Methods and compositions for treating transthyretin (TTR)- associated diseases

IL328934A0Pending Publication Date: 2026-07-01ALNYLAM PHARMACEUTICALS INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
IL · IL
Patent Type
Applications
Current Assignee / Owner
ALNYLAM PHARMACEUTICALS INC
Filing Date
2024-12-11
Publication Date
2026-07-01

AI Technical Summary

Technical Problem

Current treatments for TTR-associated diseases, such as Stargardt's disease, are not fully effective and can cause serious side effects, highlighting the need for more effective therapies.

Method used

Administering a fixed dose of a double-stranded RNA (dsRNA) agent targeting the TTR gene to inhibit its expression, thereby treating or preventing symptoms associated with TTR-associated diseases.

Benefits of technology

The method effectively reduces TTR expression, decreases vitamin A levels in the eyes, inhibits the formation of toxic Vitamin A metabolites, and halts progression of vision loss in subjects with TTR-associated diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000043_0000
    Figure 00000043_0000
  • Figure 00000074_0000
    Figure 00000074_0000
  • Figure 00000075_0000
    Figure 00000075_0000
Patent Text Reader

Abstract

The invention relates to methods of treating subjects that would benefit from reduction in expression of transthyretin (TTR), such as subjects having a TTR-associated disease, disorder, or condition, e.g., transthyretin-mediated amyloidosis, or Stargardt disease, using double-stranded ribonucleic acid (dsRNA) compositions targeting the TTR gene. The invention also provides methods for preventing at least one symptom in a subject having a TTR-associated disease, disorder, or condition, e.g., transthyretin-mediated amyloidosis, or Stargardt disease.
Need to check novelty before this filing date? Find Prior Art

Description

[0001]Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO METHODS AND COMPOSITIONS FOR TREATING TRANSTHYRETIN (TTR)- ASSOCIATED DISEASES RELATED APPLICATION The present application claims the benefit of priority to U.S. Provisional Application No. 63 / 608,908, filed on December 12, 2023, the entire contents of which are incorporated herein by reference. SEQUENCE LISTING The instant application contains a sequence listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on December 6, 2024, is named 121301-23620.xml and is 705,603 bytes in size. BACKGROUND OF THE INVENTION Transthyretin (TTR) (also known as prealbumin) is found in serum and cerebrospinal fluid (CSF). TTR transports retinol-binding protein (RBP) and thyroxine (T4) and also acts as a carrier of retinol (vitamin A) through its association with RBP in the blood and the CSF. Transthyretin is named for its transport of thyroxine and retinol. TTR also functions as a protease and can cleave proteins including apoA-I (the major HDL apolipoprotein), amyloid β-peptide, and neuropeptide Y (Liz, M.A. et al. (2010) IUBMB Life, 62(6):429-435). TTR is a tetramer of four identical 127-amino acid subunits (monomers) that are rich in beta sheet structure. Each monomer has two 4-stranded beta sheets and the shape of a prolate ellipsoid. Antiparallel beta-sheet interactions link monomers into dimers. A short loop from each monomer forms the main dimer-dimer interaction. These two pairs of loops separate the opposed, convex beta- sheets of the dimers to form an internal channel. The liver is the major site of TTR expression. Other significant sites of expression include the choroid plexus, retina (particularly the retinal pigment epithelium) and pancreas. Transthyretin is one of at least 27 distinct types of proteins that is a precursor protein in the formation of amyloid fibrils (Guan, J. et al. Am J Physiol Heart Circ Physiol, 2012 Feb 1; 302(3):H544-52). Extracellular deposition of amyloid fibrils in organs and tissues is the hallmark of amyloidosis. Amyloid fibrils are composed of misfolded protein aggregates, which may result from either excess production of or specific mutations in precursor proteins. The amyloidogenic potential of TTR may be related to its extensive beta sheet structure; X-ray crystallographic studies indicate that certain amyloidogenic mutations destabilize the tetrameric structure of the protein (Saraiva M.J.M. (2002) Expert Reviews in Molecular Medicine, 4(12):1-11). Amyloidosis is a general term for the group of amyloid diseases that are characterized by amyloid deposits. Amyloid diseases are classified based on their precursor protein; for example, the 1 ME151169145v.1 1 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO name starts with “A” for amyloid and is followed by an abbreviation of the precursor protein, e.g., ATTR for amloidogenic transthyretin. There are numerous TTR-associated diseases, most of which are amyloid diseases. Normal- sequence TTR is associated with cardiac amyloidosis in people who are elderly and is termed senile systemic amyloidosis (SSA) (also called senile cardiac amyloidosis (SCA) or cardiac amyloidosis). SSA often is accompanied by microscopic deposits in many other organs. TTR amyloidosis manifests in various forms. When the peripheral nervous system is affected more prominently, the disease is termed familial amyloidotic polyneuropathy (FAP). When the heart is primarily involved but the nervous system is not, the disease is called familial amyloidotic cardiomyopathy (FAC). A third major type of TTR amyloidosis is leptomeningeal amyloidosis, also known as leptomeningeal or meningocerebrovascular amyloidosis, central nervous system (CNS) amyloidosis, or amyloidosis VII form. Mutations in TTR may also cause amyloidotic vitreous opacities, carpal tunnel syndrome, and euthyroid hyperthyroxinemia, which is a non-amyloidotic disease thought to be secondary to an increased association of thyroxine with TTR due to a mutant TTR molecule with increased affinity for thyroxine (Moses et al. (1982) J. Clin. Invest., 86, 2025-2033). Abnormal TTR alleles may be either inherited or acquired through somatic mutations. Transthyretin associated ATTR is the most frequent form of hereditary systemic amyloidosis (Lobato, L. (2003) J. Nephrol., 16:438-442). TTR mutations accelerate the process of TTR amyloid formation and are the most important risk factor for the development of ATTR. More than 85 amyloidogenic TTR variants are known to cause systemic familial amyloidosis. TTR mutations usually give rise to systemic amyloid deposition, with particular involvement of the peripheral nervous system, although some mutations are associated with cardiomyopathy or vitreous opacities. Ibid. The V30M mutation is the most prevalent TTR mutation (Lobato, L. (2003) J Nephrol, 16:438-442). The V122I mutation is carried by 3.9% of the African American population and is the most common cause of FAC (Jacobson, D.R. et al. (1997) N. Engl. J. Med.336 (7): 466–73). It is estimated that SSA affects more than 25% of the population over age 80 (Westermark, P. et al. (1990) Proc. Natl. Acad. Sci. U.S.A.87 (7): 2843–5). Additional TTR-associated diseases include ocular diseases such as Stargardt’s disease. A primary pathological defect in the heritable eye disorder Stargardt disease is excessive accumulation of cytotoxic lipofuscin bisretinoids in the retina. Any available current treatments for TTR-associated diseases such ocular diseases, e.g., Stargardt’s disease, are not fully effective and may result in serious side effects, such as conjunctival hemorrhage, increased eye pressure, infection, retinal detachment and eye inflammation. Accordingly, there is a need in the art for effective treatments for TTR-associated diseases. SUMMARY OF THE INVENTION The invention provides methods and compositions for inhibiting the expression of a transthyretin (TTR) gene, for treating or preventing at least one symptoms in a subject having a 2 ME151169145v.1 2 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO disorder that would benefit from reduction in TTR expression, e.g., a TTR-associated disease, disorder, or condition, such as transthyretin-mediated amyloidosis, and / or Stargardt disease. The present invention also provides methods and compositions for decreasing vitamin A levels in the eyes, for decreasing the formation of toxic Vitamin A metabolites in the retina, and / or for halting progression of vision loss in a subject suffering from or prone to suffering from a TTR-associated disease, disorder, or condition, such as transthyretin-mediated amyloidosis, and / or Stargardt disease. The methods include administering to the subject a fixed dose of an RNAi agent, e.g., a double stranded RNAi agent, or a pharmaceutically acceptable salt thereof, targeting a TTR gene. Accordingly, in one aspect, the present invention provides a method of treating a subject suffering from a TTR-associated disease. The method includes administering to the subject a therapeutically effective amount, e.g., a fixed dose of about 25 mg to about 1200 mg of a dsRNA agent, or a pharmaceutically acceptable salt thereof, targeting a TTR gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- CAAGAGUAUUCCAUUUUUACU -3’ of SEQ ID NO:18 and the antisense strand comprises the nucleotide sequence 5’- AGUAAAAAUGGAAUACUCUUGGU -3’ of SEQ ID NO:20, thereby treating the subject suffering from the TTR-associated disease. In another aspect, the present invention provides a method of preventing at least one symptom in a subject having a TTR-associated disease. The method includes administering to the subject a prophylactically effective amount, e.g., a fixed dose of about 25 mg to about 1200 mg, of a dsRNA agent, or a pharmaceutically acceptable salt thereof, targeting a TTR gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- CAAGAGUAUUCCAUUUUUACU -3’ of SEQ ID NO:18 and the antisense strand comprises the nucleotide sequence 5’- AGUAAAAAUGGAAUACUCUUGGU -3’ of SEQ ID NO:20, thereby preventing at least one symptom in the subject having the TTR-associated disease. In one aspect, the present invention provides a method of inhibiting the expression of a TTR gene in a subject suffering from or prone to suffering from a TTR-associated disease. The method includes administering to the subject a therapeutically effective amount, e.g., a fixed dose of about 25 mg to about 1200 mg, of a dsRNA agent, or a pharmaceutically acceptable salt thereof, targeting a TTR gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- CAAGAGUAUUCCAUUUUUACU -3’ of SEQ ID NO:18 and the antisense strand comprises the nucleotide sequence 5’- AGUAAAAAUGGAAUACUCUUGGU -3’ of SEQ ID NO:20, thereby inhibiting the expression of the TTR gene in the subject. In another aspect, the present invention provides a method of decreasing vitamin A levels in the eyes of a subject suffering from or prone to suffering from a TTR-associated disease. The method includes administering to the subject a therapeutically effective amount, e.g., a fixed dose of about 25 3 ME151169145v.1 3 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO mg to about 1200 mg, of a dsRNA agent, or a pharmaceutically acceptable salt thereof, targeting a TTR gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- CAAGAGUAUUCCAUUUUUACU -3’ of SEQ ID NO:18 and the antisense strand comprises the nucleotide sequence 5’- AGUAAAAAUGGAAUACUCUUGGU -3’ of SEQ ID NO:20, thereby decreasing vitamin A levels in the eyes of the subject. In one aspect, the present invention provides a method of decreasing the formation of toxic Vitamin A metabolites in the retina of a subject suffering from or prone to suffering from a TTR- associated disease. The method includes administering to the subject a therapeutically effective amount, e.g., a fixed dose of about 25 mg to about 1200 mg, of a dsRNA agent, or a pharmaceutically acceptable salt thereof, targeting a TTR gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- CAAGAGUAUUCCAUUUUUACU -3’ of SEQ ID NO:18 and the antisense strand comprises the nucleotide sequence 5’- AGUAAAAAUGGAAUACUCUUGGU -3’ of SEQ ID NO:20, thereby decreasing the formation of toxic Vitamin A metabolites in the retina of the subject. In another aspect, the present invention provides a method of halting progression of vision loss in a subject suffering from or prone to suffering from a TTR-associated disease. The method includes administering to the subject a therapeutically effective amount, e.g., a fixed dose of about 25 mg to about 1200 mg, of a dsRNA agent, or a pharmaceutically acceptable salt thereof, targeting a TTR gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- CAAGAGUAUUCCAUUUUUACU -3’ of SEQ ID NO:18 and the antisense strand comprises the nucleotide sequence 5’- AGUAAAAAUGGAAUACUCUUGGU -3’ of SEQ ID NO:20, thereby halting progression of vision loss in the subject. In some embodiments, the subject is a human subject. In some embodiments, the TTR-associated disease is selected from the group consisting of transthyretin-mediated amyloidosis (ATTR amyloidosis), senile systemic amyloidosis (SSA), systemic familial amyloidosis, familial amyloidotic polyneuropathy (FAP), familial amyloidotic cardiomyopathy (FAC), leptomeningeal / Central Nervous System (CNS) amyloidosis, and Stargardt’s disease. In one embodiment, the TTR-associated disease is transthyretin-mediated amyloidosis (ATTR amyloidosis) and the method reduces an amyloid TTR deposit in the subject. In one embodiment, the ATTR is hereditary ATTR (hATTR). In another embodiment, the ATTR is wild-type ATTR (wtATTR). In one embodiment, the TTR-associated disease is an ocular disease. In some embodiments, the TTR-associated disease is Stargardt’s disease. In some embodiments, the methods further comprise measuring the level of TTR mRNA expression or TTR protein expression in a sample from the subject. 