, 1 H) 3.00 - 3.12 (m, 2 H) 3.71 (s, 3 H) 4.64 - 4.81 (m, 2 H) 7.1 1 (br d, J=7.50 Hz, 1 H) 7.28 - 7.36 (m, 1 H) 7.47 (br d, J=7.28 Hz, 1 H) 7.75 (br s, 1 H) 7.95 (br d, J=7.72 Hz, 1 H) 8.47 (br s, 1 H).10.3 10.2

[0258] To a solution of DIP A (760.95 mg, 7.52 mmol, 1.06 mL, 4.00 eq) in THF (15.00 mL) was added n-BuLi (481.73 mg, 7.52 mmol, 4.00 eq) at 0°C under N2. After 0.5 h, compound 10.3 (800.00 mg, 1.88 mmol, 1.00 eq) and chloro(iodo)methane (1.33 g, 7.52 mmol, 545.83 ί, 4.00 eq) were added to the mixture at -78°C under N2. The resultingmixture was stirred at -78°C for 1.5 hrs. Water (20 mL) was added, and the mixture was extracted with EtOAc (3 x 20mL). The combined organic layers were washed with brine (10 mL ), dried over Na2S04, filtered, and concentrated under reduced pressure to afford compound 10.2 (900.00 mg, crude) as a dark brown oil. LCMS (ESI): m / z: [M + H] calcd for C21H27D3CIN3O5: 442.2; found 339.3; RT=0.748 min. Ή NMR (400 MHz, chloroform-i / ) δ ppm 1.35 - 1.59 (m, 17 H) 1.67 (br s, 3 H) 1.76 - 2.02 (m, 3 H) 3.11 (br d, J=6.17 Hz, 2 H) 3.77 (s, 3 H) 4.60 - 4.82 (m, 2 H) 6.87 (br s, 1 H) 7.40 (br t, J=7.61 Hz, 1 H) 7.52 (br s, 1 H) 7.66 - 7.82 (m, 2 H) 7.92 (br s, 1 H).10.2 10.1

[0259] To a mixture of compound 10.2 (200.00 mg, 451.52 μιηοΐ, 1.00 eq) and 2,6- difliiorophenol (58.74 mg, 451.52 μιηοΐ, 1.00 eq) in DMF (4.00 mL) was added DIEA (175.06 mg, 1.35 mmol, 236.57 LlL, 3.00 eq) in one portion at 20 °C under N2.The mixture was stirred at 20 °C for 15 hours. The residue was purified by prep-HPLC (TFA condition) to afford compound 10.1 (20.00 mg, 37.27 μιηοΐ, 8.26% yield) as a dark brown solid. LCMS (ESI): m / z: [M + H] calcd for C27H30D3F2N3O6: 537.3; found 481.3; RT=1.208 min. ΉNMR (400 MHz, chloroform-d) δ ppm 1.41 (br s, 18 H) 1.80 (br s, 2 H) 2.08 - 2.24 (m, 2 H) 3.13 (br s, 3 H) 4.91 (br s, 3 H) 5.24 (br s, 1 H) 6.88 - 7.05 (m, 5 H) 7.37 - 7.46 (m, 3 H) 7.56 (br s, 2 H) 7.78 (br s, 1 H) 7.93 (br s, 1 H)10.1 10

[0260] To a solution of compound 10.1 (10.00 mg, 18.64 μηιοΐ, 1.00 eq) in DCM (10.00 mL) was added TFA (3.08 g, 27.01 mmol, 2.00 mL, 1449.18 eq) in one portion at 20°C under N?. The mixture was stirred at 20 °C for 4 hours, filtered, and concentrated under vacuum. The residue was purified by prep-HPLC (TFA condition) to afford compound 10trifluoroacetate salt (1.00 mg, 2.29 μιηοΐ, 12.29% yield) as a dark brown solid. LCMS (ESI): m / z: [M + H] calcd for C22H22D3F2N3O4: 437.2; found 437.3 ; RT=2.042 min. ¾ NMR (400 MHz, methanol-^) δ ppm 1.48 - 1.87 (m, 5 H) 2.13 (br s, 1 H) 2.91 - 2.99 (m, 2 H) 4.90 - 5.08 (m, 5 H) 6.94 - 7.12 (m, 3 H) 7.39 - 7.46 (m, 1 H) 7.54 - 7.65 (m, 2 H) 8.13 (s, 1 H).Example 12. Preparation of biotinylated gingipain inhibitor (11)10.7 11.6

[0261] To a solution of compound 10.7 (5.00 g, 36.46 mmol, 1.00 eq) in CH3CN (50.00 mL) was added t-BuONO (5.64 g, 54.69 mmol, 6.48 mL, 1.50 eq) and TMSNj (5.04 g, 43.75 mmol, 5.73 mL, 1.20 eq) in one portion at 0°C under N2. The mixture was stirred at 15 °C for 1 hour, filtered, and concentrated under vacuum. H20 (20 mL) was added, and the aqueous phase was extracted with EtOAc (3 x lOmL). The combined organic phase was washed with brine (5 mL), dried with anhydrous a2S04, filtered, and concentrated under vacuum to afford compound 11.6 (4.00 g, crude) as a white solid. LCMS (ESI): m / z: [M + H] calcd for C7H5N3O2: 164.0; found 164.1; RT=0.705 min. *H NMR (400 MHz, chloroform-d) δ ppm 2.71 (d, J=9.48 Hz, 1 H) 6.93 - 6.98 (m, 1 H) 7.27 - 7.32 (m, 1 H) 7.44 - 7.57 (m, 1 H) 7.79 - 7.84 (m, 1 H) 7.90 - 7.95 (m, 1 H).11.6 11.5

[0262] To a mixture of compound 11.6 (2.00 g, 12.26 mmol, 1.00 eq), HOBt (1.82 g, 13.49 mmol, 1.10 eq), and EDCI (2.59 g, 13.49 mmol, 1.10 eq) in DMF (40.00 mL) was added methyl (2S)-2-amino-6-(tert-butoxycarbonylamino)hexanoate (3.19 g, 12.26 mmol, 1.00 eq) and DIEA (6.34 g, 49.04 mmol, 8.57 mL, 4.00 eq) in one portion at 0°C under N2. The mixture was stirred at 15 °C for 4 hours. The reaction mixture was poured into H2O (20mL). The aqueous phase was extracted with EtOAc (3 x 50 mL). The combined organic phase was washed with brine (5 mL), dried with anhydrous Na2SC>4, filtered, and concentrated under vacuum. The residue was purified by column chromatography (Si02, petroleum ether / ethyl acetate=10:l to 2: 1) to afford compound 11.5 (3.50 g, 8.63 mmol, 70.39% yield) as a white solid. LCMS (ESI): m / z: [M + H] calcd for C9H27N5O5: 406.2; found 350.2; RT=0.840 rnin. Ή NMR (400 MHz, chloroform-i / ) δ ppm 1.39 (s, 10 H) 1.46 - 1.56 (m, 3 H) 1.75 - 2.00 (m, 2 H) 3.05 - 3.14 (m, 2 H) 3.77 (s, 3 H) 4.64 (br s, 1 H) 4.72 - 4.80 (m, 1 H) 6.94 (br d, J=7.06 Hz, 1 H) 7.14 (ddd, J=8.05, 2.32, 0.88 Hz, 1 H) 7.40 (t, J=7.83 Hz, 1 H) 7.47 - 7.56 (m, 2 H)11.5 11.4

[0263] To a solution of DTP A (2.25 g, 22.20 mmol, 3.12 mL, 6.00 eq) in THF (40.00 mL) was added n-BuLi (1.42 g, 22.20 mmol, 6.00 eq) at 0°C under N2. After 0.5 h, compound 11.5 (1.50 g, 3.70 mmol, 1.00 eq) and chloro(iodo)methane (2.61 g, 14.80 mmol, 1.07 mL, 4.00 eq) were added to the mixture at -78 C under N2. The resulting mixture was stirred at - 78°C for 1.5 hrs. The reaction mixture was added to water (20 mL), and the solution wasextracted with EtOAc (3 x 20 mL). The combined organic layers were washed with brine (10 mL), dried over Na2S04, filtered, and concentrated under reduced pressure to give a residue to afford compound 11.4 (1.50 g, crude) as a dark brown oil.11.4 11.3

[0264] To a mixture of compound 1 1.4 (1.50 g, 3.54 mmol, 1.00 eq) and 2,6- difluorophenol (460.34 mg, 3.54 mmol, 1.00 eq) in DMF (15.00 mL) was added DIEA (1.37 g, 10.62 mmol, 1.85 mL, 3.00 eq) in one portion at 20°C under N?. The mixture was stirred at 20 °C for 15 hours. The reaction mixture was added to water (20 rnL), and the solution was extracted with EtOAc (3 x 20 mL). The combined organic layers were washed with brine (10 mL), dried over a2S04, filtered, and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (Si02, petroleum ether / ethyl acetate=10: l to 2:1) to afford compound 11.3 (400.00 mg, 772.92 μιηοΐ, 21.83% yield) as a light yellow oil. LCMS (ESI): m / z: [M + H] calcd for C25H29F2N505: 518.2; found 518.3; RT=0.912 min.11.3 1 -2

[0265] To a mixture of compound 11.3 (270.00 mg, 521.72 μπιοΐ, 1.00 eq) and prop-2-yn- 1-amine (28.74 mg, 521.72 μιηοΐ, 33.41 jiL, 1.00 eq) in CH3CN (4.00 mL) was added CuS04(4.16 mg, 26.09 μιηοΙ. 4.00 μΐ, 0.05 eq) and sodium ascorbate (20.67 mg, 104.34 μηιοΐ, 0.20eq) in one portion at 20°C under N2. The mixture was stirred at 20 °C for 15 hours. The residue was purified by prep-HPLC (TFA conditions) to afford compound 11.2 (70.00 mg, 122.25 umol, 23.43% yield) as a dark brown oil. LCMS (ESI): m / z: [M + H] calcd for C28H34F2 6O5: 573.3; found 573.5; RT=0.846 min. Ή NMR (400 MHz, chloroform-^ δ ppm 1.19 - 1.69 (m, 8 H) 2.04 (br s, 1 H) 2.67 - 3.25 (m, 3 H) 4.45 (br s, 1 H) 4.72 - 5.15 (m, 2 H) 6.78 - 7.09 (m, 2 H) 7.58 - 8.01 (m, 2 H) 8.16 - 8.49 (m, 1 H) 8.63 - 9.26 (m, 1 H).

[0266] To a mixture of BIOTIN-DPEG(4)-COOH (34.34 mg, 69.86 μιηοΐ, 1.00 eq), HOBt (9.44 mg, 69.86 μιηοΐ, 1.00 eq), and EDCI (13.39 mg, 69.86 μηιοί, 1.00 eq) in DMF (1.00 mL) was added compound 11.2 (40.00 mg, 69.86 μιηοΐ, 1.00 eq) and DIEA (36.11 mg,279.44 μηιοΐ, 48.80 μί, 4.00 eq) in one portion at 0°C under N2. The mixture was stirred at 20 °C for 15 hours. The residue was purified by prep-HPLC (TFA conditions) to afford compound 11.1 (20.00 mg, 19.12 μιηοΐ, 27.37% yield) as a white solid. LCMS (ESI): m / z: [M + H] calcd for C49H69F2N9O12S: 1046.5; found 1046.3; RT=1.115 min. Ή NMR (400 MHz, DMSO-d6) δ ppm 1.21 - 1.34 (m, 12 H) 1.35 - 1.75 (m, 9 H) 1.85 (br dd, J=9.59, 3.64 Hz, 1 H) 2.05 (t, J=7.39 Hz, 2 H) 2.35 - 2.42 (m, 1 H) 2.38 (t, J=6.50 Hz, 1 H) 2.53 - 2.60 (m, 2 H) 2.80 (dd, J=12.35, 5.07 Hz, 1 H) 2.89 (br d, J=5.95 Hz, 2 H) 3.08 (ddd, J=8.49, 6.06, 4.63 Hz, 1 H) 3.16 (q, J=5.88 Hz, 2 H) 3.44 - 3.50 (m, 15 H) 3.62 (t, J=6.50 Hz, 3 H) 4.1 1 (dd, J=7.72, 4.41 Hz, 1 H) 4.29 (dd, J=7.72, 4.41 Hz, 1 H) 4.40 (d, J=5.73 Hz, 2 H) 4.59 - 4.67 (m, 1 H) 5.06 - 5.20 (m, 2 H) 6.76 (br t, J=5.51 Hz, 1 H) 7.06 - 7.14 (m, 3 H) 7.71 (t, J=8.05 Hz, I H) 7.82 (t, J=5.62 Hz, 1 H) 7.95 - 8.00 (m, 1 H) 8.06 (ddd, J=8.16, 2.21 , 0.88 Hz, 1 H) 8.36 (t, J=1.76 Hz, 1 H) 8.45 (t, J=5.51 Hz, 1 H) 8.64 (s, 1 H) 8.95 (d, J=7.28 Hz, 1 H).11

[0267] A solution of compound 11.1 (20.00 mg, 19.12 μηιοΐ. 1.00 eq) in TFA (1.03 g, 9.00 mmol, 666.1 1 μΙ_, 470.61 eq) was stirred under N2at 20 °C for 4 hours. The mixture was filtered and concentrated under vacuum to afford compound 11 trifluoroacetate salt (18.00 mg, 16.98 μιηοΐ, 88.81% yield, TFA) as a white solid. LCMS (ESI): m / z: [M + H] calcd for GwHeiFjNi oS: 946.4; found 946.6; RT=2.076 min.!H NMR (400 MHz, DMSO-t ) δ ppm 1.10 - 1.77 (m, 14 H) 1.82 - 1.95 (m, 1 H) 2.05 (t, J=7.40 Hz, 2 H) 2.17 (t, J=8.03 Hz, 1 H) 2.30 - 2.42 (m, 2 H) 2.53 - 2.60 (m, 3 H) 2.64 - 2.71 (m, 2 H) 2.73 - 2.85 (m, 3 H) 3.04 - 3.12 (m, 2 H) 3.17 (q, J=5.86 Hz, 3 H) 3.44 - 3.52 (m, 14 H) 3.63 (br t, J=6.46 Hz, 2 H) 4.08 - 4.15 (m, 1 H) 4.26 - 4.33 (m, 1 H) 4.40 (d, J=5.52 Hz, 2 H) 4.63 - 4.72 (m, 1 H) 5.07 - 5.21 (m, 2 H) 6.31 - 6.42 (m, 2 H) 6.95 - 6.99 (m, 1 H) 6.97 (s, 1 H) 7.06 - 7.15 (m, 3 H) 7.23 (s, 1 H) 7.58 - 7.76 (m, 4 H) 7.81 (br t, J=5.46 Hz, 1 H) 7.95 - 8.01 (m, 1 H) 7.98 (d, J=7.91 Hz, 1 H) 8.07 (dd, J=8.03, 1.25 Hz, 1 H) 8.38 (s, 1 H) 8.45 (t, J=5.52 Hz, 1 H) 8.63 - 8.66 (m, 1 H) 8.64 (s, 1 H) 8.98 (d, J=7.53 Hz, 1 H).Example 13. Preparation of (>S)-7V-(7-amino-l-(2,6-difluorophenoxy)-2-oxoheptan-3-yl)- 3-azidobenzamide (12)12.7 12.6

[0268] To a mixture of compound 12.7 (5.00 g, 36.46 mmol, 1.00 eq) and t-BuONO (5.64 g, 54.69 mmol, 6.48 mL, 1.50 eq) in CH3CN (70.00 mL) was added TMSN3(5.04 g, 43.75 mmol, 5.73 mL, 1.20 eq) in one portion at 18°C under N2. The mixture was stirred at 18 °C for 10 hours. The reaction mixture was diluted with H20 (100 mL) and extracted with EtOAc (3 x 50 mL). The combined organic layers were washed with brine (100 mL), dried over a;S04. filtered, and concentrated under reduced pressure to give a residue. The residue was purified by colum chromatography (SiC DCM: MeOH = 10: 1) to afford compound 12.6 (3.00 g, 18.39 mmol, 50.44% yield) as a yellow solid.HBoc12.5 12.4

[0269] To a solution of compound 12.5 (20.00 g, 81.20 mmol, 1.00 eq) in THF (160.00 mL) and MeOH (40.00 mL) was added TMSCHN2(27.82 g, 243.60 mmol, 3.00 eq) dropwise at 25°C under N2. The mixture was stirred at 25 °C for 20 hours. The reaction mixture was concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (Si02, ethyl acetate) to afford compound 12.4 (8.00 g, 30.73 mmol, 37.85% yield) as a colorless oil.Η2Ν ''12.6, HOBt, EDCI, DIEA, DMFNHBoc12.4 12.3

[0270] To a mixture of compound 12.6 (1.25 g, 7.68 mmol, 1.00 eq) and EDCI ( 1.62 g, 8.45 mmol, 1.10 eq) in DMF (20.00 mL) was added HOBt (1.14 g, 8.45 mmol, 1.10 eq) in one portion at 0°C under K .The mixture was stirred at 0 °C for 1 hour, then the mixture was added dropwise a solution of compound 12.4 (2.00 g, 7.68 mmol, 1.00 eq) in DMF (5 mL). DEPEA (2.98 g, 23.04 mmol, 4.03 mL, 3.00 eq) was added dropwise, and the mixture was stirred at 0°C for 1 hour. The reaction mixture was diluted with H20 (20 mL) and extracted with EtOAc (3 x 15 mL). The combined organic layers were washed with brine (40 mL), dried over Na2S04, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (S1O2, petroleum ether / ethyl acetate= 1 : 1 ) to afford compound 12.3 (2.80 g, 6.91 mmol, 89.97% yield) as a yellow oil.!H NMR (400 MHz, CD3OD-d4) δ ppm 1.40 (s, 8 H) 1.44 - 1.58 (m, 4 H) 1.80 - 2.00 (m, 2 H) 3.00 - 3.10 (m, 2 H) 3.74 (s, 3 H) 4.58 (dd, J=9.26, 5.07 Hz, 1 H) 7.25 (ddd, J=8.05, 2.32, 1.10 Hz, 1 H) 7.49 (t, J=7.83 Hz, 1 H) 7.56 (t, J=1.76 Hz, 1 H) 7.63 - 7.69 (m, 1 H). LCMS (ESI): m / z: [M + H] calcd for C19H27O5N5: 405; found 350, 306; RT=0.897min.12.3 12.2

[0271] To a solution of DIPA (1.50 g, 14.80 mmol, 2.08 mL, 6 eq) in THF (15.00 mL) was added n-BuLi (2.5 M, 5.92 mL, 6.00 eq) at 0°C, and the mixture was stirred at 0 °C for 30 mins. To the mixtrue was added a solution of compound 12.3 ( 1.00 g, 2.47 mmol, 1.00 eq) and chloro(iodo)methane (2.18 g, 12.35 mmol, 895.1 1 L, 5.00 eq) in THF (15.00 mL) at - 78°C . The mixture was stirred at -78°C for 30 mins. Saturated aqueous NH4CI ( 10 mL) wasadded, and then the mixture was extracted with EtOAc (3 x 15 mL). The combined organic layers were washed with aqueous saturated Na2SC>3(20) and brine (20 mL), dried over Na2SC>4, filtered, and concentrated under reduced pressure to provide crude compound 12.2 (2.00 g, crude) as yellow oil which was used in the next step.12.2 12.1

[0272] To a mixture of compound 12.2 (2.00 g, 4.72 mmol, 1.00 eq) and 2,6- difluorophenol (613.79 mg, 4.72 mmol, 1.00 eq) in DMF (5.00 mL) was added DIPEA (2.44 g, 18.87 mmol, 3.30 mL, 4.00 eq) in one portion at 20°C under N?. The mixture was stirred at 20 C for 10 hours. The residue was purified by prep-HPLC (TFA condition) to afford compound 12.1 (200.00 mg, 386.46 ,umol, 8.19% yield) as a yellow oil.12

[0273] To a solution of compound 12.1 (100.00 mg, 193.23 μιηοΐ, 1.00 eq) in DCM (5.00 mL) was added TFA (1.54 g, 13.51 mmol, 1.00 mL, 69.90 eq) in one portion at 18°C under N2. The mixture was stirred at 18 °C for 10 hours. The reaction mixture was concentrated under reduced pressure to give a residue. The residue was purified by prep-HPLC (TFA condition) to afford compound 12 trifluoroacetate salt (80.00 mg, 191.66 μηιοΐ, 99.19% as a yellow oil. Ή NMR (400 MHz, methanol-d4) δ ppm 1.49 - 1.67 (m, 2 H) 1.67 - 1.88 (m, 3 H) 2.11 (dddd, J=13.84, 9.48, 6.78, 4.30 Hz, 1 H) 2.89 - 2.99 (m, 2 H) 4.91 - 5.08 (m, 3 H) 6.95 - 7.05 (m, 2 H) 7.05 - 7.12 (m, 1 H) 7.26 - 7.31 (m, 1 H) 7.48 - 7.54 (m, 1 H) 7.56 (t,J=1.87 Hz, 1 H) 7.64 - 7.70 (m, 1 H). LCMS (ESI): m / z: [M + H] calcd for C20H21F2O3N5: 418; found 418; T=3.08min.Example 14. Preparation of (iS^Y^7-amino-2-oxo-l-(lH-tetrazol-l-yl)heptan-3- yl)cyclopentanecarboxamide (13) and (S)-A-(7-amino-2-oxo-l-(2H-tetrazol-2-yl)heptan- 3-yl)cyclopentanecarboxamide (14)1.2 13.1 14.1

[0274] To a solution of compound 1.2 (50.00 mg, 119.23 μιηοΐ, 1.00 eq) in DMF (3.00 mL) were added DIEA (46.23 mg, 357.70 μιηοΐ, 62.47 pL, 3.00 eq) and tetrazole (0.45 M, 264.96 L, 1.00 eq). The mixture was stirred at 25 °C for 15 hours. The residue was purified by prep-HPLC (TFA conditions). Compound 13.1 (5.00 mg, 12.24 μηιοΐ, 10.27% yield) was obtained as a white solid, And 5 mg of compound 14.1 was obtained as a white solid.13.1 13

[0275] A mixture of compound 13.1 (5.00 mg, 12.24 μιηοΐ, 1.00 eq) in DCM (5.00 mL) and TFA (1.00 mL) was stirred at 25 °C for 2 hours. The mixture was concentrated under reduced pressure to afford compound 13 trifluoroacetate salt (5.00 mg, 11.84 μηιοΐ, 96.71% yield, TFA). Ή NMR (400 MHz, methanol-^) δ ppm 1.25 - 1.57 (m, 4 H) 1.58 - 1.81 (m, 12 H) 1.84 - 2.09 (m, 6 H) 2.68 - 2.84 (m, 1 H) 2.94 (br t, J=7.50 Hz, 3 H) 4.44 - 4.58 (m, 1 H) 5.51 - 5.79 (m, 2 H) 9.06 - 9.18 (m, 1 H). LCMS (ESI): m / z: [M + H] calcd forC,4H2402N6C2HF302:423; found 309; RT=1.208 min.14.1 14

[0276] A mixture of compound 14.1 (5.00 mg, 12.24 μηιοΐ, 1.00 eq) in DCM (5.00 mL) and TFA (1.00 mL) was stirred at 25 °C for 2 hours. The mixture was concentrated under reduced pressure to afford compound 14 trifluoroacetate salt (5.00 mg, 11.84 μιηοΐ, 96.71% yield, TFA). Ή NMR (400 MHz, methanol-rf4) δ ppm 1.20 - 1.53 (m, 5 H) 1.54 - 1.80 (m, 12 H) 1.82 - 2.08 (m, 5 H) 2.64 - 2.83 (m, 1 H) 2.93 (br t, J=7.28 Hz, 3 H) 4.55 (dd, J=9.37, 4.74 Hz, 1 H) 5.71 - 5.94 (m, 2 H) 8.76 (s, 1 H). LCMS (ESI): m / z: [M + H] calcd forC,4H24Ni,02C2HF302:423; found 309; RT=1.606 min.Example 15. Preparation of a fluorescent gi ipain activity probe: (5')-A-(7-amino-l- (2,6-difluoropheiioxy)-2-oxoheptan-3-yl)-3-(4-((3-(5,5-difluoro-7,9-dimethyl-5H-514,614- dipyrrolo[l,2-c:2',l'-f] [l,3,2]diazaborinin-3-yl)propanamido)methyl)-lH-l,2,3-triazol-l- yl)benzamide (15)15.7 15.6

[0277] To a mixture of compound 15.7 (5.00 g, 52.58 mmol, 1.00 eq) and methyl 2- diethoxyphosphorylacetate ( 11.05 g, 52.58 mmol, 1.00 eq) in THF (60.00 mL) was added K2COj (14.53 g, 105.16 mmol, 2.00 eq) in one portion at 50°C under N2. The mixture was stirred at 50 °C for 10 hours. The reaction mixture was diluted with H20 (50 mL) and extracted with EtOAc (3 x 50 mL). The combined organic layers were washed with brine (100 mL), dried over Na2S04, filtered, and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (S1O2, petroleum ether / ethyl acetate=5: l) to afford 15.6 (8.60 g, 56.89 mmol, 108.20% yield) as a white solid.15.6 15.5

[0278] To a solution of compound 15.6 (8.60 g, 56.89 mmol, 1.00 eq) m MeOH (100.00 mL) was added Pd-C (10%, 0.9 g) under N2. The suspension was degassed under vacuum and purged with H2several times. The mixture was stirred under H2(50psi) at 18°C for 10 hours. The reaction mixture was filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (S1O2, petroleum ether / ethyl acetate=5: l) to afford compound 15.5 (5.00 g, 32.64 mmol, 57.37% yield) as a colorless oil.15.5 15.3

[0279] To a mixture of compound 15.5 (3.00 g, 19.58 mmol, 1 .00 eq) and compound 15.4 (2.65 g, 21.54 mmol, 1.10 eq) in DCM (60.00 mL) was added PGCL (3.30 g, 21.54 mmol, 2.00 iriL, 1.10 eq) in one portion at 18°C under N2. The mixture was stirred at 18 °C for 10 hours, followed by addition of BF3Et20 (1 1.12 g, 78.32 mmol, 9.67 mL, 4.00 eq) and DIEA (10.63 g, 82.24 mmol, 14.36 mL, 4.20 eq) dropwise at 18 °C. The mixture was stirred at 18 °C for 10 hours. The reaction mixture was filtered, diluted with H20 (50 mL), and extracted with DCM (3 x 50 mL). The combined organic layers were washed with brine (100 mL), dried over Na2S04, filtered, and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (S1O2, petroleum ether / ethyl acetate=l :4) to afford compound 15.3 (3.00 g, 9.80 mmol, 50.05% yield) as a red solid.15.3 15.2

[0280] To a mixture of compound 15.3 ( 1.00 g, 3.27 mmol, 1.00 eq) in THE ( 120.00 niL) and H20 (80.00 mL) was added HC1 (51.11 g, 519.15 mmol, 50.11 mL, 37% purity, 158.76 eq) in one portion at 18°C under N?. The mixture was stirred at 18 °C for 10 hours. The reaction mixture was quenched by addition DCM (100 mL), then extracted with DCM (3 x 100 mL). The combined organic layers were washed with brine (300 mL), dried over Na2S04, filtered, and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (Si02, DCM:MeOH = 20: 1) to afford compound 15.2 (700.00 mg, 2.40 mmol, 73.29% yield) as a red solid.

