Methods of using surrogate biomarkers in sigma-1 receptor therapy

IL328718A0Pending Publication Date: 2026-07-01ANAVEX LIFE SCIENCES CORP
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
IL · IL
Patent Type
Applications
Current Assignee / Owner
ANAVEX LIFE SCIENCES CORP
Filing Date
2024-11-27
Publication Date
2026-07-01

AI Technical Summary

Technical Problem

Current therapeutic options for neurological diseases and disorders are limited, and clinical trials for these conditions are lengthy, costly, and often rely on difficult-to-reproduce physiological endpoints.

Method used

A method involving the use of surrogate biomarkers to select and monitor the efficacy of Sigma-1 receptor agonists in treating neurological diseases. This method includes obtaining differential gene expression profiles before and after treatment, identifying specific differentially expressed genes, and using these genes as indicators for treatment efficacy.

Benefits of technology

The method allows for personalized therapy selection and effective monitoring of treatment efficacy, potentially reducing the length and cost of clinical trials and improving outcomes for neurological disease patients.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present disclosure provides precision medicine or personalized therapy of using a Sigma-1 receptor agonist in treating neurological disease or disorder. The precision medicine or personalized therapy involves patient selection through differentially expressed genes or affected biological pathways related to the Sigma-1 receptor agonist therapy. Also provided are kits for practicing the methods.
Need to check novelty before this filing date? Find Prior Art

Description

METHODS OF USING SURROGATE BIOMARKERS IN SIGMA-1 RECEPTOR THERAPY CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Application No. 63 / 604,513 filed November 30, 2023, entitled “COMPOSITIONS AND METHODS FOR SURROGATE BIOMARKERS OF ANAVEX 2-73 EFFICACY IN NEUROLOGICAL DISEASES”; and U.S. Provisional Application No.63 / 697,927 filed September 23, 2024, entitled “GENE PATHWAYS OF RETT SYNDROMES AND USES THEREOF.” The contents of both foregoing applications are incorporated by reference herein in their entireties. INCORPORATION BY REFERENCE OF SEQUENCE LISTING PROVIDED ELECTRONICALLY

[0002] This application contains references to amino acid sequences and / or nucleic acid sequences which have been submitted concurrently herewith as the sequence listing xml file entitled “830636_sequencelisting”, file size 4,096 bytes, and created on November 27, 2024. The aforementioned sequence listing is hereby incorporated by reference in its entirety pursuant to 37 C.F.R §1.52(e)(5). FIELD OF THE INVENTION

[0003] The present disclosure relates to compositions, methods, and kits for treating and assessing treatment of neurological diseases and disorders. Specifically, it is to deliver precision medicine or personalized therapy through monitoring changes in gene expressions and related biological pathways. BACKGROUND OF THE INVENTION

[0004] Neurological diseases and disorders, including neurodegenerative and / or neurodevelopmental diseases and disorders encompass a group of devastating diseases, disorders, and conditions of the central nervous system in which the normal growth and development of the brain are adversely affected and / or begin deteriorating as a person ages. While the underlying mechanisms of the diseasesand disorders may vary, they are commonly characterized by adverse impact on an individual’s cognitive and emotional abilities, including learning, language, memory, self-control and other behavioral functions. Therapeutic options for neurological diseases and disorders are quite limited and a clear need exists for new and improved therapeutic options. Further, there are at least two challenges in the design of clinical trials for neurological diseases and disorders: their length and cost, and their use of physiological endpoints for which cognitive and other testing are difficult to reproduce. SUMMARY OF THE INVENTION

[0005] One aspect of the present disclosure encompasses a method of selecting a therapeutic agent for a subject, the method comprising the steps of: (a) obtaining or having obtained a differential gene expression profile for the subject, wherein the differential gene expression profile comprises a comparison of a first gene expression profile derived from a first biological sample from the subject before administration of the therapeutic agent to the subject, and a second gene expression profile derived from a second biological sample from the subject after a period of administration time of the therapeutic agent to the subject; (b) identifying any differentially expressed gene and / or overrepresented gene cluster from the comparison of the first and second gene expression profiles in (a); (c) selecting a Sigma-1 receptor agonist as the therapeutic agent for the subject, if the identified differentially expressed gene is listed in a gene list comprising REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, and / or ACAT1; or if the identified overrepresented gene cluster overlaps with any gene in the gene list; and (e) administering the Sigma-1 receptor agonist to the subject if gene or gene cluster listed above is observed.

[0006] Another aspect of the present disclosure encompasses a method of monitoring efficacy of a Sigma-1 receptor agonist therapy administered to a subject for a treatment period to treat a neurological disease or disorder (including neurodegenerative and / or neurodevelopmental diseases and disorders) in the subject, the method comprising the steps of: (a) obtaining or having obtained a test biological sample from the subject at the end of the treatment period; (b) determininga test gene expression profile from the test biological sample, wherein the test gene expression profile comprises a test list of genes detected in the test biological sample and their expression levels; (c) comparing the test gene expression profile with a predetermined control gene expression profile to identify differentially expressed genes, wherein the predetermined control gene expression profile comprises a control list of genes detected in a control biological sample obtained from the subject before the treatment period and their expression levels; wherein the differentially expressed genes comprises genes detected both in the test list and in the control list but having different expression levels in the test biological sample from that in the control biological sample; (d) confirming the efficacy of the Sigma-1 receptor agonist therapy if the identified differentially expressed gene(s) is listed in a gene list comprising REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, and / or ACAT1; or denying the efficacy of the Sigma-1 receptor agonist therapy if no differentially expressed genes are identified or differentially expressed genes do not comprise any gene(s) listed in the gene list. For example, the identified differentially expressed gene(s) may be one or more gene selected from the group consisting of REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and any combination thereof. In another aspect, the method further comprises: (e) if the efficacy of the Sigma-1 receptor agonist therapy is confirmed in step (d), continuing the Sigma-1 receptor agonist therapy; or if the efficacy of the Sigma-1 receptor agonist therapy is not confirmed in step (d), taking one or more of the following steps: (i) switching the subject to another Sigma-1 receptor agonist; (ii) switching the subject to another neurodegenerative and / or neurodevelopmental drug therapy; or (iii) switching the subject to a combination therapy comprising the Sigma- 1 receptor agonist and another neurodegenerative and / or neurodevelopmental drug therapy.

[0007] Another aspect of the present disclosure encompasses a method of treating a neurological disease or disorder (including neurodegenerative and / orneurodevelopmental diseases and disorders) in a subject in need thereof by administering a Sigma-1 receptor agonist to the subject, the method comprising the steps of: (a) obtaining or having obtained a test biological sample from the subject at the end of a treatment period; (b) determining a test gene expression profile from the test biological sample, wherein the test gene expression profile comprises a test list of genes detected in the test biological sample and their expression levels; (c) comparing the test gene expression profile with a predetermined control gene expression profile to identify differentially expressed genes, wherein the predetermined control gene expression profile comprises a control list of genes detected in a control biological sample obtained from the subject at the beginning of the treatment period and their expression levels; wherein the differentially expressed genes comprises genes detected both in the test list and in the control list but having different expression levels in the test biological sample from that in the control biological sample; and (d) continuing the treatment with the Sigma-1 receptor agonist if the identified differentially expressed gene(s) is listed in a gene list comprising REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, and / or ACAT1; or discontinuing the treatment with the Sigma-1 receptor agonist if no differentially expressed gene is identified, or if the identified differentially expressed genes do not comprise any gene(s) listed in the gene list. For example, the identified differentially expressed gene(s) may be one or more gene selected from the group consisting of REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and any combination thereof. In one aspect, if the Sigma-1 receptor agonist is rejected in (d), the method further comprises: (i) switching the subject to another Sigma-1 receptor agonist; (ii) switching the subject to another neurodegenerative and / or neurodevelopmental drug therapy; or (iii) switching the subject to a combination therapy comprising the Sigma-1 receptor agonist and another neurodegenerative and / or neurodevelopmental drug therapy. In one aspect, the neurological disease or disorder is a neurodegenerative and / or neurodevelopmental or disorder including, for example, Alzheimer’s disease, Parkinson’s disease,Parkinson’s disease with dementia, Huntington’s disease, Amyotrophic lateral sclerosis, Prion disease, Rett syndrome, cerebral palsy, Down's syndrome, Williams- Beuren syndrome, Prader-Willi syndrome, Angelman syndrome, pervasive developmental disorder not otherwise specified (PDD-NOS), childhood disintegrative disorder, Smith-Magenis syndrome, multiple sclerosis, velo-cardio-facial syndrome, ATR-X syndrome, Barth syndrome, Fragile X syndrome, ICF syndrome, Neurofibromatosis, Smith-Lemli-Opitz syndrome, an addictive disorder, Attention- deficit / hyperactivity disorder (ADHD), an anxiety disorder, Asperger's syndrome, autism spectrum disorder, an eating disorder, epilepsy, infantile spasms, fetal alcohol syndrome, hydrocephalus, manic depressive illness, mental retardation, schizophrenia, spina bifida, Tourette's syndrome, and any combination thereof.

[0008] Another aspect of the present disclosure encompasses a method of selecting a Sigma-1 receptor agonist for a subject in treating a neurological disease or disorder (including neurodegenerative and / or neurodevelopmental diseases and disorders) in the subject in need thereof, the method comprising the steps of: (a) administering the Sigma-1 receptor agonist to the subject for a treatment period; (b) obtaining a test biological sample from the subject at the end of the treatment period; (c) determining a test gene expression profile from the test biological sample, wherein the test gene expression profile comprises a test list of genes detected in the test biological sample and their expression levels; (d) comparing the test gene expression profile with a predetermined control gene expression profile to identify differentially expressed genes, wherein the predetermined control gene expression profile comprises a control list of genes detected in a control biological sample obtained from the subject at the beginning of the treatment period and their expression levels; wherein the differentially expressed genes comprises genes detected both in the test list and in the control list but having different expression levels in the test biological sample from that in the control biological sample; and (e) selecting the Sigma-1 receptor agonist for the subject if the identified differentially expressed gene(s) is listed in a gene list comprising REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, and / or ACAT1; or rejecting the Sigma-1 receptor agonist for the subject if no differentiallyexpressed gene is identified, or if the identified differentially expressed genes do not comprise any gene(s) listed in the gene list. For example, the identified differentially expressed gene(s) may be one or more gene selected from the group consisting of REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and any combination thereof. In one aspect, if the Sigma-1 receptor agonist is rejected in (e), the method further comprises: (i) switching the subject to another Sigma-1 receptor agonist; (ii) switching the subject to another neurodegenerative and / or neurodevelopmental drug therapy; or (iii) switching the subject to a combination therapy comprising the Sigma- 1 receptor agonist and another neurodegenerative and / or neurodevelopmental drug therapy. In one aspect, the neurological disease or disorder is a neurodegenerative and / or neurodevelopmental or disorder including, for example, Alzheimer’s disease, Parkinson’s disease, Parkinson’s disease with dementia, Huntington’s disease, Amyotrophic lateral sclerosis, Prion disease, Rett syndrome, cerebral palsy, Down's syndrome, Williams-Beuren syndrome, Prader-Willi syndrome, Angelman syndrome, pervasive developmental disorder not otherwise specified (PDD-NOS), childhood disintegrative disorder, Smith-Magenis syndrome, multiple sclerosis, velo-cardio- facial syndrome, ATR-X syndrome, Barth syndrome, Fragile X syndrome, ICF syndrome, Neurofibromatosis, Smith-Lemli-Opitz syndrome, an addictive disorder, Attention-deficit / hyperactivity disorder (ADHD), an anxiety disorder, Asperger's syndrome, autism spectrum disorder, an eating disorder, epilepsy, infantile spasms, fetal alcohol syndrome, hydrocephalus, manic depressive illness, mental retardation, schizophrenia, spina bifida, Tourette's syndrome, and any combination thereof.

[0009] Another aspect of the present disclosure encompasses a method of using a differentially expressed gene in a subject as a surrogate endpoint for the subject in a trial of a Sigma-1 receptor agonist administered to the subject, the method comprising the steps of: (a) obtaining or having obtained a differentially expressed gene from the subject, wherein the differentially expressed gene comprises a gene having different expression levels before the trial and at the end of the trial; and (b) labeling the subject as meeting the surrogate endpoint if the obtained differentially expressed gene(s) is listed in a gene list comprising REM2, BCL6, ARHGAP27,CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, and / or ACAT1. For example, the identified differentially expressed gene(s) may be one or more gene selected from the group consisting of REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and any combination thereof. In one aspect, the trial is an interventional clinical trial against a neurological disease or disorder and the neurological disease or disorder is a neurodegenerative and / or neurodevelopmental or disorder including, for example, Alzheimer’s disease, Parkinson’s disease, Parkinson’s disease with dementia, Huntington’s disease, Amyotrophic lateral sclerosis, Prion disease, Rett syndrome, cerebral palsy, Down's syndrome, Williams-Beuren syndrome, Prader-Willi syndrome, Angelman syndrome, pervasive developmental disorder not otherwise specified (PDD-NOS), childhood disintegrative disorder, Smith-Magenis syndrome, multiple sclerosis, velo-cardio-facial syndrome, ATR-X syndrome, Barth syndrome, Fragile X syndrome, ICF syndrome, Neurofibromatosis, Smith-Lemli-Opitz syndrome, an addictive disorder, Attention-deficit / hyperactivity disorder (ADHD), an anxiety disorder, Asperger's syndrome, autism spectrum disorder, an eating disorder, epilepsy, infantile spasms, fetal alcohol syndrome, hydrocephalus, manic depressive illness, mental retardation, schizophrenia, spina bifida, Tourette's syndrome, and any combination thereof.

[0010] Yet another aspect of the present disclosure encompasses a method of assessing a disease risk in a subject, the method comprising the steps of: (a) administering the Sigma-1 receptor agonist to the subject for an assessment period; (b) identifying a differentially expressed gene by comparing the gene expression level in the test biological sample obtained from the subject at the end of the assessment period with the gene expression level in the control biological sample obtained from the subject before the assessment period; and (c) assessing the subject having a high risk of the disease, if any of the identified differentially expressed gene(s) is listed in a gene list comprising REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK,SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, and / or ACAT1. For example, the identified differentially expressed gene(s) may be one or more gene selected from the group consisting of REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and any combination thereof. In one aspect, the disease is a neurodegenerative and / or neurodevelopmental or disorder including, for example, Alzheimer’s disease, Parkinson’s disease, Parkinson’s disease with dementia, Huntington’s disease, Amyotrophic lateral sclerosis, Prion disease, Rett syndrome, cerebral palsy, Down's syndrome, Williams-Beuren syndrome, Prader-Willi syndrome, Angelman syndrome, pervasive developmental disorder not otherwise specified (PDD-NOS), childhood disintegrative disorder, Smith-Magenis syndrome, multiple sclerosis, velo-cardio- facial syndrome, ATR-X syndrome, Barth syndrome, Fragile X syndrome, ICF syndrome, Neurofibromatosis, Smith-Lemli-Opitz syndrome, an addictive disorder, Attention-deficit / hyperactivity disorder (ADHD), an anxiety disorder, Asperger's syndrome, autism spectrum disorder, an eating disorder, epilepsy, infantile spasms, fetal alcohol syndrome, hydrocephalus, manic depressive illness, mental retardation, schizophrenia, spina bifida, Tourette's syndrome, and any combination thereof.

[0011] Yet another aspect of the present disclosure encompasses a method of determining if a subject has or is suspected of having a neurological disease, the method comprising the steps of (a) obtaining or having obtained a differential gene expression profile for the subject, wherein the differential gene expression profile comprises a comparison of a first gene expression profile derived from a first biological sample from the subject before administration of a Sigma-1 receptor agonist to the subject, and a second gene expression profile derived from a second biological sample from the subject after a period of administration of the Sigma-1 receptor agonist to the subject; (b) identifying any differentially expressed gene and / or overrepresented gene from the comparison of the first and second gene expression profiles in (a); (c) confirming the subject as having the disease, if any of the identified differentially expressed gene(s) and / or overrepresented gene(s) is listed in a gene list comprising REM2, BCL6, ARHGAP27, CSF3R, DENND3,KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, and ACAT1. For example, the identified differentially expressed gene(s) and / or overrepresented gene(s) may be one or more gene selected from the group consisting of REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and any combination thereof. In one aspect, the neurological disease or disorder is a neurodegenerative and / or neurodevelopmental or disorder including, for example, Alzheimer’s disease, Parkinson’s disease, Parkinson’s disease with dementia, Huntington’s disease, Amyotrophic lateral sclerosis, Prion disease, Rett syndrome, cerebral palsy, Down's syndrome, Williams- Beuren syndrome, Prader-Willi syndrome, Angelman syndrome, pervasive developmental disorder not otherwise specified (PDD-NOS), childhood disintegrative disorder, Smith-Magenis syndrome, multiple sclerosis, velo-cardio-facial syndrome, ATR-X syndrome, Barth syndrome, Fragile X syndrome, ICF syndrome, Neurofibromatosis, Smith-Lemli-Opitz syndrome, an addictive disorder, Attention- deficit / hyperactivity disorder (ADHD), an anxiety disorder, Asperger's syndrome, autism spectrum disorder, an eating disorder, epilepsy, infantile spasms, fetal alcohol syndrome, hydrocephalus, manic depressive illness, mental retardation, schizophrenia, spina bifida, Tourette's syndrome, and any combination thereof.

[0012] Yet another aspect of the present disclosure encompasses a method of assessing a disease risk in a subject, the method comprising the steps of (a) obtaining or having obtained a differential gene expression profile for the subject, wherein the differential gene expression profile comprises a comparison of a first gene expression profile derived from a first biological sample from the subject before administration of a Sigma-1 receptor agonist to the subject, and a second gene expression profile derived from a second biological sample from the subject after a period of administration of the Sigma-1 receptor agonist to the subject; (b) identifying any differentially expressed gene and / or overrepresented gene cluster from the comparison of the first and second gene expression profiles in (a); (c) assessing the subject as having an increased risk of developing the disease, if any of the identifieddifferentially expressed gene(s) and / or overrepresented gene(s) is listed in a gene list comprising REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, and / or ACAT1; and (d) recommending the subject to a therapy for the disease with increased risk. For example, the identified differentially expressed gene(s) and / or overrepresented gene(s) may be one or more gene selected from the group consisting of REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and any combination thereof. In one aspect, the neurological disease or disorder is a neurodegenerative and / or neurodevelopmental or disorder including, for example, Alzheimer’s disease, Parkinson’s disease, Parkinson’s disease with dementia, Huntington’s disease, Amyotrophic lateral sclerosis, Prion disease, Rett syndrome, cerebral palsy, Down's syndrome, Williams-Beuren syndrome, Prader-Willi syndrome, Angelman syndrome, pervasive developmental disorder not otherwise specified (PDD-NOS), childhood disintegrative disorder, Smith-Magenis syndrome, multiple sclerosis, velo-cardio-facial syndrome, ATR-X syndrome, Barth syndrome, Fragile X syndrome, ICF syndrome, Neurofibromatosis, Smith-Lemli-Opitz syndrome, an addictive disorder, Attention-deficit / hyperactivity disorder (ADHD), an anxiety disorder, Asperger's syndrome, autism spectrum disorder, an eating disorder, epilepsy, infantile spasms, fetal alcohol syndrome, hydrocephalus, manic depressive illness, mental retardation, schizophrenia, spina bifida, Tourette's syndrome, and any combination thereof.

[0013] Another aspect of the present disclosure encompasses a method of evaluating effectiveness of a Sigma-1 receptor agonist therapy in a subject in need thereof, the method comprising the steps of: (a) obtaining or having obtained a differential gene expression profile for the subject, wherein the differential gene expression profile comprises a comparison of a first gene expression profile derived from a first biological sample from the subject before onset of the Sigma-1 receptor agonist therapy to the subject, and a second gene expression profile derived from a second biological sample from the subject after a period of administration of theSigma-1 receptor agonist therapy to the subject; (b) determining if REM2 or BCL6 (or other gene(s) listed in the present disclosure) is / are part of the differential gene expression profile from the comparison of the first and second gene expression profiles in (a); (c) identifying the Sigma-1 receptor agonist therapy as effective for the subject, if the REM2 or BCL6 (or other gene(s) or combinations of genes in the gene lists of the present disclosure) is / are determined to be differentially expressed in step (b); or as ineffective for the subject, if the REM2 or BCL6 (or other gene(s) or combinations of genes in the gene lists of the present disclosure) is / are determined to be not differentially expressed in the step (b); and (d) continuing in providing the Sigma-1 receptor agonist therapy to the subject if the Sigma-1 receptor agonist therapy is identified as effective in step (c), the method further comprises one or more of the following steps: (i) switching the subject to another Sigma-1 receptor agonist therapy; (ii) supplementing with another Sigma-1 receptor agonist therapy; (iii) adjusting the dose of the Sigma-1 receptor agonist therapy; or (iv) switching the subject to a combination therapy comprising the Sigma-1 receptor agonist therapy and another neurodegenerative and / or neurodevelopmental drug therapy .

[0014] Another aspect of the present disclosure encompasses a kit for a medical use, comprising: (1) a first container for receiving a control biological sample of a subject; (2) a second container for receiving a test biological sample from the subject; (3) a third container for storing an agent for measuring a gene expression profile; (4) a fourth container for storing a composition comprising a Sigma-1 receptor agonist; and (5) a user instruction in printed or computer readable medium. In one aspect, the medical use of the kit comprises one or more of the following: (i) selecting the Sigma-1 receptor agonist therapy for the subject; (ii) evaluating effectiveness of the Sigma-1 receptor agonist therapy; (iii) identifying a subject responsive to the Sigma-1 receptor agonist therapy; or (iv) determining if a subject is having, is suspected of having, or having an increased risk for developing a disease, wherein the disease comprises Alzheimer’s disease, Parkinson’s disease, Parkinson’s disease with dementia, Huntington’s disease, Amyotrophic lateral sclerosis, Prion disease, Rett syndrome, cerebral palsy, Down's syndrome, Williams- Beuren syndrome, Prader-Willi syndrome, Angelman syndrome, pervasive developmental disorder not otherwise specified (PDD-NOS), childhood disintegrative disorder, Smith-Magenis syndrome, multiple sclerosis, velo-cardio-facial syndrome,ATR-X syndrome, Barth syndrome, Fragile X syndrome, ICF syndrome, Neurofibromatosis, Smith-Lemli-Opitz syndrome, an addictive disorder, Attention- deficit / hyperactivity disorder (ADHD), an anxiety disorder, Asperger's syndrome, autism spectrum disorder, an eating disorder, epilepsy, infantile spasms, fetal alcohol syndrome, hydrocephalus, manic depressive illness, mental retardation, schizophrenia, spina bifida, Tourette's syndrome, and any combination thereof. Any one or more of steps (i), (ii), (iii), and (iv) can be performed in accordance with the aspects, methods, and / or embodiments disclosed herein.

[0015] In various aspects, methods, and / or embodiments disclosed herein, the Sigma-1 receptor agonist is selected from: tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride (A2-73), tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine (A2-73 freebase), tetrahydro-N,N-dimethyl-5,5-diphenyl-3- furanmethanamine hydrochloride (A1-41); tetrahydro-N,N-dimethyl-5,5-diphenyl-3- furanmethanamine (A1-41 freebase); 1-(2,2-diphenyltetrahydrofuran-3-yl)-N- methylmethanamine hydrochloride (A19-144); 1-(2,2-diphenyltetrahydrofuran-3-yl)- N-methylmethanamine (A19-144 freebase); (1-(2,8-dimethyl- l-thia-3,8- diazaspiro(4.5)dec-3-yl)-3-(lH-indol-3-yl)propan-l-one) (A3-71); an enantiomer thereof, a crystal form thereof, a co-crystal form thereof, a pharmaceutically acceptable salt thereof, a crystal or co-crystal of the pharmaceutically acceptable salt thereof, or any combination thereof.

[0016] In these and other various aspects, methods, and / or embodiments disclosed herein, the Sigma-1 receptor agonist is selected from: tetrahydro-N,N- dimethyl-2,2-diphenyl-3-furanmethanamine in amorphous form (A2-73 freebase amorphous form); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine in crystal Form I (A2-73 Freebase Crystal Form I); tetrahydro-N,N-dimethyl-2,2- diphenyl-3-furanmethanamine hydrochloride in crystal Form I (A2-73 Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form II (A2-73 Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride in crystal Form III (A2-73 Crystal Form III); (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in amorphous form ((+) A2-73 amorphous form); (-) tetrahydro-N,N-dimethyl-2,2- diphenyl-3-furanmethanamine hydrochloride in amorphous form ((-) A2-73 amorphous form); (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanaminehydrochloride in a crystal form ((+) A2-73 crystal form); (-) tetrahydro-N,N-dimethyl- 2,2-diphenyl-3-furanmethanamine hydrochloride in a crystal form ((-) A2-73 crystal form); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in amorphous form (A2-73 hydrogen fumarate amorphous form); tetrahydro-N,N- dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form I (A2- 73 hydrogen fumarate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrogen fumarate in crystal Form II (A2-73 hydrogen fumarate Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form III (A2-73 hydrogen fumarate Crystal Form III); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form IV (A2-73 hydrogen fumarate Crystal Form IV); tetrahydro-N,N- dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form V (A2-73 hydrogen fumarate Crystal Form V); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine mesylate in crystal Form I (A2-73 mesylate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine sulfate in crystal Form I (A2-73 sulfate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine sulfate in crystal Form II (A2-73 sulfate Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine oxalate in crystal Form I (A2-73 oxalate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine oxalate in crystal Form II (A2-73 oxalate Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine dihydrogen phosphate in crystal Form I (A2-73 dihydrogen phosphate Crystal Form I); tetrahydro-N,N- dimethyl-2,2-diphenyl-3-furanmethanamine edisylate in crystal Form I (A2-73 edisylate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine benzoate in crystal Form I (A2-73 benzoate Crystal Form I); tetrahydro-N,N-dimethyl- 2,2-diphenyl-3-furanmethanamine hydrobromide in crystal Form A (A2-73 hydrobromide Crystal Form A); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrobromide in crystal Form B (A2-73 hydrobromide Crystal Form B); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine maleate in crystal Form S5 (A2-73 maleate Crystal Form S5); tetrahydro-N,N-dimethyl-2,2- diphenyl-3-furanmethanamine maleate in crystal Form S6 (A2-73 maleate Crystal Form S6); co-crystal Form CSII of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with tartaric acid (A2-73 co-crystal with tartaric acid Crystal Form CSII); co-crystal Form CSIII of tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with citric acid (A2-73 co-crystal with citric acid Crystal Form CSIII); co-crystal Form CSIV of tetrahydro-N,N-dimethyl-2,2-diphenyl- 3-furanmethanamine hydrochloride with malic acid (A2-73 co-crystal with malic acid Crystal Form CSIV); a co-crystal of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with zinc chloride (A2-73 co-crystal with zinc chloride); a co-crystal of (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with zinc chloride ((-) A2-73 co-crystal with zinc chloride); a co-crystal of (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with zinc chloride ((+) A2-73 co-crystal with zinc chloride); and any combination thereof. In another aspect, method, or embodiment, the Sigma-1 receptor agonist therapy comprises an oral composition comprising A2- 73 freebase, A2-73 amorphous form, A2-73 Crystal Form I, A2-73 Crystal Form II, A2-73 Crystal Form III, (-) A2-73 enantiomer, (+) A2-73 enantiomer, or any combination thereof. In yet another aspect, the composition comprises about 20-50 mg of A2-73 free base, or A2-73 Crystal Form I. In yet another aspect, the composition is an oral liquid and comprises A2-73 in an amount of about 30 mg.

[0017] In various aspects, methods, and / or embodiments disclosed herein, the neurological disease or disorder is a neurodegenerative and / or neurodevelopmental disease or disorder including, for example, Alzheimer’s disease, Parkinson’s disease, Parkinson’s disease with dementia, Huntington’s disease, Amyotrophic lateral sclerosis, Prion disease, Rett syndrome, cerebral palsy, Down's syndrome, Williams-Beuren syndrome, Prader-Willi syndrome, Angelman syndrome, pervasive developmental disorder not otherwise specified (PDD-NOS), childhood disintegrative disorder, Smith-Magenis syndrome, multiple sclerosis, velo-cardio-facial syndrome, ATR-X syndrome, Barth syndrome, Fragile X syndrome, ICF syndrome, Neurofibromatosis, Smith-Lemli-Opitz syndrome, an addictive disorder, Attention- deficit / hyperactivity disorder (ADHD), an anxiety disorder, Asperger's syndrome, autism spectrum disorder, an eating disorder, epilepsy, infantile spasms, fetal alcohol syndrome, hydrocephalus, manic depressive illness, mental retardation, schizophrenia, spina bifida, Tourette's syndrome, and any combination thereof. In one aspect, the neurological disease or disorder is a neurodegenerative disease or disorder. In another aspect, method, and / or embodiment, the neurological disease or disorder is a neurodevelopmental disease or disorder. In one aspect, theneurodegenerative disease or disorder is Alzheimer’s disease, Parkinson’s disease, Parkinson’s disease with dementia, Huntington’s disease, Amyotrophic lateral sclerosis, or multiple sclerosis. In one aspect, the neurodevelopmental disorder is Rett Syndrome. In another aspect, method, and / or embodiment, the neurodevelopmental disorder is Fragile X Syndrome. In yet another aspect, the subject is a pediatric human patient, a teenage human patient, or an adult human patient.