4 ME151169145v.1 4 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO In some embodiments, the methods further comprise measuring the level of vitamin A or RBP4 protein in a sample from the subject. In some embodiments, the administration of the dsRNA agent, or a pharmaceutically acceptable salt thereof, to the subject causes a decrease in TTR enzymatic activity, a decrease in TTR protein accumulation, a decrease in vitamin A level, and / or a decrease in RBP4 level in the subject. In some embodiments, the TTR mRNA level in the subject is reduced to at least about 70%, 65%, 60%, 55%, or 50% of baseline level 6 months after the administration of the dsRNA agent, or a pharmaceutically acceptable salt thereof. In some embodiments, the dsRNA agent comprises at least one nucleotide modification. In some embodiments, substantially all of the nucleotides of the sense strand comprise a nucleotide modification. In some embodiments, substantially all of the nucleotides of the antisense strand comprise a nucleotide modification. In some embodiments, substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand comprise a nucleotide modification. In some embodiments, at least one of the nucleotide modifications is selected from the group consisting of a deoxy-nucleotide modification, a 2'-O-methyl nucleotide modification, and a 2'-fluoro nucleotide modification. In some embodiments, the nucleotide modifications are 2’-O-methyl and / or 2’-fluoro nucleotide modifications. In some embodiments, each strand of the dsRNA agent is no more than 30 nucleotides in length. In some embodiments, each strand of the dsRNA agent is independently 19-30 nucleotides in length. In some embodiments, each strand of the dsRNA agent is independently 19-25 nucleotides in length. In some embodiments, each strand is of the dsRNA agent independently 21-23 nucleotides in length. In some embodiments, at least one strand of the dsRNA agent comprises a 3’ overhang of at least 1 nucleotide. In some embodiments, at least one strand of the dsRNA agent comprises a 3’ overhang of at least 2 nucleotides. In some embodiments, the dsRNA agent further comprises a ligand. In some embodiments, the ligand is conjugated to the 3’ end of the sense strand of the dsRNA agent. In some embodiments, the ligand is an N-acetylgalactosamine (GalNAc) derivative. In some embodiments, the ligand is 5 ME151169145v.1 5 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO In some embodiments, the dsRNA agent is conjugated to the ligand as shown in the following schematic In some embodiments, X is O. In some embodiments, the sense strand comprises the nucleotide sequence 5’- csasagagUfaUfUfCfcauuuuuacu-3’ of SEQ ID NO:17 and the antisense strand comprises the nucleotide sequence 5’- asGfsuaaAfaauggaaUfaCfucuugsgsu -3’ of SEQ ID NO:19, wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; Af, Cf, Gf and Uf are 2’-fluoro (2’-F) A, C, G and U; and s is a phosphorothioate linkage. In some embodiments, the dsRNA agent is conjugated to the ligand as shown in the following schematic 6 ME151169145v.1 6 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO In one aspect, the present invention provides a method of treating a subject suffering from a TTR-associated disease, the method comprising administering to the subject a fixed dose of about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a TTR gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a modified nucleotide sequence comprising at least 19, e.g., 20, or 21, contiguous nucleotides of the modified nucleotide sequence 5’- csasagagUfaUfUfCfcauuuuuacu-3’ of SEQ ID NO:17, and the antisense strand comprises a modified nucleotide sequence comprising at least 19, e.g., 20, 21, 22 or 23, contiguous nucleotides of the modified nucleotide sequence 5’- asGfsuaaAfaauggaaUfaCfucuugsgsu - 3’ of SEQ ID NO:19, wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; Af, Cf, Gf and Uf are 2’-fluoro (2’-F) A, C, G and U; and s is a phosphorothioate linkage; and wherein a ligand is conjugated to the 3’ end of the sense strand as shown in the following schematic wherein X is O, thereby treating the subject suffering from the TTR-associated disease. 7 ME151169145v.1 7 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO In one aspect, the present invention provides a method of preventing at least one symptom in a subject having a TTR-associated disease, the method comprising administering to the subject a fixed dose of about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a TTR gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a modified nucleotide sequence comprising at least 19, e.g., 20, or 21, contiguous nucleotides of the modified nucleotide sequence 5’- csasagagUfaUfUfCfcauuuuuacu-3’ of SEQ ID NO:17, and the antisense strand comprises a modified nucleotide sequence comprising at least 19, e.g., 20, 21, 22 or 23, contiguous nucleotides of the modified nucleotide sequence 5’- asGfsuaaAfaauggaaUfaCfucuugsgsu -3’ of SEQ ID NO:19, wherein a, g, c and u are 2′-O-methyl (2′- OMe) A, G, C, and U; Af, Cf, Gf and Uf are 2’-fluoro (2’-F) A, C, G and U; and s is a phosphorothioate linkage; and wherein a ligand is conjugated to the 3’ end of the sense strand as shown in the following schematic thereby preventing at least one symptom in the subject having the TTR-associated disease. In one aspect, the present invention provides a method of inhibiting the expression of a TTR gene in a subject suffering from or prone to suffering from a TTR-associated disease, the method comprising administering to the subject a fixed dose of about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a TTR gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a modified nucleotide sequence comprising at least 19, e.g., 20, or 21, contiguous nucleotides of the modified nucleotide sequence 5’- csasagagUfaUfUfCfcauuuuuacu-3’ of SEQ ID NO:17, and the antisense strand comprises a modified nucleotide sequence comprising at least 19, e.g., 20, 21, 22 or 23, contiguous nucleotides of the modified nucleotide sequence 5’- asGfsuaaAfaauggaaUfaCfucuugsgsu -3’ of SEQ ID NO:19, wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; Af, Cf, Gf and Uf are 2’-fluoro (2’-F) A, C, G 8 ME151169145v.1 8 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO and U; and s is a phosphorothioate linkage; and wherein a ligand is conjugated to the 3’ end of the sense strand as shown in the following schematic wherein X is O, thereby inhibiting the expression of a TTR gene in the subject. In one aspect, the present invention provides a method of decreasing vitamin A levels in theeyes of a subject suffering from or prone to suffering from a TTR-associated disease, the method comprising administering to the subject a fixed dose of about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a TTR gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a modified nucleotide sequence comprising at least 19, e.g., 20, or 21, contiguous nucleotides of the modified nucleotide sequence 5’- csasagagUfaUfUfCfcauuuuuacu-3’ of SEQ ID NO:17, and the antisense strand comprises a modified nucleotide sequence comprising at least 19, e.g., 20, 21, 22 or 23, contiguous nucleotides of the modified nucleotide sequence 5’- asGfsuaaAfaauggaaUfaCfucuugsgsu -3’ of SEQ ID NO:19, wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; Af, Cf, Gf and Uf are 2’-fluoro (2’-F) A, C, G and U; and s is a phosphorothioate linkage; and wherein a ligand is conjugated to the 3’ end of the sense strand as shown in the following schematic 9 ME151169145v.1 9 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO thereby decreasing vitamin A levels in the eyes of the subject. In one aspect, the present invention provides a method of decreasing the formation of toxic Vitamin A metabolites in the retina of a subject suffering from or prone to suffering from a TTR- associated disease, the method comprising administering to the subject a fixed dose of about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a TTR gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a modified nucleotide sequence comprising at least 19, e.g., 20, or 21, contiguous nucleotides of the modified nucleotide sequence 5’- csasagagUfaUfUfCfcauuuuuacu-3’ of SEQ ID NO:17, and the antisense strand comprises a modified nucleotide sequence comprising at least 19, e.g., 20, 21, 22 or 23, contiguous nucleotides of the modified nucleotide sequence 5’- asGfsuaaAfaauggaaUfaCfucuugsgsu - 3’ of SEQ ID NO:19, wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; Af, Cf, Gf and Uf are 2’-fluoro (2’-F) A, C, G and U; and s is a phosphorothioate linkage; and wherein a ligand is conjugated to the 3’ end of the sense strand as shown in the following schematic wherein X is O, thereby decreasing the formation of toxic Vitamin A metabolites in the retina of the subject. 10 ME151169145v.1 10 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO In one aspect, the present invention provides a method of halting progression of vision loss in a subject suffering from or prone to suffering from a TTR-associated disease, the method comprising administering to the subject a fixed dose of about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a TTR gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a modified nucleotide sequence comprising at least 19, e.g., 20, or 21, contiguous nucleotides of the modified nucleotide sequence 5’- csasagagUfaUfUfCfcauuuuuacu-3’ of SEQ ID NO:17, and the antisense strand comprises a modified nucleotide sequence comprising at least 19, e.g., 20, 21, 22 or 23, contiguous nucleotides of the modified nucleotide sequence 5’- asGfsuaaAfaauggaaUfaCfucuugsgsu -3’ of SEQ ID NO:19, wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; Af, Cf, Gf and Uf are 2’-fluoro (2’-F) A, C, G and U; and s is a phosphorothioate linkage; and wherein a ligand is conjugated to the 3’ end of the sense strand as shown in the following schematic halting progression of vision loss in the subject. In some embodiments, the sense strand comprises a modified nucleotide sequence comprising at least 20 contiguous nucleotides of the modified nucleotide sequence of 5’- csasagagUfaUfUfCfcauuuuuacu-3’ of SEQ ID NO:17 and the antisense strand comprises a modified nucleotide sequence comprising at least 20 contiguous nucleotides of the modified nucleotide sequence of 5’-asGfsuaaAfaauggaaUfaCfucuugsgsu-3’ of SEQ ID NO:19. In some embodiments, the sense strand comprises a modified nucleotide sequence comprising at least 21 contiguous nucleotides of the modified nucleotide sequence of 5’- csasagagUfaUfUfCfcauuuuuacu-3’ of SEQ ID NO:17 and the antisense strand comprises a modified nucleotide sequence comprising at least 21 contiguous nucleotides of the modified nucleotide sequence of 5’-asGfsuaaAfaauggaaUfaCfucuugsgsu-3’ of SEQ ID NO:19. In some embodiments, the sense strand comprises a modified nucleotide sequence comprising at least 21 contiguous nucleotides of the modified nucleotide sequence of 5’- 11 ME151169145v.1 11 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO csasagagUfaUfUfCfcauuuuuacu-3’ of SEQ ID NO:17 and the antisense strand comprises a modified nucleotide sequence