Double-toxin antibody-drug conjugate and use thereof

IL328448APending Publication Date: 2026-07-01CHENGDU KANGHONG BIOTECH CO LTD +5
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
IL · IL
Patent Type
Applications
Current Assignee / Owner
CHENGDU KANGHONG BIOTECH CO LTD
Filing Date
2026-05-14
Publication Date
2026-07-01

AI Technical Summary

Technical Problem

The existing antibody drug conjugates mainly contain a toxin, and the lack of a bitoxin combination has limited its application in tumor therapy.

Method used

The combination of triptylin and camptothecin drugs is used as the bitoxin in the antibody drug conjugate, and is coupled to the antibody through different linking units to form an antibody drug conjugate with a specific structure.

Benefits of technology

It improves the killing effect on tumor cells and provides a new therapeutic strategy that can significantly enhance the therapeutic effect against tumors.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

Provided are a double-toxin antibody-drug conjugate, and use of the antibody-drug conjugate in preparing a drug for treating cancer.
Need to check novelty before this filing date? Find Prior Art

Description

Dual toxin antibody drug conjugate and its use

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to and the benefits of Chinese Patent Application No. 202311543915.2 and No. 202410631122.4, the entire contents of which are incorporated herein by reference. Technical Field

[0003] The present disclosure relates to the field of chemical medicine, and in particular to a dual toxin antibody drug conjugate and its use. Background Art

[0004] As a new type of targeted therapy drug, Antibody Drug Conjugate (ADC) utilizes the specificity of antibodies binding to surface antigens of normal cells and tumor cells and the high efficiency of cytotoxins. It can effectively deliver cytotoxins to the diseased site to exert its efficacy, while reducing the defect of excessive side effects of cytotoxins in traditional drug forms. It is gradually playing an increasingly important role in the treatment of tumors and other fields.

[0005] ADC drugs are composed of three parts: a monoclonal antibody, a linker, and a cytotoxic drug (cytotoxin). Most ADC drugs reported so far are antibody-drug conjugates containing a single toxin, while reports on antibody-drug conjugates containing two toxins are relatively rare. Summary of the Invention

[0006] A first aspect of the present disclosure provides use of a combination of triptolide and camptothecin in the preparation of a medicament for treating tumor diseases.

[0007] In some embodiments, triptolide and a camptothecin act together as toxins in an antibody-drug conjugate.

[0008] A second aspect of the present disclosure provides an antibody drug conjugate comprising a dual toxin having the formula:

[0009] wherein Ab is an antibody or an antigen-binding fragment thereof;

[0010] D1 and D2 are selected from triptolide or camptothecin drugs, and D1 and D2 are different;

[0011] L1 and L2 are connection units;

[0012] x,y are 0-8.

[0013] In some embodiments, L1 is linked to Ab via a sulfhydryl or amide group. In other embodiments, L2 is linked to Ab via a saccharide group.

[0014] In some embodiments, L1 has [H1-L 1a -L 1b -L 1c -D1] x In other embodiments, L2 has [H2-L 2a -L 2b -L 2c -D2] y In some embodiments, H1 and H2 are linker sites with Ab or groups capable of reacting with Ab. In other embodiments, L 1a It connects H1 and L 1b The connection unit between them, L 2a It connects H2 and L 2b In some embodiments, L 1b Is connected to L 1a and L 1c The linker between 2b Is connected to L 2a and L 2c In some embodiments, L 1c It's L 1b and the spacer between D1, L 2c It's L 2b and a spacer between D2.

[0015] In some embodiments, H1 and H2 are selected from the group consisting of: in Indicates the junction site.

[0016] In other specific embodiments, H1 is selected from: In a preferred embodiment, H1 is In some specific embodiments, H2 is selected from:

[0017] In some embodiments, H1 and H2 are selected from the group consisting of: in In some other embodiments, H2 is selected from the group consisting of:

[0018] In some specific embodiments, L 1a or L 2a Contains -L d -C(O)-, where L d is selected from an optionally substituted alkylene group, an optionally substituted polyethylene glycol group, an optionally substituted alkenylene group, an optionally substituted alkynylene group, an optionally substituted aliphatic cycloalkylene group, an optionally substituted aliphatic heterocycloalkylene group, an optionally substituted arylene group, an optionally substituted heteroarylene group, or a combination thereof. In other specific embodiments, L d Selected from optionally substituted C 1-30 Alkylene, optionally substituted polyethylene glycol, optionally substituted C 2-30 Alkenylene, optionally substituted C 2-30 Alkynylidene, optionally substituted C 3-30 Alicyclic group, optionally substituted C 1-30 Aliphatic heterocyclic group, optionally substituted C 6-30 Arylene, optionally substituted C 5-30 In some embodiments, L d Selected from -(CH2)m-, -(PEG)n- or -(CH2) m -(PEG) n -(CH2) z -, wherein m, n, z are integers of 0-10, preferably, m, n, z are integers of 0-8.

[0019] In some specific embodiments, L 1b or L 2b is a cleavable linker or a non-cleavable linker. In some embodiments, L 1b or L 2b is a peptide chain consisting of 2-10 cleavable amino acids. 1b or L 2b is selected from the group consisting of Gly-Gly-Phe-Gly, Val-Cit, Val-Ala, Val-Lys, Val-Arg, AcLys-Val-Cit, AcLys-Val-Ala, Phe-Cit, Phe-Ala, Phe-Lys, Phe-Arg, Glu-Val-Ala, Glu-Val-Cit, Ala-Lys, Leu-Cit, Ile-Cit, Trp-Cit, Ala-Ala-Asn, Ala-Ala-Ala, Ala-Asn, Lys. In a further preferred embodiment, L 1b or L 2bSelected from Gly-Gly-Phe-Gly, Val-Cit, Val-Ala, Val-Lys, Phe-Cit, Phe-Ala, Phe-Lys, Ala-Ala-Asn.

[0020] In some specific embodiments, L 1c or L 2c Selected from: in In a preferred embodiment, L 1c Selected from

[0021] In some specific embodiments, L1-D1 is Among them L 1a -(CH2) m1 -C(O)- or -(PEG) n1 -(CH2) z1 -C(O)-, wherein m1, n1, z1 are integers from 2 to 8; L 1b is Gly-Gly-Phe-Gly, Val-Cit or Val-Ala; L 1c for D1 is triptolide or camptothecin drugs.

[0022] In some specific embodiments, L2-D2 is Where: L 2a -(PEG) n2 -(CH2) z2 -C(O)-, wherein n2 and z2 are integers of 2-8; L 2b is Gly-Gly-Phe-Gly, Val-Cit or Val-Ala; L 2c for D2 is triptolide or camptothecin drugs.

[0023] In some specific embodiments, L2-D2 is Where: L 2a -(PEG) n2 -(CH2) z2 -C(O)-, wherein n2 and z2 are integers of 2-8; L 2b is Gly-Gly-Phe-Gly, Val-Cit or Val-Ala; L 2c for D2 is triptolide or camptothecin drugs.

[0024] In some specific embodiments, L1a -(CH2) m1 -C(O)-, wherein m1 is an integer of 2-6, preferably 5. In other specific embodiments, L 1a -(PEG) n1 -(CH2) z1 -C(O)-, wherein n1 and z1 are integers of 2-6, preferably n1 and z1 are 2.

[0025] In some specific embodiments, L 2a -(PEG) n2 -(CH2) z2 -C(O)-, wherein n2 and z2 are integers from 2 to 6. In other specific embodiments, L 1a -(PEG) n1 -(CH2) z1 -C(O)-, wherein n1 and z1 are integers of 2-6; preferably n2 is an integer of 4-6, and z2 is 2.

[0026] In some embodiments, D1 is triptolide and D2 is a camptothecin. In other embodiments, D1 is a camptothecin and D2 is triptolide. In some embodiments, the camptothecin is camptothecin, exitecan, topotecan, SN38, or a derivative thereof. In other embodiments, the camptothecin is exitecan.

[0027] In some specific embodiments, x is selected from 2-8, preferably 3-5; y is selected from 3-4.

[0028] In some specific embodiments, x+y≥4, preferably 4≤x+y≤9, and more preferably 7≤x+y≤8.

[0029] In some specific embodiments, L1-D1 is selected from:

[0030] In some more specific embodiments, L1-D1 is selected from:

[0031] In some specific embodiments, L2-D2 is selected from:

[0032] In some more specific embodiments, L2-D2 is selected from:

[0033] In some specific embodiments, L1-D1 is:

[0034] L2-D2 is:

[0035] In some specific embodiments, L1-D1 is:

[0036] L2-D2 is:

[0037] In some specific embodiments, L1-D1 is:

[0038] L2-D2 is:

[0039] In some specific embodiments, L1-D1 is:

[0040] L2-D2 is:

[0041] In some specific embodiments, L1-D1 is:

[0042] L2-D2 is:

[0043] In some specific embodiments, L1-D1 is:

[0044] L2-D2 is:

[0045] In some specific embodiments, L1-D1 is:

[0046] L2-D2 is:

[0047] In some specific embodiments, L1-D1 is:

[0048] L2-D2 is:

[0049] In some embodiments, L2 is linked to the antibody via an oligosaccharide, which is located in the antibody's Fc fragment, specifically linked to an asparagine residue in the Fc fragment. In some embodiments, glycoforms that can be coupled include G0-GN, G0F-GN, G0, G0F, G1, G1F, etc. In some preferred embodiments, the oligosaccharide glycoform is G0, G0F, and / or G1F. In some embodiments, the oligosaccharide on the antibody is modified by azidation. In some preferred embodiments, the azidation modification comprises: contacting the antibody with UDP-GalNAz and GalT1 for reaction. In other embodiments, the azidation-modified antibody is linked to DBCO on L2 via a coupling reaction. In other preferred embodiments, the coupling reaction comprises: coupling the azidation-modified antibody to DBCO on L2 via a click chemistry reaction to complete the coupling of L2 to the carbohydrate group of the antibody.

[0050] In some embodiments, the antibody or antigen-binding fragment binds to one or more of the following: carbonic anhydrase IX, alpha-fetoprotein, alpha-actinin, A3, A33, ART 4, B7, B7H3, B7H4, BAGE, BrE3 antigen, CA125, CAMEL, CAP", CASP-8 / m, CCL19, CCL21, CD1, CD1a, CD2, CD3, CD4, CD5, CD8, CD11A, CD14, CD15, CD16, CD18, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD29, CD30, CD32b, CD33, CD37, CD38, CD40, CD40L, CD44, CD45, CD46, CD52, CD54, CD55, CD59 , CD64, CD66a-e, CD67, CD70, CD70L, CD74, CD79a, CD80, CD83, CD95, CD126, CD132, CD133, CD138, CD147, CD154, CDC27, CDK-4, CDKN2A, HIF-Ια, colon-specific antigen p (CSAp), CEA, CEACAM5, CEACAM6, oMet, DAM, EGFR, EGFRvIII, cMet, EGP-1 (Trop-2), EGP-2, ELF2-M, Ep-CAM, Her2, Her3, Claudin 18.2, ROR1, ROR2, dll3, marcl7, fibroblast growth factor (FGF), Flt-1, Flt-3, folate receptor, G250 antigen, GAGE, gpl00, GRO-β, HLA-DR.HML24, HMGB-1, HSP70-2M., IGF-1R, IGR1R, MAGE, MAGE-3, MART-1, MART-2, NY-ESO-1, TRAG3, mCRP, MCP-1, MIP-1A, MIP-1B, MIF, MUC1, MUC2, MUC3, MUC 4. MUC5ac, MUC13, MUC16, MUM-1 / 2, MUM-3, NCA66, NCA95, NCA90, pancreatic cancer mucin, PD-1 receptor, PD-L1 receptor, placental growth factor, PLAGL2, prostatic acid phosphatase, PSA, PRAME, PSMA, P1GF, ILGF, ILGF-1R, RS5, RANTES, T101, SAGE, S100, survivin, survivin-2B, TAG, TAG-72, tenascin, TRAIL receptor, Tn antigen, ED-B, WT-1, 17-1A antigen.In other specific embodiments, the antibody or antigen-binding fragment binds to one or more selected from the group consisting of Her2, Her3, B7H3, Claudin 18.2, DLL-3, EGP-1 (Trop-2).

[0051] In some embodiments, the antibody or antigen-binding fragment is selected from the group consisting of epratuzumab, veltuzumab, sacituzumab, patritumab, trastuzumab, pertuzumab, abciximab, alemtuzumab, cetuximab, gemtuzumab, ibritumomab, panitumumab, rituximab, tositumomab, abagovomab, atlizumab, benralizumab, obinutuzumab, basiliximab, da In some embodiments, the antibody or antigen-binding fragment is selected from the group consisting of sacituzumab, daratumumab, zolbetuximab, omburtamab, patritumab, and rovalvpituzumab.

[0052] In some embodiments, the antibody or antigen-binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three complementarity determining regions (HCDRs) 1-3, comprising the amino acid sequences of SEQ ID NOs: 1-3, respectively; and the light chain variable region comprises three complementarity determining regions (LCDRs) 1-3, comprising the amino acid sequences of SEQ ID NOs: 4-6, respectively. Preferably, the heavy chain variable region of the antibody or antigen-binding fragment thereof comprises the amino acid sequence of SEQ ID NO: 7, and the light chain variable region comprises the amino acid sequence of SEQ ID NO: 8. In other embodiments, the heavy chain of the antibody or antigen-binding fragment thereof comprises the amino acid sequence of SEQ ID NO: 9, and the light chain comprises the amino acid sequence of SEQ ID NO: 10.

[0053] In some embodiments, the antibody or antigen-binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three complementarity determining regions (HCDRs) 1-3, each comprising the amino acid sequences of SEQ ID NOs: 11-13, respectively; and the light chain variable region comprises three complementarity determining regions (LCDRs) 1-3, each comprising the amino acid sequences of SEQ ID NOs: 14-16, respectively. In other embodiments, the heavy chain variable region of the antibody or antigen-binding fragment thereof comprises the amino acid sequence of SEQ ID NO: 17, and the light chain variable region comprises the amino acid sequence of SEQ ID NO: 18. More preferably, the heavy chain of the antibody or antigen-binding fragment thereof comprises the amino acid sequence of SEQ ID NO: 19, and the light chain comprises the amino acid sequence of SEQ ID NO: 20.

[0054] The third aspect of the present disclosure provides a pharmaceutical composition comprising the antibody drug conjugate described herein. In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier, excipient, or diluent.

[0055] A fourth aspect of the present disclosure provides use of the antibody-drug conjugate described herein in the preparation of a medicament for treating and / or preventing tumors.

[0056] In some embodiments, the tumor is selected from the group consisting of tumors associated with expression of one or more of the following molecules: Trop-2, Her2, Her3, B7H3, Claudin 18.2, CD30, CD38, CD33, CD70, and EGFR. In other embodiments, the tumor comprises a solid tumor or a hematological tumor. In some embodiments, the tumor is selected from the group consisting of lung cancer, kidney cancer, urethral cancer, colorectal cancer, prostate cancer, glioblastoma multiforme, ovarian cancer, pancreatic cancer, breast cancer, melanoma, liver cancer, bladder cancer, gastric cancer, leukemia, malignant lymphoma, cervical cancer, squamous cell carcinoma, penile cancer, esophageal cancer, and salivary gland cancer.

[0057] A fifth aspect of the present disclosure provides the antibody drug conjugate described herein for use in treating tumor diseases.

[0058] In some embodiments, triptolide and camptothecin act together as toxins in the antibody-drug conjugate.