[0281] To a mixture of compound 15.2 (300.00 mg, 1.03 mmol, 1.00 eq) and HOBt (152.66 mg, 1.13 mmol, 1.10 eq) in DMF (3.00 mL) was added EDCI (216.58 mg, 1.13 mmol, 1.10 eq) in one portion at 0°C under N2. The mixture was stirred at 0 °C for 1 hour. Then, propargylamine (56.57 mg, 1.03 mmol, 65.78 μί, 1.00 eq) and DIPEA (398.22 mg, 3.08 mmol, 538.13 μί,, 3.00 eq) were added in one portion at 0 °C, and the mixture was stirred at 0 °C for 1 hour. The reaction mixture was diluted with EtOAc (4 mL) and extracted with EtOAc (3 3 mL). The combined organic layers were washed with brine (5 mL), dried over Na2S04, filtered, and concentrated under reduced pressure to give a residue. The residue was purified by prep-TLC (Si02, DCM:MeOH = 20:1) to afford compound 15.1 (150.00 mg, 455.72 μηιοΐ, 44.24% yield) as a red solid.

[0282] To a mixture of compound 15.1 (100.00 mg, 303.81 μιηοΐ, 1.00 eq) and compound 12 (126.81 mg, 303.81 μιηοί, 1.00 eq) in acetonitrile (2.00 rnL) was added a solution of CuS04(2.42 mg, 15.19 μπιοΐ, 2.33 μί, 0.05 eq) in H20 (100.00 μΐ,) in one portion and sodium ascorbate (120.38 mg, 607.62 μιηοΐ, 2.00 eq) at 18°C under N2. The mixture was stirred at 18 °C for 10 hours. The residue was purified by prep-HPLC (TFA condition) to give compound 15 trifluoroacetate salt (5.00 mg, 6.70 μηιοΐ, 2.21% yield) as a red solid.!H NMR (400 MHz, methanol-d4) δ ppm 1.46 - 1.68 (m, 1 H) 1.46 - 1.67 (m, 1 H) 1.69 - 1.90 (m, 1 H) 2.04 - 2.18 (m, 2 H) 2.19 - 2.31 (m, 3 H) 2.48 (s, 2 H) 2.69 (br t, J=7.45 Hz, 2 H) 2.95 (br s, 2 H) 3.19 - 3.28 (m, 2 H) 4.52 (s, 2 H) 5.04 (br s, 3 H) 6.19 (s, 1 H) 6.31 (br d, J=3.51 Hz, 1 H) 6.91 - 7.12 (m, 4 H) 7.31 - 7.32 (m, 1 H) 7.35 (s, 1 H) 7.68 (br t, J=8.1 1 Hz, 1 H) 7.65 - 7.71 (m, 1 H) 7.95 - 8.04 (m, 2 H) 8.25 - 8.36 (m, 2 H). LCMS (ESI): mJz: [M + H] calcd for C37H39F4O4N8B : 746; found 747; RT=2.1 17minExample 16. Preparation of (5)-Ar-(7-amino-l-(methylthio)-2-oxoheptan-3-yl)cyclo- peiitaiie-carboxamide (16)1.2 16.1

[0283] To a solution of compound 1.2 (100.00 mg, 240 μηωΐ, 1.00 eq) in DMF (2.00 mL) was added methylsulfanylsodium (16 mg, 240 μιηοΐ, 15 \L, 1.00 eq). The mixture wasstirred at 25 °C for 0.5 hours. The residue was purified by prep-HPLC (TFA condition). Compound 16.1 (50.00 mg, 99.89 μηιοΐ, 55.16% yield, TFA) was obtained as a yellow oil.16.1 16

[0284] To a solution of compound 16.1 (50.00 mg, 129.35 μηιοΙ. 1.00 eq) in DCM (5.00 mL) was added TFA (1.00 niL). The mixture was stirred at 25 °C for 5 hours. The mixture was concentrated under reduced pressure to give compound 16 trifluoroacetate salt (5.00 mg, 17.46 μΐΉθΙ, 13.50% yield). ¾ MR (400 MHz, methanol-d4) δ ppm 1.33 - 1.54 (m, 2 H) 1.55 - 1.79 (m, 11 H) 1.80 - 1.99 (m, 4 H) 2.06 (s, 3 H) 2.64 - 2.80 (m, 1 H) 2.86 - 2.99 (m, 2 H) 3.36 (d, J=1.54 Hz, 2 H) 4.67 (dd, J=9.48, 4.41 Hz, 1 H). LCMS (ESI): m / z: [M + H] calcd for C14H26S02N2:287; found 287; RT=1.826 min.Example 17. Preparation of (5)-iV-(7-amino-2-oxo-l-(2,2,2-trifIuoroethoxy)heptaii-3- yl)cyclo-pentanecarboxamide (17)1.2 17.1

[0285] To a solution of compound 1.2 (50.00 mg, 1 19.23 μιηοΐ, 1.00 eq) in DMF (2.00 mL) was added K2C03 (49.44 mg, 357.69 μιηοΐ, 3.00 eq) and 2,2,2-trifluoroethan-l-ol (1 1.93 mg, 119.23 μηιοΐ, 8.58 iL, 1.00 eq). The mixture was stirred at 25°C for 15 hours. The residue was purified by prep-HPLC (TFA condition). Compound 17.1 (10.00 mg, 22.81 μιηοΐ, 19.13% yield) was obtained as a yellow oil.17.1 17

[0286] To a solution of tert-butyl compound 17.1 (10.00 mg, 22.81 μιηοΐ, 1.00 eq) in DCM (2.50 mL) was added TFA (500.00 μ£). The mixture was stirred at 25 °C for 2 hours. The mixture was concentrated under reduced pressure to give compound 17 trifhioroacetate salt (5.00 mg, 14.78 ,umol, 64.78% yield) as a yellow oil. ¾ NMR (400 MHz, methanol-d4) 5 ppm 1.32 - 1.51 (m, 3 H) 1.53 - 1.78 (m, 10 H) 1.80 - 1.96 (m, 4 H) 2.72 (quin, J=7.88 Hz, 1 H) 2.86 - 2.99 (m, 2 H) 3.96 - 4.08 (m, 2 H) 4.36 - 4.55 (m, 3 H). LCMS (ESI): m / r. [M + H] calcd forfound 339; RT=2.060 min.Example 18. Preparation of (A,KY-(7-amino-l-((l,l?l?3,3,3-hexafluoropropan-2-yl)oxy)- 2-oxoheptan-3-yl)cyclopentanecarboxamide (18)1.2 18.1

[0287] To a solution of compound 1.2 (50.00 mg, 1 19.23 μιηοΐ, 1.00 eq) in DMF (2.00 mL) was added K2C03 (49.44 mg, 357.69 μιηοΐ, 3.00 eq) and 1,1 , 1 ,3,3, 3-hexafluoropropan- 2-ol (20.04 mg, 1 19.23 μιηοΐ, 1.00 eq). The mixture wras stirred at 25 °C for 15 hours. The residue was purified by prep-HPLC (TFA condition). Compound 18.1 (15.00 mg, 29.62 μηιοΐ, 24.84% yield) was obtained as a yellow oil.18.1 18

[0288] To a solution of compound 18.1 (15.00 mg, 29.62 umol, 1.00 eq) in DCM (5.00 mL) was added TFA (1.00 mL). The mixture was stirred at 25 °C for 15 hours. The mixture was concentrated under reduced pressure to give compound 18 trifluoroacetate salt (5.00 mg, 12.30 μιηοΐ, 41.54% yield) as a yellow oil. Ή MR (400 MHz, methanol-d4) δ ppm 1.35 - 1.54 (m, 2 H) 1.55 - 1.78 (m, 10 H) 1.80 - 1.97 (m, 3 H) 2.65 - 2.79 (m, 1 H) 2.85 - 2.98 (m, 2 H) 4.45 - 4.54 (m, 1 H) 4.60 - 4.78 (m, 1 H) 4.98 - 5.08 (m, 1 H). LCMS (ESI): m / ∑: [M + H] calcd for C16H2O3N2F6:407; found 407; RT=2.356 min.Example 19. Preparation of (S)-N-(7-amiiio-l-(dimethylamino)-2-oxoheptan-3-yl)cyclo- pentanecarboxamide (19)1.2 19.1

[0289] To a mixture of compound 1.2 (100.00 mg, 238.46 μιηοΐ, 1.00 eq) and N- methylmethanamine (19.44 mg, 238.46 μιηοΐ, 21.85 μί, 1.00 eq, HCl) in DMF (1.00 mL) was added DIPEA (123.28 mg, 953.86 μιηοί, 166.59 μΐ,, 4.00 eq) in one portion at 20°C under N2. The mixture was stirred at 20 °C for 1 hour. The residue was purified by prep-HPLC (TFA condition) to give compound 19.1 (50.00 mg, 130.37 μηιοΐ, 54.67% yield) as a colorless oil. LCMS (ESI): m / z: [M + H] calcd for C20H37O4N3: 383: found 384;RT=0.672rnin19.1 19

[0290] Compound 19.1 (50.00 mg, 130.37 μιηοΐ, 1.00 eq) was dissolved in DMF (1.00 mL), the mixture was added TFA (1.12 g, 9.85 mmol, 728.95 μΤ, 75.52 eq) and stirred at 18 °C for 10 hours. The reaction mixture concentrated under reduced pressure to give compound 19 trifluoroacetate salt (50.00 mg, crude) as a colorless oil.!H NMR (400 MHz, methanol- d4) δ ppm 1.39 - 1.58 (m, 3 H) 1.59 - 1.66 (m, 2 H) 1.66 - 1.78 (m, 7 H) 1.87 - 1.98 (m, 3 H) 2.68 - 2.81 (m, 1 H) 2.90 (s, 6 H) 2.92 - 2.97 (m, 2 H) 4.28 - 4.32 (m, 1 H) 4.32 - 4.42 (m, 2 H). LCMS (ESI): m / ∑: [M + H] calcd for G5H29O2N3: 283; found 284; RT=2.365minExample 20. Preparation of (iS')-3-acetamido-A-(7-amino-l-(2,6-difiuorophenox )-2- oxoheptan-3-yl)benzamide (9)

[0291] To a solution of compound 3-acetamidobenzoic acid (1.21 g. 6.74 mmol, 1.00 eq) in DMF (30.00 mL) was added HOBt (1.00 g, 7.41 mmol 1.10 eq) and EDCI ( 1.42 g, 7.41 mmol, 1.10 eq). After addtion, the mixture was stirred at 0°C for 30 mins. Then added DIEA (3.48 g, 26.96 mmol, 4.71 mL, 4.00 eq) and compound 9.4 (2.00 g, 6.74 mmol, 1.00 eq) to above mixture at 0°C under N2. The resulting mixture was stirred at 25°C for 15.5 hrs. The reaction mixture was added water ( 10 mL), extracted with EtOAc (30 mL * 3). The organic phase was separated, washed with NaCl (10 mL) and dried over Na2S04, filtered and concentrated under reduced pressure to give a residue. Compound 9.3 (2.30 g, 5.46 mmol, 80.96% yield) was obtained as a white solid. LCMS (ESI): m / z: [M + H] calcd forC21H31N3O6: 421.22; found 322.3; RT=0.748 min. Ή NMR (400 MHz, chloroform-d) δ ppm1.30 - 1.56 (m, 14 H) 1.68 - 1.98 (m, 2 H) 2.16 (s, 3 H) 2.98 - 3.15 (m, 2 H) 3.71 (s, 3 H) 4.61 - 4.83 (m, 2 H) 7.14 (br d, J=7.50 Hz, 1 H) 7.28 - 7.37 (m, 1 H) 7.47 (br d, J=7.06 Hz, 1 H) 7.74 (br s, 1 H) 7.91 - 8.02 (m, 1 H) 8.52 (br s, 1 H).

[0292] To a solution of DIPA (384.12 mg, 3.80 mmoi, 533.50 μΐ, 4.00 eq) in THF (10.00 mL) was added n-BuLi (243.17 mg, 3.80 mmol, 4.00 eq) at 0°C under N2. After 0.5 h, compound 9.3 (400.00 mg, 949.01 μιηοΐ, 1.00 eq) and chloroiodomethane (669.55 mg, 3.80 mmol, 275.53 μΐ^, 4.00 eq) was added to above mixture at -78°C under N2. The resulting mixture was stirred at -78°C for 1.5 hrs. The reaction mixture was added water (20 mL), extracted with EtOAc (20mL * 3). The combined organic layers were washed with brine (10 mL*l), dried over Na2S04, filtered and concentrated under reduced pressure to give a residue. Compound 9.2 (500.00 mg, crude) was obtained as a black brown oil.9.2 9.1

[0293] To a solution of compound 9.2 (200.00 mg, 454.62 μηιοΐ, 1.00 eq) and DIEA (176.27 mg, 1.36 mmol, 238.20 |jL, 3.00 eq) in DMF (4.00 mL) was added 2,6- difluorophenol (1 18.28 mg, 909.24 μηωΐ, 2.00 eq) at 25°C under N2. The resulting mixture was stirred at 25°C for 16 hrs. The reaction mixture was added water (10 mL), extracted with EtOAc (lOmL * 3). The combined organic layers were washed with brine (5 mL * 1), dried over Na2S04, filtered and concentrated under reduced pressure to give a residue. The crude product (500.00 mg) was obtained as a yellow oil. The residue was purified by prep-HPLC(neutral condition). Compound 9.1 {10.00 mg, 18.74 μηιοΐ, 2.00% yield) was obtained as a white solid.

[0294] To a solution of compound 9.1 (5.00 mg, 9.37 μηιοΐ, 1.00 eq) in DCM (2.00 mL) was added TFA (2.14 mg, 18.74 μιηοΐ, 1.39 μί, 2.00 eq) under N2. The mixture was stirred at 25°C for 16 hours. Concentrated to afford residue. Compound 9 trifluoroacetate salt (5.00 mg, 9.13 μηιοϊ, 97.47% yield, TFA) was obtained as a red oil. LCMS (ESI): m / z: [M + H] calcd for C22H25F2N3O4: 433.18; found 434.2; RT=2.052 min. ¾ NMR (400 MHz, methanol-d4) δ ppm 1.44 - 1.88 (m, 1 H) 1.44 - 1.51 (m, 1 H) 1.51 - 1.84 (m, 1 H) 1.52 - 1.82 (m, 1 H) 1.52 - 1.85 (m, 1 H) 1.83 - 1.85 (m, 1 H) 2.07 - 2.20 (m, 1 H) 2.94 (br t, J=6.50 Hz, 1 H) 4.90 - 5.10 (m, 1 H) 4.91 - 5.10 (m, 1 H) 6.91 - 7.13 (m, 1 H) 7.33 - 7.47 (m, 1 H) 7.49 - 7.68 (m, 1 H) 8.03 - 8.18 (m, 1 H)

[0295] Additional compounds were synthesized according to the procedures in the preceding examples. Example 21. Preparation of (5)-iV-(7-amino-l-(methylsulfonyl)-2-oxoheptan-3-yl)- cyclopentanecarboxamide (20)1.2 20.2

[0296] To a solution of compound 1.2 (200.00 mg, 476.93 μιηοΐ, 1 .00 eq) in DMF (3.00 mL) was added methylsulfanylsodium (33.43 mg, 476.93 μηιοΐ, 30.39 uL, 1.00 eq). Themixture was stirred at 25 °C for 0.5 hours. The residue was purified by prep-HPLC, and compound 20.2 (80.00 mg, 206.96 μηιοΐ, 43.39% yield) was obtained as a yellow oil.20.2 20.1

[0297] To a solution of compound 20.2 (60.00 mg, 155.22 μηιοΐ, 1.00 eq) in THF (2.00 mL) and H20 (600.00 μΓ) was added oxone (190.85 mg, 310.44 μιηοΐ, 2.00 eq). The mixture was stirred at 25 °C for 12 hours. The residue was purified by prep-HPLC, and compound 20.1 (20.00 mg, 47.78 μηιοΐ, 30.78% yield) was obtained as a white solid20.1 20

[0298] Compound 20.1 (20.00 mg, 47.78 μιηοΐ, 1.00 eq) in TFA (1.00 mL) and DCM (5.00 mL) was stirred at 25 °C for 14 hours. The mixture was concentrated under reduced pressure to provide compound 20 trifluoroacetate salt (10.00 mg, 31.40 μηιοΐ, 65.73% yield) as a yellow oil.!H NMR (400 MHz, DMSO-i / 6) δ ppm 1.18 - 1.39 (m, 1 H) 1.18 - 1.39 (m, 1 H) 1.39 - 1.66 (m, 9 H) 1.67 - 1.88 (m, 3 H) 2.58 - 2.86 (m, 3 H) 3.08 (s, 3 H) 4.15 - 4.32 (m, 1 H) 4.39 - 4.61 (m, 2 H) 7.70 (br s, 3 H) 8.23 (d, J=7.06 Hz, 1 H). LCMS (ESI): m / z: [M + H] calcd for Ci4H26S042:319; found 319; RT=1.916 mm.Example 22. Preparation of (S)-N-(7-amino-l-(2,6-difluorophenoxy)-2-oxoheptan-3-yI)- 3-fluorobenzamide (26)26.1 26.3

[0299] To a mixture of compound 26.1 (420.44 mg, 3.0 mmol, 1 equivalent) and EDO (632.77 mg, 3.3 mmol, 1.1 equivalent), HOBt (446.01 mg, 3.3 mmol, 1.1 equivalent) in DMF (10 mL) was added compound 26.2 (1 g, 3 mmol, 1 equivalent) and DIEA (1.55 g, 12 mmol, 2.09 mL, 4 equivalent) in one portion at 0 °C under N2. The mixture was stirred at 0 °C for 15 hours. The aqueous phase was extracted with EtOAc (20 mL x 3). The combined organic phases were washed with brine (5 mL), dried with anhydrous Na2S04, filtered and concentrated in vacuum. The residue was purified by column chromatography (SiO?, Petroleum ether / Ethyl acetate = 10: 1 to 1 : 1) to give compound 26.3 (600 mg, 1.57 mmol, 52.3% yield) as a white solid; LCMS [M + H : 383; RT = 0.824min.26.3 26.4

[0300] A mixture of n-BuLi (301.51 mg, 4.71 mmol, 6 equivalent) and DIPA (476.28 mg, 4.71 mmol, 661.49 IJL, 6 equivalent) in THF (6 mL) was stirred at 0 °C under N2. After 0.5 h, 26.3 (300 mg, 784.46 μιηοΐ, 1 equivalent) and iodochloromethane (553.45 mg, 3.14 mmol, 227.76 μΕ, 4 equivalent) was added to above mixture at -78 °C under N?. The resulting mixture was stirred at -78 °C for 2 hrs. To the reaction mixture was added water (20 mL) then it was extracted with EtOAc (20 x mL x 3). The combined organic layers were washedwith brine (10 niL), dried over NaiSC , filtered and concentrated under reduced pressure. 26.4 (200 mg, 499 μηιοΐ, 63.6% yield) was obtained as a brown oil.26.4 26.S

[0301] To a mixture of compound 26.4 (200 mg, 499 μιηοΐ, 1 equivalent) and 2,6- difluorophenol (64.9 mg, 499 μηιοΐ, 1 equivalent) in DMF (4 niL) was added DIEA (193.44 mg, 1.5 mmol, 261.41 μΐ,, 3 equivalent) in one portion at 20 °C under 2. The mixture was stirred at 20 °C for 15 hours. The residue was purified by preparative scale HPLC (TFA conditions). Compound 26.5 (18 mg, 36.4 μηιοΐ, 1 equivalent) was obtained as a white solid. LCMS [M + Hp. 496; RT = 0.886 min.

[0302] A mixture of compound 26.5 (18 mg, 36.4 μιηο!, 1 equivalent) in HCl / EtOAc (10 niL) was stirred at 20 °C for 4 hours; then filtered and concentrated under vacuum. The residue was purified by semi-preparative scale HPLC (TFA conditions) to give Compound 26 (12 mg) as a colorless oil; LCMS [M + H : 395; RT = 1.53 min.!H NMR (400 MHz, METHANOL-i 4) δ ppm 1.48 - 1.63 (m, 2 H), 1.67 - 1.86 (m, 3 H), 2.07 - 2.18 (m, 1 H), 2.89 - 2.99 (m, 2 H), 4.92 - 4.96 (m, 1 H), 4.96 - 5.06 (m, 2 H), 6.95 - 7.03 (m, 2 H), 7.03 - 7.12 (m, 1 H), 7.29 - 7.35 (m, 1 H), 7.51 (td, J=7.99, 5.62 Hz, 1 H), 7.60 (dt, J=9.70, 2.09 Hz, 1 H), 7.67 - 7.71 (m, 1 H).Example 23. Preparation of (S)-N-(7-amino-l-(2,6-difluorophenoxy)-2-oxohepti 3-(2-fluoroethoxy)benzamide (27)27.1 27.2

[0303] : To a mixture of 27.1 (1 g, 6.57 mmol, 1 equivalent) and 1 -fluoro-2-bromoethane (834.44 mg, 6.57 mmol, 1 equivalent) in DMF (10 mL) was added K2C03(2.72 g, 19.71 mmol, 3 equivalent) in one portion at 20 °C under N?. The mixture was stirred at 80 °C for 15 hours. The aqueous phase was extracted with EtOAc (20 mL x 3). The combined organic phases were washed with brine (5 mL), dried with anhydrous Na2S04, filtered and concentrated in vacuum. The residue was purified by column chromatography (SiCb, Petroleum ether / Ethyl acetate = 10 / 1 to 2 / I) to give compound 27.2 (890 mg, 4.49 mmol, 68.35% yield) as colorless oil; LCMS [M + Hf:199; RT = 0.77 min.

[0304] A solution of 27.2 (890 mg, 4.49 mmol, 1 equivalent) in MeOH (27 mL) and NaOH (1 M, 8.98 rnL, 2 equivalent) was stirred at 20 °C for 15 hours. The combined aqueous layers were extracted with EtOAc (40 mL x 2) to remove neutral impurities. The aqueous phase was acidified with aqueous HCl to pH 5 and extracted with EtOAc (40 mL). Compound 27.3 (600 mg, 3.26 mmol, 72.6% yield) was obtained as colorless oil.26.1 27.4

[0305] To a mixture of compound 27.3 (600 rng, 3.26 mmol, 1 equivalent) and HOBt (484.54 mg, 3.59 mmol, 1.1 equivalent) EDCI (687.44 mg, 3.59 mmol, 1.1 equivalent) in DMF (10 mL) was added 26.1 (967.54 mg, 3.26 mmol, 1 equivalent, HCl) and DIEA (1.69 g, 13.04 mmol, 2.28 mL, 4 equivalent) in one portion at 0 °C under N?. The mixture was stirred at 20 °C for 15 hours. The reaction mixture was added to water (20 mL) then extracted with EtOAc (20mL x 3). The combined organic layers were washed with brine (10 mL), dried over Na2SC>4, filtered and concentrated under reduced pressure to give 27.4 (1.17 g, 2.74 mmol, 84% yield) as a colorless oil; LCMS [M + Hf : 427; RT = 0.825 min.27.4 27.5

[0306] n-BuLi (270.37 mg, 4.22 mmol, 6 equivalent) was added to DIPA (427.08 mg, 4.22 mmol, 593.17 μί, 6 equivalent) in THF (6 mL) in one portion at 0 °C under N?. After 0.5 hrs, 27.4 (300 mg, 703.43 μηιοΐ, 1 equivalent) and iodochloromethane (744.43 mg, 4.22 mmol, 306.35 μί, 6 equivalent) was added to above mixture at -78 °C under N2. The resulting mixture was stirred at -78 °C for 2 hrs. To the reaction mixture was added water (20 mL) then it was extracted with EtOAc (20 mL x 3). The combined organic layers were washed with brine (10 mL), dried over Na-SCXi, filtered and concentrated under reduced pressure. Compound 27.5 (300 mg, crude) was obtained as a brown oil.27.5 27.6

[0307] To a mixture of compound 27.5 (300 mg, 674.3 μηιοΐ, 1 equivalent) and 2,6- difluorophenol (87.72 mg, 674.28 μιηοΐ, 1 equivalent) in DMF (4 rnL) was added DIEA (261.43 mg, 2.02 mmol, 353.29 joL, 3 equivalent) in one portion at 20 °C under N2. The mixture was stirred at 20 °C for 15 hours. The residue was purified by prep-HPLC (TFA condition). Compound 27.6 (72 mg, 133.7 μηιοΐ, 19.8% yield) was obtained as a brown solid; LCMS [M + Hf :539; RT = 2.85 rnin.