comprising at least 22 contiguous nucleotides of the modified nucleotide sequence of 5’-asGfsuaaAfaauggaaUfaCfucuugsgsu-3’ of SEQ ID NO:19. In some embodiments, the sense strand comprises the nucleotide sequence of 5’- csasagagUfaUfUfCfcauuuuuacu-3’ of SEQ ID NO:17 and the antisense strand comprises the nucleotide sequence of 5’-asGfsuaaAfaauggaaUfaCfucuugsgsu-3’ of SEQ ID NO:19. In some embodiments, the sense strand consists of the nucleotide sequence of 5’- csasagagUfaUfUfCfcauuuuuacu-3’ of SEQ ID NO:17 and the antisense strand consists of the nucleotide sequence of 5’-asGfsuaaAfaauggaaUfaCfucuugsgsu-3’ of SEQ ID NO:19. In some embodiments, the subject is a human subject. In some embodiments, the TTR-associated disease is selected from the group consisting of transthyretin-mediated amyloidosis (ATTR amyloidosis), senile systemic amyloidosis (SSA), systemic familial amyloidosis, familial amyloidotic polyneuropathy (FAP), familial amyloidotic cardiomyopathy (FAC), leptomeningeal / Central Nervous System (CNS) amyloidosis, hyperthyroxinemia, an ocular disease, Stargardt’s disease, diabetic retinopathy, age-related macular degeneration (AMD), dry AMD and wet AMD; a metabolic disorder, a disorder of glucose and lipid homeostasis, insulin resistance associated with type II diabetes, and a cardiovascular disease. In one embodiment, the TTR-associated disease is transthyretin-mediated amyloidosis (ATTR amyloidosis) and the method reduces an amyloid TTR deposit in the subject. In one embodiment, the ATTR is hereditary ATTR (hATTR). In another embodiment, the ATTR is wild-type ATTR (wtATTR). In one embodiment, the TTR-associated disease is an ocular disease. In some embodiments, the TTR-associated disease is Stargardt’s disease. In some embodiments, the methods further comprise measuring the level of TTR mRNA expression or TTR protein expression in a sample from the subject. In some embodiments, the methods further comprise measuring the level of vitamin A or RBP4 protein in a sample from the subject. In some embodiments, the administration of the dsRNA agent, or a pharmaceutically acceptable salt thereof, to the subject causes a decrease in TTR enzymatic activity, a decrease in TTR protein accumulation, a decrease in vitamin A level, and / or a decrease in RBP4 level in the subject. In some embodiments, the TTR mRNA level in the subject is reduced to at least about 70%, 65%, 60%, 55%, or 50% of baseline level 6 months after the administration of the dsRNA agent, or a pharmaceutically acceptable salt thereof. In one embodiment, the methods of the invention further include administering an additional therapeutic to the subject. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 25 mg, about 50 mg, about 75 mg, about 100 mg, about 12 ME151169145v.1 12 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO 150 mg, about 200 mg, about 300 mg, about 400 mg, about 450 mg, about 500 mg, about 600 mg, about 700 mg, about 800 mg, about 900 mg, about 1000 mg, about 1100 mg, or about 1200 mg. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject every month, every 2 months, every 3 months, every 4 months, every 5 months, every 6 months, or every 12 months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 25 mg every three months. In some embodiments, thedsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose ofabout 100 mg every three months. In some embodiments, the dsRNA agent, or a pharmaceuticallyacceptable salt thereof, is administered to the subject at a dose of about 300 mg every three months. Insome embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administeredto the subject at a dose of about 600 mg every three months. In some embodiments, the dsRNA agent,or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 900 mgevery three months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 25 mg every six months. In some embodiments, thedsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose ofabout 100 mg every six months. In some embodiments, the dsRNA agent, or a pharmaceuticallyacceptable salt thereof, is administered to the subject at a dose of about 300 mg every six months. Insome embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administeredto the subject at a dose of about 600 mg every six months. In some embodiments, the dsRNA agent,or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 900 mgevery six months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 25 mg every twelve months. In some embodiments, thedsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose ofabout 100 mg every twelve months. In some embodiments, the dsRNA agent, or a pharmaceuticallyacceptable salt thereof, is administered to the subject at a dose of about 300 mg every twelve months.In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 600 mg every twelve months. In some embodiments, thedsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose ofabout 900 mg every twelve months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject intravenously, intramuscularly, or subcutaneously. In some embodiments,the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subjectsubcutaneously. In another aspect, the present invention provides a pharmaceutical composition comprising a dsRNA agent (e.g., AD-649264), or a pharmaceutically acceptable salt thereof. 13 ME151169145v.1 13 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO In some embodiments, the pharmaceutical composition comprises, per vial (e.g., a 0.5 mL vial), about 100 mg of a dsRNA agent (e.g., AD-649264), or about 106 mg of a pharmaceutically acceptable salt thereof, e.g., sodium form of AD-649264. In some embodiments, the pharmaceutical composition comprises about 200 mg / mL of a dsRNA agent (e.g., AD-649264), or about 212 mg / mL of a pharmaceutically acceptable salt thereof, e.g., sodium form of AD-649264. In some embodiments, the pharmaceutical composition comprising a dsRNA agent (e.g., AD- 649264), or a pharmaceutically acceptable salt thereof, and a buffer, e.g., sodium dihydrogen phosphate dihydrate, and / or di-sodium hydrogen phosphate anhydrous. In some embodiments, the pharmaceutical composition comprises, per vial (e.g., a 0.5 mL vial), about 100 mg of a dsRNA agent (e.g., AD-649264), or about 106 mg of a pharmaceutically acceptable salt thereof, e.g., sodium form of AD-649264, about 0.184 mg of sodium dihydrogen phosphate dihydrate, and about 0.188 mg of di-sodium hydrogen phosphate anhydrous. In some embodiments, the pharmaceutical composition comprises about 200 mg / mL of a dsRNA agent (e.g., AD-649264), or about 212 mg / mL of a pharmaceutically acceptable salt thereof, e.g., sodium form of AD-649264, about 0.367 mg / mL of sodium dihydrogen phosphate dihydrate, and about 0.376 mg / mL of di-sodium hydrogen phosphate anhydrous. In some embodiments, the pharmaceutical composition further comprises a diluent, e.g., water, and / or an agent for adjusting the pH, e.g., phosphoric acid, and / or sodium hydroxide. In some embodiments, compendial grade phosphoric acid at 0.3N or sodium hydroxide at 0.25N may be used as needed to adjust the pH of the composition. In some embodiments, the pharmaceutical composition comprises, per vial (e.g., a 0.5 mL vial), about 100 mg of a dsRNA agent (e.g., AD-649264), or about 106 mg of a pharmaceutically acceptable salt thereof, e.g., sodium form of AD-649264, about 0.184 mg of sodium dihydrogen phosphate dihydrate, about 0.188 mg of di-sodium hydrogen phosphate anhydrous, water, phosphoric acid and sodium hydroxide. In some embodiments, the pharmaceutical composition comprises about 200 mg / mL of a dsRNA agent (e.g., AD-649264), or about 212 mg / mL of a pharmaceutically acceptable salt thereof, e.g., sodium form of AD-649264, about 0.367 mg / mL of sodium dihydrogen phosphate dihydrate, about 0.376 mg / mL of di-sodium hydrogen phosphate anhydrous, water, phosphoric acid and sodium hydroxide. In another aspect, the present invention provides a kit for performing the methods as described herein, comprising a) the dsRNA agent, or a pharmaceutically acceptable salt thereof, and b) instructions for use, and c) optionally, means for administering the dsRNA agent, or a pharmaceutically acceptable salt thereof, to the subject. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 schematically depicts the Phase 1 study design of AD-649264 in healthy subjects. 14 ME151169145v.1 14 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO Figure 2 depicts the percent change in serum TTR relative to the baseline in healthy subjects administered subcutaneously with placebo or AD-649264 at a dose of 5 mg, 25 mg or 100 mg. Figure 3 depicts the percent change in serum TTR relative to the baseline in healthy subjects administered subcutaneously with placebo or AD-649264 at a dose of 5 mg, 25 mg, 100 mg, or 300 mg. DETAILED DESCRIPTION OF THE INVENTION The invention provides methods and compositions for inhibiting the expression of a transthyretin (TTR) gene, for treating or preventing at least one symptom in a subject having a disorder that would benefit from reduction in TTR expression, e.g., a TTR-associated disease, disorder, or condition, such as transthyretin-mediated amyloidosis, and / or Stargardt disease. The present invention also provides methods and compositions for decreasing vitamin A levels in the eyes, for decreasing the formation of toxic Vitamin A metabolites in the retina, and / or for halting progression of vision loss in a subject suffering from or prone to suffering from a TTR-associated disease, disorder, or condition, such as transthyretin-mediated amyloidosis, and / or Stargardt disease. The methods include administering to the subject a fixed dose of an RNAi agent, e.g., a double stranded RNAi agent, or a pharmaceutically acceptable salt thereof, targeting a TTR gene. The present invention provides iRNA compositions, which effect the RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of a TTR gene. The TTR gene may be withina cell, e.g., a cell within a subject, such as a human. The present invention also provides methods ofusing the iRNA compositions of the invention for inhibiting the expression of a TTR gene, and for treating a subject who would benefit from inhibiting or reducing the expression of a TTR gene, e.g., a subject suffering or prone to suffering from a TTR-associated disease disorder, or condition, such as a subject suffering or prone to suffering from such as transthyretin-mediated amyloidosis, and / or Stargardt disease. I. Definitions In order that the present invention may be more readily understood, certain terms are first defined. In addition, it should be noted that whenever a value or range of values of a parameter are recited, it is intended that values and ranges intermediate to the recited values are also intended to be part of this invention. The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element, e.g., a plurality of elements. The term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to". The term "or" is used herein to mean, and is used interchangeably with, the term "and / or," unless context clearly indicates otherwise. 