[0018] In various aspects, methods, and / or embodiments disclosed herein, the differentially expressed gene(s) is / are REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. In one aspect, the differentially expressed gene(s) is / are REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, and / or any combination thereof. In another aspect, method, or embodiment, the differentially expressed gene(s) is / are RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. In yet another aspect, method, or embodiment, the differentially expressed gene(s) is / are REM2, BCL6, and / or any combination thereof. In one embodiment, the differentially expressed gene is one or more of REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, and / or ACAT1. In another embodiment, the differentially expressed gene is one or more of REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, and / or LRRK2. In another embodiment, the differentially expressed gene is one or more of RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, and / or ACAT1. In another embodiment, the differentially expressed gene is one or more of REM2 and / or BCL6. Any gene list in the aspects, methods, and / or embodiments disclosed herein may consist of REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR,LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and any combination thereof. Any gene list in the aspects, methods, and embodiments disclosed herein may comprise REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. Any of the foregoing differentially expressed gene aspect, method, and / or embodiment combinations may be supplemented with one or more combinations of differentially expressed gene(s) listed herein. Therefore, a “gene list” in accordance with this disclosure can include any one or more gene(s), or combination, sub-combination of gene(s), from the genes included in this paragraph.

[0019] In various aspects, methods, and / or embodiments disclosed herein, the administering comprises a route of administration selected from the group consisting of oral administration, subcutaneous injection, intravenous injection, intraocular injection, intradermal injection, intramuscular injection, intraperitoneal injection, intratracheal administration, inhalation, intranasal administration, sublingual administration, buccal administration, rectal administration, vaginal administration, and topical administration.

[0020] In various aspects, methods, and / or embodiments disclosed herein, the test biological sample or the control biological sample each independently comprises a blood serum sample, a blood plasma sample, or a sample suitable for multi-omics (e.g., one or more of proteomic, transcriptomic, and / or genomic) analysis. In one aspect, the test biological sample and the control biological sample are the same type of biological samples. In another aspect, the test biological sample and the control biological sample are different types of biological samples.

[0021] In various aspects, methods, and / or embodiments disclosed herein, the treatment period or the trial period is about 12 weeks or less. In another aspect, the treatment period is about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, or about 12 weeks. In yet another aspect, the Sigma-1 receptor agonist is administered daily. In various aspects, the Sigma-1 receptor agonist is tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine in crystal Form I, or the Sigma-1 receptor agonist is tetrahydro- N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in Crystal Form I. In various aspects, the Sigma-1 receptor agonist is administered daily in an amount of about 10 mg to about 60 mg. In various aspects, the Sigma-1 receptor agonist is administered in an oral liquid comprising up to about 30 mg of the Sigma-1 receptor agonist. In various aspects, the Sigma-1 receptor agonist comprises tetrahydro-N,N- dimethyl-2,2-diphenyl-3-furanmethanamine or tetrahydro-N,N-dimethyl-2,2-diphenyl- 3-furanmethanamine hydrochloride in an oral solution, and wherein the tetrahydro- N,N-dimethyl-2,2-diphenyl-3-furanmethanamine or the tetrahydro-N,N-dimethyl-2,2- diphenyl-3-furanmethanamine hydrochloride is administered once daily for a period of 12 weeks in an escalating dose regimen starting at about 30 mg and ending at about 50 mg.

[0022] Headings included herein are simply for ease of reference and are not intended to limit the disclosure in any way. REFERENCE TO COLOR FIGURES

[0023] The application file contains at least one drawing or photograph executed in color. Copies of this patent application publication with color drawings or photographs will be provided by the Office upon request and payment of the necessary fee. BRIEF DESCRIPTION OF THE FIGURES

[0024] FIG.1 depicts the patient samples used to validate REM2 differential gene expression assay.

[0025] FIGS.2A-2C provide gene expression levels obtained through RT-qPCR measurements for a subset of genes from the original 119 gene set and from the patient samples in FIG.1, including REM2. FIG.2A is a tabulated view of the gene expression data. FIG.2B graphs the gene expression changes of various genes before and after treatment with ANAVEX® 2-73. FIG.2C specifically shows REM2 expression changes before and after treatment with ANAVEX® 2-73.

[0026] FIG.3 depicts the heatmap of patients’ data: each row represented a gene, and each column represented a different patient (18 patients in ANAVEX® 2- 73 treatment group, and 11 patients in placebo group). Z-scores were used to compare the expression of a gene in a sample against its average expression acrossall samples. A positive z-score (red) indicates expression above the mean, while a negative z-score (blue) indicates expression below the mean. Gene-list in the heatmap was sorted based on the signal to noise (S / N) ratio. DETAILED DESCRIPTION

[0027] The present disclosure is based in part on the discovery that when a subject is administered a therapeutic agent, such as a Sigma-1 receptor agonist for a period of time, a set of selected genes are differentially expressed. Further, these differentially expressed genes are involved in distinct biological pathways implicated in certain diseases and disorders. The discovered correlation between disease treatment and changes in genetic profiles pre- and post-treatment, such as differentially expressed genes and / or overrepresented gene clusters, can be used as an indicator for monitoring therapeutic effect, selecting a personalized therapy, as a surrogate endpoint for a clinical trial, to further guide endpoint selection concerning the treatment, and / or assessing and / or evaluating disease risk. By way of example, the correlation may be used to evaluate therapeutic effectiveness of a Sigma-1 receptor agonist, or to select a specific Sigma-1 receptor agonist for a subject based on changes induced in the subject’s gene expression profile, or to assess a subject’s disease state or risk for developing a disease using a Sigma-1 receptor agonist as a probe. The present disclosure focuses on Sigma-1 receptor agonist therapy and neurological diseases and disorders (including neurodegenerative and / or neurodevelopmental diseases and disorders. But the same principle and methods can be similarly applied to other classes of therapeutic agents and / or other diseases or disorders.

[0028] Sigma-1 receptors are involved in higher-ordered brain functions including memory and cognition. Thus, a Sigma-1 receptor agonist is often prescribed to patients with memory or cognition impairment, such as those with neurodegenerative and / or neurodevelopmental disorders. It has been discovered that following treatment with a Sigma-1 receptor agonist, a subject’s gene expression profiles are altered by differentially expressing some specific genes. This altered gene profile also affects biological pathways and functions, including but not limited to metabolic pathways, mitochondrial energy production, oxidative phosphorylation, fatty acidmetabolism, developmental signaling pathways, transcription / translation pathways, membrane trafficking, and branched-chain amino acid catabolism. The altered genetic profile can thus be used as an indicator or benchmark to evaluate the therapeutic effect and as a surrogate endpoint for clinical trials. The altered genetic profile can also be used to monitor the effectiveness of a therapy against a specific subject, thus design a personalized therapy. It can also be used to select a specific Sigma-1 receptor agonist for a specific subject. Alternatively, the altered gene profile may also be used to determine if a subject is responsive to a Sigma-1 receptor agonist therapy. Finally, the Sigma-1 receptor agonist can be used a probe to see if a subject is having, or is suspected of having, or at an increased risk of having, a disease linked to the altered gene expression profiles.

[0029] The Sigma-1 receptor agonist used in the aspects, methods, and / or embodiments disclosed herein is selected from: tetrahydro-N,N-dimethyl-2,2- diphenyl-3-furanmethanamine hydrochloride (A2-73), tetrahydro-N,N-dimethyl-2,2- diphenyl-3-furanmethanamine (A2-73 freebase), tetrahydro-N,N-dimethyl-5,5- diphenyl-3-furanmethanamine hydrochloride (A1-41); tetrahydro-N,N-dimethyl-5,5- diphenyl-3-furanmethanamine (A1-41 freebase); 1-(2,2-diphenyltetrahydrofuran-3- yl)-N-methylmethanamine hydrochloride (A19-144); 1-(2,2-diphenyltetrahydrofuran- 3-yl)-N-methylmethanamine (A19-144 freebase); (1-(2,8-dimethyl- l-thia-3,8- diazaspiro(4.5)dec-3-yl)-3-(lH-indol-3-yl)propan-l-one) (A3-71); an enantiomer thereof, a crystal form thereof, a co-crystal form thereof, a pharmaceutically acceptable salt thereof, a crystal or co-crystal of the pharmaceutically acceptable salt thereof, or any combination thereof.

[0030] In some aspects, methods, and / or embodiments disclosed herein, the Sigma-1 receptor agonist is selected from: tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine in amorphous form (A2-73 freebase amorphous form); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine in crystal Form I (A2-73 Freebase Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride in crystal Form I (A2-73 Crystal Form I); tetrahydro- N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form II (A2- 73 Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form III (A2-73 Crystal Form III); (+) tetrahydro-N,N- dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in amorphous form ((+)A2-73 amorphous form); (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride in amorphous form ((-) A2-73 amorphous form); (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in a crystal form ((+) A2-73 crystal form); (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride in a crystal form ((-) A2-73 crystal form); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in amorphous form (A2-73 hydrogen fumarate amorphous form); tetrahydro-N,N- dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form I (A2- 73 hydrogen fumarate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrogen fumarate in crystal Form II (A2-73 hydrogen fumarate Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form III (A2-73 hydrogen fumarate Crystal Form III); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form IV (A2-73 hydrogen fumarate Crystal Form IV); tetrahydro-N,N- dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form V (A2-73 hydrogen fumarate Crystal Form V); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine mesylate in crystal Form I (A2-73 mesylate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine sulfate in crystal Form I (A2-73 sulfate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine sulfate in crystal Form II (A2-73 sulfate Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine oxalate in crystal Form I (A2-73 oxalate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine oxalate in crystal Form II (A2-73 oxalate Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine dihydrogen phosphate in crystal Form I (A2-73 dihydrogen phosphate Crystal Form I); tetrahydro-N,N- dimethyl-2,2-diphenyl-3-furanmethanamine edisylate in crystal Form I (A2-73 edisylate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine benzoate in crystal Form I (A2-73 benzoate Crystal Form I); tetrahydro-N,N-dimethyl- 2,2-diphenyl-3-furanmethanamine hydrobromide in crystal Form A (A2-73 hydrobromide Crystal Form A); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrobromide in crystal Form B (A2-73 hydrobromide Crystal Form B); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine maleate in crystal Form S5 (A2-73 maleate Crystal Form S5); tetrahydro-N,N-dimethyl-2,2- diphenyl-3-furanmethanamine maleate in crystal Form S6 (A2-73 maleate CrystalForm S6); co-crystal Form CSII of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with tartaric acid (A2-73 co-crystal with tartaric acid Crystal Form CSII); co-crystal Form CSIII of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with citric acid (A2-73 co-crystal with citric acid Crystal Form CSIII); co-crystal Form CSIV of tetrahydro-N,N-dimethyl-2,2-diphenyl- 3-furanmethanamine hydrochloride with malic acid (A2-73 co-crystal with malic acid Crystal Form CSIV); a co-crystal of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with zinc chloride (A2-73 co-crystal with zinc chloride); a co-crystal of (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with zinc chloride ((-) A2-73 co-crystal with zinc chloride); a co-crystal of (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with zinc chloride ((+) A2-73 co-crystal with zinc chloride); and any combination thereof. In another aspect, method, and / or embodiment, the Sigma-1 receptor agonist therapy comprises an oral composition comprising A2-73 free base, A2-73 amorphous form, A2-73 Crystal Form I, A2-73 Crystal Form II, A2-73 Crystal Form III, (-) A2-73 enantiomer, (+) A2-73 enantiomer, or any combination thereof. In yet another aspect, the composition comprises about 20-50 mg of A2-73 free base, or A2-73 Crystal Form I. In yet another aspect, the composition is an oral liquid and comprises A2-73 in an amount of about 30 mg. I. Gene Expressions, Gene Expression Profiles and Gene Pathways

[0031] One aspect of the present disclosure relates to monitoring the impact of Sigma-1 receptor agonist on gene expression, gene expression levels and profiles, gene pathways, and / or biological pathways. The type of genes expressed and the quantity / level of expression can be impacted by environmental factors, such as diet, temperature, oxygen levels, humidity, light cycles, and drug intervention. Methods for measuring gene expression in a biological sample are well known. For example, gene expression levels may be measured by the amount of a specific RNA transcribed from its cognate DNA, the amount of proteins made from such RNAs, and / or via functional assays measuring the activity level of a protein in a cell. Laboratory methods to measure gene expression level include, but not limited to, Northern blotting, quantitative polymerase chain reaction (qPCR), DNA microarray, and RNA-Sequencing. As used in this disclosure, gene expression levels can bemeasured using viable and feasible methods, such as measurements of RNA transcripts generated per locus and / or tissue locations of these transcripts. Z-scores may be used to compare the expression of a gene in a sample against its average expression across all samples. A positive z-score indicates expression above the mean, while a negative z-score indicates expression below the mean. A gene expression profile comprises a list of genes detected in a biological sample, together with their expression levels. A gene expression profile can be obtained through well- established testing methods, such as Whole Exome Sequencing (WES) DNA data and full RNA exome expression (RNA-seq) data collection. When a tissue or biological entity is exposed to an environmental factor, such as administering a Sigma-1 receptor agonist, expression levels of an array of genes may be altered.

[0032] When a gene has a different expression level before and after such exposure to an environmental factor, it is a “differentially expressed gene”. In other words, a differentially expressed gene is a gene that has different expression levels before and after exposure to an environmental factor. One way to efficiently identify such differentially expressed gene is through comparing the gene expression profile before and after the exposure. For example, a control or a first gene expression profile is obtained through gene analysis on a control or a first biological sample taken before exposure to an environment factor. Then after the exposure, a second gene expression profile, also called “test gene expression profile” herein, is obtained through gene analysis on a test biological sample taken at the end of the exposure. By checking the genes in the test gene expression profile against the genes in the control gene expression profile, genes common to both profiles can be identified, then their expression levels can be compared to identify those genes that have different expression levels in the test biological sample than that in the control biological sample. Such identified gene(s) are differentially expressed gene(s). For example, genes detected and found to have been differentially expressed may comprise REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. In various aspects, methods, and / or embodiments disclosed in this section I herein, therefore, the differentially expressed gene(s) include REM2, BCL6, ARHGAP27,CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. In these and other aspects, methods, and / or embodiments disclosed in this section, the differentially expressed gene(s) include REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, and / or any combination thereof. In other aspects, methods, and / or embodiments disclosed in this section I herein, the differentially expressed gene(s) include RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. In still other aspects, methods, and / or embodiments disclosed in this section I herein, the differentially expressed gene(s) include REM2, BCL6, and / or any combination thereof. In one aspect, method, and / or embodiment disclosed in this section I herein, the differentially expressed gene(s) is one or more of REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, and ACAT1. In another aspect, method, and / or embodiment disclosed in this section I herein, the differentially expressed gene is one or more of REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, and LRRK2. In another aspect, method, and / or embodiment disclosed in this section I herein, the differentially expressed gene is one or more of RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, and ACAT1. In another aspect, method, and / or embodiment disclosed in this section I herein, the differentially expressed gene is one or more of REM2 and BCL6. Any of the foregoing differentially expressed gene aspects, methods, and / or embodiments in this section I herein may be supplemented with one or more combinations of differentially expressed gene(s) listed herein.

[0033] Another aspect of the present disclosure relates to monitoring the impact (including efficacy and / or effectiveness) of a Sigma-1 receptor agonist on a genetic pathway(s) and / or a biological pathway(s). Genes do not function in isolation butrather suites of genes act in concert to perform biological functions. When different genes function in different sequential steps in a biological process, this is known as a gene pathway. There are various databases to collect, classify and organize genes based on their biological functions. KEGG (Kyoto Encyclopedia of Genes and Genomes) is one of such databases, presenting a collection of manually drawn pathway maps, together of which represent molecular interactions and relation networks between and beyond gene information, biological pathways, disease pathologies, drug interactions, and chemical substances. The present disclosure utilizes information and data presented in the KEGG platform. In one aspect, the genetic pathways comprise one or more genes selected from the group consisting of REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, and ACAT1. The genetic pathways can, in other aspects, comprise any combinations or sub-combinations of REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, and / or ACAT1. In another aspect, the genetic pathways are genes related to metabolic pathways, developmental signaling pathways, biological pathways related to RNA transcription / translation, membrane trafficking, and branched-chain amino acid catabolism. In yet another aspect, the biological pathways include metabolic pathways, such as those involved in mitochondrial energy production and / or in oxidative phosphorylation, fatty acid metabolism, developmental signaling pathways, transcription / translation, membrane trafficking, and branched-chain amino acid catabolism. The metabolic pathways also comprise oxidative phosphorylation, fatty acid metabolism, fatty acid beta-oxidation, adipogenesis, amino acid catabolism, mitochondrial protein import, valine leucine and isoleucine degradation, cysteine and methionine metabolism, acyl chain remodeling of phosphatidylserine or phosphatidylethanolamine, deubiquitination, detoxification of reactive oxygen species, N-glycan trimming, xylulose-5-phosphate formation, glycerophospholipid metabolism, any other related pathways and response chains, and various combinations thereof. In various aspects, methods, and / or embodiments disclosed in this section I herein, therefore, the differentially expressed gene(s) include REM2,BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. In these and other aspects, methods, and / or embodiments disclosed in this section I herein, the differentially expressed gene(s) include REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, and / or any combination. In other aspects, methods, and / or embodiments disclosed in this section I herein, the differentially expressed gene(s) include RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. In still other aspects, methods, and / or embodiments disclosed in this section I herein, the differentially expressed gene(s) include REM2, BCL6, and / or any combination thereof. In one aspect, method, and / or embodiment disclosed in this section I herein, the differentially expressed gene(s) is one or more of REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and any combination thereof. In another aspect, method, and / or embodiment disclosed in this section I herein, the differentially expressed gene(s) is one or more of REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, and / or LRRK2. In another aspect, method, and / or embodiment disclosed in this section I herein, the differentially expressed gene(s) is one or more of RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, and ACAT1. In another aspect, method, and / or embodiment disclosed in this section I herein, the differentially expressed gene(s) is one or more of REM2 and / or BCL6. Any of the foregoing differentially expressed gene aspect, method, and / or embodiment disclosed in this section I herein may be supplemented with one or more combinations or sub-combinations of differentially expressed gene(s) listed herein.

[0034] Another aspect of the present disclosure relates to identifying and monitoring treatment impact and / or efficacy and / or effectiveness of a Sigma-1receptor agonist, against a neurodevelopmental disorder or a neurodegenerative disorder, such as Rett syndrome or Fragile X Syndrome. In one aspect, the treatment impact and / or efficacy are monitored through extensive transcriptomics analysis (RNAseq) on the biological samples taken before and after the treatment period. In one aspect, the impact manifests as differentially expressed genes: some genes have different expression levels before and after the treatment. In yet another aspect, these differentially expressed genes identified through Sigma-1 receptor agonist intervention represent additional potential biomarkers for treatment efficacy. In another aspect, these differentially expressed genes indicate a potential for precision medicine for individual patients. In yet another aspect, the differentially expressed genes are associated with or correlated with underlying signaling pathways involved in response to a Sigma-1 receptor agonist therapy. In various aspects, methods, and / or embodiments disclosed in this section I herein, therefore, the differentially expressed gene(s) include REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. In these and other aspects, methods, and / or embodiments disclosed in this section I herein, the differentially expressed gene(s) include REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, and / or any combination thereof. In other aspects, methods, and / or embodiments disclosed in this section I herein, the differentially expressed gene(s) include RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. In still other aspects, methods, and / or embodiments disclosed in this section I herein, the differentially expressed gene(s) include REM2, BCL6, and any combination thereof. In one aspect, method, and / or embodiment disclosed in this section I herein, the differentially expressed gene(s) is one or more of REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. In another aspect, method, and / or embodiment disclosed in this section I herein, the differentially expressed gene(s) is one or moreof REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, and / or any combination thereof. In another aspect, method, and / or embodiment disclosed in this section I herein, the differentially expressed gene(s) is one or more of RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. In another aspect, method, and / or embodiment disclosed in this section I herein, the differentially expressed gene(s) is one or more of REM2 and / or BCL6. Any of the foregoing differentially expressed gene aspect, method, and / or embodiment disclosed in this section I herein may be supplemented with one or more combinations or sub-combinations of differentially expressed gene(s) listed herein.

[0035] Yet another aspect of the present disclosure relates to a method of assessing a disease risk, for example using a Sigma-1 receptor agonist as a probe. The method comprises administering the Sigma-1 receptor agonist to the subject for an assessment period; identifying a differentially expressed gene by comparing the gene expression level in the test biological sample obtained from the subject at the end of the assessment period with the gene expression level in the control biological sample obtained from the subject before the assessment period; assessing the subject having a high risk of the disease, if any of the identified differentially expressed gene(s) appearing in a gene list comprising REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. Exemplary diseases may include Alzheimer’s disease, Parkinson’s disease, Parkinson’s disease with dementia, Huntington’s disease, Amyotrophic lateral sclerosis, Prion disease, Rett syndrome, cerebral palsy, Down's syndrome, Williams-Beuren syndrome, Prader-Willi syndrome, Angelman syndrome, pervasive developmental disorder not otherwise specified (PDD-NOS), childhood disintegrative disorder, Smith-Magenis syndrome, multiple sclerosis, velo- cardio-facial syndrome, ATR-X syndrome, Barth syndrome, Fragile X syndrome, ICF syndrome, Neurofibromatosis, Smith-Lemli-Opitz syndrome, an addictive disorder, Attention-deficit / hyperactivity disorder (ADHD), an anxiety disorder, Asperger's syndrome, autism spectrum disorder, an eating disorder, epilepsy, infantile spasms,fetal alcohol syndrome, hydrocephalus, manic depressive illness, mental retardation, schizophrenia, spina bifida, Tourette's syndrome, and / or any combination thereof. In various aspects, methods, and / or embodiments disclosed in this section I herein, therefore, the differentially expressed gene(s) include REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. In these and other aspects, methods, and / or embodiments disclosed in this section I herein, the differentially expressed gene(s) include REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, and / or any combination thereof. In other aspects, methods, and / or embodiments disclosed in this section I herein, the differentially expressed gene(s) include RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. In still other aspects, methods, and / or embodiments disclosed in this section I herein, the differentially expressed gene(s) include REM2, BCL6, and / or any combination thereof. In one aspect, method, and / or embodiment disclosed in this section I herein, the differentially expressed gene(s) is one or more of REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. In another aspect, method, and / or embodiment disclosed in this section I herein, the differentially expressed gene(s) is one or more of REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, and / or any combination thereof. In another aspect, method, and / or embodiment disclosed in this section I herein, the differentially expressed gene(s) is one or more of RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. In another aspect, method, and / or embodiment disclosed in this section I herein, the differentially expressed gene(s) is one or more of REM2 and / or BCL6. Any of the foregoing differentially expressed gene aspect, method, and / or embodiment disclosed in this section I herein may be supplemented with oneor more combinations or sub-combinations of differentially expressed gene(s) listed herein.

[0036] Another aspect of the present disclosure relates to use of differentially expressed genes as surrogate endpoints in trials, such as an interventional clinical trial or an observational clinical trial. Typically, therapeutic efficacy of the tested intervention is measured by specific physiological endpoints, such as physical parameters and / or cognitive behaviors indicative of the disorder evaluated in the trial. Often, these physiological endpoints are different for different disorders. For example, physiological endpoints for Alzheimer’s disease are different from those for Rett syndrome or Fragile X Syndrome. These endpoints measure both the pathology of each disease as well as the therapeutic response to the Sigma-1 receptor agonist. A surrogate biomarker for therapeutic response to Sigma-1 receptor agonist will simplify the design of clinical trials for each of these disorders, replacing the inherent analytical variability of the endpoint measurements for these diseases, as well as the length and size of these clinical trials. This surrogate endpoint may also be applicable across other clinical indications for Sigma-1 receptor agonist. The present disclosure presents an unexpected finding that differentially expressed genes are statistically significant for the application of these genes as a surrogate for therapeutic efficacy against various neurodevelopmental and / or neurodegenerative diseases and disorders. Such diseases or disorders may include Alzheimer’s disease, Parkinson’s disease, Parkinson’s disease with dementia, Huntington’s disease, Amyotrophic lateral sclerosis, Prion disease, Rett syndrome, cerebral palsy, Down's syndrome, Williams-Beuren syndrome, Prader-Willi syndrome, Angelman syndrome, pervasive developmental disorder not otherwise specified (PDD-NOS), childhood disintegrative disorder, Smith-Magenis syndrome, multiple sclerosis, velo- cardio-facial syndrome, ATR-X syndrome, Barth syndrome, Fragile X syndrome, ICF syndrome, Neurofibromatosis, Smith-Lemli-Opitz syndrome, an addictive disorder, Attention-deficit / hyperactivity disorder (ADHD), an anxiety disorder, Asperger's syndrome, autism spectrum disorder, an eating disorder, epilepsy, infantile spasms, fetal alcohol syndrome, hydrocephalus, manic depressive illness, mental retardation, schizophrenia, spina bifida, Tourette's syndrome, and / or any combination thereof. In various aspects, methods, and / or embodiments disclosed in this section I herein, therefore, the differentially expressed gene(s) include REM2, BCL6, ARHGAP27,CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. In these and other aspects, methods, and / or embodiments disclosed in this section I herein, the differentially expressed gene(s) include REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, and / or any combination thereof. In other aspects, methods, and / or embodiments disclosed in this section I herein, the differentially expressed gene(s) include RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. In still other aspects, methods, and / or embodiments disclosed in this section I herein, the differentially expressed gene(s) include REM2, BCL6, and / or any combination thereof. In one aspect, method, and / or embodiment disclosed in this section I herein, the differentially expressed gene(s) is one or more of REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. In another aspect, method, and / or embodiment disclosed in this section I herein, the differentially expressed gene(s) is one or more of REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, and / or any combination thereof. In another aspect, method, and / or embodiment disclosed in this section I herein, the differentially expressed gene(s) is one or more of RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. In another aspect, method, and / or embodiment disclosed in this section I herein, the differentially expressed gene(s) is one or more of REM2 and / or BCL6. Any of the foregoing differentially expressed gene aspect, method, and / or embodiment disclosed in this section I herein may be supplemented with one or more combinations or sub-combinations of differentially expressed gene(s) listed herein.

[0037] In the various aspects, methods, and / or embodiments disclosed in this section I herein, the Sigma-1 receptor agonist used in the methods disclosed hereinis selected from: tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride (A2-73), tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine (A2-73 freebase), tetrahydro-N,N-dimethyl-5,5-diphenyl-3-furanmethanamine hydrochloride (A1-41); tetrahydro-N,N-dimethyl-5,5-diphenyl-3-furanmethanamine (A1-41 freebase); 1-(2,2-diphenyltetrahydrofuran-3-yl)-N-methylmethanamine hydrochloride (A19-144); 1-(2,2-diphenyltetrahydrofuran-3-yl)-N-methylmethanamine (A19-144 freebase); (1-(2,8-dimethyl- l-thia-3,8-diazaspiro(4.5)dec-3-yl)-3-(lH-indol- 3-yl)propan-l-one) (A3-71); an enantiomer thereof, a crystal form thereof, a co-crystal form thereof, a pharmaceutically acceptable salt thereof, a crystal or co-crystal of the pharmaceutically acceptable salt thereof, or any combination thereof. In some aspects, methods, and / or embodiments disclosed in this section I herein, the Sigma- 1 receptor agonist is selected from: tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine in amorphous form (A2-73 freebase amorphous form); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine in crystal Form I (A2-73 Freebase Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride in crystal Form I (A2-73 Crystal Form I); tetrahydro- N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form II (A2- 73 Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form III (A2-73 Crystal Form III); (+) tetrahydro-N,N- dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in amorphous form ((+) A2-73 amorphous form); (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride in amorphous form ((-) A2-73 amorphous form); (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in a crystal form ((+) A2-73 crystal form); (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride in a crystal form ((-) A2-73 crystal form); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in amorphous form (A2-73 hydrogen fumarate amorphous form); tetrahydro-N,N- dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form I (A2- 73 hydrogen fumarate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrogen fumarate in crystal Form II (A2-73 hydrogen fumarate Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form III (A2-73 hydrogen fumarate Crystal Form III); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form IV (A2-73 hydrogen fumarate Crystal Form IV); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form V (A2-73 hydrogen fumarate Crystal Form V); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine mesylate in crystal Form I (A2-73 mesylate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine sulfate in crystal Form I (A2-73 sulfate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine sulfate in crystal Form II (A2-73 sulfate Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine oxalate in crystal Form I (A2-73 oxalate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine oxalate in crystal Form II (A2-73 oxalate Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine dihydrogen phosphate in crystal Form I (A2-73 dihydrogen phosphate Crystal Form I); tetrahydro-N,N- dimethyl-2,2-diphenyl-3-furanmethanamine edisylate in crystal Form I (A2-73 edisylate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine benzoate in crystal Form I (A2-73 benzoate Crystal Form I); tetrahydro-N,N-dimethyl- 2,2-diphenyl-3-furanmethanamine hydrobromide in crystal Form A (A2-73 hydrobromide Crystal Form A); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrobromide in crystal Form B (A2-73 hydrobromide Crystal Form B); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine maleate in crystal Form S5 (A2-73 maleate Crystal Form S5); tetrahydro-N,N-dimethyl-2,2- diphenyl-3-furanmethanamine maleate in crystal Form S6 (A2-73 maleate Crystal Form S6); co-crystal Form CSII of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with tartaric acid (A2-73 co-crystal with tartaric acid Crystal Form CSII); co-crystal Form CSIII of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with citric acid (A2-73 co-crystal with citric acid Crystal Form CSIII); co-crystal Form CSIV of tetrahydro-N,N-dimethyl-2,2-diphenyl- 3-furanmethanamine hydrochloride with malic acid (A2-73 co-crystal with malic acid Crystal Form CSIV); a co-crystal of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with zinc chloride (A2-73 co-crystal with zinc chloride); a co-crystal of (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with zinc chloride ((-) A2-73 co-crystal with zinc chloride); a co-crystal of (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with zinc chloride ((+) A2-73 co-crystal with zinc chloride); and any combination thereof.II. Changes in Gene Expression Levels Associated with Sigma-1 Receptor Agonist Therapy and Disease Treatment

[0038] The present disclosure encompasses genes and biological pathways that are involved in or associated with various neurological diseases and / or disorders, including but not limited to, neurodegenerative and neurodevelopmental disorders. In one aspect, such gene(s) comprise one or more of REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. In another aspect, the biological pathways comprise metabolic pathways, developmental signaling pathways, biological pathways related to RNA transcription / translation, membrane trafficking, and branched-chain amino acid catabolism. In yet another aspect, the biological pathways include metabolic pathways, such as mitochondrial energy production and / or increased expression of genes involved in oxidative phosphorylation, fatty acid metabolism, developmental signaling pathways, transcription / translation, membrane trafficking, branched-chain amino acid catabolism, or any combination thereof. In another aspect, the metabolic pathways also comprise oxidative phosphorylation, fatty acid metabolism, fatty acid beta-oxidation, adipogenesis, amino acid catabolism, mitochondrial protein import, valine leucine and isoleucine degradation, cysteine and methionine metabolism, acyl chain remodeling of phosphatidylserine or phosphatidylethanolamine, deubiquitination, detoxification of reactive oxygen species, N-glycan trimming, xylulose-5-phosphate formation, glycerophospholipid metabolism, any other related pathways and responses, and various combinations thereof.

