Prophylactic or therapeutic agent for pulmonary hypertension, and method for examining presence or absence of pulmonary hypertension or severity of pulmonary hypertension

IL328707A0Pending Publication Date: 2026-07-01NAT CEREBRAL & CARDIOVASCULAR CENT
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
IL328707
Authority / Receiving Office
IL · IL
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-11-29
Filing Date
2024-11-28
Publication Date
2026-07-01

AI Technical Summary

Technical Problem

Current treatments for pulmonary hypertension (PH) are inadequate for severe and drug-resistant cases, and there is a lack of effective methods for identifying the aryl hydrocarbon receptor (AHR) ligand involved in PH pathogenesis.

Method used

The use of a substance that adsorbs or binds to tryptophan metabolites, such as tryptamine, to remove them from the intestinal tract, thereby inhibiting their function as AHR ligands and potentially treating or preventing PH. Additionally, increasing the expression level of angiotensin-converting enzyme 2 (ACE2) in the intestinal tract to improve tryptophan absorption and reduce PH severity.

Benefits of technology

The proposed solution effectively reduces the severity of PH by eliminating tryptophan metabolites that act as AHR ligands and enhancing ACE2 expression to normalize tryptophan absorption, thereby offering a new therapeutic approach for PH.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000094_0000
    Figure 00000094_0000
  • Figure 00000094_0001
    Figure 00000094_0001
  • Figure 00000094_0002
    Figure 00000094_0002
Patent Text Reader

Abstract

The problem addressed by the present disclosure is to provide a prophylactic or therapeutic agent for pulmonary hypertension. A prophylactic or therapeutic agent for pulmonary hypertension according to the present disclosure contains a substance that adsorbs or binds to an indole compound that is a tryptophan metabolite.
Need to check novelty before this filing date? Find Prior Art

Description

Preventive or therapeutic drug for pulmonary hypertension, and method for testing for the presence or absence of pulmonary hypertension or the severity of pulmonary hypertension

[0001] The present disclosure relates to a drug for preventing or treating pulmonary hypertension (PH). The present disclosure also relates to a method for testing for the presence or absence of PH or the severity of PH, and a test kit used in the test method.

[0002] Pulmonary hypertension is a group of progressive diseases with a poor prognosis that cause cardiac and pulmonary dysfunction due to elevated pulmonary arterial blood pressure. According to the Nice Classification, pulmonary hypertension is classified into the following groups: Group 1: pulmonary arterial hypertension (PAH); Group 1': pulmonary veno-occlusive disease (PVOD) and / or pulmonary capillary hemangiomatosis (PCH); Group 1'': persistent pulmonary hypertension of the newborn; Group 2: pulmonary hypertension associated with left heart disease; Group 3: pulmonary hypertension associated with lung disease and / or hypoxemia; Group 4: chronic thromboembolic pulmonary hypertension (CTEPH); and Group 5: pulmonary hypertension associated with an unknown multifactorial mechanism.

[0003] Among PH, PAH is a disease characterized by inflammation of the peripheral pulmonary arteries (small arteries or arterioles) accompanied by pathological changes such as muscularization, neointimal proliferation, and plexiform lesions (Non-Patent Documents 1, 2). The etiology of PAH is complex and likely results from a combination of various factors, including genetic background, epigenetic modification factors, pre-existing diseases, and environmental factors (Non-Patent Document 3). Among these, inflammation and autoimmune diseases are thought to significantly contribute to the pathogenesis of PAH (Non-Patent Documents 4, 5).

[0004] In recent years, the overall prognosis for PH has been improving thanks to the use of vasodilators that target smooth muscle relaxation, but the prognosis for severe and drug-resistant patients remains poor. In addition to genetic predisposition, inflammation and second-hit drugs are thought to be important factors in the onset and worsening of PH, but many details remain unknown.

[0005] The present inventors have previously reported that the aryl hydrocarbon receptor (AHR), a known regulator of inflammatory signaling and a receptor for environmental pollutants, plays a key role in the pathogenesis of PAH (Non-Patent Document 6). In this study, we found that serum AHR activity was elevated in PAH patients, and that the more severe the condition, the higher the AHR activity, with higher activity being associated with a poorer prognosis (Figure 1). Furthermore, we have reported that the endogenous AHR ligand FICZ, when combined with hypoxic stimulation, induces severe pulmonary hypertension accompanied by intimal lesions in rats (Figure 2). Furthermore, knockout of AHR in the Su / Hx model, a severe PH model, almost completely suppressed PH pathogenesis, demonstrating that AHR plays a key role in the progression of PH (Figure 3).

[0006] Humbert M, Sitbon O, Simonneau G. Treatment of pulmonary arterial hypertension. The New England journal of medicine 2004;351:1425-36.Rabinovitch M. Molecular pathogenesis of pulmonary arterial hypertension. The Journal of clinical investigation 2012;122:4306-13.Humbert M, Guignabert C, Bonnet S, et al. Pathology and pathobiology of pulmonary hypertension: state of the art and research perspectives. The European respiratory journal 2019;53.Hashimoto-Kataoka T, Hosen N, Sonobe T, et al. Interleukin-6 / interleukin-21 signaling axis is critical in the pathogenesis of pulmonary arterial hypertension. Proceedings of the National Academy of Sciences of the United States of America 2015;112:E2677-86.Schermuly RT, Ghofrani HA, Wilkins MR, Grimminger F. Mechanisms of disease: pulmonary arterial hypertension. Nature reviews Cardiology 2011;8:443-55.Masaki T. Okazawa M et al., Aryl hydrocarbon receptor is essential for the pathogenesis of pulmonary arterial hypertension. PNAS 2021; 118, e2023899118。

[0007] Removal of AHR ligands, which play an important role in the pathogenesis of PH, may be effective in preventing, treating, and preventing the progression of PH. However, the AHR ligands involved in the pathogenesis of PH have not yet been identified.

[0008] Therefore, an object of one embodiment of the present disclosure is to identify an AHR ligand involved in the pathogenesis of PH and to provide a preventive or therapeutic drug for PH that can remove the AHR ligand.

[0009] In another embodiment of the present disclosure, an objective is to elucidate the mechanism of pathogenesis of PH caused by AHR ligands and to provide a new drug for preventing or treating PH based on this mechanism.

[0010] In still another embodiment of the present disclosure, an objective is to find a biomarker for PH and to provide a method for examining the presence or absence of PH or the severity of PH.

[0011] It has been reported that changes in metabolites due to alterations in the intestinal microbiota are associated with various diseases. Therefore, the present inventors analyzed the intestinal microbiota of PH patients. They found that PH patients experience dysbiosis, characterized by ectopic colonization of oral bacteria and an increase in Ruminococcus gnavus (R. gnavus). Furthermore, they found that this alteration in the intestinal microbiota leads to elevated tryptophan concentrations in the intestinal tract of PH patients, which in turn leads to increased production of tryptophan metabolites (indole compounds) such as tryptamine. Furthermore, they found that tryptophan metabolites function as AHR ligands, promoting the pathogenesis of PH. Furthermore, they found that tryptophan metabolites (AHR ligands) such as tryptamine inhibit tryptophan absorption in the intestinal tract by reducing B0AT1 function through a decrease in AHR-dependent angiotensin-converting enzyme 2 (ACE2) expression, further enhancing the concentration of tryptophan in the intestinal tract. They also found that PH can be prevented or treated by administering a substance that adsorbs or binds to tryptophan metabolites to remove them from the intestinal tract. The present disclosure was completed through further investigation based on these findings.

[0012] That is, one embodiment of the present disclosure provides the following inventions relating to a technology for preventing or treating PH using the mechanism of removal of tryptophan metabolites in the intestinal tract. Item 1-1. A preventive or therapeutic drug for PH, comprising a substance capable of removing an indole compound, a tryptophan metabolite, from the intestinal tract. Item 1-2. The preventive or therapeutic drug for PH according to Item 1-1, wherein the substance adsorbs or binds to an indole compound, a tryptophan metabolite. Item 1-3. The preventive or therapeutic drug for PH according to Item 1-1 or 1-2, wherein the indole compound is at least one selected from the group consisting of tryptamine, indole-3-aldehyde, indole-3-pyruvic acid, indole-3-ethanol, indole-3-acetic acid, indole-3-propionic acid, indole-3-acrylic acid, and indole-3-lactic acid. Item 1-4. The preventive or therapeutic drug for PH according to Item 1-1 or 1-2, wherein the substance is a porous inorganic adsorbent. Item 1-5. A preventive or therapeutic drug for PH according to any one of Items 1-1 to 1-4, wherein the substance is adsorbent carbon. Item 1-6. A method for treating PH, comprising a step of removing indole compounds, which are tryptophan metabolites, from the intestinal tract of a patient with PH. Item 1-7. A method for treating PH according to Item 1-6, comprising administering to the patient a therapeutically effective amount of a substance that adsorbs or binds to indole compounds, which are tryptophan metabolites, thereby removing the indole compounds from the intestinal tract of the patient with PH. Item 1-8. Use of a substance capable of removing indole compounds, which are tryptophan metabolites, from the intestinal tract, for the manufacture of a preventive or therapeutic drug for PH. Item 1-9. The use according to Item 1-8, wherein the substance is a substance that adsorbs or binds to indole compounds, which are tryptophan metabolites. Item 1-10. A substance that can remove indole compounds, which are tryptophan metabolites, from the intestinal tract, used in the treatment of PH. Item 1-11. A substance that adsorbs or binds to indole compounds, which are tryptophan metabolites, used in the treatment of PH.

[0013] Furthermore, another embodiment of the present disclosure provides the following inventions relating to a technique for testing the presence or absence of PH or the severity of PH using the tryptophan concentration in stool, intestinal contents, or a blood sample as an indicator: Item 2-1. A method for testing the presence or absence of PH or the severity of PH, comprising a step of measuring the tryptophan concentration in stool, intestinal contents, or a blood sample collected from a subject. Item 2-2. A test kit for testing the presence or absence of PH or the severity of PH, comprising a reagent for measuring tryptophan.

[0014] Furthermore, another embodiment of the present disclosure provides the following inventions relating to a technology for testing the presence or absence of PH or the severity of PH using the concentration of a tryptophan metabolite in a stool, intestinal contents, or blood sample as an indicator. Item 3-1. A method for testing the presence or absence of PH or the severity of PH, comprising a step of measuring the concentration of an indole compound, a tryptophan metabolite, in a stool, intestinal contents, or blood sample collected from a subject. Item 3-2. The testing method according to Item 3-1, wherein the indole compound is at least one selected from the group consisting of tryptamine, indole-3-aldehyde, indole-3-pyruvic acid, indole-3-ethanol, indole-3-acetic acid, indole-3-propionic acid, indole-3-acrylic acid, and indole-3-lactic acid. Item 3-3. A test kit for testing the presence or absence of PH or the severity of PH, comprising a reagent for measuring an indole compound, a tryptophan metabolite.

[0015] Furthermore, another embodiment of the present disclosure provides the following inventions relating to a technique for testing the presence or absence of PH or the severity of PH using AHR activity in stool or intestinal contents as an index: Item 4-1. A method for testing the presence or absence of PH or the severity of PH, comprising a step of measuring AHR activity in stool or intestinal contents collected from a subject. Item 4-2. A test kit for testing the presence or absence of PH or the severity of PH, comprising a reagent for measuring AHR activity in stool or intestinal contents.

[0016] Furthermore, another embodiment of the present disclosure provides the following inventions relating to technologies for testing the presence or absence of PH or the severity of PH using the ACE2 concentration in stool, intestinal contents, or blood samples as an indicator: Item 5-1. A method for testing the presence or absence of PH or the severity of PH, comprising a step of measuring the ACE2 concentration in stool, intestinal contents, or blood samples collected from a subject; Item 5-2. A test kit for testing the presence or absence of PH or the severity of PH, comprising a reagent for measuring ACE2.

[0017] Furthermore, in another embodiment of the present disclosure, the following inventions are provided relating to a technology for preventing or treating PH using an increase in the expression level of ACE2 in the intestinal tract as a mechanism of action. Item 6-1. A preventive or therapeutic drug for PH, comprising a substance that increases the expression level of ACE2. Item 6-2. A method for treating PH, comprising administering a therapeutically effective amount of a substance that increases the expression level of ACE2 to a patient with PH. Item 6-3. Use of a substance that increases the expression level of ACE2 for the manufacture of a preventive or therapeutic drug for PH. Item 6-4. A substance that increases the expression level of ACE2, used in a treatment for treating PH.

[0018] According to one embodiment of the present disclosure, PH can be prevented or treated by removing indole compounds, which are tryptophan metabolites, from the intestinal tract. Also, according to another embodiment of the present disclosure, PH can be prevented or treated by increasing the expression level of ACE2 in the intestinal tract.

[0019] According to another embodiment of the present disclosure, the presence or absence of PH or the severity of PH can be examined using the tryptophan concentration, tryptophan metabolites, or ACE2 concentration in stool, intestinal contents, or blood samples as an indicator. According to yet another embodiment of the present disclosure, the presence or absence of PH or the severity of PH can be examined using the AHR activity in stool or intestinal contents as an indicator.