15 ME151169145v.1 15 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO The term “about” is used herein to mean within the typical ranges of tolerances in the art. For example, “about” can be understood as about 2 standard deviations from the mean. In certain embodiments, about means +10%. In certain embodiments, about means +5%. When about is present before a series of numbers or a range, it is understood that “about” can modify each of the numbers in the series or range. As used herein, “transthyretin” (“TTR”) refers to the well-known gene and protein. TTR is also known as prealbumin, HsT2651, PALB, and TBPA. TTR functions as a transporter of retinol- binding protein (RBP), thyroxine (T4) and retinol, and it also acts as a protease. The liver secretes TTR into the blood, and the choroid plexus secretes TTR into the cerebrospinal fluid. TTR is also expressed in the pancreas and the retinal pigment epithelium. The greatest clinical relevance of TTR is that both normal (wild type) and mutant TTR protein can form amyloid fibrils that aggregate into extracellular deposits, causing amyloidosis. See, e.g., Saraiva M.J.M. (2002) Expert Reviews in Molecular Medicine, 4(12):1-11 for a review. The molecular cloning and nucleotide sequence of rat transthyretin, as well as the distribution of mRNA expression, was described by Dickson, P.W. et al. (1985) J. Biol. Chem. 260(13)8214-8219. The X-ray crystal structure of human TTR was described in Blake, C.C. et al. (1974) J Mol Biol 88, 1-12. The sequence of a human TTR mRNA transcript may be found at National Center for Biotechnology Information (NCBI) RefSeq accession number NM_000371.4 (SEQ ID NO:1; reverse complement, SEQ ID NO:2). The sequence of mouse TTR mRNA may be found at RefSeq accession number NM_013697.2 (SEQ ID NO:3; reverse complement, SEQ ID NO:4). The sequence of rat TTR mRNA may be found at RefSeq accession number NM_012681.1 (SEQ ID NO:5; reverse complement, SEQ ID NO:6). The sequence of Macaca fascicularis TTR mRNA may be found at RefSeq accession number NM_001283593.1 (SEQ ID NO:7; reverse complement, SEQ ID NO:8). The sequence of Macaca mulatta TTR mRNA may be found at RefSeq accession number NM_001261679.1 (SEQ ID NO:9; reverse complement, SEQ ID NO:10). Additional examples of TTR mRNA sequences are readily available through publicly available databases, e.g., GenBank, UniProt, OMIM, and the Macaca genome project web site. Further information on TTR can be found, for example, at www.ncbi.nlm.nih.gov / gene / ?term=TTR. The entire contents of each of the foregoing GenBank Accession numbers and the Gene database numbers are incorporated herein by reference as of the date of filing this application. The term TTR, as used herein, also refers to variations of the TTR gene including variants provided in the SNP database. Numerous sequence variations within the TTR gene have been identified and may be found at, for example, NCBI dbSNP and UniProt (see, e.g., www.ncbi.nlm.nih.gov / snp / ?term=TTR, the entire contents of which is incorporated herein by reference as of the date of filing this application. As used herein, “target sequence” refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a TTR gene, including mRNA that is a product 16 ME151169145v.1 16 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO of RNA processing of a primary transcription product. In one embodiment, the target portion of the sequence will be at least long enough to serve as a substrate for iRNA-directed cleavage at or near that portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a TTR gene. The target sequence of a TTR gene may be from about 9-36 nucleotides in length, e.g., about 15-30 nucleotides in length. For example, the target sequence can be from about 15-30 nucleotides, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18- 29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20- 22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention. As used herein, the term “strand comprising a sequence” refers to an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature. “G,” “C,” “A,” “T” and “U” each generally stand for a nucleotide that contains guanine, cytosine, adenine, thymidine and uracil as a base, respectively. However, it will be understood that the term “ribonucleotide” or “nucleotide” can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety (see, e.g., Table 1). The skilled person is well aware that guanine, cytosine, adenine, and uracil can be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety. For example, without limitation, a nucleotide comprising inosine as its base can base pair with nucleotides containing adenine, cytosine, or uracil. Hence, nucleotides containing uracil, guanine, or adenine can be replaced in the nucleotide sequences of dsRNA featured in the invention by a nucleotide containing, for example, inosine. In another example, adenine and cytosine anywhere in the oligonucleotide can be replaced with guanine and uracil, respectively to form G-U Wobble base pairing with the target mRNA. Sequences containing such replacement moieties are suitable for the compositions and methods featured in the invention. The terms “iRNA”, “RNAi agent,” “iRNA agent,”, “RNA interference agent” as used interchangeably herein, refer to an agent that contains RNA as that term is defined herein, and which mediates the targeted cleavage of an RNA transcript via an RNA-induced silencing complex (RISC) pathway. iRNA directs the sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). The iRNA modulates, e.g., inhibits, the expression of TTR gene in a cell, e.g., a cell within a subject, such as a mammalian subject. In another embodiment, an “iRNA” for use in the compositions and methods of the invention is a double-stranded RNA and is referred to herein as a “double stranded RNAi agent,” “double- stranded RNA (dsRNA) molecule,” “dsRNA agent,” or “dsRNA”. The term “dsRNA”, refers to a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and 17 ME151169145v.1 17 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO substantially complementary nucleic acid strands, referred to as having “sense” and “antisense” orientations with respect to a target RNA, i.e., a TTR gene. In some embodiments of the invention, a double-stranded RNA (dsRNA) triggers the degradation of a target RNA, e.g., an mRNA, through a post-transcriptional gene-silencing mechanism referred to herein as RNA interference or RNAi. In general, the majority of nucleotides of each strand of a dsRNA molecule are ribonucleotides, but as described in detail herein, each or both strands can also include one or more non-ribonucleotides, e.g., a deoxyribonucleotide and / or a modified nucleotide. In addition, as used in this specification, an “RNAi agent” may include ribonucleotides with chemical modifications; an RNAi agent may include substantial modifications at multiple nucleotides. As used herein, the term “modified nucleotide” refers to a nucleotide having, independently, a modified sugar moiety, a modified internucleotide linkage, and / or a modified nucleobase. Thus, the term modified nucleotide encompasses substitutions, additions or removal of, e.g., a functional group or atom, to internucleoside linkages, sugar moieties, or nucleobases. The modifications suitable for use in the agents of the invention include all types of modifications disclosed herein or known in the art. Any such modifications, as used in a siRNA type molecule, are encompassed by “RNAi agent” for the purposes of this specification and claims. The duplex region may be of any length that permits specific degradation of a desired target RNA through a RISC pathway, and may range from about 9 to 36 base pairs in length, e.g., about 15- 30 base pairs in length, for example, about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length, such as about 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18- 27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21- 30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention. The two strands forming the duplex structure may be different portions of one larger RNA molecule, or they may be separate RNA molecules. Where the two strands are part of one larger molecule, and therefore are connected by an uninterrupted chain of nucleotides between the 3’-end of one strand and the 5’-end of the respective other strand forming the duplex structure, the connecting RNA chain is referred to as a “hairpin loop.” A hairpin loop can comprise at least one unpaired nucleotide. In some embodiments, the hairpin loop can comprise at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 23 or more unpaired nucleotides. Where the two substantially complementary strands of a dsRNA are comprised by separate RNA molecules, those molecules need not, but can be covalently connected. Where the two strands are connected covalently by means other than an uninterrupted chain of nucleotides between the 3’- end of one strand and the 5’-end of the respective other strand forming the duplex structure, the 18 ME151169145v.1 18 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO connecting structure is referred to as a “linker.” The RNA strands may have the same or a different number of nucleotides. The maximum number of base pairs is the number of nucleotides in the shortest strand of the dsRNA minus any overhangs that are present in the duplex. In addition to the duplex structure, an RNAi may comprise one or more nucleotide overhangs. In one embodiment, an RNAi agent of the invention is a dsRNA, each strand of which comprises less than 30 nucleotides, e.g., 17-27, 19-27, 17-25, 19-25, or 19-23, that interacts with a target RNA sequence, e.g., a TTR target mRNA sequence, to direct the cleavage of the target RNA. In another embodiment, an RNAi agent of the invention is a dsRNA, each strand of which comprises 19-23 nucleotides, that interacts with a target RNA sequence, e.g., a TTR target mRNA sequence, to direct the cleavage of the target RNA. In one embodiment, the sense strand is 21 nucleotides in length. In another embodiment, the antisense strand is 23 nucleotides in length. As used herein, the term “nucleotide overhang” refers to at least one unpaired nucleotide that protrudes from the duplex structure of an iRNA, e.g., a dsRNA. For example, when a 3'-end of one strand of a dsRNA extends beyond the 5'-end of the other strand, or vice versa, there is a nucleotide overhang. A dsRNA can comprise an overhang of at least one nucleotide; alternatively the overhang can comprise at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides or more. A nucleotide overhang can comprise or consist of a nucleotide / nucleoside analog, including a deoxynucleotide / nucleoside. The overhang(s) can be on the sense strand, the antisense strand or any combination thereof. Furthermore, the nucleotide(s) of an overhang can be present on the 5'-end, 3'-end or both ends of either an antisense or sense strand of a dsRNA. In one embodiment, the antisense strand of a dsRNA has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3’-end and / or the 5’-end. In one embodiment, the sense strand of a dsRNA has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3’-end and / or the 5’-end. In another embodiment, one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate. In certain embodiments, the overhang on the sense strand or the antisense strand, or both, can include extended lengths longer than 10 nucleotides, e.g., 10-30 nucleotides, 10-25 nucleotides, 10-20 nucleotides or 10-15 nucleotides in length. In certain embodiments, an extended overhang is on the sense strand of the duplex. In certain embodiments, an extended overhang is present on the 3’end of the sense strand of the duplex. In certain embodiments, an extended overhang is present on the 5’end of the sense strand of the duplex. In certain embodiments, an extended overhang is on the antisense strand of the duplex. In certain embodiments, an extended overhang is present on the 3’end of the antisense strand of the duplex. In certain embodiments, an extended overhang is present on the 5’end of the antisense strand of the duplex. In certain embodiments, one or more of the nucleotides in the extended overhang is replaced with a nucleoside thiophosphate. The term “antisense strand” or "guide strand" refers to the strand of an iRNA, e.g., a dsRNA, which includes a region that is substantially complementary to a target sequence, e.g., a TTR mRNA. 19 ME151169145v.1 19 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO As used herein, the term “region of complementarity” refers to the region on the antisense strand that is substantially complementary to a sequence, for example a target sequence, e.g., a TTR nucleotide sequence, as defined herein. Where the region of complementarity is not fully complementary to the target sequence, the mismatches can be in the internal or terminal regions of the molecule. Generally, the most tolerated mismatches are in the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides of the 5’- and / or 3’-terminus of the iRNA. The term “sense strand” or "passenger strand" as used herein, refers to the strand of an iRNA that includes a region that is substantially complementary to a region of the antisense strand as that term is defined herein. As used herein, the term “cleavage region” refers to a region that is located immediately adjacent to the cleavage site. The cleavage site is the site on the target at which cleavage occurs. In some embodiments, the cleavage region comprises three bases on either end of, and immediately adjacent to, the cleavage site. In some embodiments, the cleavage region comprises two bases on either end of, and immediately adjacent to, the cleavage site. In some embodiments, the cleavage