[0308] To a solution of 27.6 (72 mg, 133.7 μηιοΐ, 1 equivalent) in DCM (1 rnL) was added TFA (304.87 mg, 2.67 mmol, 197.97 μί, 20 equivalent). The mixture was stirred at 20 °C for 4 hours. It was filtered and concentrated in vacuum to give Compound 27 (50 mg, 75.02 μιηοΐ, 56% yield, 2 TFA); LCMS [M + Hf : 667; RT = 0.69 rnin. ¾ NMR (400 MHz, DMSO- d6) δ ppm 1.37 - 1.55 (m, 2 H), 1.57 - 1.59 (m, 2 H), 1.69 - 1.72 (m, 2 H), 1.73-1.85 (m, 2 H), 2.75 - 2.79 (t, J=8.0 Hz, 2 H), 4.26 - 4.27 (d, J=4.0 Hz, 1 H), 4.33 - 4.34 (d, J=3.6 Hz, 2 H), 4.34 - 4.35 (m, 1 H), 4.69 - 4.71(m, 1 H), 4.81 - 4.82(m, 1 H), 5.09 - 5.13(dd, J=1.6 Hz, 2 H), 7.09 - 7.12(m, 4 H), 7.39-7.48(m, 4 H), 7.73(s, 2 H), 8.77 - 8.78 (d, J=7.6 Hz, 2 H).Example 24. Preparation of (S)-N-(7-amino-l-(2,6-difluorophenoxy)-2-oxoheptan-3-yI)- 6-fluoropicolinamide (28)26.1 28.2

[0309] To a solution of compound 28.1 (366.07 mg, 2.6 mmol, 1.1 equivalent) in DMF (15 mL) was added HOBt (350.77 mg, 2.6 mmol, 1.1 equivalent) and EDCI (497.65 mg, 2.60 mmol, 1.1 equivalent). The mixture was stirred at 0CC for 1 hr. Then to the mixture was added compound 26.1 (700 mg, 2.36 mmol, 1 equivalent, HC1) and DIEA (1.22 g, 9.44 mmol, 1.65 mL, 4 equivalent): the mixture was stirred at 25 °C for 14 hours. The reaction mixture was quenched by addition hLO (30 mL) and extracted with ethyl acetate (30xmL x 3). The combined organic layers were washed with saturated brine (5 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by column chromatography (Si02, DCM: MeOH = 10: 1) to give compound 28.2 (750 mg, 1.96 mmol, 83% yield) as yellow oil; LCMS [M + H - Boc]+: 384; RT = 0.817 min.!H NMR (400 MHz, CHLOROFORMS) δ ppm 1.42 (s, 1 1 H), 1.53 (br d, J=6.17 Hz, 2 H), 1.65 (s, 1 H), 1.75 - 2.05 (m, 2 H), 3.12 (br d, J=6.17 Hz, 2 H), 3.78 (d, J=0.66 Hz, 3 H), 4.57 (br s, 1 H), 4.67 - 4.89 (m, 1 H), 6.97 - 7.18 (m, 1 H), 7.87 - 8.03 (m, 1 H), 8.05 - 8.22 (m, 2 H).28.2 28.3

[0310] To a solution of DIP A (526.19 mg, 5.2 mmol, 730.82 L, 5 equivalent) in THF (5 mL) was added n-BuLi (2.5 M, 2.08 mL, 5 equivalent). The mixture was stirred at 0 °C for0.5 hr under N2; then to the mixture was added to the solution of compound 28.2 (400 mg, 1.04 mmol, 1 equivalent) and chloro(iodo)methane (917.18 mg, 5.2 mmol, 377.44 \xL, 5 equivalent) in THF (10 mL). This was stirred at -78 °C for 0.5 hr. The reaction mixture was quenched by addition saturated NH4CI (20 ml) at 25 °C and extracted with ethyl acetate (15 mL x 3). The combined organic layers were washed with saturated N2S(¾ (10 mL), saturated NaHCOj (10 mL) and brine (10 mL); then it was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to give 28.3 (500 mg, crude) as yellow oil.

[0311] To a solution of 28.3 (500 mg, 1.24 mmol, 1 equivalent) in DMF (8 mL) was added DIEA (481 mg, 3.72 mmol 649.69 |iL, 3 equivalent) and 2,6-difluorophenol (241.97 mg, 1.86 mmol, 1.5 equivalent). The mixture was stirred at 25 °C for 15 hours. The residue was purified by semi-preparative scale HPLC (TFA conditions) to give 28.4 (50 mg, 101 μιηοΐ, 8% yield) as yellow oil; LCMS [M + H]+: 496; RT = 2.84 min.

[0312] To a solution of 28.4 (50 mg, 101 μιηοΐ, 1 equivalent) in DCM (5 mL) was added TFA (1 mL). The mixture was stirred at 25 °C for 15 hours; then was concentrated under reduced pressure to give Compound 28 (20 mg, 50.6 μηιοΐ, 50% yield); LCMS [M + H]+: 396; RT = 2.1 1 min. ¾ NMR (400 MHz, DMSO-d6) δ ppm 1.21 - 1.44 (m, 2 H), 1.45 - 1.65 (m, 2 H), 1.71 - 2.01 (m, 2 H), 2.69 - 2.85 (m, 2 H), 4.55 - 4.76 (m, 2 H), 4.97 - 5.34 (m, 2 H), 7.03 - 7.21 (m, 2 H), 7.48 (dd, J=8.27, 1.65 Hz, 1 H), 7.68 (br s, 3 H), 7.99 (dd, J=7.28, 1.76 Hz, 1 H), 8.22 (q, J=8.08 Hz, 1 H), 8.98 (d, J=8.38 Hz, 1 H).Example 25. Preparation of (S)-N-(7-amino-l-(2,6-difluorophenoxy)-2-oxoheptan-3-yI)- 6-fluoronicotinamide (29)26.1 29.1

[0313] To a solution of 6-fluoronicotinic acid (366.3 mg, 2.6 mmol, 1.1 equivalent) in DMF (15 mL) was added HOBt (351 mg, 2.6 mmol, 1.1 equivalent) and EDCI (497.65 mg, 2.60 mmol, 1.1 equivalent). The mixture was stirred at 0 °C for 1 hr. Then to the mixture was added compound 26.1 (700 mg, 2.36 mmol, 1 equivalent, HC1 salt) and DIEA (1.22 g, 9.44 mmol, 1.65 mL, 4 equivalent); the mixture was stirred at 25 °C for 14 hours. The reaction mixture was quenched by addition H20 (50 mL) and extracted with ethyl acetate (30 mL x 3). The combined organic layers were washed wdth saturated brine (5 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by column chromatography (S1O2, Petroleum ether / Ethyl acetate = 2 / 1) to give 29.1 (300 mg, 782.45 μιηοΐ, 33.15% yield); LCMS [M + H - Boc]+: 384; T = 0.7 min. ¾ NMR (400 MHz, CHLOROFORM-i δ ppm 1.40 (s, 11 H), 1.48 - 1.59 (m, 3 H), 1.63 (s, 1 H), 1.76 - 2.04 (m, 2 H), 3.13 (br d, J=6.15 Hz, 2 H), 4.47 - 4.86 (m, 2 H), 6.93 (br s, 1 H), 7.01 (dd, J=8.53, 2.76 Hz, 1 H), 8.29 (td, J=7.97, 2.38 Hz, 1 H), 8.72 (s, 1 H).29.1 29 2

[0314] To a solution of DIP A (396 mg, 3.91 mmol, 549.82 μί, 5 equivalent) in THF (5 mL) was added n-BuLi (2.5 M, 1.56 mL, 5 equivalent). The mixture was stirred at 0 °C for 0.5 hr under N?. Then the mixture was added to a solution of 29.1 (300 mg, 782.43 μιηοΐ, 1 equivalent) and chloroiodomethane (690 mg, 3.91 mmol, 284 μΕ, 5 equivalent) in THF (5 mL); this was stirred at -78 °C for 0.5 hr. The reaction mixture was quenched by the additionof saturated NH4C1 (20 ml) then extracted with ethyl acetate (15 mL x 3). The combined organic layers were washed with saturated a2SOs (10 mL), saturated NaHCOs (10 mL) and brine (10 mL). This was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to give 29.2 (500 mg, crude) as yellow oil.29.2 29.3

[0315] To a solution of 29.2 (300.00 mg, 746.53 μηιοΐ, 1.00 equivalent) and 2,6- difluorophenol (145.7 mg, 1.12 mmol, 1.5 equivalent) in DMF (6 mL) was added DIEA (289 mg, 2.24 mmol, 391 xL, 3 equivalent). The mixture was stirred at 25 °C for 15 hours, then it was evaporated and was purified by semi-preparative HPLC (TFA conditions) to give 29.3 (40 mg, 81 μιηοΐ, 11 % yield) as yellow oil; LCMS [M + Hf: 496; RT = 0.874 min.29.3 29

[0316] To 29.3 (40 mg, 81 μιηοΐ, 1 equivalent) in DCM (5 mL) was added TFA (1 mL). The mixture was stirred at 25 °C for 15 hours then was evaporated. The residue was purified by semi-preparative scale HPLC (TFA conditions) to give Compound 29, (10 mg, 25 μηιοΐ, 31 % yield); LCMS [M + Hf : 396; RT = 0.7 min.JH NMR (400 MHz, METHANOL-^) δ ppm 1.43 - 1.67 (m, 2 H), 1.67 - 1.89 (m, 3 H), 2.05 - 2.20 (m, 1 H), 2.86 - 3.01 (m, 2 H), 4.93 - 5.11 (m, 3 H), 6.92 - 7.16 (m, 2 H), 7.19 (dd, J=8.60, 2.65 Hz, 1 H), 8.38 (td, J=8.05, 2.65 Hz, 1 H), 8.71 (d, J=2.43 Hz, 1 H).Example 26. Preparation of (S)-N-(7-amino-l-(2,6-difluorophenoxy)-2-oxoheptan-3-yI)- 3-(3-fluoropropoxy)benzamide (30)30.1 30.2

[0317] To a mixture 30.1 (540.13 mg, 3.55 mmol, 1 equivalent) and 30.2 (500 mg, 3.55 mmol, 1 equivalent) in DMF ( 10 mL) was added K2C03(981.29 mg, 7.1 mmol, 2 equivalent); the mixture was stirred at 80 °C for 15 hours. The reaction mixture was diluted with water (20 mL) and was extracted with EtOAc (20xmL x 3). The combined organic layers were washed with brine (10 mL), dried over Na^SO,}, filtered and concentrated under reduced pressure. The residue was purified by column chromatography (Si02, Petroleum ether / Ethyl acetate = 10 / 1 to 1 / 1) to give 30.2 (440 mg, 2.07 mmol, 58% yield) as colorless oil; LCMS [M + Hf : 213; RT = 0.82 mm.30.2 30.3

[0318] 30.2 (440 mg, 2.07 mmol, 1 equivalent) in MeOH (12 mL) with NaOH (1 M, 4.14 mL, 2 equivalent) was stirred at 20 °C for 15 hours. The reaction was diluted with water (40 mL) then was extracted with EtOAc (40 mL x 2) to remove neutral impurities. The aqueous phase was acidified with aqueous HC1 to pH 5, then was extracted with Ethyl acetate (40 mL). 30.3 (160 mg, 807 μηιοΐ, 39% yield) was obtained as a white solid; LCMS [M + Hf : 199; RT = 1.01 min.26.1 30.4

[0319] To 30.3 (160 mg, 807.31 μηιοΐ, 1 equivalent) and EDCI (170.24 mg, 888.04 μιηοΙ. 1.1 equivalent), HOBt (120 mg, 888 μηιοΐ, 1.1 equivalent) in DMF (2 mL) was added compound 26.1 (210.17 rng, 807.31 μιηοΐ, 1 equivalent) and DIEA (417.34 mg, 3.23 mmol, 563.97 LL, 4 equivalent) in one portion at 0CC under N2. Tlie mixture was stirred at 20 °C for 15 hours. The reaction mixture was diluted with water (20 mL) and extracted with EtOAc (20mL 3). The combined organic layers were washed with brine (10 mL), dried over N zSO,}, filtered and concentrated under reduced pressure. The residue was purified by column chromatography (S1O2, Petroleum ether Ethyl acetate = 10 / 1 to 1 / 1) to give 30.4 (240 mg, 545 μτηοΐ, 67.5% yield) as a white solid; LCMS [M + H]+: 441; RT = 0.84 min.30.4 30.5

[0320] To a mixture of n-BuLi (209.41 mg, 3.27 mmol, 6 equivalent) was added to DIPA (330.8 mg, 3.3 mmol, 460 \LL, 6 equivalent) in THF (6 mL) in one portion at 0 °C under N2. After 0.5 h, 30.4 (240 mg, 545 μιηοΐ, 1 equivalent) and chloro(iodo)methane (577 mg, 3.3 mmol, 237.3 μΐ^, 6 equivalent) was added to above mixture at -78 °C under N2. The resulting mixture was stirred at -78 °C for 2 hrs. The reaction mixture was diluted with water (20 mL) then was extracted with EtOAc (20 mL x 3). The combined organic layers were washed withbrine (10 mL), dried over Na2SC>4, filtered and concentrated under reduced pressure and 30.5 (200 mg, crude) was obtained as a brown oil.30.5 30.6

[0321] To 30.5 (200 mg, 436 μιηοΐ 1 equivalent) and 2,5-difluorophenol (57 mg, 436 μηιοΐ, 1 equivalent) in DMF (4 mL) was added DIEA (168.96 mg, 1.31 mmol, 228.32 fxL, 3 equivalent); the mixture was stirred at 20 °C for 15 hours. The residue was purified by semi- preparative scale HPLC (TFA conditions) to give 30.6 (13 mg, 23.5 μηιοΐ, 5.4% yield); LCMS [M + Hf : 553; RT = 0.91 min.30.6 30

[0322] To 30.6 ( 13 mg, 23.53 μηιοΐ, 1 equivalent) in DCM (500 μΐ ) was added TFA(160.97 mg, 1.41 mmol, 104.53 iiL, 60 equivalent). The mixture was stirred at 20 °C for 3 hours. The residue was purified by semi-preparative scale HPLC (TFA conditions) to give Compound 30 (2 mg, 4.42 μιηοΐ, 19% yield) as colorless oil; LCMS [M + H]+:453; RT = 0.7 min.lR NMR (400 MHz, METHANOL-^) δ ppm 1.47 - 1.63 (m, 2 H), 1.67 - 1.86 (m, 2 H), 2.10 - 2.23 (m, 2 H), 2.85 - 3.01 (m, 2 H), 4.10 - 4.20 (m, 1 H), 4.11 - 4.20 (m, 1 H), 4.57 (t, J=5.84 Hz, 1 H), 4.69 (t, J=5.84 Hz, 1 H), 4.90 - 5.07 (m, 4 H), 6.95 - 7.03 (m, 2 H), 7.03 - 7.1 1 (m, 1 H), 7.14 (ddd, J=7.94, 2.54, 1.21 Hz, 1 H), 7.35 - 7.46 (m, 3 H).Example 27. Preparation of (S)-N-(7-amino-l-(2,6-difluorophenoxy)-2-oxoheptan-3-yI)- 2-fiuoroisonicotinamide (31)26.1 31.1

[0323] To a solution of 2-fluoro-4-carboxypyridine (523 mg, 3.71 mmol, 1.1 equivalent) in DMF (15 mL) was added HOBt (501 mg, 3.71 mmol, 1.1 equivalent) and EDCI (710.5 mg, 3.71 mmol, 1.1 equivalent). The mixture was stirred at 0 °C for 1 hr. Then to the mixture was added 26.1 (1 g, 3.37 mmol, 1 equivalent, HC1 salt) and DIEA (1.74 g, 13.48 mmol, 2.35 mL, 4 equivalent): the mixture was stirred at 25 °C for 14 hours. The reaction mixture was quenched by addition of H20 5(0 mL) and was extracted with ethyl acetate (30 mL x 3). The combined organic layers were washed with saturated brine (5 mL), dried over anhydrous sodium sulfate, filtered and concentrated. The residue was purified by columnchromatography (S1O2, Petroleum ether / Ethyl acetate=2: l) to give compound 31.1 (800 mg, 2.1 mmol, 62% yield) as yellow oil; LCMS [M + H - Boc]: 384; T = 0.8 min.!H NMR (400 MHz, METHANOL^) δ ppm 1.27 - 1.62 (m, 14 H), 1.69 - 2.08 (m, 2 H), 3.05 (t, J=6.50 Hz, 2 H), 3.75 (s, 3 H), 4.59 (dd, J=9.37, 4.96 Hz, 1 H), 7.46 (s, 1 H), 7.69 (dt, J=5.29, 1.54 Hz, 1 H), 8.35 (d, J=5.29 Hz, 1 H)31.1 31.2

[0324] To DIPA (659.8 mg, 6.52 mmol, 916.4 ,uL, 5 equivalent) in THF (5 mL) was added n-BuLi (2.5 M, 2.61 mL, 5 equivalent). The mixture was stirred at 0 °C for 0.5 hr under N2; then the mixture was added to a solution of 31.1 (500 mg, 1.3 mmol, 1 equivalent) and chloro(iodo)methane (1.15 g, 6.52 mmol, 473.3 \xL, 5 equivalent) in THF (10 mL); this was stirred at -78 °C for 0.5 hr. The reaction mixture was quenched by addition of saturatedNH4CI (20 ml) and extracted with ethyl acetate (15 mL x 3). The combined organic layers were washed with saturated NaiSO (10 mL), saturated NaHCOj (10 mL) and brine (lOmL). This was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to give 31.2 (620 mg).31.2 31.3

[0325] To 31.2 (620 mg, 1.54 mmol, 1 equivalent) in DMF (5 mL) was added DIEA (598.2 mg, 4.63 mmol, 808.36 ,uL, 3 equivalent) and 2,6-difluorophenol (301.1 mg, 2.31 mmol, 1.5 equivalent); this was stirred at 25 °C for 15 hours. Following an aqueous work up, the residue was purified by semi-preparative scale HPLC (TFA conditions) to give 31.3 (20 mg, 40.36 μιηοΐ, 3% yield).31.3 31

[0326] 31.3 (50 mg, 101 μπιοΐ, 1 equivalent) in DCM (5 mL) and TFA (1 mL) was stirred at 25CC for 15 hours. The residue was purified fay semi-preparative scale HPLC (TFA conditions) to give Compound 31 (10 mg, 25.3 μηιοΐ, 25% yield); LCMS [M + H]: 396; RT = 1.3 min. Ή NMR (400 MHz, METHANOL-^) δ ppm 1.40 - 1.91 (m, 5 H), 2.03 - 2.22 (m, 1 H), 2.83 - 3.03 (m, 2 H), 4.87 - 5.15 (m, 3 H), 6.90 - 7.17 (m, 2 H), 7.38 - 7.53 (m, 1 H), 7.60 - 7.74 (m, 1 H), 8.24 - 8.39 (m, 1 H).Example 28. Preparation of (S)-N-(7-amino-l-(2,6-difluorophenoxy)-2-oxoheptan-3-yI)- 2-fluoronicotinamide (32)26.1 32.1

[0327] To of 2-(fluoro)nicotinic acid (366.3 mg, 2.6 mmol, 1.1 equivalent) in DMF (15 fflL) was added HOBt (350.8 mg, 2.6 mmol, 1.1 equivalent) and EDCI (497.65 mg, 2.6 mmol, 1.1 equivalent). The mixture was stirred at 0 °C for 1 hr; then to the mixture was added 26.1 (700 mg, 2.36 mmol, 1 equivalent, HC1 salt) and DIEA (1.22 g, 9.44 mmol, 1.65 mL, 4 equivalent). The mixture was stirred at 25 °C for 14 hours. The reaction mixture was quenched with H20 (50 mL) then extracted with ethyl acetate (30mL x 3). The combined organic layers were washed with brine (5mL), then dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by column chromatography (Si(¼, Petroleum ether / Ethyl acetate = 21 1) to give 32.1 (600 mg, 1.56 mmol, 66% yield) as brown oil; LCMS [M + H]: 284; RT = 0.7 min.!H NMR (400 MHz, CHLOROFORM-i / ) δ ppm 1.42 (s, 1 1 H), 1.54 (dt, J=13.68, 6.84 Hz, 3 H), 1.63 (s, 1 H), 1.76 - 2.10 (m, 2 H), 3.12 (br d, J=6.15 Hz, 2 H), 3.80 (s, 3 H), 4.57 (br s, 1 H), 4.76 - 4.90 (m, 1 H), 7.30 - 7.48 (m, 2 H), 8.36 (br d, J=4.52 Hz, 1 H), 8.55 (ddd, J=9.66, 7.72, 1.95 Hz, I H).32.1 32.2

[0328] To DIPA (527.8 mg, 5.2 mmol, 733 5 equivalent) in THF (5 mL) was added n- BuLi (2.5 M, 2.1 mL, 5 equivalent): the mixture was stirred at 0 °C for 0.5 hr under N2. Then the mixture was added to 32.2 (400 mg, 1.04 mmol, 1 equivalent) and chloro(iodo)methane(920 mg, 5.22 mmol, 378.6 lL, 5 equivalent) in THF (5 mL); this was stirred at -78 °C for 0.5 hours. The reaction mixture was quenched with saturated NH4CI (20 ml) and extracted with ethyl acetate (15xmL x 3). The combined organic layers were washed with saturated Na2SOs (10 mL), saturated NaHCC>3 ( 10 mL) and brine (lOmL); this was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to give 32.2 (620 mg).32.2 32.2

[0329] To 32.2 (500 mg, 1.24 mmol, 1 equivalent) and 2,6-difluorophenol (242.8 mg, 1.87 mmol, 1.5 equivalent) in DMF (6 mL) was added DIEA (482.41 mg, 3.73 mmol, 652(uL, 3 equivalent). The mixture was stirred at 25 °C for 15 hours. The residue was purified by semi-preparative scale HPLC (TFA conditions) to give 32.2 (20 mg, 40.4 μιηοΐ, 3% yield); LCMS [M + H]: 496; RT = 0.86 min.

[0330] 32.2 (20 mg, 40.4 μηιοΐ, 1 equivalent) in DCM (5 mL) and TFA (1 mL) was stirred at 25 °C for 15 hows. The residue was purified by semi-preparative scale HPLC (TFA conditions) to give Compound 32 (5 mg, 12.65 μιηοί, 31% yield); LCMS [M + H]: 396; RT = 1.25 min.!H NMR (400 MHz, METHANOL-^) δ ppm 1.44 - 1.87 (m, 5 H), 2.06 - 2.22 (m, 1 H), 2.85 - 3.03 (m, 2 H), 4.89 - 5.12 (m, 3 H), 6.93 - 7.05 (m, 2 H), 7.06 - 7.15 (m, 1 H), 7.45 (ddd, J=7.22, 5.02, 1.87 Hz, 1 H), 8.26 (ddd, .7=9.48, 7.50, 1.98 Hz, 1 H), 8.30 - 8.40 (m, 1 H).Example 29. Preparation of (S)-N-(7-amino-l-(2,6-difluorophenoxy)-2-oxoheptan-3-yI)- 3-azidobenzamide (33)33.1 33.2

[0331] To 33.1 (5 g, 36.5 mmol, 1 equivalent) and t-BuONO (5.64 g, 54.7 mmol, 6.5 mL, 1.5 equivalent) in AcN (70 mL) was added TMSN3(5.04 g, 43.75 mmol, 5.73 mL, 1.2 equivalent) in one portion at 18 °C under ]¾. The mixture was stirred at 18 °C for 10 hours. The reaction mixture was diluted with H20 (100 mL) and extracted with EtOAc (50 mL x 3). The combined organic layers were washed with brine (100 mL), dried over Na2SC>4, filtered and concentrated under reduced pressure. This material was purified by columnchromatography (Si02, DCM: MeOH = 10: 1 ) to give 33.2 (3 g, 18.4 mmol, 50% yield).26.1 33.310332 J To 33.2 (1.25 g, 7.68 mmol, 1 equivalent) and EDCI (1.62 g, 8.45 mmol, 1.1 equivalent) in DMF (20 mL) was added HOBt (1.14 g, 8.45 mmol, 1.1 equivalent). The mixture was stirred at 0 °C for 1 hour; then a solution of 26.1 (2 g, 7.68 mmol, 1 equivalent) in DMF (5 mL) was added drop wise followed by the addition of DIPEA (2.98 g, 23.04 mmol, 4.03 mL, 3 equivalent). This mixture was stirred at 0 °C for 1 hour. The reaction mixture was diluted with H20 (20 mL) and extracted with EtOAc (15 mL x 3). The combined organic layers were washed with brine (40 mL x 1), dried over Na SO / i, filtered and concentrated. The residue was purified by column chromatography (S1O2, Petroleum ether / Ethyl acetate = 1 / 1) to give 33.3 (2.8 g, 6.91 mmol, 90% yield).JH NMR (400 MHz, METHANOL-d4) δ ppm 1.40 (s, 8 H), 1.44 - 1.58 (m, 4 H), 1.80 - 2.00 (m, 2 H), 3.00 - 3.10 (m, 2 H), 3.74 (s, 3 H), 4.58 (dd, J=9.26, 5.07 Hz, 1 H), 7.25 (ddd, J=8.05, 2.32, 1.10 Hz, 1 H), 7.49 (t, J=7.83 Hz, 1 H), 7.56 (t, J= 1.76 Hz, 1 H), 7.63 - 7.69 (m, 1 H).33.3 33.4

[0333] To a solution of DIPA (1.5 g, 14.8 mmol, 2.08 mL, 6 equivalent) in THF (15 mL) was added n-BuLi (2.5 M, 5.92 mL, 6 equivalent) at 0 °C; the mixture was stirred for 30 mins. This was added to 33.3 (1 g, 2.47 mmol, 1 equivalent) and chloro(iodo)methane (2.18 g, 12.35 mmol, 895.1 1 iL, 5 equivalent) in THF (15 mL) at -78 °C. The mixture was stirred at -78CC for 30 mins. The reaction mixture was quenched by addition of NH4C1 (10 mL), and then extracted with EtOAc (15 mL x 3). The combined organic layers were washed with NazSO.i (20 mL), and brine (20 mL), dried over Na2SC>4; then filtered and concentrated to give 33.4 (2 g) which was used to next step.33.4 33.5

[0334] To 33.4 (2 g) and 2,6-difluorophenol (614 mg, 4.72 mmol, 1 equivalent) in DMF (5 mL) was added DIPEA (2.44 g, 18.87 mmol, 3.3 mL, 4 equivalent); this mixture was stirred at 20 °C for 10 hours. Following an aqueous work up, the residue was purified by semi- preparative HPLC (TFA conditions) to give 33.5 (200 mg, 386.46 μηιοΐ, 8% yield).