[0020] Serum AhR ligand activity is elevated in PAH patients, reflecting the severity of PAH (Non-Patent Document 6). Figure 6 shows results. A: Serum AHR-Luc activity in healthy volunteers (HV) and PAH patients determined by AHR luciferase reporter assay (HV: n=16, PAH: n=18). B: Distribution of AHR-Luc (luciferase) activity stratified by WHO pulmonary hypertension functional class (HV: n=16; WHO-FC 1, 2: n=10; WHO-FC 3, 4: n=8). C: Kaplan-Meier analysis of event-free survival (P=0.0376, two-sided log-rank test) between patients with low AHR-Luc activity (n=10) and patients with high AHR-Luc activity (n=8). In C, the mean AHR-Luc activity was used as the cutoff value to stratify patients into those with low AHR-Luc activity and those with high AHR-Luc activity. Clinical events in C were defined as death, lung transplantation, and hospitalization due to right heart failure. Statistical values ​​are mean ± standard deviation: ***P<0.001, *P<0.05. These results demonstrate that FICZ, an endogenous AHR ligand, induces severe pulmonary hypertension accompanied by intimal lesions in rats when combined with hypoxic stimulation (Non-Patent Document 6).A. Experimental procedure to determine whether FICZ administration in combination with hypoxic stimulation induces PH in rats (FICZ / Hx / Nx model). B. Right ventricular systolic pressure (RVSP) in FICZ / Hx / Nx and Veh / Hx / Nx rats. Normoxia: n=5, Veh / Hx / Nx 5 wks: n=7, FICZ / Hx / Nx 5 wks: n=6, Veh / Hx / Nx 8 wks: n=6, FICZ / Hx / Nx 8 wks: n=6. n=7); C: Right ventricular hypertrophy index (Fulton index) in FICZ / Hx / Nx and Veh / Hx / Nx rats; D: Representative images of vascular remodeling in distal pulmonary arterioles obtained by Elastica van Gieson (EVG) staining of lung tissue sections from the rats in B and C; E: Medial thickening index in FICZ / Hx / Nx and Veh / Hx / Nx rats (Normoxia: n=3, Veh / Hx / Nx 5 wks: n=4, FICZ / Hx / Nx 5 wks: n=3, Veh / Hx / Nx 8 wks: n=6, FICZ / Hx / Nx 8 wks: n=6); F: Open pulmonary artery obstruction lesions in vessels with pulmonary artery outer diameter (OD: <50 μm) in FICZ / Hx / Nx and Veh / Hx / Nx rats. The results were graded as open (no intimal lesions), partial (<50% obstruction), or closed (≥50% obstruction) (Normoxia: n = 3, Veh / Hx / Nx 5 weeks: n = 4, FICZ / Hx / Nx 5 weeks: n = 3, Veh / Hx / Nx 8 weeks: n = 6, FICZ / Hx / Nx 8 weeks: n = 6). Figure G shows the results of pulmonary artery obstruction in vessels with an external diameter (OD) of 50-100 μm in FICZ / Hx / Nx and Veh / Hx / Nx rats, graded as above as open, partial, or closed. In the figure, the abbreviation "FICZ" indicates the FICZ-treated group, "Veh" indicates the vehicle-treated group, "Hx" indicates hypoxic loading, and "Nx" indicates normoxic conditions. In A, the abbreviation "RHC" indicates right heart catheterization. Statistical values ​​are mean ± standard deviation: ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05. This figure shows that AHR knockout rats were resistant to pulmonary hypertension in the SuHx rat model (Non-Patent Document 6).A: Experimental procedure to verify the role of the AHR signaling pathway in the SuHx rat model; B: Right ventricular systolic pressure (RVSP) at 5 weeks in SuHx rats (Ahr- / -, Ahr+ / +) and normoxic rats (Normoxia; Ahr- / -, Ahr+ / +) (Normoxia Ahr+ / +: n=7, Normoxia Ahr- / -: n=7, SuHx 5 wks Ahr+ / +: n=3, SuHx 5 wks Ahr+ / -: n=7, SuHx 5 wks Ahr- / -: n=8); C: Fulton's coefficient at 5 weeks in SuHx rats (Ahr- / -, Ahr+ / +) and normoxic rats (Normoxia; Ahr- / -, Ahr+ / +); D: Fulton's coefficient at 5 weeks in SuHx rats (Ahr- / -, Ahr+ / +) and normoxic rats (Normoxia; Representative images of vascular remodeling in distal pulmonary arterioles in EVG-stained lung tissue sections from SuHx rats (Ahr- / -, Ahr+ / +) and normoxic rats (Normoxia; Ahr- / -, Ahr+ / +) at 8 weeks. E shows the medial thickening index of SuHx rats (Ahr- / -, Ahr+ / +) and normoxic rats (Normoxia; Ahr- / -, Ahr+ / +) at 8 weeks (Normoxia Ahr+ / +: n=4, Normoxia Ahr- / -: n=5, SuHx 8 wks Ahr+ / +: n=3, SuHx 8 wks Ahr- / -: n=3). F shows the pulmonary artery occlusion lesions in vessels with an external diameter (OD: <50 μm) of pulmonary artery as classified as open (no intimal lesions), partial (<50%), and pulmonary artery occlusion lesions in vessels with an external diameter (OD: <50 μm) from SuHx rats (Ahr- / -, Ahr+ / +) and normoxic rats (Normoxia; Ahr- / -, Ahr+ / +) at 8 weeks. G shows the pulmonary artery occlusion lesions in vessels with an external diameter (OD: 50-100 μm) of the pulmonary artery at 8 weeks in SuHx rats (Ahr- / -, Ahr+ / +) and normoxia rats (Normoxia; Ahr- / -, Ahr+ / +), graded as open, partial, or closed as above.In the figure, the abbreviation "Su" indicates the SU5416 treatment group, "Hx" indicates hypoxia, "Nx" indicates normoxic conditions, "Ahr- / -" indicates AHR knockout, "Ahr+ / +" indicates no AHR knockout, and "RHC" indicates right heart catheterization. Statistics are mean ± standard deviation: ****P<0.0001, ***P<0.001, **P<0.01. Figure 1 shows alterations in the intestinal microbiota of PH patients. (A) shows the alpha diversity of the intestinal microbiota of PH patients (PH, 89 cases) and healthy controls (HV, 82 cases) in terms of Faith PD and Shannon index. (B) shows the beta diversity (unweighted unifrac PCoA) of the intestinal microbiota of PH patients and healthy controls. (****P<0.0001, *P<0.05). Figure 1 shows alterations in the intestinal microbiota of PH patients. A is a volcano plot comparing the bacterial genus composition of the intestinal microbiota between PH patients and healthy controls (HV). B is a graph showing the oral microbial score in the intestines of PH patients and healthy controls. C is a comparison of the proportion of patients with WHO PH functional classifications I to IV, divided into PH patients with an oral microbial score (OS) of ≥5 and <5. D is a graph showing the results of a Kaplan-Meier analysis (P<0.01, two-sided log-rank test) of event-free survival (EFS) for PH patients divided into those with an oral microbial score of ≥5 and those with an OS of ≤5. E is a graph showing the fecal concentrations of acetate, propionate, and butyrate in PH patients and healthy controls. Clinical events in D were defined as death, lung transplantation, and hospitalization due to right heart failure. Statistics are mean ± standard deviation: ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05. In patients with PH, Ruminococcus gnavus coexists with multiple oral bacteria in the intestinal tract, forming a network, which is associated with poor prognosis. (A) A network diagram of bacteria correlated with Ruminococcus gnavus, created using the results of a compositional analysis of the intestinal microbiota of patients with PH.Figure B shows the results of a Kaplan-Meier analysis of event-free survival in PH patients classified by the abundance of Ruminococcus gnavus, Streptococcus, Rothia, Fusobacterium, or Veillonella in the intestine. In Figure B, clinical events were defined as death, lung transplantation, and hospitalization due to right heart failure. Figure 1 shows gut microbiota alterations in pulmonary hypertension model rats (International Publication No. 2021 / 167088). Figure A shows the procedure for creating pulmonary hypertension model rats. The upper panel shows hypoxia challenge, the middle panel shows monocrotaline challenge, and the lower panel shows the procedure for creating pulmonary hypertension model rats using Sugen5416 / hypoxia / normoxia challenge (SuHx). Figure B shows the beta diversity of the gut microbiota in each model rat. Figure C shows a bar plot showing the family-level composition of gut bacteria in the gut microbiota of each model rat. This figure shows that antibiotic administration to pulmonary hypertension rat models improves PH pathology (WO 2021 / 167088). (A) Hypoxic (Hx) model rats were given antibiotic cocktail water (Abx) or water (vehicle) ad libitum, and unstimulated SD rats were given water ad libitum (control). PH pathology (pulmonary artery media thickening, right ventricular systolic pressure, and right ventricular hypertrophy index) was evaluated. (B) MCT model rats were given antibiotic cocktail water (Abx) or water (vehicle) ad libitum, and PH pathology (pulmonary artery media thickening, right ventricular systolic pressure, and right ventricular hypertrophy index) was evaluated. (C) SuHx model rats were given antibiotic cocktail water (Abx) or water (vehicle) ad libitum, and PH pathology (pulmonary artery media thickening, right ventricular systolic pressure, and right ventricular hypertrophy index) was evaluated. Statistical values ​​are means ± standard deviation: ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05. Figures show changes in the pathology of pulmonary hypertension in gnotobiotic PH model rats. (A) shows a method for producing gnotobiotic PH model rats. (B) shows the results of analyzing the composition of the intestinal microbiota in F344 rats transplanted with feces from PH patients and healthy donors.(C) Right ventricular systolic pressure and right ventricular hypertrophy index were measured in F344 rats transplanted with feces from PH patients (MCT-PH), F344 rats transplanted with feces from healthy controls (MCT-HV), F344 rats housed in a germ-free environment (MCT-GF), and F344 rats housed in an SPF environment (MCT-SPF). Statistical values ​​are mean ± standard deviation. **P<0.01, *P<0.05. (A) RNA-seq analysis of lungs from F344 rats transplanted with feces from PH patients (PH) and F344 rats transplanted with feces from healthy controls (HV). (A) Volcano plot showing comparison of RNA expression in the lungs. (B) Gene Ontology Term analysis of RNA expression in the lungs. (C) Bar plot showing differences in expression of individual genes related to (B). (A) Experimental results of administering vancomycin to rats transplanted with feces from PH patients. (A) Experimental procedure. (B) Right ventricular systolic pressure and right ventricular hypertrophy index were measured in PH patient fecal transplant rats administered vancomycin (PH-FMT-VCM) and in PH patient fecal transplant rats administered water (vehicle) (PH-FMT). Statistics are mean ± standard deviation. **P<0.01, *P<0.05. (C) Shotgun analysis of gut bacteria using human fecal samples and AHR luciferase reporter assays using feces from humans and gnotobiotic rats. (A) Volcano plots show the results of KEGG module pathway analysis of fecal samples from PH patients and healthy controls using shotgun metagenomic data. (B) AHR ligand activity was measured in fecal samples from PH patients (PH) and healthy controls (HV) using AHR luciferase reporter assays. (C) shows the results of measuring AHR ligand activity in feces from gnotobiotic PH model rats (PH patient feces-transplanted F344 rats (PH-FMT) and healthy donor feces-transplanted F344 rats (HV-FMT)) using an AHR luciferase reporter assay. Statistics are means ± standard error. **P<0.01, ***P<0.001. (C) shows the results of measuring the concentrations of tryptophan and its metabolites in feces or fecal samples from humans and gnotobiotic rats using targeted LC-MS analysis.(A) Concentrations of tryptophan (Trp) and its metabolites (tryptamine (TryptA), indole-3-pyruvic acid (IPyA), indole-3-aldehyde (IAld), indole-3-acetic acid (IAA), indole-3-ethanol (IEt), indole-3-propionic acid (IPA), indole-3-lactic acid (ILA), and indole-3-acrylic acid (IAcr)) were measured in fecal samples from PH patients (PH) and healthy controls (HV). (B) Concentrations of tryptophan and its metabolites were measured in fecal samples from PH model gnotobiotic rats (PH feces-transplanted F344 rats and HV feces-transplanted F344 rats). Statistics are mean ± standard deviation. *P<0.05, **P<0.01, ***P<0.001, ****<0.0001). Figure 1 shows the results of an experiment in which an AHR inhibitor (CH223191) was administered to fecal transplanted rats from PH patients. Figure A shows the experimental procedure. Figure B shows the results of measurements of right ventricular systolic pressure and right ventricular hypertrophy index in fecal transplanted rats from PH patients administered an AHR inhibitor (CH223191) or corn oil (vehicle). Figure C shows a uniform manifold approximation and projection (UMAP) created based on the results of single-cell RNA-seq analysis of immune cells recovered from the lungs of the fecal transplanted rats from PH patients, along with the analysis results. Statistics are mean ± standard deviation. *P<0.05, ****P<0.0001. Figure 1 shows the results of simultaneous multi-analyte LC-MS analysis of fecal samples (HV n=28, PH n=31) and serum samples (HV n=24, PH n=24) from healthy subjects (HV) and PH patients (PH). The left panel shows the results for the fecal samples, and the right panel shows the results for the serum samples. Figures showing tryptophan concentrations in stool and serum samples from healthy subjects (HV), PH patients (PH), and heart failure patients (HF). A shows the tryptophan concentration in the stool sample, B shows the tryptophan concentration in the serum sample, and C shows the tryptophan concentration in the fasting serum sample. Statistical values ​​are mean ± standard deviation (A, B) or standard error (C). *p<0.05, **P<0.01, ***P<0.001. Figures showing the results of LC-MS measurement of amino acid concentrations in serum samples from healthy subjects and PH patients.Figure 17 shows the serum concentrations of tryptophan, valine, proline, asparagine, threonine, alanine, methionine, glycine, glutamic acid, and lysine from healthy subjects (HV) and patients with PH (PH), in that order from left to right. *P<0.05, **P<0.01, ***P<0.001. Figure 17 shows an intravenous experiment using CACO-2 cells, an intestinal epithelial cell line. (A) shows the expression level of ACE2 protein when cultured with 0-500 μM tryptamine. (B) shows the expression level of ACE2 protein when cultured with 200 μM tryptamine and 0-5 μM AHR inhibitor (BAY-218). *P<0.05, **P<0.01. This figure demonstrates that tryptamine suppresses ACE2 expression in an AHR-dependent manner, resulting in reduced tryptophan absorption in the small intestine. (A) shows the experimental procedure. Figure B shows Western blotting using small intestinal epithelial cell layers. Figure C shows quantification of Ace2 expression levels based on the results of Figure B. Figure D shows the results of a tritium-labeled tryptophan uptake experiment using small intestines isolated from wild-type SD rats (Slc6a19 + / +) and Slc6a19 knockout rats (Slc6a19 + / -, - / -). Figure E shows the results of a tritium-labeled tryptophan uptake experiment using small intestines isolated from wild-type SD rats (Ace2 + / y) and Ace2 knockout rats (Ace2 - / y). Statistics are means ± standard error. * p<0.05, *** p<0.001. Figure A shows the importance of tryptophan in the pathogenesis of PH. Figure A shows the experimental protocol. Figure B shows the results of measuring AHR activity in stool and serum. Figure C shows the results of measuring right ventricular systolic pressure and right ventricular hypertrophy index. Statistics are means ± standard deviation. D shows the results of measuring the tryptophan metabolite concentration in the feces. **P<0.01, ***P<0.001, ****<0.0001. This figure demonstrates that tryptamine intake induces aggravation of PH pathology. A shows the experimental procedure. B shows the results of measuring right ventricular systolic pressure and right ventricular hypertrophy index. C shows an Elastica van Gieson stained image of the lung of a rat fed a tryptamine-containing diet. In C, the arrow indicates the area where inflammatory cell infiltration was observed.Statistics are means ± standard deviations. *P<0.05, **P<0.01. Figure 1 shows that Ruminococcus gnavus worsens PH through synergistic interactions with Streptococcus pasteurianus. (A) Whole genome analysis (shotgun analysis) was performed on stool samples from healthy individuals (HV) and PH patients (PH) to determine the prevalence of the gene encoding tryptophan decarboxylase (K01593). (B) Analysis of the proportion of bacterial species carrying the K01593 gene. (C) Measured tryptamine (TryptA) concentrations in the culture medium over time after anaerobic in vitro culture of Ruminococcus gnavus, Streptococcus salivarius, Streptococcus pasteurianus, and Streptococcus mutans. (D) Protocol for administering Ruminococcus gnavus and Streptococcus pasteurianus to germ-free rats. E shows the results of measurements of right ventricular systolic pressure and right ventricular hypertrophy index in experiment D. F shows the results of measurements of mucin expression levels in small intestinal epithelial cells by qPCR in experiment D. In F, "GF" represents the condition without bacterial inoculation, "Gnavus" represents the condition inoculated with Ruminococcus gnavus only, "Gnavus+St" represents the condition inoculated with both Ruminococcus gnavus and Streptococcus pasteurianus, and "St" represents the condition inoculated with Streptococcus pasteurianus only. G shows the results of a Ruminococcus gnavus culture experiment with and without mucin, measuring the turbidity of the culture medium after culture. H shows the results of measurements of the concentrations of tryptophan and its metabolites in feces by LC-MS in experiment D. In H, "GF" represents a condition without bacterial inoculation, "Gnavus" represents a condition in which only Ruminococcus gnavus was inoculated, "St" represents a condition in which only Streptococcus pasteurianus was inoculated, and "Gnavus+St" represents a condition in which both Ruminococcus gnavus and Streptococcus pasteurianus were inoculated.Statistics are means ± standard deviation. *P<0.05, ***P<0.001. Figure 1 shows that dietary administration of AST-120 adsorbent charcoal adsorbed various indole compounds from the rat intestine. Figure 1 shows the experimental protocol. Figure 1 shows fecal concentrations of tryptamine (TryptA) and indole-3-pyruvic acid (IPyA), fecal concentrations of indole-3-aldehyde (IAld), fecal concentrations of indole-3-acetic acid (IAA), fecal concentrations of indole-3-ethanol (IEt), fecal concentrations of indole-3-propionic acid (IPA), fecal concentrations of indole-3-lactic acid (ILA), and fecal concentrations of tryptophan (Trp). Figure 1 shows the results of oral administration of AST-120 to gnotobiotic rats with PH, eliminating intestinal tryptophan metabolites and significantly improving PH pathology. Figure 1 shows the experimental protocol. (B) Right ventricular systolic pressure and right ventricular hypertrophy index were measured. (C) Fecal AHR ligand activity was measured. (D) Fecal concentrations of tryptamine (TryptA), indole-3-pyruvic acid (IPyA), indole-3-aldehyde (IAld), indole-3-acetic acid (IAA), indole-3-ethanol (IEt), indole-3-propionic acid (IPA), indole-3-lactic acid (ILA), and tryptophan (Trp) were measured. Statistics are mean ± standard deviation. *P<0.05, **P<0.01, ***P<0.001. This figure shows that rearing Regnase-1 Cd11cCre (Reg-1 CKO) mice, a model of spontaneous severe PAH, in a germ-free environment suppresses the spontaneous onset of PAH, and administration of adsorbed charcoal to Reg-1 CKO mice suppresses PAH pathogenesis. Panels A and B show the results of measuring right ventricular systolic pressure (A) and right ventricular hypertrophy index (B) in Reg-1 CKO mice after they were raised in an SPF environment or a germ-free (GF) environment. Reg1 f / w in A is a control group that does not develop PAH. Panel C shows the experimental protocol for administering AST-120 to Reg-1 CKO mice. Panel D shows the results of measuring right ventricular systolic pressure in the experiment in panel C. Statistical values ​​are mean ± standard deviation. **P<0.01.This figure shows that administration of adsorbed charcoal to PH model rats suppresses the formation of PAH pathology. (A) AST-120 was administered to monocrotaline-loaded PH model rats, and right ventricular systolic pressure was measured. (B) AST-120 was administered to hypoxia-loaded PH model rats, and right ventricular systolic pressure was measured. *P<0.05. This figure shows that adsorbed charcoal (AST-120, medicinal charcoal, and granulated activated charcoal) efficiently binds to indole compounds. The figures show the adsorption rates of L-valine, L-glutamic acid, 3-aminoisobutyric acid, L-tryptophan, tryptamine, indole-3-aldehyde, and indole-3-acetic acid measured by each adsorbed charcoal.