site specifically occurs at the site bound by nucleotides 10 and 11 of the antisense strand, and the cleavage region comprises nucleotides 11, 12 and 13. As used herein, and unless otherwise indicated, the term “complementary,” when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by the skilled person. Such conditions can, for example, be stringent conditions, where stringent conditions can include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50oC or 70oC for 12-16 hours followed by washing (see, e.g., “Molecular Cloning: A Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press). Other conditions, such as physiologically relevant conditions as can be encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides. Complementary sequences within an iRNA, e.g., within a dsRNA as described herein, include base-pairing of the oligonucleotide or polynucleotide comprising a first nucleotide sequence to an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the entire length of one or both nucleotide sequences. Such sequences can be referred to as “fully complementary” with respect to each other herein. However, where a first sequence is referred to as “substantially complementary” with respect to a second sequence herein, the two sequences can be fully complementary, or they can form one or more, but generally not more than 5, 4, 3 or 2 mismatched base pairs upon hybridization for a duplex up to 30 base pairs, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., inhibition of gene expression via a RISC pathway. However, where two oligonucleotides are designed to form, upon hybridization, 20 ME151169145v.1 20 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO one or more single stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity. For example, a dsRNA comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 21 nucleotides that is fully complementary to the shorter oligonucleotide, can yet be referred to as “fully complementary” for the purposes described herein. “Complementary” sequences, as used herein, can also include, or be formed entirely from, non-Watson-Crick base pairs and / or base pairs formed from non-natural and modified nucleotides, in so far as the above requirements with respect to their ability to hybridize are fulfilled. Such non- Watson-Crick base pairs include, but are not limited to, G:U Wobble or Hoogstein base pairing. The terms “complementary,” “fully complementary” and “substantially complementary” herein can be used with respect to the base matching between the sense strand and the antisense strand of a dsRNA, or between the antisense strand of an iRNA agent and a target sequence, as will be understood from the context of their use. As used herein, a polynucleotide that is “substantially complementary to at least part of” a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA encoding TTR). For example, a polynucleotide is complementary to at least a part of a TTR mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding TTR. Accordingly, in some embodiments, the antisense strand polynucleotides disclosed herein are fully complementary to the target TTR sequence. In other embodiments, the antisense strand polynucleotides disclosed herein are substantially complementary to the target TTR sequence and comprise a contiguous nucleotide sequence which is at least about 80% complementary over its entirelength to the equivalent region of the nucleotide sequence of SEQ ID NOs: 1, 3, 5, 7, or 9, or afragment of any one of SEQ ID NOs:1, 3, 5, 7, or 9, such as about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about % 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary. In one embodiment, an RNAi agent of the invention includes a sense strand that is substantially complementary to an antisense polynucleotide which, in turn, is complementary to a target TTR sequence, and wherein the sense strand polynucleotide comprises a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region ofthe nucleotide sequence of SEQ ID NOs: 2, 4, 6, 8, or 10, or a fragment of any one of SEQ ID NOs:2,4, 6, 8, or 10, such as about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about % 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary. In some embodiments, an iRNA of the invention includes an antisense strand that is substantially complementary to the target TTR sequence and comprises a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region of 21 ME151169145v.1 21 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO the nucleotide sequence of any one of the sense strands in Table 2, or a fragment of any one of the sense strands in Table 2, such as about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary, or 100% complementary. A “pharmaceutically acceptable salt” of the dsRNA of the invention being used in the methods of the invention includes any salt which is pharmaceutically acceptable, e.g., a sodium salt of the dsRNA agent. In one embodiment, the pharmaceutically acceptable salt of the dsRNA of the invention being used in the methods of the invention has the following structure: The term “inhibiting,” as used herein, is used interchangeably with “reducing,” “silencing,” “downregulating,” “suppressing” and other similar terms, and includes any level of inhibition. The phrase “inhibiting expression of a TTR gene,” as used herein, includes inhibition of expression of any TTR gene (such as, e.g., a mouse TTR gene, a rat TTR gene, a monkey TTR gene, or a human TTR gene) as well as variants or mutants of a TTR gene that encode a TTR protein. Thus, the TTR gene may be a wild-type TTR gene, a mutant TTR gene, or a transgenic TTR gene in the context of a genetically manipulated cell, group of cells, or organism. “Inhibiting expression of a TTR gene” includes any level of inhibition of a TTR gene, e.g., at least partial suppression of the expression of a TTR gene, such as an inhibition by at least about 20%. In certain embodiments, inhibition is by at least about 25%, at least about 30%, at least about 35%,at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%. 22 ME151169145v.1 22 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO The expression of a TTR gene may be assessed based on the level of any variable associated with TTR gene expression, e.g., TTR mRNA level or TTR protein level. The expression of a TTR gene may also be assessed indirectly based on, for example, the levels of circulating RBP4 protein, retinol, and / or vitamin A in a sample, such as a serum sample. Inhibition may be assessed by a decrease in an absolute or relative level of one or more of these variables compared with a control level. The control level may be any type of control level that is utilized in the art, e.g., a pre-dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control). In one embodiment, at least partial suppression of the expression of a TTR gene, is assessed by a reduction of the amount of TTR mRNA which can be isolated from, or detected, in a first cell or group of cells in which a TTR gene is transcribed and which has or have been treated such that the expression of a TTR gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has or have not been so treated (control cells). The degree of inhibition may be expressed in terms of: (mRNAincontrolcells) - (mRNAin treated cells) ^100 % (mRNAincontrol cells) Inhibition of the expression of a TTR protein may be manifested by a reduction in the level of the TTR protein that is expressed by a cell or group of cells or in a subject sample (e.g., the level of protein in a blood sample derived from a subject). As explained above, for the assessment of mRNA suppression, the inhibition of protein expression levels in a treated cell or group of cells may similarly be expressed as a percentage of the level of protein in a control cell or group of cells, or the change in the level of protein in a subject sample, e.g., blood or serum derived therefrom. The level of TTR mRNA that is expressed by a cell or group of cells may be determined using any method known in the art for assessing mRNA expression. In one embodiment, the level of expression of TTR in a sample is determined by detecting a transcribed polynucleotide, or portion thereof, e.g., mRNA of the TTR gene. RNA may be extracted from cells using RNA extraction techniques including, for example, using acid phenol / guanidine isothiocyanate extraction (RNAzol B; Biogenesis), RNeasyTM RNA preparation kits (Qiagen®) or PAXgeneTM (PreAnalytixTM, Switzerland). Typical assay formats utilizing ribonucleic acid hybridization include nuclear run-on assays, RT-PCR, RNase protection assays, northern blotting, in situ hybridization, and microarray analysis. In some embodiments, the level of expression of TTR is determined using a nucleic acid probe. The term “probe”, as used herein, refers to any molecule that is capable of selectively binding to a specific TTR. Probes can be synthesized by one of skill in the art, or derived from appropriate biological preparations. Probes may be specifically designed to be labeled. Examples of molecules 23 ME151169145v.1 23 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO that can be utilized as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules. Isolated mRNA can be used in hybridization or amplification assays that include, but are not limited to, Southern or northern analyses, polymerase chain reaction (PCR) analyses and probe arrays. One method for the determination of mRNA levels involves contacting the isolated mRNA with a nucleic acid molecule (probe) that can hybridize to TTR mRNA. In one embodiment, the mRNA is immobilized on a solid surface and contacted with a probe, for example by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane, such as nitrocellulose. In an alternative embodiment, the probe(s) are immobilized on a solid surface and the mRNA is contacted with the probe(s), for example, in an Affymetrix® gene chip array. A skilled artisan can readily adapt known mRNA detection methods for use in determining the level of TTR mRNA. An alternative method for determining the level of expression of TTR in a sample involves the process of nucleic acid amplification or reverse transcriptase (to prepare cDNA) of for example mRNA in the sample, e.g., by RT-PCR (the experimental embodiment set forth in Mullis, 1987, U.S. Patent No.4,683,202), ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sci. USA 88:189-193), self sustained sequence replication (Guatelli et al . (1990) Proc. Natl. Acad. Sci. USA 87:1874-1878), transcriptional amplification system (Kwoh et al . (1989) Proc. Natl. Acad. Sci. USA 86:1173-1177), Q-Beta Replicase (Lizardi et al . (1988) Bio / Technology 6:1197), rolling circle replication (Lizardi et al ., U.S. Patent No.5,854,033) or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers. In particular aspects of the invention, the level of expression of TTR is determined by quantitative fluorogenic RT-PCR (i.e., the TaqManTM System). The expression levels of TTR mRNA may be monitored using a membrane blot (such as used in hybridization analysis such as northern, Southern, dot, and the like), or microwells, sample tubes, gels, beads or fibers (or any solid support comprising bound nucleic acids). See U.S. Patent Nos. 5,770,722, 5,874,219, 5,744,305, 5,677,195 and 5,445,934, which are incorporated herein by reference. The determination of TTR expression level may also comprise using nucleic acid probes in solution. In some embodiments, the level of mRNA expression is assessed using branched DNA (bDNA) assays or real time PCR (qPCR). The level of TTR protein expression may be determined using any method known in the art for the measurement of protein levels. Such methods include, for example, electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, fluid or gel precipitin reactions, absorption spectroscopy, a colorimetric assays, spectrophotometric assays, flow cytometry, immunodiffusion (single or double), 24 ME151169145v.1 24 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO immunoelectrophoresis, western blotting, radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISAs), immunofluorescent assays, electrochemiluminescence assays, and the like. In some embodiments, the efficacy of the methods of the invention are assessed by a decreasein TTR mRNA or protein level (e.g., in a liver biopsy). In certain embodiments, a puncture liverbiopsy sample serves as the tissue material for