[0039] Neurodegenerative and neurodevelopmental diseases and disorders refer to a group of conditions wherein the growth and development of the brain is affected, which in turn impact an individual's language, emotions, behavior, self-control, learning and memory abilities. A sub-group of neurodevelopmental diseases is genetic neurodevelopmental diseases, indicating they are related to and / or are caused by abnormal or dysfunction genes, and may be hereditary. Exemplary neurodegenerative and neurodevelopmental diseases and disorders include but are not limited to, Alzheimer’s disease, Parkinson’s disease, Parkinson’s disease withdementia, Huntington’s disease, Amyotrophic lateral sclerosis, Prion disease, Rett syndrome, cerebral palsy, Down's syndrome, Williams-Beuren syndrome, Prader- Willi syndrome, Angelman syndrome, pervasive developmental disorder not otherwise specified (PDD-NOS), childhood disintegrative disorder, Smith-Magenis syndrome, multiple sclerosis, velo-cardio-facial syndrome, ATR-X syndrome, Barth syndrome, Fragile X syndrome, ICF syndrome, Neurofibromatosis, Smith-Lemli- Opitz syndrome, an addictive disorder, Attention-deficit / hyperactivity disorder (ADHD), an anxiety disorder, Asperger's syndrome, autism spectrum disorder, an eating disorder, epilepsy, infantile spasms, fetal alcohol syndrome, hydrocephalus, manic depressive illness, mental retardation, schizophrenia, spina bifida, Tourette's syndrome, and any combination thereof.

[0040] As a specific example, Rett syndrome (RTT), originally termed cerebroatrophic hyperammonemia, is a rare genetic postnatal neurological disorder of the grey matter of the brain that almost exclusively affects females but has also been found in male patients. The clinical features include small hands and feet, and a deceleration of the rate of head growth (including microcephaly in some). Repetitive stereotyped hand movements, such as wringing and / or repeatedly putting hands into the mouth, are also noted. People with Rett syndrome are prone to gastrointestinal disorders and seizures. RTT affected individuals typically have no verbal skills, and about 50% of them could not walk. Scoliosis, growth failure, and constipation are quite common. The signs and symptoms of RTT are most easily confused with those of Angelman syndrome, cerebral palsy, and autism. RTT occurs in approximately 1:10,000 live female births in all geographies, and across all races and ethnicities. Without being bound by theory, it is believed that RTT is caused by mutations in the gene MECP2 (methyl CpG binding protein 2) located on the X chromosome (which is involved in transcriptional silencing and epigenetic regulation of methylated DNA) and can arise sporadically or from germline mutations. In less than 10% of RTT cases, mutations in the genes CDKL5 or FOXG1 have also been found. RTT is initially diagnosed by clinical observation, but the diagnosis is definitive when there is a genetic defect in the MECP2 gene. The present disclosure expressly contemplates the treatment of RTT with a Sigma-1 receptor agonist, and the methods disclosed herein.

[0041] As another specific example, Fragile X Syndrome (FXS), also known as Martin-Bell syndrome, is a rare non-Mendelian trinucleotide repeat disorder. FXS is the most prevalent inherited cause of mild-to-severe intellectual disability and the most common monogenic cause of autism spectrum disorder. It accounts for about one-half of cases of X-linked intellectual disability and is the most common cause of mental impairment after trisomy 21. Physical features of FXS include a long, narrow face with a prominent jaw and forehead, hyperflexible fingers, and large ears. After puberty, enlarged testicles may be present in males. About a third of FXS children have features of autism and delayed speech that are present from an early age. FXS is underdiagnosed, leading to suboptimal management and patient outcomes. Occurrence wise, FXS with a full mutation allele occurs in approximately 1 in 7000 males and 1 in 11,000 females; however, the exact frequency is unknown. Female carrier status is estimated to be as high as 1 in 130 to 250 individuals, and the incidence of male carriers is about 1 in 250 to 800 individuals. However, it is essential to note that the carrier frequency can vary greatly based on the diagnostic testing used and the population of interest. Treatment wise, there is no cure to the disease, but medications can be used for symptom-based relief to minimize behavioral and mental health challenges associated with FXS. For examples, stimulants may target FXS hyperactivity, impulsivity, and attention issues. Antidepressants (e.g., bupropion, buspirone, or selective serotonin and norepinephrine reuptake inhibitors) may treat anxiety, obsessive-compulsive behaviors, and mood disorders in FXS patients. The present disclosure expressly contemplates the treatment of FXS with a Sigma-1 receptor agonist, and the methods disclosed herein.

[0042] Huntington’s disease is a familial disorder inherited as an autosomal dominant trait and characterized by the onset of progressive chorea and dementia in the fourth or fifth decade of life. Common initial manifestations include paranoia, poor impulse control, depression, hallucinations, and delusions. Late symptoms include intellectual impairment, loss of fine motor control, athetosis, and diffuse chorea involving axial and limb musculature develops, leading to a vegetative state within 10-15 years of disease onset. Its juvenile variant has a more fulminant course including seizures, ataxia, dementia, and chorea. The present disclosure expresslycontemplates the treatment of Huntington’s disease with a Sigma-1 receptor agonist, and the methods disclosed herein.

[0043] Prion disease, also called “transmissible spongiform encephalopathies” (TSEs), refers to a family of rare progressive neurodegenerative disorders that affect both humans and animals. They are distinguished by long incubation periods, characteristic spongiform changes associated with neuronal loss, and a failure to induce inflammatory response. The causative agents of TSEs are believed to be prions. The term “prions” refers to abnormal, pathogenic agents that are transmissible and can induce abnormal folding of specific normal cellular proteins called prion proteins that are found most abundantly in the brain. The abnormal folding of the prion proteins leads to brain damage and the characteristic signs and symptoms of the disease. Prion diseases are usually rapidly progressive and always fatal. Human Prion disease comprises at least Creutzfeldt-Jakob Disease (CJD), Variant Creutzfeldt-Jakob Disease (vCJD), Gerstmann-Straussler-Scheinker Syndrome, Fatal Familial Insomnia and Kuru. Animal Prion disease comprises at least Bovine Spongiform Encephalopathy (BSE), Chronic Wasting Disease (CWD), Scrapie, Transmissible mink encephalopathy, Feline spongiform encephalopathy, and Ungulate spongiform encephalopathy. The present disclosure expressly contemplates the treatment of prion disease with a Sigma-1 receptor agonist, and the methods disclosed herein.

[0044] Amyotrophic lateral sclerosis, or “ALS”, often also called Lou Gehrig's disease (after the baseball player who was diagnosed with it). It is a degenerative nervous system disease that affects nerve cells in the brain and spinal cord, causing loss of muscle control. ALS also affects upper motor neurons in the brain and lower motor neurons in the brain stem and spinal cord. Disease onset is usually after the age of 50 and the process is usually fatal within 3 to 6 years. Clinical manifestations include progressive weakness, atrophy, fasciculation, hyperreflexia, dysarthria, dysphagia, and eventual paralysis of respiratory function. Pathologic features include the replacement of motor neurons with fibrous astrocytes and atrophy of anterior spinal nerve roots and corticospinal tracts. ALS often begins with muscle twitching and weakness in a limb, or slurred speech. Its impact often starts in the hands, feet or limbs, and then spreads to other parts of your body. As the disease advances and nerve cells are destroyed, your muscles get weaker. This eventually affects chewing,swallowing, speaking and breathing. Symptoms include, but not limited to, difficulty walking or doing normal daily activities, tripping and falling, weakness in legs, feet or ankles, hand weakness or clumsiness, slurred speech or trouble swallowing, muscle cramps and twitching in arms, shoulders and tongue, inappropriate crying, laughing or yawning, and cognitive and behavioral changes. There is no cure for this fatal disease. The present disclosure expressly contemplates the treatment of ALS with a Sigma-1 receptor agonist, and the methods disclosed herein.

[0045] Angelman syndrome is a genetic disorder causing developmental disabilities and nerve-related symptoms. It usually could not be detected until developmental delays become noticeable, usually when a baby is about six to 12 months old. Symptoms may include lack of crawling or babbling, minimal speech, inability to walk, move, or balance well (ataxia). Children with Angelman syndrome typically have a happy, excitable demeanor with frequent smiling, laughter, and hand-flapping movements. Hyperactivity and a short attention span are common. Most affected children also have difficulty sleeping and need less sleep than usual. With age, individuals with Angelman syndrome become less excitable, and their sleeping problems may improve. However, affected individuals continue to have intellectual disability, severe speech impairment, and seizures throughout their lives. Adults with Angelman syndrome have distinctive facial features that may be described as "coarse." Other common features include unusually fair skin with light- colored hair and an abnormal side-to-side curvature of the spine (scoliosis). The life expectancy of people with this condition appears to be nearly normal. Current treatment includes anti-seizure medication and therapies to help manage medical and developmental concerns. There is no approved drug therapy to directly target the impacted genes or malfunctioned neurons related to this disorder. The present disclosure expressly contemplates the treatment and relief of Angelman syndrome with a Sigma-1 receptor agonist, and the methods disclosed herein.

[0046] Cerebral palsy (CP) is a group of congenital disorders that affect a person's ability to move and maintain balance and posture. Cerebral palsy is caused by abnormal brain development, often before birth, and may be related to infection, blood clots, prematurity, genetic problems, or lack of oxygen in the brain. Symptoms include exaggerated reflexes, floppy or rigid limbs, and / or involuntary motions. These symptoms often appear by early childhood and are the most common motordisability in children. There is no cure for cerebral palsy, but supportive treatments, medications, and surgery can help many individuals improve their motor skills and communication abilities. Long-term treatment includes physical and drug therapies, and sometimes surgery. A newly developed therapy for cerebral palsy is “Non- Invasive Brain Stimulation”, implemented by sending a small electrical current to the brain to stimulate specific areas. The aim of this therapy is to help improve movement and coordination by stimulating the part of the brain responsible for controlling motor functions. A2-73 is being investigated to treat CP or relieve some of its symptoms. The present disclosure expressly contemplates the treatment and relief of cerebral palsy with a Sigma-1 receptor agonist, and the methods disclosed herein.

[0047] Multiple sclerosis (MS) is a long-lasting (chronic) disease of the central nervous system. It is thought to be an autoimmune disorder, a condition in which the body attacks itself by mistake. MS is not considered as a genetic disorder, but genetic factors may play a role in the disease onset, development and progression. MS is an unpredictable disease that affects people differently. Some people with MS may have only mild symptoms. Others may lose their ability to see, write, speak, or walk when communication between the brain and other parts of the body becomes disrupted. Myelin is the fatty tissue that surrounds and protects nerve fibers. In MS, the myelin is destroyed in many areas. This loss of myelin forms scar tissue called sclerosis, resulting in plaques or lesions. When the nerves are damaged in this way, they can’t conduct electrical impulses to and from the brain. About 50% of all people with MS have thinking (cognitive) problems linked to the disease. The effects of these problems may be mild. There is no cure yet for MS. But certain remedies may help changing the course of the disease, treating flare-ups, and managing symptoms. A2-73 is being investigated to treat MS, and / or relieve its symptoms. The present disclosure expressly contemplates the treatment and relief of MS with a Sigma-1 receptor agonist, and the methods disclosed herein.

[0048] Williams syndrome (WS), also known as Williams-Beuren syndrome, is an autosomal dominant disorder. Most individuals diagnosed with WS have the disorder as the result of a de novo 1.5- to 1.8-Mb 7q11.23 deletion; rarely, an individual with WS has an affected parent. Recommendations for the parents of a proband with WS include obtaining a medical history to determine if signs or symptoms of WS arepresent. In the absence of clinical findings of WS in the parents, testing of the parents for the 7q11.23 deletion identified in the proband is not warranted. Each child of an individual with WS has a 50% chance of inheriting the 7q11.23 deletion and being affected. Once the WS-causing 1.5- to 1.8-Mb 7q11.23 deletion has been identified in an affected family member, prenatal and preimplantation genetic testing are possible. Its diagnosis can be directly established by identification of a heterozygous 1.5- to 1.8-Mb deletion of the Williams-Beuren syndrome critical region (WBSCR) on chromosome 7q11.23. Clinical manifestations of WS include cardiovascular disease (elastin arteriopathy, most often manifesting as supravalvar aortic stenosis), developmental delay, usually mild intellectual disability, a specific cognitive profile, unique personality characteristics, connective tissue abnormalities, growth abnormalities, other endocrine manifestations, and distinctive facies. Additional manifestations can include sleep problems, ocular issues, hearing loss, dental problems, gastrointestinal difficulties, urinary tract abnormalities, and musculoskeletal issues. Currently treatments are limited to tackle each manifested symptoms separately. A2-73 is being investigated to treat Williams-Beuren Syndrome, and / or relieve multiple symptoms thereof. The present disclosure expressly contemplates the treatment and relief of Williams-Beuren syndrome with a Sigma-1 receptor agonist, and the methods disclosed herein.

[0049] Smith-Magenis syndrome (SMS) is a genetic disorder caused by a heterozygous deletion of or a heterozygous pathogenic variant in RAI1 on chromosome 17p11.2. Majority of 17p11.2 deletions are de novo, while deleterious variants in RAI1 can be de novo or inherited. Complex familial chromosome rearrangements may lead to the occurrence of del(17)(p11.2) and thus result in SMS. Although SMS usually occurs as the result of a de novo deletion of 17p11.2, rare instances of vertical transmission from an affected parent to a child, parental germline mosaicism, and complex familial chromosome rearrangements leading to del(17)(p11.2) and SMS have been reported. If the SMS-related genetic alteration has been identified in an affected family member, prenatal testing for a pregnancy at an increased risk and preimplantation genetic testing are possible. In the rare instance of a complex familial chromosome rearrangement, prenatal testing is possible for a pregnancy at an increased risk using prenatal chromosomal microarray analysis (CMA) and sequencing on fetal cells. SMS is characterized bydistinctive physical features (particularly coarse facial features that progress with age), developmental delay, cognitive impairment, behavioral abnormalities, sleep disturbance, and childhood-onset abdominal obesity. Infants affected by SMS often have feeding difficulties, failure to thrive, hypotonia, hyporeflexia, prolonged napping or need to be awakened for feeds, and generalized lethargy. Majority of SMS individuals ranges in the mild-to-moderate level of intellectual disability. SMS’s behavioral phenotype, including significant sleep disturbance, stereotypies, maladaptive and self-injurious behaviors, is often not recognized until 18 months or older and continues to change until adulthood. Sensory issues are frequently noted, which may include avoidant behavior and repetitive seeking of textures, sounds, and experiences. Toileting difficulties are common. Significant anxiety is common as are problems with executive functioning, including inattention, distractibility, hyperactivity, and impulsivity. Maladaptive behaviors include frequent outbursts / temper tantrums, attention-seeking behaviors, opposition, aggression, and self-injurious behaviors including self-hitting, self-biting, skin picking, inserting foreign objects into body orifices (polyembolokoilamania), and yanking fingernails and / or toenails (onychotillomania). Among the stereotypic behaviors described, the spasmodic upper body squeeze or "self-hug" seems to be highly associated with SMS. An underlying developmental asynchrony, specifically emotional maturity delayed beyond intellectual functioning, may also contribute to maladaptive behaviors in people with SMS. Currently treatments are limited to tackle manifested disorders or symptoms. A2-73 is being investigated to treat SMS, and / or relieve multiple symptoms or disordered related thereof. The present disclosure expressly contemplates the treatment and relief of SMS with a Sigma-1 receptor agonist, and the methods disclosed herein.

[0050] Pervasive developmental disorders (PDD), also known as autism spectrum disorder (ASD), are neurological and developmental disorder that affects how people interact with others, communicate, learn, and behave. The term “pervasive developmental disorders” (PDD) used herein includes autism, Asperger's syndrome, childhood disintegrative disorder and an unspecified form of pervasive developmental disorder. Asperger's syndrome is generally thought to be at the mild end of autism spectrum disorder. These disorders and diseases are the developmental disability caused by defects and dysfunctions in the brain. Peoplewith PDD or ASD often have problems with social communication and interaction, and restricted or repetitive behaviors or interests. PDD or ASD can be characterized by delays in the development of social and communication skills. Parents may note related symptoms as early as infancy, although the typical age of onset is by 3 years of age. Symptoms of PDD or ASD vary widely. Some children do not speak at all, while others speak in limited phrases or conversations, and some have relatively average language development. Repetitive play skills and limited social skills are generally evident. Extreme responses to sensory information, such as loud noises and lights, are also common. Currently, there is no known cure for PDD. Medications may be used to address specific behavioral problems and therapy should be specialized according to the needs of each child. Some children with PDD benefit from specialized classrooms and others function well in standard special education classes or regular classes with additional support. A2-73 is being investigated to treat PDD / ASD, and / or improve their social and communication skills thereof. The present disclosure expressly contemplates the treatment and relief of PDD or ASD with a Sigma-1 receptor agonist, and the methods disclosed herein.

[0051] Childhood disintegrative disorder (CDD), also known as Heller's syndrome and disintegrative psychosis, is a rare condition characterized by late onset (>3 years of age) of developmental delays in language, social function, and motor skills. It is a complex disorder that affects many different areas of the child's development. It is grouped with the pervasive developmental disorders (PDDs) and is related to the better known and more common disorder of autism. The cause of childhood disintegrative disorder is unknown. Research findings suggest, however, that it may arise in the neurobiology of the brain. About half the children diagnosed with CDD have an abnormal electroencephalogram (EEG). EEGs measure the electrical activity in the brain generated by nerve transmission (brain waves). CDD is also sometimes associated with seizures, as another indication that the neurobiology of the brain may be involved. Children with CDD have at least 2 years of normal development in all areas—language understanding, speech, skill in the use of large and small muscles, and social development. After this period of normal growth, the child begins to lose the skills he or she has acquired. This loss usually takes place between ages 3 and 4, but it can happen any time up to age ten. The prevalence of CDD is 1 in 100,000 boys and ratio of boys to girls is estimated to be 8 boys to 1 girl.Currently treatments are limited to tackle manifested disorders or symptoms. A2-73 is being investigated to treat CDD, and / or relieve multiple symptoms or disordered related thereof. The present disclosure expressly contemplates the treatment and relief of CDD with a Sigma-1 receptor agonist, and the methods disclosed herein.

[0052] The present disclosure also expressly contemplates the treatment and relief of other neurological diseases with a Sigma-1 receptor agonist, and the methods disclosed herein, including Alzheimer’s disease, Parkinson’s disease, Parkinson’s disease with dementia, Down's syndrome, Prader-Willi syndrome, velo- cardio-facial syndrome, ATR-X syndrome, Barth syndrome, ICF syndrome, Neurofibromatosis, Smith-Lemli-Opitz syndrome, an addictive disorder, ADHD, an anxiety disorder, Asperger's syndrome, autism spectrum disorder, an eating disorder, epilepsy, infantile spasms, fetal alcohol syndrome, hydrocephalus, manic depressive illness, mental retardation, schizophrenia, spina bifida, Tourette's syndrome, and any combination thereof

[0053] Other diseases or disorders encompassed by the present disclosure include, but not limited to, a disorder or condition related to neuron generations, neuron regenerations, and / or neuron communications to the nervous system.

[0054] In various aspects, methods, and / or embodiments disclosed in this section II herein, therefore, the differentially expressed gene(s) include REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. In these and other aspects, methods, and / or embodiments disclosed in this section II herein, the differentially expressed gene(s) include REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, and / or any combination thereof. In other aspects, methods, and / or embodiments disclosed in this section II herein, the differentially expressed gene(s) include RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. In still other aspects, methods, and / or embodiments disclosed in this section II herein, the differentially expressed gene(s) include REM2, BCL6, and any combination thereof. In one aspect, method, and / or embodiment disclosed in thissection II herein, the differentially expressed gene(s) is one or more of REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. In another aspect, method, and / or embodiment disclosed in this section II herein, the differentially expressed gene(s) is one or more of REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, and LRRK2. In another aspect, method, and / or embodiment disclosed in this section II herein, the differentially expressed gene(s) is one or more of RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. In another aspect, method, and / or embodiment disclosed in this section II herein, the differentially expressed gene(s) is one or more of REM2 and / or BCL6. Any of the foregoing differentially expressed gene aspect, method, and / or embodiment disclosed in this section II herein may be supplemented with one or more combinations or sub-combinations of differentially expressed gene(s) listed herein.

[0055] The Sigma-1 receptor agonist used in to treat the neurological diseases and disorders disclosed in this section II is selected from: tetrahydro-N,N-dimethyl- 2,2-diphenyl-3-furanmethanamine hydrochloride (A2-73), tetrahydro-N,N-dimethyl- 2,2-diphenyl-3-furanmethanamine (A2-73 freebase), tetrahydro-N,N-dimethyl-5,5- diphenyl-3-furanmethanamine hydrochloride (A1-41); tetrahydro-N,N-dimethyl-5,5- diphenyl-3-furanmethanamine (A1-41 freebase); 1-(2,2-diphenyltetrahydrofuran-3- yl)-N-methylmethanamine hydrochloride (A19-144); 1-(2,2-diphenyltetrahydrofuran- 3-yl)-N-methylmethanamine (A19-144 freebase); (1-(2,8-dimethyl- l-thia-3,8- diazaspiro(4.5)dec-3-yl)-3-(lH-indol-3-yl)propan-l-one) (A3-71); an enantiomer thereof, a crystal form thereof, a co-crystal form thereof, a pharmaceutically acceptable salt thereof, a crystal or co-crystal of the pharmaceutically acceptable salt thereof, or any combination thereof. In some aspects, methods, and / or embodiments the Sigma-1 receptor agonist used to treat the diseases and disorders in this section II is selected from: tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine in amorphous form (A2-73 freebase amorphous form); tetrahydro-N,N-dimethyl-2,2- diphenyl-3-furanmethanamine in crystal Form I (A2-73 Freebase Crystal Form I);tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form I (A2-73 Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride in crystal Form II (A2-73 Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form III (A2-73 Crystal Form III); (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride in amorphous form ((+) A2-73 amorphous form); (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in amorphous form ((-) A2-73 amorphous form); (+) tetrahydro-N,N-dimethyl-2,2- diphenyl-3-furanmethanamine hydrochloride in a crystal form ((+) A2-73 crystal form); (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in a crystal form ((-) A2-73 crystal form); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrogen fumarate in amorphous form (A2-73 hydrogen fumarate amorphous form); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form I (A2-73 hydrogen fumarate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form II (A2-73 hydrogen fumarate Crystal Form II); tetrahydro-N,N-dimethyl- 2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form III (A2-73 hydrogen fumarate Crystal Form III); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrogen fumarate in crystal Form IV (A2-73 hydrogen fumarate Crystal Form IV); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form V (A2-73 hydrogen fumarate Crystal Form V); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine mesylate in crystal Form I (A2-73 mesylate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine sulfate in crystal Form I (A2-73 sulfate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine sulfate in crystal Form II (A2-73 sulfate Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine oxalate in crystal Form I (A2-73 oxalate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine oxalate in crystal Form II (A2-73 oxalate Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine dihydrogen phosphate in crystal Form I (A2-73 dihydrogen phosphate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine edisylate in crystal Form I (A2-73 edisylate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine benzoate in crystal Form I (A2-73 benzoate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrobromide in crystal Form A (A2-73 hydrobromide Crystal Form A); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrobromide in crystal Form B (A2-73 hydrobromide Crystal Form B); tetrahydro-N,N-dimethyl-2,2- diphenyl-3-furanmethanamine maleate in crystal Form S5 (A2-73 maleate Crystal Form S5); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine maleate in crystal Form S6 (A2-73 maleate Crystal Form S6); co-crystal Form CSII of tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with tartaric acid (A2-73 co-crystal with tartaric acid Crystal Form CSII); co-crystal Form CSIII of tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with citric acid (A2-73 co-crystal with citric acid Crystal Form CSIII); co-crystal Form CSIV of tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with malic acid (A2-73 co-crystal with malic acid Crystal Form CSIV); a co-crystal of tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with zinc chloride (A2-73 co-crystal with zinc chloride); a co-crystal of (-) tetrahydro-N,N- dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with zinc chloride ((-) A2- 73 co-crystal with zinc chloride); a co-crystal of (+) tetrahydro-N,N-dimethyl-2,2- diphenyl-3-furanmethanamine hydrochloride with zinc chloride ((+) A2-73 co-crystal with zinc chloride); and any combination thereof. III. Differentially Expressed Genes and Uses Thereof

[0056] One aspect of the present disclosure encompasses a method of monitoring effectiveness of a Sigma-1 receptor agonist in treating a neurodevelopmental or neurodegenerative disease or disorder, including but not limited to, Alzheimer’s disease, Parkinson’s disease, Parkinson’s disease with dementia, Huntington’s disease, Amyotrophic lateral sclerosis, Prion disease, Rett syndrome, cerebral palsy, Down's syndrome, Williams-Beuren syndrome, Prader- Willi syndrome, Angelman syndrome, pervasive developmental disorder not otherwise specified (PDD-NOS), childhood disintegrative disorder, Smith-Magenis syndrome, multiple sclerosis, velo-cardio-facial syndrome, ATR-X syndrome, Barth syndrome, Fragile X syndrome, ICF syndrome, Neurofibromatosis, Smith-Lemli- Opitz syndrome, an addictive disorder, Attention-deficit / hyperactivity disorder (ADHD), an anxiety disorder, Asperger's syndrome, autism spectrum disorder, an eating disorder, epilepsy, infantile spasms, fetal alcohol syndrome, hydrocephalus,manic depressive illness, mental retardation, schizophrenia, spina bifida, Tourette's syndrome, and any combination thereof. The method comprises the steps of: (a) obtaining or having obtained a test biological sample from the subject at the end of the treatment period; (b) determining a test gene expression profile from the test biological sample, wherein the test gene expression profile comprises a test list of genes detected in the test biological sample and their expression levels; (c) comparing the test gene expression profile with a predetermined control gene expression profile to identify differentially expressed genes, wherein the predetermined control gene expression profile comprises a control list of genes detected in a control biological sample obtained from the subject before the treatment period and their expression levels; wherein the differentially expressed genes comprises genes detected both in the test list and in the control list but having different expression levels in the test biological sample from that in the control biological sample; and (d) confirming the efficacy of the Sigma-1 receptor agonist therapy if the identified differentially expressed gene(s) is listed in a gene list comprising REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof; or identifies the therapy as ineffective for the subject if no differentially expressed genes are identified or differentially expressed genes do not comprise any gene(s) listed in the gene list. For example, the identified differentially expressed gene(s) may be one or more gene selected from the group consisting of REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. The above steps or actions may be performed in any other reasonable order or sequence.

[0057] Another aspect of the present disclosure encompassing a method of treating a subject with a Sigma-1 receptor agonist therapy. And such subject suffers from, or is suspected of suffering from, or has a high risk of developing a neurodevelopmental or neurodegenerative disease or disorder, such as Alzheimer’s disease, Parkinson’s disease, Parkinson’s disease with dementia, Huntington’sdisease, Amyotrophic lateral sclerosis, Prion disease, Rett syndrome, cerebral palsy, Down's syndrome, Williams-Beuren syndrome, Prader-Willi syndrome, Angelman syndrome, pervasive developmental disorder not otherwise specified (PDD-NOS), childhood disintegrative disorder, Smith-Magenis syndrome, multiple sclerosis, velo- cardio-facial syndrome, ATR-X syndrome, Barth syndrome, Fragile X syndrome, ICF syndrome, Neurofibromatosis, Smith-Lemli-Opitz syndrome, an addictive disorder, Attention-deficit / hyperactivity disorder (ADHD), an anxiety disorder, Asperger's syndrome, autism spectrum disorder, an eating disorder, epilepsy, infantile spasms, fetal alcohol syndrome, hydrocephalus, manic depressive illness, mental retardation, schizophrenia, spina bifida, Tourette's syndrome, and any combination thereof. The method comprises the steps of (a) administering the Sigma-1 receptor agonist to the subject for a treatment period; (b) obtaining a test biological sample from the subject at the end of the treatment period; (c) determining a test gene expression profile from the test biological sample, wherein the test gene expression profile comprises a test list of genes detected in the test biological sample and their expression levels; and (d) comparing the test gene expression profile with a predetermined control gene expression profile to identify differentially expressed genes, wherein the predetermined control gene expression profile comprises a control list of genes detected in a control biological sample obtained from the subject at the beginning of the treatment period and their expression levels; wherein the differentially expressed genes comprises genes detected both in the test list and in the control list but having different expression levels in the test biological sample from that in the control biological sample, and (e) continuing the Sigma-1 receptor agonist for the subject if the identified differentially expressed gene(s) is listed in a gene list comprising REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. If the identified differentially expressed gene(s) do not comprise one or more of REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, and ACAT1, then the method comprises discontinuing the Sigma-1 receptor agonist for the subject, and optionally switching the subject to anotherSigma-1 receptor agonist, to another therapy, or to a combination therapy comprising the Sigma-1 receptor agonist and another neurodegenerative and / or neurodevelopmental drug therapy. The above steps or actions may be performed in any other reasonable order or sequence.