[0021] 1. Definitions Unless otherwise specified, terms used herein have the meanings that are commonly understood by those skilled in the art of medicine, pharmacology, molecular biology, microbiology, organic chemistry, etc. When a term defined herein does not have the same meaning as commonly understood, the description in this specification takes precedence.

[0022] In this disclosure, "pulmonary hypertension (PH)" refers to a group of progressive diseases with poor prognosis that cause cardiac and pulmonary dysfunction due to elevated pulmonary arterial blood pressure. Specifically, it is a condition in which the mean pulmonary arterial pressure (PAP) measured by right heart catheterization at rest is 25 mmHg or higher. According to the Nice Classification, PH is classified into the following groups: Group 1: pulmonary arterial hypertension (PAH); Group 1': pulmonary veno-occlusive disease (PVOD) and / or pulmonary capillary hemangiomatosis (PCH); Group 1'': persistent pulmonary hypertension of the newborn; Group 2: pulmonary hypertension associated with left heart disease; Group 3: pulmonary hypertension associated with lung disease and / or hypoxemia; Group 4: chronic thromboembolic pulmonary hypertension; and Group 5: pulmonary hypertension associated with an unknown multifactorial mechanism.

[0023] In this disclosure, "severity of PH" is classified according to the WHO Functional Classification of Pulmonary Hypertension, as shown in Table 1.

[0024] In the present disclosure, "aromatic hydrocarbon receptor (AHR)" refers to a transcription factor that binds to and is activated by an agonist (endogenous or exogenous ligand) and controls the expression of downstream genes such as CYP1A1 (cytochrome P450, family 1, subfamily A) and AHRR (AHR repressor).

[0025] In the present disclosure, "B0AT1" refers to the sodium-dependent neutral amino acid transporter B(0)AT1, a protein encoded by the SLC6A19 gene.

[0026] In the present disclosure, "angiotensin-converting enzyme 2 (ACE2)" is a protein that is one of the factors that work in the renin-angiotensin system and is also known to contribute to the absorption of neutral amino acids in the intestinal tract by functioning as a chaperone for B0AT1.

[0027] In the present disclosure, the term "indole compound that is a tryptophan metabolite" refers to a compound having an indole ring among compounds produced by the metabolism of tryptophan. Specific examples of indole compounds that are tryptophan metabolites include tryptamine (TryptA), indole-3-aldehyde (IAld), indole-3-pyruvic acid (IPyA), indole-3-ethanol (IEt), indole-3-acetic acid (IAA), indole-3-propionic acid (IPA), indole-3-acrylic acid (IAcr), indole-3-lactic acid (ILA), indole-3-acetaldehyde, indole-3-acetamide, indole-3-acetonitrile, indoxyl sulfate, 2-oxindole, indole-3-butyric acid, 3-methylindole, N-methyltryptamine, N-hydroxytryptamine, 3-methylindolepyruvic acid, indole-3-acetaldoxime, 3-methyldeoxyindole, 2-oxindoleacetic acid, 2-oxindole, indole-3-carbinol, indole, and indole-3-glycerol phosphate.

[0028] In this disclosure, "prevention" refers to inhibiting the onset of or prolonging the time until onset of a disease or condition, and "treatment" refers to alleviating, ameliorating, or slowing the rate of progression of a disease or condition.

[0029] In this disclosure, a "blood sample" is a sample derived from blood, and includes whole blood, serum, and plasma.

[0030] 2. Preventive or therapeutic drug for PH (1) that utilizes removal of tryptophan metabolites in the intestinal tract as a mechanism of action The present inventors have identified indole compounds, which are tryptophan metabolites, as ligands for AHR, which plays an important role in the pathogenesis of PH, and have discovered that PH can be prevented or treated by removing these indole compounds from the intestinal tract. Therefore, in one embodiment of the present disclosure, a preventive or therapeutic drug for PH (hereinafter referred to as "preventive or therapeutic drug for PH (1)") is provided, which contains a substance that can remove indole compounds, which are tryptophan metabolites, from the intestinal tract. The preventive or therapeutic drug for PH (1) of the present disclosure is described in detail below.

[0031] [Active ingredient] The PH preventive or therapeutic drug (1) of the present disclosure contains, as an active ingredient, a substance that can remove indole compounds, which are tryptophan metabolites, from the intestinal tract. The PH preventive or therapeutic drug (1) of the present disclosure makes it possible to prevent or treat PH by removing tryptophan metabolites (indole compounds) present in the intestinal tract.

[0032] In the PH preventive or therapeutic drug (1) of the present disclosure, the type of indole compound to be removed from the intestinal tract is not particularly limited, but preferred examples include tryptamine, indole-3-aldehyde, indole-3-pyruvic acid, indole-3-ethanol, indole-3-acetic acid, indole-3-propionic acid, indole-3-acrylic acid, and indole-3-lactic acid. The active ingredient may be capable of removing one indole compound from the intestinal tract, but preferably is capable of removing two or more indole compounds from the intestinal tract. Furthermore, among indole compounds, tryptamine plays a particularly important role in the pathogenesis of PH. Therefore, it is preferred that the active ingredient be capable of removing at least tryptamine from the intestinal tract. Furthermore, because tryptophan is an essential amino acid, it is preferred that the active ingredient be one that is difficult to remove tryptophan from the intestinal tract.

[0033] The type of substance that can remove indole compounds, which are tryptophan metabolites, from the intestinal tract is not particularly limited, but specific examples include substances that adsorb or bind to indole compounds, which are tryptophan metabolites.These substances adsorb or bind to tryptophan metabolites (indole compounds) present in the intestinal tract and excrete the tryptophan metabolites in feces without allowing them to function as AHR ligands, thereby making it possible to prevent or treat PH.

[0034] The substance that adsorbs to indole compounds is not particularly limited, as long as it adsorbs to the indole compounds and interferes with their function as AHR ligands, and a suitable example is a porous inorganic adsorbent (inorganic adsorbent). Specific examples of porous inorganic adsorbents include adsorbent carbon (activated carbon, medicinal carbon, etc.), activated alumina, silica gel, bentonite, diatomaceous earth, zeolite, molecular sieve, clay, silica-magnesia preparations, silica, zinc aluminosilicate, titanium oxide, iron oxide, tin oxide, titanium hydroxide, iron hydroxide, tin hydroxide, calcium carbide, montmorillonite, hydroxyapatite, talc, kaolin, carbon nanotubes, aluminum silicate, magnesium silicate, hydrotalcite, magnesium aluminometasilicate, aluminum oxide, aluminum oxide, aluminum hydroxide gel, silica-alumina minerals (such as chivlets and Secards), carbon nitride, platinum, glass, and boiling stones. The pore size of the porous inorganic adsorbent is not particularly limited, and may be any of micropores (2 nm or less), mesopores (2 to 50 nm), or macropores (50 nm or more), but a suitable example of a porous inorganic adsorbent is a porous inorganic adsorbent having mesopores (mesoporous inorganic adsorbent). The shape of the porous inorganic adsorbent is not particularly limited, as long as it can be administered into a living body, and may be any of powder, granules, etc.

[0035] Other examples of substances that adsorb to indole compounds include organic metal frameworks (porous coordination polymers composed of metal ions and crosslinkable organic ligands); tannic acid-based adsorbents such as albumin tannate; protein-based adsorbents such as albumin, lactoferrin, lactoglobulin, casein, and fragments thereof; thickeners such as gelatin, agar, alginic acid, carrageenan, pectin, and dextrin; micelles such as casein micelles; emulsifiers; synthetic adsorbents whose base polymer is polydivinylbenzene, polymethacrylate, polymethacrylate-divinylbenzene crosslinked, polystyrene-divinylbenzene crosslinked, or the like; ion exchange resins; and structures related thereto.

[0036] Among the substances that adsorb to indole compounds, a suitable example is a porous inorganic adsorbent (inorganic adsorbent), more preferably adsorbent carbon. Conventionally, as spherical adsorbent carbon for oral administration, spherical adsorbent carbon AST-120 (trade name: Kremezin), spherical adsorbent carbon (trade name: Mylan), and spherical adsorbent carbon (trade name: Nichi-Iko) have been used clinically for the purpose of improving uremic symptoms and delaying the introduction of dialysis in chronic renal failure. In the present disclosure, AST-120, spherical adsorbent carbon (Mylan), or spherical adsorbent carbon (Nichi-Iko) can also be used as the adsorbent carbon.

[0037] Substances that bind to indole compounds are not particularly limited, as long as they bind to indole compounds and thereby interfere with their function as AHR ligands. Specific examples include antibodies against indole compounds and antibody fragments thereof; albumin (recombinant albumin protein, etc.), albumin fragments, partial peptides thereof (including recombinant forms, etc.), and analogs thereof; AHR protein (recombinant AHR protein, etc.), partial peptides thereof (including recombinant forms, etc.), and analogs thereof; F-box protein (TIR1) (recombinant TIR1 protein, etc.), which is a subunit of the auxin (indole-3-acetic acid) receptor SCF (Skp1 / Cullin / F-box) complex, partial peptides thereof (including recombinant forms, etc.), and analogs thereof; serotonin receptor 4 (recombinant serotonin receptor 4 protein, etc.), partial peptides thereof (including recombinant forms, etc.), and analogs thereof; other indole compound-binding proteins (recombinant forms, etc.), partial peptides thereof, and analogs thereof. In addition, albumin has the property of binding to tryptamine as well as the property of adsorbing to indole compounds, and therefore albumin, albumin fragments, partial peptides thereof, etc. can be used either as a substance that adsorbs to indole compounds or as a substance that binds to indole compounds.

[0038] In one embodiment of the preventive or therapeutic drug for PH (1) of the present disclosure, the active ingredient is preferably a substance that adsorbs to an indole compound, more preferably an inorganic adsorbent (porous inorganic adsorbent), even more preferably adsorbent carbon, particularly preferably spherical adsorbent carbon, and even more preferably AST-120, Mylan spherical adsorbent carbon, or Nichi-Iko spherical adsorbent carbon.

[0039] In the preventive or therapeutic drug for PH (1) of the present disclosure, the substance capable of removing indole compounds, which are tryptophan metabolites, from the intestinal tract may be used alone or in combination of two or more.

[0040] The PH preventive or therapeutic drug (1) of the present disclosure is provided in a desired dosage form by blending the active ingredient with pharmaceutically acceptable carriers, additives, etc. Examples of pharmaceutically acceptable carriers or additives include sterile water, physiological saline, stabilizers, excipients, antioxidants, buffers, preservatives, surfactants, chelating agents, binders, etc.

[0041] The dosage form of the PH preventive or therapeutic drug (1) of the present disclosure may be, for example, capsules, tablets, pills, sachets, liquids, powders, granules, fine granules, film-coated formulations, pellets, troches, sublingual tablets, chewable tablets, buccal tablets, pastes, syrups, suspensions, elixirs, or emulsions. The content of the active ingredient in the PH preventive or therapeutic drug (1) of the present disclosure may be appropriately determined depending on the dosage, dosage form, etc.

[0042] [Dosage and Administration] In the preventive or therapeutic drug for PH (1) of the present disclosure, the clinical classification of PH to be prevented or treated is not particularly limited, and the PH may be classified into any of Groups 1, 1', 1'', 2, 3, 4, and 5 of the Nice Classification. In one embodiment, the preventive or therapeutic drug for PH (1) of the present disclosure can be used for the prevention or treatment of Group 1 (PAH) of the Nice Classification.

[0043] Furthermore, in the preventive or therapeutic drug for PH (1) of the present disclosure, the severity of PH to be treated is not particularly limited, and may be any of the severity levels I to IV in the WHO Functional Classification of Pulmonary Hypertension.

[0044] The route of administration of the PH preventive or therapeutic drug (1) of the present disclosure may be any route as long as the active ingredient can be transferred into the intestine, and examples thereof include oral administration and enteral administration, with oral administration being preferred.

[0045] The dosage of the PH preventive or therapeutic drug (1) of the present disclosure may be appropriately determined depending on the age of the subject, the severity of the PH condition, the type of active ingredient used, and the like. For example, the active ingredient may be administered to an adult at a dose of about 1 to 80,000 mg / kg, preferably about 10 to 8,000 mg / kg, of the active ingredient per day, 1 to 6 times per day, preferably 2 to 4 times per day. More specifically, when a porous inorganic adsorbent (particularly, adsorbent carbon) is used as the active ingredient, the porous inorganic adsorbent may be administered at a dose of about 10 to 8,000 mg / kg, preferably about 80 to 500 mg / kg, of the active ingredient per day, 1 to 6 times per day, preferably 2 to 4 times per day.

[0046] 3. Method for Testing the Presence or Severity of PH Using Tryptophan Concentration in Stool, Gastrointestinal Contents, or Blood Samples as an Indicator (PH Test Method (1)) The present inventors have discovered that tryptophan absorption is inhibited in the intestines of PH patients, and that PH patients have higher tryptophan concentrations in their stool and gastrointestinal contents and lower tryptophan concentrations in their blood compared to healthy individuals. Therefore, one embodiment of the present disclosure provides a method for testing the presence or absence of PH or the severity of PH, which includes a step of measuring the tryptophan concentration in stool, gastrointestinal contents, or blood sample collected from a subject (hereinafter referred to as "PH test method (1)"). The PH test method (1) of the present disclosure is described in detail below.

[0047] In the PH diagnostic method (1) of the present disclosure, the subject may be any person who needs to be tested for the presence or absence of PH or the severity of PH. Examples of people who need to be tested for the presence or absence of PH include healthy individuals and people suspected of having PH. Examples of people who need to be tested for the severity of PH include PH patients and people suspected of having PH.

[0048] In the pH testing method (1) of the present disclosure, the biological sample in which the tryptophan concentration is measured may be any of stool, digestive tract contents, or blood samples. The digestive tract contents are preferably the contents of the small intestine. The digestive tract contents can be collected, for example, by inserting a nasoenteric tube. Stool is preferred because it can be collected non-invasively. When using stool or digestive tract contents, an extract containing tryptophan may be prepared from the stool or digestive tract contents using an extraction solvent such as water as a sample for measuring the tryptophan concentration. The blood sample may be any of whole blood, serum, or plasma, with serum being a preferred example.

[0049] The tryptophan concentration in feces, digestive tract contents, or blood samples can be measured using known tryptophan measurement methods such as high performance liquid chromatography, liquid chromatography mass spectrometry, gas chromatography mass spectrometry, and enzyme-linked immunosorbent assay (ELISA).

[0050] When testing for the presence or absence of PH using the PH testing method (1) of the present disclosure, a subject with a high tryptophan concentration in stool or gastrointestinal contents is determined to be highly likely to have PH. In testing for the presence or absence of PH, the tryptophan concentration in stool or gastrointestinal contents can be determined by comparing the mean or median tryptophan concentrations in stool or gastrointestinal contents of healthy individuals and / or PH patients, or a cutoff value for distinguishing between the two, with the reference value. For example, if the tryptophan concentration in a subject's stool or gastrointestinal contents is higher than the mean or median tryptophan concentrations in stool or gastrointestinal contents of healthy individuals, the subject can be determined to be highly likely to have PH. Furthermore, if the tryptophan concentration in a subject's stool or gastrointestinal contents is equal to or higher than the mean or median tryptophan concentrations in stool or gastrointestinal contents of PH patients, the subject can be determined to be highly likely to have PH. The experimental results described below confirmed that the mean fecal tryptophan concentration in PH patients was 113.7 μg / g (dry fecal wt.), the median was 28.9 μg / g (dry fecal wt.), and the cutoff value providing optimal sensitivity and specificity between PH patients and healthy controls was 26.18 μg / g (dry fecal wt.). Therefore, either of these values ​​can be used as a reference value to determine whether or not a subject has PH.

[0051] Furthermore, when testing for the presence or absence of PH using the PH testing method (1) of the present disclosure, a subject with a low tryptophan concentration in a blood sample is determined to be highly likely to have PH. In testing for the presence or absence of PH, the level of tryptophan concentration in a blood sample can be determined by comparing the mean or median tryptophan concentrations of blood samples from healthy individuals and / or PH patients, or a cutoff value that distinguishes between the two, with the reference value. For example, if the tryptophan concentration in a subject's blood sample is lower than the mean or median tryptophan concentrations of blood samples from healthy individuals, the subject can be determined to be highly likely to have PH. Furthermore, if the tryptophan concentration in a subject's blood sample is equal to or lower than the mean or median tryptophan concentrations of blood samples from PH patients, the subject can be determined to be highly likely to have PH. The experimental results described below confirmed that the mean serum tryptophan concentration in PH patients was 7.48 μg / mL, the median was 7.35 μg / mL, and the cutoff value for optimal sensitivity and specificity between PH patients and healthy individuals was 13.0 μg / mL or less. Therefore, any of these values ​​can be used as a reference value to determine whether or not a subject has PH.