[0059] In some embodiments, the tumor is selected from the group consisting of tumors associated with expression of one or more of the following molecules: Trop-2, Her2, Her3, B7H3, Claudin 18.2, CD30, CD38, CD33, CD70, and EGFR. In other embodiments, the tumor comprises a solid tumor or a hematological tumor. In some embodiments, the tumor is selected from the group consisting of lung cancer, kidney cancer, urethral cancer, colorectal cancer, prostate cancer, glioblastoma multiforme, ovarian cancer, pancreatic cancer, breast cancer, melanoma, liver cancer, bladder cancer, gastric cancer, leukemia, malignant lymphoma, cervical cancer, squamous cell carcinoma, penile cancer, esophageal cancer, and salivary gland cancer.

[0060] A sixth aspect of the present disclosure provides a method for treating and / or preventing tumors, comprising administering a therapeutically effective amount of the antibody drug conjugate described herein to an individual in need thereof.

[0061] In some embodiments, triptolide and camptothecin act together as toxins in the antibody-drug conjugate.

[0062] In some embodiments, the tumor is selected from the group consisting of tumors associated with expression of one or more of the following molecules: Trop-2, Her2, Her3, B7H3, Claudin 18.2, CD30, CD38, CD33, CD70, and EGFR. In other embodiments, the tumor comprises a solid tumor or a hematological tumor. In some embodiments, the tumor is selected from the group consisting of lung cancer, kidney cancer, urethral cancer, colorectal cancer, prostate cancer, glioblastoma multiforme, ovarian cancer, pancreatic cancer, breast cancer, melanoma, liver cancer, bladder cancer, gastric cancer, leukemia, malignant lymphoma, cervical cancer, squamous cell carcinoma, penile cancer, esophageal cancer, and salivary gland cancer.

[0063] A seventh aspect of the present disclosure provides use of the antibody drug conjugate described herein in treating and / or preventing tumors.

[0064] In some embodiments, the tumor is selected from the group consisting of tumors associated with expression of one or more of the following molecules: Trop-2, Her2, Her3, B7H3, Claudin 18.2, CD30, CD38, CD33, CD70, and EGFR. In other embodiments, the tumor comprises a solid tumor or a hematological tumor. In some embodiments, the tumor is selected from the group consisting of lung cancer, kidney cancer, urethral cancer, colorectal cancer, prostate cancer, glioblastoma multiforme, ovarian cancer, pancreatic cancer, breast cancer, melanoma, liver cancer, bladder cancer, gastric cancer, leukemia, malignant lymphoma, cervical cancer, squamous cell carcinoma, penile cancer, esophageal cancer, and salivary gland cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0065] FIG1 shows a schematic diagram of the structure of an ADC containing dual toxins.

[0066] FIG2A shows the expression of HSP70 in HCT-15 (human colorectal cancer) cells used in Example 12. FIG.

[0067] FIG2B shows the expression of the efflux valve gene ABAC1 in HCT-15 (human colorectal cancer) cells used in Example 12. FIG.

[0068] FIG3A shows the changes in mouse tumor volume in the human colorectal cancer mouse model (COLO205 cells) used in Example 13.

[0069] FIG3B shows the changes in mouse tumor weight in the human colorectal cancer mouse model (COLO205 cells) used in Example 13.

[0070] FIG4 shows the changes in mouse tumor volume in the human pancreatic cancer mouse model (Bxpc-3 cells) used in Example 14.

[0071] FIG5 shows the changes in mouse tumor volume in the drug-resistant mouse model of human colorectal cancer (HCT-15-TROP2 cells) used in Example 15.

[0072] FIG6A shows the effect of the small molecule toxin used in Example 16 on the confluence of MX-1 cells (human breast cancer cells).

[0073] FIG6B shows the effect of the small molecule toxin used in Example 16 on the confluence of WiDr cells (human colorectal cancer cells).

[0074] FIG6C shows the effect of the small molecule toxin used in Example 16 on the confluence of HeLa cells (human cervical cancer cells).

[0075] FIG6D shows the effect of the small molecule toxin used in Example 16 on the confluence of MFE-280 cells (human endometrial cancer cells).

[0076] FIG7A shows the effect of the small molecule toxin used in Example 16 on the survival rate of HuH-7 cells (human hepatoma cells).

[0077] FIG7B shows the effect of the small molecule toxin used in Example 16 on the survival rate of NUGC-4 cells (human gastric cancer cells).

[0078] FIG7C shows the effect of the small molecule toxin used in Example 16 on the survival rate of Calu-6 cells (human anaplastic cancer cells).

[0079] FIG8A shows the changes in tumor volume of mice in the human colorectal cancer drug-resistant model (HCT-15-TROP2 cells) used in Example 17.

[0080] FIG8B shows the changes in tumor weight of mice in the human colorectal cancer drug-resistant model (HCT-15-TROP2 cells) used in Example 17.

[0081] FIG9A shows the changes in mouse tumor volume in the human lung cancer model (NCI-H2170 cells) used in Example 18.

[0082] FIG9B shows the changes in mouse tumor weight in the human lung cancer model (NCI-H2170 cells) used in Example 18.

[0083] FIG10 shows the changes in mouse tumor volume in the human NCI-H292 CDX model used in Example 22.

[0084] FIG11 shows the changes in tumor volume of mice in the subcutaneous tumor-bearing model of human gastric cancer (NUGC-4 cells) used in Example 27.

[0085] FIG12A shows the changes in tumor volume in mice in the subcutaneous tumor-bearing model of human colon cancer (COLO205 cells) used in Example 28. FIG.

[0086] FIG12B shows the changes in tumor volume of mice in the subcutaneous tumor-bearing model of human colon cancer (COLO205 cells) used in Example 28.

[0087] FIG13A shows the changes in tumor volume in mice in the subcutaneous tumor-bearing model of human lung squamous cell carcinoma (NCI-H2170 cells) used in Example 29. FIG.

[0088] FIG13B shows the changes in tumor volume of mice in the subcutaneous tumor-bearing model of human colon cancer (NCI-H2170 cells) used in Example 29. DETAILED DESCRIPTION

[0089] In the following description, certain specific details are included to provide a thorough understanding of each disclosed embodiment. However, one skilled in the relevant art will recognize that the embodiments can be implemented without one or more of these specific details and with other methods, components, materials, etc.

[0090] Unless otherwise required in this disclosure, throughout the specification and claims, the words "include" and "comprising" should be interpreted in an open, inclusive sense, ie, "including, but not limited to."

[0091] Reference throughout this specification to "one embodiment" or "another embodiment" or "an embodiment" or "certain embodiments" means that the particular referenced elements, structures, or features described in connection with that embodiment are included in at least one embodiment. Thus, appearances of the phrases "one embodiment" or "an embodiment" or "another embodiment" in various places throughout this specification are not necessarily all referring to the same embodiment. Furthermore, the particular elements, structures, or features may be combined in any suitable manner in one or more embodiments.

[0092] It will be understood that the singular article “a,” “an,” and “the,” as used in the specification and claims of this disclosure, includes plural referents unless the context clearly dictates otherwise.

[0093] Definition of terms

[0094] Unless otherwise indicated, the following terms used in the specification and claims have the following meanings:

[0095] The abbreviations placed before certain chemical groups named in this disclosure represent the total number of carbon atoms present in the indicated chemical group. For example, C1-C 30 Alkyl describes an alkyl group as defined below having a total of 1 to 30 carbon atoms, and C3-C 30 Cycloalkyl describes a cycloalkyl group as defined below having a total of 3 to 30 carbon atoms. The total number of carbons in the shorthand notation does not include carbons that may be present in substituents of the group being described.

[0096] In this disclosure, the carbon number range preceding a substituent is intended to include all subranges within that range as well as individual values. For example, "C 1-30 ” is considered to contain “C 1-20 ”, “C 1-10 ”, “C 2-30 ”, “C 2-20 ”, “C 2-10 ”, “C 3-30 ”, “C 3-20 ”, “C 3-10 ” etc. For example, “C 6-30 ” is considered to contain “C 6-24 ”, “C 6-18 ”, “C 6-15 ”, “C 6-12 ” etc. In addition, “C 2-30 ” and “C 5-30 "Also gave corresponding explanations.

[0097] In this disclosure, the term "halogen" refers to fluorine, chlorine, bromine or iodine.

[0098] In this disclosure, the term "hydroxyl" refers to an -OH group.

[0099] In this disclosure, the term "amino" refers to a -NH2 group.

[0100] In this disclosure, the term "carboxyl" refers to a -COOH group.

[0101] In this disclosure, the term "cyano" refers to a -CN group.

[0102] In this disclosure, the term "nitro" refers to a -NO2 group.

[0103] In this disclosure, the term "hydrocarbyl" refers to an aliphatic hydrocarbon group. The hydrocarbyl portion can be a "saturated hydrocarbyl" group, i.e., an alkyl group, which does not contain any alkene or alkyne moieties. The hydrocarbyl portion can also be an "unsaturated hydrocarbyl" portion, i.e., an alkenyl group or an alkynyl group, which contains at least one alkene or alkyne moiety. "Alkyl" refers to a saturated hydrocarbon group consisting of a specified number of carbon atoms. "Alkenyl" refers to a straight or branched hydrocarbon chain group consisting of a specified number of carbon atoms and at least one carbon-carbon double bond, and connected to the rest of the molecule by a single bond, such as vinyl, prop-1-enyl, but-1-enyl, pent-1-enyl, pent-1,4-dienyl, etc. "Alkynyl" refers to a straight or branched hydrocarbon chain group consisting of a specified number of carbon atoms and at least one carbon-carbon triple bond, and connected to the rest of the molecule by a single bond. The hydrocarbyl portion, whether saturated or unsaturated, can be branched or straight-chain. In this disclosure, the term "hydrocarbylene", such as "alkylene", "alkenylene" and "alkynylene", refers to a divalent corresponding hydrocarbon group.

[0104] In the present disclosure, the term "alkyloxy" refers to the general formula -O-alkyl, wherein alkyl is as defined in the present disclosure. Illustrative examples of alkyloxy include, but are not limited to, methoxy, ethoxy, n-propoxy, 1-methylethoxy (isopropoxy), n-butoxy, isobutoxy, sec-butoxy, tert-butoxy, pentoxy, and tert-pentoxy.

[0105] In this disclosure, the term "aryl" refers to a carbocyclic ring (all carbon) or two or more fused rings (rings sharing two adjacent carbon atoms) with a completely delocalized pi electron system. Aryl groups include, but are not limited to, fluorenyl, phenyl, biphenyl, and naphthyl. In this disclosure, the term "arylene" refers to a divalent form of the above aryl groups.

[0106] In the present disclosure, the term "heteroaryl" refers to an aromatic ring group consisting of a specified number of carbon atoms (e.g., 3 to 30 carbon atoms) and 1 to 5 heteroatoms selected from nitrogen, oxygen, and sulfur. The heteroaryl group can be a monocyclic, bicyclic, tricyclic, or tetracyclic ring system, which can include fused or bridged ring systems. Illustrative examples of heteroaryl groups include, but are not limited to, azaquinolyl, acridinyl, benzimidazolyl, benzothiazolyl, benzindolyl, benzodioxolyl, benzofuranyl, benzoxazolyl, benzothiazolyl, benzothiadiazolyl, benzo[b][1,4]dioxepanyl, 1,4-benzodioxanyl, benzonaphthofuranyl, benzoxazolyl, benzodioxolyl, benzodioxinyl, benzopyranyl, benzopyrone, benzofuranyl, benzofuranone, benzothiophenyl, benzotriazolyl, benzo[4,6]imidazo[1,2-a]pyridinyl, carbazolyl, cinnolinyl, dibenzofuranyl, diphenyl The term "heteroaryl" refers to a divalent heteroaryl radical as defined above.

[0107] In the present disclosure, the term "alicyclic group" refers to a stable non-aromatic monocyclic hydrocarbon group consisting only of carbon and hydrogen atoms, which is saturated or unsaturated and connected to the rest of the molecule by a single bond, such as cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclodecyl, etc. The term "aliphatic heterocyclylene group" refers to a divalent aliphatic heterocyclyl group as described above.

[0108] In the present disclosure, "substituted" means substituted by one or more substituents selected from the group consisting of deuterium, halogen, amino group, cyano group, nitro group, C1-C 10 Alkyl groups, C1-C 10 Alkoxy groups, C1-C 10 Alkylamino group, C2-C 10 Alkenyl groups, C2-C 10 Alkynyl group, C3-C 10 Cycloalkyl groups, C6-C 20 Aryl groups and C2-C 20 Heteroaryl groups.

[0109] In this disclosure, the terms "subject" and "patient" are used interchangeably to refer to animals (e.g., humans), companion animals (e.g., dogs, cats, or horses), and livestock (e.g., cattle, pigs, and sheep). In certain embodiments, the subject is a mammal, including males and females. In certain embodiments, the subject is a human.

[0110] In this disclosure, the term "mammal" refers to animals including, for example, dogs, cats, cows, sheep, horses, and humans, etc. In certain embodiments, the mammal includes humans.

[0111] In this disclosure, the term "pharmaceutically acceptable" refers to carriers, vehicles, diluents, excipients and / or salts that must be compatible with the other ingredients of the formulation and not deleterious to the recipient thereof.

[0112] In this disclosure, the terms "optional" or "optionally" mean that the subsequently described event or circumstance can or cannot occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

[0113] In the present disclosure, the term "pharmaceutically acceptable excipient" includes but is not limited to any auxiliary substances in various forms that have been approved by the U.S. Food and Drug Administration and can be used for humans or animals without side effects on the composition of pharmaceutical compositions, such as carriers, glidants, sweeteners, diluents, preservatives, dyes / colorants, flavor enhancers, surfactants, wetting agents, dispersants, suspending agents, stabilizers, isotonic agents, solvents or emulsifiers, etc.

[0114] In this disclosure, the term "carrier" is defined as a compound that facilitates the introduction of a compound into cells or tissues. For example, dimethyl sulfoxide (DMSO) is commonly used as a carrier because it facilitates the introduction of certain organic compounds into cells or tissues of an organism.

[0115] In the present disclosure, the term "diluent" is defined as a substance used to dilute the main drug component in a pharmaceutical preparation. Its main function is to mix the trace main drug component with other ingredients evenly, thereby improving the uniformity of the drug content in the preparation, or improving the formability of the preparation to meet the needs of the preparation process.

[0116] In the present disclosure, the term "pharmaceutically acceptable salt" includes "acceptable acid addition salts" and "acceptable base addition salts".

[0117] In this disclosure, the term "acceptable acid addition salts" refers to those salts which retain the biological effectiveness and properties of the free bases and which are biologically or otherwise suitable and are formed using inorganic acids such as, but not limited to, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like, or organic acids such as, but not limited to, acetic acid, 2,2-dichloroacetic acid, adipic acid, alginic acid, ascorbic acid, aspartic acid, benzenesulfonic acid, benzenecarboxylic acid, 4-acetamidobenzenecarboxylic acid, camphoric acid, camphor-10-sulfonic acid, decanoic acid, hexanoic acid, octanoic acid, carbonic acid, cinnamic acid, citric acid, cyclohexanesulfamic acid, dodecylsulfuric acid, ethane-1,2-disulfonic acid, Ethanesulfonic acid, 2-hydroxyethanesulfonic acid, formic acid, fumaric acid, mucic acid, gentisic acid, glucoheptonic acid, gluconic acid, glucuronic acid, glutamic acid, glutaric acid, 2-oxo-glutaric acid, glycerophosphate, glycolic acid, hippuric acid, isobutyric acid, lactic acid, lactobionic acid, lauric acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, mucic acid, naphthalene-1,5-disulfonic acid, naphthalene-2-sulfonic acid, 1-hydroxy-2-naphthoic acid, nicotinic acid, oleic acid, orotic acid, oxalic acid, palmitic acid, pamoic acid, propionic acid, pyroglutamic acid, pyruvic acid, salicylic acid, 4-aminosalicylic acid, sebacic acid, stearic acid, succinic acid, tartaric acid, thiocyanic acid, p-toluenesulfonic acid, trifluoroacetic acid, undecylenic acid, etc.