[0058] Another aspect of the present disclosure encompassing a method of selecting a therapeutic agent, such as a Sigma-1 receptor agonist, for a subject suffering from, being suspected of suffering from, or having a high risk of developing a neurological disorder, including a neurodevelopmental or neurodegenerative disease or disorder, such as Alzheimer’s disease, Parkinson’s disease, Parkinson’s disease with dementia, Huntington’s disease, Amyotrophic lateral sclerosis, Prion disease, Rett syndrome, cerebral palsy, Down's syndrome, Williams-Beuren syndrome, Prader-Willi syndrome, Angelman syndrome, pervasive developmental disorder not otherwise specified (PDD-NOS), childhood disintegrative disorder, Smith-Magenis syndrome, multiple sclerosis, velo-cardio-facial syndrome, ATR-X syndrome, Barth syndrome, Fragile X syndrome, ICF syndrome, Neurofibromatosis, Smith-Lemli-Opitz syndrome, an addictive disorder, Attention-deficit / hyperactivity disorder (ADHD), an anxiety disorder, Asperger's syndrome, autism spectrum disorder, an eating disorder, epilepsy, infantile spasms, fetal alcohol syndrome, hydrocephalus, manic depressive illness, mental retardation, schizophrenia, spina bifida, Tourette's syndrome, and any combination thereof. The method comprises the steps of (a) administering the Sigma-1 receptor agonist to the subject for a treatment period; (b) obtaining a test biological sample from the subject at the end of the treatment period; (c) determining a test gene expression profile from the test biological sample, wherein the test gene expression profile comprises a test list of genes detected in the test biological sample and their expression levels; and (d) comparing the test gene expression profile with a predetermined control gene expression profile to identify differentially expressed genes, wherein the predetermined control gene expression profile comprises a control list of genes detected in a control biological sample obtained from the subject at the beginning of the treatment period and their expression levels; wherein the differentially expressed genes comprises genes detected both in the test list and in the control list but having different expression levels in the test biological sample from that in the control biological sample, and selecting the Sigma-1 receptor agonist for the subject if theidentified differentially expressed gene(s) is listed in a gene list comprising REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. If the identified differentially expressed genes do not comprise one or more of REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, and ACAT1, then the method comprises discontinuing the Sigma-1 receptor agonist for the subject, and optionally switching the subject to another Sigma-1 receptor agonist, to another therapy, or to a combination therapy comprising the Sigma-1 receptor agonist and another neurodegenerative and / or neurodevelopmental drug therapy. The above steps or actions may be performed in any other reasonable order or sequence.

[0059] Yet another aspect of the present disclosure encompasses a method of assessing a disease risk in a subject by using a Sigma-1 receptor agonist. The disease comprises a neurological disease or disorder, including a neurodevelopmental or neurodegenerative disease or disorder, such as Alzheimer’s disease, Parkinson’s disease, Parkinson’s disease with dementia, Huntington’s disease, Amyotrophic lateral sclerosis, Prion disease, Rett syndrome, cerebral palsy, Down's syndrome, Williams-Beuren syndrome, Prader-Willi syndrome, Angelman syndrome, pervasive developmental disorder not otherwise specified (PDD-NOS), childhood disintegrative disorder, Smith-Magenis syndrome, multiple sclerosis, velo- cardio-facial syndrome, ATR-X syndrome, Barth syndrome, Fragile X syndrome, ICF syndrome, Neurofibromatosis, Smith-Lemli-Opitz syndrome, an addictive disorder, Attention-deficit / hyperactivity disorder (ADHD), an anxiety disorder, Asperger's syndrome, autism spectrum disorder, an eating disorder, epilepsy, infantile spasms, fetal alcohol syndrome, hydrocephalus, manic depressive illness, mental retardation, schizophrenia, spina bifida, Tourette's syndrome, and any combination thereof. The method comprises the steps of (a) administering the Sigma-1 receptor agonist to the subject for an assessment period; (b) identifying a differentially expressed gene by comparing the gene expression level in the test biological sample obtained from thesubject at the end of the assessment period with the gene expression level in the control biological sample obtained from the subject before the assessment period; (c) assessing the subject having a high risk of the disease, if any of the identified differentially expressed gene(s) is listed in a gene list comprising REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. The above steps or actions may be performed in any other reasonable order or sequence.

[0060] Yet another aspect of the present disclosure encompasses a method of using a differentially expressed gene as a surrogate endpoint for a trial in evaluating a Sigma-1 receptor agonist therapy. The trial is for treating neurological disorder, including a neurodevelopmental or neurodegenerative disease or disorder, such as Alzheimer’s disease, Parkinson’s disease, Parkinson’s disease with dementia, Huntington’s disease, Amyotrophic lateral sclerosis, Prion disease, Rett syndrome, cerebral palsy, Down's syndrome, Williams-Beuren syndrome, Prader-Willi syndrome, Angelman syndrome, pervasive developmental disorder not otherwise specified (PDD-NOS), childhood disintegrative disorder, Smith-Magenis syndrome, multiple sclerosis, velo-cardio-facial syndrome, ATR-X syndrome, Barth syndrome, Fragile X syndrome, ICF syndrome, Neurofibromatosis, Smith-Lemli-Opitz syndrome, an addictive disorder, Attention-deficit / hyperactivity disorder (ADHD), an anxiety disorder, Asperger's syndrome, autism spectrum disorder, an eating disorder, epilepsy, infantile spasms, fetal alcohol syndrome, hydrocephalus, manic depressive illness, mental retardation, schizophrenia, spina bifida, Tourette's syndrome, and any combination thereof. The method comprises: (a) obtaining or having obtained a differentially expressed gene from the subject, wherein the differentially expressed gene comprises a gene having different expression levels before the trial and at the end of the trial; and (b) labeling the subject as meeting the surrogate endpoint if the obtained differentially expressed gene(s) is listed in a gene list comprising REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. Theabove steps or actions may be performed in any other reasonable order or sequence.

[0061] In various aspects, methods, and / or embodiments disclosed in this section III herein, therefore, the differentially expressed gene(s) include REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. In these and other aspects, methods, and / or embodiments disclosed in this section III herein, the differentially expressed gene(s) include REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, and / or any combination thereof. In other aspects, methods, and / or embodiments disclosed in this section III herein, the differentially expressed gene(s) include RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. In still other aspects, methods, and / or embodiments disclosed in this section III herein, the differentially expressed gene(s) include REM2, BCL6, and / or any combination thereof. In one aspect, method, and / or embodiment disclosed in this section III herein, the differentially expressed gene(s) is one or more of REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. In another aspect, method, and / or embodiment disclosed in this section III herein, the differentially expressed gene(s) is one or more of REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, and / or any combination thereof. In another aspect, method, and / or embodiment disclosed in this section III herein, the differentially expressed gene(s) is one or more of RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. In another aspect, method, and / or embodiment disclosed in this section III herein, the differentially expressed gene(s) is one or more of REM2 and / or BCL6. Any of the foregoing differentially expressed gene aspect, method,and / or embodiment disclosed in this section III herein may be supplemented with one or more combinations or sub-combinations of differentially expressed gene(s) listed herein.

[0062] The Sigma-1 receptor agonist used in to treat the neurological diseases and disorders disclosed in this section III is selected from: tetrahydro-N,N-dimethyl- 2,2-diphenyl-3-furanmethanamine hydrochloride (A2-73), tetrahydro-N,N-dimethyl- 2,2-diphenyl-3-furanmethanamine (A2-73 freebase), tetrahydro-N,N-dimethyl-5,5- diphenyl-3-furanmethanamine hydrochloride (A1-41); tetrahydro-N,N-dimethyl-5,5- diphenyl-3-furanmethanamine (A1-41 freebase); 1-(2,2-diphenyltetrahydrofuran-3- yl)-N-methylmethanamine hydrochloride (A19-144); 1-(2,2-diphenyltetrahydrofuran- 3-yl)-N-methylmethanamine (A19-144 freebase); (1-(2,8-dimethyl- l-thia-3,8- diazaspiro(4.5)dec-3-yl)-3-(lH-indol-3-yl)propan-l-one) (A3-71); an enantiomer thereof, a crystal form thereof, a co-crystal form thereof, a pharmaceutically acceptable salt thereof, a crystal or co-crystal of the pharmaceutically acceptable salt thereof, or any combination thereof. In some aspects, methods, and / or embodiments the Sigma-1 receptor agonist used to treat the diseases and disorders in this section III is selected from: tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine in amorphous form (A2-73 freebase amorphous form); tetrahydro-N,N-dimethyl-2,2- diphenyl-3-furanmethanamine in crystal Form I (A2-73 Freebase Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form I (A2-73 Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride in crystal Form II (A2-73 Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form III (A2-73 Crystal Form III); (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride in amorphous form ((+) A2-73 amorphous form); (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in amorphous form ((-) A2-73 amorphous form); (+) tetrahydro-N,N-dimethyl-2,2- diphenyl-3-furanmethanamine hydrochloride in a crystal form ((+) A2-73 crystal form); (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in a crystal form ((-) A2-73 crystal form); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrogen fumarate in amorphous form (A2-73 hydrogen fumarate amorphous form); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form I (A2-73 hydrogen fumarate Crystal Form I);tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form II (A2-73 hydrogen fumarate Crystal Form II); tetrahydro-N,N-dimethyl- 2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form III (A2-73 hydrogen fumarate Crystal Form III); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrogen fumarate in crystal Form IV (A2-73 hydrogen fumarate Crystal Form IV); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form V (A2-73 hydrogen fumarate Crystal Form V); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine mesylate in crystal Form I (A2-73 mesylate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine sulfate in crystal Form I (A2-73 sulfate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine sulfate in crystal Form II (A2-73 sulfate Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine oxalate in crystal Form I (A2-73 oxalate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine oxalate in crystal Form II (A2-73 oxalate Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine dihydrogen phosphate in crystal Form I (A2-73 dihydrogen phosphate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine edisylate in crystal Form I (A2-73 edisylate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine benzoate in crystal Form I (A2-73 benzoate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrobromide in crystal Form A (A2-73 hydrobromide Crystal Form A); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrobromide in crystal Form B (A2-73 hydrobromide Crystal Form B); tetrahydro-N,N-dimethyl-2,2- diphenyl-3-furanmethanamine maleate in crystal Form S5 (A2-73 maleate Crystal Form S5); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine maleate in crystal Form S6 (A2-73 maleate Crystal Form S6); co-crystal Form CSII of tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with tartaric acid (A2-73 co-crystal with tartaric acid Crystal Form CSII); co-crystal Form CSIII of tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with citric acid (A2-73 co-crystal with citric acid Crystal Form CSIII); co-crystal Form CSIV of tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with malic acid (A2-73 co-crystal with malic acid Crystal Form CSIV); a co-crystal of tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with zinc chloride (A2-73 co-crystal with zinc chloride); a co-crystal of (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with zinc chloride ((-) A2- 73 co-crystal with zinc chloride); a co-crystal of (+) tetrahydro-N,N-dimethyl-2,2- diphenyl-3-furanmethanamine hydrochloride with zinc chloride ((+) A2-73 co-crystal with zinc chloride); and any combination thereof.

[0063] In various aspects, methods, and / or embodiments disclosed in this section III herein, the subject may be a human subject. In another aspect, the subject may have or is suspected of having, or have a risk of having or developing a disorder or disease. In one aspect, such disease or disorder comprises Alzheimer’s disease, Parkinson’s disease, Parkinson’s disease with dementia, Huntington’s disease, Amyotrophic lateral sclerosis, Prion disease, Rett syndrome, cerebral palsy, Down's syndrome, Williams-Beuren syndrome, Prader-Willi syndrome, Angelman syndrome, pervasive developmental disorder not otherwise specified (PDD-NOS), childhood disintegrative disorder, Smith-Magenis syndrome, multiple sclerosis, velo-cardio- facial syndrome, ATR-X syndrome, Barth syndrome, Fragile X syndrome, ICF syndrome, Neurofibromatosis, Smith-Lemli-Opitz syndrome, an addictive disorder, Attention-deficit / hyperactivity disorder (ADHD), an anxiety disorder, Asperger's syndrome, autism spectrum disorder, an eating disorder, epilepsy, infantile spasms, fetal alcohol syndrome, hydrocephalus, manic depressive illness, mental retardation, schizophrenia, spina bifida, Tourette's syndrome, and any combination thereof.

[0064] In various aspects, methods, and / or embodiments disclosed in this section III herein, if a Sigma-1 receptor agonist therapy is identified as ineffective or rejected for a subject, a follow-up action may be taken. In another aspect, the follow-up action may comprise one of more of steps comprising switching the subject to another Sigma-1 receptor agonist, supplementing the subject with another therapy, adjusting doses or dose regimen, or switching to a combined neurodegenerative or neurodevelopmental therapy. IV. Sigma-1 Receptor Agonist

[0065] The neurological (e.g., neurodegenerative or neurodevelopmental) disease or disorder therapy comprises a Sigma-1 receptor agonist therapy, or a NMDA therapy, or a cognition enhancing physical therapy. For example, aneurodegenerative or neurodevelopmental therapy may comprise a drug therapy comprising a Sigma-1 receptor agonist.

[0066] In various aspects, methods, and / or embodiments disclosed herein, the Sigma-1 receptor agonist comprises tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine in amorphous form (A2-73 freebase amorphous form); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine in crystal Form I (A2-73 freebase Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form I (A2-73 Crystal Form I); tetrahydro-N,N-dimethyl-2,2- diphenyl-3-furanmethanamine hydrochloride in crystal Form II (A2-73 Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form III (A2-73 Crystal Form III); (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride in amorphous form ((+) A2-73 amorphous form); (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in amorphous form ((-) A2-73 amorphous form); (+) tetrahydro-N,N-dimethyl-2,2- diphenyl-3-furanmethanamine hydrochloride in a crystal form ((+) A2-73 crystal form); (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in a crystal form ((-) A2-73 crystal form); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrogen fumarate in amorphous form (A2-73 hydrogen fumarate amorphous form); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form I (A2-73 hydrogen fumarate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form II (A2-73 hydrogen fumarate Crystal Form II); tetrahydro-N,N-dimethyl- 2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form III (A2-73 hydrogen fumarate Crystal Form III); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrogen fumarate in crystal Form IV (A2-73 hydrogen fumarate Crystal Form IV); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form V (A2-73 hydrogen fumarate Crystal Form V); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine mesylate in crystal Form I (A2-73 mesylate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine sulfate in crystal Form I (A2-73 sulfate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine sulfate in crystal Form II (A2-73 sulfate Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine oxalate in crystal Form I (A2-73 oxalate Crystal Form I);tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine oxalate in crystal Form II (A2-73 oxalate Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine dihydrogen phosphate in crystal Form I (A2-73 dihydrogen phosphate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine edisylate in crystal Form I (A2-73 edisylate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine benzoate in crystal Form I (A2-73 benzoate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrobromide in crystal Form A (A2-73 hydrobromide Crystal Form A); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrobromide in crystal Form B (A2-73 hydrobromide Crystal Form B); tetrahydro-N,N-dimethyl-2,2- diphenyl-3-furanmethanamine maleate in crystal Form S5 (A2-73 maleate Crystal Form S5); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine maleate in crystal Form S6 (A2-73 maleate Crystal Form S6); co-crystal Form CSII of tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with tartaric acid (A2-73 co-crystal with tartaric acid Crystal Form CSII); co-crystal Form CSIII of tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with citric acid (A2-73 co-crystal with citric acid Crystal Form CSIII); co-crystal Form CSIV of tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with malic acid (A2-73 co-crystal with malic acid Crystal Form CSIV); a co-crystal of tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with zinc chloride (A2-73 co-crystal with zinc chloride); a co-crystal of (-) tetrahydro-N,N- dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with zinc chloride ((-) A2- 73 co-crystal with zinc chloride); a co-crystal of (+) tetrahydro-N,N-dimethyl-2,2- diphenyl-3-furanmethanamine hydrochloride with zinc chloride ((+) A2-73 co-crystal with zinc chloride); and any combination thereof.

[0067] In one aspect, method, and / or embodiment, the Sigma-1 receptor agonist comprises A2-73 freebase in amorphous form, A2-73 freebase in crystal Form I, A2- 73 in amorphous form, A2-73 crystal Form I, A2-73 crystal Form II, A2-73 crystal Form III, (+)A2-73 enantiomer, (-) A2-73 enantiomer. The A2-73 freebase in crystal Form I is disclosed and characterized in WO 2019 / 200345 A1 (hereby incorporated by reference herein in its entirety). Specifically, the A2-73 Freebase in crystal Form I is characterized substantially by XRPD pattern shown in FIG.16 and particle shapes depicted in FIG.15. In one aspect, A2-73 crystal is the Form I, Form II, and / or FormIII crystals as disclosed and characterized in WO 2017 / 013498 A2 (hereby incorporated by reference herein in its entirety). Specifically, the A2-73 crystal Form I is characterized substantially by XRPD pattern shown in FIG.1 and particle shapes depicted in FIGS.2 and 3. The A2-73 crystal Form II is characterized substantially by XRPD pattern shown in FIG.4, particle shapes depicted in FIG.7, and the FTIR spectrum shown in FIG.5. The A2-73 crystal Form III is characterized substantially by XRPD pattern shown in FIG.8, particle shapes depicted in FIG.11, and the FTIR spectrum shown in FIG.9. The analog of A2-73 may include A1-41. The metabolite of A2-73 may include A19-144. In one aspect, the pharmaceutically acceptable salt comprises a hydrochloride salt, a hydrobromide salt, a fumarate salt, a sulfate salt, a dihydrogen phosphate salt, a benzoate salt, a mesylate salt, an edysilate salt, or an oxalate salt. In another aspect, the co-crystal comprises a A2-73 pharmaceutically acceptable salt with an organic acid comprising tartaric acid, citric acid, maleic acid, or a combination thereof. In another aspect, the A2-73 is A2-73 amorphous form, A2- 73 Freebase crystal Form I, A2-73 crystal Form I, A2-73 crystal Form II, A2-73 crystal Form III, (+)A2-73 enantiomer, (-)A2-73 enantiomer. In one aspect, the active is A2-73 freebase fumarate salt and / or its crystals, such as A2-73 Freebase fumarate salt in amorphous form, A2-73 Freebase hydrogen fumarate salt crystal Form I, A2-73 Freebase hydrogen fumarate salt crystal Form II, A2-73 Freebase hydrogen fumarate salt crystal Form III, A2-73 Freebase hydrogen fumarate salt crystal Form IV, A2-73 Freebase hydrogen fumarate salt crystal Form V, all of which are disclosed and characterized in WO 2019 / 200345 A1 (hereby incorporated by reference herein in its entirety), such as XRPD patterns shown in FIG.29, FIG.30, FIG.32 FIG.33, and FIG.34, respectively. In another aspect, the A2-73 is other salt crystals, such as A2-73 Freebase Mesylate Form I, A2-73 Freebase Sulfate Form I, A2-73 Freebase Sulfate Form II, A2-73 Freebase Oxalate Form I, A2-73 Freebase Oxalate Form II, A2-73 Freebase Oxalate Form III, A2-73 Freebase Dihydrogen phosphate Form I, A2-73 Freebase Edisylate Form I, A2-73 Freebase Benzoate Form I, all of which are disclosed and characterized in WO 2019 / 200345 A1 (hereby incorporated by reference herein in its entirety), such as XRPD patterns shown in FIGs.18-23 and 25-27, respectively. In yet another aspect, the active is A2-73 Freebase hydrobromide crystal Form A, A2-73 Freebase hydrobromide crystal Form B, A2-73 maleate crystal Form S5, or A2-73 maleate crystal Form S6. They are disclosed and characterized in WO 2021 / 158586 A1 (hereby incorporated byreference herein in its entirety). In yet another aspect, the active is co-crystal Form CSII of A2-73 co-crystal with tartaric acid, co-crystal Form CSIII of A2-73 co-crystal with citric acid, or co-crystal Form CSIV of A2-73 co-crystal with malic acid. They are disclosed and characterized in WO 2023 / 208133 A1(hereby incorporated by reference herein in its entirety). In yet another aspect, the active is co-crystal of A2- 73 with zinc chloride disclosed in U.S. Patent No.12,018,005 B1 (hereby incorporated by reference herein in its entirety).

[0068] In yet another aspect, method, and / or embodiment herein, the Sigma-1 agonist is in a crystal form selected from A2-73 freebase Form I, A2-73 Crystal Form I, A2-73 Crystal Form II, A2-73 Crystal Form III, (-) A2-73 enantiomer, (+) A2-73 enantiomer, A2-73 Freebase Fumarate Salt Form I, A2-73 Freebase Fumarate Salt Form II, A2-73 Freebase Fumarate Salt Form III, A2-73 Freebase Sulfate Form I, A2- 73 Freebase Sulfate Form II, A2-73 Freebase Dihydrogen Phosphate Form I, A2-73 Freebase Dihydrogen Phosphate Form II, A2-73 Freebase Mesylate Form I, A2-73 Freebase Mesylate Form II, A2-73 Freebase Oxalate Form I, A2-73 Freebase Oxalate Form II, A2-73 Freebase Oxalate Form III, A2-73 Freebase Benzoate Form I, A2-73 Freebase Edisylate Form I, A2-73 Freebase HBr Salt Form A and A2-73 Freebase HBr Salt Form B, A2-73 Freebase Maleate Salt Form S5, and A2-73 Freebase Maleate Salt Form S6. Details on the A2-73 freebase salts may be found in US 2021-0115004 A1 or US 2023-0058102 A1 (each of which is hereby incorporated by reference herein in its entirety). In another aspect, the co-crystal forms comprise an A2-73 co-crystal with a tartaric acid, with a citric acid, and / or with a malic acid. In another aspect, the co-crystal is Crystal Form CSII of A2-73 and tartaric acid, Crystal Form CSIII of co-crystal of A2-73 and citric acid, Crystal Form CSIV of co-crystal of A2-73 with malic acid. The co-crystals may be prepared by methods as detailed in WO 2023 / 208133 (hereby incorporated by reference herein in its entirety). The present disclosure encompasses various polymorphic forms and co- crystal forms of A2-73, A2-73 freebase, A2-73 freebase salts. The polymorphic forms may be prepared by solvent extraction or by supercritical fluid extraction (SCE). The crystal forms prepared from solvent extraction can be found in WO 2019 / 200345 A1 and the crystal forms prepared by SCE extraction can be found in WO 2017 / 013498 A2 (each of which are hereby incorporated by reference herein in its entirety). The present disclosure expressly encompasses the A2-73 Crystal Form I, A2-73 CrystalForm II and A2-73 Crystal Form III as prepared and characterized in WO 2017 / 013498 A1 (hereby incorporated by reference herein in its entirety). A2-73 Crystal Form I is a crystal with XRPD peaks as shown in FIG.1. A2-73 Crystal Form I is further characterized by scanning electron microscope (SEM) micrographs as shown in FIGS.2-3. A2-73 Crystal Form II is a crystal with XRPD peaks as shown in FIG.4. A2-73 Crystal Form II is also characterized by FTIR as shown in FIG.5. The SEM micrographs of A2-73 Crystal Form II is shown in FIG.7. A2-73 Crystal Form III is a crystal with XRPD peaks as shown in FIG.8. A2-73 Crystal Form III is characterized by FTIR as shown in FIG.9. A2-73 Crystal Form III is characterized by scanning electron microscope (SEM) micrograph as shown in FIG.11. The present disclosure also encompassed the polymorphic forms of A2-73 free base. The polymorphic form I of A2-73 freebase and its preparation can be found in WO 2019 / 200345 A1 (hereby incorporated by reference herein in its entirety). As an example, a crystal form of A2-73 freebase is the crystalline form characterized by XRPD pattern shown in FIG.16. And such crystalline form possesses particle shapes depicted in FIG.15. The present disclosure encompasses an enantiomer of A2-73 or a mixture of such enantiomer. The enantiomer may be an (+) or (-) enantiomer. The enantiomer refers to an optical pure or a substantial optical pure entity. The substantial optical pure entity refers to the opposite rotation entity may be presented in an amount of no more than 20%, such as at or about 0.1%, at or about 0.5%, at or about 1%, at or about 2%, at or about 5%, at or about 8%, at or about 10%, at or about 12%, at or about 15%, at or about 18%, or at or about 20%. The present disclosure expressly encompasses the (+) and (-) enantiomer disclosed and characterized in US 2018-0169059 A1 (hereby incorporated by reference herein in its entirety).

[0069] In various aspects, methods, and / or embodiments herein, the Sigma-1 receptor agonist therapy comprises administering to the subject an oral solution comprising A2-73 freebase, a crystal form of A2-73 freebase, a salt of A2-73 freebase, a crystal form of A2-73 freebase salt, A2-73 amorphous form, a crystal form of A2-73, an enantiomer or stereoisomer of A2-73, a co-crystal of A2-73, an enantiomer or stereoisomer of A2-73 freebase, an enantiomer or stereoisomer of A2- 73 freebase salt. In yet another aspect of the present disclosure, a Sigma-1 receptor agonist is administered to the subject for a period up to 14 weeks, such as about 4weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, about 13 weeks, or about 14 weeks. In another aspect, a Sigma-1 receptor agonist is administered to the subject daily, such as once daily, twice daily, and / or 3 times daily. In another aspect, a Sigma-1 receptor agonist is administered to the subject according to an intermittent regimen. In one aspect, the intermittent dosing regimen comprises at least two cycles, each cycle comprising (a) a dosing period during which the Sigma-1 receptor agonist and / or its composition is administered to said patient; and thereafter (b) a resting period. In one aspect, the dosing period and the resting period are of the same duration. In another aspect, the dosing period and the resting period are of different durations. In one aspect, the dosing period and the resting period is in the range of a lower limit of about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, and 14 days to an upper limit of about 28 days, 27 days, 26 days, 25 days, 24 days, 23 days, 22 days, 21 days, 20 days, 19, days, 18 days, 17 days, 16 days, 15 days, and 14 days.

[0070] In yet another aspect, method, and / or embodiment herein, a Sigma-1 receptor agonist therapy comprises A2-73 and its pharmaceutical composition thereof. In one aspect, a composition comprising A2-73 or A2-73 freebase in a crystal form and is administered in the amount of about 40 mg to about 60 mg once daily for about 6-11 weeks. In one aspect, the composition of A2-73 is an oral liquid. In another aspect, A2-73 is administered in about 50 mg daily for up to 11 weeks. Alternatively, A2-73 is administered daily in an escalating dose starting from about 10 mg to ending at about 50 mg once daily for 6-11 weeks.

[0071] In another aspect, method, and / or embodiment herein the Sigma-1 receptor agonist may comprise ANAVEX® 19-144 (A19-144), having the chemical name of 1-(2,2-diphenyltetrahydrofuran-3-yl)-N-methylmethanamine hydrochloride. Without being bound by any theory, A19-144 is reported as a metabolite of A2-73. In the present disclosure A2-73 is a compound, which is subjected to enzymatic oxidation, reduction or hydrolysis under physiological conditions in the living body and is converted to A19-144 of the present disclosure. A19-144 may be in the forms of A19-144 freebase, A19-144 amorphous form, a A19-144 crystal. Such crystal may be prepared by methods and procedures disclosed in WO 2017 / 013498 A1 (hereby incorporated by reference herein in its entirety). Without being bound by theory, A19-144 is reported as a metabolite of A2-73. In the present disclosure A2-73 is a compound, which is subjected to enzymatic oxidation, reduction or hydrolysis under physiological conditions in the living body and is converted to A19-144 of the present disclosure. A19-144 may be in the forms of A19-144 freebase, A19-144 amorphous form, a A19-144 crystal. Such crystal may be prepared by methods and procedures disclosed in WO 2017 / 013498 A1 (hereby incorporated by reference herein in its entirety). When the active pharmaceutical ingredient is A3-71 , a composition may comprise from about 1 mg to about 50 g, from about 0.1 to about 5 g, from about 0.5 g to about 3 g, from about 1 mg to about 55 mg, from about 5 mg to about 30 mg, from about 40 mg to about 60 mg, from about 80 mg to about 120 mg, from about 180 mg to about 220 mg, from about 0.1 g to about 5 g, or from about 0.5 g to about 3 g of A3-71. The active pharmaceutical ingredient may be administered daily, twice daily, or three times daily. The duration of administration may be about 3-6 weeks, 6- 11 weeks, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months or chronically. For example, A2-73 or A3-71 may be administered in an amount of about 40 mg to about 60 mg once daily for about 6-11 weeks or is administered in about 50 mg daily for up to 11 weeks. A3-71 or A2-73 may also be administered daily in an escalating dose starting from about 10 mg to ending at about 50 mg once daily.