[0335] 33.5 5(100 mg, 193.23 μηιοΐ, 1 equivalent) in DCM (5 niL) and TFA (1 mL) was stirred at 18 °C for 10 hours. The reaction mixture was concentrated under reduced pressure, then was purified by semi-preparative HPLC (TFA conditions) to give Compound 33 (80 mg, 192 μηιοΐ, yield 99%) as yellow oil; LCMS [M + H]: 418; RT = 3.1 min. Ή NMR (400 MHz, METHANOL-d4) δ ppm 1.49 - 1.67 (m, 2 H) 1.67 - 1.88 (m, 3 H) 2.1 1 (dddd,J=13.84, 9.48, 6.78, 4.30 Hz, 1 H) 2.89 - 2.99 (m, 2 H) 4.91 - 5.08 (m, 3 H) 6.95 - 7.05 (m, 2 H) 7.05 - 7.12 (m, 1 H) 7.26 - 7.31 (m, 1 H) 7.48 - 7.54 (m, 1 H) 7.56 (t, J=1.87 Hz, 1 H) 7.64 - 7.70 (m, 1 H).Example 30. Preparation of (S)-N-(7-amino-l-(2,6-difIuorophenoxy)-2-oxoheptan-3-yl)- 2-bromonicotinamide (34)26.1 34.1

[0336] To 2-(bromo)mcotmic acid (748.71 mg, 3.71 mmol, 1.1 equivalent) in DMF (30 mL) was added HOBt (501 mg, 3.71 mmol, 1.1 equivalent) and EDCI (710.5 mg, 3.71 mmol, 1.1 equivalent); this was stirred at 0 °C for 1 hr. To this mixture was added compound 26.1 (1 g, 3.37 mmol, 1 equivalent, HC1 salt) and DIEA (1.74 g, 13.48 mmol, 2.35 mL, 4 equivalent); this was stirred at 25CC for 14 hours. The reaction mixture was quenched by addition H20 ( 50 mL) and extracted with ethyl acetate (30 mL x 3). The combined organic layers were washed with brine (5 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by column chromatography (S1O2, Petroleum ether / Ethyl acetate = 2 / 1) to give 34.1 (950 mg, 2.14 mmol, 63.5% yield) as yellow oil; LCMS [M + H]: 345; RT= 0.73 min.!H NMR (400 MHz, CHLOROFORM-* / ) δ ppm 1.29 - 1.60 (m, 16 H), 1.76 - 2.04 (m, 2 H), 2.98 - 3.27 (m, 2 H), 3.80 (s, 3 H), 4.59 (br s, 1 H), 4.71 - 4.86 (m, 1 H), 6.95 (br d, J=6.61 Hz, 1 H), 7.36 (dd, .7=7.61, 4.74 Hz, 1 H), 7.92 (dd, J=7.61, 1.87 Hz, 1 H), 8.45 (dd, J=4.85, 1.98 Hz, 1 H)34.1 34.2

[0337] To DIPA (1.08 g, 10.69 mmol, 1.50 mL, 5 equivalent) in THF (5 mL) was added n- BuLi (2.5 M, 4.28 mL, 5 equivalent); this mixture was stirred at 0 °C for 0.5 hr under N2. This mixture was added to 34.1 (950 mg, 2.14 mmol, 1 equivalent) and chloro(iodo)methane (1.89 g, 10.7 mmol, 776.65 ,uL, 5 equivalent) in THF (10 mL) and stirred at -78 °C for 0.5 hr. The reaction mixture was quenched with N H C1 (20 ml) at 25 °C and extracted with ethyl acetate (15 mL x 3). The combined organic layers were washed with saturated Na2SC>3 (10 mL), NaHCOs (10 mL) and brine (10 mL). This was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to give 34.2 (1.1 g).34.2 34.3

[0338] To 34.2 ( 1.1 g, 2.38 mmol, 1 equivalent) in DMF ( 10 mL) was added DIEA (921.63 mg, 7.13 mmol, 1.25 mL, 3 equivalent) and 2,6-difluorophenol (463.84 mg, 3.57 mmol, 1.5 equivalent). The mixture was stirred at 25 °C for 15 hours; following an aqueous work-up, the product was purified by semi-preparative HPLC (TFA conditions) to give 34.3 (150 mg, 269.6 μιηοΐ, 1 1% yield).

[0339] A 34.3 (150 mg, 270 μιηοΐ, 1 equivalent) in DCM (10 mL) and TFA (2 mL) was stirred at 25 °C for 14 hours. The mixture was concentrated under reduced pressure to giveCompound 34 (100 mg, 219.16 μιηοΐ, 81.3% yield);LCMS [M + H]: 456; RT = 2.28 min. ¾ NMR (400 MHz, METHANOL -<¾) δ ppm 1.51 - 1.88 (m, 6 H), 1.97 - 2.21 (m, 1 H), 2.95 (br t, J=7.50 Hz, 2 H), 4.96 (dd, .7=9.70, 4.19 Hz, 1 H), 5.00 - 5.14 (m, 1 H), 6.93 - 7.15 (m, 2 H), 7.41 - 7.56 (m, 1 H), 7.73 - 7.89 (m, 1 H), 8.35 - 8.48 (m, 1 H). Example 31. Preparation of (S)-N-(7-amino-l-(2,6-difluorophenoxy)-2-oxoheptan-3-yl)- 4-fluorobeiizamide (35)26.1 35.1

[0340] To 4-(fluoro)benzoic acid (538.2 mg, 3.84 mmol, 1 equivalent) in DMF (15 mL) was added HOBt (570.75 mg, 4.22 mmol, 1.1 equivalent) and EDCI (809.74 mg, 4.22 mmol. 1.1 equivalent); the mixture was stirred at 25 °C for 0.5h. To the mixture was added 26.1 (1 g, 3.84 mmol, 1 equivalent) and DIEA (1.99 g, 15.36 mmol, 2.68 iriL, 4 equivalent); the reaction was stirred for 14h. The reaction mixture was quenched by addition H20 (50 mL) and extracted with EtOAc (50 mL x 3). The combined organic layers were washed with saturated NaHC0. (25 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to give 35.1 (1.10 g); LCMS [M + H]: 369; RT = 0.8 min.35.1 35.2

[0341] To DIPA (1.32 g, 13.05 mmol, 1.83 mL, 5 equivalent) in THF (10 mL) was added n-BuLi (835.98 mg, 13.05 mmol, 5 equivalent); this was stirred at 25° for 0.5 h under N2. The mixture was added to 35.1 (1 g, 2.61 mmol, 1 equivalent) and ch 1 oi o( i odo) metha e (5 equivalents) in THF (10 mL), then was stirred at -78° for 2h. The reaction mixture was quenched by addition saturated ammonium chloride (30 mL) and extracted with EtOAc (50mL x 3). The combined organic layers were washed with saturated sodium hydrogen sulfite (25 mL) and brine. This was dried over anliydrous sodium sulfate, filtered and concentrated under reduced pressure to give 35.2 (800 mg, 2 nimol, 77% yield). The product used into the next step without further purification; LCMS [M ÷ H]: 402; RT = 0.8 min.

[0342] To 35.2 (800 mg, 2 mmol, 1 equivalent) in DMF (10 mL) was added DIEA (773.76 mg, 5.99 mmol, 1.05 mL, 3 equivalent) and 2,6-difluorophenol (389.42 mg, 2.99 mmol, 1.5 equivalent). The mixture was stirred at 25CC for 15 hours. Following an aqueous work up, it was purified by semi-preparative HPLC (TFA conditions) to give 35.3 (80 mg, 161.78 μηωΐ, 8 % yield); LCMS [M + H]: 495; RT = 0.94 min.35.3 35

[0343] 35.3 (80 mg, 232.95 μηιοί) in HCl / EtOAc (15 mL) was stirred at 25 °C for 14 hours. The reaction mixture was filtered and concentrated under reduced pressure to give Compound 35 (50 mg, 205.51 μιηοΐ, 88% yield); LCMS [M + H]: 244; RT = 0.104 min.XH NMR (400 MHz, METHANOL-^) δ ppm 1.51 - 1.65 (m, 2 H), 1.67 - 1.87 (m, 3 H), 2.05 - 2.18 (m, 1 H), 2.95 (br d, J=5.29 Hz, 2 H), 4.90 - 4.95 (m, 1 H), 4.95 - 5.07 (m, 2 H), 6.96 - 7.02 (m, 2 H), 7.03 - 7.12 (m, 1 H), 7.22 (t, .7=8.82 Hz, 2 H), 7.92 (dd, J=8.82, 5.29 Hz, 2 H).32. Preparation of N-(7-amino-l,l,l-trifluoro-2-oxoheptan-3-yl)benzamide36.1

[0344] To ε-Cbz lysine (2.4 g, 8.56 mmol, 1 equivalent) in H20 (6 mL) was added NaOH (684.93 nig, 17.12 mrnol, 2 equivalent) in one portion at 0 °C under N2. The mixture was stirred at 0 °C for 1 hour. The mixture was then added compound benzoyl chloride (1.20 g, 8.56 mmol, 994.64 μΐ^, 1 equivalent) dropwise, and the mixture was stirred for 9 hours. The reaction mixture was filtered and the solid was washed with EtOAc (10 ml) to give 36.1 (4 g) as a white solid; LCMS [M + H]: 385; RT = 0.77 min.36.1 36.2

[0345] To 36.1 (4 g, 10.41 mmol 1 equivalent) in DCM (40 ml.) was added EDCI (2 g, 10.41 mmol, 1 equivalent) in one portion at 18CC under N2. The mixture was stirred at 18CC for 0.5 hours. The reaction mixture was quenched by addition H20 (40 mL) then extracted with DCM (20 mL x 3). The combined organic layers were washed with NaHCCh (50mL), dried over Na2S04. filtered and concentrated under reduced pressure to give 36.2 (5 g); LCMS [M + H]: 367; RT = 0.87 min. ¾ NMR (400 MHz, METHANOL-^) δ ppm 1.33 - 2.02 (m, 7 H), 3.10 - 3.17 (m, 2 H), 4.35 - 4.54 (m, 1 H), 4.98 - 5.06 (m, 2 H), 7.28 - 7.38 (m, 5 H), 7.42 - 7.50 (m, 2 H), 7.52 - 7.58 (m, 1 H), 7.76 - 7.86 (m, 2 H).NHCbz36.2 36.3

[0346] To 36.2 (3 g, 8.19 mmol, 1 equivalent) was added TFAA (2,06 g, 9.83 mmol, 1.37 mL, 1.2 equivalent); this was stirred at 40 °C for 10 hours. The reaction mixture was concentrated under reduced pressure to give 36.3 (3.5 g, 7.57 mmol, 92% yield); LCMS [M + H]: 463; RT = 0.96 min.36.3 36.4

[0347] To 36.3 (3 g, 6.49 mmol, 1 equivalent) was added oxalic acid (934.53 mg, 10.38 mmol, 916 μί, 1 equivalent). The mixture was stirred at 120 °C for 5 mins. Then it was quenched by addition FTO (20 mL) and extracted with EtOAc (20 mL x 2). The combined organic layers were washed with brine (40 mL), dried over Na2S04, filtered and concentrated. The residue was purified by semi-preparative HPLC (TFA conditions) to give 36.4 (200 mg, 458.27 μιηοΐ, 7% yield); LCMS [M + H]: 437; RT = 0.9 min. *H NMR (400 MHz,METHANOL-^) δ ppm 1.21 - 1.96 (m, 7 H), 3.04 - 3.16 (m, 2 H), 4.30 - 4.51 (m, 1 H), 4.99 (s, 1 H), 7.27 - 7.34 (m, 3 H), 7.40 - 7.47 (m, 1 H), 7.48 - 7.56 (m, 1 H), 7.74 - 7.83 (m, 1 H).36.4 36

[0348] To 36.4 ( 100 mg, 229.14 Limol, 1.00 equivalent) in i-PrOH ( 10 niL) and HC1 ( 1 M, 2 mL, 8.73 equivalent) was added Pd-C (10%, 0.02 g) under N2. The suspension was degassed under vacuum and purged with H2several times. The mixture was stirred under H2(50 psi) at 18 °C for 10 hours. The reaction mixture was filtered and concentrated under reduced pressure. The residue was purified by semi-preparative HPLC (neutral conditions) to give Compound 36 (20 mg, 66.16 μιηοΐ, 29% yield); LCMS [M + H]: 303; RT = 1.73 min. Ή NMR (400 MHz, METHANOL-^) δ ppm 1.27 - 2.04 (m, 6 H), 2.88 (br s, 1 H), 4.50 (br t, J=12.04 Hz, 1 H), 7.44 - 7.52 (m, 2 H), 7.53 - 7.61 (m, 1 H), 7.73 - 7.90 (m, 2 H). Example 33. Preparation of N-(7-amino-l,l-difluoro-2-oxoheptan-3-yl)benzamide (37)36.2 37.1

[0349] 36.2 (1.2 g, 3.28 mmol, 1 equivalent) in difluoroacetic anhydride (1.71 g, 9.83 rnmol, 3 equivalent) was stirred at 40 °C for 2 hours. The reaction mixture was concentrated under reduced pressure to give 37.1 (1.2 g, crude); LCMS [M + H]: 445; RT = 0.91 min. bz37.1 37.2

[0350] 37.1 (1.2 g, 2.70 mmol, 1 equivalent) and oxalic acid (486.18 mg, 5.40 mmol, 476.64 ]xL, 2 equivalent) was stirred at 120 °C for 10 min under N2. The mixture was concentrated under reduced pressure and purified by column chromatography (Si02, Ethyl acetate) to give a crude 37.2, then was purified further by semi-preparative scale HPLC (neutral conditions) to give pure 37.2 (120 mg, 286.79 μιηοΐ, 80% yield); LCMS [M + H]: 419; RT = 0.79 min.37.2 37

[0351] 37.2 (10 mg, 23.9 μηιοΐ, I equivalent) in HCI (1 mL) and dioxane (1 mL) was stirred at 50 °C for 2 hours. The mixture was concentrated under reduced pressure and was purified by semi-preparative scale HPLC (neutral conditions) to give Compound 37 (120 mg, 287 μιηοΐ, 80% yield); LCMS [M + H]: 285; RT = 2.0 min.lR NMR (400 MHz,METHANOL-^) δ ppm 1.38 - 1.57 (m, 1 H), 1.72 - 1.97 (m, 5 H), 2.01 - 2.14 (m, 1 H), 3.70 - 3.85 (m, 1 H), 4.05 (br dd, J=12.35, 6.84 Hz, 1 H), 5.95 - 6.29 (m, 1 H), 7.44 - 7.60 (m, 4 H), 7.81 - 7.90 (m, 2 H). Example 34. Preparation of a fluorescent gingipain activity probe with cleavable quencher: (S,E)-N-(7-amino-l-(4-((4-((4-(dimethyIamiiio)phenyl)diazeiiyl)benzamido)- methyl)-2,6-difluorophenoxy)-2-oxoheptan-3-yl)-3-(4-((3-(5,5-difluoro-7,9-dimethyl-5H- 514,614-dipyrrolo[l,2-c:2^1'-i][l,3,2]diazaborinin-3-yl)propanamido)methyI)-lH-l,2,3- triazol-l-yl)benzamide (38)

[0352] To 2,6-Difluoro-4-cyanophenol (2.5 g, 16.12 mmol, 1 equivalent) was added BH3- THF ( 1 M, 64.48 mL, 4 equivalent). The mixtiue was stirred at 70 °C for 10 hours. Thereaction was quenched by addition of HQ (6 M, 5 mL) at 25 °C then it was concentrated under reduced pressure to give 38.1 (7.1 g, crude) as a white solid.38.1 38.3

[0353] To 38.2 (6.09 g, 22.62 mmol 1 equivalent) in DMF (15 mL) was added HOBt (3.36 g, 24.88 mmol, 1.1 equivalent) and EDCI (4.77 g, 24.88 mmol, 1.1 equivalent). The mixture was stirred at 0 °C for 1 hour, then 38.1 (3.60 g, 22.62 mmol, 1 equivalent) and DIEA (11.70 g, 90.48 mmol, 15.81 mL, 4.00 equivalent) was added; this mixture was stirred at 25 °C for 11 hours. The reaction was diluted with ¾0 (20 mL) and extracted with EtOAc (20 rnL x 3). The combined organic layers were washed with brine (20 mL), dried over Na2S04, filtered and concentrated under reduced pressure. This was purified by columnchromatography (S1O2, Petroleum ether / Ethyl acetate = 1 / 1) to give 38.3 (400 mg, 974.6 μΐΉθΙ) as a red solid. Ή NMR (400 MHz, METHANOL-^) δ ppm 3.1 1 (s, 6 H), 4.48 (s, 2 H), 6.84 (d, J=9.29 Hz, 2 H), 6.90 - 6.98 (m, 2 H), 7.78 - 7.90 (m, 4 H), 7.94 - 8.01 (m, 2 H).38.3

[0354] To 33.4 (1 g, 2.36 mmol, 1 equivalent) and 38.3 (100 mg, 243.65 μιηοΐ, 0.1 equivalent) in DMF (10 mL) was added DIPEA (1.22 g, 9.44 mmol, 1.65 mL, 4 equivalent) in one portion at 20 °C under N2. The mixture was stirred at 20CC for 10 hours. The reaction mixture was diluted with H20 (10 mL) and extracted with EtOAc (10 mL x 3). The combined organic layers were washed with brine (30 mL), dried over Na2SC>4, filtered andconcentrated. This was purified by column chromatography (SiC>2, Petroleum ether / Ethyl acetate = 1 / 1) to give 38.4 (250 mg, 313.34 μηιοΐ) as a red solid.

[0355] To a mixture of 38.4 (220 mg, 275.74 μιηοΐ, 1 equivalent) and prop-2-yn-l -amine (15.19 mg, 275.74 μηιοΐ, 17.66 μΐ,, 1 equivalent) in DMSO (2 mL) was added the solution of CuS04(8.8 mg, 55.15 μιηοΐ 8.46 μΐ., 0.2 equivalent) in H20 (100 μί) and sodium ascorbate (109.25 mg, 551.48 μηιοΐ, 2 equivalent) in one portion at 18 °C under N2. This mixture was stirred at 18 °C for 5 mins. The reaction mixture was diluted with ¾0 (5 mL) and extracted with EtOAc (5 mL x 3). The combined organic layers were washed with brine (10 mL), dried over Na2SC>4, filtered and concentrated to give 38.5 (250 mg) as a brown solid; LCMS [M + H]: 853; RT = 1.14 min.38.6

[0356] To 2-formylpyrrole (5 g, 52.58 mmol, 1 equivalent) and methyl 2- diethoxyphosphorylacetate (1 1.05 g, 52.58 mmol, 1 equivalent) in THF (60 mL) was added K2CO3 (14.53 g, 105.16 mmol, 2 equivalent) at 50 °C under N2. The mixture was stirred at 50 °C for 10 hours. The reaction was diluted with H2O (50 mL) and extracted with EtOAc (50 mL x 3). The combined organic layers were washed with brine (100 mL), dried over Na2S04, filtered and concentrated. This material was purified by column chromatography (Si02, Petroleum ether / Ethyl acetate = 5 / 1) to give 38.6 (8.6 g, 57 mmol) as a white solid; LCMS [M ÷ H]: 152; RT = 0.68 min.JH NMR (400 MHz, METHANOL-d4) δ ppm 3.69 - 3.76 (m, 3 H), 6.04 - 6.13 (m, 1 H), 6.15 - 6.21 (m, 1 H) ,6.31 (dt, J=3.91, 2.12 Hz, 1 H,) 6.45 - 6.57 (m, 1 H), 6.92 (br d, J= 1.32 Hz, 1 H), 6.98 - 7.21 (m, I H), 7.44 - 7.59 (m, 1 H).38.6 38.7

[0357] To 38.6 (8.6 g, 56.89 mmol) in MeOH (100 mL) was added Pd-C (10%, 0.9 g) under N2. The suspension was degassed under vacuum and purged with H2several times. The mixture was stirred under H2(50 psi) at 18 °C for 10 hours. The reaction mixture was filtered and concentrated. This material was purified by column chromatography (Si02, Petroleum ether / Ethyl acetate = 5 / 1) to give 38.6 (5 g, 32.64 mmol); LCMS [M + H]: 154; RT = 0.55 min. *H NMR (400 MHz, CHLOROFORM-cf) δ ppm 2.66 (t, J=6.78 Hz, 2 H), 2.93 (t, J=6.71 Hz, 2 H), 3.62 - 3.78 (m, 3 H), 5.80 - 5.99 (m, 1 H), 6.12 (q, J=2.76 Hz, 1 H) 6.60 - 6.76 (m, 1 H), 8.54 (br s, 1 H).38.6 38.7

[0358] To 38.6 (3 g, 19.58 mmol, 1 equivalent) and compound 2-formyl-3,5- dimethylpyrrole (2.65 g, 21.54 mmol, 1.1 equivalent) in DCM (60 mL) was added POCI3 (3.3 g, 21.54 mmol, 2 mL, 1.1 equivalent) in one portion at 18 °C under N2. The mixture was stirred at 18 °C for 10 hours, then BF3.Et20 (1 1.12 g, 78.32 mmol, 9.67 mL, 4 equivalent) and DIEA (10.63 g, 82.24 mmol, 14.36 mL, 4.2 equivalent) was added drop wise at 18 °C. This mixture was stirred at 18 °C for 10 hours. The reaction mixture was filtered, then diluted with H20 (50 mL) and extracted with DCM (50 mL x 3). The combined organic layers were washed with brine (100 mL), dried over Na2S04, filtered and concentrated. This was purified by column chromatography (Si02, Petroleum ether / Ethyl acetate = 1 / 4) to give 38.7 (3 g, 9.80 mmol). Ή NMR (400 MHz, CHLOROFORM-* / ) δ ppm 2.25 (s, 3 H), 2.57 (s, 3 H), 2.78 (t, J=7.59 Hz, 2 H), 3.30 (t, J=7.65 Hz, 2 H), 3.67 - 3.78 (m, 3 H), 6.1 1 (s, 1 H), 6.27 (d, J=3.89 Hz, 1 H), 6.88 (d, J=3.89 Hz, 1 H), 7.08 (s, 1 H).38.7 38.8

[0359] 38.7 (1.2 g, 3.92 mmol, 1 equivalent) and HC1 ( 50 mL, 37%) in THF (120 mL) and H20 (80 mL) was stirred at 18 °C for 24 hours. The reaction mixture was partitioned with DCM (80 mL) and the aqueous layer was extracted with DCM (100 mL x 2). The combined organic layers were washed with brine (300 mL), dried over Na2S0 , filtered and concentrated. This material was purified by preparative scale TLC (S1O2, DCM: MeOH = 10: 1 ) to give 38.8 (700 mg, 2.4 mmol) as a red solid.38.5 38.9

[0360] To a mixture of 38.8 (109.59 mg, 375.18 Limol, 2 equivalent) and HOBt (152.08 mg, 1.13 mmol, 6 equivalent) in DMF (2 mL) was added EDCI (215.76 mg, 1.13 mmol, 6 equivalent) at 0 °C under N2. The mixture was stirred at 0 °C for 10 mins. To this mixture was added 38.5 (160 mg, 187.59 μηιοΐ, 1 equivalent) and DIPEA (145.46 mg, 1.13 mmol, 196.57 Ε, 6 equivalent), this mixture was stirred at 0 °C for 20 mins. The reaction mixture was diluted with H20 (5 mL) and extracted with EtOAc (5 mL x 3). The combined organic layers were washed with brine (10 mL), dried over Na2SC>4, filtered and concentrated. The residue was purified by preparative scale TLC (S1O2, EtOAc) to give 38.9 (60 mg, 53.24 μιηοί); LCMS [M + H]: 1 128; RT = 1.45 min.