[0118] In this disclosure, the term "acceptable base addition salts" refers to salts that retain the biological effectiveness and properties of the free acids, and the base addition salts are biologically or otherwise suitable. These salts are prepared by adding inorganic or organic bases to the free acids. Salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts, and the like. In certain embodiments, the inorganic salts are ammonium, sodium, potassium, calcium, and magnesium salts. Salts derived from organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines, and basic ion exchange resins, such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, diethanolamine, ethanolamine, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrazine, choline, betaine, benzylamine, phenylethylenediamine, ethylenediamine, glucosamine, methylglucamine, theobromine, triethanolamine, tromethamine, purines, piperazine, piperidine, N-ethylpiperidine, polyamine resins, and the like. In certain embodiments, the organic base is isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine.

[0119] In the present disclosure, the term "solvent or solvent mixture" refers to any and all solvents. In certain embodiments, the solvent or solvent mixture is an organic solvent and water, which includes but is not limited to methanol, ethanol, 2-propanol, n-butanol, isobutanol, acetone, methyl ethyl ketone, ethyl acetate, 1,4-dioxane, diethyl ether, methyl tert-butyl ether, tetrahydrofuran, acetonitrile, dichloromethane, chloroform, N,N-dimethylformamide, cyclohexane, cyclopentane, n-hexane, n-heptane, n-pentane, toluene, o-xylene, p-xylene, dimethyl sulfoxide (DMSO), pyridine, acetic acid, anisole, butyl acetate, isopropyl benzene, ethyl formate, formic acid, isobutyl acetate, isopropyl acetate, methyl acetate, 3-methyl-1-butanol, methyl isobutyl ketone, 2-methyl-1-propanol, 1-pentanol, propyl acetate, ethylene glycol and 1-methyl-2-pyrrolidone, as well as any and all mixtures of two or more such solvents. In certain embodiments, the solvent or solvent mixture is a single solvent and a binary mixture. In certain embodiments, the solvent or solvent mixture is a single solvent of water and an organic solvent and a binary mixture of water and an organic solvent.

[0120] As used herein, the term "pharmaceutical composition" refers to a formulation of a compound described herein and a medium generally accepted in the art for delivering the bioactive compound to mammals, such as humans. Such a medium includes any pharmaceutically acceptable carrier, diluent, or excipient.

[0121] In this disclosure, the terms "therapeutically effective amount" and "effective amount" are used interchangeably and refer to an amount of a compound or combination of compounds that ameliorates, reduces, or eliminates a particular disease or condition and symptoms of a particular disease or condition, or prevents or delays the onset of a particular disease or condition or symptoms of a particular disease or condition. The amount of a compound described in this disclosure that constitutes a "therapeutically effective amount" will vary depending on the compound, the disease state and its severity, and the age, weight, etc. of the mammal to be treated, but the amount of a compound described in this disclosure can be routinely determined by one skilled in the art based on their own knowledge and this disclosure.

[0122] As used in this disclosure, "treatment" encompasses treating a relevant disease or condition in a mammal, such as a human, suffering from the relevant disease or condition, and includes:

[0123] (i) preventing a disease or disease state from occurring in a mammal, particularly where the mammal is susceptible to said disease state but has not yet been diagnosed with such disease state;

[0124] (ii) inhibiting the disease or disease state, i.e., preventing its occurrence; or

[0125] (iii) ameliorating the disease or condition, even if the disease or condition regresses or does not progress.

[0126] As used in this disclosure, the terms "disease," "disorder," and "disease state" may be used interchangeably, or may be distinct in that a particular disease or disease state may have no known causative agent (and therefore cannot be explained etiologically) and therefore is not recognized as a disease, but rather is considered an undesirable disease state or disorder in which clinicians have identified a more or less specific constellation of symptoms.

[0127] In this disclosure, the term "physiologically acceptable" refers to a carrier or diluent that does not abrogate the biological activity and properties of the compound.

[0128] Exemplary embodiments

[0129] The present disclosure unexpectedly discovered that triptolide combined with camptothecin drugs has a synergistic effect, which can significantly enhance the killing effect on tumor cells and is expected to provide a new treatment strategy for tumor diseases.

[0130] Therefore, the present disclosure provides the use of triptolide combined with camptothecin drugs in the preparation of drugs for treating tumor diseases.

[0131] In some specific embodiments, the present disclosure discovered that triptolide and camptothecin drugs can be used together as toxins in antibody-drug conjugates to prepare drugs for treating tumor diseases.

[0132] In some specific embodiments, the camptothecin drug is exemplarily camptothecin (CPT), exatecan, exitecan, topotecan, SN38 or a derivative thereof. In some preferred embodiments, the camptothecin drug is exitecan.

[0133] In some specific embodiments, the molar ratio of triptolide to camptothecin is 0.1 to 10:1. In other preferred embodiments, the molar ratio of triptolide to camptothecin is 1:0.5 to 1:2. In other preferred embodiments, the molar ratio of triptolide to camptothecin is about 1:1.

[0134] In some more specific embodiments, the present disclosure provides an antibody drug conjugate comprising a dual toxin having the formula:

[0135] wherein Ab is an antibody or an antigen-binding fragment thereof;

[0136] D1 and D2 are toxins with anti-tumor activity, and D1 and D2 are selected from triptolide or camptothecin drugs, and D1 and D2 are different;

[0137] L1 and L2 are the linking units connecting the toxin and the antibody;

[0138] x, y are 0-8, x, y are integers or non-integers.

[0139] In some more specific embodiments, x and y can be 0, 1, 2, 3, 4, 5, 6, 7 or 8, and other values ​​between these values. In some more specific embodiments, the sum of x and y is greater than or equal to 4.

[0140] In some more specific embodiments, the present disclosure provides an antibody drug conjugate comprising a dual toxin having the formula:

[0141] Ab-〔L1-D1-L2-D2〕 x

[0142] wherein Ab is an antibody or an antigen-binding fragment thereof;

[0143] D1 and D2 are toxins with anti-tumor activity, and D1 and D2 are selected from triptolide or camptothecin drugs, and D1 and D2 are different;

[0144] L1 and L2 are the linking units connecting the toxin and the antibody;

[0145] x is 2-8, and x and y are integers or non-integers.

[0146] In some more specific embodiments, x, y can be 2, 3, 4, 5, 6, 7 or 8, and other values ​​between these values.

[0147] In some embodiments, the L1 is connected to the Ab via a sulfhydryl or amide group. In some preferred embodiments, the L1 is connected to the Fab fragment of the Ab. One of the most common methods for coupling antibodies to toxins is to utilize the lysine residues of the antibody, where the amino acid nucleophilic NH2 group reacts with the electrophilic N-hydroxysuccinimide (NHS) group on the payload. In addition, a disulfide re-bridging strategy can be used to reduce the four interchain disulfide bonds contained in the IgG antibody to produce eight sulfhydryl groups, which react with the linker of the maleimide. In addition, divinyl pyrimidine re-bridging technology, dibromopyridine dione bridging technology, bissulfone re-bridging coupling technology, engineered non-natural amino acid biocoupling, etc. can be used to couple toxins to antibodies.

[0148] In some embodiments, L2 is linked to the Ab via a glycosyl group. In some preferred embodiments, L2 is linked to the Fc fragment of the Ab. Since IgG is a glycoprotein, it contains N-glycans at asparagine residues in the CH2 domain of each heavy chain of the Fc fragment. This glycosylation can serve as an attachment point for a payload. In some embodiments, L2 is linked to the antibody via an oligosaccharide located in the antibody's Fc fragment, specifically at an asparagine residue in the Fc fragment. In some embodiments, glycoforms that can be conjugated include G0-GN, G0F-GN, G0, G0F, G1, G1F, etc. In some preferred embodiments, the oligosaccharide is a glycoform of G0, G0F, and / or G1F. In some preferred embodiments, the oligosaccharide on the antibody is modified by azidation. In some preferred embodiments, the azidation modification comprises contacting the antibody with UDP-GalNAz and GalT1. In other embodiments, the azidated antibody is linked to DBCO on L2 via a conjugation reaction. The L2 is linked to the asparagine (Asn residue) on the antibody via an oligosaccharide, and more preferably, the L2 is linked to the asparagine on the antibody via the GlcNac on the oligosaccharide. In some specific embodiments, the oligosaccharide is linked to the Fc fragment of the antibody. In some specific embodiments, the oligosaccharide is linked to the CH2 domain of the Fc fragment. In some more specific embodiments, the oligosaccharide is linked to the Asn of the Fc fragment. In other preferred embodiments, the coupling reaction comprises: reacting the azide-modified antibody with the DBCO on L2 through a click chemistry reaction to complete the glycosylation coupling of L2 to the antibody. For glycosylation coupling methods, please refer to the reference Chemoenzymatic Conjugation of Toxic Payloads to the Globally Conserved N Glycan of Native mAbs Provides Homogeneous and Highly Efficacious Antibody-Drug Conjugate, RV Geel et al., Bioconjug Chem. 2015 Nov 18; 26(11): 2233-42.

[0149] In some embodiments:

[0150] The L1 has [H1-L 1a -L 1b -L 1c -D1] x The structure shown;

[0151] The L2 has [H2-L 2a-L 2b -L 2c -D2] y The structure shown;

[0152] H1 and H2 are linker sites with the antibody or antigen-binding fragment thereof or groups capable of reacting with Ab;

[0153] L 1a It is the connection part H1 and L 1b The connection unit between them, L 2a It is the connection part H2 and L 2b The connection units between them;

[0154] L 1b Is connected to L 1a and L 1c The linker between 2b Is connected to L 2a and L 2c The linker between

[0155] L 1c It's L 1b and the spacer between D1, L 2c It's L 2b and a spacer between D2.

[0156] In some embodiments, H1 and H2 are selected from:

[0157] In some embodiments, the H1 is selected from:

[0158] Preferably, H1 is

[0159] In some embodiments, H2 is selected from the group consisting of:

[0160] In some embodiments, the L 1a or L 2a Contains -L d -C(O)-, where L d is selected from an optionally substituted alkylene group, an optionally substituted polyethylene glycol group, an optionally substituted alkenylene group, an optionally substituted alkynylene group, an optionally substituted aliphatic cycloalkylene group, an optionally substituted aliphatic heterocycloalkylene group, an optionally substituted arylene group, an optionally substituted heteroarylene group, or a combination thereof.

[0161] In some embodiments, the L d Selected from -(CH2)m-, -(PEG)n- or -(CH2) m -(PEG) n-(CH2) z -, wherein m, n, z are integers from 0 to 10, preferably, m, n, z are integers from 0 to 8. For example, m, n, z are 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or a range consisting of any two of these values.

[0162] In some embodiments, the L 1b or L 2b It is a cleavable linker or a non-cleavable linker. ADCs based on non-cleavable linkers must be internalized, and the antibody portion needs to be degraded by lysosomal proteases to release the active molecule. A representative non-cleavable linker is N-succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC). Cleavable linkers can be divided into enzyme-dependent and non-enzyme (chemical) dependent linkers. Typical chemically dependent linkers are linkers containing disulfide bonds, which are subjected to nucleophilic attack by thiols to release the active carrier. Enzyme linkers are the most promising linker type currently, which can be enzymatically hydrolyzed by tissue proteases, phosphatases, pyrophosphatases, β-glucuronidases, β-galactosidases, sulfatases, and the like.

[0163] In some embodiments, the L 1b or L 2b is a cleavable peptide chain consisting of 2-10 amino acids; preferably, the L2 or L5 is selected from Gly-Gly-Phe-Gly (abbreviated as GGFG), Val-Cit (abbreviated as VC), Val-Ala (abbreviated as VA), Val-Lys, Val-Arg, AcLys-Val-Cit, AcLys-Val-Ala, Phe-Cit, Phe-Ala, Phe-Lys, Phe-Arg, Glu-Val-Ala, Glu-Val-Cit, Ala-Lys, Leu-Cit, lle-Cit, Trp-Cit, Ala-Ala-Asn, Ala-Ala-Ala, Ala-Asn, Lys; preferably, the L 1b or L 2b Selected from Gly-Gly-Phe-Gly, Val-Cit, Val-Ala, Val-Lys, Phe-Cit, Phe-Ala, Phe-Lys, Ala-Ala-Asn.

[0164] In some embodiments, the L 1c or L 2c Selected from:

[0165] In some preferred embodiments, the L 1c Selected from

[0166] In some specific embodiments, the L1-D1 is:

[0167] in:

[0168] L 1a -(CH2) m1 -C(O)- or -(PEG) n1 -(CH2) z1 -C(O)-, wherein m1, n1, and z1 are integers from 2 to 8;

[0169] L 1b is Gly-Gly-Phe-Gly, Val-Cit or Val-Ala;

[0170] L 1c for

[0171] D1 is triptolide or camptothecin drugs.

[0172] In a more specific embodiment, m1, n1, z1 are 2, 3, 4, 5, 6, 7, 8, or a range consisting of any two of these values.

[0173] In some preferred embodiments, the L 1a -(CH2) m1 -C(O)-, wherein m1 is an integer from 2 to 6, preferably 5; or L 1a -(PEG) n1 -(CH2) z1 -C(O)-, wherein n1 and z1 are integers of 2-6, preferably n1 and z1 are 2.

[0174] In some specific embodiments, the L2-D2 is:

[0175] in:

[0176] L 2a -(PEG) n2 -(CH2) z2 -C(O)-, wherein n2 and z2 are integers from 2 to 8;

[0177] L 2b is Gly-Gly-Phe-Gly, Val-Cit or Val-Ala;

[0178] L 2c for

[0179] D2 is triptolide or camptothecin drugs.

[0180] In a more specific embodiment, n2, z2 is 2, 3, 4, 5, 6, 7, 8, or a range consisting of any two of these values.

[0181] In some preferred embodiments, the L 2a -(PEG) n2 -(CH2) z2 -C(O)-, wherein n2 and z2 are integers of 2-6; or L 1a -(PEG) n1 -(CH2) z1 -C(O)-, wherein n1 and z1 are integers of 2-6, preferably n2 is an integer of 4-6, and z2 is 2.

[0182] In some embodiments, D1 is triptolide, and D2 is a camptothecin drug.

[0183] In some preferred embodiments, D1 is a camptothecin drug, and D2 is triptolide.

[0184] In some embodiments, the camptothecin drug is camptothecin (CPT), exotecan, topotecan, SN38 or a derivative thereof; preferably, the camptothecin drug is exotecan.

[0185] Exemplarily, camptothecin drugs or derivatives have the following structure:

[0186] In some preferred embodiments, the camptothecin drug is exitecan.

[0187] In some embodiments, x is selected from 2-8, preferably 3-5; y is selected from 3-4.

[0188] In some embodiments, D1 is

[0189] In some embodiments, D2 is

[0190] In some embodiments, D1 is

[0191] In some embodiments, D2 is

[0192] In some embodiments, the L1-D1 structure is selected from:

[0193] In some embodiments, the L2-D2 structure is selected from:

[0194] In some specific embodiments, the L1-D1 structure is:

[0195] The L2-D2 structure is:

[0196] In other specific embodiments, the L1-D1 structure is:

[0197] The L2-D2 structure is:

[0198] In other specific embodiments, the L1-D1 structure is:

[0199] The L2-D2 structure is:

[0200] In other specific embodiments, the L1-D1 structure is:

[0201] The L2-D2 structure is:

[0202] In some embodiments, L2 is linked to the antibody via an oligosaccharide, which is located in the antibody's Fc fragment, specifically linked to an asparagine residue in the Fc fragment. In some embodiments, glycoforms that can be coupled include G0-GN, G0F-GN, G0, G0F, G1, G1F, etc. In some preferred embodiments, the oligosaccharide glycoform is G0, G0F, and / or G1F. In some embodiments, the oligosaccharide on the antibody is modified by azidation. In some preferred embodiments, the azidation modification comprises: contacting the antibody with UDP-GalNAz and GalT1 for reaction. In other embodiments, the azidation-modified antibody is linked to DBCO on L2 via a coupling reaction. In other preferred embodiments, the coupling reaction comprises: coupling the azidation-modified antibody to DBCO on L2 via a click chemistry reaction to complete the coupling of L2 to the carbohydrate group of the antibody.