[0052] Furthermore, when testing the severity of PH using the PH testing method (1) of the present disclosure, subjects with higher tryptophan concentrations in their stool or gastrointestinal contents are determined to be more likely to have severe PH. In testing the severity of PH, the tryptophan concentration in their stool or gastrointestinal contents can be determined by comparing the mean or median tryptophan concentration in their stool or gastrointestinal contents, or a cutoff value that distinguishes between different levels of severity, with the reference value obtained in advance by dividing PH patients into groups according to severity.

[0053] Furthermore, when testing the severity of PH using the PH testing method (1) of the present disclosure, subjects with lower tryptophan concentrations in their blood samples are determined to be more likely to have severe PH. In testing the severity of PH, the tryptophan concentration in the blood sample can be determined by comparing it with a reference value obtained in advance by dividing PH patients into groups according to severity and determining the mean or median tryptophan concentrations in the blood samples, or a cutoff value that distinguishes between the mean and median values.

[0054] In the PH testing method (1) of the present disclosure, when the tryptophan concentration in the stool or digestive tract contents is high and the tryptophan concentration in the blood sample is low, it is determined with higher accuracy that the patient is likely to have PH or that the severity of PH is likely to be high, compared to when determination is based on only one of the indicators.

[0055] The PH testing method (1) of the present disclosure can be performed as a test to assist in the diagnosis of PH. Therefore, for subjects who are determined to have a high possibility of suffering from PH or whose PH is highly severe by the PH testing method (1) of the present disclosure, it is desirable to conduct further tests such as catheterization, echocardiography, electrocardiography, and chest X-ray to make a definitive diagnosis.

[0056] In one embodiment of the present disclosure, a test kit for use in carrying out the pH test method (1) is provided. The test kit may include a reagent for measuring tryptophan. The test kit may further include, as needed, an instrument for collecting stool or digestive tract contents, a reagent for extracting tryptophan from stool or digestive tract contents, and the like.

[0057] 4. Method for Testing the Presence or Severity of PH Using the Concentration of Tryptophan Metabolites in Stool, Gastrointestinal Contents, or Blood Samples as an Indicator (PH Test Method (2)) The present inventors have discovered that the high concentration of tryptophan in the intestines of PH patients results in high concentrations of indole compounds (AHR ligands), which are tryptophan metabolites, in the intestinal flora and blood. Therefore, one embodiment of the present disclosure provides a method for testing the presence or absence of PH or the severity of PH, which includes a step of measuring the concentration of indole compounds, which are tryptophan metabolites, in stool, gastrointestinal contents, or blood samples collected from a subject (hereinafter referred to as "PH Test Method (2)"). The PH Test Method (2) of the present disclosure is described in detail below.

[0058] In the pH testing method (2) of the present disclosure, the subject, stool, digestive tract contents, and blood sample are the same as those in the pH testing method (1).

[0059] In the pH testing method (2) of the present disclosure, the indole compound to be measured may be at least one selected from the group consisting of tryptamine, indole-3-aldehyde, indole-3-pyruvic acid, indole-3-ethanol, indole-3-acetic acid, indole-3-propionic acid, indole-3-acrylic acid, and indole-3-lactic acid. Among these indole compounds, the concentration of tryptamine is highly correlated with the pathological condition of pH, so it is preferable that the indole compound to be measured contains at least tryptamine. When two or more indole compounds are to be measured, the total concentration of the two or more indole compounds may be determined.

[0060] The concentration of indole compounds in feces, digestive tract contents, or blood samples can be measured by known tryptophan measurement methods such as high performance liquid chromatography, liquid chromatography mass spectrometry, gas chromatography mass spectrometry, and enzyme-linked immunosorbent assay (ELISA).

[0061] When testing for the presence or absence of PH using the PH testing method (2) of the present disclosure, subjects with high indole compound concentrations in stool, gastrointestinal contents, or blood samples are determined to be highly likely to have PH. In testing for the presence or absence of PH, the level of indole compound concentrations in stool, gastrointestinal contents, or blood samples can be determined by comparing the mean or median indole compound concentrations in stool, gastrointestinal contents, or blood samples from healthy individuals and / or PH patients, or a cutoff value that distinguishes between the two, with the reference value. For example, if the indole compound concentration in the stool, gastrointestinal contents, or blood sample of a subject is higher than the mean or median indole compound concentrations in stool, gastrointestinal contents, or blood samples of healthy individuals, the subject can be determined to be highly likely to have PH. Furthermore, if the indole compound concentration in the stool, gastrointestinal contents, or blood sample of a subject is equal to or higher than the mean or median indole compound concentrations in stool, gastrointestinal contents, or blood samples of PH patients, the subject can be determined to be highly likely to have PH.

[0062] Specific reference values ​​for testing for PH, estimated from the experimental results described below, are as follows: For fecal tryptamine concentrations, the mean and median values ​​for PH patients were 4648 ng / g (dry fecal wt.), 1589 ng / g (dry fecal wt.), and a cutoff value of 1559 ng / g (dry fecal wt.) was confirmed to provide optimal sensitivity and specificity between PH patients and healthy controls. For fecal indole-3-aldehyde concentrations, the mean and median values ​​for PH patients were 179.9 ng / g (dry fecal wt.), 106.0 ng / g (dry fecal wt.), and a cutoff value of 97.13 ng / g (dry fecal wt.) was confirmed to provide optimal sensitivity and specificity between PH patients and healthy controls. The mean and median fecal concentrations of indole-3-pyruvic acid in PH patients were 1177 and 623 ng / g (dry fecal wt.), respectively, with a cutoff of 558 ng / g (dry fecal wt.) for optimal sensitivity and specificity between PH patients and healthy controls. The mean and median fecal concentrations of indole-3-ethanol in PH patients were 363.1 and 155.9 ng / g (dry fecal wt.), respectively, with a cutoff of 342.6 ng / g (dry fecal wt.) for optimal sensitivity and specificity between PH patients and healthy controls. The mean fecal indole-3-acetic acid concentration in PH patients was 13,986 ng / g (dry fecal wt.), the median was 4,851 ng / g (dry fecal wt.), and the cutoff value for optimal sensitivity and specificity between PH patients and healthy controls was 6,097 ng / g (dry fecal wt.).The mean and median fecal concentrations of indole-3-propionic acid in PH patients were 7238 and 2750 ng / g (dry fecal wt.), respectively, with a cutoff of 12630.8 ng / g (dry fecal wt.) for optimal sensitivity and specificity between PH patients and healthy controls. The mean and median fecal concentrations of indole-3-acrylic acid in PH patients were 174.1 and 84.5 ng / g (dry fecal wt.), respectively, with a cutoff of 159.2 ng / g (dry fecal wt.) for optimal sensitivity and specificity between PH patients and healthy controls. The fecal indole-3-lactic acid concentration in patients with PH has been confirmed to be a mean of 20,099 ng / g (dry fecal wt.), a median of 830.5 ng / g (dry fecal wt.), and a cutoff value of 249.1 ng / g (dry fecal wt.) that provides optimal sensitivity and specificity between patients with PH and healthy controls. At least one of these values ​​can be used as a reference value to determine whether a subject has PH.

[0063] When testing the severity of PH using the PH testing method (2) of the present disclosure, subjects with higher indole compound concentrations in stool, gastrointestinal contents, or blood samples are determined to be likely to have a high severity of PH. In testing the severity of PH, the level of the indole compound concentration in stool, gastrointestinal contents, or blood samples can be determined in advance by dividing PH patients into groups according to severity and determining the mean or median of the indole compound concentrations in stool, gastrointestinal contents, or blood samples, or a cutoff value that distinguishes between different levels of severity, and comparing the results with the reference value.

[0064] The PH testing method (2) of the present disclosure can be performed as a test to assist in the diagnosis of PH. Therefore, for subjects who are determined to have a high possibility of suffering from PH or whose PH is highly severe by the PH testing method (2) of the present disclosure, it is desirable to conduct further tests such as catheterization, echocardiography, electrocardiography, and chest X-ray to make a definitive diagnosis.

[0065] In one embodiment of the present disclosure, a test kit for use in carrying out the pH test method (2) is provided. The test kit may include a reagent for measuring indole compounds. The test kit may further include, as needed, an instrument for collecting stool or digestive tract contents, a reagent for extracting indole compounds from stool or digestive tract contents, and the like.

[0066] 5. Method for Testing the Presence or Severity of PH Using AHR Activity in Stool or Gastrointestinal Contents as an Indicator (PH Test Method (3)) The present inventors have discovered that indole compounds, which are tryptophan metabolites, are AHR ligands, and that the high concentrations of these indole compounds in the intestines of PH patients result in high AHR activity in stool and gastrointestinal contents. Therefore, one embodiment of the present disclosure provides a method for testing the presence or absence of PH or the severity of PH, which includes a step of measuring AHR activity in stool or gastrointestinal contents collected from a subject (hereinafter referred to as "PH test method (3)"). The PH test method (3) of the present disclosure is described in detail below.

[0067] In the pH testing method (3) of the present disclosure, the subject, stool, and digestive tract contents are the same as those in the pH testing method (1).

[0068] In the PH testing method (3) of the present disclosure, the AHR activity in stool or gastrointestinal contents can be measured by measuring the transcriptional activity of AHR. The transcriptional activity of AHR can be measured by the following method: A reporter gene assay cell line is used, into which a plasmid vector with a reporter gene linked downstream of a foreign body response element (XRE) is introduced. An example of the reporter gene is the luciferase gene. The reporter gene assay cell line is cultured in the presence of a sample isolated and prepared from a subject, and the expression level of the reporter gene is measured. The expression level of the reporter gene is proportional to the activity (transcriptional activity) of AHR. Therefore, the activity of AHR in the sample can be evaluated based on the expression level of the reporter gene. When a luciferase gene is used as the reporter gene, the expression level of the luciferase gene can be measured by measuring the amount of luminescence produced by the catalytic reaction of luciferase upon expression of the luciferase gene using a luminometer. Reporter gene assays can be performed using commercially available reagents (including assay cell lines). Reagents for performing AHR luciferase reporter assays are commercially available, such as IB06001 from INDIGO Biosciences.

[0069] When testing for the presence or absence of PH using the PH testing method (3) of the present disclosure, subjects with high AHR activity in their stool or gastrointestinal contents are determined to have a high likelihood of having PH. In testing for the presence or absence of PH, the level of AHR activity in their stool or gastrointestinal contents can be determined by comparing the mean or median AHR activity in the stool or gastrointestinal contents of healthy subjects and / or PH patients, or a cutoff value for distinguishing between the two, with the reference value. For example, if the AHR activity in the stool or gastrointestinal contents of a subject is higher than the mean or median AHR activity in the stool or gastrointestinal contents of healthy subjects, the subject can be determined to have a high likelihood of having PH. Furthermore, if the AHR activity in the stool or gastrointestinal contents of a subject is equal to or higher than the mean or median AHR activity in the stool or gastrointestinal contents of PH patients, the subject can be determined to have a high likelihood of having PH.

[0070] Furthermore, when testing the severity of PH using the PH testing method (3) of the present disclosure, subjects with higher AHR activity in their stool or gastrointestinal contents are determined to be likely to have a high severity of PH. In testing the severity of PH, the level of AHR activity in their stool or gastrointestinal contents can be determined in advance by dividing PH patients into groups according to severity and determining the mean or median AHR activity in their stool or gastrointestinal contents, or a cutoff value that distinguishes between different levels of severity, and comparing the level with the reference value.

[0071] The PH testing method (3) of the present disclosure can be performed as a test to assist in the diagnosis of PH. Therefore, for subjects who are determined to have a high possibility of having PH or whose PH is highly severe by the PH testing method (3) of the present disclosure, it is desirable to conduct further tests such as catheterization, echocardiography, electrocardiography, and chest X-ray to make a definitive diagnosis.

[0072] In one embodiment of the present disclosure, a test kit for use in carrying out PH test method (3) is provided. The test kit may include a reagent for measuring AHR activity (e.g., a reagent for performing an AHR luciferase reporter assay). The test kit may further include, as needed, an instrument for collecting stool or gastrointestinal contents, a reagent for extracting indole compounds from stool or gastrointestinal contents, and the like.

[0073] 6. Method for Determining the Presence or Severity of PH Using ACE2 Concentration in Stool, Gastrointestinal Contents, or Blood Samples as an Indicator (PH Test Method (4)) The present inventors have discovered that the intestinal tract of PH patients has reduced ACE2 expression levels due to high concentrations of indole compounds (AHR ligands), which are tryptophan metabolites, resulting in low ACE2 concentrations in stool, gastrointestinal contents, and blood samples. Therefore, one embodiment of the present disclosure provides a method for determining the presence or severity of PH, comprising measuring the ACE2 concentration in stool, gastrointestinal contents, or blood samples collected from a subject (hereinafter referred to as "PH Test Method (4)"). The PH Test Method (4) of the present disclosure is described in detail below.

[0074] In the pH testing method (4) of the present disclosure, the subject, stool, digestive tract contents, and blood sample are the same as those in the pH testing method (1).

[0075] The ACE2 concentration in the intestinal flora or blood samples can be measured by known ACE2 measurement methods such as enzyme-linked immunosorbent assay (ELISA), immunoprecipitation, Western blotting, LC-MS / MS MRM, etc. The ACE2 concentration in blood samples can be measured by measuring soluble ACE2.

[0076] When testing for the presence or absence of PH using the PH testing method (4) of the present disclosure, subjects with low ACE2 concentrations in stool, gastrointestinal contents, or blood samples are determined to be highly likely to have PH. In testing for the presence or absence of PH, the level of ACE2 concentration in stool, gastrointestinal contents, or blood samples can be determined by comparing the mean or median ACE2 concentrations in stool, gastrointestinal contents, or blood samples from healthy individuals and / or PH patients, or a cutoff value that distinguishes between the two, with the reference value. For example, if the ACE2 concentration in a subject's stool, gastrointestinal contents, or blood sample is lower than the mean or median ACE2 concentration in stool, gastrointestinal contents, or blood samples from healthy individuals, the subject can be determined to be highly likely to have PH. Furthermore, if the ACE2 concentration in a subject's stool, gastrointestinal contents, or blood sample is equal to or lower than the mean or median ACE2 concentration in stool, gastrointestinal contents, or blood samples from PH patients, the subject can be determined to be highly likely to have PH.

[0077] Furthermore, when testing the severity of PH using the PH testing method (4) of the present disclosure, subjects with lower ACE2 concentrations in stool, gastrointestinal contents, or blood samples are determined to be more likely to have severe PH. In testing the severity of PH, the level of ACE2 concentration in stool, gastrointestinal contents, or blood samples can be determined by comparing the mean or median ACE2 concentration in stool, gastrointestinal contents, or blood samples, or a cutoff value that distinguishes between different levels of severity, as a reference value, by dividing PH patients into groups according to severity.

[0078] The PH testing method (4) of the present disclosure can be performed as a test to assist in the diagnosis of PH. Therefore, it is desirable that subjects who are determined to have a high possibility of having PH by the PH testing method (4) of the present disclosure undergo further tests such as catheterization, echocardiography, electrocardiography, and chest X-ray.

[0079] In one embodiment of the present disclosure, a test kit for use in carrying out the PH test method (4) is provided. The test kit may include a reagent for measuring ACE2 (e.g., an anti-ACE2 antibody, etc.). The test kit may further include, as needed, an instrument for collecting intestinal flora, a reagent for extracting ACE2 from stool or digestive tract contents, etc.

[0080] 7. Preventive or Therapeutic Drug for PH (2) Based on Increasing ACE2 Expression in the Intestinal Tract The present inventors have discovered that in the intestinal tract of PH patients, high concentrations of indole compounds (AHR ligands), which are tryptophan metabolites, result in reduced ACE2 expression, which in turn leads to reduced B0AT1 function and contributes to the pathology of PH. Therefore, one embodiment of the present disclosure provides a preventive or therapeutic drug for PH (hereinafter referred to as "Preventive or Therapeutic Drug for PH (2)") that contains a substance that increases ACE2 expression. The presently disclosed preventive or therapeutic drug for PH (2) is described in detail below.

[0081] [Active ingredient] The PH preventive or therapeutic drug (2) of the present disclosure contains, as an active ingredient, a substance that increases the expression level of ACE2. The PH preventive or therapeutic drug (2) of the present disclosure increases the expression level of ACE2 in the intestinal tract and normalizes the function of B0AT1, thereby making it possible to prevent or treat PH.

[0082] Substances that increase the expression level of ACE2 are not particularly limited, as long as they can promote the expression of ACE2 and are pharmaceutically acceptable, but examples include bile acids (ursodeoxycholic acid, etc.), mineralocorticoid receptor antagonists, 17β-estradiol, atorvastatin, diminazene diaceturate, fibroblast growth factor 21 (FGF21), and polyinosinic acid-polycytidylic acid potassium salt (Poly(I:C)).