monitoring the reduction in the TTR gene or protein expression. In other embodiments, a blood sample serves as the subject sample for monitoring the reduction in the TTR protein expression. A reduction in the expression of TTR may also be assessed indirectly by measuring a decrease in the circulating level of RBP4 protein, retinol, and / or vitamin A in a sample, such as a serum sample. In some embodiments, the efficacy of the methods of the invention can be monitored by detecting or monitoring a reduction in a symptom of a TTR-associate disorder, e.g., reduction in sensory neuropathy (e.g., paresthesia, hypesthesia in distal limbs), autonomic neuropathy (e.g., gastrointestinal dysfunction, such as gastric ulcer, or orthostatic hypotension), motor neuropathy, seizures, dementia, myelopathy, polyneuropathy, carpal tunnel syndrome, autonomic insufficiency, cardiomyopathy, vitreous opacities, renal insufficiency, nephropathy, substantially reduced mBMI (modified Body Mass Index), cranial nerve dysfunction, and corneal lattice dystrophy. It is well within the ability of one skilled in the art to monitor efficacy of the methods by measuring any one of such parameters, or any combination of parameters. In some embodiments of the methods of the invention, the iRNA is administered to a subject such that the iRNA is delivered to a specific site within the subject. The inhibition of expression of TTR may be assessed using measurements of the level or change in the level of TTR mRNA or TTR protein in a sample derived from fluid or tissue from the specific site within the subject (e.g., liver or blood). The phrase “contacting a cell with an RNAi agent,” such as a dsRNA, as used herein, includes contacting a cell by any possible means. Contacting a cell with an RNAi agent includes contacting a cell in vitro with the iRNA or contacting a cell in vivo with the iRNA. The contacting may be done directly or indirectly. Thus, for example, the RNAi agent may be put into physical contact with the cell by the individual performing the method, or alternatively, the RNAi agent may be put into a situation that will permit or cause it to subsequently come into contact with the cell. Contacting a cell in vitro may be done, for example, by incubating the cell with the RNAi agent. Contacting a cell in vivo may be done, for example, by injecting the RNAi agent into or near the tissue where the cell is located, or by injecting the RNAi agent into another area, e.g., the bloodstream or the subcutaneous space, such that the agent will subsequently reach the tissue where the cell to be contacted is located. For example, the RNAi agent may contain and / or be coupled to a ligand, e.g., GalNAc3, that directs the RNAi agent to a site of interest, e.g., the liver. Combinations of in vitro and in vivo methods of contacting are also possible. For example, a cell may also be contacted in vitro with an RNAi agent and subsequently transplanted into a subject. 25 ME151169145v.1 25 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO In one embodiment, contacting a cell with an iRNA includes “introducing” or “delivering the iRNA into the cell” by facilitating or effecting uptake or absorption into the cell. Absorption or uptake of an iRNA can occur through unaided diffusive or active cellular processes, or by auxiliary agents or devices. Introducing an iRNA into a cell may be in vitro and / or in vivo. For example, for in vivo introduction, iRNA can be injected into a tissue site or administered systemically. In vivo delivery can also be done by a beta-glucan delivery system, such as those described in U.S. Patent Nos.5,032,401 and 5,607,677, and U.S. Publication No.2005 / 0281781, the entire contents of which are hereby incorporated herein by reference. In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection. Further approaches are described herein below and / or are known in the art. As used herein, a “subject” is an animal, such as a mammal, including a primate (such as a human, a non-human primate, e.g., a monkey, and a chimpanzee), a non-primate (such as a cow, a pig, a camel, a llama, a horse, a goat, a rabbit, a sheep, a hamster, a guinea pig, a cat, a dog, a rat, a mouse, a horse, and a whale), or a bird (e.g., a duck or a goose). In an embodiment, the subject is a human, such as a human being treated or assessed for a disease, disorder or condition that would benefit from reduction in TTR expression; a human at risk for a disease, disorder or condition that would benefit from reduction in TTR expression; a human having a disease, disorder or condition that would benefit from reduction in TTR expression; and / or human being treated for a disease, disorder or condition that would benefit from reduction in TTR expression as described herein. In some embodiments, the human subject is suffering from a TTR-associated disease. In other embodiments, the subject is a subject at risk for developing a TTR-associated disease, e.g., a subject with a TTR gene mutation that is associated with the development of a TTR associated disease, a subject with a family history of TTR-associated disease, or a subject who has signs or symptoms suggesting the development of TTR associated disease without meeting the diagnostic criteria for a TTR-associated disease. As used herein, the terms “treating” or “treatment” refer to a beneficial or desired result, such as reducing at least one sign or symptom of a TTR-associated disorder in a subject. Treatment also includes a reduction of one or more sign or symptoms associated with unwanted TTR expression; diminishing the extent of unwanted TTR activation or stabilization; amelioration or palliation of unwanted TTR activation or stabilization. “Treatment” can also mean prolonging survival as compared to expected survival in the absence of treatment. The term “lower” in the context of a TTR-associated disease refers to a statistically significant decrease in such level. The decrease can be, for example, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or more. In certain embodiments, a decrease is at least 20%. ”Lower” in the context of the level of TTR in a subject is preferably down to a level accepted as within the range of normal for 26 ME151169145v.1 26 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO an individual without such disorder. In certain embodiments, “lower” is the decrease in the difference between the level of a marker or symptom for a subject suffering from a disease and a level accepted within the range of normal for an individual. The term “lower” can also be used in association with normalizing a symptom of a disease or condition, i.e. decreasing the difference between a level in a subject suffering from a TTR-associated disorder towards or to a level in a normal subject not suffering from a TTR-associated disorder. As used herein, if a disease is associated with an elevated value for a symptom, “normal” is considered to be the upper limit of normal. If a disease is associated with a decreased value for a symptom, “normal” is considered to be the lower limit of normal. As used herein, “prevention” or “preventing,” when used in reference to a disease, disorder or condition thereof, may be treated or ameliorated by a reduction in expression of a TTR gene, refers to a reduction in the likelihood that a subject will develop a symptom associated with such a disease,disorder, or condition, e.g., a symptom of a TTR-associated disorder, e.g., senile systemic amyloidosis(SSA), systemic familial amyloidosis, familial amyloidotic polyneuropathy (FAP), familial amyloidotic cardiomyopathy (FAC), leptomeningeal / Central Nervous System (CNS) amyloidosis, and Stargardt’s disease, e. The failure to develop a disease, disorder or condition, or the reduction in the development of a symptom associated with such a disease, disorder or condition (e.g., by at least about 10% on a clinically accepted scale for that disease or disorder), or the exhibition of delayed symptoms delayed (e.g., by days, weeks, months or years) is considered effective prevention. A “TTR-associated disease,” as used herein, is intended to include any disease associated with the TTR gene or protein. Such a disease may be caused, for example, by excess production of the TTR protein, by TTR gene mutations, by abnormal cleavage of the TTR protein, instability of TTR tetramers, by abnormal interactions between TTR and other proteins or other endogenous or exogenous substances. A “TTR-associated disease” includes any type of transthyretin-mediated amyloidosis (ATTR amyloidosis) wherein TTR plays a role in the formation of abnormal extracellular aggregates or amyloid deposits, e.g., either hereditary ATTR (h-ATTR) amyloidosis or non-hereditary ATTR (wtATTR) amyloidosis. TTR-associated diseases also include senile systemic amyloidosis (SSA), systemic familial amyloidosis, familial amyloidotic polyneuropathy (FAP), familial amyloidotic cardiomyopathy (FAC), leptomeningeal / Central Nervous System (CNS) amyloidosis, amyloidotic vitreous opacities, carpal tunnel syndrome, and Stargardt’s disease,. Symptoms of TTR amyloidosis include sensory neuropathy (e.g., paresthesia, hypesthesia in distal limbs), autonomic neuropathy (e.g., gastrointestinal dysfunction, such as gastric ulcer, or orthostatic hypotension), motor neuropathy, seizures, dementia, myelopathy, polyneuropathy, carpal tunnel syndrome, autonomic insufficiency, cardiomyopathy, vitreous opacities, renal insufficiency, nephropathy, substantially reduced mBMI (modified Body Mass Index), cranial nerve dysfunction, and corneal lattice dystrophy. "Therapeutically effective amount," as used herein, is intended to include the amount of an RNAi agent that, when administered to a subject having a TTR-associated disease, disorder, or condition, is sufficient to effective treatment of the disease (e.g., by diminishing, ameliorating or maintaining the existing disease or one or more symptoms of disease). The "therapeutically effective 27 ME151169145v.1 27 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO amount" may vary depending on the RNAi agent, how the agent is administered, the disease and its severity and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the subject to be treated. “Prophylactically effective amount,” as used herein, is intended to include the amount of an iRNA that, when administered to a subject having a TTR-associated disease, disorder, or condition, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease. Ameliorating the disease includes slowing the course of the disease or reducing the severity of later-developing disease. The "prophylactically effective amount" may vary depending on the iRNA, how the agent is administered, the degree of risk of disease, and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated. A "therapeutically-effective amount" or “prophylactically effective amount” also includes an amount of an RNAi agent that produces some desired local or systemic effect at a reasonable benefit / risk ratio applicable to any treatment. iRNA employed in the methods of the present invention may be administered in a sufficient amount to produce a reasonable benefit / risk ratio applicable to such treatment. A “fixed dose” (e.g., a dose in mg) means that one dose of an iRNA agent is used for all subjects regardless of any specific subject-related factors, such as weight. A fixed dose is different from a weight-based dose (e.g., a dose in mg / kg) which refers to a dose of the iRNA agent that will change depending on the subject’s weight. In certain embodiments, an RNAi agent is administered to the subject as a fixed dose of about 5 mg to about 1200 mg, about 25 mg to about 1200 mg, about 50 mg to about 1200 mg, about 75 mg to about 1200 mg, about 100 mg to about 1200 mg, about 150 mg to about 1200 mg, about 200 mg to about 1200 mg, about 250 mg to about 1200 mg, about 300 mg to about 1200 mg, about 350 mg to about 1200 mg, about 400 mg to about 1200 mg, about 450 mg to about 1200 mg, about 500 mg to about 1200 mg, about 550 mg to about 1200 mg, about 600 mg to about 1200 mg, about 700 mg to about 1200 mg, about 800 mg to about 1200 mg, about 900 mg to about 1200 mg, about 1000 mg to about 1200 mg, about 5 mg to about 600 mg, about 25 mg to about 600 mg, about 75 mg to about 600 mg, about 150 mg to about 600 mg, about 300 to about 600 mg, about 450 to about 600 mg, about 25 mg to about 100 mg, about 100 mg to about 150 mg, 150 mg to about 200 mg, 200 mg to about 250 mg, about 250 mg to about 300 mg, about 300 mg to about 350 mg, about 350 mg to about 400 mg, about 400 mg to about 450 mg, about 450 mg to about 500 mg, about 500 mg to about 550 mg, about 550 mg to about 600 mg, about 650 mg to about 700 mg, about 700 mg to about 750 mg, about 750 mg to about 800 mg, about 800 mg to about 850 mg, about 850 mg to about 900 mg, about 900 mg to about 950 mg, about 950 mg to about 1000 mg, about 1000 mg to about 1050 mg, about 1050 mg to about 1100 mg, about 1150 mg to about 1200 mg, about 5 mg to about 100 mg, about 25 mg to about 150 mg, about 75 mg to about 200 mg, about 100 mg to about 250 mg, about 150 mg to about 300 mg, about 200 mg to about 350 mg, about 250 mg to about 400 mg, about 300 mg to about 450 mg, 28 ME151169145v.1 28 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO about 350 mg to about 500 mg, about 400 mg to about 600 mg, about 500 mg to about 800 mg, about 600 mg to about 900 mg, or about 1100 mg to about 1200 mg. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a fixed dose of , e.g., a fixed dose of about 5 mg, about 25 mg, about 50 mg, about 75 mg, about 100 mg, about 150 mg, about 200 mg, about 250, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 600 mg, about 700 mg, about 800 mg, about 900 mg, about 1000 mg, about 1100 mg, or about 1200 mg. Values and ranges intermediate to the foregoing recited values are also intended to be part of this invention. The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human subjects and animal subjects without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio. The phrase "pharmaceutically-acceptable carrier" as used herein means a pharmaceutically- acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject being treated. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium state, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and / or polyanhydrides; (22) bulking agents, such as polypeptides and amino acids (23) serum component, such as serum albumin, HDL and LDL; and (22) other non-toxic compatible substances employed in pharmaceutical formulations. The term “lower” in the context of the level of TTR gene expression or TTR protein production in a subject, or a disease marker or symptom refers to a statistically significant decrease in such level. The decrease can be, for example, at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or below the level of detection for the detection method. In certain embodiments, the expression of the target is normalized, i.e., decreased towards or to a level accepted as within the range of normal for an individual without such disorder, e.g., 29 ME151169145v.1 29 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO normalization of body weight, blood pressure, or a serum lipid level. As used here, “lower” in a subject can refer to lowering of gene expression or protein production in a cell in a subject does not require lowering of expression in all cells or tissues of a subject. For example, as used herein, lowering in a subject can include lowering of gene expression or protein production in the liver of a subject. The term “sample,” as used herein, includes a collection of similar fluids, cells, or tissues isolated from a subject, as well as fluids, cells, or tissues present within a subject. Examples of biological fluids include blood, serum and serosal fluids, plasma, cerebrospinal fluid, ocular fluids, lymph, urine, saliva, and the like. Tissue samples may include samples from tissues, organs or localized regions. For example, samples may be derived from particular organs, parts of organs, or fluids or cells within those organs. In certain embodiments, samples may be derived from the liver (e.g., whole liver or certain segments of liver or certain types of cells in the liver, such as, e.g., hepatocytes). In some embodiments, a “sample derived from a subject” refers to blood or plasma drawn from the subject. II. Methods of the Invention The present invention provides methods for inhibiting the expression of a transthyretin (TTR) gene, and methods for treating or preventing at least one symptom in a subject suffering from or prone to suffering from a disease, disorder or condition that would benefit from reduction in expression of aTTR gene, e.g., a TTR-associated disease, e.g., transthyretin-mediated amyloidosis, and / or Stargardtdisease. The present invention also provides methods for decreasing Vitamin A levels and / or decreasing the formation of toxic Vitamin A metabolites in the retina of a subject, e.g., a subject suffering or prone to suffering from a disease, disorder or condition that would benefit from reductionin expression of a TTR gene, e.g., a TTR-associated disease, e.g., transthyretin-mediated amyloidosis,and / or Stargardt disease. The present invention further provides methods of halting progression of vision loss in a subject suffering from or prone to suffering from a disease, disorder or condition that would benefit from reduction in expression of a TTR gene, e.g., a TTR-associated disease, e.g., transthyretin-mediated amyloidosis, and / or Stargardt disease. The methods include administering to the subject a fixed dose of about 25 mg to about 1200 mg of a dsRNA agent, or a pharmaceutically acceptable salt thereof, of the invention. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a fixed dose of about 25 mg to about 1200 mg, about 50 mg to about 1200 mg, about 75 mg to about 1200 mg, about 100 mg to about 1200 mg, about 150 mg to about 1200 mg, about 200 mg to about 1200 mg, about 250 mg to about 1200 mg, about 300 mg to about 1200 mg, about 350 mg to about 1200 mg, about 400 mg to about 1200 mg, about 450 mg to about 1200 mg, about 500 mg to about 1200 mg, about 550 mg to about 1200 mg, about 600 mg to about 1200 mg, about 700 mg to about 1200 mg, about 800 mg to about 1200 mg, about 900 mg to about 1200 mg, about 1000 mg to about 1200 mg, about 25 mg to about 600 mg, about 75 mg to about 600 mg, about 150 mg to about 30 ME151169145v.1 30 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO 600 mg, about 300 to about 600 mg, about 450 to about 600 mg, about 25 mg to about 100 mg, about 100 mg to about 150 mg, 150 mg to about 200 mg, 200 mg to about 250 mg, about 250 mg to about 300 mg, about 300 mg to about 350 mg, about 350 mg to about 400 mg, about 400 mg to about 450 mg, about 450 mg to about 500 mg, about 500 mg to about 550 mg, about 550 mg to about 600 mg, about 650 mg to about 700 mg, about 700 mg to about 750 mg, about 750 mg to about 800 mg, about 800 mg to about 850 mg, about 850 mg to about 900 mg, about 900 mg to about 950 mg, about 950 mg to about 1000 mg, about 1000 mg to about 1050 mg, about 1050 mg to about 1100 mg, about 1150 mg to about 1200 mg, about 25 mg to about 150 mg, about 75 mg to about 200 mg, about 100 mg to about 250 mg, about 150 mg to about 300 mg, about 200 mg to about 350 mg, about 250 mg to about 400 mg, about 300 mg to about 450 mg, about 350 mg to about 500 mg, about 400 mg to about 600 mg, about 500 mg to about 800 mg, about 600 mg to about 900 mg, or about 1100 mg to about 1200 mg. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a fixed dose of , e.g., a fixed dose of about 25 mg, about 50 mg, about75 mg, about 100 mg, about 150 mg, about 200 mg, about 250, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 600 mg, about 700 mg, about 800 mg, about 900 mg, about 1000 mg, about 1100 mg, or about 1200 mg. In one embodiment, a TTR-associated disease, disorder, or condition includes, but is not limited to, any type of transthyretin-mediated amyloidosis (ATTR amyloidosis), e.g., either hereditary ATTR (h-ATTR) amyloidosis, or non-hereditary ATTR (wtATTR) amyloidosis; senile systemic amyloidosis (SSA), systemic familial amyloidosis, familial amyloidotic polyneuropathy (FAP), familial amyloidotic cardiomyopathy (FAC), leptomeningeal / Central Nervous System (CNS) amyloidosis, amyloidotic vitreous opacities, and an ocular disease, e.g., Stargardt’s disease. Accordingly, in one aspect, the present invention provides methods of treating a subject having a disorder that would benefit from reduction in TTR expression, e.g., a TTR-associated disease, such as transthyretin-mediated amyloidosis (ATTR amyloidosis), e.g., either hereditary ATTR (h-ATTR) amyloidosis, or non-hereditary ATTR (wtATTR) amyloidosis; senile systemic amyloidosis (SSA), systemic familial amyloidosis, familial amyloidotic polyneuropathy (FAP), familial amyloidotic cardiomyopathy (FAC), leptomeningeal / Central Nervous System (CNS) amyloidosis, amyloidotic vitreous opacities, and an ocular disease, e.g., Stargardt’s disease. The methods include administering to the subject a therapeutically effective amount of dsRNA agent, or a pharmaceutically acceptable salt thereof, that inhibits expression of TTR, thereby treating the disorder in the subject. In one embodiment, the TTR-associated disease is transthyretin-mediated amyloidosis. In one embodiment, the TTR-associated disease is Stargardt’s disease. In one aspect, the invention provides methods of preventing at least one symptom in a subject having a disorder that would benefit from reduction in TTR expression, e.g., a TTR-associated disease, e.g., transthyretin-mediated amyloidosis (ATTR amyloidosis), or Stargardt’s disease. The methods include administering to the subject a prophylactically effective amount of dsRNA agent, or 31 ME151169145v.1 31 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO a pharmaceutically acceptable salt thereof, that inhibits expression of TTR, thereby preventing at least one symptom in the subject. In addition, the present invention provides methods of inhibiting expression of TTR in a cell, such as a cell in a subject. The methods include contacting the cell with an RNAi agent or pharmaceutical composition comprising an iRNA agent of the invention. In the methods of the invention the cell may be contacted in vitro or in vivo, i.e., the cell may be within a subject. A cell suitable for treatment using the methods of the invention may be any cell that expresses a TTR gene. A cell suitable for use in the methods of the invention may be a mammalian cell, e.g., a primate cell (such as a human cell or a non-human primate cell, e.g., a monkey cell or a chimpanzee cell), a non-primate cell (such as a cow cell, a pig cell, a camel cell, a llama cell, a horse cell, a goat cell, a rabbit cell, a sheep cell, a hamster, a guinea pig cell, a cat cell, a dog cell, a rat cell, a mouse cell, a lion cell, a tiger cell, a bear cell, or a buffalo cell), a bird cell (e.g., a duck cell or a goose cell), or a whale cell. In one embodiment, the cell is a human cell, e.g., a human liver cell. TTR expression is inhibited in the cell by at least about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or about 100%. In preferred embodiments, TTR expression is inhibited by at least 20%. In one embodiment, the in vivo methods of the invention may include administering to a subject a composition containing an iRNA, where the iRNA includes a nucleotide sequence that is complementary to at least a part of an RNA transcript of the TTR gene of the mammal to be treated. When the organism to be treated is a mammal such as a human, the composition can be administered by any means known in the art including, but not limited to oral, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal and intrathecal), intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), nasal, rectal, and topical (including buccal and sublingual) administration. In certain embodiments, the compositions are administered by intravenous infusion or injection. In certain embodiments, the compositions are administered by subcutaneous injection, e.g., using a pre-filled syringe. In some embodiments, the administration is via a depot injection. A depot injection may release the iRNA, or a pharmaceutically acceptable salt thereof, in a consistent way over a prolonged time period. Thus, a depot injection may reduce the frequency of dosing needed to obtain a desired effect, e.g., a desired inhibition of TTR, or a therapeutic or prophylactic effect. A depot injection may also provide more consistent serum concentrations. Depot injections may include subcutaneous injections or intramuscular injections. In preferred embodiments, the depot injection is a subcutaneous injection. In some embodiments, the administration is via a pump. The pump may be