[0203] In some embodiments, the antibody or antigen-binding fragment binds to one or more of the following: carbonic anhydrase IX, alpha-fetoprotein, alpha-actinin, A3, A33, ART 4, B7, B7H3, B7H4, BAGE, BrE3 antigen, CA125, CAMEL, CAP", CASP-8 / m, CCL19, CCL21, CD1, CD1a, CD2, CD3, CD4, CD5, CD8, CD11A, CD14, CD15, CD16, CD18, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD29, CD30, CD32b, CD33, CD37, CD38, CD40, CD40L, CD44, CD45, CD46, CD52, CD54, CD55, CD59 , CD64, CD66a-e, CD67, CD70, CD70L, CD74, CD79a, CD80, CD83, CD95, CD126, CD132, CD133, CD138, CD147, CD154, CDC27, CDK-4, CDKN2A, HIF-Ια, colon-specific antigen p (CSAp), CEA, CEACAM5, CEACAM6, oMet, DAM, EGFR, EGFRvIII, cMet, EGP-1 (Trop-2), EGP-2.ELF2-M, Ep-CAM, Her2, Her3, Claudin 18.2, ROR1, ROR2, dll3, marcl7, fibroblast growth factor (FGF), Flt-1, Flt-3, folate receptor, G250 antigen, GAGE, gpl00, GRO-β, HLA-DR.HML24, HMGB-1, HSP70-2M., IGF-1R, IGR1R, MAGE, MAGE-3, MART-1.MART-2.NY-ESO-1, TRAG3, mCRP, MCP-1, MIP-1A, MIP-1B, MIF, MUC1, MUC2, MUC3, MUC 4. MUC5ac, MUC13, MUC16, MUM-1 / 2, MUM-3, NCA66, NCA95, NCA90, pancreatic cancer mucin, PD-1 receptor, PD-L1 receptor, placental growth factor, PLAGL2, prostatic acid phosphatase, PSA, PRAME, PSMA, P1GF, ILGF, ILGF-1R, RS5, RANTES, T101, SAGE, S100, survivin, survivin-2B, TAG, TAG-72, tenascin, TRAIL receptor, Tn antigen, ED-B, WT-1, 17-1A antigen.In a preferred embodiment, the antibody or antigen-binding fragment binds to one or more selected from Her2, Her3, B7H3, Claudin 18.2, DLL-3 or EGP-1 (Trop-2).

[0204] In some specific embodiments, the antibody or antigen-binding fragment is selected from epratuzumab, veltuzumab, sacituzumab, patritumab, trastuzumab, pertuzumab, abciximab, alemtuzumab, cetuximab, gemtuzumab, ibritumomab, panitumumab, rituximab, tositumomab, abagovomab, atlizumab, benralizumab, obinutuzumab, basiliximab, d adizumab, efalizumab, muromomab, natlizumab, omalizumab, gaiitenemmab, solanezumab, tisotumab, brentuximab, inotuzumab, moxetumomab, polatuzumab, enfortumab, belantamab, cetuximab, loncastuximab, daratumumab, nimotuzumab, zolbetuximab, omburtamab, rovalpituzumab.

[0205] In some preferred embodiments, the antibody or antigen-binding fragment is selected from sacituzumab, daratumumab, zolbetuximab, omburtamab, patritumab, and rvalpituzumab.

[0206] In some embodiments, the antibody or antigen-binding fragment is selected from the sacituzumab antibody or its antigen-binding fragment, and the sacituzumab antibody or antigen-binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region includes three complementarity determining regions HCDR1-3, which respectively comprise the amino acid sequences described in SEQ ID NOs: 1-3; wherein the light chain variable region includes three complementarity determining regions LCDR1-3, which respectively comprise the amino acid sequences described in SEQ ID NOs: 4-6.

[0207] In some specific embodiments, the amino acid sequences of HCDR1-3 of the antibody or antigen-binding fragment are shown in SEQ ID NOs: 1-3, respectively. In other specific embodiments, the amino acid sequences of LCDR1-3 of the antibody or antigen-binding fragment are shown in SEQ ID NOs: 4-6, respectively.

[0208] In some more specific embodiments, the heavy chain variable region of the sacituzumab antibody or antigen-binding fragment thereof comprises the amino acid sequence of SEQ ID NO: 7, and the light chain variable region comprises the amino acid sequence of SEQ ID NO: 8. For example, in some embodiments, the amino acid sequence of the heavy chain variable region of the antibody or antigen-binding fragment is as shown in SEQ ID NO: 7. In other embodiments, the amino acid sequence of the light chain variable region of the antibody or antigen-binding fragment is as shown in SEQ ID NO: 8.

[0209] In some more specific embodiments, the heavy chain of the sacituzumab antibody or antigen-binding fragment thereof comprises the amino acid sequence of SEQ ID NO: 9, and the light chain comprises the amino acid sequence of SEQ ID NO: 10. For example, in some embodiments, the amino acid sequence of the heavy chain of the antibody or antigen-binding fragment thereof is as shown in SEQ ID NO: 9. In other embodiments, the amino acid sequence of the light chain of the antibody or antigen-binding fragment thereof is as shown in SEQ ID NO: 10.

[0210] In some embodiments, the antibody or antigen-binding fragment is selected from Patritumab antibody or its antigen-binding fragment, and the Patritumab antibody or antigen-binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region includes three complementarity determining regions HCDR1-3, which respectively comprise the amino acid sequences described in SEQ ID NOs: 11-13; wherein the light chain variable region includes three complementarity determining regions LCDR1-3, which respectively comprise the amino acid sequences described in SEQ ID NOs: 14-16.

[0211] In some specific embodiments, the amino acid sequences of HCDR1-3 of the antibody or antigen-binding fragment are shown in SEQ ID NOs: 11-13, respectively. In other specific embodiments, the amino acid sequences of LCDR1-3 of the antibody or antigen-binding fragment are shown in SEQ ID NOs: 14-16, respectively.

[0212] In some more specific embodiments, the heavy chain variable region of the Patritumab antibody or antigen-binding fragment thereof comprises the amino acid sequence of SEQ ID NO: 17, and the light chain variable region comprises the amino acid sequence of SEQ ID NO: 18. For example, in some embodiments, the amino acid sequence of the heavy chain variable region of the antibody or antigen-binding fragment is as shown in SEQ ID NO: 17. In other embodiments, the amino acid sequence of the light chain variable region of the antibody or antigen-binding fragment is as shown in SEQ ID NO: 18.

[0213] In some more specific embodiments, the heavy chain of the Patritumab antibody or antigen-binding fragment thereof comprises the amino acid sequence of SEQ ID NO: 19, and the light chain comprises the amino acid sequence of SEQ ID NO: 20. For example, in some embodiments, the amino acid sequence of the heavy chain of the antibody or antigen-binding fragment thereof is as shown in SEQ ID NO: 19. In other embodiments, the amino acid sequence of the light chain of the antibody or antigen-binding fragment thereof is as shown in SEQ ID NO: 20.

[0214] In some embodiments, the preparation method of the dual toxin antibody drug conjugate of the present disclosure comprises: firstly performing an azidation reaction on the antibody, so that the toxin D2 (or as described above [H2-L 2a -L 2b -L 2c -D2] y Structural unit) is sugar-coupled with the antibody; then the toxin D1 (or as mentioned above [H1-L 1a -L 1b -L 1c -D1] x The antibody-drug conjugate containing two toxins is prepared by coupling the toxin 1 to the antibody via the sulfhydryl group of the linker unit. The schematic structure of the conjugate is shown in Figure 1. In Figure 1, toxin 1 is coupled to the antibody via the sulfhydryl group of the linker unit. The four interchain disulfide bonds contained in the antibody are reduced to produce eight sulfhydryl groups. Therefore, 2-8 toxins 1 can be loaded through the linker unit. Toxin 2 is coupled to the antibody via the sugar group of the linker unit, and 2-4 toxins 2 can be loaded through the linker unit.

[0215] Another aspect of the present disclosure is to provide a pharmaceutical composition comprising the antibody-drug conjugate of the present disclosure and a pharmaceutically acceptable carrier, excipient or diluent.

[0216] Another aspect of the present disclosure is to provide a use of the antibody-drug conjugate described in the present disclosure in the preparation of a drug for treating and / or preventing tumors.

[0217] In some preferred embodiments, the tumor is selected from tumors associated with expression of one or more of the following molecules: Trop-2, Her2, Her3, B7H3, Claudin 18.2, CD30, CD38, CD33, CD70, and EGFR.

[0218] In some specific embodiments, the tumor comprises a solid tumor or a hematological tumor.

[0219] In some more specific embodiments, the tumor is selected from the group consisting of lung cancer, kidney cancer, urethral cancer, colorectal cancer, prostate cancer, glioblastoma multiforme, ovarian cancer, pancreatic cancer, breast cancer, melanoma, liver cancer, bladder cancer, gastric cancer, leukemia, malignant lymphoma, cervical cancer, squamous cell carcinoma, penile cancer, esophageal cancer, and salivary gland cancer.

[0220] Example

[0221] The present disclosure is further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present disclosure and are not used to limit the scope of the present disclosure, and the following examples do not represent that the following experiments are all experiments or the only experiments in the present disclosure.

[0222] The exemplary antibody used in the present disclosure is Sacituzumab (also known as Certolizumab / Gosatuzumab / hRS7), which is described in detail in WO2014057687A. Specifically, the heavy chain variable region of the Sacituzumab antibody includes three complementary determining regions (HCDR1-3), each comprising the amino acid sequence of SEQ ID NOs: 1-3; the light chain variable region includes three complementary determining regions (LCDR1-3), each comprising the amino acid sequence of SEQ ID NOs: 4-6. More specifically, the heavy chain variable region of the Sacituzumab antibody comprises the amino acid sequence of SEQ ID NO: 7, and the light chain variable region comprises the amino acid sequence of SEQ ID NO: 8; more specifically, the heavy chain of the Sacituzumab antibody comprises the amino acid sequence of SEQ ID NO: 9, and the light chain comprises the amino acid sequence of SEQ ID NO: 10. The construction of the antibody can be carried out by conventional biological methods in the art or purchased commercially.

[0223] Another exemplary antibody used in the present disclosure is Patritumab (also known as Patritumab), which is described in detail in WO2007077028A2. Specifically, the heavy chain variable region of the Patritumab antibody includes three complementary determining regions (HCDR1-3), each comprising the amino acid sequence of SEQ ID NOs: 11-13; the light chain variable region includes three complementary determining regions (LCDR1-3), each comprising the amino acid sequence of SEQ ID NOs: 14-16. More specifically, the heavy chain variable region of the Patritumab antibody includes the amino acid sequence of SEQ ID NO: 17, and the light chain variable region includes the amino acid sequence of SEQ ID NO: 18; more specifically, the heavy chain of the Patritumab antibody includes the amino acid sequence of SEQ ID NO: 19, and the light chain includes the amino acid sequence of SEQ ID NO: 20. Antibodies can be constructed by conventional biological methods in the art or purchased commercially.

[0224] The reference drug (positive control drug) Dato-Dxd (datopotamab deruxtecan, DS-1062a) is an antibody-drug conjugate targeting a Trop-2 antibody (datopotamab) and a topoisomerase inhibitor (Dxd) developed based on Daiichi Sankyo Co., Ltd.'s Dxd-ADC platform. Its structure and preparation method are described in detail in WO2014057687A and can be prepared or commercially purchased using this patented method.

[0225] The reference drug (positive control drug) Trodelvy is an antibody-drug conjugate developed by Gilead Sciences targeting trop-2 antibody (Sacituzumab) and SN38. The reference drug analogue was obtained commercially.

[0226] Other raw materials disclosed herein are commercially available or prepared by methods known in the art. For example, the toxin used in the present disclosure is triptolide, purchased from the China Food and Drug Administration, CAT#111567-201404, ID: DP03-BYVB, M.wt: 360.4. Exatecan disclosed herein is commercially available, CAS No.: 171335-80-1. Exatecan mesylate is commercially available, CAS No.: 169869-90-3.

[0227] Compound 7 (147270-MC-VA-PAB-Exatecan) is commercially available with a CAS number of 2680543-57-9 and the following structure:

[0228] Compound 8 (HY-13631E) is commercially available with a CAS number of 1599440-13-7 and the following structure:

[0229] Example 1 Preparation of Compound 1 (DBCO-PEG6-VA-PAB-Exatecan)

[0230] Compound 1-a (150 mg, 0.37 mmol) and compound 1-b (132 mg, 0.37 mmol) were dissolved in 1.5 mL of DMF. TEA (75 mg, 0.74 mmol) was slowly added dropwise and allowed to react at room temperature for 2 h. Post-treatment: The reaction solution was directly purified using a reverse-phase column (HO:ACN = 60%:40%). After lyophilization, 300 mg of a yellow oil (compound 1-c) was obtained, yielding 94%.

[0231] Compound 1-c (135 mg, 0.21 mmol) and HATU (96 mg, 0.25 mmol) were dissolved in 4 mL of DMF. DIEA (40 mg, 0.31 mol) was added and stirred at room temperature for 15 minutes. Compound 1-d (162 mg, 0.21 mmol) was then added and stirred at room temperature for 1 hour. Post-processing: The reaction solution was directly subjected to reverse-phase HPLC and lyophilized to afford 130 mg of an off-white solid (yield: 43%).

[0232] NMR: 1H NMR (400MHz, DMSO) δ9.92(s,1H),8.17(d,J=6.7Hz,1H),8.06(d,J=7.9Hz,1H),7.87(d,J=8.6Hz,1H),7.79–7.72(m,2H),7.67(d,J=6.7Hz,1 H),7.60(d,J=8.5Hz,3H),7.47(dd,J=15.6,7.0Hz,3H),7.36(d,J=7.8Hz,3H),7.33–7.26(m,3H),6.51(s,1H),5.44(s,2H),5.28(s,3H),5.0 9–4.99(m,3H),4.38(t,J=7.1Hz,1H),4.23–4.17(m,1H),3.61–3.55(m,3H),3.49–3.43(m,22H),3.28(d,J=5.8Hz,2H),3.10–3.04(m,2H),2 .61–2.54(m,1H),2.44(d,J=6.7Hz,1H),2.37(s,3H),2.27–1.70(m,9H),1.30(d,J=7.1Hz,3H),0.88(t,J=6.2Hz,6H),0.83(d,J=6.7Hz,3H).

[0233] Example 2 Preparation of Compound 2 (MC-PEG2-GGFG-Triptolide)

[0234] Compound 2-a (10 g, 38.9 mmol) and HOSU (5.37 g, 46.7 mmol) were dissolved in 100 mL of DCM. EDCI (11.2 g, 58.5 mmol) was added and stirred at room temperature for 1 h. LCMS monitoring confirmed no residual starting material. The reaction mixture was concentrated and purified by column chromatography (DCM:EA = 10:1) to afford 12 g of a light yellow oil (compound 2-b), with a yield of 87%.

[0235] Compound 2-b (8 g, 22.6 mmol) and compound 2-c (9.56 g, 22.6 mmol) were placed in a three-necked flask and dissolved in 90 mL of water:acetonitrile = 2:1. Under nitrogen protection, DIEA (2.33 g, 18 mmol) was added at 0-10°C. After addition, the mixture was warmed to room temperature and reacted for 16 hours. LCMS monitored the reaction completion. The reaction solution was extracted once with EA. The aqueous phase was adjusted to pH 2 with 0.5 mol / L HCl and extracted four times with DCM:IPA = 4:1. The organic phases were combined, dried over anhydrous sodium sulfate, concentrated, and slurried with EA to obtain 10.5 g of a white solid (yield: 70%).