[0083] In the preventive or therapeutic drug for PH (2) of the present disclosure, the substance that increases the expression level of ACE2 may be used alone or in combination of two or more.

[0084] The PH preventive or therapeutic drug (2) of the present disclosure is provided in a desired dosage form by blending the active ingredient with pharmaceutically acceptable carriers, additives, etc. Examples of pharmaceutically acceptable carriers or additives include sterile water, physiological saline, stabilizers, excipients, antioxidants, buffers, preservatives, surfactants, chelating agents, binders, etc.

[0085] Examples of dosage forms of the PH preventive or therapeutic drug (2) of the present disclosure include capsules, tablets, pills, sachets, liquids, powders, granules, fine granules, film-coated formulations, pellets, troches, sublingual tablets, chewable tablets, buccal tablets, pastes, syrups, suspensions, elixirs, and emulsions. The content of the active ingredient in the PH preventive or therapeutic drug (2) of the present disclosure may be appropriately determined depending on the dosage, dosage form, and the like.

[0086] [Dosage and Administration] In the preventive or therapeutic drug for PH (2) of the present disclosure, the clinical classification of PH to be prevented or treated is not particularly limited, and the PH may be classified into any of Groups 1, 1', 1'', 2, 3, 4, and 5 of the Nice Classification. In one embodiment, the preventive or therapeutic drug for PH (2) of the present disclosure can be used for the prevention or treatment of Group 1 (PAH) of the Nice Classification.

[0087] Furthermore, in the preventive or therapeutic drug for PH (2) of the present disclosure, the severity of PH to be treated is not particularly limited, and may be any of the severity levels I to IV in the WHO Functional Classification of Pulmonary Hypertension.

[0088] The route of administration of the PH preventive or therapeutic agent (2) of the present disclosure may be any route as long as the active ingredient can be transferred into the intestine, and examples thereof include oral administration and enteral administration, with oral administration being preferred.

[0089] The dosage of the preventive or therapeutic drug for PH (2) of the present disclosure may be appropriately determined depending on the age of the subject, the severity of the PH condition, the type of active ingredient used, and the like. For example, the active ingredient may be administered in a dose of about 1 to 100 mg / kg, preferably about 1 to 20 mg / kg, per day for an adult, in 1 to 4 divided doses per day, preferably 2 to 3 divided doses per day.

[0090] The present disclosure will be explained in more detail below by showing examples, but it should not be construed as being limited to these examples.

[0091] 1. Test Materials and Methods 1-1. Clinical Study With approval from the ethics committee, fecal and blood samples were collected from 89 PH patients and 82 healthy controls. The PH patients included 40 with idiopathic / hereditary pulmonary arterial hypertension, 19 with collagen vascular disease-related pulmonary arterial hypertension, 10 with pulmonary hypertension associated with portal hypertension, 8 with chronic thromboembolic pulmonary hypertension, 7 with pulmonary arterial hypertension associated with congenital shunt disease, and 5 with other conditions. The healthy controls were age- and sex-matched. Table 2 shows the background characteristics of PH patients and healthy controls. Feces were collected from the subjects, transported to the laboratory at 4°C as quickly as possible, and stored at -80°C until analysis. Blood samples were centrifuged at 3500 rpm for 5 minutes to collect serum, which was then stored at -80°C until analysis.

[0092]

[0093] 1-2. Measurement of Fecal Short-Chain Fatty Acid Concentration To measure fecal organic acids, 100 mg of feces was placed in a 2.0 mL tube with zirconia beads and suspended in MilliQ. The sample was heated at 85°C for 15 minutes, vortexed at 5 m / s for 45 seconds using a FastPrep 24 5G (MPBiomedicals, CA, USA), centrifuged at 15,350 × g for 10 minutes, and the supernatant was filtered through a 0.2 μm filter. The organic acid concentrations in the filtrate were measured by high-performance liquid chromatography (Prominence, SHIMADZU, Kyoto, Japan), a detector (CDD-10A, SHIMADZU, Kyoto, Japan), two tandem columns (Shim-pack SCR-102(H), 300 mm × 8 mm ID, SHIMADZU, Kyoto, Japan), and a guard column (Shim-pack SCR-102(H), 50 mm × 6 mm ID, SHIMADZU, Kyoto, Japan) using a post-column reaction. The mobile phase (5 mM p-toluenesulfonic acid) and reaction solution (5 mM p-toluenesulfonic acid, 100 μM EDTA, 20 mM Bis-Tris) were used.

[0094] 1-3. Animal Experiments All experiments were conducted under the guidelines of the National Cerebral and Cardiovascular Center Animal Committee and approved by the National Cerebral and Cardiovascular Center Institutional Review Board. Ahr knockout (Ahr - / -) rats (Masaki et al., PNAS, 2021, 118(11):e2023899118), Ace2 knockout rats (Ace2 - / y), and Slc6a19 knockout rats (Slc6a19 + / -, - / -) were generated using CRISPR / Cas9 gene editing. All rats were housed at 24 ± 1°C with a 12-hour light / 12-hour dark cycle and provided with standard mouse chow and water.

[0095] Gnotobiotic experiments: Male germ-free F344 rats were purchased from Japan SLC Co., Ltd. and bred in a sterile isolator environment. 11-week-old rats were administered feces from healthy individuals or patients with pulmonary hypertension, and 15-week-old rats were administered monocrotaline (MCT) subcutaneously to create gnotobiotic rats with pulmonary hypertension. Specifically, feces from four healthy individuals were mixed in an anaerobic chamber and diluted with anaerobic transport medium (1000 mL containing 20 g of Lablemco powder, 1 g of L-cysteine, 0.45 g of KH2PO4, 0.9 g of NaCl, 0.45 g of (NH4)2SO4, 0.045 g of CaCl2, 0.045 g of MgSO4, 400 mL of glycerol, and 600 mL of distilled water) to prepare a diluted fecal solution from healthy individuals. Similarly, feces from four patients were mixed in an anaerobic chamber and diluted with anaerobic transport medium to prepare a diluted fecal solution from patients. Subsequently, 11-week-old rats were orally administered the diluted fecal solution from healthy individuals (final 10-fold dilution) or the diluted fecal solution from patients (final 10-fold dilution) in separate isolators to generate fecal transplant gnotobiotic rats reproducing the gut microbiota of healthy individuals and patients. Four weeks after fecal transplantation (at 15 weeks of age), the rats were subcutaneously injected with 60 mg / kg of monocrotaline (Sigma Aldrich) and then housed in an isolator for three weeks to generate gnotobiotic rat models of PH. Table 3 shows the basic information for the PH patients and healthy controls used in fecal transplantation.

[0096]

[0097] (Gnotobiotic experiment with AHR inhibitor administration) Patient-derived feces were administered to 11-week-old germ-free rats, and at 15 weeks of age, monocrotaline was administered subcutaneously to create a gnotobiotic rat model of pulmonary hypertension. Starting the day after monocrotaline administration, the vehicle group received corn oil, and the AHR inhibitor group received CH223191 (Sellec) at 8 mg / kg / day via gavage. On the 21st day after monocrotaline administration, right ventricular systolic pressure and right ventricular hypertrophy index were measured, and feces, blood, and organ samples were collected.

[0098] (Gnotobiotic experiment using low-tryptophan or high-tryptophan diets) 11-week-old germ-free rats were administered patient-derived feces, and 13-week-old rats were divided into low-tryptophan and high-tryptophan diet groups. The low-tryptophan group received a diet containing 0.1 w / w% tryptophan, while the high-tryptophan group received a diet containing 1.25 w / w% tryptophan. At 15 weeks of age, monocrotaline was administered subcutaneously to induce pulmonary hypertension. Twenty-one days after monocrotaline administration, right ventricular systolic pressure and right ventricular hypertrophy index were measured, and feces, blood, and organ samples were collected.

[0099] (Gnotobiotic experiment using single or dual bacterial transplants) Ruminococcus gnavus (JCM6515) and Streptococcus pasteurianus (isolated from rat feces transplanted with patient feces) were cultured in trypticase soy broth under anaerobic conditions at 37°C. 11-week-old germ-free rats were inoculated with either single or dual bacterial strains of Ruminococcus gnavus or Streptococcus pasteurianus. At 15 weeks of age, monocrotaline was administered subcutaneously to induce pulmonary hypertension. 21 days after monocrotaline administration, right ventricular systolic pressure and right ventricular hypertrophy index were measured, and feces, blood, and organ samples were collected.

[0100] (AST-120-administered gnotobiotic experiment) Patient-derived feces were administered to 1-week-old germ-free rats, and at 15 weeks of age, monocrotaline was administered subcutaneously to create a gnotobiotic rat model of pulmonary hypertension. Starting the day after monocrotaline administration, the vehicle group received a standard sample (CRF-1 powdered feed), while the AST-120 group received CRF-1 powdered feed containing 8 wt% AST-120. Twenty-one days after monocrotaline administration, right ventricular systolic pressure and right ventricular hypertrophy index were measured, and feces and organs were collected.

[0101] 1-3-2. Experiments in an SPF (Specific Pathogen Free) Environment Experiments in an SPF environment were conducted using Sprague-Dawley (SD) rats purchased from Charles River Japan, Inc. Male rats aged 6 to 8 weeks were used.

[0102] 1-3-3. Experiments using Regnase-1 CD11c-Cre mice We used Regnase-1 CD11c-Cre (Reg-1 CKO) mice (Yaku et al., 2022, Circulation, 146(13):1006-1022), kindly provided by Professor Osamu Takeuchi of the Kyoto University Graduate School of Medicine.

[0103] 1-3-4. Tryptamine administration experiment 13-week-old germ-free F344 rats were fed standard chow (CRF-1 powder) in the vehicle group and 1.25 w / w% tryptamine-containing CRF-1 powder in the tryptamine group. At 15 weeks of age, pulmonary hypertension was induced by subcutaneous administration of 60 mg / kg of monocrotaline. 21 days after monocrotaline administration, right ventricular systolic pressure and right ventricular hypertrophy index were measured, and feces, blood, and organ samples were collected.

[0104] 1-3-5. AST-120 administration experiment (SD rats; measurement of tryptophan metabolites) Six-week-old male SD rats were divided into a vehicle group and an AST-120 group. The vehicle group was fed a standard diet (CRF-1 powder), while the AST-120 group was fed a CRF-1 powder containing 8 w / w% AST-120. Feces were collected on the 7th day, and tryptophan metabolites (indole compounds) in the feces were measured using LC-MS.

[0105] (Monocrotaline-loaded SD rats; measurement of right ventricular systolic pressure) Six-week-old male SD rats housed in a special-purpose environment were divided into a vehicle group and an AST-120 group. At 6 weeks of age, both groups were subcutaneously administered 60 mg / kg of monocrotaline to induce pulmonary hypertension. The vehicle group was fed a standard diet (CRF-1 powder), while the AST-120 group was fed a CRF-1 powder containing 8 wt% AST-120 for 3 weeks. Right ventricular systolic pressure was measured 3 weeks after monocrotaline administration.

[0106] (Hypoxia-loaded SD rats; measurement of right ventricular systolic pressure) Six-week-old male SD rats housed in a specific-pathway environment were divided into a vehicle group and an AST-120 group. Both groups were continuously housed in a chamber maintained at 10% oxygen for 4 weeks. During the 10% oxygen housing period, the vehicle group was fed standard chow (CRF-1 powder), while the AST-120 group was fed CRF-1 powder containing 8 wt% AST-120. Right ventricular systolic pressure was measured after 4 weeks of housing in the 10% oxygen condition.

[0107] (Regnase-1 CD11c-Cre mice) Four-week-old Regnase-1 CD11c-Cre (Regnase-1 KO) mice were divided into a vehicle group and an AST-120 group. The vehicle group received a standard sample (CRF-1 powdered diet), while the AST-120 group received CRF-1 powdered diet containing 8 w / w% AST-120. After 4 weeks, right ventricular systolic pressure and right ventricular hypertrophy index were measured.

[0108] 1-4. Measurement of Right Ventricular Systolic Pressure. Rats were sedated and analgesic using inhalation anesthesia with isoflurane (Pfizer). During the procedure, rat body temperature was maintained at 37–38°C using a thermostatically controlled heat pad linked to a rectal temperature monitor. After tracheotomy, rats were ventilated with a rat ventilator (Harvard apparatus) at a tidal volume of 10 μL / g and 70 breaths / min. Right ventricular pressure (RVP) was measured using a polyethylene tube inserted into the right external jugular vein and advanced to the right ventricle. The RVP signal was detected by a pressure transducer (MLT0670; AD Instruments), relayed by a pressure amplifier (ML117; AD Instruments), continuously sampled by a Power Lab system (AD Instruments, Colorado Springs, CO), and recorded on a computer using Chart software (AD Instruments). Heart rate was calculated based on the peak right ventricular systole.

[0109] Measurement of right ventricular systolic pressure in mice was performed under the same conditions as in rats, except that (1) the ventilator was set to 160-170 breaths / min, and (2) a 24G needle with a polyethylene tube catheter inserted was inserted into the right ventricle below the diaphragm to measure RVP.

[0110] 1-5. Measurement of right ventricular hypertrophy index (Fulton's index) After measuring right ventricular systolic pressure, the rats were euthanized by administering an overdose of anesthetic and the hearts were removed. The atria were removed, and the right ventricle was separated from the left ventricle and septum. After blotting, the weights of the right ventricle and the left ventricle plus septum were measured, and the weight ratio of the two (right ventricle / left ventricle weight ratio) was calculated as the right ventricular hypertrophy index to evaluate right ventricular hypertrophy.

[0111] 1-6. RNA-seq Analysis. The quality of RNA and library preparation was assured using TapeStation (Agilent). For RNA-sequencing analysis of rat lung, 100 ng of total RNA was used for ribosomal RNA removal, followed by library preparation using the TruSeq Stranded mRNA Sample Preparation Kit (Illumina). For RNA-sequencing analysis of human or rat peripheral blood mononuclear cells (PBMCs), 100 pg of total RNA was used, and library preparation was performed using the SMART-seq v4 Ultra Low Input RNA Kit (Takara Clontech). More than 25 million reads with 75 bp paired-end reads were obtained per sample. Quality control of sequencing data was performed using FastQC. Trimmed and filtered reads were aligned to the rat genome version rn6 reference genome for rats using the rat genome (Rn6) and to the human genome (hg38) reference genome for humans using Hisat2. Genes specifically expressed in lung tissue were defined as those showing a 2-fold or less change in expression level with a false discovery rate (FDR) of <0.05. Genes specifically expressed in PBMCs were defined as those showing a 1.5-fold or greater change in expression level in humans and a 2-fold or greater change in expression level in rats with a P <0.05.

[0112] 1-7. Metagenomic Analysis (16S Analysis) DNA was extracted from feces using a NecleoSpin DNA stool (Macherey-Nagel). 16S Metagenomic Sequencing Library Preparation (Illumina) was used to prepare libraries according to the manufacturer's protocol using a primer set targeting 16S ribosomal RNA V1-V2 (27Fmod: 5'-AGRGTTTGATCMTGGCTCAG-3' (SEQ ID NO: 1) and 338R: 5'-TGCTGCCTCCCGTAGGAGT-3' (SEQ ID NO: 2)). The 251-nt amplicon was sequenced using the MiSeq System (Illumina). The resulting paired-end reads were merged using PEAR (sco.h-its.org / exelixis / web / software / pear / ) and trimmed using BBtrim (bbmap.sourceforge.net). Further, up to 20,000 reads per sample were randomly extracted using random_sequence_sample.pl (ualberta.ca / ~stothard / software.html). The processed sequences were clustered into operational taxonomic units (OTUs) based on 99% identity using UCLUST version 1.2.33q. Each OTU was taxonomically classified using the Silvav138 database, and bioinformatic bacterial community analysis was performed using QIIME version 2.

[0113] (Shotgun analysis) Whole-genome sequencing was performed on a DNBSEQ-G400 (MGI Tech) system, generating paired-end reads of 150 bases each. The main steps of the quality check (QC) process were (i) trimming of low-quality bases, (ii) removal of duplicate reads, and (iii) identification and masking of human reads. Duplicate reads were marked using PRINSEQ-lite53 (version 0.20.4). Raw reads were trimmed using Trimomatic (version 0.39) to clip Illumina adapters and remove low-quality bases at both ends. Reads less than 60 bp in length after trimming were discarded. Next, duplicates were removed from duplicates of the same sequence, leaving only the longest read. As a final QC step, the quality-filtered reads were aligned to the human reference genome (hg38) using bowtie2 (version 2.3.5) and BMTagger (version 3.101). Only reads that failed paired-end alignment with either tool were retained. For phylogenetic annotation and abundance quantification, filtered paired-end reads were aligned to a reference genome dataset using bowtie2. For multiply mapped reads, only the best alignment was selected by alignment score. The number of reads mapped to each genome was divided by the genome length. The values ​​for each genome were summed for each sample to calculate the relative abundance of species-level clades.