[0072] In another aspect, method, and / or embodiment herein, the Sigma-1 receptor agonist comprises ANAVEX®1-41 (A1-41), having a chemical name of tetrahydro-N,N-dimethyl-5,5- diphenyl-3-furanmethanamine hydrochloride. In another aspect, the Sigma-1 receptor agonist comprises AV1066, having a chemical name of 1-(3- 4(((1 R,3S,5S)-adamantan-1-yl)(pheny)methyl)propyl)-4-methylpiperazine. In yet another aspect, the Sigma-1 receptor agonist comprises ANAVEX3-71 (A3-71, AF-710B), having chemical name of 1-(2,8-dimethyl-1-thia-3,8- diazaspiro[4.5]decan- 3-yl)-3-(1 H-indol-3-yl)propan-1 -one. In another aspect, the Sigma-1 receptor agonist comprises their amorphous form, a crystal form therefore, an enantiomer thereof, or a prodrug thereof, or a combination thereof.

[0073] In any of the aspects, methods, and / or embodiments herein, the Sigma-1 receptor agonist therapy comprises administering to the subject the Sigma-1 agonist for a period up to 14 weeks, such as about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks,about 12 weeks, about 13 weeks, or about 14 weeks. In another aspect, a Sigma-1 receptor agonist is administered to the subject daily, such as once daily, twice daily, and / or 3 times daily. In another aspect, a Sigma-1 receptor agonist is administered to the subject according to an intermittent regimen. In one aspect, the intermittent dosing regimen comprises at least two cycles, each cycle comprising (a) a dosing period during which the Sigma-1 receptor agonist and / or its composition is administered to said patient; and thereafter (b) a resting period. In one aspect, the dosing period and the resting period are of the same duration. In another aspect, the dosing period and the resting period are of different durations. In one aspect, the dosing period and the resting period is in the range of a lower limit of about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, and 14 days to an upper limit of about 28 days, 27 days, 26 days, 25 days, 24 days, 23 days, 22 days, 21 days, 20 days, 19, days, 18 days, 17 days, 16 days, 15 days, and 14 days. V. Methods of Treatment

[0074] One aspect of the present disclosure encompasses a method of personalized therapy or precision medicine by monitoring the treatment effectiveness in a subject by administering a therapeutically effective amount of a Sigma-1 receptor agonist, analyzing the changes in the subject’s gene profiles, then identifying differentially expressed genes. If one or more of the differentially expressed gene(s) is listed in a gene list comprising REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof, the therapy delivered by the Sigma-1 receptor agonist would be deemed effective, and should continue. If on the other hand, there is no differentially expressed gene(s) or none of the gene(s) differentially expressed is among the group of REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, and ACAT1, the therapy is deemed not effective, and change of a therapy or supplement with another therapy would berecommended. The disorder or disease treated by a Sigma-1 receptor agonist including, but not limited to, Alzheimer’s disease, Parkinson’s disease, Parkinson’s disease with dementia, Huntington’s disease, Amyotrophic lateral sclerosis, Prion disease, Rett syndrome, cerebral palsy, Down's syndrome, Williams-Beuren syndrome, Prader-Willi syndrome, Angelman syndrome, pervasive developmental disorder not otherwise specified (PDD-NOS), childhood disintegrative disorder, Smith-Magenis syndrome, multiple sclerosis, velo-cardio-facial syndrome, ATR-X syndrome, Barth syndrome, Fragile X syndrome, ICF syndrome, Neurofibromatosis, Smith-Lemli-Opitz syndrome, an addictive disorder, Attention-deficit / hyperactivity disorder (ADHD), an anxiety disorder, Asperger's syndrome, autism spectrum disorder, an eating disorder, epilepsy, infantile spasms, fetal alcohol syndrome, hydrocephalus, manic depressive illness, mental retardation, schizophrenia, spina bifida, Tourette's syndrome, and any combination thereof.

[0075] In various aspects, methods, and / or embodiments disclosed in this section V herein, therefore, the differentially expressed gene(s) include REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. In these and other aspects, methods, and / or embodiments disclosed in this section V herein, the differentially expressed gene(s) include REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, and / or any combination thereof. In other aspects, methods, and / or embodiments disclosed in this section V herein, the differentially expressed gene(s) include RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. In still other aspects, methods, and / or embodiments disclosed in this section V herein, the differentially expressed gene(s) include REM2, BCL6, and any combination thereof. In one aspect, method, and / or embodiment disclosed in this section V herein, the differentially expressed gene(s) is one or more of REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A,TIMM22, ACAT1, and / or any combination thereof. In another aspect, method, and / or embodiment disclosed in this section V herein, the differentially expressed gene(s) is one or more of REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, and / or any combination thereof. In another aspect, method, and / or embodiment disclosed in this section V herein, the differentially expressed gene(s) is one or more of RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof. In another aspect, method, and / or embodiment disclosed in this section V herein, the differentially expressed gene(s) is one or more of REM2 and / or BCL6. Any of the foregoing differentially expressed gene aspect, method, and / or embodiment disclosed in this section V herein may be supplemented with one or more combinations or sub-combinations of differentially expressed gene(s) listed herein.

[0076] The Sigma-1 receptor agonist used in to treat the neurological diseases and disorders disclosed in this section V is selected from: tetrahydro-N,N-dimethyl- 2,2-diphenyl-3-furanmethanamine hydrochloride (A2-73), tetrahydro-N,N-dimethyl- 2,2-diphenyl-3-furanmethanamine (A2-73 freebase), tetrahydro-N,N-dimethyl-5,5- diphenyl-3-furanmethanamine hydrochloride (A1-41); tetrahydro-N,N-dimethyl-5,5- diphenyl-3-furanmethanamine (A1-41 freebase); 1-(2,2-diphenyltetrahydrofuran-3- yl)-N-methylmethanamine hydrochloride (A19-144); 1-(2,2-diphenyltetrahydrofuran- 3-yl)-N-methylmethanamine (A19-144 freebase); (1-(2,8-dimethyl- l-thia-3,8- diazaspiro(4.5)dec-3-yl)-3-(lH-indol-3-yl)propan-l-one) (A3-71); an enantiomer thereof, a crystal form thereof, a co-crystal form thereof, a pharmaceutically acceptable salt thereof, a crystal or co-crystal of the pharmaceutically acceptable salt thereof, or any combination thereof. In some embodiments the Sigma-1 receptor agonist used to treat the diseases and disorders in this section V is selected from: tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine in amorphous form (A2- 73 freebase amorphous form); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine in crystal Form I (A2-73 Freebase Crystal Form I); tetrahydro- N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form I (A2- 73 Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form II (A2-73 Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form III (A2-73 Crystal Form III); (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in amorphous form ((+) A2-73 amorphous form); (-) tetrahydro-N,N-dimethyl-2,2- diphenyl-3-furanmethanamine hydrochloride in amorphous form ((-) A2-73 amorphous form); (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in a crystal form ((+) A2-73 crystal form); (-) tetrahydro-N,N-dimethyl- 2,2-diphenyl-3-furanmethanamine hydrochloride in a crystal form ((-) A2-73 crystal form); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in amorphous form (A2-73 hydrogen fumarate amorphous form); tetrahydro-N,N- dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form I (A2- 73 hydrogen fumarate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrogen fumarate in crystal Form II (A2-73 hydrogen fumarate Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form III (A2-73 hydrogen fumarate Crystal Form III); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form IV (A2-73 hydrogen fumarate Crystal Form IV); tetrahydro-N,N- dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form V (A2-73 hydrogen fumarate Crystal Form V); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine mesylate in crystal Form I (A2-73 mesylate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine sulfate in crystal Form I (A2-73 sulfate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine sulfate in crystal Form II (A2-73 sulfate Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine oxalate in crystal Form I (A2-73 oxalate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine oxalate in crystal Form II (A2-73 oxalate Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine dihydrogen phosphate in crystal Form I (A2-73 dihydrogen phosphate Crystal Form I); tetrahydro-N,N- dimethyl-2,2-diphenyl-3-furanmethanamine edisylate in crystal Form I (A2-73 edisylate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine benzoate in crystal Form I (A2-73 benzoate Crystal Form I); tetrahydro-N,N-dimethyl- 2,2-diphenyl-3-furanmethanamine hydrobromide in crystal Form A (A2-73 hydrobromide Crystal Form A); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrobromide in crystal Form B (A2-73 hydrobromide Crystal Form B); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine maleate incrystal Form S5 (A2-73 maleate Crystal Form S5); tetrahydro-N,N-dimethyl-2,2- diphenyl-3-furanmethanamine maleate in crystal Form S6 (A2-73 maleate Crystal Form S6); co-crystal Form CSII of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with tartaric acid (A2-73 co-crystal with tartaric acid Crystal Form CSII); co-crystal Form CSIII of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with citric acid (A2-73 co-crystal with citric acid Crystal Form CSIII); co-crystal Form CSIV of tetrahydro-N,N-dimethyl-2,2-diphenyl- 3-furanmethanamine hydrochloride with malic acid (A2-73 co-crystal with malic acid Crystal Form CSIV); a co-crystal of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with zinc chloride (A2-73 co-crystal with zinc chloride); a co-crystal of (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with zinc chloride ((-) A2-73 co-crystal with zinc chloride); a co-crystal of (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with zinc chloride ((+) A2-73 co-crystal with zinc chloride); and any combination thereof.

[0077] For example, the Sigma-1 receptor agonist may comprise ANAVEX 2-73 (A2-73), A2-73 freebase, ANAVEX 19-144 (A19-144), A19-144 freebase, ANAVEX1- 41 (A1-41), A1-41 freebase, AV1066, ANAVEX3-71 (A3-71), PRE-084, Donepezil, Fluvoxamine, Amitriptyline, L-687,384, SA-4503, Dextromethorphan, Dimethyltryptamine, (+)-pentazocine, or any of their crystal forms, enantiomers and pharmaceutically acceptable salts thereof. In one aspect, the treatment is for Parkinson’s Disease, Parkinson’s disease with dementia, or for treating Rett Syndrome.

[0078] Another aspect of the present disclosure encompasses a method of determining if a subject is having or is suspected of having a neurological disorder, such as a neurodegenerative or neurodevelopmental disorder. The disease or disorder is for example selected from Alzheimer’s disease, Parkinson’s disease, Parkinson’s disease with dementia, Huntington’s disease, Amyotrophic lateral sclerosis, Prion disease, Rett syndrome, cerebral palsy, Down's syndrome, Williams- Beuren syndrome, Prader-Willi syndrome, Angelman syndrome, pervasive developmental disorder not otherwise specified (PDD-NOS), childhood disintegrative disorder, Smith-Magenis syndrome, multiple sclerosis, velo-cardio-facial syndrome, ATR-X syndrome, Barth syndrome, Fragile X syndrome, ICF syndrome,Neurofibromatosis, Smith-Lemli-Opitz syndrome, an addictive disorder, Attention- deficit / hyperactivity disorder (ADHD), an anxiety disorder, Asperger's syndrome, autism spectrum disorder, an eating disorder, epilepsy, infantile spasms, fetal alcohol syndrome, hydrocephalus, manic depressive illness, mental retardation, schizophrenia, spina bifida, Tourette's syndrome, and any combination thereof. In one aspect, the method comprises obtaining or having a gene expression profile for the first biological sample and for the second biological sample; comparing the gene expression profile of the first biological sample with that of the second biological sample to identify differentially expressed genes and overrepresented gene clusters; and identifying the subject as having a disorder or disease as listed above, or as having an increased risk of developing such disorder or disease, if any one of the following conditions is observed: (i) the identified differentially expressed gene(s) is listed in a gene list comprising REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof; or (ii) the identified overrepresented gene cluster(s) overlaps with one or more gene(s) listed in the gene list. Alternatively, the comparison is made between the second or the test gene expression profile with a predetermined control gene expression profile to identify differentially expressed genes, wherein the predetermined control gene expression profile comprises a control list of genes detected in a control biological sample obtained from the subject at the beginning of the treatment period; and their expression levels; wherein the differentially expressed genes comprises genes detected both in the test list and in the control list but having different expression levels in the test biological sample from that in the control biological sample. As used herein, the term “differentially expressed gene” means the gene expression levels in two experimental conditions or in two samples possess statistically significant difference or change.

[0079] Yet another aspect of the present disclosure relates to use the gene profile as a surrogate clinical trial endpoint. The clinical trial wherein the present disclosure may find utility is any interventional trials for disease treatment, and such trial may be in any phase, such as Phase 1, Phase 2 and Phase 3 clinical trials, as long as a clinical endpoint is required. Clinical endpoints are measurable events, outcomes, orchange in pathological biomarkers that can help determine whether a medical intervention, such as a drug therapy, is benefiting patients or bringing desirable outcomes. Clinical endpoints can be primary or secondary. A clinical trial may have multiple primary endpoints, and / or multiple secondary endpoints. Phase 1 studies are performed to find the highest dose of the new treatment that can be given safely to human being without causing severe side effects. These studies also help to decide on the best way to give the new treatment. Phase 1 trials may only open to healthy human subjects but may have endpoint measurements.

[0080] In one aspect, method, and / or embodiment disclosed herein, the Sigma-1 receptor agonist comprises A2-73 in the forms of A2-73 freebase, A2-73 amorphous form, A2-73 Crystal Form I, A2-73 Crystal Form II, A2-73 Crystal Form III, (-) A2-73 enantiomer, (+) A2-73 enantiomer, or any combination thereof. And the therapeutically effective amount of A2-73 comprises A2-73 in an amount of 0.5-100 mg per day, such 10-50 mg per day. A2-73, the therapeutically effective amount of A2-73 can range from about 0.5 mg to about 20 mg, about 1 mg to about 60 mg, about 30 mg to about 50 mg, or about 3 mg to about 5 mg. The therapeutically effective amount of A2-73 can range from about 0.5 mg / day to about 100 mg / day, from about 1 to about 60 mg / day, from about 20 to about 50 mg / day, from about 20 to about 30 mg / day, or from about 15 to about 25 mg / day. Administering the anti- neurodegenerative effective amount of A2-73 can provide blood levels of about 10 ng / ml, about 12 ng / ml of A2-73.

[0081] In one aspect, method, and / or embodiment disclosed herein, the Sigma-1 receptor agonist comprises A2-73 in any pharmaceutically suitable form and is administered to the subject daily or more than once daily. Further, A2-73 can be administered every 2, 3, 4, 5, 6, 7, 14, or every 30 days. A2-73 can be administered over a period ranging from about 1 day to about 1 year, from about 1 day to about 1 week, from about 3 days to about 1 month, from about 2 weeks to about 6 months, or from about 2 months to about 4 months. A2-73 can also be administered over a period of about 1 day, about 7 days, about 30 days, about 60 days, about 120 days, or about 180 days or more. In some aspects, A2-73 is administered over a period of about 6 weeks, 8 weeks, 10 weeks, 11 weeks, 12 weeks, 13 weeks, 14 weeks, 57 weeks, about 148 weeks, about 208 weeks, indefinitely, or until resolution of the condition being treated.

[0082] Other methods of administering A2-73 can be found in, e.g., U.S. Patent No.9750746, U.S. Patent Publication No.20170360798, U.S. Patent Publication No. 20190022052, U.S. Patent Publication No.20180360796, U.S. Patent Publication No.20180169059, U.S. Patent Publication No.20180177756, U.S. Patent Publication No.20180169060, and U.S. Patent Publication No.20190117615, each of which are hereby incorporated by reference herein in their entirety.

[0083] In another aspect method, and / or embodiment disclosed herein, the Sigma-1 receptor agonist may comprise ANAVEX®19-144 (A19-144), having the chemical name of 1-(2,2-diphenyltetrahydrofuran-3-yl)-N-methylmethanamine hydrochloride, or A19-144 freebased, having the chemical name of 1-(2,2- diphenyltetrahydrofuran-3-yl)-N-methylmethanamine. Without being bound by theory, A19-144 is reported as a metabolite of A2-73. In the present disclosure A2-73 is a compound, which is subjected to enzymatic oxidation, reduction or hydrolysis under physiological conditions in the living body and is converted to A19-144 or A19-144 freebase of the present disclosure. A19-144 may be in the forms of A19-144 freebase, A19-144 amorphous form, a A19-144 crystal. Such crystal may be prepared by methods and procedures disclosed in WO 2017 / 013498 (hereby incorporated by reference herein in its entirety). The effective amount of 19-144 or A19-144 freebase may comprise an amount of 0.5-100 mg per day, such as 10 mg, 20 mg, 30 mg, 40 mg, or 50 mg per day. In one aspect, the therapeutically effective amount of A19-144 or A19-144 freebase may range from about 0.5 mg to about 20 mg, about 1 mg to about 60 mg, about 30 mg to about 50 mg, or about 3 mg to about 5 mg. The therapeutically effective amount of A2-73 can range from about 0.5 mg / day to about 100 mg / day, from about 1 to about 60 mg / day, from about 20 to about 50 mg / day, from about 20 to about 30 mg / day, or from about 15 to about 25 mg / day. Administering the anti-neurodegenerative effective amount of A19-144 or A19-144 freebase can provide blood levels of about 10 ng / ml, about 12 ng / ml of A2- 73.

[0084] Yet in another aspect method, and / or embodiment disclosed herein, the Sigma-1 receptor agonist may comprise A1-41, A1-41 Freebase, AV1066, ANAVEX®3-71 (A3-71, AF-710B, having a chemical name of 1-(2,8-dimethyl-1-thia- 3,8-diazaspiro [4.5] decan-3-yl)-3-(1H-indol-3-yl) propan-1-one), or an amorphous form thereof, a crystal form thereof, a salt thereof. In one aspect, the Sigma-1receptor agonist comprises A3-71, and it is administered in a composition comprising from about 1 mg to about 50 g, from about 0.1 to about 5 g, from about 0.5 g to about 3 g, from about 1 mg to about 55 mg, from about 5 mg to about 30 mg, from about 40 mg to about 60 mg, from about 80 mg to about 120 mg, from about 180 mg to about 220 mg, from about 0.1 g to about 5 g, or from about 0.5 g to about 3 g of A3-71. The composition may be administered daily, twice daily, or three times daily. The duration of administration may be about 3-6 weeks, 6-11 weeks, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months or chronically. For example, A2- 73, A19-144, A1-14, AV1006 or A3-71 may be administered in an amount of about 40 mg to about 60 mg once daily for about 6-11 weeks or is administered in about 50 mg daily for up to 11 weeks. A3-71 or A2-73 may also be administered daily in an escalating dose starting from about 10 mg to ending at about 50 mg once daily. VI. Biological Samples

[0085] Any biological samples suitable for transcriptome or gene analysis can be used in the present disclosure. Non-limiting examples of suitable biological samples include fluid samples, biopsy samples, skin samples, and hair samples. Fluid samples may include blood, serum, plasma, saliva, tears, and lymph. In some aspect, the biological sample is a blood sample, a serum sample, a plasma sample or any transcriptomic sample. Methods of collecting a biological sample from a subject are well known in the art.

[0086] The biological sample, for instance, comprises a solid, a semi-solid, a semi-fluid, a fluid, a tissue, or other material collected from a subject. A biological sample may be a fluid biological sample. A fluid biological sample may include fluid and some or all of cells, particles, crystals, and other components in the fluid. Examples of biological samples include but are not limited to, blood, serum, plasma, bone marrow, a nasal swab, a nasopharyngeal wash, saliva, urine, gastric fluid, spinal fluid, tears, stool, mucus, sweat, earwax, oil, a glandular secretion, cerebral spinal fluid, tissue, semen, vaginal fluid, interstitial fluids derived from tumorous tissue, ocular fluids, spinal fluid, a throat swab, breath, hair, finger nails, skin, biopsy, placental fluid, amniotic fluid, cord blood, lymphatic fluids, cavity fluids, sputum, pus, microbiota, meconium, breast milk and / or other secretions or excretions. Biologicalsamples may include nasopharyngeal wash, or other fluid obtained by washing a body cavity or surface of a subject, or by washing a swab following application of the swab to a body cavity or surface of a subject. Nasal swabs, throat swabs, stool samples, hair, fingernail, ear wax, breath, and other solid, semi-solid, or gaseous samples may be processed in an extraction buffer, e.g., for a fixed or variable amount of time. Examples of tissue samples of the subject may include but are not limited to, connective tissue, muscle tissue, nervous tissue, epithelial tissue, cartilage, cancerous sample, or bone. The sample may be obtained from a human or animal. The sample may be obtained from a vertebrate, e.g., a bird, fish, or mammal, such as a rat, a mouse, a pig, an ape, another primate (including humans), a farm animal, a sport animal, or a pet. The sample may be obtained from a living or dead subject. The sample may be obtained fresh from a subject or may have undergone some form of pre-processing, storage, or transport. The terms “blood” and “whole blood” refer to blood as it exists within an animal and as directly obtained from a subject in a blood sample. Blood contains red blood cells, white blood cells, proteins such as albumin, globulins, and clotting factors, salts, water, and other constituents. A blood sample is a fluid biological sample. In one aspect, a biological sample refers to a fluid sample containing suspended cells, cellular material, fungi, antigens, biological factors, immunogens, proteins, and other material of biological origin generally having a size substantially larger than the size of the molecules that comprise the fluid. Biological factors refer to compounds made by living organisms or attached to living organisms that have biological or physiological activities. Biological factors include but are not limited to biological markers, antibodies, cytokines, growth factors, and other peptides, proteins, lipids and carbohydrates produced biologically. Terms “plasma” and “blood plasma” refer to the liquid portion of blood (e.g., a blood sample) that remains after the removal of blood cells. Red blood cells and white blood cells may be removed by centrifugation of a blood sample, leaving plasma above the pelleted cells in the bottom of the centrifuge tube. Plasma retains blood clotting factors and is obtained from anti-coagulated blood samples. A sample of plasma is a fluid biological sample. The terms “serum” and “blood serum” refer to the liquid portion of blood that remains after blood is allowed to clot, and the clot is removed. Serum differs from plasma in that serum lacks clotting factors: since clotting requires fibrin, thrombin, and other proteins, which form and remain part of a blood clot, serum lacks these proteins while plasma contains them. A sample ofblood serum is a fluid biological sample. The present disclosure comprises a first biological sample and / or a second biological sample. The first and the second biological sample can be the same type of biological sample but taken at different time. The first and the second biological sample may be a different type of biological sample taken from the same subject. The first and the second biological sample may be different type of biological sample taken at different time from the same subject. The first and the second biological sample may be the same type of biological sample taken at the same time, but from different subjects. The first and the second biological sample each is independently any biological sample recited above. In one aspect, the first and the second biological sample each independently, comprises a blood serum sample, a plasma sample, or a biological sample suitable for transcriptomic analysis. Transcriptome analysis is the study of the transcriptome, of the complete set of RNA transcripts that are produced by the genome, under specific circumstances or in a specific cell, often using high-throughput methods. The transcriptomic analysis is useful in identifying the functions of genes, and / or identification of pathways that respond to or ameliorate environmental stresses. RNA-Seq can also identify disease-associated gene fusions, single nucleotide polymorphisms and even allele-specific expression. The present disclosure expressly incorporates any biological sample that are suitable and / or capable of being used for transcriptomic analysis. The biological sample may comprise a solid, a semi-solid, a semi-fluid, a fluid, a tissue, or other material collected from a subject. A biological sample may be a fluid biological sample.

[0087] Gene expression measurement includes both DNA and RNA measurements. They may be accomplished by a variety of methods including northern blotting, quantitative real-time PCR (qRT-PCR), nucleic acid microarrays, Luminex microspheres, and nuclease protection assay. Methods of determining a substantially different level of RNA expression are known in the art and include distribution analysis. In some aspects, a substantially different level of RNA expression is determined by normalizing RNA expression values as Transcripts Per Kilobase Million (TPM).

[0088] Over the last decade, there is an avalanche of biomedical data generation and a parallel expansion in computational capabilities to analyze and make sense of these data. Starting with genome sequencing (such as omics) and widely employeddeep sequencing technologies, these trends have now taken hold in all omics disciplines and increasingly call for multi-omics integration as well as data interpretation by artificial intelligence technologies. Artificial intelligence (AI) aided- data modeling (AI Modeling) has made the interpretation of large omics data sets feasible and meaningful. Use of omics and AI Modeling in biomarker discovery can aid clinicians by identifying markers of risk for developing a certain disease, monitoring care, determining prognosis, and developing druggable targets. Combined, AI Modeling has the power to improve patient care and facilitates the development of precision medicine. In the present disclosure, the AI Modeling not only considers omics data, but also a broad range of other subjects’ data. Such data include, but not limited to, subject’s clinical diagnosis, co-morbidity, co-medication, age, weight, height, and gender. The AI Modeling used in the present disclosure also include trial data, such as doses received, dosing time points, endpoint assessment, and behavior impacts, such as sleep or cognition impacts. Thorough data collection and advanced algorithm, the AI Modeling in the present disclosure can generate and analyze over 24 million relationships and concludes with biomarkers with convincing confidence and p values. VII. Pharmaceutical Compositions

[0089] One aspect of the disclosure encompasses a pharmaceutical composition comprising a Sigma-1 receptor agonist and optionally another neurological disease or disorder drug therapy. A pharmaceutical composition comprises a therapeutically effective amount of an active pharmaceutical ingredient, and any pharmaceutically acceptable salt thereof. The active pharmaceutical ingredient can be an organic molecule, an inorganic molecule, a protein, a polypeptide, an antibody, an antibody fragment, an RNA or a DNA. When the active pharmaceutical ingredient is an organic molecule, it can exist as a crystal form, or an amorphous form. When the active pharmaceutical ingredient is an organic molecule and has at least one chiral center, the active can be either a racemic form, or a crystal or polymorphic form. Further, a crystal may form a co-crystal with an acid or an ionic salt, and function as the active pharmaceutical ingredient.

[0090] The Sigma-1 receptor agonist used in the pharmaceutical compositions disclosed in this section VII is selected from: tetrahydro-N,N-dimethyl-2,2-diphenyl- 3-furanmethanamine hydrochloride (A2-73), tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine (A2-73 freebase), tetrahydro-N,N-dimethyl-5,5-diphenyl-3- furanmethanamine hydrochloride (A1-41); tetrahydro-N,N-dimethyl-5,5-diphenyl-3- furanmethanamine (A1-41 freebase); 1-(2,2-diphenyltetrahydrofuran-3-yl)-N- methylmethanamine hydrochloride (A19-144); 1-(2,2-diphenyltetrahydrofuran-3-yl)- N-methylmethanamine (A19-144 freebase); (1-(2,8-dimethyl- l-thia-3,8- diazaspiro(4.5)dec-3-yl)-3-(lH-indol-3-yl)propan-l-one) (A3-71); an enantiomer thereof, a crystal form thereof, a co-crystal form thereof, a pharmaceutically acceptable salt thereof, a crystal or co-crystal of the pharmaceutically acceptable salt thereof, or any combination thereof. In some embodiments the Sigma-1 receptor agonist used in the pharmaceutical compositions in this section VII is selected from: tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine in amorphous form (A2- 73 freebase amorphous form); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine in crystal Form I (A2-73 Freebase Crystal Form I); tetrahydro- N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form I (A2- 73 Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form II (A2-73 Crystal Form II); tetrahydro-N,N-dimethyl-2,2- diphenyl-3-furanmethanamine hydrochloride in crystal Form III (A2-73 Crystal Form III); (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in amorphous form ((+) A2-73 amorphous form); (-) tetrahydro-N,N-dimethyl-2,2- diphenyl-3-furanmethanamine hydrochloride in amorphous form ((-) A2-73 amorphous form); (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in a crystal form ((+) A2-73 crystal form); (-) tetrahydro-N,N-dimethyl- 2,2-diphenyl-3-furanmethanamine hydrochloride in a crystal form ((-) A2-73 crystal form); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in amorphous form (A2-73 hydrogen fumarate amorphous form); tetrahydro-N,N- dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form I (A2- 73 hydrogen fumarate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrogen fumarate in crystal Form II (A2-73 hydrogen fumarate Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form III (A2-73 hydrogen fumarate Crystal Form III); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate incrystal Form IV (A2-73 hydrogen fumarate Crystal Form IV); tetrahydro-N,N- dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form V (A2-73 hydrogen fumarate Crystal Form V); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine mesylate in crystal Form I (A2-73 mesylate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine sulfate in crystal Form I (A2-73 sulfate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine sulfate in crystal Form II (A2-73 sulfate Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine oxalate in crystal Form I (A2-73 oxalate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine oxalate in crystal Form II (A2-73 oxalate Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine dihydrogen phosphate in crystal Form I (A2-73 dihydrogen phosphate Crystal Form I); tetrahydro-N,N- dimethyl-2,2-diphenyl-3-furanmethanamine edisylate in crystal Form I (A2-73 edisylate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine benzoate in crystal Form I (A2-73 benzoate Crystal Form I); tetrahydro-N,N-dimethyl- 2,2-diphenyl-3-furanmethanamine hydrobromide in crystal Form A (A2-73 hydrobromide Crystal Form A); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrobromide in crystal Form B (A2-73 hydrobromide Crystal Form B); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine maleate in crystal Form S5 (A2-73 maleate Crystal Form S5); tetrahydro-N,N-dimethyl-2,2- diphenyl-3-furanmethanamine maleate in crystal Form S6 (A2-73 maleate Crystal Form S6); co-crystal Form CSII of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with tartaric acid (A2-73 co-crystal with tartaric acid Crystal Form CSII); co-crystal Form CSIII of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with citric acid (A2-73 co-crystal with citric acid Crystal Form CSIII); co-crystal Form CSIV of tetrahydro-N,N-dimethyl-2,2-diphenyl- 3-furanmethanamine hydrochloride with malic acid (A2-73 co-crystal with malic acid Crystal Form CSIV); a co-crystal of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with zinc chloride (A2-73 co-crystal with zinc chloride); a co-crystal of (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with zinc chloride ((-) A2-73 co-crystal with zinc chloride); a co-crystal of (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with zinc chloride ((+) A2-73 co-crystal with zinc chloride); and any combination thereof.