[0361] 38.9 (50 mg, 44.37 μιηοΐ, 1 equivalent) was added to HC1 / EtOAc (5 mL), and the mixture was stirred at 18 °C for 10 mins. The reaction was concentrated under reduced pressure, then was purified by semi-preparative scale HPLC (TFA condition) to give Compound 38 (10 mg, 9.74 μιηοΐ); LCMS [M + H]: 1027; T = 2.82 min. Ή NMR (400 MHz, DMSO-d6) δ ppm 1.23 - 1.59 (m, 4 H), 1.67 (br d, J=9.48 Hz, 1 H), 1.85 (br d, J=6.62 Hz, 1 H), 2.21 (s, 2 H), 2.42 (s, 3 H), 2.53 (br d, J=7.94 Hz, 2 H), 2.74 (br d, J=6.39 Hz, 2 H), 3.04 (s, 5 H), 3.06 - 3.1 1 (m, 1 H), 4.39 (br d, J=5.51 Hz, 5 H), 4.64 (br s, 1 H), 4.99 - 5.20 (m, 2 H), 6.25 (s, 1 H), 6.32 (br d, J=3.97 Hz, 1 H), 6.81 (br d, J=9.04 Hz, 2 H), 6.96 - 7.10 (m, 2 H), 7.52 - 7.62 (m, 3 H), 7.68 (br t, J=8.05 Hz, 1 H), 7.79 (br dd, J=8.60, 4.41 Hz, 3 H), 7.90 - 8.01 (m, 2 H), 8.04 (d, J=7.72 Hz, 1 H), 8.36 (s, 1 H), 8.47 - 8.58 (m, 1 H), 8.64 (s, 1 H), 8.96 (br d, J=7.50 Hz, 1 H), 9.07 - 9.20 (m, 1 H).Example 35. Preparation of (S)-N-(7-amiiio-2-oxo-l-(6-oxopyrimidin-l(6H)-yl)heptan-3- yl)cyclopentanecarboxamide (39)1.2 39.1

[0362] To 1.2 (150 mg, 357.7 μιτιοΐ, 1 equivalent) in DMF (2 mL) was added K2C03(148.31 mg, 1.07 mmol, 3and 4-hydoxylpyrimidine (34.37 mg, 357.7 μιτιοΐ, 1 equivalent). The mixture was stirred at 25 °C for 15 hours. The residue was purified by semi-preparative scale HPLC (TFA condition) to give 39.1 (40 mg, 92.05 μιηοΐ); LCMS [M + H]: 435; RT = 0.76 min.39.1 39

[0363] 39.1 (40 mg, 92.05 Limol, 1 equivalent) in DCM (5 mL) and TFA (1 mL) was stirred at 25 °C for 15 hours. The mixture was concentrated under reduced pressure to give Compound 39 (20 mg, 59.8 μιηοΐ, 65% yield); LCMS [M + H]: 335; RT = 0.25 min. ¾ NMR (400 MHz, METHANOL-^) δ ppm 1.37 - 1.57 (m, 2 H), 1.57 - 1.81 (m, 10 H), 1.83 - 2.06 (m, 3 H), 2.63 - 2.83 (m, 1 H), 2.94 (br t, J=7.50 Hz, 2 H), 4.52 (dd, J=8.49, 5.40 Hz, 1 H), 4.95 - 4.99 (m, 1 H), 4.97 (s, 1 H), 6.51 (d, J=6.61 Hz, 1 H), 8.00 (d, J=6.61 Hz, 1 H), 8.32 (s, 1 H).Example 36. Preparation of (S)-N-(7-amino-2-oxo-l-(4-oxopyrimidin-l(4H)-yl)heptan-3- yl)cyclopentanecarboxamide (40)1.2 40.1

[0364] To 1.2 (100 mg, 238.46 μηιοΐ, 1 equivalent) in DMF (3 mL) was added Ag2C03(197.27 mg, 715.38 μηιοΐ, 32.45 μΤ, 3.00 equivalent) and 4-hydroxypynmidine (22.91 mg, 238.46 μιηοΐ, 1 equivalent). The mixture was stirred at 25 °C for 15 hours. The residue was purified by semi-preparative scale HPLC (TFA condition) to give 40.1 (30 mg, 69.04 μηιοΐ, 29% yield) as a white solid; LCMS [M + H]: 435; RT=0.74 min.40.1

[0365] 40.1 (30 mg, 69 μτηοΐ, 1 equivalent) in TFA (1 mL) and DCM (5 mL) was stirred at 25 °C for 15 hours. The mixture was concentrated under reduced pressure to give Compound 40 (2 mg, 6 μηιοΐ); LCMS [M + H]: 335; RT = 0.43 min. ¾ NMR (400 MHz,METHANOL-^) δ ppm 1.24 - 1.57 (m, 4 H), 1.58 - 1.81 (m, 10 H), 1.82 - 2.03 (m, 4 H), 2.66 - 2.84 (m, 1 H), 2.86 - 3.03 (m, 2 H), 4.31 - 4.48 (m, 1 H), 4.95 - 5.19 (m, 2 H), 6.30 (d, J=7.58 Hz, 1 H), 7.62 (br d, J=7.34 Hz, 1 H), 8.23 (br s, 1 H).Example 37. Preparation of (S)-N-(7-amino-l-(5-fluoro-6-oxopyrimidin-l(6H)-yI)-2- oxoheptan-3-yl)cyclopentanecarboxamide (41)1.2 41.1

[0366] To 1.2 (150 mg, 357.7 μιηοΐ, 1 equivalent) in DMF (2 mL) was added K2C03(148.31 mg, 1.07 mmol, 3 equivalent) and 5-fluorop>Timidin-4-ol (40.81 mg, 357.7 μηιοΐ, 1 equivalent). The mixture was stirred at 25CC for 15 hours. The residue was purified by semi-preparative scale HPLC (TFA condition) to give 41.1 (50.00 mg, 1 10.49 μιηοΐ, 30.89% yield) as a white solid; LCMS [M + H]: 453; RT = 0.8 min.41.1 41

[0367] 41.1 (50 mg, 1 10.49 μηιοΐ, 1. equivalent) in DCM (5 mL) and TFA (1 mL) was stirred at 25 °C for 15 hours. The mixture was concentrated under reduced pressure to give Compound 41 (30 mg, 85.13 μιηοΐ, 77% yield) as a white solid; LCMS [M + H]: 353; RT = 0.16 min. 'H NMR (400 MHz, METHANOL^) 6 ppm 1.28 - 1.47 (m, 2 H), 1.48 - 1.73 (m, 9 H), 1.75 - 1.98 (m, 3 H), 2.56 - 2.73 (m, 1 H), 2.86 (br t, J=7.52 Hz, 2 H), 4.44 (dd, J=8.56, 5.50 Hz, 1 H), 4.90 - 5.04 (m, 2 H), 7.95 (d, J=2.45 Hz, 1 H), 8.05 (s, 1 H).Example 38. Preparation of (S)-N-(7-amino-2-oxo-l-(2,3,6-trifhiorophenoxy)heptan-3- yl)nicotinamide (42)26.1 42.1

[0368] To nicotinic acid (497.86 mg, 4.04 mmol, 339 μΧ, 1.2 equivalent) in DMF (10 mL) was added HOBt (501 mg, 3.71 mmol, 1.1 equivalent) and EDCI (710.5 mg, 3.71 mmol, 1.1 equivalent). The mixture was stirred at 0 °C for ihr. Then the mixture was added to DIPEA (1.74 g, 13.48 mmol, 2.35 mL, 4 equivalent) and 26.1 (1 g, 3.37 mmol, 1.00 equivalent, HC1 salt) and stirred at 25 °C for 11 hours. The reaction mixture was diluted with H>0 (20 mL) and extracted with EtOAc (20xmL x 3). The combined organic layers were washed with brine (20 mL), dried over Na2SC>4, filtered and concentrated. The residue was purified by column chromatography (S1O2, Petroleum ether / Ethyl acetate = 20 / 1 to 0 / 1) to give 42.1 (800 mg, 2.19 mmol, 65% yield) as colorless oil. 1H NMR (400 MHz, CHLOROFORM-d) δ ppm 1.41 (br s, 10 H), 1.54 (br d, J=6.11 Hz, 3 H), 1.81 - 2.06 (m, 3 H), 3.14 (br s, 2 H), 3.80 (br d, J=2.69 Hz, 3 H), 4.06 - 4.20 (m, 1 H), 7.04 (br s, 1 H), 7.40 (br d, J=5.14 Hz, 1 H), 8.16 (br s, 1 H), 8.76 (br s, 1 H), 9.07 (br s, 1 H).42.1 42.2

[0369] To a solution of DIP A (648 mg, 6.4 mmol, 9 ί, 6 equivalent) in THF (5 mL) was added n-BuLi (2.5 M, 2.56 mL, 6 equivalent); this was stirred at 0CC for Ihour. To 42.1 (390 mg, 1.07 mmol, 1 equivalent) in THF (5 mL) was added chloro(iodo)methane (1.13 g, 6.4 mmol, 464.8 μί, 6 equivalent); this was stirred at -78 °C for 30 min. Then the two mixtures were combined and stirred at -78 °C for 2hr. The reaction was quenched by addition NH4CI solution (15 mL) and extracted with EtOAc (20 mL x 3). The combinedorganic layers were washed with a2S03solution (15 mL), NaHCOs solution (15 mL) and brine (15 mL); this was dried over NaiSC , filtered and concentrated under reduced pressure to give 42.2 (410 mg); LCMS [M + H]: 384; T = 0.79 min.42.2 42.3

[0370] To 42.2 (410 mg, 1.07 mmol, 1 equivalent) in DMF (5 mL) was added DEPEA (553.15 mg, 4.28 mmol, 747.5 xL, 4 equivalent) and 2,3,6-trifluorophenol (158.45 mg, 1.07 mmol, 1 equivalent). The mixture was stirred at 25 °C for 12 hours. The residue was purified by serni-preparative scale HPLC (column: Waters Xbridge 150 x 25 x 5μ; mobile phase: [A: water (0.1 %TFA); B: AcN]; gradient of B: 24%-65% over 12 min) to give 42.3 (40 mg, 90 μηιοΐ); LCMS [M + H]: 496; RT = 0.80 min.42.3 42

[0371] To 42.3 (40.00 mg, 80.73 μηιοΐ) in CH2C12(5 mL) was added TFA (1 mL) and stirred at 25 °C for 12 hours. The reaction mixture was concentrated under reduced pressure to remove solvent to give Compound 42 (20 mg, 50.59 μηιοΐ, 63% yield); LCMS [M + Hj: 396; RT = 0.76 min. 1H NMR (400 MHz, METHANOL -d4) δ ppm 1.48 - 1.67 (m, 2 H), 1.70 - 1.91 (m, 3 H), 2.08 - 2.19 (m, 1 H), 2.91 - 3.03 (m, 1 H), 2.97 (br t, J=7.03 Hz, 1 H), 4.95 - 5.01 (m, 1 H), 5.05 - 5.25 (m, 2 H), 6.94 - 7.09 (m, 2 H), 7.68 - 7.81 (m, 1 H), 8.39 - 8.51 (m, 1 H), 8.75 - 8.85 (m, 1 H), 9.01 - 9.14 (m, 1 H).Example 39. Preparation of (S)-N-(7-amino-l-(2,6-difluorophenoxy)-2-oxoheptan-3- yl)nicotinamide (43)26.1 43.1

[0372] To nicotinic acid (497.86 rng, 4.04 mmol, 338.68 μΐ,, 1.2 equivalent) in DMF (10 mL) was added HOBt (500.8 mg, 3.71 mmol, 1.1 equivalent) and EDCI (710.5 mg, 3.71 mmol, 1.1 equivalent). The mixture was stirred at 0 °C for lhr. To the mixture was added DIPEA (1.74 g, 13.48 mmol, 2.35 mL, 4 equivalent) and 26.1 (1 g, 3.37 mmol, 1 equivalent, HQ); this was stirred at 25 °C for 11 hours. The reaction mixture was diluted with H20 (20 mL) and extracted with EtOAc (20mL x 3). The combined organic layers were washed with brine (20 mL), dried over Na2SC>4, filtered and concentrated. The residue was purified by column chromatography (S1O2, Petroleum ether / Ethyl acetate = 20:1 to 0: 1) to give 43.1 (800 mg, 2.19 mmol); LCMS [M + H]: 366; RT = 0.69 min. ¾ NMR (400 MHz,CHLOROFORM-d) δ ppm 1.39 (s, 9 H), 1.49 - 1.59 (m, 2 H), 1.78 - 2.05 (m, 5 H), 3.12 (br d, J=5.70 Hz, 2 H), 3.79 (s, 2 H), 3.78 - 3.81 (m, 1 H), 4.65 (br s, 1 H), 4.79 (br d, J=5.26 Hz, 1 H), 7.02 (br d, J=5.70 Hz, 1 H), 7.39 (dd, J=7.67, 5.04 Hz, 1 H), 8.15 (br d, J=7.89 Hz, 1 H), 8.74 (br d, J=4.38 Hz, 1 H), 9.06 (br s, 1 H).43.1 43.2

[0373] To a solution of DIP A (662 mg, 6.54 mmol, 919 iL, 6 equivalent) in THF (5 mL) was added n-BuLi (2.5 M, 2.62 mL, 6 equivalent); this was stirred at 0 °C for lhr. 43.1 (400 mg, 1.09 mmol, 1 equivalent) in THF (5 mL) was added chloro(iodo)methane (1.15 g, 6.54 mmol, 474.7 μί, 6 equivalent) and stirred at -78 °C for 30 min. Then the mixture was addedthe before mixture and stirred at -78 °C for 2 hours. The reaction mixture was quenched by addition NH4C1 solution 15 mL at 25 °C, and extracted with EtOAc (15mL x 3). The combined organic layers were washed with Na2SOs solution (15 mL), NaHCC>3 solution (15 mL) and brine (15 mL); then dried over Na2SC>4, filtered and concentrated to give 43.2 (500 mg).

[0374] To 43.3 (500 mg, 1.30 mmol, 1 equivalent) in DMF (5 mL) was added DEPEA (672.05 mg, 5.2 mmol, 908.18 fiL, 4 equivalent) and 2,6-difluorophenol (186.03 mg, 1.43 mmol, 1.1 equivalent). The mixture was stirred at 25 °C for 12 hours. The residue was purified by prep-HPLC (column: Waters Xbridge 150 x 25 x 5 μ; mobile phase: [A: water (0.1%TFA), B: AcN]; gradient of B: 23% to 63%, over 12 min) to give 43.4 (40 mg, 86.30 μηιοΐ).43.4 43

[0375] 43.4 (40 mg, 83.77 iimol) in CH2C12(5 mL) and TFA {1 mL) was stirred at 25 °C for 7 hours. The reaction mixture was concentrated under reduced pressure to giveCompound 43 (15 mg); LCMS [M + H]: 378; RT = 0.61 min. Ή NMR (400 MHz, METHANOL-^) δ ppm 1.51 - 1.68 (m, 2 H), 1.72 - 1.90 (m, 3 H), 2.08 - 2.24 (m, 1 H), 2.97 (br t, J=6.60 Hz, 2 H), 4.97 - 5.12 (m, 3 H), 6.95 - 7.06 (m, 2 H), 7.06 - 7.15 (m, 1 H), 7.71 - 7.83 (m, 1 H), 8.50 (br d, J=7.95 Hz, 1 H), 8.82 (br d, J=3.67 Hz, 1 H), 9.03 - 9.17 (m, 1 H).Example 40. Preparation of (S,E)-N-(7-amino-l-(4-((4-((4-(dimethylamino)phenyl)di- azenyl)benzamido)methyl)-2,6-difluorophenoxy)-2-oxoheptan-3-yl)-3-azidobenzamide(44)38.4

[0376] To a solution of 38.4 (100 mg, 125.34 umol, 1 equivalent) in CH2C12(5 mL) was added TFA (1.54 g, 13.51 mmol, 1 mL. 107.76 equivalent) and was stirred at 25 °C for 12 hours. The residue was purified by prep-HPLC (Waters Xbridge 150 x 25x 5μ; mobile phase: [A: water(0.1%TFA) & B: ACM]; B%: 31%-61%,12min) to give Compound 44 (40 mg, 57.33 umol, 46% yield) as a red solid; LCMS [M + H] : 698; RT=2.764 min.!H NMR (400 MHz, DMSO-d6) δ ppm 1.29 - 1.46 (m, 2 H), 1.52 (dt, J=14.28, 7.30 Hz, 2 H), 1.63 - 1.74 (m, 1 H), 1.79 - 1.91 (m, 1 H), 2.71 - 2.81 (m, 2 H), 3.07 (s, 5 H), 4.42 (br d, J=5.73 Hz, 2 H), 4.54 - 4.67 (m, 1 H), 4.95 - 5.19 (m, 2 H), 6.84 (br d, J=9.04 Hz, 2 H), 7.01 - 7.1 1 (m, 2 H), 7.30 (br d, J=7.94 Hz, 1 H), 7.52 (br t, J=7.83 Hz, 1 H), 7.57 (s, 1 H), 7.63 (br s, 2 H), 7.68 (br d, .7=7.72 Hz, 1 H), 7.82 (dd, J=8.71, 4.74 Hz, 3 H), 7.94 - 8.10 (m, 1 H), 8.85 (br d, J=7.50 Hz, 1 H), 9.1 1 - 9.24 (m, 1 H).Example 41. Preparation of (S,E)-N-(7-amuio-l-(4-(2-(4-((4-(dimethylamino)phenyl)di- azenyl)benzamido)ethyl)-2,6-difl«orophenoxy)-2-oxoheptan-3-yl)-3-(4-((3-(5,5-difluoro- 7,9-dimethyl-5H-514,614-dipyrrolo[ 1 ,2-c: 2',1 '-fj [1 ,3,2] diazaborinin-3- yl)propanamido)methyl)-lH-l,2,3-triazol-l-yl)benzamide (45)45.1

[0377] To a solution of 3,5-difluoro-4-hydroxybenzaldehyde (5 g, 31.63 mmol, 1 equivalent) in acetic acid (50.00 mL) was added nitromethane (1 1.58 g, 189.78 mmol, 10.25mL, 6.00 equivalent) and CH3COONH4(9.75 g, 126.52 mmol, 4.00 equivalent). The mixture was stirred at 1 10 °C for 1.5 hour. The reaction mixture was diluted with H20 (20 mL) and extracted with EtOAc (20 mL x 3). The combined organic layers were washed with brine (20 mL), dried overfiltered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (S1O2, Petroleum ether / Ethyl acetate=20 / l to 1 :1) to give 45.1 (4.60 g, 22.87 mmol, 72% yield) as a yellow solid. Ή NMR (400 MHz, METHANOL-^) δ ppm 7.33 - 7.40 (m, 2 H), 7.77 - 7.89 (m, 1 H), 7.90 - 8.01 (m, 1 H).45.1 45.2

[0378] To a solution of 45.1 (2.10 g, 10.44 mmol, 1.00 equivalent) in EtOH (200.00 mL) was added HQ (6 M, 12.60 mL, 7.24 equivalent) and Pd / C (10%, 1.5 g) under Ar atmosphere at 0° C. The suspension was degassed and purged with H2for 3 times. The mixture was stirred under ¾ (1 Psi) at 0 °C for 3 hours. The reaction mixture was concentrated under reduced pressure to remove EtOH to give 45.2 (2.00 g, crude ) as a brown solid; LCMS [M + H]: 174; RT= 0.102 min. 'H MR (400 MHz, METHANOL-^) δ ppm 2.88 (t, ,7=7.52 Hz, 2 H) 3.08 - 3.20 (m, 2 H), 6.85 - 6.93 (m, 2 H).45.2 45.3

[0379] To a solution of the diazo compound (3.1 1 g, 11.55 mmol, 1.00 equivalent) in DMF (20.00 mL) was added EDCI (2.44 g, 12.71 mmol, 1.10 equivalent) and HOBt (1.72 g, 12.71 mmol, 1.10 equivalent) and stirred at 0 °C for Ihr. Then the mixture was added 45.2 (2.00 g, 11.55 mmol, 1.00 equivalent) and DIPEA (5.97 g, 46.20 mmol, 8.07 mL, 4.00 equivalent) and stirred at 25 °C for 1 Ihr. The reaction mixture was diluted with ¾0 (20 mL) andextracted with EtOAc (20 mL x 3). The combined organic layers were washed with brine (20 mL), dried over Na2S(>4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (S1O2, Petroleum ether / Ethyl acetate=20 / l to 1 : 1 ) to give 45.3 (600 mg, 1.41 mmol). LCMS [M + H]: 425; T=0.848 niin. 1H NMR (400 MHz, DMSO-d6) δ ppm 3.04 - 3.09 (in, 6 H), 3.43 - 3.51 (m, 1 H), 4.37 (br d, J=5.99 Hz, 1 H), 4.54 (br d, J=5.75 Hz, 1 H), 6.76 - 7.02 (m, 3 H), 6.79 (br s, 1 H), 7.71 - 7.85 (m, 4 H) 7.88 - 8.01 (m, 2 H).45.3 45.4

[0380] To a solution of 45.3 (310.00 mg, 730.37 μπιοΐ 0.18 equivalent) in DMF (10.00 mL) was added 33.4 (1.70 g, 4.01 mmol, 1.00 equivalent) and DIPEA (2.07 g, 16.04 mmol, 2.80 mL, 4.00 equivalent). The mixture was stirred at 25 °C for 12 hours. The reaction mixture was diluted with H20 (20 mL) and extracted with EtOAc (20 mL x 3). The combined organic layers were washed with brine (20 mL), dried over Na2S04, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (Si(¾, Petroleum ether / Ethyl acetate=20 / l to 1 : 1) to give 45.4 (350 mg) LCMS [M + H]: 813; RT=1.393 min.45.5

[0381] To a solution of 45.4 (200.00 mg, 246.34 μηιοΐ, 1.00 equivalent) in DMSO (2,00 mL) was added compound 14A (13.57 mg, 246.34 μηιοΐ, 15.78 μΐ., 1.00 equivalent) and CuS04(1.97 mg, 12.32 μιηοΐ, 1.89 μί, 0.05 equivalent) in H20 (200.00 μΕ ) and sodiumascorbate (97.61 mg, 492.68 μτηοΐ, 2.00 equivalent). The mixture was stirred at 25 °C for 1 hour. The reaction mixture was diluted with H?0 (20 mL) and extracted with EtOAc (20 mL x 3). The combined organic layers were washed with brine (20 mL), dried over NazSC , filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiCb, Petroleum ether / Ethyl acetate=20 / l to 1 :1) to give 45.5(130 mg).

[0382] To a mixture of difluoroborate dye (48.18 mg, 164.95 μηιοΐ, 1.10 equivalent) in DMF (2.00 mL) was added EDCI (31.62 mg, 164.95 μιηοΐ, 1.10 equivalent) and HOBt(22.29 mg, 164.95 μιηοί, 1.10 equivalent) at 0 °C and stirred for lhr. Then the mixture was added 45.5 (130.00 mg, 149.95 μιηοΐ, 1.00 equivalent) and DIPEA (77.52 mg, 599.80 μιηοΐ, 104.76 μί, 4.00 equivalent) and stirred at 25 °C for I lhr. The reaction mixture was diluted with LLO (20 mL) and extracted with EtOAc (20 mL x 3). The combined organic layers were washed with brine (20 mL), dried overfiltered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (S1O2, Ethyl acetate) to give 45.6 (120.00 mg); LCMS [M + H]: 1142; RT=1.461 min.

[0383] To a solution of compound 15 (120.00 mg, 105.17 μιηοΐ, 1.00 equivalent) in HCl / EtOAc (5.00 mL) was stirred at 25 °C for 0.1 hour. The residue was purified by prep- HPLC (column: Luna CI 8 100 x 30 x 5u; mobile phase: A: water(0.1%TFA), B:ACN; B%30%-60%,10min) to give Compound 45 (20.00 mg, 19.21 μηιοΐ, 18.27% yield) as a red solid.!H NMR (400 MHz, DMSO-4) δ ppm 1.33 - 1.51 (m, 2 H), 1.56 (dt, J 14.00, 7.06 Hz, 2 H), 1.73 (br dd, J=9.29, 4.40 Hz, 1 H), 1.90 (br d, J=6.24 Hz, 1 H), 2.25 (s, 3 H), 2.46 (s, 3 H). 2.74 - 2.87 (m, 5 H). 3.08 (s, 6 H), 3.46 - 3.55 (m, 2 H), 4.44 (br d, J=5.01 Hz, 2 H), 4.64 - 4.73 (m, 1 H), 5.01 - 5.18 (m, 2 H), 6.30 (s, 1 H), 6.36 (d, J=4.03 Hz, I H), 6.86 {d, J=9.17 Hz, 2 H), 7.01 - 7.11 (m, 3 H), 7.62 - 7.76 (m, 4 H), 7.78 - 7.87 (m, 4 H), 7.92 - 8.11 (m, 4 H), 8.40 (s, 1 H), 8.57 (br t, J=5.50 Hz, 1 H). 8.61 - 8.70 (m, 2 H), 8.99 (br d, J=7.34 Hz, 1 H).Example 42. Preparation of a fluorescent gingipain activity probe with cleavable quencher: (S,E)-N-(7-amino-l-(4-(2-(4-((4-(dimethylamino)phenyl)diazenyl)benz- amido)ethyI)-2,6-difluorophenoxy)-2-oxoheptan-3-yl)-3-azidobenzamide (46)

[0384] To a solution of 45.5 (150.00 mg, 188.01 μιηοΐ, 1.00 equivalent) in HCI / EtOAc (5.00 mL) was stirred at 25 °C for 0.2 hour. The residue was purified by prep-HPLC(column: Waters Xbridge Prep OBD C18 150 x 30 x 5 u; mobile phase: A: water(0.1%TFA), B: ACN; B%: 26%-66%, 12 min) to give Compound 46 (10.00 mg, 14.33 μιηοΐ, 7.62% yield) as a red solid; LCMS [M + H]: 712; RT = 2.76 min.!H NMR (400 MHz, METHANOL-^) δ ppm 1.52 - 1.60 (m, 2 H), 1.67 - 1.85 (m, 4 H), 2.09 (br s, 1 H), 2.85 - 3.00 (m, 4 H), 3.13 (s, 6 H). 3.61 (br t, J=7.24 Hz, 2 H), 4.52 (s, 1 H), 4.92 - 5.04 (m, 2 H), 6.87 (d, J=8.77 Hz, 2 H), 6.95 (br d, J=9.21 Hz, 1 H), 7.03 (br d, J=9.65 Hz, ΓΗ), 7.27 (br d, J=7.89 Hz, 1 H), 7.47 - 7.53 (m, 1 H), 7.55 (br s, 1 H), 7.65 (br d, J=7.02 Hz, 1 H), 7.80 - 7.91 (m, 5 H), 7.98 (d, J=8.77 Hz, 1 H).Example 43. Preparation of (S)-N-(7-amino-2-oxo-l-(2,3,6-trifhiorophenoxy)heptan-3- yl)-2-methoxy-2-methylpropanamide (47)26.4 47.1

[0385] To a solution of 2-methoxy-2-:methyl-propanoic acid (398.03 mg, 3.37 mmol, 1.00 equivalent) in DMF ( 15.00 mL) was added HOBt (500.89 mg, 3.71 mmol, 1.10 equivalent) and EDCI (710.63 mg, 3.71 mmol, 1.10 equivalent) the mixture was stirred at 25 °C for lhr. Then to the mixture was added DIPEA (1.74 g, 13.48 mmol, 2.35 mL, 4.00 equivalent) and 26.4 (1.00 g, 3.37 mmol, 1.00 equivalent, HO). The mixture was stirred at 25 °C for 14 hours. The reaction mixture was diluted with ¾0 (20 mL) and extracted with EtOAc (20 mL x 3). The combined organic layers were washed with brine (20 mL), dried over Na2S04, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiC>2, Petroleum ether / Ethyl acetate=2: l ) to give 47.1 (1.00 g, 2.77 mmol, 82.33% yield) as yellow oil; LCMS [M + H]: 361; RT=0.780min. Ή NMR (400MHz, CHLOROFORM-; / ) δ ppm 1.20 - 1.58 (m, 17 H), 1.60 - 1.75 (m, 1 H), 1.81 - 1.94 (m, 1 H), 3.09 (br d, J=6.17 Hz, 2 H), 3.29 (s, 3 H), 3.74 (s, 3 H), 4.45 - 4.73 (m, 2 H), 7.09 (br d, J=8.38 Hz, 1 H).47.1 47.2

[0386] To a solution of DIPA (1.54 g, 15.24 mmol, 2.14 mL, 5.50 equivalent) in THF (10 mL) was added n-BuLi (2.5 M, 6.09 mL, 5.50 equivalent). The mixture was stirred at 0 °C for 0.5 hr under N2. Then the mixture was added to the solution of compound 2 (1.00 g, 2.77 mmol, 1.00 equivalent) and chloro(iodo)methane (2.69 g, 15.24 mmol, 1.1 1 mL, 5.50 equivalent) in THF (10 mL) was stirred at -78 °C for 0.5 hr. The reaction mixture was diluted with ¾0 (20 mL) and extracted with EtOAc (20 mL x 3). The combined organiclayers were washed with brine (20 mL), dried over Na2SC>4, filtered and concentrated under reduced pressure to give a residue to give 47.2 (1.30 g, crude) as browrn oil.