[0114] The filtered paired-end reads were de novo assembled into contigs using MEGAHIT (version 1.2.9). Open reading frames (ORFs) on the contigs were predicted using MetageneMark (version 3.38). The ORF catalog was then annotated using the Kyoto Encyclopedia of Genes and Genomes (KEGG) protein database (https: / / www.kegg.jp). Annotation was performed using the KEGG gene database for prokaryotes and MGENES, a database of KEGG genes for metagenomic samples. The deduced amino acid sequences translated from the ORF catalog were aligned with the KEGG protein database using BLASTP (version v0.9.32.133) in DIAMOND. To quantify ORF abundance, the filtered paired-end reads were mapped to the assembled contigs using bowtie2 with default parameters. To avoid gene size bias, ORF abundance was defined as the region depth of each ORF in the ORF catalog according to the mapping results. After sample QC, bacterial abundance data were QC and normalized, followed by normalization of microbial gene ortholog abundance data.

[0115] AHR luciferase reporter assays were performed using INDIGO Biosciences' IB06001 according to the manufacturer's instructions, except for the stimulation conditions. Stimulation was performed by adding serum or fecal extract in PBS to the medium described in the manufacturer's instructions to a final concentration of 10 w / v%.

[0116] 1-9. LC-MS Analysis The standard substances for tryptophan and indole compounds measured by LC-MS analysis are shown in Table 4.

[0117]

[0118] 1-10. Preparation of measurement samples Four volumes of methanol were added to serum, followed by vortexing and centrifugation, and the resulting supernatant was used for analysis. Four volumes of 0.1% formic acid water were added to feces, which were then homogenized by bead crushing. The supernatant after centrifugation was mixed with an equal volume of methanol. The sample mixed with methanol was further centrifuged, and the resulting supernatant was filtered and used for analysis. For the measurement of IPyA in serum and feces, 0.25 mol / L 2-aminoethanethiol (pH 8.0) was added in an amount three times the amount of the supernatant when methanol was added, and the mixture was allowed to react at room temperature for one hour, followed by centrifugation, and the resulting supernatant was measured as TAZ.

[0119] 1-11. LC-MS Analysis Ultra-high performance liquid chromatography (UHPLC) separation was performed using a Shimadzu Nexera ultra-high performance liquid chromatograph, with a Shimadzu GLC Shim-pack Scepter C18 column (inner diameter 2.1 mm, length 100 mm, particle size 3 μm). Mobile phase A was 0.1% formic acid water, and mobile phase B was 0.1% formic acid acetonitrile. Mass spectrometry was performed using an LCMS-8060NX or 8060 triple quadrupole mass spectrometer (Shimadzu). MRM transition optimization was performed using each standard solution. Initial metabolite data was analyzed using LabSolutions LCMS (Shimadzu).

[0120] Multi-component simultaneous LC-MS analysis was performed using a Shimadzu method package (cell culture profiling, primary metabolites) by relative comparison of area values. The column used was a Supelco Discovery HS F5-3 with an inner diameter of 2.1 mm, length of 150 mm, and particle size of 3 μm. Mobile phase A was 0.1% formic acid in water, and mobile phase B was 0.1% formic acid in acetonitrile. Mass spectrometry was performed using an LCMS-8060NX triple quadrupole mass spectrometer (Shimadzu).

[0121] 1-12. Single-cell RNA-seq analysis. Immune cells were isolated from surgically harvested lungs. Specifically, lung tissue was cut with scissors in a digestion solution containing Hank's balanced salt solution (HBSS) supplemented with collagenase (Sigma), DNAse I (Roche), and dispase (Thermo). Then, the tissue was mechanically disrupted using a gentleMACS (Miltenyi Biotec). The resulting cells were subjected to Percoll density gradient centrifugation to enrich for immune cells, and the immune cell-containing fraction was collected. Immune cells were separated using a FACS Aria Fusion (BD Biosciences). Dead cells were excluded by 7-Amino-Actinomycin D (7-AAD) staining. The sorted cells were loaded onto a Chromium Next GEM Chip G (10x Genomics) on a Chromium Controller (10x Genomics) for barcoding and cDNA synthesis. cDNA amplification and library construction were performed using the Chromium Next GEM Single Cell 3' GEM, Library & Gel Bead Kit v3.1 or the Chromium Next GEM Single Cell 3' Kit v3.1 for 3' profiling (10x Genomics) according to the manufacturer's protocol. Libraries were sequenced on a DNBSEQ-G400 (MGI Tech). Droplet libraries were processed using Cell Ranger 5.0.0 (10X Genomics). Sequencing reads were aligned to the GRCh38 human reference genome using STAR (v2.7.2a) 50. Analysis was performed using a filtered expression matrix created using Cell Ranger count. For each sample, cells with a unique molecular identifier (UMI) below the 1st percentile or above the 99th percentile were excluded. Cells with fewer than 200 expressed genes and cells with more than 10% of reads from mitochondrial or hemoglobin genes were also excluded.Uniform manifold approximation and projection (UMAP) projection, cell type annotation, and differential expression analysis were performed using BBrowser X (BioTuring).

[0122] 1-13. Experiments Using CACO-2 Cells (In Vitro) The human CACO-2 colon cancer cell line obtained from ATCC was used. The culture medium was minimal essential medium (MEM; Nacalai tesque) supplemented with 20% fetal bovine serum (SIGMA), 1% non-essential amino acids (Nacalai tesque), 100 U / ml penicillin, and 100 μg / ml streptomycin (Nacalai tesque). CACO-2 cells were seeded in 12-well plates and cultured at 37°C in a 5% CO2 humidified incubator. The medium was changed twice a week, and experiments were performed after 21 days. Tryptamine or BAY-218 (AChemBlock) was added to the culture medium at the indicated concentrations. After 72 hours, cells were harvested and ACE2 protein expression was measured.

[0123] 1-14. Tritium-labeled tryptophan uptake experiment (ex-vivo) Tritium-labeled tryptophan 3 H-Tryptophan, L-[5- 3 [H] (American Radiolabeled Chemicals) was used. After washing the rat small intestine with cold saline, intestinal rings were prepared by turning it inside out with a 1 ml pipette. For uptake experiments, 0.1 μCi tritium-labeled tryptophan was added to HBSS (Hanks' Balanced Salt Solution, containing Ca2+ and Mg2+) containing cOmplete (Roche) and incubated at room temperature for 5 minutes. Na-free HBSS was used by replacing NaCl with choline-Cl and Na2HPO4 with K2HPO4. After washing the intestine with Na-free HBSS, it was dissolved in liquid scintillation (pico-fluor plus, PerkinElmer) and the radioactivity was counted using a liquid scintillation counter (Tri-Carb 4910TR, PerkinElmer). The amount of radioactivity taken up in Na-free HBSS and Na+ The ratio of the radiation dose taken up in HBSS was calculated to evaluate the Na-dependent tryptophan uptake.

[0124] 1-15. Western Blotting. Proteins were extracted from Caco2 monolayers or rat-derived small intestinal epithelial cell layers in radioimmunoprecipitation assay buffer (50 mM Tris pH 7.4, 150 mM sodium chloride, 1% NP40, 0.5% sodium deoxycholate, 0.1% SDS, 1 mM EDTA, complete protease inhibitor mixture). After centrifugation at 20,000 × g and 4°C for 15 minutes, protein was quantified using a BCA protein assay kit (Thermo Fisher Scientific). Equal amounts of protein were loaded onto SuperSep ace 5-20 (Fujifilm) and transferred to a 0.2 μm polyvinylidene fluoride plus membrane. After blocking with 5% skim milk (Nacalai Tesque) for 1 hour at room temperature, the membrane was incubated overnight at 4°C with the following primary antibodies: anti-ACE2 antibody (NOVUS) and anti-β-actin antibody (Cell Signaling). After washing, the membranes were incubated with Horseradish peroxidase (HRP)-conjugated secondary antibodies (Cell Signaling) for 1 hour at room temperature and visualized using an ECL-plus (Thermo Fisher Scientific) imaging system (Cytiva). Protein expression was normalized to β-actin expression, and densitometry of Western blot bundling was analyzed using ImageJ.

[0125] 1-16. Bacterial Culture (In Vitro) Ruminococcus gnavus (JCM6515), Streptococcus salivarium (JCM5707), Streptococcus pasteurianus (isolated from feces of gnotobiotic rats receiving patient fecal transplants at the National Cerebral and Cardiovascular Center), Streptococcus mutans (JCM5705), and Rothia aeria (JCM11412) were cultured in Trypticase soy medium under anaerobic conditions at 37°C, and the tryptophan-derived indole compounds in the culture supernatant were measured using LC-MS. Ruminococcus gnavus was cultured in Trypticase soy medium and Trypticase soy medium containing 0.5% mucin (Sigma) for 24 hours, and the turbidity (bacterial count) was measured using a MicroScan Turbidity Meter (Beckman).

[0126] 1-17. qPCR. Rat or human lung tissue, or PBMC or cultured cell lysates were lysed using TRIzol (Invitrogen), and total RNA was extracted using the PureLink RNA Mini Kit (Invitrogen) and PureLink DNase (Invitrogen). Quantitative real-time RT-PCR was performed using the QuantiFast SYBRGreen RT-PCR Kit (Qiagen) or the PrimeScript RT Reagent Kit (TAKARA BIO) and FastStart Essential DNA Green Master (Roche). For the former, 80 ng of total RNA was transcribed for 10 minutes at 50°C, denatured at 95°C for 5 minutes, and then subjected to 45 cycles of 95°C for 10 seconds and 60°C for 30 seconds. Fluorescence data were collected and analyzed using a LightCycler 96 (Roche). The genes and primers used were as follows: Gapdh: FW: AAAGGGTCATCATCTCCGCC (SEQ ID NO: 3) RV: AGTGATGGCATGGACTGTGG (SEQ ID NO: 4) Mucin2: FW: ACCACCATTACCACCACCTCAG (SEQ ID NO: 5) RV: CGATCACCACCATTGCCACTG (SEQ ID NO: 6)

[0127] 1-18. Measurement of Adsorption Capacity of Adsorbent Charcoal L-valine, L-glutamic acid, and 3-aminoisobutyric acid were each dissolved in PBS(-) at 20 mg / ml to prepare stock solutions. L-tryptophan, tryptamine, indole-3-aldehyde, and indole-3-acetic acid were each dissolved in dimethyl sulfoxide at 100 mg / ml to prepare stock solutions. The resulting stock solutions were mixed and diluted with PBS(-) to prepare a compound mixture containing each compound at a concentration of 0.1 mg / ml.

[0128] 20 mg of each of AST-120 (CAS: 90597-58-3, Kureha Corporation), medicinal charcoal (CAS: 16291-96-6, Nichi-Iko Pharmaceutical Co., Ltd.), and granulated activated charcoal (CAS: 7440-44-0, U.S. Corporation) was placed in a 15 ml tube, and the compound mixture was added to bring the total volume of the charcoal and compound mixture to 10 ml. After gentle stirring at 37°C for half a day, the charcoal was removed by filtration, and the filtrate was recovered. The resulting filtrate was subjected to LC-MS analysis to quantify the concentration of each compound. A control was also prepared using the same procedure as above, except that no charcoal was added. The adsorption rate of each compound to the charcoal was calculated according to the following formula: Adsorption rate = {(AB) / A} x 100. A: Compound concentration in the control filtrate. B: Compound concentration in the filtrate with charcoal added.

[0129] 1-19. Statistics All data were expressed as mean ± standard error or standard deviation. Significant differences between multiple groups were tested using one-way ANOVA, followed by post-hoc testing. Tests between two groups were analyzed using the Student t-test or Mann-Whitney test. Event-free survival curves were derived using the Kaplan-Meier method and compared using the log-rank test. Network analysis was performed using Spearman rank correlation. A p-value of less than 0.05 was considered statistically significant.

[0130] 2. Previously reported information by the inventor (Non-Patent Document 6) 2-1. Serum AHR activity is elevated in PAH patients, and serum AHR activity reflects the severity of PAH. It has been shown that serum AHR agonist activity (AHR-Luc activity) is significantly higher in PAH patients than in healthy volunteers (HV) (Figure 2A). Furthermore, serum AHR-Luc activity has been shown to be significantly higher in patients with more severe PAH (WHO pulmonary hypertension functional class III and IV) than in patients with relatively milder PAH (WHO pulmonary hypertension functional class I and II) (Figure 2B). Furthermore, it has been reported that PAH patients with high AHR-Luc activity are significantly more likely to experience severe clinical events, such as death, lung transplantation, and hospitalization for right heart failure, compared with patients with low AHR-Luc activity (Figure 2C). Thus, the present inventors have already discovered that AHR activation plays an important role in the development of PAH, and that serum AHR activation can be an indicator of the severity of PAH.

[0131] 2-2. The endogenous AHR ligand FICZ, in combination with hypoxic stimulation, induces severe pulmonary hypertension with intimal lesions in rats. 6-formylindolo[3,2-b]carbazole (FICZ) is a potent endogenous AHR agonist. Subcutaneous administration of FICZ in rats with hypoxia (10% O2) for the first 3 weeks (FICZ / Hx / Nx rat model; Figure 2A) has been reported to significantly increase right ventricular systolic pressure (Figure 2B) and Fulton index (Figure 2C). Furthermore, distal arterioles of FICZ / Hx / Nx rats have been shown to exhibit not only medial thickening (Figure 2D, E) but also occlusive lesions due to neointimal proliferation (Figure 2D, F, G). Thus, the present inventors have previously demonstrated that AHR activation contributes to the onset and severity of PH.

[0132] 2-3. Knockout of AHR in the SuHx rat model significantly suppresses PAH pathology. The SuHx rat model induces PAH pathology through administration of the VEGF receptor antagonist SU5416, hypoxia, and normoxia. The AHR knockout SuHx rat model (Ahr- / - rats) was generated using the CRISPR / Cas9 gene editing system, and the following results were reported regarding PAH pathology. Ahr- / - rats did not exhibit elevated right ventricular systolic pressure (Figure 3B) or Fulton's coefficient (Figure 3C). The medial thickness index of distal arterioles was significantly reduced in Ahr- / - rats compared with Ahr+ / + rats (Figure 3D, E). Furthermore, Ahr- / - rats did not exhibit occluded vessels (Figure 3D, F, G). This indicates that AHR signaling inhibition is effective not only in suppressing medial thickening (seen in mild pulmonary hypertension models such as mice) but also in suppressing the appearance of neointimal and plexiform lesions seen in severe pulmonary hypertension in humans, suggesting that it may also be effective in severe and treatment-resistant cases in which existing drugs do not sufficiently improve the condition. Thus, the present inventors have already discovered that AHR inhibition is effective in suppressing the onset of PAH.

[0133] 3. Reference Study Results 3-1. PH Patients Show Altered Gut Microbiota Characterized by Ectopic Colonization of Oral Bacteria. The gut microbiota of PH patients (PH, 89 cases) and healthy controls (HV, 82 cases) was analyzed. The Faith PD and Shannon index, indicators of alpha diversity, of the gut microbiota of PH patients were significantly reduced compared to healthy controls (Figure 4A). Furthermore, the gut microbiota of PH patients showed significant changes in beta diversity (unweighted unifrac PCoA) compared to healthy controls (Figure 4B).

[0134] Furthermore, volcano plots of the analysis of gut microbiota composition (ANCOM) revealed that PH patients had increased oral bacteria, such as Streptococcus, Rothia, and Actinomyces, and decreased short-chain fatty acid (SCFA)-producing bacteria, such as Subdolignulum, Ruminococcus, and Coprococcus (Fig. 5A). Furthermore, the oral resident bacterial score (OS) was calculated by scoring the number of species of oral commensal bacteria (core 14 bacteria, which are present in more than 90% of patients at a frequency of 1% or more) colonizing the intestine. The oral resident bacterial score in PH patients was significantly elevated compared with healthy controls (Fig. 5B). Furthermore, PH patients with a high oral resident bacterial score (OS > 5) had a higher WHO functional class, more severe PH symptoms, and lower event-free survival rates (Fig. 5C) compared with patients with a low oral resident bacterial score (OS ≤ 5).

[0135] Furthermore, the concentrations of acetate, propionate, and butyrate were significantly reduced in the feces of PH patients compared with those of healthy individuals (Fig. 5E), suggesting that the intestinal environment was significantly deviated from a healthy state.

[0136] These results confirmed that the intestinal flora of PH patients is altered by colonization by oral bacteria.