[0091] In another aspect, method, and / or embodiment disclosed herein, the present disclosure encompasses the active pharmaceutical ingredient in the form of a racemic, a stereoisomer, an enantiomer, a polymorph, or a co-crystal. In one aspect, the enantiomer may be (+) or (-) rotation or expressed as (R) or (S) forms. In one aspect, method, and / or embodiment disclosed herein, a pharmaceutically acceptable co-crystal is formed between: (i) A2-73 Freebase, A2-73, A19-144 Freebase, A19-144, A1-41 Freebase, A1-41, an enantiomer therefore, a polymorph thereof; and (ii) an acid or an ionic salt. In another aspect, the acid comprises fumaric acid, sulfuric acid, phosphoric acid, hydrogen phosphoric acid, dihydrogen phosphoric acid, benzoic acid, salicylic acid, oxalic acid, ethanedisulfonic acid, tartaric acid, citric acid, maleic acid, or a combination thereof. The ionic salt comprises a quaternary ammonium cationic salt, a salt of a transitional metal, a salt of an alkaline earth metal, or a salt of alkali metal. In one aspect, the ionic salt comprises lithium chloride, sodium chloride, magnesium chloride, potassium chloride, calcium chloride, zinc chloride, iron (II) chloride, iron (III) chloride, titanium chloride, chromium (III) chloride, scandium (III) chloride, manganese (II) chloride, copper (I) chloride, copper (II) chloride, nickel chloride, or aluminum chloride.

[0092] In yet another aspect, method, and / or embodiment disclosed herein, the present disclosure encompasses the active pharmaceutical ingredient in the form of a pharmaceutically acceptable salt of the Sigma-1 receptor agonist. In one aspect, such salt include, without limitation, acetate, aspartate, benzoate, bitartrate, citrate, formate, gluconate, glucuronate, glutamate, fumarate, hydrochloride, hydrobromide, hydroiodide, hypophosphite, isobutyrate, isocitrate, lactate, malate, maleate, meconate, methylbromide, methanesulfonate, monohydrate, mucate, nitrate, oxalate, phenylpropionate, phosphate, phthalate, propionate, pyruvate, salicylate, stearate, succinate, sulfate, tannate, tartrate, terephthalate, valerate, and the like.

[0093] When the active pharmaceutical ingredient is ANAVEX 2-73 (A2-73), a composition may comprise from about 1 mg to about 50 g, from about 0.1 to about 5 g, from about 0.5 g to about 3 g, from about 1 mg to about 55 mg, from about 40 mg to about 60 mg, from about 80 mg to about 120 mg, from about 180 mg to about 220 mg, from about 0.1 g to about 5 g, or from about 0.5 g to about 3 g of A2-73. Formulations comprising A2-73 can be found in, e.g., U.S. Patent No.9750746, U.S. Patent Publication No.20170360798, U.S. Patent Publication No.20190022052,U.S. Patent Publication No.20180360796, U.S. Patent Publication No. 20180169059, U.S. Patent Publication No.20180177756, U.S. Patent Publication No.20180169060, and U.S. Patent Publication No.20190117615 (each of which are hereby incorporated by reference herein in their entirety).

[0094] The active pharmaceutical ingredient can be formulated and administered to a subject by several different means. For instance, a composition can generally be administered parenterally, intraperitoneally, intravascularly, transdermal, subcutaneously, or intrapulmonary in dosage unit formulations containing conventional nontoxic pharmaceutically acceptable adjuvants, carriers, excipients, and vehicles as desired. The term parenteral as used herein includes subcutaneous, intravenous, intramuscular, intrathecal, or intracisternal injection, or infusion techniques. Formulation of pharmaceutical compositions is discussed in, for example, Hoover, John E., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa. (1975), and Liberman, H. A. and Lachman, L., Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, N.Y. (1980).

[0095] A pharmaceutical composition also comprises one or more pharmaceutically acceptable excipients. Non-limiting examples of excipients include chemical enhancers, humectants, pressure sensitive adhesives, antioxidants, solubilizers, thickening agents, plasticizers, adjuvants, carriers, excipients, vehicles, coatings, and any combinations thereof. One or more excipients can be selected for oral, transdermal, parenteral, intraperitoneal, intravascular, subcutaneous, by inhalation spray, rectal, or intrapulmonary administration. Binders

[0096] Non-limiting examples of binders suitable for the formulations or dosage forms of various aspects include starches, pregelatinized starches, gelatin, polyvinylpyrrolidone, cellulose, methylcellulose, sodium carboxymethylcellulose, ethylcellulose, polyacrylamides, polyvinyloxoazolidone, polyvinylalcohols, C12-C18 fatty acid alcohols, polyethylene glycol, polyols, saccharides, oligosaccharides, polypeptides, oligopeptides, and combinations thereof. The polypeptide may be any arrangement of amino acids ranging from about 100 to about 300,000 Daltons.

[0097] The binder can be introduced into the mixture to be granulated in a solid form, including but not limited to a crystal, a particle, a powder, or any other finelydivided solid form known in the art. Alternatively, the binder can be dissolved or suspended in a solvent and sprayed onto the mixture in a granulation device as a binder fluid during granulation. Diluents

[0098] Non-limiting examples of diluents (also referred to as “fillers” or “thinners”) include carbohydrates, inorganic compounds, and biocompatible polymers, such as polyvinylpyrrolidone (PVP). Other non-limiting examples of diluents include dibasic calcium sulfate, tribasic calcium sulfate, starch, calcium carbonate, magnesium carbonate, microcrystalline cellulose, dibasic calcium phosphate, tribasic calcium phosphate, magnesium carbonate, magnesium oxide, calcium silicate, talc, modified starches, saccharides such as sucrose, dextrose, lactose, microcrystalline cellulose, fructose, xylitol, and sorbitol, polyhydric alcohols; starches; pre-manufactured direct compression diluents; and mixtures of any of the foregoing. Disintegrants

[0099] Disintegrants can be effervescent or non-effervescent. Non-limiting examples of non-effervescent disintegrants include starches such as corn starch, potato starch, pregelatinized and modified starches thereof, sweeteners, clays, such as bentonite, micro-crystalline cellulose, alginates, sodium starch glycolate, gums such as agar, guar, locust bean, karaya, pectin, and tragacanth. Suitable effervescent disintegrants include but are not limited to sodium bicarbonate in combination with citric acid, and sodium bicarbonate in combination with tartaric acid. Preservatives

[0100] Non-limiting examples of preservatives include, but are not limited to, ascorbic acid and its salts, ascorbyl palmitate, ascorbyl stearate, anoxomer, N- acetylcysteine, benzyl isothiocyanate, m-aminobenzoic acid, o-aminobenzoic acid, p- aminobenzoic acid (PABA), butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), caffeic acid, canthaxantin, alpha-carotene, beta-carotene, beta-caraotene, beta-apo-carotenoic acid, carnosol, carvacrol, catechins, cetyl gallate, chlorogenic acid, citric acid and its salts, clove extract, coffee bean extract, p-coumaric acid, 3,4-dihydroxybenzoic acid, N,N'-diphenyl-p-phenylenediamine (DPPD), dilauryl thiodipropionate, distearyl thiodipropionate, 2,6-di-tert-butylphenol,dodecyl gallate, edetic acid, ellagic acid, erythorbic acid, sodium erythorbate, esculetin, esculin, 6-ethoxy-1,2-dihydro-2,2,4-trimethylquinoline, ethyl gallate, ethyl maltol, ethylenediaminetetraacetic acid (EDTA), eucalyptus extract, eugenol, ferulic acid, flavonoids (e.g., catechin, epicatechin, epicatechin gallate, epigallocatechin (EGC), epigallocatechin gallate (EGCG), polyphenol epigallocatechin-3-gallate), flavones (e.g., apigenin, chrysin, luteolin), flavonols (e.g., datiscetin, myricetin, daemfero), flavanones, fraxetin, fumaric acid, gallic acid, gentian extract, gluconic acid, glycine, gum guaiacum, hesperetin, alpha-hydroxybenzyl phosphinic acid, hydroxycinammic acid, hydroxyglutaric acid, hydroquinone, N-hydroxysuccinic acid, hydroxytryrosol, hydroxyurea, rice bran extract, lactic acid and its salts, lecithin, lecithin citrate; R-alpha-lipoic acid, lutein, lycopene, malic acid, maltol, 5-methoxy tryptamine, methyl gallate, monoglyceride citrate; monoisopropyl citrate; morin, beta- naphthoflavone, nordihydroguaiaretic acid (NDGA), octyl gallate, oxalic acid, palmityl citrate, phenothiazine, phosphatidylcholine, phosphoric acid, phosphates, phytic acid, phytylubichromel, pimento extract, propyl gallate, polyphosphates, quercetin, trans-resveratrol, rosemary extract, rosmarinic acid, sage extract, sesamol, silymarin, sinapic acid, succinic acid, stearyl citrate, syringic acid, tartaric acid, thymol, tocopherols (i.e., alpha-, beta-, gamma- and delta-tocopherol), tocotrienols (i.e., alpha-, beta-, gamma- and delta-tocotrienols), tyrosol, vanilic acid, 2,6-di-tert- butyl-4-hydroxymethylphenol (i.e., Ionox 100), 2,4-(tris-3',5'-bi-tert-butyl-4'- hydroxybenzyl)-mesitylene (i.e., Ionox 330), 2,4,5-trihydroxybutyrophenone, ubiquinone, tertiary butyl hydroquinone (TBHQ), thiodipropionic acid, trihydroxy butyrophenone, tryptamine, tyramine, uric acid, vitamin K and derivates, vitamin Q10, wheat germ oil, zeaxanthin, or combinations thereof. Flavor-modifying agents

[0101] Suitable flavor-modifying agents include flavorants, taste-masking agents, sweeteners, and the like. Flavorants include, but are not limited to, synthetic flavor oils and flavoring aromatics and / or natural oils, extracts from plants, leaves, flowers, fruits, and combinations thereof. Other non-limiting examples of flavors include cinnamon oils, oil of wintergreen, peppermint oils, clover oil, hay oil, anise oil, eucalyptus, vanilla, citrus oils such as lemon oil, orange oil, grape and grapefruit oil, fruit essences including apple, peach, pear, strawberry, raspberry, cherry, plum, pineapple, and apricot.

[0102] Taste-masking agents include but are not limited to cellulose hydroxypropyl ethers (HPC) such as Klucel®, Nisswo HPC and PrimaFlo HP22; low- substituted hydroxypropyl ethers (L-HPC); cellulose hydroxypropyl methyl ethers (HPMC) such as Seppifilm-LC, Pharmacoat®, Metolose SR, Opadry YS, PrimaFlo, MP3295A, Benecel MP824, and Benecel MP843; methylcellulose polymers such as Methocel® and Metolose®; Ethylcelluloses (EC) and mixtures thereof such as E461, Ethocel®, Aqualon®-EC, Surelease; Polyvinyl alcohol (PVA) such as Opadry AMB; hydroxyethylcelluloses such as Natrosol®; carboxymethylcelluloses and salts of carboxymethylcelluloses (CMC) such as Aualon®-CMC; polyvinyl alcohol and polyethylene glycol co-polymers such as Kollicoat IR®; monoglycerides (Myverol), triglycerides (KLX), polyethylene glycols, modified food starch, acrylic polymers and mixtures of acrylic polymers with cellulose ethers such as Eudragit® EPO, Eudragit® RD100, and Eudragit® E100; cellulose acetate phthalate; sepifilms such as mixtures of HPMC and stearic acid, cyclodextrins, and mixtures of these materials. In other aspects, additional taste-masking agents contemplated are those disclosed in U.S. Pat. Nos.4,851,226; 5,075,114; and 5,876,759, each of which is hereby incorporated by reference in its entirety.

[0103] Non-limiting examples of sweeteners include glucose (corn syrup), dextrose, invert sugar, fructose, and mixtures thereof (when not used as a carrier); saccharin and its various salts such as the sodium salt; dipeptide sweeteners such as aspartame; dihydrochalcone compounds, glycyrrhizin; Stevia rebaudiana (Stevioside); chloro derivatives of sucrose such as sucralose; sugar alcohols such as sorbitol, mannitol, sylitol, hydrogenated starch hydrolysates and the synthetic sweetener 3,6-dihydro-6-methyl-1,2,3-oxathiazin-4-one-2,2-dioxide, particularly the potassium salt (acesulfame-K), and sodium and calcium salts thereof. Lubricants and glidants

[0104] The lubricant compositions may be utilized to lubricate ingredients that form a pharmaceutical composition. As a glidant, the lubricant facilitates removal of solid dosage forms during the manufacturing process. Non-limiting examples of lubricants and glidants include magnesium stearate, calcium stearate, zinc stearate, hydrogenated vegetable oils, sterotex, polyoxyethylene monostearate, talc, polyethylene glycol, sodium benzoate, sodium lauryl sulfate, magnesium lauryl sulfate, and light mineral oil. The pharmaceutical composition will generally comprisefrom about 0.01% to about 10% by weight of a lubricant. In some aspects, the pharmaceutical composition will comprise from about 0.1% to about 5% by weight of a lubricant. In a further aspect, the pharmaceutical composition will comprise from about 0.5% to about 2% by weight of a lubricant. Dispersants

[0105] Dispersants may include but are not limited to starch, alginic acid, polyvinylpyrrolidones, guar gum, kaolin, bentonite, purified wood cellulose, sodium starch glycolate, isoamorphous silicate, and microcrystalline cellulose as high hydrophilic-lipophilic balance (HLB) emulsifier surfactants. Colorants

[0106] Depending upon the aspect of the disclosure, it may be desirable to include a coloring agent. Suitable color additives include but are not limited to food, drug and cosmetic colors (FD&C), drug and cosmetic colors (D&C), or external drug and cosmetic colors (Ext. D&C). These colors or dyes, along with their corresponding lakes, and certain natural and derived colorants, may be suitable for use in various aspects of the disclosure. pH modifiers

[0107] Non-limiting examples of pH modifiers include citric acid, acetic acid, tartaric acid, malic acid, fumaric acid, lactic acid, phosphoric acid, sorbic acid, benzoic acid, sodium carbonate and sodium bicarbonate. Chelating agents

[0108] A chelating agent may be included as an excipient to immobilize oxidative groups, including but not limited to metal ions, to inhibit the oxidative degradation of the morphinan by these oxidative groups. Non-limiting examples of chelating agents include lysine, methionine, glycine, gluconate, polysaccharides, glutamate, aspartate, and disodium ethylenediaminetetraacetate (Na2EDTA). Antimicrobial agents

[0109] An antimicrobial agent may be included as an excipient to minimize the degradation of the compound according to this disclosure by microbial agents, including but not limited to bacteria and fungi. Non-limiting examples of antimicrobials include parabens, chlorobutanol, phenol, calcium propionate, sodiumnitrate, sodium nitrite, Na2EDTA, and sulfites including but not limited to sulfur dioxide, sodium bisulfite, and potassium hydrogen sulfite. Release-controlling polymers

[0110] Release-controlling polymers may be included in the various aspects of the solid dosage pharmaceutical compositions incorporating compounds according to this disclosure. In one aspect, the release-controlling polymers may be used as a tablet coating. In other aspects, including but not limited to bilayer tablets, a release- controlling polymer may be mixed with the granules and other excipients prior to the formation of a tablet by a known process including but not limited to compression in a tablet mold. Suitable release-controlling polymers include but are not limited to hydrophilic polymers and hydrophobic polymers.

[0111] Suitable hydrophilic release-controlling polymers include, but are not limited to, cellulose acetate, cellulose diacetate, cellulose triacetate, cellulose ethers, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose, microcrystalline cellulose, nitrocellulose, crosslinked starch, agar, casein, chitin, collagen, gelatin, maltose, mannitol, maltodextrin, pectin, pullulan, sorbitol, xylitol, polysaccharides, ammonia alginate, sodium alginate, calcium alginate, potassium alginate, propylene glycol alginate, alginate sodium carmellose, calcium carmellose, carrageenan, fucoidan, furcellaran, arabic gum, carrageens gum, ghafti gum, guar gum, karaya gum, locust bean gum, okra gum, tragacanth gum, scleroglucan gum, xanthan gum, hypnea, laminaran, acrylic polymers, acrylate polymers, carboxyvinyl polymers, copolymers of maleic anhydride and styrene, copolymers of maleic anhydride and ethylene, copolymers of maleic anhydride propylene or copolymers of maleic anhydride isobutylene), crosslinked polyvinyl alcohol and poly N-vinyl-2- pyrrolidone, diesters of polyglucan, polyacrylamides, polyacrylic acid, polyamides, polyethylene glycols, polyethylene oxides, poly(hydroxyalkyl methacrylate), polyvinyl acetate, polyvinyl alcohol, polyvinyl chloride, polystyrenes, polyvinylpyrrolidone, anionic and cationic hydrogels, and combinations thereof. Coatings

[0112] A solid dosage comprising a compound according to this disclosure may comprise a coating, wherein such a coating may control release of the compound, function as a moisture barrier, or buffer or modify pH. A “control releasing coat” or“controlled release coat” as used herein is defined to mean a functional coat which can for example comprise at least one pH independent polymer, pH dependent polymer (for example enteric or reverse enteric type polymers), soluble polymer, insoluble polymer, lipids, lipidic materials, or combinations thereof. The coating, when applied onto a dosage form, may slow (for example when applied to a normal release matrix dosage form), further slow (for example when applied to a controlled release matrix dosage form) or modify the rate of release of a compound according to this disclosure when applied to an uncoated dosage form. For example, the control releasing coat can be designed such that when the control releasing coat is applied to a dosage form, the dosage form in conjunction with the control releasing coat can exhibit the release of the compound according to this disclosure, such as a “modified-release”, “controlled-release”, “sustained-release”, “extended-release”, “delayed-release”, “prolonged-release,” or combinations thereof. The “control releasing coat” may optionally comprise additional materials that may alter the functionality of the control releasing coat.

[0113] The term “moisture barrier” as used herein is one which impedes or retards the absorption of moisture. Compounds according to this disclosure may be hygroscopic and, as such, may be susceptible to decomposition over time under highly humid conditions. The proportion of the components of the moisture barrier and the amount of the moisture barrier optionally applied onto the control-releasing coating or onto the core are typically such that the moisture barrier does not fall within the USP definition and requirement for an enteric coat. Suitably, the moisture barrier may comprise an enteric and / or acrylic polymer, suitably an acrylic polymer, optionally a plasticizer, and a permeation enhancer. The permeation enhancer is a hydrophilic substance, which allows water to enter without physical disruption of the coating. The moisture barrier may additionally comprise other conventional inert excipients, which may improve processing of an extended-release formulation.

[0114] Coating and matrix materials which may be used in accordance with the present disclosure are those known in the art for use in controlled-release formulations, such as synthetic polymers of the polyvinyl type, e.g., polyvinylchloride, polyvinylacetate and copolymers thereof, polyvinylalcohol, and polyvinylpyrrolidone; synthetic polymers of the polyethylene type, e.g., polyethylene and polystyrene; acrylic acid polymers; biopolymers or modified biopolymers, such as cellulosicpolymers, shellac and gelatin; fats, oils, higher fatty acids and higher alcohols (i.e., acids and alcohols containing alkyl chains of at least 10 carbon atoms), for example aluminum monostearate, cetylalcohol, hydrogenated beef tallow, hydrogenated castor oil, 12-hydroxystearl alcohol, glyceryl mono- or dipalmitate; glyceryl mono-, di- or tristearate; myristyl alcohol, stearic acid, stearyl alcohol, and polyethyleneglycols; waxes; sugars and sugar alcohols.

[0115] The pH-buffering properties of a coating may be strengthened by introducing into the coating substances chosen from a group of compounds usually used in antacid formulations, for example magnesium oxide, hydroxide or carbonate, aluminum or calcium hydroxide, carbonate or silicate; composite aluminum / magnesium compounds, for example Al2O3·6MgO·CO2·12H2O, (Mg6Al2(OH)16CO3·4H2O), MgO·Al2O3·2SiO2.nH2O, aluminum bicarbonate coprecipitate or similar compounds; or other pharmaceutically acceptable pH- buffering compounds, for example the sodium, potassium, calcium, magnesium and aluminum salts of phosphoric, carbonic, citric or other suitable, weak, inorganic or organic acids; or suitable organic bases, including basic amino acids; and salts or combinations thereof.

[0116] A pH-dependent coating serves to release the drug in desired areas of the gastrointestinal (GI) tract, e.g., the stomach or small intestine. When a pH- independent coating is desired, the coating is designed to achieve optimal release regardless of pH-changes in the environmental fluid, e.g., the GI tract. When the coating is formulated to release a compound according to this disclosure in the intestines (especially the upper small intestines), the coating is often called an “enteric coating”. A pH-dependent coating may include, but is not limited to, acrylic acid polymers and copolymers, for example polymers formed from acrylic acid, methacrylic acid, methyl acrylate, ammonio methylacrylate, ethyl acrylate, methyl methacrylate and / or ethyl methacrylate (e.g., Eudragit™); cellulosic polymers such as hydroxypropyl cellulose, hydroxyethyl cellulose, hydroxypropyl methyl cellulose, methyl cellulose, ethyl cellulose, cellulose acetate, cellulose acetate phthalate (CAP), cellulose acetate trimellitate, hydroxypropylmethyl cellulose phthalate, hydroxypropylmethyl cellulose succinate and carboxymethylcellulose sodium; shellac (purified lac); vinyl polymers and copolymers such as polyvinyl pyrrolidone, polyvinyl acetate, polyvinylacetate phthalate (PVAP), vinylacetate crotonic acid copolymer,and ethylene-vinyl acetate copolymers; zein; and salts and combinations thereof. Oral tablets and capsules typically have coatings. VIII: Dosage Forms

[0117] Another aspect of the present disclosure encompasses a dosage form (also called “unit dose”). It refers to the end-product encompassing the pharmaceutical composition and being packaged in a form suitable to be marketed and used. Depending on the method / route of administration, dosage form may be in the form of a liquid, a solid, or a semisolid. The present disclosure provides dosage forms suitable for delivery of the therapeutic agent, such as in the forms of pills, tablets, capsules, drinks, injections, among many others. The present disclosure provides dosage forms suitable for delivery of the therapeutic agent to the designated patient groups, such as elder patients, pediatric patients, or in the forms suitable to be administered by the health care providers, and / or caregivers.

[0118] One aspect of the disclosure encompasses dosage forms of a Sigma-1 receptor agonist, or a dual modulator of Sigma-1 receptor and muscarinic receptor. In another aspect, the dosage form is an oral liquid. In yet another aspect, the dosage form is suitable to be administered to a pediatric subject.

[0119] The Sigma-1 receptor agonist used in the dosage forms disclosed in this section VIII is selected from: tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride (A2-73), tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine (A2-73 freebase), tetrahydro-N,N-dimethyl-5,5-diphenyl-3- furanmethanamine hydrochloride (A1-41); tetrahydro-N,N-dimethyl-5,5-diphenyl-3- furanmethanamine (A1-41 freebase); 1-(2,2-diphenyltetrahydrofuran-3-yl)-N- methylmethanamine hydrochloride (A19-144); 1-(2,2-diphenyltetrahydrofuran-3-yl)- N-methylmethanamine (A19-144 freebase); (1-(2,8-dimethyl- l-thia-3,8- diazaspiro(4.5)dec-3-yl)-3-(lH-indol-3-yl)propan-l-one) (A3-71); an enantiomer thereof, a crystal form thereof, a co-crystal form thereof, a pharmaceutically acceptable salt thereof, a crystal or co-crystal of the pharmaceutically acceptable salt thereof, or any combination thereof. In some embodiments the Sigma-1 receptor agonist used in the dosage forms disclosed in this section VIII is selected from: tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine in amorphous form (A2-73 freebase amorphous form); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine in crystal Form I (A2-73 Freebase Crystal Form I); tetrahydro- N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form I (A2- 73 Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form II (A2-73 Crystal Form II); tetrahydro-N,N-dimethyl-2,2- diphenyl-3-furanmethanamine hydrochloride in crystal Form III (A2-73 Crystal Form III); (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in amorphous form ((+) A2-73 amorphous form); (-) tetrahydro-N,N-dimethyl-2,2- diphenyl-3-furanmethanamine hydrochloride in amorphous form ((-) A2-73 amorphous form); (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in a crystal form ((+) A2-73 crystal form); (-) tetrahydro-N,N-dimethyl- 2,2-diphenyl-3-furanmethanamine hydrochloride in a crystal form ((-) A2-73 crystal form); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in amorphous form (A2-73 hydrogen fumarate amorphous form); tetrahydro-N,N- dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form I (A2- 73 hydrogen fumarate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrogen fumarate in crystal Form II (A2-73 hydrogen fumarate Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form III (A2-73 hydrogen fumarate Crystal Form III); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form IV (A2-73 hydrogen fumarate Crystal Form IV); tetrahydro-N,N- dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form V (A2-73 hydrogen fumarate Crystal Form V); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine mesylate in crystal Form I (A2-73 mesylate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine sulfate in crystal Form I (A2-73 sulfate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine sulfate in crystal Form II (A2-73 sulfate Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine oxalate in crystal Form I (A2-73 oxalate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine oxalate in crystal Form II (A2-73 oxalate Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine dihydrogen phosphate in crystal Form I (A2-73 dihydrogen phosphate Crystal Form I); tetrahydro-N,N- dimethyl-2,2-diphenyl-3-furanmethanamine edisylate in crystal Form I (A2-73 edisylate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanaminebenzoate in crystal Form I (A2-73 benzoate Crystal Form I); tetrahydro-N,N-dimethyl- 2,2-diphenyl-3-furanmethanamine hydrobromide in crystal Form A (A2-73 hydrobromide Crystal Form A); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrobromide in crystal Form B (A2-73 hydrobromide Crystal Form B); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine maleate in crystal Form S5 (A2-73 maleate Crystal Form S5); tetrahydro-N,N-dimethyl-2,2- diphenyl-3-furanmethanamine maleate in crystal Form S6 (A2-73 maleate Crystal Form S6); co-crystal Form CSII of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with tartaric acid (A2-73 co-crystal with tartaric acid Crystal Form CSII); co-crystal Form CSIII of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with citric acid (A2-73 co-crystal with citric acid Crystal Form CSIII); co-crystal Form CSIV of tetrahydro-N,N-dimethyl-2,2-diphenyl- 3-furanmethanamine hydrochloride with malic acid (A2-73 co-crystal with malic acid Crystal Form CSIV); a co-crystal of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with zinc chloride (A2-73 co-crystal with zinc chloride); a co-crystal of (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with zinc chloride ((-) A2-73 co-crystal with zinc chloride); a co-crystal of (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with zinc chloride ((+) A2-73 co-crystal with zinc chloride); and any combination thereof.

[0120] When such agonist is A2-73 or A2-73 Freebase, the dosage form can comprise from about 1 mg to about 50 g, from about 1 mg to about 500 mg, from about 1 mg to about 100 mg, from about 1 mg to about 500 mg, from about 50 to about 400 mg, from about 75 to about 150 mg, from about 150 to about 200 mg, from about 40 mg to about 60 mg, from about 80 mg to about 120 mg, or from about 180 mg to about 220 mg of A2-73. For instance, the dosage form can comprise 1, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, or 300 or more mg of A2-73. In some aspect, dosage forms can comprise from about 1 mg to about 500 mg, or about 1 mg to about 100 mg of A2-73.

[0121] Dosage forms include those formulated for extended or slow release, and those formulated for immediate release. For example, an immediate release dosage form may include a crystalline form of A2-73 Freebase, A2-73, a A2-73 Freebase salt as disclosed herein. For example, a fast-dissolve oral dosage form may includefor example A2-73 crystal Form I. Alternatively, a dosage form may comprise a crystalline Form I of A2-73 Freebase, or crystalline Form I of A2-73 Freebase fumarate salt formulated for inhalation drug delivery, either as a dry powder or aerosol spray.

[0122] Dosage forms also include those formulated for topical administration. For instance, a dosage form can be formulated as one or more of a gel, ointment, emulsion, microemulsion, solution, suspension, paste, gel, foam, spray, lotion, or cream. In one aspect, a topical administration dosage form is a transdermal patch. When the dosage form is formulated as a transdermal patch, the transdermal patch can contain from about 40 mg to about 60 mg, from about 80 mg to about 120 mg, or from about 180 mg to about 220 mg of A2-73 Freebase in crystalline form.

[0123] Dosage forms can alternatively be formulated for oral administration. Dosage forms formulated for oral administration can be tablets to swallow, chew, or dissolve in water or under the tongue, capsules and chewable capsules, powders, granules, teas, drops, or liquid medications or syrups. In some aspect, the dosage form is an enteric coated oral formulation.

[0124] When the dosage form is an enteric coated oral formulation, the formulation can comprise from about 0.1 mg to about 60 mg A2-73 Freebase, preferably from about 1 mg to about 50 mg A2-73 Freebase.

[0125] An enteric coated oral formulation can also contain A2-73 Freebase salt in crystalline form. The A2-73 Freebase salt can be a fumarate salt, a sulfate salt, a mesylate salt, a dihydrogen phosphate salt, an edisylate salt, a benzoate salt, a hydrochloride salt, and an oxalate salt. In one aspect, the A2-73 salt is a fumarate salt. When the A2-73 salt is a fumarate salt, the enteric coated oral formulation can comprise from about 0.1 to about 100 mg of A2-73 fumarate salt, preferably from about 1 mg to about 55 mg of A2-73 fumarate salt.