[0236] Compound 2-d (1.62 g, 2.44 mmol) and triptolide (800 mg, 2.22 mmol) were placed in a three-necked flask and dissolved in 20 mL of Py (pyridine). Under nitrogen, POCl₃ (3.4 g, 22.2 mmol) was added at -10-5°C and maintained at this temperature for 5 min. LCMS monitored the reaction completion. The reaction solution was then added dropwise to 400 mL of icy 1 mol / L HCl and extracted with 200 x 3 (DCM:IPA = 4:1). The organic phases were combined, dried over anhydrous sodium sulfate, and concentrated for preparation. The preparation solution was lyophilized to yield 1.1 g of a yellow solid, with a yield of 44%.

[0237] NMR: 1 H NMR (400MHz, DMSO) δ8.61(t,J=6.7Hz,1H),8.30(t,J=5.7Hz,1H),8.18-8.05(m,2H),7.99(t,J=5.7Hz,1H),7.29–7.22(m,4H),7.22-7.15(m,1H) ,7.01(s,2H),5.03(s,1H),4.90-4.73(m,2H),4.70-4.58(m,2H),4.54-4 .45(m,1H),4.17(s,2H),3.95(d,J=3.0Hz,1H),3.80–3.66(m,6H),3.63- 3.48(m,8H),3.47-3.43(m,2H),3.43–3.39(m,2H),3.06(dd,J=13.8,4. 4Hz,1H),2.80(dd,J=13.9,9.9Hz,1H),2.68-2.58(m,1H),2.36(t,J=6.5 Hz,2H),2.28-2.18(m,1H),2.16-2.06(m,1H),2.00-1.90(m,1H),1.90–1 .75(m,2H),1.34–1.23(m,2H),0.92–0.84(m,6H),0.74(d,J=6.8Hz,3H).

[0238] Example 3 Preparation of Compound 3 (DBCO-PEG4-GGFG-Triptolide)

[0239] Compound 3-a (2 g, 3.62 mmol), NHS (624 mg, 5.42 mmol), and 2,6-lutidine were dissolved in 80 mL of dimethylacetamide. EDCI (1.04 g, 5.43 mmol) was added at room temperature and allowed to react overnight. Post-treatment: The reaction mixture was poured into water and extracted with EA. The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, and spin-dried to obtain 2.4 g of a yellow oil (compound 3-b).

[0240] Compound 3-b (2.0 g, 3.07 mmol) and compound 3-d (1.3 g, 3.07 mmol) were dissolved in 10 mL of DMF, and TEA (620 mg, 6.14 mol) was added. The mixture was stirred at room temperature for 1 h. Post-treatment: The reaction solution was directly purified using a reverse-phase column (HO:CAN = 60%:40%) and lyophilized to afford 1.2 g of a slightly yellow, hygroscopic solid (compound 3-d), with a two-step yield of 50%.

[0241] Compound 3-d (1.2 g, 1.23 mmol) and triptolide (446 mg, 1.23 mmol) were dissolved in 18 mL of pyridine. Under nitrogen, the temperature was cooled to -30°C, and POCl₃ (569 mg, 3.71 mmol) was slowly added dropwise. The temperature was maintained between -10 and -30°C for 0.5 h. Post-treatment: The reaction solution was cooled to -30°C and quickly loaded onto a reverse-phase column for purification using 50% H₂O:ACN. After lyophilization, 1.5 g of a white solid was obtained, which was then subjected to reverse-phase purification. The final yield was 1.1 g of a white solid, with a yield of 68%.

[0242] NMR: 1H NMR (400MHz, DMSO) δ8.61(t,J=6.8Hz,1H),8.30(t,J=5.8Hz,1H),8.18–8.08(m,2H),7.99(t,J =5.7Hz,1H),7.75(t,J=5.5Hz,1H),7.70–7.65(m,1H),7.62(d,J=7.0Hz,1H),7.52–7.42(m,3H ),7.40–7.28(m,3H),7.27–7.22(m,4H),7.18(td,J=5.9,2.5Hz,1H),5.03(t,J=7.0Hz,2H),4. 89–4.72(m,2H),4.69–4.58(m,2H),4.50(td,J=9.1,4.3Hz,1H),4.17(s,2H),3.95(d,J=3.1Hz ,1H),3.76(dt,J=17.3,5.7Hz,3H),3.71–3.67(m,3H),3.60(dd,J=12.7,6.2Hz,5H),3.48–3.4 3(m,12H),3.30(s,2H),3.13–3.02(m,3H),2.80(dd,J=13.8,9.7Hz,1H),2.58(dd,J=16.1,7.9 Hz,2H),2.38(t,J=6.5Hz,2H),2.23(ddd,J=15.4,10.2,5.5Hz,2H),2.16–2.06(m,1H),2.03–1 .92(m,2H),1.89–1.72(m,3H),1.29(d,J=5.2Hz,2H),0.91–0.85(m,6H),0.74(d,J=6.8Hz,3H).

[0243] Example 4 Preparation of Compound 4 (MC-GGFG-Triptolide)

[0244] Triptolide (36 mg, 0.1 mmol) and compound 4-a (62 mg, 0.1 mmol) were added to pyridine (1.5 mL dried) and stirred at -10 ° C under nitrogen protection. Then POCl3 (46 mg, 0.3 mmol) was added, and the mixture was stirred at -10 ° C under N2 atmosphere for 0.5 h. The mixture was purified by HPLC to obtain a white solid (20 mg, yield 21%).

[0245] NMR: 1H NMR (400MHz, DMSO) δ8.62(d,J=6.8Hz,1H),8.32(t,J=5.7Hz,1H),8.18–8.05(m,2H),8.01(t,J=5.6Hz,1H),7.35-7.15(m,5H),7.02(s,2H),5 .06(s,1H),4.92–4.77(m,2H),4.72–4.58(m,2H),4.52(td,J=9.2,4.6 Hz,1H),4.19(s,2H),3.97(d,J=3.2Hz,1H),3.83–3.53(m,8H),3.40(d, J=7.0Hz,2H),3.08(dd,J=13.8,4.5Hz,1H),2.82(dd,J=13.7,9.8Hz,1H),2.62(s,1H),2.31–2.20(m,1H),2.18–2.06(m,3H),1.88(ddd,J=33. 7,27.6,17.1Hz,3H),1.50(dq,J=14.6,7.3Hz,4H),1.39–1.28(m,2H),1.21(dt,J=15.1,7.6Hz,2H),0.94–0.85(m,6H),0.77(t,J=5.9Hz,3H).

[0246] Example 5 Preparation of Compound 5 (DBCO-PEG4-VA-PAB-Exatecan)

[0247] Compound 5-a (1.8 g, 2.64 mmol) and isoproterenol mesylate (1.54 g, 2.91 mmol) were dissolved in 18 mL of DMSO. DIEA (1 g, 7.92 mmol) was slowly added and allowed to react at room temperature for 4 h. The reaction was monitored for consumption of the starting material. TEA (1.8 mL) was then added and stirred at room temperature for 3 h. Post-treatment: The reaction solution was directly purified using a reverse-phase column (HO:ACN = 65%:35%). After lyophilization, 1.98 g of a yellow-green powder (compound 5-c) was obtained, yielding 99%.

[0248] Compound 5-c (409 mg, 0.21 mmol) and HATU (247 mg, 043 mmol) were dissolved in 3 mL of DMF. DIEA (105 mg, 0.54 mol) was added and stirred at room temperature for 15 minutes. Compound 5-d (300 mg, 0.36 mmol) was then added and stirred at room temperature for 2 hours. Post-processing: The reaction solution was directly subjected to reverse-phase HPLC and lyophilized to afford 120 mg of an off-white solid (yield: 17%).

[0249] NMR :1 H NMR (400MHz, DMSO) δ9.93(s,1H),8.17(d,J=6.9Hz,1H),8.06(d,J=8.4Hz,1H),7.87(d,J=8.6Hz,1H),7.76(t,J=9.9Hz,2H),7.66(d,J=6.3Hz,1H) ,7.60(d,J=8.4Hz,3H),7.50–7.43(m,3H),7.36(d,J=8.7Hz,3H),7.33–7 .26(m,3H),6.51(s,1H),5.44(s,2H),5.28(d,J=4.3Hz,3H),5.10–4.98(m ,3H),4.38(t,J=7.1Hz,1H),4.24–4.17(m,1H),3.61–3.55(m,3H),3.52– 3.39(m,14H),3.28(d,J=5.9Hz,2H),3.08(dd,J=10.0,5.3Hz,2H),2.58( dd,J=16.1,7.9Hz,1H),2.44(t,J=6.7Hz,1H),2.37(s,3H),2.27–1.71(m , 9H), 1.30 (d, J = 7.1Hz, 3H), 0.88 (t, J = 6.2Hz, 6H), 0.83 (d, J = 6.8Hz, 3H).

[0250] Example 6 Preparation of Compound 6 (MC-PEG2-VA-PAB-Exatecan)

[0251] Compound 6-a (480 mg, 0.64 mmol) was added to a 100 mL three-necked flask at room temperature. DMF (20 mL) was added to dissolve the mixture, followed by compound 6-b (237.2 mg, 0.67 mmol). The reaction mixture was cooled to 0°C, and DIEA (237.2 mg, 1.28 mmol) was slowly added dropwise. The reaction mixture was stirred at 0°C for 2 h. LC-MS indicated the reaction was complete. Acetic acid (0.5 mL) was added to the reaction solution, which was separated by reverse phase chromatography (TFA / MeCN) and lyophilized. Preparative separation and lyophilization yielded 127 mg of a yellow solid (Compound 6) in a 20% yield.

[0252] NMR: 1H NMR (400MHz, DMSO) δ9.95(s,1H),8.19(d,J=6.8Hz,1H),8.08(d,J=8.8Hz,1H),7.88(d,J=8.8Hz,1H),7.79(d,J=10 .8Hz,1H),7.62(d,J=8.4Hz,2H),7.39(d,J=8.4Hz,2H),7.33(s,1H),7.04(s,2H),5.47(s,2H),5.30(d,J=4.4Hz,3 H),5.10(s,2H),4.44-4.36(m,1H),4.25-4.19(m,1H),3.58(dd,J=11.2,5.6Hz,5H),3.52(d,J=5.2Hz,3H),3.36-3 .07(m,3H),2.49-2.36(m,5H),2.20(d,J=13.2Hz,2H),2.04-1.85(m,3H),1.32(d,J=7.2Hz,3H),0.92-0.84(m,9H).

[0253] Example 7 Preparation of Triptolide (Compound 2) / Ixitecan (Compound 1) Dual Toxin ADC (ADC-1)

[0254] The sample was added according to the following reaction system to make the final concentration of antibody (Sacituzumab) 10 mg / ml, the final concentration of MnCl2 10 mmol / L, the final concentration of Tris-HCl pH 7.5 10 mmol / L, the final concentration of UDP-GalNAz 5 mmol / L, and GalT1 added at a ratio of 5 mg GalT1 / 1 g mAb to 50 mg GalT1 / 1 g mAb. The antibody was azide-treated on a 30°C constant temperature shaker for ≥12 h. The UDP-GalNAz, GalT1, and MnCl2 introduced by the azide reaction were removed by chromatography. 2+and other substances. According to the following reaction system, compound 1 is added to make the final concentration of the azidated antibody 10 mg / ml, the final concentration of DMSO 10%, the molar ratio of compound 1 to antibody 5-15, and the reaction is shaken on a constant temperature shaker at 30°C for ≥12h to complete the sugar coupling of the antibody and the toxin. TCEP is directly added to the above reaction solution to reduce the antibody, the molar ratio of TCEP to antibody is 5, and the antibody is shaken on a constant temperature shaker at 30°C for 2h to reduce the antibody. Compound 2 is added to complete the thiol coupling, the molar ratio of compound 2 to antibody is 5, and the reaction is stirred at 2-8°C for 2h to complete the thiol coupling. TCEP, DMSO, compound 1, compound 2 and other substances introduced during the process are removed by concentration and liquid replacement, and the sample is replaced with 4.29g / L MES buffer at pH 6.5. Trehalose and polysorbate 80 (II) are added to make the final concentration of trehalose 8.56g / L and the final concentration of polysorbate 80 (II) 0.1g / L to complete the sample preparation. A 100 μg sample was added to 2 μl of 1 mol / L DTT, and ultrapure water was added to a final volume of 100 μl. The sample was reduced at room temperature for 30 minutes before direct LC-MS analysis. The average DAR values ​​of the samples were calculated after normalization based on the mass spectrometry signal intensity: 3.7 for triptolide and 3.6 for etiolate.

[0255] Example 8 Preparation of Ixitecan (Compound 7) / Triptolide (Compound 3) Dual Toxin ADC (ADC-2)

[0256] The sample was added according to the following reaction system to make the final concentration of antibody (Sacituzumab) 10 mg / ml, the final concentration of MnCl2 10 mmol / L, the final concentration of Tris-HCl pH 7.5 10 mmol / L, the final concentration of UDP-GalNAz 5 mmol / L, and GalT1 added at a ratio of 5 mg GalT1 / 1 g mAb to 50 mg GalT1 / 1 g mAb. The antibody was azide-treated on a 30°C constant temperature shaker for ≥12 h. The UDP-GalNAz, GalT1, and MnCl2 introduced by the azide reaction were removed by chromatography. 2+Compound 3 was added to the following reaction system to make the final concentration of the azidated antibody 10 mg / ml, the final concentration of DMSO 10%, the molar ratio of compound 3 to antibody 5-15, and the reaction was shaken on a constant temperature shaker at 30°C for ≥12h to complete the sugar coupling of the antibody and the toxin. TCEP was directly added to the above reaction solution to reduce the antibody, with a molar ratio of TCEP to antibody of 4.5, and the antibody was reduced on a constant temperature shaker at 30°C for 2h. Compound 7 was added to complete the thiol coupling, with a molar ratio of compound 7 to antibody of 5, and the reaction was stirred at 2-8°C for 2h to complete the thiol coupling. TCEP, DMSO, compound 3, compound 7 and other substances introduced during the process were removed by concentration and liquid replacement. The sample was replaced with 4.29g / L MES buffer at pH 6.5, the protein concentration was adjusted to 20mg / ml, trehalose and polysorbate 80(II) were added to make the final concentration of trehalose 8.56g / L and the final concentration of polysorbate 80(II) 0.1g / L to complete the sample preparation. A 100 μg sample was added with 2 μl of 1 mol / L DTT, and ultrapure water was added to a final volume of 100 μl. The sample was reduced at room temperature for 30 minutes before direct LC-MS analysis. The average DAR values ​​of the samples were calculated after normalization based on mass spectrometry signal intensity: 4.2 for etiolate and 3.7 for triptolide.

[0257] Example 9 Preparation of Triptolide (Compound 4) / Ixitecan (Compound 1) Dual Toxin ADC (ADC-3)

[0258] The sample was added according to the following reaction system to make the final concentration of antibody (Sacituzumab) 10 mg / ml, the final concentration of MnCl2 10 mmol / L, the final concentration of Tris-HCl pH 7.5 10 mmol / L, the final concentration of UDP-GalNAz 5 mmol / L, and GalT1 added at a ratio of 5 mg GalT1 / 1 g mAb to 50 mg GalT1 / 1 g mAb. The antibody was azide-treated on a 30°C constant temperature shaker for ≥12 h. The UDP-GalNAz, GalT1, and MnCl2 introduced by the azide reaction were removed by chromatography. 2+and other substances. According to the following reaction system, compound 1 was added to make the final concentration of the azidated antibody 10 mg / ml, the final concentration of DMSO 10%, the molar ratio of compound 1 to antibody 5-15, and the reaction was shaken on a constant temperature shaker at 30°C for ≥12h to complete the sugar coupling of the antibody and the toxin. TCEP was directly added to the above reaction solution to reduce the antibody, the molar ratio of TCEP to antibody was 5, and the antibody was shaken on a constant temperature shaker at 30°C for 2h to reduce the antibody. Compound 4 was used to complete the sulfhydryl coupling, the molar ratio of compound 4 to antibody was 5, and the reaction was stirred at 2-8°C for 2h to complete the sulfhydryl coupling. TCEP, DMSO, compound 1, compound 4 and other substances introduced during the process were removed by concentration and liquid replacement, and the sample was replaced with 4.29g / L MES buffer at pH 6.5. Trehalose and polysorbate 80 (II) were added to make the final concentration of trehalose 8.56g / L and the final concentration of polysorbate 80 (II) 0.1g / L to complete the sample preparation. A 100 μg sample was added with 2 μl of 1 mol / L DTT, and ultrapure water was added to a final volume of 100 μl. The sample was reduced at room temperature for 30 minutes before direct LC-MS analysis. The average DAR values ​​of the samples were calculated after normalization based on the mass spectrometry signal intensity: 4.5 for triptolide and 3.8 for etiolate.