[0137] 3-2. In the intestines of PH patients, Ruminococcus gnavus coexists in a network with multiple oral bacteria, which is associated with poor prognosis. Compositional analysis of the intestinal microbiota of PH patients revealed that the relative frequency of Ruminococcus gnavus was higher in PH patients with a higher oral resident bacterial score. Furthermore, network analysis of bacteria correlated with Ruminococcus gnavus (Spearman correlation coefficient >0.2) revealed that Ruminococcus gnavus coexists in a network with Streptococcus, Veillonella, Rothia, and Fusobacterium (all core oral bacteria) in the intestine (Figure 6A). Furthermore, we found that PH patients who had Ruminococcus gnavus coexist with Streptococcus, Rothia, Fusobacterium, or Veillonella in the intestine had a significantly poorer prognosis (Log-rank test; Streptococcus P = 0.007, Rothia P = 0.004, Veillonella P = 0.023) (Fig. 6B). These results suggest that Ruminococcus gnavus coexists with multiple oral bacteria in the intestinal tract, forming a network, which is associated with a poor prognosis.

[0138] 3-3. Pulmonary hypertension rat model exhibits altered intestinal microbiota (WO 2021 / 167088). There are three representative rat models of PH (Figure 7A). Alterations in the intestinal microbiota were confirmed in these rat models.

[0139] Six-week-old male SD rats were continuously housed in a hypoxic chamber with 10% oxygen for 3 weeks to create a hypoxia (Hx)-induced pulmonary hypertension model (Fig. 7A). Six-week-old male SD rats were subcutaneously administered monocrotaline at 60 mg / kg and housed in a normoxic environment (normoxia) for 3 weeks to create a monocrotaline / hypoxia (MCT)-induced pulmonary hypertension model (Fig. 7A). Six-week-old male SD rats were subcutaneously administered the VEGFR2 inhibitor Sugen5416 at 20 mg / kg, housed in a hypoxic chamber with 10% oxygen for 3 weeks, and then housed in a normoxic environment (normoxia) for 2 weeks to create a Sugen5416 / hypoxia (SuHx)-induced pulmonary hypertension model (Fig. 7A).

[0140] Analysis of the gut microbiota of each pulmonary hypertension model rat revealed altered β-diversity in the Hx, MCT, and SuHx model rats (Fig. 7B). However, the rat gut microbiota differed significantly from that of humans, with oral bacteria such as Streptococcus rarely detected in the rats, while bacteria belonging to the Mulibaculaceae family were commonly increased and Lachnospiraceae were commonly decreased (Fig. 7C).

[0141] 3-4. Antibiotic Administration Improves PH in Pulmonary Hypertension Rat Models (WO 2021 / 167088). Hx, MCT, and SuHx rat models were administered water containing 1 g / L ampicillin, 1 g / L neomycin, 1 g / L metronidazole, and 1 g / L vancomycin (antibiotic cocktail water) or water, and PH pathology (pulmonary arterial medial thickening, right ventricular systolic pressure, and right / left ventricular mass ratio) was evaluated. In the case of Hx, rats were housed in a hypoxic chamber with 10% oxygen for 3 weeks, and then allowed free access to either the antibiotic cocktail water or water. In the case of MCT, PH pathology was evaluated after administration of monocrotaline and then housed in a normoxic environment (normoxa) for 3 weeks, and then allowed free access to the antibiotic cocktail water. In the SuHx model, rats were housed in a normoxic environment (normoxic) for 2 weeks after hypoxia and then allowed free access to either antibiotic cocktail water or water. PH pathology was then assessed. Male SD rats without PH were housed as controls, with free access to water. Significant decreases in pulmonary arterial media thickening, right ventricular systolic pressure, and right / left ventricular mass ratio were observed in both antibiotic cocktail-treated and water-treated PH model rats compared with those with water (Fig. 8A–C).

[0142] 3-5. Reconstitution of the gut microbiota of PH patients in PH model rats promotes PH pathology and enhances lung inflammatory signaling and responses to xenobiotics. 11-week-old germ-free F344 rats were administered a diluted fecal solution from PH patients or healthy controls, and then at 15 weeks of age, monocrotaline was administered. These rats were then housed for an additional 3 weeks to generate gnotobiotic PH model rats (PH patient fecal transplant F344 rats or healthy control fecal transplant F344 rats) (Figure 9A). 11-week-old germ-free F344 rats were also housed in a specific-pathogen-free (SPF) environment at the National Cerebral and Cardiovascular Center without the administration of a diluted fecal solution. At 15 weeks of age, monocrotaline was administered and housed for an additional 3 weeks to generate specific-pathogen-free (SPF) F344 rats.

[0143] Analysis of the intestinal microbiota composition in F344 rats transplanted with feces from PH patients and healthy donors revealed significant differences in the composition of the intestinal microbiota between the two groups. The F344 rats transplanted with feces from PH patients were colonized with a high proportion of oral bacteria, Streptococcus, while the F344 rats transplanted with feces from healthy donors were colonized with a high proportion of Faecalibacterium, a typical butyrate-producing bacterium (Fig. 9B).

[0144] We also measured right ventricular systolic pressure and right / left ventricular mass ratio in each rat. Both right ventricular systolic pressure and right / left ventricular mass ratio were lower in germ-free F344 rats compared with SPF F344 rats, indicating a significant suppression of monocrotaline-induced PH (Fig. 9C). Healthy donor fecal-transplanted F344 rats also showed similar right ventricular systolic pressure and right / left ventricular mass ratio to germ-free F344 rats, indicating a significant suppression of monocrotaline-induced PH (Fig. 9C). Furthermore, patient fecal-transplanted F344 rats showed significantly elevated right ventricular systolic pressure compared with healthy donor fecal-transplanted F344 rats (Fig. 9C). These results confirm that reconstitution of the gut microbiota of PH patients in PH model rats can facilitate the development of PH pathology.

[0145] RNA sequencing analysis of the lungs of F344 rats transplanted with feces from PH patients and healthy controls revealed increased expression of RNAs such as Egr1, Cma1, Mcp1, Tnf, and Gzmb in the lungs of F344 rats transplanted with feces from PH patients (Fig. 10A). Gene ontology term analysis revealed that genes related to defense against Gram-positive bacteria, genes promoting inflammatory responses, and responses to xenobiotic stimuli were upregulated in PH patient fecal-transplanted F344 rats compared with healthy donor fecal-transplanted F344 rats (Fig. 10B). In particular, genes related to macrophage chemotaxis (e.g., C5ar1, Cxcl17), lymphocyte chemotaxis (e.g., Ccl9, Ccl6), protein processing (e.g., Cma1, Gzmb), IL-6 response (e.g., Mcpt1, Prnp), and xenobiotic stimulation (e.g., Cebpa, Egr1) were upregulated (Fig. 10C). In contrast, genes related to angiogenesis and vasculogenesis were upregulated in healthy donor fecal-transplanted F344 rats (Fig. 10B). In particular, genes related to angiogenesis (e.g., Tmem100, Sox17) were upregulated (Fig. 10C).

[0146] 3-6. The promotion of PH pathology due to reconstitution of the intestinal flora of PH patients in PH model rats can be abolished by reducing Gram-positive cocci with vancomycin. We examined the effect of vancomycin administration on PH pathology in gnotobiotic PH model rats (Fig. 11A). Specifically, 11-week-old germ-free F344 rats were administered diluted feces from PH patients or healthy controls, and the following day, they were allowed to drink water containing 1 g / L vancomycin or water ad libitum for 4 weeks. At 15 weeks of age, monocrotaline 60 mg / kg was administered subcutaneously, and the rats were housed in a normoxia environment (normoxia) for 3 weeks. After this, right ventricular systolic pressure and right ventricular hypertrophy index were measured.

[0147] The results showed that right ventricular systolic pressure and right ventricular hypertrophy index were significantly lower in the vancomycin-treated group than in the water-treated group (Figure 11B). This indicates that vancomycin-susceptible bacteria (mainly gram-positive cocci) are involved in the pathogenesis of PH, and that reducing gram-positive cocci with vancomycin can counteract the PH pathogenesis caused by the reconstitution of the intestinal flora in PH patients.

[0148] 4. Test Results 4-1. The gut microbiota of PH patients exhibits enhanced tryptophan metabolism and abundant AHR ligand production. We explored the mechanism by which the characteristic gut microbiota alterations in PH patients exacerbate PH pathology. First, we performed whole-genome shotgun sequencing on stool samples from 52 healthy individuals and 71 patients. Using the KEGG module database, we performed metagenomic biological pathway analysis to identify pathways significantly altered in PH patients compared with healthy individuals. Among pathway modules significantly altered in PH patients, the fifth most altered pathway was tryptophan metabolism (Figure 12A). This indicates that the gut microbiota of PH patients exhibits enhanced tryptophan metabolism compared with healthy individuals. Furthermore, AHR ligand activity was measured in stool samples from PH patients and healthy individuals using an AHR luciferase reporter assay. The results showed that AHR ligand activity was significantly elevated in stool samples from PH patients compared with healthy individuals (Figure 12B). These results demonstrate that abundant AHR ligands are produced in the intestines of PH patients using tryptophan as a raw material.

[0149] Furthermore, we performed an AHR luciferase reporter assay on the feces of the gnotobiotic PH model rats (PH patient feces-transplanted F344 rats and healthy control feces-transplanted F344 rats). The results showed that fecal AHR ligand activity was significantly elevated in the PH patient feces-transplanted F344 rats compared with the healthy control feces-transplanted F344 rats (Fig. 12C). This confirms that the PH patient feces-transplanted F344 rats also reflect the characteristics of the intestinal microbiota of PH patients.

[0150] Next, to identify the gut bacterial AHR ligands that may be key to pathogenesis, we performed targeted LC-MS analysis of stool samples from PH patients and healthy controls to determine the concentrations of tryptophan and its metabolites. The results showed that stool samples from PH patients had elevated levels of tryptophan metabolites compared with healthy controls (Figure 13A). In particular, stool samples from PH patients showed significantly elevated levels of ILA, Trp, TryptA, IPyA, IAA, and IAld, and tended to show elevated levels of IAcr, IPA, and IEt.

[0151] We also analyzed the fecal concentrations of tryptophan and its metabolites in the gnotobiotic rats (PH patient feces-transplanted F344 rats and healthy control feces-transplanted F344 rats) by targeted LC-MS analysis. The fecal TryptA concentrations were significantly higher in the PH patient feces-transplanted F344 rats than in the healthy control feces-transplanted F344 rats (Fig. 13B).

[0152] These results indicate that the intestinal flora of PAH patients are capable of producing indole compounds, primarily TryptA, and that alterations in the intestinal flora are involved in the worsening of PH pathology. Furthermore, the feces of PH patients showed high concentrations of tryptophan and AHR ligands (indole compounds) produced as tryptophan metabolites. These findings confirm that the concentrations of tryptophan and its metabolites in feces or intestinal contents, as well as AHR activity in feces or intestinal contents, can be used as diagnostic markers for PH.

[0153] 4-2. AHR inhibitors reverse the pathological deterioration caused by the intestinal microbiota in PH patients. We examined the effects of AHR inhibitor administration on PH pathology in gnotobiotic rats (Figure 14A). Specifically, 11-week-old germ-free F344 rats were administered a diluted fecal solution from PH patients and, at 15 weeks of age, received subcutaneous monocrotaline. Starting the day after monocrotaline administration, rats received either 8 mg / kg / day of the AHR inhibitor CH223191 or corn oil daily via gavage. Twenty-one days after monocrotaline administration, right ventricular systolic pressure and right ventricular hypertrophy index were measured, and immune cells were collected from the lungs. Both right ventricular systolic pressure and right ventricular hypertrophy index were significantly improved in the AHR inhibitor (CH223191)-treated group compared with the corn oil (vehicle)-treated group (Figure 14B).

[0154] To understand the AHR signal-dependent changes in immune cells in the lung, we performed single-cell RNA-seq analysis to examine the effects of CH223191. Specifically, we created a Uniform Manifold Approximation and Projection (UMAP) model to visualize gene expression profiles based on the results of single-cell RNA-seq analysis of immune cells recovered from the lung. The results showed that in the AHR inhibitor (CH223191)-treated group, the proportion of Ifnγ-positive cells in Cluster 3 (Th17 cells), which express IL17a, was significantly reduced, indicating that Th17 cells were transformed into pathogenic Th17 cells in an AHR-dependent manner (Figure 14C).

[0155] Taken together, these results suggest that lung Th17 cells are key to promoting PH pathology, and that AHR signaling in the intestine induces differentiation into effector memory T cells in the MLN and the resulting polarization of pathogenic Th17 cells in the lung, exacerbating PH.

[0156] 4-3. Tryptophan absorption is impaired in the intestinal tract of PH patients, resulting in increased tryptophan concentrations in intestinal contents and decreased tryptophan concentrations in serum. Multi-analyte simultaneous LC-MS analysis was performed on stool and serum samples from healthy individuals and PH patients. The results showed that tryptophan concentrations were high in stool samples from PH patients, and conversely, low in serum samples (Figure 15).

[0157] We also measured tryptophan concentrations in stool and serum samples from healthy individuals, PH patients, and heart failure patients. Stool tryptophan concentrations were significantly elevated in PH patients compared with healthy individuals, whereas serum tryptophan concentrations were significantly decreased in PH patients compared with both healthy individuals and heart failure patients (Fig. 16A, B). Furthermore, we measured tryptophan concentrations in serum samples collected from healthy individuals and PH patients in the fasting state. These concentrations were significantly decreased in PH patients compared with healthy individuals (Fig. 16C). When we examined the disease specificity of this phenomenon, we found that it was specific to PH patients, but not to heart failure patients (Fig. 16A, B).

[0158] These results suggest that PH patients experience impaired tryptophan absorption, resulting in elevated tryptophan concentrations in the feces and intestinal contents and decreased tryptophan concentrations in the blood.

[0159] 4-4. Neutral Amino Acid Transport Activity is Decreased in the Intestinal Tract of PH Patients. Tryptophan is primarily absorbed by the neutral amino acid transporter B0AT1 present in the small intestinal brush border. ACE2 has been reported to regulate the expression and function of B0AT1 as a chaperone. Therefore, we measured the amino acid concentrations in serum samples from healthy individuals and PH patients using LC-MS. The results showed that the concentrations of the neutral amino acids tryptophan, valine, proline, asparagine, threonine, alanine, and methionine were significantly decreased in serum samples from PH patients, but no decrease was observed in the concentrations of acidic amino acids (glutamic acid) or basic amino acids (lysine) (Figure 17). These results indicate that neutral amino acid transport activity is decreased in the intestinal tract of PH patients.

[0160] 4-5. AHR-dependent decrease in ACE2 protein expression in intestinal epithelial cells To examine the effect of tryptamine (TryptA), which is present at high concentrations in the intestines of PH patients, on intestinal cells, an in vitro experiment was conducted using the intestinal epithelial cell line CACO-2 cells.

[0161] Specifically, tryptamine was added to CACO-2 cells at concentrations of 0–500 μM and cultured for 72 hours. After the cells were harvested, the expression levels of ACE2 protein were measured. The results showed that the expression levels of ACE2 protein in CACO-2 cells decreased depending on the tryptamine concentration (Fig. 18A).

[0162] In addition, CACO-2 cells were cultured for 72 hours in a medium containing 200 μM tryptamine and 0-5 μM of the AHR inhibitor (BAY-218). The cells were then harvested and ACE2 protein expression was measured. The tryptamine-induced decrease in ACE2 protein expression was inhibited by the AHR inhibitor (BAY-218) (Figure 18B). These results demonstrate that ACE2 protein expression is downregulated in an AHR-dependent manner in intestinal epithelial cells.

[0163] 4-6. Tryptamine inhibits tryptophan absorption by reducing B0AT1 (Slc6a19) function via AHR-dependent downregulation of ACE2 expression. Wild-type SD rats and Ahr-knockout (Ahr-KO) rats were orally administered tryptamine at 100 mg / kg / day in their diets for one week, and then their small intestines were isolated for Western blotting analysis and ex vivo tritium-labeled tryptophan uptake experiments (Fig. 19A). Tryptamine administration reduced ACE2 protein expression in wild-type SD rats, but not in Ahr-KO rats (Fig. 19B,C). Furthermore, ex vivo tryptophan uptake experiments showed reduced tryptophan uptake in the small intestine of tryptamine-treated wild-type SD rats, but not in tryptamine-treated Ahr-KO rats (Fig. 19F).

[0164] Furthermore, we performed tritium-labeled tryptophan uptake experiments in the small intestines of wild-type SD rats, Slc6a19 knockout (Slc6a19-KO) rats, and Ace2 knockout (Ace2-KO) rats. In Slc6a19-KO rats, in which the neutral amino acid transporter Slc6a19 (B0AT1) was knocked out, sodium-dependent tryptophan uptake was reduced as the number of Slc6a19 alleles decreased (wild-type (+ / +) → heterozygous (+ / -) → homozygous (- / -)) (Fig. 19D). Sodium-dependent tryptophan uptake was also reduced in Ace2-KO rats (Fig. 19E).