[0126] Dosage forms also encompass those formulated for subcutaneous and / or intramuscular injection. For example, an intramuscular dosage form may comprise A2-73 in the freebase form, dissolved in an oil matrix for intramuscular injection, or alternatively prepared as a suspension of the freebase for intramuscular injection. A dosage form formulated for subcutaneous or intramuscular injection may comprise A2-73 in a salt or freebase form as disclosed herein, prepared as microspheresusing methods known in the art. Alternatively, A2-73 in freebase or salt form may be coated, for example using Atomic Layer Deposition (ALD) techniques, with a thin layer coating such as a coating of zinc oxide and used in a formulation for subcutaneous or intramuscular injection. Alternatively, A2-73 freebase may be dissolved in a biodegradable polymer matrix, and then implanted subcutaneously or used in a transdermal patch.

[0127] The active pharmaceutical ingredient can in general be formulated for improving patient compliance, preventing a subject from removing the drug-delivery device. For instance, Sigma-1 receptor agonists could be formulated for improved patient compliance and preventing removal of a drug-delivery device by providing formulations for extended delivery. Extended delivery can range for periods ranging from more than one day, to months. This may be especially relevant for patients with compromised cognitive and / or motor-control abilities. Extended delivery for periods can range from about 1 day to about 1 year, from about 1 day to about 1 week, from about 3 days to about 1 month, from about 2 weeks to about 6 months, or from about 2 months to about 4 months.

[0128] Extended-release formulations could be used for substantially continuous delivery of drug at a preselected rate. For example, for crystalline A2-73, the drug can be delivered at a rate of from about 1 mg to about 100 mg / day, from about 40 to about 60 mg / day, or from about 10 to about 30 mg / day. Appropriate amounts of crystalline A2-73 can be readily determined by the ordinarily skilled artisan based upon, for example, the intended duration of administration of the drug by the extended-release formulation, the delivery mechanism, the formulation, and the relative potency of the drug among other factors. IX. Kits for Medical Uses

[0129] One aspect of the present disclosure encompasses a kit for a medical use according to any of the monitoring, evaluating, or therapy selection methods disclosed herein. A kit for such uses includes one or more containers for receiving and holding biological samples that may be taken at different points in time, and reagents for conducting gene expression analysis. For example, the kit may have a first container for receiving a first or control biological sample as used in thedisclosed methods; a second container for receiving a second or evaluate biological sample as used in the disclosed methods; and additional one or more containers for receiving and / or storing reagent(s) useful for sequencing or measuring a gene expression. Additional containers may be included to receive and store composition(s) in a safe, stable and durable way. The composition may comprise a Sigma-1 receptor agonist, such as a composition comprising A2-73 or A2-73 freebase. The kit may include an instruction in hard copy printed from or in a computer readable form, which explains the use of the kit components to perform any of the aspects, methods, and / or embodiments disclosed herein. The instruction may be written with the medical practitioner and / or the patient as the intended reader. The kit may also include any one or more gene list(s) disclosed herein for comparison of the measured gene expression(s) in the biological sample(s).

[0130] In one aspect of the present disclosure, the kit may be used for various purposes, such as selection of a therapeutic agent for a subject, monitoring effectiveness of a Sigma-1 receptor agonist therapy, identification of a subject responsive to a Sigma-1 receptor agonist therapy, or determining if a subject is having, is suspected of having, or having an increased risk for developing a disorder or a disease. Such disorder or disease may include Alzheimer’s disease, Parkinson’s disease, Parkinson’s disease with dementia, Huntington’s disease, Amyotrophic lateral sclerosis, Prion disease, Rett syndrome, cerebral palsy, Down's syndrome, Williams-Beuren syndrome, Prader-Willi syndrome, Angelman syndrome, pervasive developmental disorder not otherwise specified (PDD-NOS), childhood disintegrative disorder, Smith-Magenis syndrome, multiple sclerosis, velo-cardio-facial syndrome, ATR-X syndrome, Barth syndrome, Fragile X syndrome, ICF syndrome, Neurofibromatosis, Smith-Lemli-Opitz syndrome, an addictive disorder, Attention- deficit / hyperactivity disorder (ADHD), an anxiety disorder, Asperger's syndrome, autism spectrum disorder, an eating disorder, epilepsy, infantile spasms, fetal alcohol syndrome, hydrocephalus, manic depressive illness, mental retardation, schizophrenia, spina bifida, Tourette's syndrome, and any combination thereof. The Sigma-1 receptor agonist used in the kits disclosed in this section IX is selected from: tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride (A2- 73), tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine (A2-73 freebase), tetrahydro-N,N-dimethyl-5,5-diphenyl-3-furanmethanamine hydrochloride (A1-41);tetrahydro-N,N-dimethyl-5,5-diphenyl-3-furanmethanamine (A1-41 freebase); 1-(2,2- diphenyltetrahydrofuran-3-yl)-N-methylmethanamine hydrochloride (A19-144); 1- (2,2-diphenyltetrahydrofuran-3-yl)-N-methylmethanamine (A19-144 freebase); (1- (2,8-dimethyl- l-thia-3,8-diazaspiro(4.5)dec-3-yl)-3-(lH-indol-3-yl)propan-l-one) (A3- 71); an enantiomer thereof, a crystal form thereof, a co-crystal form thereof, a pharmaceutically acceptable salt thereof, a crystal or co-crystal of the pharmaceutically acceptable salt thereof, or any combination thereof. In some embodiments the Sigma-1 receptor agonist used in the kits disclosed in this section IX is selected from: tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine in amorphous form (A2-73 freebase amorphous form); tetrahydro-N,N-dimethyl-2,2- diphenyl-3-furanmethanamine in crystal Form I (A2-73 Freebase Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form I (A2-73 Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride in crystal Form II (A2-73 Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form III (A2-73 Crystal Form III); (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride in amorphous form ((+) A2-73 amorphous form); (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in amorphous form ((-) A2-73 amorphous form); (+) tetrahydro-N,N-dimethyl-2,2- diphenyl-3-furanmethanamine hydrochloride in a crystal form ((+) A2-73 crystal form); (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in a crystal form ((-) A2-73 crystal form); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrogen fumarate in amorphous form (A2-73 hydrogen fumarate amorphous form); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form I (A2-73 hydrogen fumarate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form II (A2-73 hydrogen fumarate Crystal Form II); tetrahydro-N,N-dimethyl- 2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form III (A2-73 hydrogen fumarate Crystal Form III); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrogen fumarate in crystal Form IV (A2-73 hydrogen fumarate Crystal Form IV); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form V (A2-73 hydrogen fumarate Crystal Form V); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine mesylate in crystal Form I (A2-73 mesylate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine sulfate in crystal Form I (A2-73 sulfate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine sulfate in crystal Form II (A2-73 sulfate Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine oxalate in crystal Form I (A2-73 oxalate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine oxalate in crystal Form II (A2-73 oxalate Crystal Form II); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine dihydrogen phosphate in crystal Form I (A2-73 dihydrogen phosphate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine edisylate in crystal Form I (A2-73 edisylate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine benzoate in crystal Form I (A2-73 benzoate Crystal Form I); tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrobromide in crystal Form A (A2-73 hydrobromide Crystal Form A); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrobromide in crystal Form B (A2-73 hydrobromide Crystal Form B); tetrahydro-N,N-dimethyl-2,2- diphenyl-3-furanmethanamine maleate in crystal Form S5 (A2-73 maleate Crystal Form S5); tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine maleate in crystal Form S6 (A2-73 maleate Crystal Form S6); co-crystal Form CSII of tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with tartaric acid (A2-73 co-crystal with tartaric acid Crystal Form CSII); co-crystal Form CSIII of tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with citric acid (A2-73 co-crystal with citric acid Crystal Form CSIII); co-crystal Form CSIV of tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with malic acid (A2-73 co-crystal with malic acid Crystal Form CSIV); a co-crystal of tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with zinc chloride (A2-73 co-crystal with zinc chloride); a co-crystal of (-) tetrahydro-N,N- dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with zinc chloride ((-) A2- 73 co-crystal with zinc chloride); a co-crystal of (+) tetrahydro-N,N-dimethyl-2,2- diphenyl-3-furanmethanamine hydrochloride with zinc chloride ((+) A2-73 co-crystal with zinc chloride); and any combination thereof. DEFINITIONS

[0131] Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which present disclosure belongs. The following references provide one of skill with ageneral definition of many of the terms used in the present disclosure: Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd ed.1994); The Cambridge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, 5th Ed., R. Rieger et al. (eds.), Springer Verlag (1991); and Hale & Marham, The Harper Collins Dictionary of Biology (1991). As used herein, the following terms have the meanings ascribed to them unless specified otherwise.

[0132] When introducing elements of the present disclosure or the preferred aspects(s) thereof, the articles "a", "an", "the" and "said" are intended to mean that there are one or more of the elements. The terms "comprising", "including" and "having" are intended to be inclusive and mean that there may be additional elements other than the listed elements.

[0133] As various changes could be made in the above-described cells and methods without departing from the scope of the present disclosure, it is intended that all matter contained in the above description and in the examples given below, shall be interpreted as illustrative and not in a limiting sense.

[0134] The term “comprising” or “comprising of” means “including, but not necessarily limited to”; it specifically indicates open-ended inclusion or membership in a so-described combination, group, series and the like. The terms “comprising”, “comprising of”, and “including” as used herein are inclusive and / or open-ended and do not exclude additional, unrecited elements or method processes. The term “consisting of” means “made up of”, and expressly includes any subtypes / derivatives under each listed member / species. The term “consisting essentially of” is more limiting than “comprising” but not as restrictive as “consisting of.” Specifically, the term “consisting essentially of” limits membership to the specified materials or items and those that do not materially affect the essential characteristics of the present disclosure.

[0135] As used herein, the term “gene” means a segment of DNA that contains the information for the regulated biosynthesis of an RNA product, including promoters, exons, introns, and other untranslated regions that control expression. As used herein, “expression” includes but is not limited to one or more of the following: transcription of the gene into precursor mRNA; splicing and other processing of the precursor mRNA to produce mature mRNA; mRNA stability; translation of the maturemRNA into protein (including codon usage and tRNA availability); and glycosylation and / or other modifications of the translation product, if required for proper expression and function.

[0136] As used herein, the term “differentially expressed gene” means a gene whose expression levels in two experimental conditions or in two samples possess statistically significant difference or change. As used herein, the terms “overrepresented” genes or gene clusters means genes from a pre-defined set are present more than expected. Similarly, the term “differential gene expression” means the expression levels of a gene in two experimental conditions or in two samples possess statistically significant difference or change. Gene expression can be detected by quantitative PCR (qPCR) technique. It monitors the amplification of a targeted DNA molecule during the PCR (i.e., in real time), not at its end, as in conventional PCR. Real-time PCR can be used quantitatively and semi-quantitatively (i.e., above / below a certain amount of DNA molecules). Gene expression can also be observed using a microarray of polynucleotides, an ELISA technique, or a Southern blotting method. As used herein, RT qPCT means Reverse transcription quantitative polymerase chain reaction, which is used to measure a gene expression level.

[0137] As used herein, the term “polynucleotide” means any RNA or DNA, which may be unmodified or modified RNA or DNA. Polynucleotides include, without limitation, single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, RNA that is mixture of single- and double-stranded regions, and hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. In addition, polynucleotide refers to triple- stranded regions comprising RNA or DNA or both RNA and DNA. The term polynucleotide also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons.

[0138] As used herein, the term “genetic polymorph” or “genetic polymorphism refers to the presence of two or more variant forms of a specific DNA sequence that can occur among different individuals or populations. Genetic polymorphism determines the diversity of individuals or populations. The most common type of genetic polymorphism involves variation at a single nucleotide (also called a single-nucleotide polymorphism, or SNP). Other polymorphisms can be much larger, involving longer stretches of DNA. Genetic polymorphisms can have a harmful effect, a beneficial effect, or no effect. Some polymorphisms have been shown to increase the risk of certain diseases or disorders.

[0139] As used herein, the term “polypeptide” means any polypeptide comprising two or more amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres. Polypeptide refers to both short chains, commonly referred to as peptides, glycopeptides or oligomers, and to longer chains, generally referred to as proteins. Polypeptides may contain amino acids other than the 20 gene-encoded amino acids. Polypeptides include amino acid sequences modified either by natural processes, such as post-translational processing, or by chemical modification techniques that are well-known in the art. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature.

[0140] As used herein, the terms “disease”, “disorder” or “dysfunction” are used interchangeably in the present disclosure. They refer to any condition, disorder or disease manifested as one or more physiological, physical and / or psychological symptoms or dysfunctions for which treatment is desirable, and includes previously and newly identified diseases, disorders or dysfunctions on any organs, tissues or biological activities. As used herein, the term “medical use” is any use or means related to restore, remedy, or preserve health or wellbeing of a subject.

[0141] As used herein, the terms “polymorph”, “polymorphic form”, “crystal”, and “crystalline” are used interchangeably and refer to an ordered solid form, wherein atoms, ions, and / or molecules are arranged and patterned in specific ways, which give rise to a specific and unique three-dimensional format. One molecule may exist in multiple crystalline forms, which may possess different physiochemical or biological properties. Different polymorphic forms of the same active pharmaceutical ingredient (API) can lead to changes in API’s solubility, dissolution rate, pharmacokinetics and ultimately its bioavailability and efficacy in therapeutic uses. Developing polymorphic forms and identifying which poly-morphic form is the most stable and / or most favorable is crucial in drug design and manufacturing.

[0142] As used herein, the terms “co-crystal” and “cocrystal” are used interchangeably and refer to solids that are crystalline, single-phase materials composed of two or more different molecular or ionic compounds generally in a specific stoichiometric ratio. In essence, a co-crystal consists of two or more components that form a unique crystalline structure and has unique properties. A co- crystal may comprise an organic compound with an acid or with an ionic salt. Widely encountered cocrystals include hydrates, solvates and clathrates. Co-crystals are often stable and possess their own physiochemical and / or biological properties different from the individual components made up the co-crystals.

[0143] As used herein, the terms “enantiomer”, “optical isomer”, or “optical antipode” are used interchangeably and refer to one of the two stereoisomers that are non-superposable on-to their own mirror image, due to the chirality of the carbon atom. No amount of re-orientation of a molecule as a whole or conformational change converts one chemical into its enantiomer. Chemical structures with chirality rotate plane-polarized light. There-fore, an enantiomer can be expressed as (-) or (+) form, indicating the direction of the optical rotation. There are three common naming conventions for specifying one of the two enantiomers (the absolute configuration) of a given chiral molecule: the R / S system is based on the geometry of the molecule; the (+)- and (−)- system is based on its optical rotation properties; and the D / L system is based on the molecule's relationship to enantiomers of glyceraldehyde. When a molecule is denoted dextrorotatory, it rotates the plane of polarized light clockwise and can also be denoted as (+). When it is denoted as levorotatory, it rotates the plane of polarized light counterclockwise and can also be denoted as (−). A mixture of equal amounts of each enantiomer, called “a racemic mixture” or a “racemate”, does not rotate light. The two enantiomers of the same molecule may have different physiochemical or biological properties, imparting difference in solubility, dissolution rate, pharmacokinetics and ultimately bioavailability. Additionally, one enantiomer may have different crystal structures, i.e. polymorphs. And one enantiomer may form co-crystal with other compounds or molecules. Stereoisomers include both enantiomers and diastereomers. Diastereomers, like enantiomers, share the same molecular formula and are also non-superposable onto each other; however, they are not mirror images of each other.

[0144] As used herein, the term “subject” means that preferably the subject is a mammal, such as a human, but can also be an animal, e.g., domestic animals (e.g., dogs, cats and the like), farm animals (e.g., cows, sheep, pigs, horses and the like) and laboratory animals (e.g., cynomolgus monkey, rats, mice, guinea pigs and the like). When the subject is a human, it expressly encompasses any age, gender, or race of human, such as infant, children, teen, adult, or senior.

[0145] As used herein, the administration of an agent or drug to a subject or patient includes self-administration and the administration by another. It is also to be appreciated that the various modes of treatment or prevention of medical conditions as described are intended to mean “substantial”, which includes total but also less than total treatment or prevention, and wherein some biologically or medically relevant result is achieved.

[0146] The publications discussed above are provided solely for their disclosure before the filing date of the present application. Nothing herein is to be construed as an admission that the present disclosure is not entitled to antedate such disclosure by virtue of prior disclosure. EXAMPLES

[0147] The following examples are included to demonstrate the disclosure. It should be appreciated by those of skill in the art that the techniques disclosed in the following examples represent techniques discovered by the inventors to function well in the practice of the disclosure. Those of skill in the art should, however, in light of the present disclosure, appreciate that many changes could be made in the disclosure and still obtain a like or similar result without departing from the spirit and scope of the disclosure, therefore all matter set forth is to be interpreted as illustrative and not in a limiting sense. Example 1. Study Design on Surrogate Biomarkers

[0148] ANAVEX®2-73 (blarcamesine or “A2-73”), an agonist of Sigma-1 receptor (SIGMAR1), has shown therapeutic effects against Alzheimer’s disease, Parkinson’sdisease, Parkinson’s disease with dementia, Rett Syndrome, and other neurological diseases.

[0149] The therapeutic efficacy of ANAVEX 2-73 was measured in the clinic with physiological endpoints for different neurological diseases. These endpoints were different for Alzheimer’s, Rett Syndrome and Parkinson’s. Some measure physical parameters in patients, while others measure cognitive behaviors. These endpoints measure both the pathology of each disease as well as the therapeutic response to ANAVEX 2-73. A surrogate biomarker for therapeutic response to ANAVEX 2-73 will simplify the design of clinical trials for each of these indications, replacing the inherent analytical variability of the endpoint measurements for these diseases, as well as the length and size of these clinical trials. This surrogate may also be applicable across other clinical indications for ANAVEX 2-73.

[0150] In order to identify such surrogate biomarker, gene expression levels were monitored on preliminary surrogate candidates for the therapeutic effect of ANAVEX 2-73 by first selecting 100 top candidates (listed in TABLE 1) for RNAseq data from a Parkinson’s study for ANAVEX 2-73. Patients used in this study were summarized in FIG.1. RT qPCR differential gene expression primers were designed for each of these preliminary surrogate candidate genes. SEQ ID NO.: 1 provides sequence of forward primer for REM2; and SEQ ID NO.: 2 provides sequence of reverse primer for REM2. The viability of each gene as a surrogate for ANAVEX 2-73 was tested in a set of samples from an independent Rett syndrome clinical study which included placebo responders and non-responders, as well as ANAVEX 2-73 responders and non-responders. Differential gene expression results for each gene were determined from RT qPCR results for each validated primer pair designed for each surrogate gene candidate against patient samples from a Rett syndrome study.TABLE 1: Genes Tested as Surrogate Candidate Genes for ANAVEX 2-73Example 2. Results on Surrogate Biomarkers

[0151] The testing results for selected genes were summarized in FIG.2A. FIG. 2B showed gene expression changes of various genes before and after treatment with ANAVEX® 2-73. FIG.2C specifically showed that REM2 is differentially expressed triggered by treatment with ANAVEX® 2-73. Statistical analysis showed that REM2 differential gene expression were statistically significant for the application of this gene as a surrogate for ANAVEX® 2-73 treatment effects. Therefore, the differential gene expression of REM2 was identified as a potential ANAVEX® 2-73ANAVEX 2-73 surrogate for multiple neurological indications. SEQ ID NO.: 1 – Sequence of REM2-F – sequence of forward primer for REM2: AACCGGAGAACCCAGAGGATAC SEQ ID NO.: 2 - Sequence REM2-R – sequence of reverse primer for REM2: CCCTGTTCCCAGATGTCATAAACGExample 3. Studies on Rett Syndrome

[0152] ANAVEX Life Sciences Corp designed and completed ANAVEX®2-73-RS- 002 AVATAR Rett syndrome trial. AVATAR study was a randomized, placebo- controlled clinical trial in 33 patients with Rett syndrome which included pre-specified biomarkers of response as well as Whole Exome Sequencing (WES) DNA data and full RNA exome expression (RNA-seq) data collection. This was the first entire clinical gene pathway analysis by comparing treatment group (administering ANAVEX®2-73) and placebo in patients with Rett syndrome, including analysis of gene expression changes in each treatment group as well as analysis of the impact of single nucleotide polymorphisms / variants (SNPs / SNVs) on treatment response.

[0153] ANAVEX®2-73 transcriptomics analysis (RNAseq) identified gene networks that were differentially expressed in Rett syndrome patients treated with ANAVEX®2-73 compared to placebo. Patient samples were analyzed based on over 20 million unique reads in both placebo and ANAVEX®2-73 treated patients. Biological relevance of this pool of genes was assessed through pathway analysis and confirmed the impact of ANAVEX®2-73 treatment on pathways involved in neurodevelopmental diseases.

[0154] The results highlighted many significant differences between active treatment group and placebo, such as the differential expression of several genes in response to ANAVEX®2-73 treatment as shown in the heatmap FIG.3. In the heatmap, each column represented a different patient, and each row represented a gene of the patient. A total of 18 patients underwent ANAVEX® 2-73 treatment, and 11 patients were placebo. Z-scores were used to compare the expression of a gene in a sample against its average expression across all samples. A positive z-score (read) indicated expression above the mean, while a negative z-score (blue) indicated expression below the mean. Gene-list in the heatmap was sorted based on the signal to noise (S / N) ratio. Genes detected and found to have been differentially expressed included RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and any combination thereof. Pathway analysis of the differentially expressed genes suggested ANAVEX®2-73 may, among other functions, correct metabolic pathway alterations in patients with Rett syndrome through enhanced mitochondrial energy productionand / or increased expression of genes involved in oxidative phosphorylation, fatty acid metabolism, developmental signaling pathways, transcription / translation, membrane trafficking, and branched-chain amino acid catabolism as shown in TABLE 2. The metabolic pathway comprised oxidative phosphorylation, fatty acid metabolism, fatty acid beta-oxidation, adipogenesis, amino acid catabolism, mitochondrial protein import, valine leucine and isoleucine degradation, cysteine and methionine metabolism, acyl chain remodeling of phosphatidylserine or phosphatidylethanolamine, deubiquitination, detoxification of reactive oxygen species, N-glycan trimming, xylulose-5-phosphate formation, glycerophospholipid metabolism, or any combination thereof.

[0155] The results confirmed that Rett syndrome was indeed a neurodevelopmental disorder with a key metabolic component, which can be addressed with a therapeutic intervention, such as ANAVEX®2-73, and was likely relevant for other neurodevelopmental disease indications. The scope of these detected gene expression changes identified through ANAVEX®2-73 intervention represented additional potential biomarkers of disease pathology and response. The results represented an extensive transcriptomics analysis (RNAseq) of a therapeutic agent in patients with Rett syndrome and such results indicated a Precision Medicine potential for Rett syndrome with the ability to compensate for expression levels of dysregulated developmental and metabolic genes, apparent within the Rett syndrome pathology. The results further demonstrated a steady progress toward improved understanding on Rett Syndrome. The results also deepened the understanding of the underlying signaling pathways involved in response to ANAVEX®2-73 treatment in patients with Rett syndrome.TABLE 2: A2-73 Enriched Pathways

Claims

WHAT IS CLAIMED IS:

1. A method of selecting a therapeutic agent for a subject, the method comprising the steps of: (a) obtaining or having obtained a differential gene expression profile for the subject, wherein the differential gene expression profile comprises a comparison of a first gene expression profile derived from a first biological sample from the subject before administration of the therapeutic agent to the subject, and a second gene expression profile derived from a second biological sample from the subject after a period of administration time of the therapeutic agent to the subject; (b) identifying any differentially expressed gene and / or overrepresented gene cluster from the comparison of the first and second gene expression profiles in (a); (c) selecting a Sigma-1 receptor agonist as the therapeutic agent for the subject, if the identified differentially expressed gene is listed in a gene list comprising REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, and LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, and ACAT1, or the identified overrepresented gene cluster overlaps with any gene in the gene list; and (e) administering the Sigma-1 receptor agonist to the subject if the identified differentially expressed gene is listed in the gene list or if the identified overrepresented gene cluster overlaps with any gene in the gene list.

2. A method of monitoring efficacy of a Sigma-1 receptor agonist therapy administered to a subject for a treatment period to treat a neurodevelopmental disorder in the subject, the method comprising the steps of: a. obtaining or having obtained a test biological sample from the subject at the end of the treatment period; b. determining a test gene expression profile from the test biological sample, wherein the test gene expression profile comprises a test list of genes detected in the test biological sample and their expression levels; c. comparing the test gene expression profile with a predetermined control gene expression profile to identify differentially expressed genes, whereinthe predetermined control gene expression profile comprises a control list of genes detected in a control biological sample obtained from the subject before the treatment period and their expression levels; wherein the differentially expressed genes comprises genes detected both in the test list and in the control list but having different expression levels in the test biological sample from that in the control biological sample; and d. confirming the efficacy of the Sigma-1 receptor agonist therapy if the identified differentially expressed gene(s) is listed in a gene list comprising REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and any combination thereof; or denying the efficacy of the Sigma-1 receptor agonist therapy if no differentially expressed gene(s) are identified or differentially expressed gene(s) do not comprise any gene(s) listed in the gene list.

3. The method of claim 2, wherein the method further comprises: (e) if the efficacy of the Sigma-1 receptor agonist therapy is confirmed in step (d), continuing the Sigma-1 receptor agonist therapy; or if the efficacy of the Sigma-1 receptor agonist therapy is not confirmed in step (d), taking one or more of the following steps: (i) switching the subject to another Sigma-1 receptor agonist; (ii) switching the subject to another neurodevelopmental drug therapy; and / or (iii) switching the subject to a combination therapy comprising the Sigma-1 receptor agonist.

4. The method of any one of claims 1 to 3, wherein the sigma-1 receptor agonist is selected from: tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride (A2- 73),tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine (A2-73 freebase), tetrahydro-N,N-dimethyl-5,5-diphenyl-3-furanmethanamine hydrochloride (A1- 41); tetrahydro-N,N-dimethyl-5,5-diphenyl-3-furanmethanamine (A1-41 freebase); 1-(2,2-diphenyltetrahydrofuran-3-yl)-N-methylmethanamine hydrochloride (A19-144); 1-(2,2-diphenyltetrahydrofuran-3-yl)-N-methylmethanamine (A19-144 freebase); (1-(2,8-dimethyl- l-thia-3,8-diazaspiro(4.5)dec-3-yl)-3-(lH-indol-3-yl)propan-l- one) (A3-71); an enantiomer thereof, a crystal form thereof, a co-crystal form thereof, a pharmaceutically acceptable salt thereof, a crystal or co-crystal of the pharmaceutically acceptable salt thereof, and any combination thereof.

5. The method of any one of claims 1 to 4, wherein the Sigma-1 receptor agonist is selected from: tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine in amorphous form; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form II; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form III; (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in amorphous form; (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in amorphous form; (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in a crystal form; (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in a crystal form;tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in amorphous form; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form II; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form III; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form IV; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form V; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine mesylate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine sulfate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine sulfate in crystal Form II; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine oxalate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine oxalate in crystal Form II; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine dihydrogen phosphate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine edisylate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine benzoate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrobromide in crystal Form A; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrobromide in crystal Form B; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine maleate in crystal Form S5;tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine maleate in crystal Form S6; co-crystal Form CSII of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with tartaric acid; co-crystal Form CSIII of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with citric acid; co-crystal Form CSIV of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with malic acid; a co-crystal of tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with zinc chloride; a co-crystal of (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with zinc chloride; a co-crystal of (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with zinc chloride; and any combination thereof.

6. The method of any one of claims 1 to 5, wherein the administering comprises a route of administration selected from the group consisting of oral administration, subcutaneous injection, intravenous injection, intraocular injection, intradermal injection, intramuscular injection, intraperitoneal injection, intratracheal administration, inhalation, intranasal administration, sublingual administration, buccal administration, rectal administration, vaginal administration, and topical administration.

7. The method of any one of claims 1 to 6, wherein the treatment period is about 12 weeks or less.

8. The method of any one of claims 1 to 7, wherein the treatment period is about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks.

9. The method of any preceding claim, wherein the Sigma-1 receptor agonist is administered daily.

10. The method of any preceding claim, wherein the Sigma-1 receptor agonist is tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine in crystal Form I.

11. The method of any preceding claim, wherein the Sigma-1 receptor agonist is tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in Crystal Form I.

12. The method of any preceding claim, wherein the Sigma-1 receptor agonist is administered daily in an amount of about 10 mg to about 60 mg.

13. The method of any preceding claim, wherein the Sigma-1 receptor agonist is administered in an oral liquid comprising up to about 30 mg of the Sigma-1 receptor agonist.

14. The method of any preceding claim, wherein the Sigma-1 receptor agonist comprises tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine or tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in an oral solution, and wherein the tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine or the tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride is administered once daily for a period of 12 weeks in an escalating dose regimen starting at about 30 mg and ending at about 50 mg.

15. The method of any preceding claim, wherein the neurological disease or disorder comprises Alzheimer’s disease, Parkinson’s disease, Parkinson’s disease with dementia, Huntington’s disease, Amyotrophic lateral sclerosis, Prion disease, Rett syndrome, cerebral palsy, Down's syndrome, Williams- Beuren syndrome, Prader-Willi syndrome, Angelman syndrome, pervasive developmental disorder not otherwise specified (PDD-NOS), childhood disintegrative disorder, Smith-Magenis syndrome, multiple sclerosis, velo- cardio-facial syndrome, ATR-X syndrome, Barth syndrome, Fragile X syndrome, ICF syndrome, Neurofibromatosis, Smith-Lemli-Opitz syndrome, an addictive disorder, Attention-deficit / hyperactivity disorder (ADHD), an anxiety disorder, Asperger's syndrome, autism spectrum disorder, an eatingdisorder, epilepsy, infantile spasms, fetal alcohol syndrome, hydrocephalus, manic depressive illness, mental retardation, schizophrenia, spina bifida, Tourette's syndrome, and any combination thereof..