[0387] To a solution of 47.2 (650.00 mg, 1.72 mmol, 1.00 equivalent) in DMF (10.00 mL) was added DIPEA (666.88 mg, 5.16 mmol, 901.19 3.00 equivalent) and 2, 3, 6- trifluorophenol (280.17 mg, 1.89 mmol, 1.10 equivalent). The mixture was stirred at 25 °C for 15 hours. The residue was purified by prep-HPLC (TFA condition) to give 47.3 (50.00 mg, 128.07 μιηοΐ, 7.45% yield) as yellow oil; LCMS [M + H]: 391; RT=0.877min.47.3 47

[0388] A mixture of 47.3 (50.00 mg, 101.93 μιηοΐ, 1.00 equivalent) in DCM (5.00 mL) and TFA (1.00 mL) was stirred at 25 °C for 15 hours. The mixture was concentrated under reduced pressure to give Compound 47 (30.00 mg, 76.84 μιηοΐ, 75.39% yield) as brcwn oil; LCMS [M + H]: 391; RT=0.681min. ¾ NMR (400 MHz, METHANOL-^) δ ppm 1.26 - 1.39 (m, 6 H), 1.39 - 1.56 (m, 2 H), 1.57 - 1.84 (m, 3 H), 1.96 - 2.12 (m, I H), 2.82 - 3.01 (m, 2 H), 3.27 - 3.31 (m, 3 H), 4.68 (dd, J=9.60, 4.34 Hz, 1 H), 4.95 - 5.15 (m, 1 H), 6.89 - 7.12 (m, 2 H).Example 44. Preparation of (S)-N-(7-amino-l-(2,6-difluorophenoxy)-2-oxoheptan-3-yl)- 2-methoxy-2-methyIpropanamide (48)47.2 48.1

[0389] To a solution of 47.2 (650.00 mg, 1.72 mmol, 1.00 equivalent) in DMF (10.00 inL) was added DIPEA (666.88 mg, 5.16 mmol, 901.19 μΐ,, 3.00 equivalent) and 2, 6- difluorophenol (246.13 mg, 1.89 mmol, 1.10 equivalent). The mixture was stirred at 25 °C for 14 hours. The residue was purified by prep-HPLC (TFA condition) to give 48.1 (50.00 mg, 134.26 μιηοΐ, 7.81% yield) as yellow oil; LCMS [M + H]: 473; RT=0.864min.48.1 48

[0390] 48.1 (50.00 mg, 105.82 μιηοΐ, 1.00 equivalent) in DCM (5.00 mL) and TFA (1.00 mL) was stirred at 25 °C for 15 hours. The mixture was concentrated under reduced pressure to give Compound 48 (30.00 mg, 80.56 μηιοΐ, 76.13% yield); LCMS [M + H]: 373;RT=0.671min. ¾ NMR (400 MHz, METHANOLS) δ ppm 1.18 - 1.39 (m, 6 H), 1.41 - 1.56 (m, 2 H), 1.57 - 1.82 (m, 3 H), 1.88 - 2.15 (m, 1 H), 2.78 - 3.03 (m, 2 H), 3.25 - 3.31 (m, 3 H), 4.74 (dd, J=9.54, 4.28 Hz, 1 H), 4.90 - 5.03 (m, 2 H), 6.89 - 7.20 (m, 3 H).Example 45. Preparation of (S)-N-(7-amino-l-(isoxazol-3-yloxy)-2-oxoheptan-3- yl)cyclopentanecarboxamide (49)1.2 49.1

[0391] To a solution of 1.2 (0.3 g, 715.39 μιηοΐ, 1 equivalent) in DMF (5 mL) was added K2CO3(296.62 mg, 2.15 rnrnol, 3 equivalent) and the isoxazole (66.94 nig, 786.92 μηιοΐ, 1.1 equivalent). The mixture was stirred at 25 °C for 15 hrs. The reaction mixture was quenched by addition H20 (10 mL) at 25 °C and extracted with Ethyl acetate (15 mL x 3). The combined organic layers were washed with brine (lOniL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to give a crade product. The residue was purified by column chromatography (Si02, Petroleum ether / Ethyl acetate=2: 1) to give 49.1 (100 mg, 236.13 μιηοΐ, 33.01% yield) as a yellow solid; LCMS [M + H +Na]: 446; RT=1.443min.49.1 49

[0392] To a solution of 49.1 (0.1 g) in DCM (5 mL) was added TFA ( 1 mL) The mixture was stirred at 25 °C for 14 hrs. The mixture was concentrated under reduced pressure to give a residue. The residue was purified by prep-HPLC (TFA condition) to give Compound 49 (20 mg, 61.85 μιηοΐ, 26.19% yield) as yellow oil; LCMS [M + H]: 324; RT=2.072min. ¾ NMR (400 MHz, METHANOL-^) δ ppm 1.37 - 1.55 (m, 2 H) ,1.57 - 1.80 (m, 10 H) 1.89, (br dd, J=12.68, 5.62 Hz, 3 H), 2.73 (quin, J=7.77 Hz, 1 H), 2.93 (br t, J=6.84 Hz, 2 H), 4.52 (dd, J=9.04, 5.07 Hz, 1 H), 4.96 - 5.17 (m, 2 H), 6.17 (d, J=1.54 Hz, 1 H), 8.38 (d, J=1.54 Hz, 1 H).Example 46. Preparation of (S)-N-(7-amino-2-oxo-l-(2,3,6-trifhiorophenoxy)heptan-3- yl)picolinamide (50)50.1 50.2

[0393] 50.1 was prepared in the same fashion as 34.2, but with pyridine-2-carboxylic acid replacing 2-bromonicotinic acid.

[0394] To 50.1 (600.00 mg, 1.56 mniol, 1.00 equivalent) in DMF (5.00 ml_) was added DIPEA (606.02 mg, 4.69 mmol, 818.94 μί, 3.00 equivalent) and 2, 3, 6-trifluorophenol (231.45 mg, 1.56 mmol, 1.00 equivalent). The mixture was stirred at 25 °C for 15 hours. The residue was purified by prep-HPLC (TFA condition) to give compound 50.2 (50.00 mg, 100.91 μη-ϊοΐ, 6.47% yield) as yellow oil; LCMS [M + H]: 496; RT=1.302 min.50.2 50

[0395] This reaction was run in the same fashion as Compound 34. The product obtained was purified by prep-HPLC (TFA condition) to give Compound 50 (10 mg); LCMS [M + H]: 396; RT=2.187 min. Ή NMR (400 MHz, METHANOL-^) δ ppm 1.43 - 1.62 (m, 2 H), 1.62 - 1.93 (m, 3 H), 2.06 - 2.24 (m, 1 H), 2.93 (br t, J=7.28 Hz, 2 H), 4.97 (br dd, J=9.48, 4.19 Hz, 1 H), 5.03 - 5.21 (m, 2 H), 6.91 - 7.07 (m, 2 H), 7.60 (dd, J=6.95, 5.40 Hz, 1 H), 8.00 (td, J=7.66, 1.65 Hz, 1 H), 8.12 (d, J=7.72 Hz, 1 H), 8.60 - 8.74 (m, 1 H).Example 47. Preparation of a biotinylated gingipain activity probe: N-((S)-7-amino-l- (2,6-difluorophenoxy)-2-oxoheptan-3-yl)-3-(4-((5-((3aS,4S,6aR)-2-oxohexahydro-lH- thieno[3,4-d]imidazoI-4-yl)pentanamido)methyl)-lH-l,2,3-triazol-l-yl)benzamide (51)51.1 51.2

[0396] To 51.1 (2.00 g, 4.72 mmol, 1.00 equivalent) and the phenol (613.79 nig, 4.72 mmol, 1.00 equivalent) in DMF (10.00 mL) was added DIPEA (2.44 g, 18.87 mmol, 3.30 mL, 4.00 equivalent) in one portion at 20 C under N?. The mixture was stirred at 20 °C for 10 hours. The reaction mixture was diluted with H20 10 mL and extracted with EtOAc (10 mL x 3). The combined organic layers were washed with brine (30 mL), dried over Na2S04filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (Si02, Petroleum ether / Ethyl acetate=l : l) to give 51.2 (160.00 mg, 309.17 μηιοΐ, 6.55% yield) as yellow oil; LCMS [M + Ffj: 518; RT=0.909 min.51.2 51.3

[0397] To 51.2 (140.00 mg, 270.52 μιηοΐ, 1.00 equivalent) and the aminopropyne (14.90 mg, 270.52 μιηοΐ, 17.33 μί, 1.00 equivalent) in DMSO (3.00 mL) was added the solution of CuS04 (8.64 mg, 54.10 μιηοΐ, 8.31 μί, 0.20 equivalent) in H20 (100.00 iL). The mixture was stirred at 18 °C for 5 mins. The reaction mixture was diluted with ¾0 10 mL and extracted with EtOAc (10 mL x 3). The combined organic layers were washed with brine (30 mL), dried overfiltered and concentrated under reduced pressure to give 51.3(150.00 mg, crude) as a red solid.51.4 51.5

[0398] To a mixture of 51.4 (64.00 mg, 261.96 μηιοΐ, 1.00 equivalent) and HOBt (38.94 mg, 288.16 μιηοΐ, 1.10 equivalent) in DMF (2.00 mL) was added EDCl (55.24 mg, 288.16 μιηοΐ, 1.10 equivalent) in one portion at 0 °C under N2. The mixture was stirred at 0 °C for 1 hour, then the mixture was added 51.3 (150.00 mg, 261.96 μιηοΐ, 1.00 equivalent) andDIPEA (101.57 mg, 785.88 μηιοΐ, 137.26 \xL, 3.00 equivalent) in one portion at 0°C, and the mixture was stirred at 0 °C for 1 hour. The reaction mixture was diluted with FLO 10 rnL and extracted with EtOAc (10 mL x 3). The combined organic layers were washed with brine (30 mL), dried overfiltered and concentrated under reduced pressure to give 51.5(200.00 mg, 250.34 μηιοΐ, 95.57% yield) as a yellow solid; LCMS [M + FLj: 799; RT .373 min.51.5 51

[0399] 51.5 (200 mg) was dissolved into HCl EtOAc (5 mL), and the mixture was stirred at 18 °C for 1 min. The reaction mixture was concentrated under reduced pressure to give a residue. The residue was purified by prep-HPLC (TFA condition) to give Compound 51 (40 mg) as a white solid; LCMS [M + H]: 699; RT= 2.391 min. ¾ NMR (400 MHz,METHANOL-d4) 5 ppm 1.34 - 1.46 (m, 2 H), 1.48 - 1.63 (m, 3 H), 1.64 - 1.77 (m, 4 H), 1.77- 1.91 (m, 2 H), 2.08 - 2.20 (m, 1 H), 2.27 (t, J=7.17 Hz, 2 H), 2.62 (d, J=12.79 Hz, 1 H), 2.80 - 2.89 (m, 1 H), 2.95 (br t, J=6.50 Hz, 2 H), 3.11 - 3.19 (m, 1 H), 4.24 (dd, J=7.94, 4.41 Hz, 1 H), 4.43 (dd, J=7.50, 4.63 Hz, 1 H), 4.53 (s, 2 H), 4.98 (br d, J=3.75 Hz, 1 H), 5.00 - 5.10 (m, 2 H), 6.96 - 7.05 (m, 2 H), 7.06 - 7.13 (m, 1 H), 7.68 - 7.74 (m, 1 H), 7.95 - 8.00 (m, 1 H), 8.02 - 8.08 (m, 1 H), 8.35 (t, J= 1.76 Hz, 1 H), 8.46 (s, 1 H).Example 48. Preparation of (S)-N-(7-amino-2-oxo-l-(2,3,6-trifluorophenoxy)heptan-3- l)isonicotin amide (52)52.1 52.2 10400 J 52.1 was prepared in the same fashion as 34.2, but with pyridine-4-carboxylic acid replacing 2-bromonicotinic acid.

[0401] To 52.1 (783.60 mg, 2.04 mmol, 1.00 equivalent) in DMF (10.00 mL) was added DIPEA (791.46 mg, 6.12 mmol, 1.07 mL, 3.00 equivalent) and the trifluorophenol (302.28 mg, 2.04 mmol, 1.00 equivalent). The mixture was stirred at 25 °C for 15 hours. The reaction mixture was diluted with ¾0 (10 mL) and extracted with EtOAc (10 mL x 3). The combined organic layers were washed with brine (30 mL), dried over NazSO,}, filtered and concentrated under reduced pressure. The residue was purified by column chromatography (Si02, Petroleum ether / Ethyl acetate=10 / l to 1 / 1) to give 52.2 (50.00 mg); LCMS [M + H]: 496; T=0.777 min.52.2 52

[0402] To 52.2 (10.00 mg, 20.18 iimoi, 1.00 equivalent) in DCM (500.00 iiL) was added TFA (154.00 mg, 1.35 mmol, 100.00 μΐ,, 66.93 equivalent). The mixture was stirred at 25 °C for 15 hours. The reaction mixture was concentrated under reduced pressure to giveCompound 52 (7.50 mg, 18.97 μιηοΐ): LCMS [M + FfJ: 397; RT= 2.128 min. 'H NMR (400 MHz, METHANOL^) δ ppm 1.49 - 1.66 (m, 2 H), 1.67 - 1.92 (m, 3 H), 2.04 - 2.21 (m, 1 H), 2.94 (br t, J=7.61 Hz, 2 H), 4.95 (dd, J=9.70, 4.41 Hz, 1 H), 5.05 - 5.18 (m, 2 H), 6.88 - 7.13 (m, 2 H), 7.86 - 8.00 (m, 2 H), 8.79 (br d, J=4.19 Hz, 2 H).Example 49. Preparation of (S)-N-(7-amino-2-oxo-l-(2H-tetrazol-2-yl)heptan-3-yI)-6- fluoronicotinamide (53)29.2 53.1

[0403] To 29.2 ( 1.70 g, 4.23 mmol, 1.00 equivalent) in DMF ( 10.00 mL) was added tetrazole (0.45 M, 10.34 mL, 1.10 equivalent) and DIPEA (2.19 g, 16.92 mmol, 2.96 mL, 4.00 equivalent). The mixture was stirred at 10 °C for 12 hours. The reaction mixture was diluted with H20 (10 mL) and extracted with EtOAc (10 mL x 3). The combined organic layers were washed with brine (30 mL), dried over Na^SO,}, filtered and concentrated under reduced pressure. The residue was purified by prep-HPLC (column: Luna CI 8 100 x 30 x 5u; mobile phase: A: water (0.1%TFA) and B:ACN; B%: 20%-60%, lOmin) to give 53.1(10.00 mg).53.1 53

[0404] To 53.1 ( 10.00 mg) in DCM (2.50 mL) was added TFA (0.5 mL). The mixture was stirred at 10 °C for 12 hours. The reaction mixture concentrated under reduced pressure to give Compound 53 (2.00 mg, 5.96 μηιοΐ); LCMS [M + H]: 336; RT=0.593 min. 'H NMR (400 MHz, METHANOL-d4) δ ppm 1.49 - 1.66 (m, 2 H), 1.67 - 1.80 (m, 2 H), 1.83 - 1.93 (m, 1 H), 2.06 - 2.16 (m, 1 H), 2.89 - 3.00 (m, 2 H), 4.79 (br s, 1 H), 5.87 - 6.01 (m, 2 H), 7.15 - 7.24 (m, 1 H), 8.35 - 8.46 (m, 1 H), 8.68 - 8.79 (m, 2 H).Example 50. Preparation of (S)-N-(7-amiiio-2-oxo-l-(2H-tetrazol-2-yl)heptan-3-yI)-2- fluoronicotinamide (54)32.2 54.1

[0405] To 32.2 ( 1.70 g, 4.23 mmol, 1.00 equivalent) in DMF ( 10.00 mL) was added tetrazole (0.45 M, 10.34 mL, 1.10 equivalent) and DIPEA (2.19 g, 16.92 mmol, 2.96 mL, 4.00 equivalent). The mixture was stirred at 10 °C for 12 hours. The reaction mixture was diluted with H20 (10 mL) and extracted with EtOAc (10 mL x 3). The combined organic layers were washed with brine (30 mL), dried over Na2SC>4, filtered and concentrated under reduced pressure. The residue was purified by prep-HPLC (column: Luna C18 100 x 30 x 5 u; mobile phase: A: water (0.1%TFA), B: ACN; B%: 20%-60%,10 min) to give 54.1 (5.00 mg).

[0406] To 54.1 (5.00 mg) in DCM (2.50 mL) was added TFA (0.5 mL). The mixture was stirred at 10 °C for 12 hours. The reaction mixture concentrated under reduced pressure to give to Compound 54 (2.00 mg); LCMS [M + H]: 336: RT=3.720 min. *H NMR (400 MHz,METHANOL-d4) δ ppm 1.51 - 1.66 (m, 2 H), 1.70 - 1.79 (m, 2 H), 1.81 - 1.91 (m, 1 H), 2.03 - 2.19 (m, 1 H), 2.96 (br t, J=7.61 Hz, 2 H), 3.77 (s, 1 H), 4.84 (br d, J=4.85 Hz, 1 H), 5.96 (d, J=2.65 Hz, 2 H), 7.46 (ddd, J=7.22, 5.13, 1.76 Hz, 1 H) ,8.25 - 8.41 (m, 2 H) ,8.68 - 8.80 (m, 1 H).Example 51. Preparation of (S)-N-(7-amino-l-(isoxazol-3-yloxy)-2-oxoheptan-3-yl)-6- fliioronicotinamide (55)55.1 55.2

[0407] A mixture 55.1 (10.00 g, 101.94 mmol, 10.00 mL, 1.00 equivalent), hydroxylamine hydrochloride (9.21 g, 132.52 mmol, 1.30 equivalent), NaOH (15.25 g, 381.26 mmol, 3.74 equivalent) in H20 (150.00 mL) and MeOH (170.00 mL) was stirred at 25 °C for 100 hours. The mixture was acidified to pH 2 with concentrated hydrochloric acid and then saturated with sodium chloride. The solution was extracted with DCM (8 x 150 ml), the extracts combined, dried and the solvent evaporated. The solid residue was washed with hot iso- hexane (3 x 100ml) and the final suspension was allowed to cool and the resulting solid was collected by filtration, dried under vacuum to give 55.2 (4.00 g, 47.03 mmol, 46.13% yield) as a yellow solid.!H NMR (400 MHz, CHLOROFORM- ) δ ppm 6.04 (d, J=1.76 Hz, 1 H), 8.10 (d, J=1.76 Hz, 1 H), 1 1.11 (br s, 1 H).29.255.3

[0408] To 29.2 (200.00 mg, 497.69 μηιοΐ, 1.00 equivalent) in DMF (3.00 mL) was added K2C03(206.36 mg, 1.49 mmol, 3.00 equivalent) and 55.2 (55.03 mg, 647.00 μιηοΐ, 1.30 equivalent). The mixture was stirred at 25 °C for 15 hours. The reaction mixture was diluted with H20 (10 mL) and extracted with EtOAc ( 10 mL x 3). The combined organic layerswere washed with brine (30 mL), dried over Na2SC>4, filtered and concentrated under reduced pressure. The residue was purified by column chromatography (Si02, Petroleum ether / Ethyl acetate=2: l ) to give 55.3 (0.1 g, 222.00 μηιοΐ, 44.61% yield) as yellow oil; LCMS [M + H]: 451; RT= 1.145 min.55.3 55

[0409] To a solution of 55.3 (0.1 g) in DCM (5 mL) was added TFA (1 mL). The mixture was stirred at 25CC for 15 hours. The mixture was concentrated under reduced pressure to give a residue. The residue was purified by prep-HPLC (TFA condition) to give Compound 55 (20 mg); LCMS [M + Ffj: 351; RT=0.850 min.JH NMR (400 MHz, METHANOLS) δ ppm 1.44 - 1.66 (m, 2 H), 1.67 - 1.90 (m, 3 H), 2.00 - 2.18 (m, 1 H), 2.82 - 3.09 (m, 2 H), 4.79 (dd, J=9.26, 4.85 Hz, 1 H), 5.06 - 5.22 (m, 2 H), 6.18 (d, J=1.10 Hz, 1 H), 7.07 - 7.27 (m, 1 H), 8.30 - 8.47 (m, 2 H), 8.72 (d, J=1.98 Hz, 1 H).Example 52. Preparation of (S)-N-(7-amino-l-(isoxazol-3-yloxy)-2-oxoheptan-3-yl)-2- fluoronicotinamide (56)32.2 56.1

[0410] To 32.2 ( 1.40 g, 3.48 mmol, 1.00 equivalent) in DMF (15.00 mL) was added K2CO?(1.44 g, 10.44 mmol, 3.^equivalent) and isoxazol-3-ol (55.2, 296.01 mg, 3.48 mmol, 1.00 equivalent). The mixture was stirred at 25 °C for 15 hours. The reaction mixture was diluted with H20 (10 mL) and extracted with EtOAc (10 mL x 3). The combined organic layers were washed with brine (30 mL), dried over Na2S04, filtered and concentrated under reducedpressure. The residue was purified by column chromatography (S1O2, Petroleum ether / Ethyl acetate=2: l) to give 56.1 (300 mg); LCMS [M + H]: 453; RT=1.379 min.56.1 56

[0411] To 56.1 (0.3 g) in DCM (5 mL) was added TFA (1 mL). The mixture was stirred at 25 °C for 15 hours. The mixture was concentrated under reduced pressure to give a residue. The residue was purified by prep-HPLC (TFA condition) to give Compound 56 (20 mg); LCMS [M + Ffj: 351; RT=0.730 min. Ή NMR (400 MHz, METHANOL-^ > 5 ppm 1.45 - 1.64 (m, 2 H), 1.65 - 1.89 (m, 3 H), 1.96 - 2.18 (m, 1 H), 2.95 (br t, .7=7.50 Hz, 2 H), 4.81 (br dd, J=9.15, 4.74 Hz, 1 H), 5.16 (s, 2 H),6.19 (s, 1 H), 7.46 (br t, .7=6.06 Hz, 1 H), 8.14 - 8.50 (m, 3 H).Example 53. Preparation of (S)-N-(7-amino-l-(isoxazol-3-yloxy)-2-oxoheptan-3-yi)-2- methoxy-2-methylpropanamide (57)

[0412] To a solution of 47.2 (893 mg, 2.36 mmol, 1 equivalent) and isoxazol-3-ol (200.48 mg, 2.36 mmol, 1 equivalent) in DMF (8 mL) was added DIPEA (913.83 mg, 7.07 mmol,1.23 mL, 3 equivalent). The mixture was stirred at 25 °C for 10 hr. The reaction mixture was diluted with H 0 (10 mL) and extracted with EtOAc (10 mL x 3). The combined organic layers were washed with brine (30 mL), dried over a2SC>4, filtered and concentrated under reduced pressure. The residue was purified by column chromatography (S1O2, Petroleum ether / Ethyl acetate=10 / l to 1 / 1) to give 57.1 (130 mg); LCMS [M + H] : 428; RT=0.649 min.57.1 57

[0413] To a 57.1 (50 mg) in DCM (5 mL) was added TFA (1 mL). The mixture was stirred at 25 °C for 10 hours. The residue was purified by prep-HPLC (TFA condition) to give Compound 57 (10 mg); LCMS [M + H |: 328; RT=2.430 min.!H MR (400 MHz,METHANOL-^) δ ppm 1.38 (s, 7 H), 1.45 (br d, J=6.84 Hz, 2 H), 1.58 - 1.80 (m, 4 H), 2.01 (br s, 1 H), 2.92 (br d, J=7.28 Hz, 2 H), 3.31 - 3.33 (m, 3 H), 4.53 - 4.62 (m, 1 H), 4.99 - 5.14 (m, 2 H), 6.17 (s, 1 H), 8.38 (s, 1 H).Example 54. Preparation of (S)- -(7-amino-l-(dimethyl(oxo)- 6-sulfanylidene)-2- oxoheptan-3-yl)cyclopentanecarboxamide (58)58.1 58.2

[0414] Potassium 2-methylpropan-2-olate (1 M, 5.87 mL, 2.99 equivalent) was added drop wise into a toluene (17 mL) suspension of BL AHmethane chloride (896.67 mg, 6.97 mmol, 3.55 equivalent) at 25 °C. The mixture was heated to 70 °C for 4 hours and then was cooled to 0°C. A THF (15 mL) suspension of 58.1 (0.7 g, 1.96 mmol, 1 equivalent) was added drop- wise at 0 °C, and the resultant solution was stirred for 16 hours at 0 °C. The solution was washed by MTBE for three times. The filter cake was concentrated under reduced pressure to give 58.2 (630 mg, 1.51 mmol, 38.51% yield) as a white solid; LCMS [M + H]: 417; RT=0.910 min.58.2 58