[0165] 4-7. High-tryptophan dietary loading promotes PH pathology via increased AHR agonist activity. We investigated the effects of high-tryptophan dietary loading on PH pathology in gnotobiotic rats (Fig. 20A). Specifically, 11-week-old germ-free F344 rats were administered a diluted fecal solution from PH patients and, from 13 weeks of age, were fed a low-tryptophan diet (0.1 w / w% tryptophan) or a high-tryptophan diet (1.25 w / w% tryptophan). Monocrotaline was administered subcutaneously at 15 weeks of age. 21 days after monocrotaline administration, feces and serum samples were collected, and right ventricular systolic pressure and right ventricular hypertrophy index were measured.

[0166] AHR activity in feces and serum was measured using an AHR luciferase reporter assay. The high-tryptophan diet group had elevated AHR activity in feces and serum compared with the low-tryptophan diet group (Fig. 20B). Furthermore, the high-tryptophan diet group had elevated right ventricular systolic pressure and right ventricular hypertrophy index, indicating a worsening of PH pathology (Fig. 20C). Furthermore, LC-MS analysis of fecal tryptophan metabolite (indole compound) concentrations revealed elevated levels in the high-tryptophan diet group (Fig. 20D). These results confirm the importance of intestinal tryptophan in the pathogenesis of PH.

[0167] 4-8. AHR ligands inhibit tryptophan uptake via reduced expression of ACE2 in intestinal epithelial cells, creating a positive feedback loop that enriches AHR ligands in the intestine. Based on the results presented above, it is believed that PH pathology is formed based on the following mechanisms (1) to (4): (1) Oral bacteria that produce tryptophan metabolites (indole compounds), which are AHR ligands, colonize the intestinal flora, causing alterations in the intestinal flora. (2) Following alterations in the intestinal flora, the production of AHR ligands (tryptophan metabolites) from tryptophan is enhanced in the intestinal tract. (3) Enhanced production of AHR ligands (tryptophan metabolites) promotes the differentiation of Th17 cells, which then migrate to the lungs, resulting in PH pathology. (4) Increased production of AHR ligands (tryptophan metabolites) in the intestinal tract leads to an AHR-dependent decrease in ACE2 expression, resulting in impaired tryptophan absorption. This further increases the tryptophan concentration in the intestinal tract, creating a vicious cycle in which production of AHR ligands (tryptophan metabolites) in the intestinal tract is further increased.

[0168] The effect of tryptamine administration on PH pathology in germ-free rats was examined (Fig. 21A). Specifically, 11-week-old germ-free F344 rats were fed a standard diet or a diet containing 1.25 w / w% tryptamine. At 15 weeks of age, monocrotaline was administered subcutaneously. 21 days after monocrotaline administration, right ventricular systolic pressure and right ventricular hypertrophy index were measured. Lungs were harvested for histological analysis of pulmonary vascular tissue.

[0169] The right ventricular systolic pressure and right ventricular hypertrophy index were significantly elevated in the tryptamine-fed group compared with the standard-fed group (Fig. 21B). Furthermore, Elastica-van Gieson (EVG) staining images of the lungs showed medial thickening of the pulmonary arteries and infiltration of inflammatory cells in rats fed the 1.25 w / w% tryptamine-fed diet (Fig. 21C).

[0170] 4-10. Ruminococcus gnavus worsens PH through cooperation with Streptococcus pasteurianus. To identify TryptA-producing bacteria, we focused on metabolic enzymes and examined metagenomic information. TryptA is produced from tryptophan by L-tryptophan decarboxylase (K01593). Therefore, we performed whole-genome analysis (shotgun analysis) using stool samples from healthy individuals and PH patients to determine the prevalence of the gene encoding tryptophan decarboxylase (K01593). The results showed that the proportion of bacteria carrying the K01593 gene was significantly higher in PH patients than in healthy individuals (Figure 22A). In addition, the proportion of bacterial species carrying the K01593 gene was analyzed, and the bacteria carrying the K01593 gene were Ruminococcus gnavus, Streptomyces ficellus, Faecalicatena sp., Marseille, Cupriavidus metalligurans, Bradyrhizobium, Sphingopyxis macrogoltabida, and Blautia hansenii, with R. gnavus accounting for the majority of the species (Figure 22B).

[0171] In addition, we analyzed tryptamine levels in the culture medium of R. gnavus, S. salivarius, S. pasturianus, and S. mutans anaerobically in vitro and found that only R. gnavus produced tryptamine (Fig. 22C).

[0172] These results suggest that R. gnavus produces TryptA and is the causative agent of PH. Therefore, we next performed an experiment in which R. gnavus and S. pasteurianus were administered to germ-free rats (Fig. 22D). Specifically, 11-week-old germ-free F344 rats were inoculated with R. gnavus and S. pasteurianus, either alone or in combination, and allowed to colonize the intestine for 4 weeks. At 15 weeks of age, monocrotaline was administered subcutaneously. 21 days after monocrotaline administration, right ventricular systolic pressure and right ventricular hypertrophy index were measured, and qPCR analysis of small intestinal epithelial cells and fecal tryptophan and its metabolite concentrations were measured.

[0173] Inoculation of R. gnavus or S. pasteurianus did not significantly increase right ventricular systolic pressure or right ventricular hypertrophy index, but inoculation of a combination of R. gnavus and S. pasteurianus significantly increased right ventricular systolic pressure and right ventricular hypertrophy index (Fig. 22E). R. gnavus coexisted with oral bacteria such as Streptococcus, and this correlated with the severity of PH, suggesting that Streptococcus may support the growth of R. gnavus.

[0174] Streptococcus is known to promote mucin production in host small intestinal epithelial cells. Indeed, qPCR analysis of small intestinal epithelial cells confirmed that mucin production in small intestinal epithelial cells was elevated only in the presence of S. pasteurianus (Fig. 22F). To confirm the effect of mucin on R. gnavus growth, we cultured R. gnavus in the presence or absence of mucin. Anaerobic in vitro culture of R. gnavus in the absence of mucin did not result in an increase in turbidity or enhanced growth. However, anaerobically cultured R. gnavus in the presence of mucin increased turbidity and enhanced growth (Fig. 22G). These results suggest that R. gnavus produces TryptA, which is important for the pathogenesis of PH. Streptococcus promotes host mucin production, and R. gnavus utilizes the mucin produced as a carbon source to support its growth, thereby acting synergistically with the mucin.

[0175] Furthermore, when the concentrations of tryptophan and its metabolites in feces were quantified by LC-MS, elevated concentrations of tryptamine and IPA were observed in mice receiving R. gnavus alone (Fig. 22H).Furthermore, elevated concentrations of ILA, IPA, and other metabolites were observed in mice receiving a combination of R. gnavus and S. pasteurianus (Fig. 22H), suggesting an increase in fecal AHR activity.

[0176] 4-11. Adsorbent charcoal adsorbs and removes various tryptophan metabolites. AST-120, an oral adsorbent that adsorbs indole sulfate and inhibits its absorption in the intestinal tract, is widely used in the treatment of patients with chronic renal failure. Therefore, we investigated whether AST-120 administration could remove tryptophan metabolites from the intestine. Specifically, we analyzed fecal tryptophan metabolites using LC-MS after feeding 6-week-old SD rats a standard diet or a diet containing 8% AST-120 for 1 week (Figure 23A). The AST-120-treated group showed a significant decrease in fecal tryptophan metabolites (TryptA, IAld, IAA, IEt, IPA, and ILA) (Figure 23B-G). However, AST-120 administration did not result in a decrease in fecal tryptophan (Figure 23H). These results confirmed that administration of adsorbent charcoal can remove tryptophan metabolites (indole compounds) in the intestine without reducing the essential amino acid tryptophan.

[0177] 4-12. Charcoal adsorbs tryptophan metabolites derived from intestinal bacteria and ameliorates PH. We investigated the effect of administration of charcoal adsorbed with AST-120 on PH pathology in gnotobiotic rats (Fig. 24A). Specifically, 11-week-old germ-free F344 rats were administered a diluted fecal solution from PH patients, and at 15 weeks of age, monocrotaline was administered subcutaneously. Starting the day after monocrotaline administration, the rats were fed a standard diet or a diet containing 8% AST-120 for 3 weeks. After this, right ventricular systolic pressure and right ventricular hypertrophy index were measured, and fecal AHR activity was measured. Fecal samples were analyzed by LC-MS.

[0178] In the AST-120-treated group, right ventricular systolic pressure and right ventricular hypertrophy index were significantly suppressed, indicating amelioration of PH pathology (Fig. 24B). Furthermore, fecal AHR activity was significantly reduced in the AST-120-treated group (Fig. 24C). Furthermore, fecal LC-MS analysis of tryptophan and its metabolites revealed significant decreases in fecal concentrations of tryptophan metabolites (TryptA, IAld, IAA, IEt, IPA, and ILA) in the AST-120-treated group, but not in fecal tryptophan (Fig. 24D). These results confirm that removal of intestinal tryptophan metabolites by adsorbent charcoal can ameliorate PH pathology.

[0179] 4-13. Rearing Regnase-1 CD11c-Cre (Reg-1 CKO) mice, a model of spontaneous severe PAH, in a germ-free environment suppresses spontaneous PAH development, and administration of adsorbed charcoal to Reg-1 CKO mice suppresses PAH pathogenesis. Regnase-1 CD11c-Cre (Reg-1 CKO) mice, a novel model of spontaneous severe PAH, were reared in either an SPF or germ-free environment until 12 weeks of age, after which their right ventricular systolic pressure and right ventricular hypertrophy index were measured. Reg-1 CKO mice reared in an SPF environment exhibited a significant increase in right ventricular systolic pressure, whereas reared in a germ-free environment suppressed this increase (Figure 25A). There was no significant difference in the right ventricular hypertrophy index between the two groups (Figure 25B).

[0180] Next, we investigated the effect of administration of AST-120, a charcoal-adsorbed protein, on the spontaneous development of PAH in Reg-1 CKO mice (Fig. 25C). Specifically, 0-week-old Reg-1 CKO mice were fed a standard diet or a diet containing 8% AST-120 for 4 weeks, and then measured right ventricular systolic pressure and right ventricular hypertrophy index. The results showed that AST-120-treated Reg-1 CKO mice exhibited a significant decrease in right ventricular systolic pressure and suppressed the development of PH (Fig. 25D).

[0181] These results also confirmed that alterations in the intestinal flora are involved in the pathogenesis of PH, and that PH pathology can be improved by removing tryptophan metabolites from the intestinal tract.

[0182] 4-14. Administration of adsorbed charcoal to monocrotaline- and hypoxia-loaded PH model rats suppresses PH pathogenesis. The effect of administration of adsorbed charcoal AST-120 to monocrotaline-loaded PH model rats on PH pathogenesis was examined. Specifically, 6-week-old male SD rats were subcutaneously administered monocrotaline and fed either a standard diet or a diet containing 8% AST-120 for 3 weeks, after which right ventricular systolic pressure was measured. As a result, right ventricular systolic pressure was significantly reduced in AST-120-treated rats, indicating that PH pathogenesis was suppressed (Figure 26A).

[0183] Furthermore, we investigated the effect of administration of AST-120 charcoal adsorbent on PH pathology in hypoxic PH model rats. Specifically, 6-week-old male SD rats were placed in a chamber maintained at 10% oxygen and fed either standard chow or a chow containing 8% AST-120 for 4 weeks. Right ventricular systolic pressure and right ventricular hypertrophy index were then measured. The results showed that AST-120-treated rats had significantly reduced right ventricular systolic pressure, suggesting that PH pathogenesis was suppressed (Fig. 26B).

[0184] These results also confirmed that PH pathology can be improved by removing tryptophan metabolites from the intestinal tract.

[0185] The adsorption capacity of AST-120 (CAS: 90597-58-3, Kureha Corporation), medicinal charcoal (CAS: 16291-96-6, Nichi-Iko Pharmaceutical Co., Ltd.), and granulated activated charcoal (CAS: 7440-44-0, U.S. Corporation) for various compounds was evaluated. Specifically, each adsorbent charcoal (AST-120, medicinal charcoal, and granulated activated charcoal) was added to an aqueous solution containing 3-aminoisobutyric acid, L-valine, L-glutamic acid, L-tryptophan, tryptamine, indole-3-aldehyde, or indole-3-acetic acid, and the adsorption rate of each compound by the adsorbent charcoal was measured. The results showed that AST-120, medicinal charcoal, and granulated activated charcoal all exhibited low adsorption rates for 3-aminoisobutyric acid, L-valine, and L-glutamic acid, but high adsorption rates for L-tryptophan, tryptamine, indole-3-aldehyde, and indole-3-acetic acid (Figure 27). These results demonstrate that adsorbent charcoal can efficiently adsorb indole compounds.

[0186] The present disclosure is not limited in any way to the description of the embodiments and examples of the invention. Various modifications within the scope of the claims and within the scope that can be easily conceived by a person skilled in the art are also included in the present invention. The contents of the documents and the like shown in this specification are hereby incorporated by reference in their entirety.

Claims

1. A preventive or therapeutic drug for pulmonary hypertension, which contains a substance capable of removing indole compounds, which are tryptophan metabolic products, from the intestinal tract.

2. The preventive or therapeutic drug for pulmonary hypertension according to claim 1, wherein the substance is a substance that adsorbs or binds to an indole compound that is a tryptophan metabolic product.

3. The preventive or therapeutic drug for pulmonary hypertension according to claim 1 or 2, wherein the indole compound is at least one selected from the group consisting of tryptamine, indole-3-aldehyde, indole-3-pyruvic acid, indole-3-ethanol, indole-3-acetic acid, indole-3-propionic acid, indole-3-acrylic acid, and indole-3-lactic acid.

4. A drug for preventing or treating pulmonary hypertension according to claim 1 or 2, wherein the substance is a porous inorganic adsorbent.

5. A drug for preventing or treating pulmonary hypertension according to claim 1 or 2, wherein the substance is adsorbed carbon.

6. A method for treating pulmonary hypertension, comprising the step of removing an indole compound, which is a tryptophan metabolic product, from the intestinal tract of a patient with pulmonary hypertension.

7. A method for treating pulmonary hypertension according to claim 6, comprising administering to a patient with pulmonary hypertension a therapeutically effective amount of a substance that adsorbs or binds to an indole compound, which is a tryptophan metabolite, thereby removing the indole compound from the intestinal tract of the patient.

8. A method for testing for the presence or absence of pulmonary hypertension or the severity of pulmonary hypertension, comprising the step of measuring a tryptophan concentration in a stool, intestinal contents or blood sample collected from a subject.

9. A test kit for determining the presence or absence of pulmonary hypertension or the severity of pulmonary hypertension, comprising a reagent for measuring tryptophan.

10. A method for testing for the presence or absence of pulmonary hypertension or the severity of pulmonary hypertension, comprising the step of measuring the concentration of an indole compound, which is a metabolic product of tryptophan, in a stool, intestinal contents or blood sample collected from a subject.

11. The testing method according to claim 10, wherein the indole compound is at least one selected from the group consisting of tryptamine, indole-3-aldehyde, indole-3-pyruvic acid, indole-3-ethanol, indole-3-acetic acid, indole-3-propionic acid, indole-3-acrylic acid, and indole-3-lactic acid.

12. A test kit for determining the presence or absence of pulmonary hypertension or the severity of pulmonary hypertension, comprising a reagent for measuring an indole compound that is a metabolic product of tryptophan.

13. A method for examining the presence or absence of pulmonary hypertension or the severity of pulmonary hypertension, comprising the step of measuring aromatic hydrocarbon receptor activity in stool or intestinal contents collected from a subject.

14. A test kit for determining the presence or absence of pulmonary hypertension or the severity of pulmonary hypertension, comprising a reagent for measuring activity of an aromatic hydrocarbon receptor in stool or intestinal contents.

15. A method for testing for the presence or absence of pulmonary hypertension or the severity of pulmonary hypertension, comprising the step of measuring the concentration of angiotensin-converting enzyme 2 in a stool, intestinal contents or blood sample collected from a subject.

16. A test kit for determining the presence or absence of pulmonary hypertension or the severity of pulmonary hypertension, comprising a reagent for measuring angiotensin-converting enzyme 2.

17. A preventive or therapeutic drug for pulmonary hypertension, which contains a substance that increases the expression level of angiotensin-converting enzyme 2.

18. A method for treating pulmonary hypertension, comprising the step of administering a therapeutically effective amount of a substance that increases the expression level of angiotensin-converting enzyme 2 to a patient with pulmonary hypertension.