16. The method of claim 1, wherein the neurological disease or disorder is Rett Syndrome or Fragile X Syndrome.

17. The method of any preceding claim, wherein the subject is a pediatric human patient, a teenage human patient, or an adult human patient.

18. The method of any preceding claim, wherein the test biological sample or the control biological sample each independently comprises a blood serum sample, a blood plasma sample, or a sample suitable for transcriptomic analysis.

19. The method of any preceding claim, wherein the test biological sample and the control biological sample are the same type of biological samples.

20. The method of any preceding claim, wherein the test biological sample and the control biological sample are different types of biological samples.

21. A method of treating a neurological disease or disorder in a subject in need thereof by administering a Sigma-1 receptor agonist to the subject, the method comprising the steps of: a. obtaining or having obtained a test biological sample from the subject at the end of a treatment period; b. determining a test gene expression profile from the test biological sample, wherein the test gene expression profile comprises a test list of genes detected in the test biological sample and their expression levels; c. comparing the test gene expression profile with a predetermined control gene expression profile to identify differentially expressed genes, wherein the predetermined control gene expression profile comprises a control list of genes detected in a control biological sample obtained from the subject at the beginning of the treatment period; and their expression levels; wherein the differentially expressed genes comprises genes detected bothin the test list and in the control list but having different expression levels in the test biological sample from that in the control biological sample; and d. continuing the treatment with the Sigma-1 receptor agonist if the identified differentially expressed gene(s) is listed in a gene list comprising REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof; or discontinuing the treatment with the Sigma-1 receptor agonist if NO differentially expressed gene is identified, or the identified differentially expressed genes do not comprise any gene(s) listed in the gene list.

22. The method of claim 21, wherein if the Sigma-1 receptor agonist is discontinued in step (d), the method further comprises: (i) switching the subject to another Sigma-1 receptor agonist; (ii) switching the subject to another neurodevelopmental drug therapy; and / or (iii) switching the subject to a combination therapy comprising the Sigma-1 receptor agonist.

23. The method of claim 21, wherein the administering comprises a route of administration selected from the group consisting of oral administration, subcutaneous injection, intravenous injection, intraocular injection, intradermal injection, intramuscular injection, intraperitoneal injection, intratracheal administration, inhalation, intranasal administration, sublingual administration, buccal administration, rectal administration, vaginal administration, and topical administration.

24. The method of any one of claims 21 to 23, wherein the Sigma-1 receptor agonist is selected from:tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride (A2- 73), tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine (A2-73 freebase), tetrahydro-N,N-dimethyl-5,5-diphenyl-3-furanmethanamine hydrochloride (A1- 41); tetrahydro-N,N-dimethyl-5,5-diphenyl-3-furanmethanamine (A1-41 freebase); 1-(2,2-diphenyltetrahydrofuran-3-yl)-N-methylmethanamine hydrochloride (A19-144); 1-(2,2-diphenyltetrahydrofuran-3-yl)-N-methylmethanamine (A19-144 freebase); (1-(2,8-dimethyl- l-thia-3,8-diazaspiro(4.5)dec-3-yl)-3-(lH-indol-3-yl)propan-l- one) (A3-71); an enantiomer thereof, a crystal form thereof, a co-crystal form thereof, a pharmaceutically acceptable salt thereof, a crystal or co-crystal of the pharmaceutically acceptable salt thereof, and any combination thereof.

25. The method of any one of claims 21 to 24, wherein the Sigma-1 agonist is selected from: tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine in amorphous form; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form II; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form III; (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in amorphous form; (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in amorphous form; (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in a crystal form;Ĩ-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in a crystal form; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in amorphous form; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form II; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form III; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form IV; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form V; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine mesylate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine sulfate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine sulfate in crystal Form II; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine oxalate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine oxalate in crystal Form II; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine dihydrogen phosphate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine edisylate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine benzoate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrobromide in crystal Form A; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrobromide in crystal Form B;tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine maleate in crystal Form S5; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine maleate in crystal Form S6; co-crystal Form CSII of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with tartaric acid; co-crystal Form CSIII of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with citric acid; co-crystal Form CSIV of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with malic acid; a co-crystal of tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with zinc chloride; a co-crystal of (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with zinc chloride; a co-crystal of (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with zinc chloride; and any combination thereof.

26. The method of any one of claims 21 to 25, wherein the treatment period is 12 weeks or less.

27. The method of any one of claims 21 to 26, wherein the treatment period is about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks.

28. The method of any one of claims 21 to 27, wherein the Sigma-1 receptor agonist is administered daily.

29. The method any one of claims 21 to 28, wherein the Sigma-1 receptor agonist is tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine in crystal Form I.

30. The method of any one of claims 21 to 28, wherein the Sigma-1 receptor agonist is tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form I.

31. The method of any one of claims 21 to 30, wherein the Sigma-1 receptor agonist is administered once daily in an amount of about 10 mg to about 60 mg.

32. The method of any one of claims 21 to 31, wherein the Sigma-1 receptor agonist is administered as an oral liquid comprising up to about 30 mg of the Sigma-1 receptor agonist.

33. The method of any one of claims 21 to 32, wherein the Sigma-1 receptor agonist comprises tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine or tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in an oral solution, and wherein the tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine or the tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride is administered once daily for a period of 12 weeks in an escalating dose regimen starting at about 30 mg and ending at about 50 mg.

34. The method of any one of claims 21 to 33, wherein the neurological disease or disorder comprises Alzheimer’s disease, Parkinson’s disease, Parkinson’s disease with dementia, Huntington’s disease, Amyotrophic lateral sclerosis, Prion disease, Rett syndrome, cerebral palsy, Down's syndrome, Williams- Beuren syndrome, Prader-Willi syndrome, Angelman syndrome, pervasive developmental disorder not otherwise specified (PDD-NOS), childhood disintegrative disorder, Smith-Magenis syndrome, multiple sclerosis, velo- cardio-facial syndrome, ATR-X syndrome, Barth syndrome, Fragile X syndrome, ICF syndrome, Neurofibromatosis, Smith-Lemli-Opitz syndrome, an addictive disorder, Attention-deficit / hyperactivity disorder (ADHD), an anxiety disorder, Asperger's syndrome, autism spectrum disorder, an eating disorder, epilepsy, infantile spasms, fetal alcohol syndrome, hydrocephalus,manic depressive illness, mental retardation, schizophrenia, spina bifida, Tourette's syndrome, and any combination thereof.

35. The method of any one of claims 21 to 34, wherein the neurological disease or disorder is Rett Syndrome.

36. The method of any one of claims 21 to 35, wherein the neurological disease or disorder is Fragile X Syndrome.

37. The method of any one of claims 21 to 36, wherein the subject is a pediatric human patient, a teenager human patient, or an adult human patient.

38. The method of any one of claims 21 to 37, wherein the test biological sample or the control biological sample each independently comprises a blood serum sample, a blood plasma sample, or a sample suitable for transcriptomic analysis.

39. The method of any one of claims 21 to 38, wherein the test biological sample and the control biological sample are the same type of biological samples.

40. The method of any one of claims 21 to 38, wherein the test biological sample and the control biological sample are different types of biological samples.

41. A method of selecting a Sigma-1 receptor agonist for a subject in treating a neurological disease or disorder in the subject in need thereof, the method comprising the steps of: a. administering the Sigma-1 receptor agonist to the subject for a treatment period; b. obtaining a test biological sample from the subject at the end of the treatment period; c. determining a test gene expression profile from the test biological sample, wherein the test gene expression profile comprises a test list of genes detected in the test biological sample and their expression levels; d. comparing the test gene expression profile with a predetermined control gene expression profile to identify differentially expressed genes, whereinthe predetermined control gene expression profile comprises a control list of genes detected in a control biological sample obtained from the subject at the beginning of the treatment period and their expression levels; wherein the differentially expressed genes comprises genes detected both in the test list and in the control list but having different expression levels in the test biological sample from that in the control biological sample; and e. selecting the Sigma-1 receptor agonist for the subject if the identified differentially expressed gene(s) is listed in a gene list comprising REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof; or rejecting the Sigma-1 receptor agonist for the subject if no differentially expressed gene(s) is identified, or the identified differentially expressed gene(s) do not comprise any gene(s) listed in the gene list.

42. The method of claim 41, wherein if the Sigma-1 receptor agonist is rejected in (e), the method further comprises: (i). switching the subject to another Sigma-1 receptor agonist; (ii). switching the subject to another neurodevelopmental drug therapy; or (iii). switching the subject to a combination therapy comprising the Sigma-1 receptor agonist.

43. The method of claim 40, wherein the neurological disease or disorder comprises Alzheimer’s disease, Parkinson’s disease, Parkinson’s disease with dementia, Huntington’s disease, Amyotrophic lateral sclerosis, Prion disease, Rett syndrome, cerebral palsy, Down's syndrome, Williams-Beuren syndrome, Prader-Willi syndrome, Angelman syndrome, pervasive developmental disorder not otherwise specified (PDD-NOS), childhood disintegrative disorder, Smith-Magenis syndrome, multiple sclerosis, velo-cardio-facial syndrome, ATR-X syndrome, Barth syndrome, Fragile X syndrome, ICF syndrome, Neurofibromatosis, Smith-Lemli-Opitz syndrome, an addictive disorder, Attention-deficit / hyperactivity disorder (ADHD), an anxiety disorder, Asperger's syndrome, autism spectrum disorder, an eating disorder, epilepsy, infantile spasms, fetal alcohol syndrome, hydrocephalus, manic depressive illness, mental retardation, schizophrenia, spina bifida, Tourette's syndrome, and any combination thereof.

44. The method of any one of claims 41 to 43, wherein the treating comprises administering the Sigma-1 receptor agonist through a route selected from the group consisting of oral administration, subcutaneous injection, intravenous injection, intraocular injection, intradermal injection, intramuscular injection, intraperitoneal injection, intratracheal administration, inhalation, intranasal administration, sublingual administration, buccal administration, rectal administration, vaginal administration, and topical administration.

45. The method of any one of claims 41 to 44, wherein the Sigma-1 receptor agonist is selected from: tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride (A2- 73), tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine (A2-73 freebase), tetrahydro-N,N-dimethyl-5,5-diphenyl-3-furanmethanamine hydrochloride (A1- 41); tetrahydro-N,N-dimethyl-5,5-diphenyl-3-furanmethanamine (A1-41 freebase); 1-(2,2-diphenyltetrahydrofuran-3-yl)-N-methylmethanamine hydrochloride (A19-144); 1-(2,2-diphenyltetrahydrofuran-3-yl)-N-methylmethanamine (A19-144 freebase); (1-(2,8-dimethyl- l-thia-3,8-diazaspiro(4.5)dec-3-yl)-3-(lH-indol-3-yl)propan-l- one) (A3-71); an enantiomer thereof, a crystal form thereof, a co-crystal form thereof, a pharmaceutically acceptable salt thereof, a crystal or co-crystal of the pharmaceutically acceptable salt thereof, or any combination thereof.

46. The method of any one of claims 41 to 45, wherein the Sigma-1 agonist is selected from: tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine in amorphous form; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form II; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form III; (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in amorphous form; (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in amorphous form; (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in a crystal form; (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in a crystal form; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in amorphous form; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form II; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form III; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form IV; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form V; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine mesylate in crystal Form I;tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine sulfate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine sulfate in crystal Form II; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine oxalate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine oxalate in crystal Form II; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine dihydrogen phosphate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine edisylate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine benzoate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrobromide in crystal Form A; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrobromide in crystal Form B; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine maleate in crystal Form S5; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine maleate in crystal Form S6; co-crystal Form CSII of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with tartaric acid; co-crystal Form CSIII of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with citric acid; co-crystal Form CSIV of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with malic acid; a co-crystal of tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with zinc chloride; a co-crystal of (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with zinc chloride; a co-crystal of (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with zinc chloride; andany combination thereof.

47. The method of any one of claims 41 to 46, wherein the treatment period is 12 weeks or less.

48. The method of any one of claims 41 to 47, wherein the treatment period is about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks.

49. The method of any one of claims 41 to 48, wherein the Sigma-1 receptor agonist is administered daily.

50. The method of any one of claims 41 to 49, wherein the Sigma-1 receptor agonist is tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine in crystal Form I.

51. The method any one of claims 41 to 49, wherein the Sigma-1 receptor agonist is tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form I.

52. The method of any one of claims 41 to 51, wherein the Sigma-1 receptor agonist is administered daily in an amount of about 10 mg to about 60 mg.

53. The method of any one of claims 41 to 52, wherein the Sigma-1 receptor agonist is administered in an oral liquid comprising up to about 30 mg of the Sigma-1 receptor agonist.

54. The method of any one of claims 41 to 53, wherein the Sigma-1 receptor agonist comprises tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine or tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in an oral solution, and wherein the tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine or the tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride is administered once daily for a period of 12weeks in an escalating dosage regimen starting at about 30 mg and ending at about 50 mg.

55. The method of any one of claims 41 to 54, wherein the neurological disease or disorder is Rett Syndrome.

56. The method of any one of claims 41 to 54, wherein the neurological disease or disorder is Fragile X Syndrome.

57. The method of any one of claims 41 to 56, wherein the subject is a pediatric human patient, a teenager human patient, or an adult human patient.

58. The method of any one of claims 41 to 57, wherein the test biological sample or the control biological sample each independently comprises a blood serum sample, a blood plasma sample, or a sample suitable for transcriptomic analysis.

59. The method of any one of claims 41 to 58, wherein the test biological sample and the control biological sample are the same type of biological samples.

60. The method of any one of claims 41 to 58, wherein the test biological sample and the control biological sample are different types of biological samples.

61. A method of using a differentially expressed gene in a subject as a surrogate endpoint for the subject in a trial of a Sigma-1 receptor agonist administered to the subject, the method comprising: a. obtaining or having obtained a differentially expressed gene from the subject, wherein the differentially expressed gene comprises a gene having different expression levels before the trial and at the end of the trial; and b. labeling the subject as meeting the surrogate endpoint if the obtained differentially expressed gene(s) is listed in a gene list comprising REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9,TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof.

62. The method of claim 61, wherein the trial is an interventional clinical trial against a neurological disease or disorder.

63. The method of claim 61 or 62, wherein the sigma-1 receptor agonist is selected from: tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride (A2- 73), tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine (A2-73 freebase), tetrahydro-N,N-dimethyl-5,5-diphenyl-3-furanmethanamine hydrochloride (A1- 41); tetrahydro-N,N-dimethyl-5,5-diphenyl-3-furanmethanamine (A1-41 freebase); 1-(2,2-diphenyltetrahydrofuran-3-yl)-N-methylmethanamine hydrochloride (A19-144); 1-(2,2-diphenyltetrahydrofuran-3-yl)-N-methylmethanamine (A19-144 freebase); (1-(2,8-dimethyl- l-thia-3,8-diazaspiro(4.5)dec-3-yl)-3-(lH-indol-3-yl)propan-l- one) (A3-71); an enantiomer thereof, a crystal form thereof, a co-crystal form thereof, a pharmaceutically acceptable salt thereof, a crystal or co-crystal of the pharmaceutically acceptable salt thereof, or any combination thereof.

64. The method of any one of claims 61 to 63, wherein the Sigma-1 receptor agonist is selected from: tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine in amorphous form; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form II; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form III;(+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in amorphous form; (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in amorphous form; (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in a crystal form; (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in a crystal form; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in amorphous form; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form II; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form III; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form IV; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form V; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine mesylate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine sulfate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine sulfate in crystal Form II; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine oxalate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine oxalate in crystal Form II; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine dihydrogen phosphate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine edisylate in crystal Form I;tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine benzoate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrobromide in crystal Form A; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrobromide in crystal Form B; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine maleate in crystal Form S5; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine maleate in crystal Form S6; co-crystal Form CSII of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with tartaric acid; co-crystal Form CSIII of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with citric acid; co-crystal Form CSIV of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with malic acid; a co-crystal of tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with zinc chloride; a co-crystal of (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with zinc chloride; a co-crystal of (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with zinc chloride; and any combination thereof.

65. The method of any one of claims 61 to 64, wherein the administering comprises a route of administration selected from the group consisting of oral administration, subcutaneous injection, intravenous injection, intraocular injection, intradermal injection, intramuscular injection, intraperitoneal injection, intratracheal administration, inhalation, intranasal administration, sublingual administration, buccal administration, rectal administration, vaginal administration, and topical administration.

66. The method of any one of claims 61 to 65, wherein the trial period is about 12 weeks or less.

67. The method of any one of claims 61 to 66, wherein the trial period is about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks.

68. The method of any one of claims 61 to 67, wherein the Sigma-1 receptor agonist is administered daily.

69. The method of any one of claims 61 to 68, wherein the Sigma-1 receptor agonist is tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine in crystal Form I.

70. The method of any one of claims 61 to 68, wherein the Sigma-1 receptor agonist is tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form I.

71. The method of any one of claims 61 to 70, wherein the Sigma-1 receptor agonist is administered daily in an amount of about 10 mg to about 60 mg.

72. The method of any one of claims 61 to 71, wherein the Sigma-1 receptor agonist is administered in an oral liquid comprising up to about 30 mg of the Sigma-1 receptor agonist.

73. The method of any one of claims 61 to 72, wherein the Sigma-1 receptor agonist comprises tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine or tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in an oral solution, and wherein the tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine or the tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride is administered once daily for a period of 12 weeks in an escalating dose regimen starting at about 30 mg and ending at about 50 mg.

74. The method of any one of claims 61 to 73, wherein the neurological disease or disorder comprises Alzheimer’s disease, Parkinson’s disease, Parkinson’sdisease with dementia, Huntington’s disease, Amyotrophic lateral sclerosis, Prion disease, Rett syndrome, cerebral palsy, Down's syndrome, Williams- Beuren syndrome, Prader-Willi syndrome, Angelman syndrome, pervasive developmental disorder not otherwise specified (PDD-NOS), childhood disintegrative disorder, Smith-Magenis syndrome, multiple sclerosis, velo- cardio-facial syndrome, ATR-X syndrome, Barth syndrome, Fragile X syndrome, ICF syndrome, Neurofibromatosis, Smith-Lemli-Opitz syndrome, an addictive disorder, Attention-deficit / hyperactivity disorder (ADHD), an anxiety disorder, Asperger's syndrome, autism spectrum disorder, an eating disorder, epilepsy, infantile spasms, fetal alcohol syndrome, hydrocephalus, manic depressive illness, mental retardation, schizophrenia, spina bifida, Tourette's syndrome, and any combination thereof..

75. The method of any one of claims 61 to 74, wherein the neurodevelopmental disorder is Rett Syndrome.

76. The method of any one of claims 61 to 75, wherein the neurodevelopmental disorder is Fragile-X Syndrome.

77. The method of any one of claims 61 to 76, wherein the subject is a pediatric human patient, a teenager human patient, or an adult human patient.

78. The method of any one of claims 61 to 77, wherein the test biological sample or the control biological sample each independently comprises a blood serum sample, a blood plasma sample, or a sample suitable for transcriptomic analysis.

79. The method of any one of claims 61 to 78, wherein the test biological sample and the control biological sample are the same type of biological samples.

80. The method of any one of claims 61 to 78, wherein the test biological sample and the control biological sample are different types of biological samples.

81. A method of using a Sigma-1 receptor agonist in assessing a disease risk in a subject, the method comprising the steps of:a. administering the Sigma-1 receptor agonist to the subject for an assessment period; b. identifying a differentially expressed gene by comparing the gene expression level in the test biological sample obtained from the subject at the end of the assessment period with the gene expression level in the control biological sample obtained from the subject before the assessment period; and c. assessing the subject having a high risk of the disease, if any of the identified differentially expressed gene(s) is listed in a gene list comprising REM2, BCL6, ARHGAP27, CSF3R, DENND3, KLHL2, LBR, LILRB3, LRRK2, RASGRP3, NOCT, MSTO1, AGK, SLC20A2, COX7B, GRAPL, IRAK1BP1, MRPL48, COX7A2L ANK3, GOT2, PSMC1, NDUFA9, TIMM17A, AUH, ENGASE, NDUFA5, MRPS15, CPT1A, TIMM22, ACAT1, and / or any combination thereof; and wherein the disease comprises Alzheimer’s disease, Parkinson’s disease, Parkinson’s disease with dementia, Huntington’s disease, Amyotrophic lateral sclerosis, Prion disease, Rett syndrome, cerebral palsy, Down's syndrome, Williams-Beuren syndrome, Prader-Willi syndrome, Angelman syndrome, pervasive developmental disorder not otherwise specified (PDD-NOS), childhood disintegrative disorder, Smith-Magenis syndrome, multiple sclerosis, velo-cardio-facial syndrome, ATR-X syndrome, Barth syndrome, Fragile X syndrome, ICF syndrome, Neurofibromatosis, Smith-Lemli-Opitz syndrome, an addictive disorder, Attention-deficit / hyperactivity disorder (ADHD), an anxiety disorder, Asperger's syndrome, autism spectrum disorder, an eating disorder, epilepsy, infantile spasms, fetal alcohol syndrome, hydrocephalus, manic depressive illness, mental retardation, schizophrenia, spina bifida, Tourette's syndrome, or any combination thereof.

82. The method of claim 81, wherein the sigma-1 receptor agonist is selected from:tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride (A2- 73), tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine (A2-73 freebase), tetrahydro-N,N-dimethyl-5,5-diphenyl-3-furanmethanamine hydrochloride (A1- 41); tetrahydro-N,N-dimethyl-5,5-diphenyl-3-furanmethanamine (A1-41 freebase); 1-(2,2-diphenyltetrahydrofuran-3-yl)-N-methylmethanamine hydrochloride (A19-144); 1-(2,2-diphenyltetrahydrofuran-3-yl)-N-methylmethanamine (A19-144 freebase); (1-(2,8-dimethyl- l-thia-3,8-diazaspiro(4.5)dec-3-yl)-3-(lH-indol-3-yl)propan-l- one) (A3-71); an enantiomer thereof, a crystal form thereof, a co-crystal form thereof, a pharmaceutically acceptable salt thereof, a crystal or co-crystal of the pharmaceutically acceptable salt thereof, or any combination thereof.

83. The method of claims 81 or 82, wherein the Sigma-1 receptor agonist is selected from: tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine in amorphous form; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form II; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form III; (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in amorphous form; (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in amorphous form; (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in a crystal form; (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in a crystal form;tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in amorphous form; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form II; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form III; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form IV; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form V; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine mesylate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine sulfate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine sulfate in crystal Form II; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine oxalate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine oxalate in crystal Form II; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine dihydrogen phosphate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine edisylate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine benzoate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrobromide in crystal Form A; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrobromide in crystal Form B; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine maleate in crystal Form S5;tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine maleate in crystal Form S6; co-crystal Form CSII of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with tartaric acid; co-crystal Form CSIII of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with citric acid; co-crystal Form CSIV of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with malic acid; a co-crystal of tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with zinc chloride; a co-crystal of (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with zinc chloride; a co-crystal of (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with zinc chloride; and any combination thereof.

84. The method of any one of claims 81 to 83, wherein the administering comprises a route of administration selected from the group consisting of oral administration, subcutaneous injection, intravenous injection, intraocular injection, intradermal injection, intramuscular injection, intraperitoneal injection, intratracheal administration, inhalation, intranasal administration, sublingual administration, buccal administration, rectal administration, vaginal administration, and topical administration.

85. The method of any one of claims 81 to 84, wherein the assessment period is about 12 weeks or less.

86. The method of any one of claims 81 to 85, wherein the assessment period is about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks.

87. The method of any one of claims 81 to 86, wherein the Sigma-1 receptor agonist is administered daily.

88. The method of any one of claims 81 to 87, wherein the Sigma-1 receptor agonist is tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine in crystal Form I.

89. The method of any one of claims 81 to 87, wherein the Sigma-1 receptor agonist is tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form I.

90. The method of any one of claims 81 to 89, wherein the Sigma-1 receptor agonist is administered daily in an amount of about 10 mg to about 60 mg.

91. The method of any one of claims 81 to 90, wherein the Sigma-1 receptor agonist is administered in an oral liquid comprising up to about 30 mg of the Sigma-1 receptor agonist.

92. The method of any one of claims 81 to 91, wherein the Sigma-1 receptor agonist comprises tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine or tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in an oral solution, and wherein the tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine or the tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride is administered once daily for a period of 12 weeks in an escalating dose regimen starting at about 30 mg and ending at about 50 mg.

93. The method of any one of claims 81 to 92, wherein the disease is Rett Syndrome.

94. The method of any one of claims 81 to 92, wherein the disease is Fragile X Syndrome.

95. The method of any one of claims 81 to 94, wherein the subject is a pediatric human patient, a teenager human patient, or an adult human patient.

96. The method of any one of claims 81 to 95, wherein the test biological sample or the control biological sample each independently comprises a blood serumsample, a blood plasma sample, or a sample suitable for transcriptomic analysis.

97. The method of any one of claims 81 to 96, wherein the test biological sample and the control biological sample are the same type of biological samples.

98. The method of any one of claims 81 to 96, wherein the test biological sample and the control biological sample are different types of biological samples.

99. A kit for a medical use, comprising: (1) a first container for receiving a control biological sample of a subject; (2) a second container for receiving a test biological sample from the subject; (3) a third container for storing an agent for measuring a gene expression profile; (4) a fourth container for storing a composition comprising a Sigma-1 receptor agonist; and (5) a user instruction in printed or computer readable medium.

100. The kit of claim 99, wherein the medical use comprises one or more of the following: (i) selecting the Sigma-1 receptor agonist therapy for the subject; (ii) evaluating effectiveness of the Sigma-1 receptor agonist therapy; (iii) identifying a subject responsive to the Sigma-1 receptor agonist therapy; and / or (iv) determining if a subject is having, is suspected of having, or having an increased risk for developing a disease, wherein the disease comprises Alzheimer’s disease, Parkinson’s disease, Parkinson’s disease with dementia, Huntington’s disease, Amyotrophic lateral sclerosis, Prion disease, Rett syndrome, cerebral palsy, Down's syndrome, Williams-Beuren syndrome, Prader-Willi syndrome, Angelman syndrome, Smith-Magenis syndrome, velo- cardio-facial syndrome, ATR-X syndrome, Barth syndrome, Fragile X syndrome, ICF syndrome, Neurofibromatosis, Smith-Lemli-Opitz syndrome, an addictive disorder, ADHD, an anxiety disorder, Asperger's syndrome, an autistic disorder, an eating disorder, epilepsy, infantile spasms, fetal alcoholsyndrome, hydrocephalus, manic depressive illness, mental retardation, schizophrenia, spina bifida, Tourette's syndrome, or any combination thereof.

101. The kit of claims 99 or 100, wherein the sigma-1 receptor agonist is selected from: tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride (A2- 73), tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine (A2-73 freebase), tetrahydro-N,N-dimethyl-5,5-diphenyl-3-furanmethanamine hydrochloride (A1- 41); tetrahydro-N,N-dimethyl-5,5-diphenyl-3-furanmethanamine (A1-41 freebase); 1-(2,2-diphenyltetrahydrofuran-3-yl)-N-methylmethanamine hydrochloride (A19-144); 1-(2,2-diphenyltetrahydrofuran-3-yl)-N-methylmethanamine (A19-144 freebase); (1-(2,8-dimethyl- l-thia-3,8-diazaspiro(4.5)dec-3-yl)-3-(lH-indol-3-yl)propan-l- one) (A3-71); an enantiomer thereof, a crystal form thereof, a co-crystal form thereof, a pharmaceutically acceptable salt thereof, a crystal or co-crystal of the pharmaceutically acceptable salt thereof, and / or any combination thereof.

102. The kit of any one of claims 99 to 101, wherein the Sigma-1 receptor agonist is selected from: tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine in amorphous form; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form II; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form III;(+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in amorphous form; (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in amorphous form; (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in a crystal form; (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in a crystal form; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in amorphous form; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form II; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form III; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form IV; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrogen fumarate in crystal Form V; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine mesylate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine sulfate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine sulfate in crystal Form II; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine oxalate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine oxalate in crystal Form II; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine dihydrogen phosphate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine edisylate in crystal Form I;tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine benzoate in crystal Form I; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrobromide in crystal Form A; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrobromide in crystal Form B; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine maleate in crystal Form S5; tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine maleate in crystal Form S6; co-crystal Form CSII of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with tartaric acid; co-crystal Form CSIII of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with citric acid; co-crystal Form CSIV of tetrahydro-N,N-dimethyl-2,2-diphenyl-3- furanmethanamine hydrochloride with malic acid; a co-crystal of tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with zinc chloride; a co-crystal of (-) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with zinc chloride; a co-crystal of (+) tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride with zinc chloride; and any combination thereof.

103. The kit of any one of claims 99 to 102, wherein the Sigma-1 receptor agonist is tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine in crystal Form I.

104. The kit of any one of claims 99 to 102, wherein the Sigma-1 receptor agonist is tetrahydro-N,N-dimethyl-2,2-diphenyl-3-furanmethanamine hydrochloride in crystal Form I.

105. The kit of any one of claims 99 to 104, wherein the composition comprises the Sigma-1 receptor agonist in an amount of about 10 mg to about 60 mg.

106. The kit of any one of claims 99 to 105, wherein the composition comprises the Sigma-1 receptor agonist in an amount of about 30 mg to about 50 mg.

107. The kit of any one of claims 99 to 106, wherein the composition is for oral administration, subcutaneous administration, intravenous administration, intraocular injection, intradermal injection, intramuscular injection, intraperitoneal injection, intratracheal administration, inhalation administration, intranasal administration, sublingual administration, buccal administration, rectal administration, vaginal administration, or topical administration.