[0259] Example 10 Preparation of Exitecan (Compound 6) / Triptolide (Compound 3) Dual Toxin ADC (ADC-4)

[0260] The sample was added according to the following reaction system to make the final concentration of antibody (Sacituzumab) 10 mg / ml, the final concentration of MnCl2 10 mmol / L, the final concentration of Tris-HCl pH 7.5 10 mmol / L, the final concentration of UDP-GalNAz 5 mmol / L, and GalT1 added at a ratio of 5 mg GalT1 / 1 g mAb to 50 mg GalT1 / 1 g mAb. The antibody was azide-treated on a 30°C constant temperature shaker for ≥12 h. The UDP-GalNAz, GalT1, and MnCl2 introduced by the azide reaction were removed by chromatography. 2+Compound 3 was added to the following reaction system to make the final concentration of the azidated antibody 10 mg / ml, the final concentration of DMSO 10%, the molar ratio of compound 3 to antibody 5-15, and the reaction was shaken on a constant temperature shaker at 30°C for ≥12h to complete the sugar coupling of the antibody and the toxin. TCEP was directly added to the above reaction solution to reduce the antibody, with a molar ratio of TCEP to antibody of 4.5, and the antibody was reduced on a constant temperature shaker at 30°C for 2h. Compound 6 was added to complete the thiol coupling, with a molar ratio of compound 6 to antibody of 5, and the reaction was stirred at 2-8°C for 2h to complete the thiol coupling. TCEP, DMSO, compound 3, compound 6 and other substances introduced during the process were removed by concentration and liquid replacement. The sample was replaced with 4.29g / L MES buffer at pH 6.5, the protein concentration was adjusted to 20mg / ml, trehalose and polysorbate 80(II) were added to make the final concentration of trehalose 8.56g / L and the final concentration of polysorbate 80(II) 0.1g / L to complete the sample preparation. A 100 μg sample was added with 2 μl of 1 mol / L DTT, and ultrapure water was added to a final volume of 100 μl. The sample was reduced at room temperature for 30 minutes before direct LC-MS analysis. The average DAR values ​​of the samples were calculated after normalization based on mass spectrometry signal intensity: 3.7 for ixetine and 3.6 for triptolide.

[0261] Example 11 Preparation of Exitecan (Compound 1) ADC (ADC-5)

[0262] The sample was added according to the following reaction system to make the final concentration of antibody (Sacituzumab) 10 mg / ml, the final concentration of MnCl2 10 mmol / L, the final concentration of Tris-HCl pH 7.5 10 mmol / L, the final concentration of UDP-GalNAz 5 mmol / L, and GalT1 added at a ratio of 5 mg GalT1 / 1 g mAb to 50 mg GalT1 / 1 g mAb. The antibody was azide-treated on a 30°C constant temperature shaker for ≥12 h. The UDP-GalNAz, GalT1, and MnCl2 introduced by the azide reaction were removed by chromatography. 2+Compound 1 was added according to the following reaction system to make the final concentration of the azidated antibody 10 mg / ml, the final concentration of DMSO 10%, the molar ratio of compound 1 to antibody 5-15, and the mixture was shaken on a constant temperature shaker at 30°C for ≥12 hours to complete the sugar coupling of the antibody and the toxin. DMSO, compound 1 and other substances introduced during the process were removed by concentration and liquid replacement. The sample was replaced with 4.29 g / L MES buffer at pH 6.5, the protein concentration was adjusted to 20 mg / ml, and trehalose and polysorbate 80 (II) were added to make the final concentration of trehalose 8.56 g / L and the final concentration of polysorbate 80 (II) 0.1 g / L to complete the sample preparation. 100 μg of the sample was taken, ultrapure water was added to the final volume of 100 μl, and then directly detected by LC-MS. The average DAR value of the sample was calculated after normalization based on the mass spectrometry signal intensity, and the value for isotecan was 3.7.

[0263] Example 12

[0264] HSP70 is upregulated in many tumors and can contribute to tumor progression and chemotherapy resistance. The relative expression level of HSP70 was used to investigate the inhibitory effect of triptolide on mRNA transcription.

[0265] Experimental methods: HCT-15 (human colorectal cancer) cells were grown to 90% confluence in T75 medium, digested with trypsin and passaged into 6-well plates. After overnight culture at 37°C, Dxd (100nM), Exatecan (100nM), Triptolide (100nM), Triptolide+Dxd (100nM+100nM), and Triptolide+Exatecan (100nM+100nM) were added respectively. The group without drug addition was designated as CTRL. After 24 h, the culture medium was discarded and 500 μl / well Trizol was added to extract RNA. After reverse transcription, real-time quantitative PCR was performed with 18S as the internal control to detect the expression of HSP70 and ABAC1. The primer sequences were as follows: ABAC1F: ATGGCTACATGAGAGCGGAG (SEQ ID NO: 21); ABAC1 R: CGTTGCACCTCTCTGGTCC (SEQ ID NO: 22); HSP70 F: ACCAAGCAGACGCAGATCTTC (SEQ ID NO: 23); HSP70R: CGCCCTCGTA CACCTGGAT (SEQ ID NO: 24); 18S F: CTCGCTCCTCTCCCACTTG (SEQ ID NO: 25); 18S R: TGACCGGGTTGGTTTTGATC (SEQ ID NO: 26).

[0266] The results are shown in Figures 2A and 2B. In Figure 2A, the vertical axis represents HSP70. HSP70 expression was significantly upregulated in HCT-15 cells stimulated by 100 nM Dxd or Exatecan, while HSP70 mRNA was significantly reduced when treated with Triptolide at the same concentration, indicating that Triptolide can inhibit mRNA synthesis.

[0267] In Figure 2B, the vertical axis represents the expression level of the efflux valve gene ABAC1. As can be seen from the figure, Triptolide significantly reduces the expression of the efflux valve gene ABAC1 in HCT-15 cells, causing the cells to be more sensitive to Dxd or Exatecan.

[0268] The combination of triptolide and exatecan significantly upregulated the expression of HSP70 and ABAC1, demonstrating the synergistic effect of triptolide and exatecan in protecting against cell apoptosis and drug resistance.

[0269] Example 13 Drug efficacy experiment in human colorectal cancer model (COLO205 cells)

[0270] experimental animals

[0271] NCG mice were purchased from Chengdu Yaokang Biotechnology Co., Ltd.

[0272] Animal modeling

[0273] COLO205 cells were resuspended in 1640 medium or DMEM medium (total volume 0.1 mL / mouse). NCG mice were shaved of their hair on the right front side of the back before inoculation, and then inoculated subcutaneously with 6×10 6 -1×10 7 cells.

[0274] Dosage regimen

[0275] Seven days after tumor implantation, mice were given test samples (negative control: PBS solution; test drugs: ADC-1, ADC-2; positive controls: Dato-Dxd, Trodelvy) by intravenous injection, with 6 animals in each group and a dose of 5 mg / kg. After the start of administration, the body weight and tumor size of the mice were measured twice a week. The formula for calculating tumor volume is: tumor volume (mm3) = 1 / 2×(L×W2) (where L represents the long diameter and W represents the short diameter). The results of tumor volume changes are shown in Figure 3A. After the experiment, the mice were killed, the tumors were dissected and weighed, and the results are shown in Figure 3B (* indicates P<0.05, ** indicates P<0.01, *** indicates P<0.001, **** indicates P<0.0001).

[0276] Example 14 Tumor Inhibition in a Human Pancreatic Cancer Model (Bxpc-3 Cells)

[0277] experimental animals

[0278] NCG mice were purchased from Chengdu Yaokang Biotechnology Co., Ltd.

[0279] Animal modeling

[0280] Bxpc-3 cells were resuspended in 1640 medium or DMEM medium (total volume 0.1 mL / mouse). NCG mice were shaved of their hair on the right front side of the back before inoculation, and then inoculated subcutaneously with 6×10 6 -1×10 7 cells.

[0281] Dosage regimen

[0282] 17 days after tumor inoculation, mice were given test samples (negative control: PBS solution; test drug: ADC-3; positive control: Dato-Dxd) by intravenous injection, with 6 animals in each group, and the dose was 5 mg / kg. On the 28th day after inoculation, that is, 11 days after the first dose, a second dose was given at a dose of 10 mg / kg. After the start of administration, the body weight and tumor size of the mice were measured twice a week. Tumor volume calculation formula: Tumor volume (mm 3 )=1 / 2×(L×W 2 )(wherein L represents the major diameter and W represents the minor diameter). The results of tumor volume changes are shown in FIG4 .

[0283] Example 15 Tumor Inhibition Effect in Human Colorectal Cancer Drug Resistance Model (HCT-15-TROP2 Cells)

[0284] experimental animals

[0285] NCG mice were purchased from Chengdu Yaokang Biotechnology Co., Ltd.

[0286] Animal modeling

[0287] HCT-15-TROP2 cells were resuspended in 1640 medium or DMEM medium (total volume 0.1 mL / mouse). The hair on the right front side of the back of NCG mice was shaved before inoculation, and then 6×10 6 -1×10 7 cells.

[0288] Dosage regimen

[0289] Ten days after tumor implantation, mice were intravenously injected with the test sample (negative control: PBS solution; test drug: ADC-2; positive control: Dato-Dxd), with 6 animals per group at a dose of 5 mg / kg. After the start of administration, the body weight and tumor size of the mice were measured twice a week. Tumor volume calculation formula: Tumor volume (mm 3 )=1 / 2×(L×W 2 )(wherein L represents the major diameter and W represents the minor diameter). The results of tumor volume changes are shown in FIG5 .

[0290] Example 16

[0291] This example is used to investigate whether the use of Triptolide and Exatecan alone or in combination in a 1:1 ratio can significantly kill tumor cells.

[0292] Cell preparation

[0293] MX-1 cells (human breast cancer cells), WiDr cells (human colorectal cancer cells), MFE-280 cells (human endometrial cancer cells), HeLa cells (human cervical cancer cells), HuH-7 cells (human liver cancer cells), NUGC-4 cells (human gastric cancer cells), and Calu-6 cells (human anaplastic carcinoma cells) in the logarithmic growth phase were digested with 0.25% Trypsin-EDTA and resuspended in 1640 medium containing 10% FBS. The cells were counted by trypan blue staining and the cell density was adjusted to 1×10 6 The cells were seeded into 96-well cell culture plates at 100 μl per well and allowed to adhere to the plate for 4 h at 37°C and 5% CO2 incubator.

[0294] Drug preparation:

[0295] Drug Group 1: Dilution of the small molecule toxin Dxd: Using 1640 medium containing 10% FBS, Dxd was diluted with 100 nM as the starting concentration, and then diluted 2-fold into 4 gradients, for a total of 5 concentration gradients, 6 of which were blank, with the concentrations being: 100 nM, 50 nM, 25 nM, 12.5 nM, and 6.25 nM, respectively.

[0296] Drug Group 2: Dilution of the small molecule toxin Exatecan (EXA): Exatecan was diluted using 1640 medium containing 10% FBS with a starting concentration of 100 nM, and then diluted 2-fold into 4 gradients, for a total of 5 concentration gradients, with 6 being blank. The concentrations were: 100 nM, 50 nM, 25 nM, 12.5 nM, and 6.25 nM, respectively.

[0297] Drug Group 3: Dilution of the small molecule toxin Triptolide (TRP): Triptolide was diluted with 1640 medium containing 10% FBS at a starting concentration of 100 nM, and then diluted 2-fold in 4 gradients, for a total of 5 concentration gradients, with 6 being blank. The concentrations were: 100 nM, 50 nM, 25 nM, 12.5 nM, and 6.25 nM, respectively.

[0298] Drug Group 4: Dilution of the small molecule toxin Dxd + Triptolide (DXD + TRP): Using 1640 medium containing 10% FBS, a 100 nM Dxd + 100 nM Triptolide mixed solution (i.e., 2 ml of 100 nM Dxd + 2 ml of 100 nM Triptolide mixed solution) was diluted 2-fold in 4 gradients, starting at 50 nM, for a total of 5 concentration gradients, with 6 being a blank. The concentrations were: 50 nM, 25 nM, 12.5 nM, 6.25 nM, and 3.125 nM, respectively.

[0299] Drug Group 5: Dilution of the small molecule toxin Exatecan + Triptolide (EXA + TRP): Using 1640 medium containing 10% FBS, a 100 nM Exatecan + 100 nM Triptolide mixed solution (i.e., 2 ml of 100 nM Exatecan + 2 ml of 100 nM Triptolide mixed solution) was diluted 2-fold using 1640 medium containing 10% FBS, starting at 50 nM, for a total of 5 concentration gradients, with 6 being blank. The concentrations were: 50 nM, 25 nM, 12.5 nM, 6.25 nM, and 3.125 nM, respectively.

[0300] Add sample:

[0301] 100 μl of the diluted Dxd, Exatecan, Triptolide, Dxd+Triptolide, and Exatecan+Triptolide samples with different concentration gradients were transferred to culture plates seeded with MX-1, WiDr, MFE-280, HeLa, HuH-7, NUGC-4, and Calu-6 cells in duplicate, for a total of 5 groups of samples, namely: Dxd alone group, Exatecan alone group, Triptolide alone group, Dxd+Triptolide group, and Exatecan+Triptolide group. The final concentrations of the Dxd group alone were 50nM, 25nM, 12.5nM, 6.25nM, and 3.125nM; the final concentrations of the Exatecan group alone were 50nM, 25nM, 12.5nM, 6.25nM, and 3.125nM; the final concentrations of the Triptolide group alone were 50nM, 25nM, 12.5nM, 6.25nM, and 3.125nM; the final concentrations of the Dxd+Triptolide group and the Exatecan+Triptolide group were 25nM, 12.5nM, 6.25nM, 3.125nM, and 1.562nM.

[0302] Data collection

[0303] After the sample addition is completed, the cell plate is placed in the Incucyte and photographed continuously every 2 hours. Continuous photography is used to collect data and analyze the cell fusion to reflect the drug's ability to kill cells.

[0304] Experimental results

[0305] The confluence (or fusion) of MX-1 cells, WIDR cells, HeLa cells, and MFE-280 cells are shown in Figures 6A-6D, respectively. The survival rates of HuH-7 cells, NUGC-4 cells, and Calu-6 cells are shown in Figures 7A-7C. These results indicate that the combination of Dxd or Exatecan and Triptolide significantly kills cells compared to Dxd, Exatecan, or Triptolide alone.

[0306] Example 17 Tumor Inhibition Effect in Human Colorectal Cancer Drug Resistance Model (HCT-15-TROP2 Cells)

[0307] experimental animals

[0308] NCG mice were purchased from Chengdu Yaokang Biotechnology Co., Ltd.

[0309] Animal modeling

[0310] HCT-15-Trop2 cells were resuspended in 1640 medium or DMEM medium (total volume 0.1 mL / mouse). The hair on the right front side of the back of NCG mice was shaved before inoculation, and then 1×10 7 cells.