[0415] To a solution 58.2 (50 mg) in DCM (2 mL) was added TFA (0.4 mL) in one portion at 18 °C under N2. The mixture was stirred at 18 °C for 30 mins. The reaction mixture was concentrated under reduced pressure to give Compound 58 (50 mg) as a yellow oil; LCMS [M + H]: 317; RT=1.782 min. Ή NMR (400 MHz, ACETONITRILE-*) δ ppm 1.39 - 1.51 (m, 2 H), 1.56 (br d, J=6.60 Hz, 2 H), 1.67 (br d, J=4.77 Hz, 6 H), 1.75 - 1.89 (m, 4 H), 2.70 (dt, .7=15.68, 7.75 Hz, 1 H), 2.94 (br s, 2 H), 3.63 (s, 8 H), 4.17 - 4.26 (m, 1 H).Example 55. Preparation of -((S)-7-amino-l-(2,6-difluorophenoxy)-2-oxoheptan-3-yI)- 3.(4.(15-oxo-19H(3aS,4S,6aR)-2-oxohexahydro-lH hieno[3,4-d]imidazol-4-yl)-2,5,8,ll- tetraoxa-14-azanonadecyl)-lH-l,2,3-triazol-l-yl)benzamide (59)Biotin59 1

[0416] A mixture Biotin (159.29 mg, 982.36 μηιοί, 1.2 equivalent) in DMF (2 mL) was stirred at 25 °C for 12 hours. The mixture was filtered and concentrated under reduced pressure to give 59.1 (200 mg, crude) as a white solid; LCMS [M + H]: 295; RT=0.298 min.DIPEA, DMF

[0417] A mixture of 59.1 (127.28 mg, 432.36 μιηοΐ, 1 equivalent), 59.2(100 mg, 432.36 μιηοΐ, 1 equivalent), DIPEA (167.64 mg, 1.30 mmol, 225.93 μΕ, 3 equivalent) in DMF (3 mL) was stirred at 25 °C for 12 hours. The residue was purified by prep-HPLC (TFA condition) to give 59.3 (100 mg, 218.54 μηιοΐ, 50.55% yield) as a white solid; LCMS [M + H]: 458; RT= 1.052 min.59.4

[0418] To a solution of 59.3 (80 mg, 174.83 μιηοΐ, 1 equivalent) in DM SO (2 mL) and H20 (0.2 mL) was added 33.5 (90.48 mg, 174.83 μηιοΐ, 1 equivalent) and CuS04(5.58 mg, 34.97 μιηοί, 5.37 μΤ, 0.2 equivalent) and sodium ascorbate (69.27 mg, 349.66 μηιοΐ, 2 equivalent). The mixture was stirred at 25 °C for 10 min. The reaction mixture was quenched by addition H20 10 mL at 25 °C and extracted with ethyl acetate (lOmL x 3). The combined organic layers were washed with saturated brines (5mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to give a crude product. The residue was purified by prep-TLC (Si02, DCM: MeOH = 10: 1) to give 59.4 (90 mg, 92.30 μιηοΐ, 52.79% yield) was obtained as yellow oil; LCMS [M + H] : 951 ; RT= 1.160 min.59

[0419] 59.4 (90 mg, 92.30 μιηοΐ) in DCM (5 mL) and TFA (1 mL) was stirred at 25 °C for 12 hours under 2 atmosphere. The reaction mixture was concentrated under reduced pressure to give a residue. The residue was purified by prep-HPLC (TFA condition) to give Compound 59 (20 mg, 22.86 μηιοΐ) as a white solid; LCMS [M + H]: 875; RT=0.870 min. ¾ NMR (400 MHz, METHANOL-^) δ ppm 1.25 - 1.46 (m, 2 H), 1.47 - 1.95 (m, 9 H), 2.02 - 2.29 (m, 3 H), 2.68 (d, J=12.57 Hz, 1 H), 2.82 - 3.04 (m, 3 H), 3.07 - 3.22 (m, 1 H), 3.31 - 3.35 (m, 2 H), 3.43 - 3.54 (m, 2 H), 3.54 - 3.66 (m, 8 H), 3.67 - 3.78 (m, 4 H), 4.18 - 4.35 (m, 1 H), 4.47 (dd, J=7.72, 4.85 Hz, 1 H), 4.75 (s, 2 H), 4.92 - 5.17 (m, 3 H), 6.88 - 7.18 (m, 2 H), 7.72 (t, J=7.94 Hz, 1 H) ,7.89 - 8.13 (m, 2 H), 8.30 - 8.43 (m, 1 H), 8.62 (s, 1 H).Example 56. Preparation of N-((S)-7-amino-l-(2,6-difluorophenoxy)-2-oxoheptan-3-yI)- 3-(4-(3,43-dioxo-47-((3aS,4S,6aR)-2-oxohexahydro-lH-thieno[3,4-d]imidazol-4-yI)- 6,9,12,15,18,21,24,27,30,33,36,39-dodecaoxa-2,42-diazaheptatetracontyl)-lH-l,2,3- triazol-l-yl)benzamide (60)33.5 60.1

[0420] To a solution of prop-2-yn-l -amine (21.29 mg, 386.46 μπιοΐ, 24.75 \LL, 1 equivalent) and 33.5 (200 mg, 386.46 μιηοΐ, 1 equivalent) in DMSO (2 rnL) was addedCuS04(362.30 ug, 2.27 μηιοΐ 3.48 0.2 equivalent) in H20 (0.1 mL) and Sodium ascorbate (153.12 mg, 772.91 μmol, 2 equivalent). The mixture was stirred at 25 °C for 15 mins. The reaction mixture was quenched by addition H?0 10 mL at 25 °C and extracted with ethyl acetate (lOmL x 3). The combined organic layers were washed with saturated brines (5mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to give a crude product. The residue was purified by column chromatography (S1O2DCM: MeOH = 0:1) to give 60.1 (140 mg, 244.50 μιηοΐ, 63.27% yield) as a yellow solid; LCMS [M + H]: 573; T=0.991 min.

[0421] To a solution of 60.2 (200 mg, 236.96 μπιοΐ, 1 equivalent) in DMF (5 mL) was added HOBt (35.22 mg, 260.66 μηιοΐ, 1.1 equivalent) and EDCI (49.97 mg, 260.66 μιηοΐ, 1.1 equivalent). The mixture was stirred at 25 °C for lhr. Then to the mixture was added 60.1 (135.69 mg, 236.96 μιηοΐ, 1 equivalent) and DIPEA (122.50 mg, 947.85 μιηοΐ, 165.10 pL, 4 equivalent). The mixture was stirred at 25CC for 1 1 hours. The residue was purified by prep-HPLC (TFA condition) to give 60.3 (55 mg, 39.32 μηωΐ, 16.60% yield) as a yellow solid; LCMS [M + H]: 700: RT=1.225 min.

[0422] A mixture of 60.3 (50 mg, 35.75 μηιοΐ) in DCM (5 mL) and TFA (1 mL), the mixture was stirred at 25 °C for 12 hours. The mixture was concentrated in vacuum to give a crude product. The residue was purified by prep-HPLC (TFA condition) to give Compound 60 (15 mg, 1 1.55 μηιοΐ) as yellow oil; LCMS [M + H]: 1299; RT=1.06 min. 'H NMR (400 MHz, METHANOL^) δ ppm 1.32 - 1.93 (m, 12 H), 2.06 - 2.27 (m, 3 H), 2.52 (t, J=5.95Hz, 2 H), 2.70 (d, .7=12.79 Hz, 1 H), 2.86 - 3.05 (m, 3 H), 3.14 - 3.24 (m, 1 H), 3.32 - 3.38 (m, 2 H), 3.45 - 3.68 (m, 49 H), 3.77 (t, .7=5.84 Hz, 2 H), 4.30 (dd, J=7.83, 4.52 Hz, 1 H), 4.49 (dd, J=7.72, 4.63 Hz, 1 H), 4.56 (s, 2 H), 4.96 - 5.13 (m, 2 H), 6.94 - 7.14 (m, 3 H), 7.64 - 7.77 (m, 1 H), 7.91 - 8.10 (m, 2 H), 8.28 - 8.39 (m, 1 H), 8.44 - 8.52 (m, 1 H). Example 57. Preparation of (S)-5-((7-amino-l-(isoxazol-3-yloxy)-2-oxoheptan-3- yl)carbamoyl)-N,N,N-trimethylpyridin-2-aminium chloride (61)

[0423] A solution of N,N-dimethylmethanamine (2 M, 4.44 mL, 20 equivalent) in THF (0.5 mL) was added 55.3 (0.2 g, 443.99 μηιοΐ, 1 equivalent) in one portion at 18 °C. The mixture was stirred at 18 °C for 1 hours. The reaction mixture concentrated under reduced pressure to give a residue. The residue was purified by prep-HPLC (HQ condition) to give 61.1 (20 mg, 40.77 μηιοΐ, 9.18% yield) and 62.1 (20 mg, 42.06 ,umol, 9.47% yield) as white solid; LCMS [M + H] for C24H37N5O6+; RT=1.136min.61.1 61

[0424] 61.1 (20 mg) was dissolved in HCl / MeOH (2 mL), and the mixture was stirred at 25 °C for 10 mins. The reaction mixture was concentrated under reduced pressure to give Compound 61 (15 mg) as yellow oil; LCMS [M + H] for Ci9H29N504+: 391 ; RT=0.149 min. ¾ NMR (400 MHz, METHANOL-^) δ ppm 1.47 - 1.66 (m, 2 H), 1.68 - 1.82 (m, 2 H), 1.84 - 1.97 (m, 1 H), 2.01 - 2.16 (m, 1 H), 2.97 (br t, .7=7.45 Hz, 2 H), 3.67 - 3.74 (m, 9 H), 4.81 (dd, J=9.43, 4.60 Hz, 1 H), 5.15 - 5.21 (m, 2 H), 6.17 - 6.23 (m, 1 H), 8.10 - 8.19 (m, 1 H), 8.39 (d, .7=1.75 Hz, 1 H), 8.64 (dd, J=8.77, 2.19 Hz, 1 H), 9.1 1 (d, .7=1.75 Hz, 1 H).Example 58. Preparation of (S)-N-(7-amino-l-(isoxazol-3-yloxy)-2-oxoheptan-3-yl)-6- (dimethylamino)iiicotinamide (62)62.1 62

[0425] 62.1 (20 mg) was dissolved in HCi / MeOH (2 mL), and the mixture was stirred at 25 °C for 10 mins. The reaction mixture was concentrated under reduced pressure to give Compound 62 (15 mg) as yellow oil; LCMS [M + H] for Ci8H26N504: 376; RT=2.077mm. Ή NMR (400 MHz, METHANOL-^) δ ppm 1.46 - 1.67 (m, 2 H), 1.75 (br d, J=7.02 Hz, 2 H), 1.87 (dtd, J=14.25, 9.65, 9.65, 4.60 Hz, 1 H), 2.00 - 2.1 1 (m, 1 H), 2.97 (br t, J=7.45 Hz, 2 H), 3.34 - 3.41 (m, 6 H), 4.74 (dd, J=9.21, 4.82 Hz, 1 H), 5.16 (d, J=1.75 Hz, 2 H), 6.19 (d, J=1.75 Hz, 1 H), 7.33 (d, J=9.65 Hz, 1 H), 8.39 (d, J=1.75 Hz, 1 H), 8.43 (dd, J=9.65, 1.75 Hz, 1 H), 8.52 (d, . / =1.75 Hz, 1 H).Example 59. Preparation of (S)-N-(7-amino-l-((2,6-dimethyIpyridin-4-yl)oxy)-2- oxoheptan-3-yl)-2-methoxy-2-methylpropanamide (63)47.263.1

[0426] To 47.2 (423 mg, 1.12 mmol, 1 equivalent) and 2,6-dimethyl-4-hydroxypyridine (137.49 mg, 1.12 mmol, 1 equivalent) in DMF (9 mL) were added K2C03(462.89 mg, 3.35 mmol, 3 equivalent) and KI (185.33 mg, 1.12 mmol, 1 equivalent) in one portion at 25 °C under N2. Then the mixture was stirred for 2 hours. The reaction mixture was quenched by addition H20 (20 mL) and then diluted with EtOAc (20mL) and extracted with EtOAc ( 10 mL x 3). The combined organic layers were washed with H?0 (10 mL x 3), dried over, filtered and concentrated under reduced pressure to give a residue. The residue was purifiedby column chromatography (SiC>2, Petroleum ether / Ethyl acetate=3: l) to give 63.1 (85 mg, 182.57 μτηοΐ) as a white solid; LCMS [M + H]: 466; RT=1.155min. Ή NMR (400 MHz, METHANOL-^,) δ ppm 1.38 (d, J=5.51 Hz, 8 H) , 1.43 (s, 1 1 H) ,1.50 (dt, J= 13.67, 6.84 Hz, 3 H), 1.64 - 1.77 (m, 2 H) ,1.88 - 1.99 (m, 2 H), 2.41 - 2.46 (m, 6 H) ,2.99 - 3.09 (m, 3 H) ,3.31 - 3.32 (m, 3 H), 4.55 - 4.62 (m, 2 H) ,4.92 - 5.04 (m, 3 H) ,6.66 (s, 2 H).63.1 63

[0427] 63.1(85 mg) in DCM (5 mL) and TFA (1 niL) was stirred for 0.5 hour. The reaction mixture was concentrated under reduced pressure. The residue was purified by column chromatography (S1O2, Petroleum ether / Ethyl acetate=2: l) to give compound 63 (50 mg); LCMS [M + H]: 366; RT=1.517min. ¾ NMR (400 MHz, METHANOL-^) δ ppm 1.25 - 1.40 (m, 6 H) ,1.46 - 1.59 (m, 2 H) , 1.67 - 1.80 (m, 3 H) , 1.94 - 2.05 (m, 1 H), 2.61 - 2.66 (m, 6 H) ,2.93 (br t, J=7.58 Hz, 2 H) ,3.30 - 3.32 (m, 3 H) ,4.47 (dd, J=9.66, 4.40 Hz, 1 H), 5.22 - 5.40 (m, 2 H) ,7.13 - 7.22 (m, 2 H). Example 60. Preparation of (S)-N-(7-amino-2-oxo-l-(pyridin-3-yloxy)heptan-3-yl)-2- methoxy-2-methylpropanamide (64)64

[0428] Compound 64 was prepared by the same methods used for Compound 63 with 3- hydrozypyridine used instead of 2,6-dimemyl-4-hydroxypyridine; LCMS [M + H]: 338; RT 4.585 min. Ή NMR (400 MHz, METHANOL-^) δ ppm 1.21 - 1.40 (m, 6 H), 1.42 - 1.58 (m, 2 H) ,1.64 - 1.80 (m, 3 H), 1.95 - 2.05 (m, 1 H) ,2.93 (br t, J=7.64 Hz, 2 H) ,3.30 - 3.32 (m, 3 H), 4.51 (dd, J=9.66, 4.40 Hz, 1 H), 5.14 - 5.29 (m, 2 H) ,7.86 (dd, J=8.80, 5.38 Hz, 1 H) ,7.98 - 8.03 (m, 1 H), 8.41 (br d, J=5.14 Hz, 1 H), 8.51 (br d, J=2.08 Hz, 1 H).Example 61. Preparation of (S)-N-(7-amino-l-((2-methylpyrimidin-5-yI)oxy)-2- oxoheptan-3-yl)-2-methoxy-2-methylpropanamide (65)65

[0429] Compound 65 was prepared by the same methods used for Compound 63 with 5- hy droxypyri mid ine used instead of 2,6-dimethyl-4-hydroxypyridine; LCMS [M ÷ H]: 353; RT = 1.98 min. Ή MR (400 MHz, DMSO-t6) δ ppm 1.24 (br s, 1 H), 1.31 (s, 7 H), 1.34 (br s, 1 H), 1.45 - 1.58 (m, 2 H), 1.65 (dtd, J=14.00, 9.48, 9.48, 4.71 Hz, 1 H), 1.78 - 1.89 (m, 1 H), 2.55 (s, 3 H), 2.72 - 2.85 (m, 2 H), 3.20 (s, 3 H), 4.19 - 4.61 (m, 1 H), 5.18 (br s, 2 H), 7.68 (br s, 2 H), 8.21 (d, J=7.70 Hz, 1 H), 8.36 (s, 2 H). Example 62. Preparation of (S)-N-(7-amino-2-oxo-l-(pyridin-3-ylthio)heptan-3-yl)-2- methoxy-2-methylpropanamide (66)

[0430] To 66.1 (2 g, 12.66 mmol, 1.22 inL, 1 equivalent) in dioxane (20 mL) was added 66.2 (2.90 g, 13.29 mmol, 1.05 equivalent), DIPEA (3.27 g, 25.32 mmol, 4.41 mL, 2 equivalent) and Xantphos (732.45 mg, 1.27 mmol, 0.1 equivalent), Pd2(dba):, (579.58 mg, 632.93 μηιοΐ, 0.05 equivalent). The mixture was stirred at 100 °C for 2 hr. The reaction mixture was quenched by addition H20 (20 mL), and extracted with EtOAc (20 rnL x 3). The combined organic layers were washed with brine (20 mL), dried over Na2SC>4 and concentrated under reduced pressure to give a residue. The residue was purified by MPLC (Si02, Petroleum ether / Ethyl acetate=10 / l to 1 : 1) to give 66.3 (3.6 g, 12.19 mmol, 96.26% yield) as yellow oil.66.3 66.4

[0431] To 66.3 (800 mg, 2.71 mmol, 1 equivalent) in THF (10 niL) was added t- BuOK / THF (1 M, 4.06 niL, 1.5 equivalent). The mixture was stirred at -78 °C for 1 h. The reaction mixture was concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (Si02, EtOAc / MEOH=10 / l to 1 : 1) to give 66.4 (80 mg) as yellow oil. Ή NMR (400 MHz, DMSO-d6) δ ppm 8.53 (d, J=1.75 Hz, 1 H), 8.31 (dd, J=4.82, 1.32 Hz, 1 H), 7.83 - 7.91 (m, 1 H), 7.30(dd, J=7.45, 4.82 Hz, 1 H),3.58 (br s, 8 H) 3.38 - 3.73 (m, 1 H).66.5

[0432] To 47.2 (500 mg, 1.32 mmol, 1 equivalent) in DMF (5 mL) was added 66.4 (80 mg, 719.65 μητοΐ, 5.45 equivalent), K2C03(547.15 mg, 3.96 mmol, 3 equivalent) and KI (219.06 mg, 1.32 mmol, 1 equivalent). The mixture was stirred at 25 °C for 5h. The reaction mixture was filtered, and the desired compound was in the filtrate. The filtrate was purified by prep- HPLC (column: Phenomenex Luna C18 200 x 40mm x 10 um;mobile phase: A:water(0.1 %TFA)- B: ACN; B%: 15%-35%, 8 rnin) to give 66.5 (40 mg, 88.18 μητοΐ).66.5 66

[0433] To 66.5 in DCM (5 mL) was added TFA (1 mL). The mixture was stirred at 25 °C for lh. The reaction mixture was concentrated under reduced pressure to give a residue to give Compound 66 (12 mg); LCMS [M + H]: 354; RT= 1.83 min. ¾ NMR (400 MHz, METHANOL-d4) δ ppm 8.62 (br s, 1 H) ,8.49 (br s, 1 H) ,8.14 (d, J=8.33 Hz, 1 H) ,7.62 (dd,J=8.33, 4.82 Hz, 1 H) ,4.60 (dd, J=9.43, 4.17 Hz, 1 H), 4.10 - 4.21 (m, 1 H), 3.29 (br s, 3 H), 2.90 (br t, J= 7.45 Hz, 2 H), 1.97 (br d, J= 10.09 Hz, 1 H), 1.62 - 1.74 (m, 3 H), 1.42 (br d, J=4.39 Hz, 1 H), 1.36 (d, J=4.38 Hz, 8 H), 1.27 - 1.33 (m, 1 H).Example 63. Preparation of (S)-N-(7-amino-l-((2,6-dimethyIpyridin-4-yl)thio)-2- oxoheptan-3-yl)-2-methoxy-2-methylpropanamide (67)67.1

[0434] To 2,6-dimethyl-4-chloropyridine (2 g, 14.12 mmol, 1 equivalent) in DMF (20 mL) was added NaSH (1.98 g, 35.31 mmol, 2.5 equivalent). The mixture was stirred at 140 °C for 2h. The reaction mixture was concentrated under reduced pressure to give a residue. The residue was purified by MPLC (Dichlorome thane: Methanol S1O2, =10 / 1 to 1:1) to give 67.1 (2.7 g) as a yellow solid.47.2 67.2

[0435] To 67.1 (367.44 mg, 2.64 mmol, 1 equivalent) in DMF (7 mL) was added 47.2 (1 g, 2.64 mmol, 1 equivalent), K2C03(1.09 g, 7.92 mmol, 3 equivalent) and Kl (438.12 mg, 2.64 mmol, 1 equivalent). The mixture was stirred at 25 °C for 2h. The reaction mixture was filtered, and the desired compound was in the filtrate. The filtrate was purified by prep- HPLC (column: Phenomenex Luna (2) CI 8, 250 x 50 x 10 u; mobile phase A:water(0.1%TFA) and B: ACN; gradient B%: 10%-40% over 20 min) to give 67.2 (353 mg).67.2 67

[0436] To 67.2 (353 nig) in DCM (5 mL) was added TFA (1 mL). The mixtiue was stirred at 25 °C for lh. The reaction mixture was concentrated under reduced pressure to give Compound 67 (350 mg); LCMS | M ÷ H |: 382; RT=1.799 min. Ή NMR (400 MHz, METHANOL-^) δ ppm 7.40 - 7.52 (m, 2 H) ,4.32 - 4.57 (m, 3 H), 3.32 (br s, 3 H) ,2.94 (br t, J=7.64 Hz, 2 H), 2.63 (s, 6 H) ,1.95 - 2.08 (m, 1 H) ,1.65 - 1.83 (m, 3 H) , 1.43 - 1.57 (m, 2 H) , 1.39 (d, J=5.62 Hz, 6 H).Example 64. Preparation of (S)-N-(7-amino-l-((2-methylpyrimidin-5-yl)thio)-2- oxoheptan-3-yl)-2-methoxy-2-methylpropanamide (68)68

[0437] Compound 68 was prepared by the same methods used for Compound 66 with 2- methyl-5-bromopyrimidine used instead of 3-bromopyridine; LCMS [M + H]: 369; RT = 2.0 min.!H NMR (400 MHz, METHANOL-^) δ ppm 1.36 (s, 8 H), 1.38 - 1.48 (m, 2 H) ,1.60 - 1.74 (m, 3 H) ,1.90 - 2.01 (m, 1 H), 2.65 (s, 3 H) ,2.90 (br t, J=6.80 Hz, 2 H), 3.29 (s, 3 H) ,3.91 - 4.10 (m, 2 H), 4.62 (dd, J=9.43, 4.60 Hz, 1 H) ,8.68 (s, 2 H).Example 65. Preparation of (S)-N-(7-amino-l-((l,l,l?3,3?3-hexafluoropropan-2-yl)oxy)- 2-oxoheptan-3-yI)-2-methoxy-2-methyIpropanamide (69)1.2 69.1

[0438] A suspension of compound 1.2 (1.0 g, 2.36 mmol, 1.0 equivalent), 1,1,13,3,3- hexafluoroisopropanol (595 mg, 3.54 mmol, 1.5 equivalent), KF (41 1 mg, 7.09 mmol, 3.0 equivalent) in DMF (7 mL) was degassed and purged with N2for 3 times, and then the suspension was stirred at 25 °C for 2 hr under N2atmosphere. LCMS indicated compound 1.2 was consumed completely. The reaction was quenched with water (21 mL) slowly and then extracted with EtOAc (20 mL x 2). The combined organic phase was washed with brine (10 mL), dried over anhydrous a?S04, filtered and concentrated in vacuo. The residue was purified by column chromatography (SiGh, Petroleum ether: Ethyl acetate = 15: 1 to 3 : 1 ) to give 69.1 (0.90 g. 1.67 mmol, 70% yield) as a colorless gum. Ή NMR (400 MHz, DMSO- ds) δ 8.05 (d, J= 8.4 Hz, IK), 6.73(broad s, 1H), 5.42-5.50 (m, 1H), 4.65 (dd, J= 1.2 Hz, J = 1.2 Hz, 2H), 4.26-4.32 (m, 1H), 3.15 (s, 3H), 2.80-2.91 (m, 2H), 1.67-1.75 (m, lH), 1.52-1.58 (m, lH), 1.33 (s, 1 lH), 1.25 (s, 6H) ppm.69.1 69

[0439] To a solution of compound 3 (0.90 g, 1.76 mmol, 1.0 equivalent) in EtOAc (10 mL) was added HCl EtOAc (4 M, 10 mL, 22 equivalent) at 0 °C. The solution was stirred at 0 °C for 1 hr. LCMS indicated compound 69.1 was consumed completely. The reaction mixture was concentrated under reduced pressure to give a residue. This was dried by freeze diyer to give compound Compound 69 (0.78 g, total yield: 63.7%, HCl salt) as a yellow gum. Ή NMR (400 MHz, DMSO-d6) δ 8.09 (d, J= 8.4 Hz, 1H), 7.91 (br.s, 3H), 5.47-5.54 (m,1H), 4.61-4.79 (m, 2H), 3.15 (s, 3H), 2.64-2.72 (m, 2H), 1.58-1.74 (m, 1H), 1.52-1.58 (m, 3H), 1.33-1.34 (m, 2H), 1.33 (s, 6H) ppm.Example 66. Preparation of cyanine gingipain activity probes 70, 71, and 72

[0440] Probe compound 70 was prepared according to the following scheme.

[0441] Probe compound 71 was prepared according to the following scheme.