[0311] Dosage regimen

[0312] Animals (7 animals per group) were injected with test samples (negative control: PBS solution; test drugs: ADC-2, ADC-4, ADC-5; positive control: Dato-Dxd) through the tail vein every two weeks. The day of administration was marked as D0, and the drug was administered three times (Day 0, Day 14 and Day 29) at a dose of 5 mg / kg. After the start of administration, the body weight and tumor size of the mice were measured twice a week. Tumor volume calculation formula: Tumor volume (mm 3 )=1 / 2×(L×W 2 (where L represents the major diameter and W represents the minor diameter). The results of tumor volume changes are shown in Figure 8A. After the experiment, the mice were sacrificed, and the tumors were dissected and weighed. The results are shown in Figure 8B (* indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001, and **** indicates P < 0.0001).

[0313] Example 18 Tumor Inhibition Effect in Human Lung Cancer NCI-H2170 Cell Model

[0314] experimental animals

[0315] NCG mice were purchased from Chengdu Yaokang Biotechnology Co., Ltd.

[0316] Animal modeling

[0317] NCI-H2170 cells were resuspended in 1640 medium or DMEM medium (total volume 0.1 mL / mouse). The hair on the right front side of the back of NCG mice was shaved before inoculation, and then 1×10 7 cells.

[0318] Dosage regimen

[0319] Animals (6 animals per group) were injected with the test samples (negative control: PBS solution; test drugs: ADC-2, ADC-4, ADC-5; positive control: Dato-Dxd) through the tail vein. The day of administration was marked as D0, and the drug was administered once (Day 0) at a dose of 5 mg / kg. After the start of administration, the body weight and tumor size of the mice were measured twice a week. Tumor volume calculation formula: Tumor volume (mm 3 )=1 / 2×(L×W 2(where L represents the major diameter and W represents the minor diameter). The results of tumor volume changes are shown in Figure 9A. After the experiment, the mice were sacrificed, and the tumors were dissected and weighed. The results are shown in Figure 9B (* indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001, and **** indicates P < 0.0001).

[0320] Example 19 Preparation of Exitecan (Compound 6) ADC (ADC-6)

[0321] TCEP-reduced antibody (sacituzumab) was added directly to the protein solution at a 4:1 molar ratio of TCEP to antibody. The solution was shaken at 30°C for 2 h. Compound 6 was added to complete the thiol conjugation at a 5:1 molar ratio of compound 6 to antibody. The solution was stirred at 2-8°C for 2 h to complete the thiol-toxin conjugation. DMSO, compound 6, and other substances introduced during the process were removed by concentration and exchange. The sample was then replaced with 4.29 g / L MES buffer (pH 6.5). The protein concentration was adjusted to 20 mg / mL. Trehalose and polysorbate 80(II) were added to a final concentration of 8.56 g / L trehalose and 0.1 g / L polysorbate 80(II) to complete the sample preparation. A 100 μg sample was taken and brought to a final volume of 100 μL with ultrapure water. The sample was then directly analyzed by LC-MS. The average DAR value for sacituzumab was calculated after normalization based on mass spectrometry signal intensity, and was 3.9 for sacituzumab.

[0322] Example 20 Preparation of Exitecan (Compound 6) ADC (ADC-7)

[0323] TCEP-reduced antibody (sacituzumab) was added directly to the protein solution at a molar ratio of 8:1. The solution was shaken at 30°C for 2 hours. Compound 6 was added to complete the thiol conjugation at a molar ratio of 10:1. The solution was stirred at 2-8°C for 2 hours. DMSO, compound 6, and other substances introduced during the process were removed by concentration and exchange. The sample was then replaced with 4.29 g / L MES buffer (pH 6.5). The protein concentration was adjusted to 20 mg / mL. Trehalose and polysorbate 80(II) were added to a final concentration of 8.56 g / L trehalose and 0.1 g / L polysorbate 80(II) to complete the sample preparation. A 100 μg sample was taken and brought to a final volume of 100 μL with ultrapure water. The sample was then directly analyzed by LC-MS. The average DAR value for sacituzumab was calculated after normalization based on the mass spectrometry signal intensity, and was 7.9 for sacituzumab.

[0324] Example 21 Preparation of Triptolide (Compound 3) ADC (ADC-8)

[0325] The sample was added according to the following reaction system to make the final concentration of antibody (Sacituzumab) 10 mg / ml, the final concentration of MnCl2 10 mmol / L, the final concentration of Tris-HCl pH 7.5 10 mmol / L, the final concentration of UDP-GalNAz 5 mmol / L, and GalT1 added at a ratio of 5 mg GalT1 / 1 g mAb to 50 mg GalT1 / 1 g mAb. The antibody was azide-treated on a 30°C constant temperature shaker for ≥12 h. The UDP-GalNAz, GalT1, and MnCl2 introduced by the azide reaction were removed by chromatography. 2+ and other substances. Compound 3 was added according to the following reaction system to make the final concentration of the azidated antibody 10 mg / ml, the final concentration of DMSO 10%, the molar ratio of compound 3 to antibody 5-15, and the mixture was shaken on a constant temperature shaker at 30°C for ≥12h to complete the sugar coupling of the antibody and the toxin. DMSO, compound 3 and other substances introduced during the process were removed by concentration and liquid replacement, and the sample was replaced in 4.29g / L MES buffer at pH 6.5. The protein concentration was adjusted to 20mg / ml, and trehalose and polysorbate 80 (II) were added to make the final concentration of trehalose 8.56g / L and the final concentration of polysorbate 80 (II) 0.1g / L to complete the sample preparation. 100μg of the sample was taken, ultrapure water was added to the final volume of 100μl, and then directly detected by LC-MS. The average DAR value of the sample was calculated after normalization based on the mass spectrometry signal intensity, and the value for triptolide was 3.7.

[0326] Example 22: NCI-H292 CDX model animal efficacy experiment

[0327] experimental animals

[0328] NKG mice were purchased from Saiye Biotechnology Co., Ltd.

[0329] Animal modeling

[0330] NCI-H292 cells were resuspended in 1640 medium or DMEM medium at a density of 1×10 8 Before inoculation, the hair on the right front side of the back of the experimental mice was removed, and then 0.1 mL of cell suspension was subcutaneously inoculated per mouse, with an inoculation density of 1×10 7 NCI-H292 cells / mouse, 8 animals per group.

[0331] Dosage regimen

[0332] The animals were injected with the test samples (negative control: PBS solution; test drugs: ADC8 group, ADC-7 group, ADC8+ADC6 group, ADC-4 group) through the tail vein. The day of administration was recorded as D0, and the drug was administered three times in total (Day 0, Day 14, Day 28). The dosage was: ADC8 group (5 mg / kg), ADC-7 group (5 mg / kg), ADC8+ADC6 group (2.5 mg / kg+2.5 mg / kg), ADC-4 group (5 mg / kg); after the start of administration, the body weight and tumor size of the mice were measured twice a week. Tumor volume calculation formula: Tumor volume (mm 3 )=1 / 2×(L×W 2 ) (where L represents the major diameter and W represents the minor diameter). The results of tumor volume changes are shown in Figure 10. Observation was stopped and the experiment was terminated on D43. Mouse mortality was counted and the results showed that 5 mice survived and 3 died in the ADC-4 group; 7 mice died in the ADC-7 group, and 7 mice died in the PBS control group. The results are shown in the table below.

[0333] The results show that the efficacy of the ADC8+ADC6 (Trippy-ADC and Ixitec-ADC) combination group was similar to that of the ADC-7 and ADC-4 groups after the first two doses. After the third dose, the ADC-4 group had the best efficacy, and its safety was the best, judging from the time and number of mouse deaths.

[0334] Table 1

[0335] Example 23 Preparation of Dxd-ADC (ADC-9)

[0336] This preparation process includes antibody reduction → thiol coupling → concentration and liquid exchange. The antibody (Patritumab) is reduced with TCEP, and TCEP is added at a molar ratio of 4:1 between TCEP and antibody. The reduction reaction is carried out on a constant temperature shaker at 22°C for 2 hours. After the reduction reaction of the antibody is completed, a small molecule toxin (compound 8) with a maleimide linker is added to carry out thiol coupling of the antibody. The small molecule load (Dxd) is added at a molar ratio of 6:1 between the small molecule and the antibody. The thiol coupling reaction is carried out on a constant temperature shaker at 22°C for 2 hours. Impurities introduced by the process such as DMSO, TCEP, and small molecule load are then removed by concentration and liquid exchange. The average DAR value of the sample is calculated after normalization based on the mass spectrometry signal intensity, and Dxd is 5.63.

[0337] Example 24 Preparation of Dxd-ADC (ADC-10)

[0338] This preparation process includes antibody reduction → thiol coupling → concentration and liquid exchange. The antibody (Patritumab) is reduced with TCEP, and TCEP is added at a molar ratio of 20:1. The reduction reaction is carried out on a 22°C constant temperature shaker with a reaction time of 2 hours. After the antibody reduction reaction is completed, a small molecule toxin compound 8 with a maleimide linker is added to the antibody for thiol coupling. The small molecule payload (Dxd) is added at a molar ratio of 20:1. The thiol coupling reaction is carried out on a 22°C constant temperature shaker with a reaction time of 2 hours. Impurities introduced by the process, such as DMSO, TCEP, and small molecule payload, are then removed by concentration and liquid exchange. The average DAR value of the sample was calculated based on normalization of the mass spectrometry signal intensity, and Dxd was 7.93.

[0339] Example 25 Preparation of Ixitecan (Compound 6) / Triptolide (Compound 3) Dual Toxin ADC (ADC-11)

[0340] This preparation process includes antibody azidation → protein A affinity chromatography → sugar coupling → antibody reduction → thiol coupling → concentration and liquid exchange. The sample is added according to the following reaction system to make the final concentration of the antibody (Patritumab) 10mg / ml, the final concentration of pH7.5 Tris-HCl 10mmol / L, the final concentration of UDP-GalNAz 5mmol / L, and GalT1 is added according to the mass ratio of GalT1 to antibody (Patritumab) of 40:1. The azidation reaction of the antibody is carried out under shaking conditions on a constant temperature shaker at 22℃, and the reaction time is 14 to 16h. The GalT1, UDP-GalNAz, Mn added in the azidation reaction are then removed by protein A affinity chromatography. 2+Impurities such as DMSO and DMSO were removed. The antibody with an azide group and a small molecule payload (Compound 3) with a DBCO linker were then added for a click chemistry reaction at a molar ratio of 7.5:1. The glycoconjugation reaction was performed on a shaker at 22°C for 14-16 hours, completing the glycoconjugation of the antibody and the small molecule payload (Compound 3). The glycoconjugated antibody was reduced with TCEP, adding TCEP at a molar ratio of 3.7:1 to the antibody. The reduction reaction was performed on a shaker at 22°C for 2 hours. After the reduction reaction, the antibody was sulfhydryl-conjugated with a small molecule (Compound 6) with a maleimide linker. The small molecule payload (Compound 6) was added at a molar ratio of 6:1 to the antibody. The sulfhydryl coupling reaction was performed on a shaker at 22°C for 2 hours. Finally, the solution was concentrated and replaced to remove impurities introduced by the process, such as DMSO, TCEP, and the small molecule payload. The average DAR values ​​of the samples were calculated after normalization based on the mass spectrometry signal intensity, which were 3.89 for exitecan and 3.78 for triptolide.

[0341] Example 26 Preparation of Triptolide ADC (ADC-12)

[0342] This preparation process includes antibody azidation → protein A affinity chromatography → sugar coupling → concentration and exchange of liquid. Samples are added according to the following reaction system to a final concentration of 10 mg / ml for the antibody (Patritumab), 10 mmol / L for pH 7.5 Tris-HCl, and 5 mmol / L for UDP-GalNAz. GalT1 is added at a GalT1:antibody (Patritumab) mass ratio of 40:1. The antibody azidation reaction is performed on a 22°C incubator for 14 to 16 hours. Protein A affinity chromatography is then used to remove impurities such as GalT1, UDP-GalNAz, and Mn2+ added during the azidation reaction. The antibody with an azide group and a small molecule payload (compound 3) with a DBCO linker were then added for a click chemistry reaction at a molar ratio of 5:1. The antibody glycoconjugation reaction was carried out on a 22°C constant temperature shaker for 14 to 16 hours to complete the glycoconjugation of the antibody and the small molecule payload (compound 3). Finally, the solution was concentrated and replaced to remove impurities introduced by the process, such as DMSO, TCEP, and the small molecule payload. The average DAR value of the sample was calculated after normalization of the mass spectrometry signal intensity, and the triptolide was 3.9.

[0343] Example 27: Drug Efficacy in a Subcutaneous Tumor Model of NUGC-4 Human Gastric Cancer Cells in NCG Mice

[0344] experimental animals

[0345] NCG mice were purchased from Chengdu Yaokang Biotechnology Co., Ltd.

[0346] Animal modeling

[0347] NUGC-4 cells were cultured in 1640+10% FBS+1% P / S medium. NUGC-4 cells in the exponential growth phase were collected and resuspended in 1640 empty medium to adjust the cell density to 1×10 8 Cells were divided into 1.5 ml EP tubes at 1 ml / well and stored on ice. The cells were resuspended in 1640 empty culture medium (total volume 0.1 mL / mouse). The hair on the right front side of the back of the experimental mice was shaved before inoculation, and then 1×10 7 NUGC-4 cells. 8 animals per group.

[0348] Dosage regimen

[0349] The animals were injected with the test sample (negative control: PBS solution; test drug: ADC-9 group or ADC-10 group, ADC-11 group) through the tail vein. The day of administration was recorded as Day 0, and the drug was administered three times in total (ADC-9 / ADC-10 group was administered with ADC-9 on Day 0, and ADC-10 on Day 21 and Day 28). The dosage was: 5 mg / kg on Day 0, 10 mg / kg on Day 21 and Day 28 respectively; after the start of administration, the tumor size of the mice was measured twice a week. Tumor volume calculation formula: Tumor volume (mm 3 )=1 / 2×(L×W 2 ) (wherein L represents the major diameter and W represents the minor diameter). The results of tumor volume changes are shown in FIG11 .

[0350] Example 28 Drug Efficacy in a Subcutaneous Tumor-Bearing Model of Colon Cancer COLO205 Cells

[0351] experimental animals

[0352] C-NKG mice were purchased from Saiye Biotechnology Co., Ltd.

[0353] Animal modeling

[0354] COLO205 cells were cultured in 1640+10% FBS medium. COLO205 cells in the exponential growth phase were collected and resuspended in 1640 empty medium to adjust the cell density to 1×10 8 Cells were divided into 1.5 ml EP tubes at a density of 1 × 10 cells / ml. The cells were aliquoted into 1 ml / tube and stored on ice. The hair on the right front side of the back of the experimental mice was shaved before inoculation. Then 0.1 ml of cell suspension was subcutaneously inoculated per mouse at a density of 1 × 107 NCI-H2170 cells / mouse. 8 animals per group.

[0355] Dosage regimen

[0356] The animals were injected with the test sample (negative control: PBS solution; test drug: ADC9 group, ADC11 group) through the tail vein. The day of administration was recorded as D0, and the drug was administered four times in total (Day 0, Day 7, Day 14, Day 21). The dosage was: 10 mg / kg on Day 0, 5 mg / kg on Day 7 and Day 14, and 10 mg / kg on Day 21. After the start of administration, the tumor size of the mice was measured twice a week. Tumor volume calculation formula: Tumor volume (mm 3 )=1 / 2×(L×W 2 ) (wherein L represents the major diameter and W represents the minor diameter). The results of tumor volume changes are shown in FIG12A .

[0357] Thirty-one days after dosing, the animals in the ADC-9 group were evenly divided into two groups and given ADC-10 and ADC-11, respectively, at a dose of 10 mg / kg. The changes in tumor volume are shown in Figure 12B. As can be seen from the figure, the tumors had developed resistance to ADC-9. While group dosing with ADC-11 significantly suppressed tumor growth, the ADC-10 group was unable to suppress tumor growth.

[0358] Example 29: Drug Efficacy in a Subcutaneous Tumor-Bearing Model of Lung Squamous Cell Carcinoma NCI-H2170

[0359] experimental animals

[0360] C-NKG mice were purchased from Saiye Biotechnology Co., Ltd.

[0361] Animal modeling

[0362] NCI-H2170 cells were cultured in 1640+20% FBS medium. NCI-H2170 cells in the exponential growth phase were collected and resuspended in 1640 empty medium to adjust the cell density to 1×10 8 Cells were divided into 1.5 ml EP tubes at a density of 1 × 10 cells / ml. The cells were aliquoted into 1 ml / tube and stored on ice. The hair on the right front side of the back of the experimental mice was shaved before inoculation. Then 0.1 ml of cell suspension was subcutaneously inoculated per mouse at a density of 1 × 10 7 NCI-H2170 cells / mouse. 8 animals per group.

[0363] Dosage regimen

[0364] Animals were injected with test samples (negative control: PBS solution; test drugs: ADC-9 group, ADC-11 group, ADC-12) via the tail vein. The day of administration was marked as D0, and the drug was administered twice in total (Day 0, Day 10). The dosage was 5 mg / kg. After the start of administration, the tumor size of the mice was measured twice a week. Tumor volume calculation formula: Tumor volume (mm 3 )=1 / 2×(L×W 2 ) (wherein L represents the major diameter and W represents the minor diameter). The results of tumor volume changes are shown in FIG13A .

[0365] Twenty-one days after the first dose, the 16 mice in the original ADC-9 group were evenly divided into two groups based on tumor volume. ADC-10 and ADC-11 were administered weekly at a 10 mg / kg dose. The PBS group and the original ADC-11 group also continued to receive 10 mg / kg weekly. The changes in tumor volume are shown in Figure 13B. As can be seen from the figure, ADC-10 had no significant inhibitory effect on tumor growth under the weekly dosing condition, while the ADC-11 group significantly reduced tumor size.

Claims

1. Use of a combination of triptolide and camptothecin drugs in the preparation of drugs for treating tumor diseases.

2. The use according to claim 1, characterized in that: Triptolide and camptothecins act together as toxins in antibody-drug conjugates.

3. An antibody drug conjugate comprising a dual toxin having the formula: in, Ab is an antibody or its antigen-binding fragment; D1 and D2 are selected from triptolide or camptothecin drugs, and D1 and D2 are different; L1 and L2 are connection units; x,y is 0-8.

4. The antibody-drug conjugate according to claim 3, characterized in that: The L1 is connected to Ab via a thiol or amide group.

5. The antibody-drug conjugate according to claim 3 or 4, characterized in that: The L2 is linked to Ab via a sugar group.

6. The antibody-drug conjugate according to any one of claims 3 to 5, characterized in that: The L1 has [H1-L 1a -L 1b -L 1c -D1] x The structure shown; The L2 has [H2-L 2a -L 2b -L 2c -D2] y The structure shown; H1 and H2 are linker sites with Ab or groups that can react with Ab; L 1a It is connected between H1 and L 1b The connection unit between 2a It connects H2 and L 2b The connection unit between them; L 1b Is connected to L 1a and L 1c The linker between 2b Is connected to L 2a and L 2c The linker between L 1c YesL 1b and D1, L 2c YesL 2b and a spacer between D2.

7. The drug conjugate according to claim 6, characterized in that The H1 and H2 are selected from: in Indicates the connection site.

8. The drug conjugate according to claim 7, characterized in that The H1 is selected from: Preferably, H1 is 9. The drug conjugate according to claim 7, characterized in that: The H2 is selected from:

10. The antibody-drug conjugate according to any one of claims 6 to 9, characterized in that: The L 1a or L 2a Contains-L d -C(O)-, where L d is selected from an optionally substituted alkylene group, an optionally substituted polyethylene glycol group, an optionally substituted alkenylene group, an optionally substituted alkynylene group, an optionally substituted alicyclic group, an optionally substituted alicyclic heterocyclic group, an optionally substituted arylene group, an optionally substituted heteroarylene group or a combination thereof, preferably, L d Selected from optionally substituted C 1-30 an alkylene group, an optionally substituted polyethylene glycol group, an optionally substituted C 2-30 Alkenylene, optionally substituted C 2-30 Alkyne, optionally substituted C 3-30 Alicyclic group, optionally substituted C 1-30 Aliphatic heterocyclic group, optionally substituted C 6-30 Arylene, optionally substituted C 5-30 or a combination thereof.

11. The antibody-drug conjugate according to claim 10, characterized in that: The L d Selected from -(CH2)m-, -(PEG)n- or -(CH2) m -(PEG) n -(CH2) z -, wherein m, n, z are integers of 0-10, preferably, m, n, z are integers of 0-8.

12. The antibody-drug conjugate according to any one of claims 6 to 11, characterized in that: The L 1b or L 2b It is a cleavable linker or a non-cleavable linker.

13. The antibody-drug conjugate according to claim 12, characterized in that: The L 1b or L 2b is a cleavable peptide chain consisting of 2-10 amino acids; preferably, the L 1b or L 2b is selected from the group consisting of Gly-Gly-Phe-Gly, Val-Cit, Val-Ala, Val-Lys, Val-Arg, AcLys-Val-Cit, AcLys-Val-Ala, Phe-Cit, Phe-Ala, Phe-Lys, Phe-Arg, Glu-Val-Ala, Glu-Val-Cit, Ala-Lys, Leu-Cit, lle-Cit, Trp-Cit, Ala-Ala-Asn, Ala-Ala-Ala, Ala-Asn, Lys; preferably, the L 1b or L 2b Selected from Gly-Gly-Phe-Gly, Val-Cit, Val-Ala, Val-Lys, Phe-Cit, Phe-Ala, Phe-Lys, Ala-Ala-Asn.

14. The antibody-drug conjugate according to any one of claims 6 to 13, characterized in that: The L 1c or L 2c Selected from: Preferably, the L 1c Selected from in Indicates the connection site.

15. The antibody-drug conjugate according to any one of claims 3 to 14, characterized in that: The L1-D1 is in L 1a -(CH2) m1 -C(O)- or -(PEG) n1 -(CH2) z1 -C(O)-, wherein m1, n1, z1 are integers from 2 to 8; L 1b is Gly-Gly-Phe-Gly, Val-Cit or Val-Ala; L 1c for D1 is triptolide or camptothecin drugs.

16. The antibody-drug conjugate according to any one of claims 3 to 15, characterized in that: The L2-D2 is in: L 2a -(PEG) n2 -(CH2) z2 -C(O)-, wherein n2 and z2 are integers of 2 to 8; L 2b is Gly-Gly-Phe-Gly, Val-Cit or Val-Ala; L 2c for D2 is triptolide or camptothecin drugs.

17. The antibody-drug conjugate according to claim 15, characterized in that: The L 1a -(CH2) m1 -C(O)-, wherein m1 is an integer of 2-6, preferably 5; or L 1a -(PEG) n1 -(CH2) z1 -C(O)-, wherein n1 and z1 are integers of 2-6, preferably n1 and z1 are 2.

18. The antibody-drug conjugate according to claim 16, characterized in that: The L 2a -(PEG) n2 -(CH2) z2 -C(O)-, wherein n2 and z2 are integers of 2 to 6; or L 1a -(PEG) n1 -(CH2) z1 -C(O)-, wherein n1 and z1 are integers of 2-6, preferably n 2为 An integer from 4 to 6, where z2 is 2.

19. The antibody-drug conjugate according to claim 3, characterized in that: The D1 is triptolide, and D2 is a camptothecin drug.

20. The antibody-drug conjugate according to claim 3, characterized in that: The D1 is a camptothecin drug, and D2 is triptolide.

21. The antibody drug conjugate according to any one of claims 3 to 20, characterized in that: The camptothecin drug is camptothecin, exotecan, topotecan, SN38 or a derivative thereof; preferably, the camptothecin drug is exotecan.

22. The antibody-drug conjugate according to claim 3, characterized in that: The x is selected from 2-8, preferably 3-5; and y is selected from 3-4.

23. The antibody drug conjugate according to any one of claims 3 to 14, characterized in that: The L1-D1 is selected from:

24. The antibody drug conjugate according to any one of claims 3 to 14, characterized in that: The L2-D2 is selected from:

25. The antibody drug conjugate according to any one of claims 3 to 14, characterized in that: The L1-D1 is: L2-D2 is: Or the L1-D1 is: L2-D2 is: Or the L1-D1 is: L2-D2 is: Or the L1-D1 is: L2-D2 is:

26. The antibody drug conjugate according to any one of claims 3 to 25, characterized in that: The L2 is linked to the antibody via an oligosaccharide.

27. The antibody drug conjugate according to any one of claims 3 to 26, characterized in that: The antibody or antigen-binding fragment binds to one or more of the following: carbonic acid tincture enzyme IX, alpha-fetoprotein, alpha-actinin, A3, A33, ART 4, B7, B7H3, B7H4, BAGE, BrE3 antigen, CA125, CAMEL, CAP", CASP-8 / m, CCL19, CCL21, CD1, CD1a.CD2, CD3, CD4, CD5, CD8, CD11A, CD14, CD15, CD16, CD18, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD29, CD30, CD32b, CD33, CD37, CD38, CD40, CD40L, CD44, CD45, CD46, CD52, CD54, CD55, CD59 、CD64、CD66a-e、CD67、CD70、CD70L、CD74、CD79a、CD80、CD83、CD95、CD126、CD132、CD133、CD138、CD147、CD154、CDC27、CDK-4、CDKN2A、HIF-Ια、colon-specific antigen p(CSAp)、CEA、CEACAM5、CEACAM6、oMet、DAM、EGFR、EGFRvIII、cMet、EGP-1(Trop-2)、EGP-2、ELF2-M、Ep-CAM、Her2、Her3、Claudin 18.2, ROR1, ROR2, dll3, marcl7, fibroblast growth factor (FGF), Flt-1, Flt-3, folate receptor, G250 antigen, GAGE, gpl00, GRO-β, HLA-DR.HML24, HMGB-1, HSP70-2M., IGF-1R, IGR1R, MAGE, MAGE-3, MART-1, MART-2, NY-ESO-1, TRAG3, mCRP, MCP-1, MIP-1A, MIP-1B, MIF, MUC1, MUC2, MUC3, MUC4, MUC5ac, MUC13, MUC16, MUM-1 / 2, MUM-3, NCA66, NCA95, NCA90, pancreatic cancer mucin, PD-1 receptor, PD-L1 receptor, placental growth factor, PLAGL2, prostatic acid phosphatase, PSA, PRAME, PSMA, P1GF, ILGF, ILGF-1R, RS5, RANTES, T101, SAGE, S100, survivin, survivin-2B, TAG, TAG-72, tenascin, TRAIL receptor, Tn antigen, ED-B, WT-1, 17-1A antigen; preferably, the antibody or antigen-binding fragment binds to an antigen selected from Her2, Her3, B7H3, Claudin 18.

2. One or more of DLL-3 or EGP-1 (Trop-2); and. Preferably, the antibody or antigen-binding fragment is selected from the group consisting of epratuzumab, veltuzumab, sacituzumab, patritumab, trastuzumab, pertuzumab, abciximab, alemtuzumab, cetuximab, gemtuzumab, ibritumomab, panitumumab, rituximab, tositumomab, abagovomab, atlizumab, benralizumab, obinutuzumab, basiliximab, dadizumab, efalizumab, muromomab, natlizumab, omalizumab, b, gaiitenemmab, solanezumab, tisotumab, brentuximab, inotuzumab, moxetumomab, polatuzumab, enfortumab, belantamab, cetuximab, loncastuximab, daratumumab, nimotuzumab, zolbetuximab, omburtamab, and rvalpituzumab; more preferably, the antibody or antigen-binding fragment is selected from sacituzumab, daratumumab, zolbetuximab, omburtamab, patritumab, and rvalpituzumab.

28. The antibody drug conjugate according to any one of claims 3 to 27, characterized in that: The antibody or antigen-binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three complementary determining regions HCDR1-3, each comprising an amino acid sequence as described in SEQ ID NO: 1-3; The light chain variable region includes three complementarity determining regions LCDR1-3, which respectively contain the amino acid sequences described in SEQ ID NO: 4-6; preferably, the heavy chain variable region of the antibody or its antigen-binding fragment contains the amino acid sequence described in SEQ ID NO: 7, and the light chain variable region contains the amino acid sequence described in SEQ ID NO: 8; more preferably, the heavy chain of the antibody or its antigen-binding fragment contains the amino acid sequence described in SEQ ID NO: 9, and the light chain contains the amino acid sequence described in SEQ ID NO:

10.

29. The antibody drug conjugate according to any one of claims 3 to 27, characterized in that: The antibody or antigen-binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three complementarity determining regions HCDR1-3, respectively comprising the amino acid sequences described in SEQ ID NOs: 11-13; wherein the light chain variable region comprises three complementarity determining regions LCDR1-3, respectively comprising the amino acid sequences described in SEQ ID NOs: 14-16; preferably, the heavy chain variable region of the antibody or antigen-binding fragment thereof comprises the amino acid sequence described in SEQ ID NO: 17, and the light chain variable region comprises the amino acid sequence described in SEQ ID NO: 18; more preferably, the heavy chain of the antibody or antigen-binding fragment thereof comprises the amino acid sequence described in SEQ ID NO: 19, and the light chain comprises the amino acid sequence described in SEQ ID NO:

20.

30. The antibody drug conjugate according to any one of claims 3 to 29, characterized in that: x+y≥4, preferably 4≤x+y≤9, more preferably 7≤x+y≤8.

31. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the antibody-drug conjugate according to any one of claims 3 to 30, and a pharmaceutically acceptable carrier, excipient or diluent.

32. Use of the antibody drug conjugate of any one of claims 3 to 30 in the preparation of a medicament for treating and / or preventing a tumor; preferably, the tumor is selected from tumors associated with the expression of one or more of the following molecules: Trop-2, Her2, Her3, B7H3, Claudin 18.2, CD30, CD38, CD33, CD70 and EGFR; preferably, the tumor comprises a solid tumor or a blood tumor; more preferably, the tumor is selected from: lung cancer, kidney cancer, urethral cancer, colorectal cancer, prostate cancer, glioblastoma multiforme, ovarian cancer, pancreatic cancer, breast cancer, melanoma, liver cancer, bladder cancer, gastric cancer, leukemia, malignant lymphoma, cervical cancer, squamous cell carcinoma, penile cancer, esophageal cancer, salivary gland cancer.

33. The antibody drug conjugate according to any one of claims 3 to 30 for use in treating tumor diseases. The antibody drug conjugate according to claim 33 , wherein triptolide and camptothecin drugs serve together as toxins in the antibody drug conjugate.

35. A method for treating a tumor disease in an individual, comprising administering to the individual an antibody drug conjugate according to any one of claims 3 to 30 or a pharmaceutical composition according to claim 31, preferably, the tumor is selected from tumors associated with expression of one or more of the following molecules: Trop-2, Her2, Her3, B7H3, Claudin 18.2, CD30, CD38, CD33, CD70 and EGFR; preferably, the tumor comprises a solid tumor or a blood tumor; more preferably, the tumor is selected from: lung cancer, kidney cancer, urethral cancer, colorectal cancer, prostate cancer, glioblastoma multiforme, ovarian cancer, pancreatic cancer, breast cancer, melanoma, liver cancer, bladder cancer, gastric cancer, leukemia, malignant lymphoma, cervical cancer, squamous cell carcinoma, penile cancer, esophageal cancer, salivary gland cancer.