[0442] Probe compound 72 was prepared according to the following scheme.Example 67. Inhibition of Lysine Gingipain

[0443] The capacities of compounds of the present invention to inhibit the activity of lysine gingipain were measured in a fluorogenic assay similar to those described by Barret (Biochemical Journal. 1980, 187(3), 909). The specific assay conditions were as follows. Buffer: pH = 7.5, 100 mM Tris-HCl, 75 mM NaCl, 2.5 mM CaCl2, 10 mM cysteine, 1% DMSO after all additions. Protein: 0.1 nM Kgp, isolated from culture of Porphyromonas gingivaUs, as described by Pike et al. (J. Biol. Chem. 1994, 269(1), 406), and Potempa and Nguyen (Current Protocols in Protein Science. 2007, 21.20.1-21.20.27). Fluorogenic substrate: 10 μΜ Z-His-Glu-Lys-MCA. Time = 90 minutes. Temperature = 37 °C. Each compound: 10 concentrations, starting at either 100 μΜ or 100 nM, with lowerconcentrations generated by serial 3-fold dilutions. By testing a range of concentrations foreach compound, the concentration required to inhibit the activity of lysine gingipain by 50% (the "ICso") was determined. Under the described assay conditions, the signal-to-noise ratio was excellent, and the Z factor was greater than 0.6. Compounds in Table 1 were tested, as well as the compounds set forth in Table 2 below.

[0444] The capacities of compounds of the present invention to inhibit the activity of cathepsins B, H, K, L, and S were measured in similar assays. Boc-Leu-Arg-Arg-AMC (20 μΜ) in sodium acetate buffer (50 mM, pH 5.5) containing DTT (1 mM) and EDTA (2 mM) was used for the Cathepsin B assay. L-Arg-AMC (20 uM ) in sodium acetate buffer (50 mM, pH 5.5) containing DTT (1 mM) and EDTA (2 mM) was used for the Cathepsin H assay. Z- Phe-Arg-AMC (10 μΜ) in HEPES buffer (50 mM, pH 7.4) containing DTT (2.5 mM) and EDTA (1 mM) was used for the Cathepsin K assay. Z-Phe-Arg-AMC (20 μΜ) in sodium acetate buffer (50 mM, pH 5.5) containing DTT (1 mM) and EDTA (2 mM) was used for the Cathepsin L assay. Z-Leu-Arg-AMC (10 μΜ) in sodium acetate buffer (25 mM, pH 4.5) containing DTT (2.5 m ) and NaCl (50 mM) was used for the Cathepsin S assay. The capacities of the compounds to inhibit the activity of cathepsins F, V, and Z were also measured. Compounds in Table 1 were tested, as well as the compounds set forth in Table 2 below.Table 2. Comparative Lysine gingipain inhibitors.

[0445] IC50values for inhibition of Kgp and cathepsins by compounds of the invention are set forth in Table 3. The results show that the compounds of the invention and reference compound 73 are comparable with respect to Kgp inhibition activity, having sub-nanomolar Kgp IC50values. Surprisingly, the compounds of the invention exhibit superior selectivity for Kgp. For example, the CatH and CatS IC50values for compound 2 are more than ten times higher than the IC50 values for reference compound 73, indicating that compound 2 is a less effective cathepsin inhibitor than reference compound 73. The CatB IC50 value for compound 2 is more than 20 times higher than the CatB IC50 value for reference compound 73. The CatK and CatL IC50values for compound 2 are more than 100 times higher than the IC50 values for reference compound 73.

[0446] The decreased cathepsin inhibition activity of the compounds is advantageous because cathepsins are lysosomal proteases implicated in a number of importantphysiological processes including MHC-II-mediated antigen presentation, bone remodeling, keratinocyte differentiation, and prohormone activation. The compoimds of the invention can therefore be used to selectively inhibit Kgp in a subject, resulting from invasive P. gingivahs, without perturbing endogenous cathepsin activity in the subject.Table 3. Inhibition of Lysine Gingipain and Cathepsins by compounds of the invention.IC5(I(iiM)Compound Kgp CatB CatS CatK CatL CatHNo.14a 6.4215a 3.8916a >10017a >10018a 0.5019a >10020a >10073 <0.05 485 9980 20 700 11074 <0.0575 2.29Example 68. Neuroprotective effects of compounds of the invention

[0447] Human neuroblastoma SH-SY5Y cells at thirteen passages were inoculated and cultured in complete medium, DMEM / F12 (Invitrogen 11330-032) supplemented with 2 mM L-glutamine (Invitrogen 25030164), 10% heat-inactivated fetal bovine serum (Invitrogen- 10099141), and 1% penicillin-streptomycin (Pen / Strep; Invitrogen- 15140122) in a 5% CO2incubator (Thermal Fisher 371). The cells were seeded at a density of 2-4 * 104cells / well (200 μΐ of 1-2 x 105cell / mL) in a 96-well black / flat bottom plates (Greiner-655090) manually coated with collagen type I. The plates were incubated in a CO2incubator at 37°C.

[0448] When the cell culture in the wells reached 70-80% confiuency (~ 6* lO4cells / well), they were challenged with P. gingivalis in the presence of test compounds at various concentrations, or in the absence of test compounds. Compound stock solutions were prepared via serial dilution with DMSO in a sterile v-bottom 96-well plate (2.8, 6.4, 3.2, 1.6, 0.8, 0.4, 0.2, 0.1 , 0.05 and 0 mg / ml). Stock solutions (6 uL) were then transferred into a 96- deep well plate filled with 594 μΐ. complete mcdium-Pen / Strcp to provide working solutions for further testing (128, 64, 32, 16, 8, 4, 2, 1, 0.5 and 0 μ^ιηΐ,).

[0449] The strain P. gingivalis ATCC BAA-308 was streaked out from -80°C stock onto a brain heart infusion agar (BHA) (BD-211065). The plate was incubated for 72 h at 37CC in an anaerobic workstation (Shanghaiyuejin, YQX-II). The atmosphere was kept at 80% N2, 10% CO2, and 10% H2. At the time of testing, the plates were taken out of the anaerobic work station and processed in ambient atmosphere. The bacteria were harvested and suspended in complete medium-Pen / Strep (without Pen<'Strep). The turbidity of the suspension was adjusted to 0.5 by Siemens MicroScan® Turbidity Meter (Siemens), which is equivalent to~6χ108cfu / mL. The bacterial suspension was diluted in complete medium-Pen''Strep to the final bacterial density of 6* 10scfu / ml (for MOI 1 : 1000) including one well with no bacteria as a negative control.

[0450] The cells in testing plate were washed once with 200 μί^complete medium- Pen / Strep. Then 100 uL of working solution was added. Immediately after this step, 100 μΐ. of bacterial suspension was added. The final concentrations of the test compounds were 64, 32, 16, 8, 4, 2, 1 , 0.5, 0.025 and 0 μg / mL with 1% DMSO. The testing plates were incubated at 37°C in a 5% CO incubator for 24 hrs.

[0451] Cell viability was determined using AlamarBlue (Invitrogen-527026). The cells in the testing plates were washed twice using complete medium- Pen / Strep to removed bacteria from the suspension. Immediately after this, 220 uL AlamarBlue medium mix (consisting of 200 μΐ. complete medium-Pen / Strep and 20 μΐ. AlamarBlue) was added to each well of the testing plates using a multi-pipette. The testing plates were then incubated in a 37°C CO2incubator for fluorescent reduced-AlamarBlue to develop, which was readable after 5-6 hours of development using a SpectraMax M2e plate reader (Molecular Devices) without saturation. Excitation and emission wavelengths were set to 530 nm and 590 nm, respectively, according to the supplier's manual (Invitrogen).

[0452] Kgp inhibitors of the invention protected SH-SY5Y neuroblastoma cells from P. gmgivalis-m'duccd cell death, as shown in FIG. 1. Example 69. Prevention of iron acquisition by P. gingivatis

[0453] Three days prior to the day of test, bacterial strains were streaked out from -80°C glycerol stock onto Brain Heart Infusion Agar (BHA) (BD-211065) plates and incubated at 37°C for 72 h in a YQX-II anaerobic workstation. The single colonies were picked using an inoculation loop (Greiner-731175) and suspended into 5 ml sterile saline. The turbidity of the suspension was adjusted to 0.2 (Siemens MicroScan turbidity meter), equal to ~2* 108cfu / rnL. The bacterial suspension was then diluted lOOx in testing media. This was used for inoculating daughter plates.

[0454] An aliquot of 100 μΐ of the bacterial suspension was inoculated into each well of the daughter plates. Each well contained ~1.0χlO6cfu / mL bacteria, 1% DMSO, and serially diluted compounds in 200 μΐ, Brucella Broth (BRU). The plates were incubated for 6 days at37°C in a YQX-II anaerobic workstation. Results of iron acquisition were read by visualizing conversion of the color of the bacteria to black.

[0455] FIG. 2 shows that compounds of the present invention are approximately twice as effective in preventing hemoglobin breakdown and iron acquisition, a key survival mechanism of P. gingivalis, as compared to reference compound 73.Example 70. Improved pharmacokinetic properties of Kgp inhibitors

[0456] Adult male Balb / C mice (20-25 grams, Harlan Laboratories, USA) were anesthetized using isoflurane (2%, 800 n L / min O2). Bupivacaine / epinephrine was used for local analgesia and carprofen was used for peri- / post-operative analgesia. The animals were placed in a stereotaxic frame (Kopf instruments, USA). MetaQuant (MQ) microdialysis probes (regenerated cellulose membrane, 3 mm exposed surface, BrainLink, the Netherlands) were inserted into the hippocampus and a cannula was inserted into the jugular vein.Coordinates for the tips of the hippocampal probes were: anterior-posterior (AP) = -3.1 mm from bregma, lateral (L) = -2.8 mm from midline and ventral (V) = -4.1 mm from dura, the toothbar set at 0 mm. After surgery, animals were housed individually in cages and provided food and water ad libitum .

[0457] Compound 1 and reference compound 73 were prepared fresh in 2% DM SO and 98% Saline at 2 mg / mL and dosed p.o. at 5 mL / kg resulting in a final dosing concentration of 10 mg / kg.

[0458] Microdialysis sampling was initiated one day after surgery. On the day of the experiment, the probes were connected with flexible PEEK tubing to a microperfusion pump (Harvard PHD 2000 Syringe pump, Holliston, MA or similar). Microdialysis probes were perfused with aCSF containing 147 mM NaCl, 3.0 mM KC1, 1.2 mM CaCL, 1.2 mM MgCl2, and 0.15 % BSA, at a slow flow rate of 0.15 μΕ / ηιίη and a carrier flow (UP water, 0.04% ascorbic acid, and 0.15% BSA) at a rate of 0.8 ,uL / min. Microdialysis samples were collected for 15- or 30-rninute periods by an automated fraction collector (820 Microsampler, Univentor, Malta) into 300 \xL. After stabilization, one baseline sample was collected and reference compound 73 (10 mg / kg; PO) was administered to all animals. Samples were collected for an additional 8 hours. Plasma was also collected via the tail vein at 15, 30, 60, 120, 240 360, 480 and 720 minutes after administration of reference compound 73. All the samples were stored at -80 °C awaiting analysis by Brains On-Line. After the completion of the experiment, the mice were sacrificed, brains were collected for probe verification.

[0459] Concentrations of drug in dialysate and plasma were determined by HPLC with tandem mass (MS / MS) detection. Microdialysis samples were injected without any sample pretreatment onto the LC system (LC20XR, Shimadzu, Japan) by an automated sample injector (Sil20ACHT, Shimadzu, Japan). Plasma samples were precipitated with a mixture containing 80% ACN. Samples were further diluted with water containing 0.1 % formic acid.

[0460] Chromatographic separation was performed on a reversed phase column (2.1 x 50 mm, particle size: 2.5 μηι, Xbridge C8, Waters, USA). Components were separated using a linear gradient of acetonitrile containing 0.1% formic acid in ultrapurified H20 containing 0.1% formic acid (flow rate 0.2 niL / min).

[0461] MS analyses were performed using an API 4000 triple-quadropole system consisting of an API 4000 triple-quadropole detector and a Turbo Ion Spray interface (both from Applied Biosystems, USA). The acquisitions were performed in positive ionization mode, with optimized settings for the analytes. The instrument was operated in multiple- reaction-monitoring (MRM) mode using a mass transition of 405.2-to-221.3. Data were calibrated and quantified using the Analyst™ data system (Applied Biosystem) using the response of the analyte versus the concentration.

[0462] The compounds of the invention provide increased plasma concentrations and free brain concentrations in mice as shown in FIG. 3 and FIG. 4, respectively.Example 71. Inhibition of Lysine Gingipain

[0463] Further assays to measure the inhibitory activity of compounds of the present invention against Kgp and cathepsins B, H, K, L, and S were conducted as described in Example 66. The capacities of the compounds to inhibit the activity of cathepsins F, V, and Z were also measured. Taken together, the results of Example 66 and Example 70 show that the compounds described herein are very effective inhibitors of Kgp exhibiting nanomolar and picomolar IC50values. Furthermore, as shown in Table 4, a number of compounds— including compounds 1, 2, 7, and 50— show increased selectivity for Kgp over endogenous cathepsin as compared to reference compound 73. Compounds 18, 47, 55, and 69, in particular, are far more selective for Kgp over endogenous cathepsins as compared to reference compound 73.

[0464] The compounds also displayed other important advantages. For example, compounds 1, 47, 48, and 69 exhibited improved oral availability and increased plasmaconcent...

Claims

WHAT IS CLAIMED IS: L A compound according to Formula I:or a pharmaceutically acceptable salt thereof wherein:A is selected from the group consisting of -CH2- and -0-;RI aand Rlare each independently selected from the group consisting of hydrogen, Ci- alkyl, and an amine protecting group;R2aand R2are each independently selected from the group consisting of hydrogen, halogen, Ci-4haloalkyl, and Ci-4haloalkoxy;R3is selected from the group consisting of C}.& cycloalkyL C3-8 alkyl,3- to 12-membered heterocyclyl, Ce-io aryl, 5- to 12-membered heteroaryl, and a reporter moiety wherein R' is optionally substituted with one or more R substituents;each Rjais independently selected from the group consisting ofhalogen, -CN, -N02, -N3, -OH, C1-4 alkyl, C1 -4haloalkyl, CMalkoxy, CM haloalkoxy, -N(RC)2, -N+(R )3, -(CH2)kC(0)Rb,-NRc(CH2)uC(0)Rb, -0(CH2)uC(0)R , -(CH2)kCONRcRc, -(CH2)kNRcC(0)Rb, -NRc(CH2).,CONRcRc, -NRc(CH2)uNRcC-(O)Rb, -0(CH2,CONRcRc, and -0(CH2)uNRcC(0)R , and optionally substituted triazolyl; each R is independently selected from the group consisting of C1-4alkyl,Ci-4haloalkyl, and CM deuteroalkyl;each Rcis independently selected from the group consisting of hydrogen and Cj-8alkyl;each subscript k is independently selected from 0, 1 , 2, 3, 4, 5, and 6;each subscript u is independently selected from I, 2, 3, 4, 5, and 6;R4is selected from the group consisting of hydrogen and Q-4alkyl;R^ is selected from the group consisting of -CH2R5a, -CHS(0)(R5b)2, andCi-6haloalkyl;R5ais selected from the group consisting of -O-R6, -S-R7, -SO-R7,-S02-R7, -N(R8)2, 5- to 12-membered heteroaryl, and 3- to 12-membered heterocyclyl, wherein 5- to 12-membered heteroaryl is optionally substituted with one or more members independently selected from the group consisting of halogen, C1- alkyl, and C1-3 haloalkyl, and3- to 12-membered heterocyclyl is optionally substituted with one or more members independently selected from the group consisting of oxo, halogen, C1-3 alkyl, and C1-3 haloalkyl;each R315is independently selected O-e alkyl;R6and R7are selected from the group consisting of phenyl, Ci_ alkyl, Q-6 haloalkyl, and 5- to 12-membered heteroaryl,wherein phenyl is substituted with 1-5 halogens, andwherein 5- to 12-membered heteroaryl is optionally substituted with one or more halogen, C1.3 alkyl, or C1.3 haloalkyl;each R8is independently selected Ci-6 alkyl; andR' optionally comprises a quenching moiety R9;provided that R5is other than 2,3,5,6-tetrafluorophenoxymethyl.

2. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein R3is selected from the group consisting of C3.S cycloalkyl, C3.8 alkyl, Ο,-ιο aryl, 5- to 12-membered heteroaryl, and 3- to 12-membered heterocyclyl, each of which is optionally substituted with one or more R3substituents.

3. The compound of claim 1 or claim 2, or a pharmaceutically acceptable salt thereof, wherein R3is selected from the group consisting of cvclopentyl and phenyl, each of which is optionally substituted with one or more Rasubstituents.

4. The compound of claim 2 or claim 3, or a pharmaceutically acceptable salt thereof wherein each Rjais independently selected from the group consisting of halogen, -N3, C1-4 alkyl, C1-4 haloalkyl, C1-4 alkoxy, C1-4 haloalkoxy, -N(RC)2, -N+(Rb)3, and -NRcC(0)Rb.

5. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein R'' is cyclopentyl.

6. The compound of claim 1 or claim 2, or a pharmaceutically acceptable salt thereof wherein RJis C3-8 aikyl substituted with Ci-4 alkoxy.

7. The compound of claim 6, or a pharmaceutically acceptable salt thereof wherein RJis methoxypropyl.

8. The compound of claim 5, or a pharmaceutically acceptable salt thereof, having a structure accordin to Formula la:

9. The compound of claim 8, or a pharmaceutically acceptable salt thereof, wherein R4is hydrogen.

10. The compound of claim 9, or a pharmaceutically acceptable salt thereof, wherein R5ais -O-phenyl, wherein phenyl is substituted with 1 -5 halogens.

11. The compound of claim 10, or a pharmaceutically acceptable salt thereof, wherein each halogen in R5ais independently selected from the group consisting of F and CI.

12. The compound of claim 1 1 , or a pharmaceutically acceptable salt thereof, wherein R5ais selected from the group consisting of 2,3,6-trifluorophenoxy; 2,3,5- trifluorophenoxy; 2,3-difluorophenoxy; 2,5-difluorophenoxy; 2,6-difluorophenoxy; 3,5- difluorophenoxy; 2-fluorophenoxy; and 3-fluorophenoxy.

13. The compound of any one of claims 1-4, 6, and 7, or apharmaceutically acceptable salt thereof, having a structure according to Formula la:

14. The compound of any one of claims 1-4, 6, 7, and 13, or a pharmaceutically acceptable salt thereof, wherein R4is hydrogen.

15. The compound of claim 13 or claim 14, or a pharmaceutically acceptable salt thereof, wherein R33is -O-phenyl, wherein phenyl is substituted with 1-5 halogens.

16. The compound of claim 15, or a pharmaceutically acceptable salt thereof, wherein each halogen in R2is independently selected from the group consisting of F and CI.

17. The compound of claim 16, or a pharmaceutically acceptable salt thereof, wherein each halogen in R3dis F.

18. The compound of any one of claims 1-4, 6, 7, and 13-17, or a pharmaceutically acceptable salt thereof, wherein R,ais selected from the group consisting of 2,3,6-trifluorophenoxy; 2,3,5-trif uorophenoxy; 2,3,4-trifluorophenoxy; 3,4,5- trifluorophenoxy; 2,3-difluorophenoxy; 2,4-difluorophenoxy; 2,5-difluorophenoxy; 2,6- difluorophenoxy; 3,4-difluorophenoxy; 3,5-difluorophenoxy; 2-fluorophenoxy; 3- fluorophenoxy; and 4-fiuorophenoxy.

19. The compound of claim 18, or a pharmaceutically acceptable salt thereof, wherein R5ais selected from the group consisting of 2,3,6-trifluorophenoxy; 2,3,5- trifluorophenoxy; 2,3-difluorophenoxy; 2,5-difluorophenoxy; 2,6-difluorophenoxy; 3,5- difluorophenoxy; 2-fluorophenoxy; and 3-fluorophenoxy.

20. The compound of claim 18, or a pharmaceutically acceptable salt thereof, wherein R5ais selected from the group consisting of 2,3,6-trifiuorophenoxy and 2,6- difluorophenoxy.

21. The compound of claim 13 or claim 14, or a pharmaceutically acceptable salt thereof, wherein R5is -CH2R:'2, R,ais -O-R6, and R6is Q.6 haloalkyl.

22. The compound of claim 21 , or a pharmaceutically acceptable salt thereof, wherein R6is selected from the group consisting of trifluoroethyl andhexafluoropropyl.

23. The compound of claim 13 or claim 14, or a pharmaceutically acceptable salt thereof, wherein R5is -CH2R~, R3ais -O-R6, and R6is5- to 12-membered heteroaryl, which is optionally substituted with one or more members independently selected from the group consisting of halogen and C1-3 alkyl.

24. The compound of claim 23, wherein R6is selected from the group consisting of isoxazolyl and pyridinyl.

25. The compound of claim 13 or claim 14, or a pharmaceutically acceptable salt thereof, wherein R33is selected from the group consisting of -N(R8)2, 5- to 12-membered heteroaryl, and 3- to 12-membered heterocyclyl, wherein:5- to 12-membered heteroaryl is optionally substituted with one or more members independently selected from the group consisting of halogen, C1-3 alkyl, and Ci-3 haloalkyl, and3- to 12-membered heterocyclyl is optionally substituted with one or more members independently selected from the group consisting of oxo, halogen, C,..? alkyl, and C1-3 haloalkyl.

26. The compound of claim 25, or a pharmaceutically acceptable salt thereof, wherein R5ais selected from the group consisting of tetrazolyl and oxopyrimidinyl.

27. The compound of claim 13 or claim 14, or a pharmaceutically acceptable salt thereof, wherein:R' is selected from the group consisting of -CiLR^ and -CHS(0)(R5b)2,R,ais selected from the group consisting of -S-R7and -S-(0)2R'', andR7is selected from the group consisting of Ci-6 alkyl, Ci_6 haloalkyl,5- to 12-membered heteroaryl, and 3- to 12-membered heterocvclyl.

28. The compound of claim 27, or a pharmaceutically acceptable salt thereof, wherein R5is -CILR53; R5£1is selected from the group consisting of -S-R7and -S-(0)2R7; and R7is Ci-6alkyl.

29. The compound of claim 27, or a pharmaceutically acceptable salt thereof, wherein R5is -CH2R" a; R5ais -S-R7; and R' is selected from the group consisting of 5- to 12-membered heteroaryl and 3- to 12-membered heterocvclyl.

30. The compound of claim 29, or a pharmaceutically acceptable salt thereof, wherein R' is selected from the group consisting of isoxazolyl, pyridinyi, and pyrimidinyl.

31. The compound of claim 27, wherein R5is -CHS(0)(RiD)2.

32. The compound of claim 13 or claim 14, wherein RDis C , haloalkyl.

33. The compound of claim 32, wherein RDis difluoromethyl.

34. The compound claim 1 , or a pharmaceutically acceptable salt thereof, which is selected from the group consisting of:23623836. A pharmaceutical composition comprising a compound of any one of claims 1-35, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient.

37. A method of treating a disease or condition associated with P.gingivalis infection, the method comprising administering to a subject in need thereof an effective amount of a compound according to any one of claims 1-35, or a pharmaceutically acceptable salt thereof, or an effective amount of a composition according to claim 36.

38. The method of claim 37, wherein the disease or condition is selected from the group consisting of a brain disorder, periodontal disease, diabetes, a cardiovascular disease, arthritis, rheumatoid arthritis, osteoarthritis, infectious arthritis, psoriatic arthritis, elevated risk of preterm birth, pneumonia, cancer, a kidney disease, a liver disease, a retinal disorder, and glaucoma.

39. The method of claim 38, wherein the disease or condition is a brain disorder.

40. The method of claim 39, wherein the brain disorder is selected from the group consisting of Alzheimer's disease, Down's syndrome, epilepsy, autism, Parkinson'sdisease, essential tremor, fronto-temporal dementia, progressive supranuclear palsy, amyotrophic lateral sclerosis, Huntington's disease, multiple sclerosis, mild cognitive impairment, age associated memoiy impairment, clironic traumatic encephalopathy, stroke, cerebrovascular disease, Lewy Body disease, multiple system atrophy, schizophrenia, and depression.

41. The method of claim 40, wherein the brain disorder is Alzheimer's disease.

42. The method of claim 41 , further comprising administering to the subject one or more active agents selected from the group consisting of a choiinesterase inhibitor, a serotonin modulator, an NMDA modulator, an Αβ targeted therapy, an ApoE targeted therapy, a microglia targeted therapy, a blood brain barrier targeted therapy, a tau targeted therapy, a complement targeted therapy, and an anti-inflammatory.

43. The method of claim 38, wherein the disease or condition is periodontal disease.

44. The method of claim 38, wherein the disease or condition is a liver disease.

45. The method of claim 44, wherein the liver disease is non-alcoholic steatohepatitis.

46. The method of claim 38, wherein the disease or condition is a retinal disorder.

47. The method of claim 46, wherein the retinal disorder is age-related macular degeneration.

48. The method of claim 38, wherein the disease or condition is cancer.

49. The method of claim 48, wherein the cancer is selected from the group consisting of oral cancer, breast cancer, pancreatic cancer, and glioblastoma multiforme.

50. The method of claim 38, wherein the disease or condition is elevated risk of preterm birth.

51. The method of claim 38, wherein the disease or condition is arthritis.

52. The method of claim 51 , wherein the arthritis is rheumatoid arthritis or osteoarthritis.

53. The method of claim 38, wherein the disease or condition is a cardiovascular disease.

54. The method of claim 38, wherein the disease or condition is diabetes.

55. The method of any one of claims 37-54, wherein the compound is administered to the subject for at least one month.

56. The method of claim 55, wherein the compound is administered to the subject for at least one year.

57. The method of claim 55, wherein the compound is administered to the subj ect for at least 10 years .

58. The method of claim 55, wherein the compound is administered to the subject for at least 60 years.

59. The method of any one of claims 37-58, wherein the subject is a human, a canine, or a feline.

60. The method of claim 59, wherein the subject is a human.