an external pump or a surgically implanted pump. In certain embodiments, the pump is a subcutaneously implanted osmotic pump. In other embodiments, the pump is an infusion pump. An infusion pump may be used 32 ME151169145v.1 32 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO for intravenous, subcutaneous, arterial, or epidural infusions. In preferred embodiments, the infusion pump is a subcutaneous infusion pump. In other embodiments, the pump is a surgically implanted pump that delivers the iRNA, or a pharmaceutically acceptable salt thereof, to the liver. An iRNA, or a pharmaceutically acceptable salt thereof, of the invention may be present in a pharmaceutical composition, such as in a suitable buffer solution. The buffer solution may comprise acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof. In one embodiment, the buffer solution is phosphate buffered saline (PBS). The pH and osmolarity of the buffer solution containing the iRNA can be adjusted such that it is suitable for administering to a subject. Alternatively, an iRNA, or a pharmaceutically acceptable salt thereof, of the invention may be administered as a pharmaceutical composition, such as a dsRNA liposomal formulation. The mode of administration may be chosen based upon whether local or systemic treatment is desired and based upon the area to be treated. The route and site of administration may be chosen to enhance targeting. In one aspect, the present invention also provides methods for inhibiting the expression of a TTR gene in a mammal. The methods include administering to the mammal a composition comprising a dsRNA that targets a TTR gene in a cell of the mammal, thereby inhibiting expression of the TTR gene in the cell. Reduction in gene expression can be assessed by any methods known it the art and by methods, e.g. qRT-PCR, described herein. Reduction in protein production can be assessed by any methods known it the art and by methods, e.g. ELISA, enzymatic activity, described herein. For example, a reduction in the expression of TTR may be determined by determining the mRNA expression level of TTR using methods routine to one of ordinary skill in the art, e.g., Northern blotting, qRT-PCR; by determining the protein level of TTR using methods routine to one of ordinary skill in the art, such as Western blotting, immunological techniques. In certain embodiments, a puncture liver biopsy sample serves as the tissue material for monitoring the reduction in the TTR gene or protein expression. In other embodiments, a blood sample serves as the subject sample for monitoring the reduction in the TTR protein expression. A reduction in the expression of TTR may also be assessed indirectly by measuring a decrease in the level s of circulating RBP4 protein, retinol, and / or vitamin A in a sample, such as a serum sample. The present invention further provides methods of treatment in a subject in need thereof, e.g., a subject diagnosed with a TTR-associated disorder, such as transthyretin-mediated amyloidosis (ATTR amyloidosis), e.g., hereditary ATTR (h-ATTR) amyloidosis or non-hereditary ATTR (wtATTR) amyloidosis; senile systemic amyloidosis (SSA), systemic familial amyloidosis, familial amyloidotic polyneuropathy (FAP), familial amyloidotic cardiomyopathy (FAC), leptomeningeal / Central Nervous System (CNS) amyloidosis, and an ocular disease, e.g., Stargardt’s disease. The present invention further provides methods of prophylaxis in a subject in need thereof. The treatment methods of the invention include administering a dsRNA, or a pharmaceutically 33 ME151169145v.1 33 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO acceptable salt thereof, of the invention to a subject, e.g., a subject that would benefit from a reduction of TTR expression, in a prophylactically effective amount of a dsRNA, or a pharmaceutically acceptable salt thereof, targeting a TTR gene. Treatment of a subject that would benefit from a reduction and / or inhibition of TTR gene expression includes therapeutic treatment (e.g., a subject is having a TTR-associated disorder) and prophylactic treatment (e.g., the subject is not having a TTR-associated disorder or a subject may be at risk of developing a TTR-associated disorder). In some embodiments, the TTR-associated disorder is selected from the group consisting of transthyretin-mediated amyloidosis (ATTR amyloidosis), e.g., hereditary ATTR (h-ATTR) amyloidosis or non-hereditary ATTR (wtATTR) amyloidosis; senile systemic amyloidosis (SSA), systemic familial amyloidosis, familial amyloidotic polyneuropathy (FAP), familial amyloidotic cardiomyopathy (FAC), leptomeningeal / Central Nervous System (CNS) amyloidosis, and an ocular disease, e.g., Stargardt’s disease. In one embodiment, the subject has a TTR-associated amyloidosis and the method reduces anamyloid TTR deposit in said subject. In one embodiment, the ATTR is hereditary ATTR (h-ATTR).In one embodiment, the ATTR is non-hereditary ATTR (wt ATTR). In one embodiment, administration of the dsRNA agent or pharmaceutical composition to the subject improves at least one indicia of neurological impairment, quality of life, ongoing nerve damage, or cardiovascular impairment in the subject. In one embodiment, the subject is suffering from familial amyloidotic cardiomyopathy (FAC). In another embodiment, the subject is suffering from FAC with a mixed phenotype, i.e., a subject having both cardiac and neurological impairments. In yet another embodiment, the subject is suffering from FAP with a mixed phenotype, i.e., a subject having both neurological and cardiac impairments. In one embodiment, the subject is suffering from FAP that has been treated with an orthotopic liver transplantation (OLT). In another embodiment, the subject is suffering from senile systemic amyloidosis (SSA). In other embodiments of the methods of the invention, the subject is suffering from familial amyloidotic cardiomyopathy (FAC) and senile systemic amyloidosis (SSA). Normal-sequence TTR causes cardiac amyloidosis in people who are elderly and is termed senile systemic amyloidosis (SSA) (also called senile cardiac amyloidosis (SCA) or cardiac amyloidosis). SSA often is accompanied by microscopic deposits in many other organs. TTR mutations accelerate the process of TTR amyloid formation and are the most important risk factor for the development of clinically significant TTR amyloidosis (also called ATTR (amyloidosis-transthyretin type)). More than 85 amyloidogenic TTR variants are known to cause systemic familial amyloidosis. In some embodiments, the subject is suffering from transthyretin (TTR)-related familial amyloidotic polyneuropathy (FAP). Such subjects may suffer from ocular manifestations, such as vitreous opacity and glaucoma. It is known to one of skill in the art that amyloidogenic transthyretin (ATTR) synthesized by retinal pigment epithelium (RPE) plays important roles in the progression of 34 ME151169145v.1 34 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO ocular amyloidosis. Previous studies have shown that panretinal laser photocoagulation, which reduced the RPE cells, prevented the progression of amyloid deposition in the vitreous, indicating that the effective suppression of ATTR expression in RPE may become a novel therapy for ocular amyloidosis (see, e.g., Kawaji, T., et al., Ophthalmology. (2010) 117: 552-555). Another TTR- associated disease is hyperthyroxinemia, also known as “dystransthyretinemic hyperthyroxinemia” or “dysprealbuminemic hyperthyroxinemia”. This type of hyperthyroxinemia may be secondary to an increased association of thyroxine with TTR due to a mutant TTR molecule with increased affinity for thyroxine. See, e.g., Moses et al. (1982) J. Clin. Invest., 86, 2025-2033. In some embodiments, the TTR-associated disorder is an ocular disease, e.g., Stargardt’s disease. As used herein, the term “Stargardt’s Disease” refers to a genetic eye disorder that causes retinal degeneration and vision loss. Stargardt’s disease is a form of macular degeneration, and is also called “juvenile macular degeneration” or “Stargardt macular degeneration.” Stargardt Disease is the most common form of inherited macular degeneration, affecting about 30,000 people in the U.S. The progressive vision loss associated with Stargardt disease is caused by the degeneration of photoreceptor cells in the central portion of the retina called the macula. The macula is responsible for sharp central vision, which is needed for detailed tasks such as reading, driving, and recognizing faces. In most people with Stargardt’s Disease, a fatty yellow pigment (lipofuscin) builds up in cells underlying the macula. Over time, the abnormal accumulation of this substance can damage cells that are critical for clear central vision. In addition to central vision loss, people with Stargardt’s Disease have problems with night vision that can make it difficult to navigate in low light. Some affected individuals also have impaired color vision. The signs and symptoms of Stargardt’s Disease typically appear in late childhood to early adulthood and worsen over time. Increased synthesis and excessive accumulation of cytotoxic lipofuscin, e.g., lipid-protein- retinoid aggregates, in the RPE was shown in a mouse model of Stargardt’s disease (Abca4- / -). The major cytotoxic component of RPE lipofuscin is bisretinoid. Lipofuscin synthesis in the retina depends on the influx of serum retinol from the circulation into the RPE, and formation of the tertiary RBP4 / TTR / retinol complex in the serum is required for this influx. As shown by Racz et al, administering a non-retinoid RBP4 antagonist to Abca4- / - mice significantly reduced serum RBP4 levels and inhibited bisretinoid synthesis (Racz et al. J Biol Chem.2018, 20;293(29):11574-11588), which represents a potential treatment strategy for Stargardt’s disease and other disorders characterized by excessive accumulation of lipofuscin. A “TTR-associated ocular disorder” includes any ocular disease associated with the TTR and / or RBP4 gene or protein in the eye that would benefit from reduction in TTR expression. Such TTR-associated ocular diseases are characterized by, for example, accumulation of lipofuscin pigment such as Stargardt’s disease,. 35 ME151169145v.1 35 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO The iRNA, or a pharmaceutically acceptable salt thereof, can be administered by any known methods in the art. In some embodiments, the iRNA, or a pharmaceutically acceptable salt thereof, is administered to the subject intravenously, intramuscularly, or subcutaneously. The iRNA, or a pharmaceutically acceptable salt thereof, can be administered by intravenous infusion over a period of time, on a regular basis. In certain embodiments, after an initial treatment regimen, the treatments can be administered on a less frequent basis. Before administration of a full dose of the iRNA, or a pharmaceutically acceptable salt thereof, patients can be administered a smaller dose, such as a 5% infusion reaction, and monitored for adverse effects, such as an allergic reaction. In another example, the patient can be monitored for unwanted immunostimulatory effects, such as increased cytokine (e.g., TNF-alpha or INF-alpha) levels. Alternatively, the iRNA, or a pharmaceutically acceptable salt thereof, can be administered subcutaneously, i.e., by subcutaneous injection. One or more injections may be used to deliver the desired daily dose of iRNA, or a pharmaceutically acceptable salt thereof, to a subject. The injections may be repeated over a period of time. The administration may be repeated on a regular basis. In certain embodiments, after an initial treatment regimen, the treatments can be administered on a less frequent basis. A repeat-dose regimen may include administration of a therapeutic amount of iRNA, or a pharmaceutically acceptable salt thereof, on a regular basis, such as every other day or to once a year. In certain embodiments, the iRNA, or a pharmaceutically acceptable salt thereof, is administered about once per week, once every 7-10 days, once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, once every 10 weeks, once every 11 weeks, once every 12 weeks, once per month, once every 2 months, once every 3 months (once per quarter), once every 4 months, once every 5 months, or once every 6 months, or every 12 months. In certain embodiments, the iRNA, or a pharmaceutically acceptable salt thereof, is administered about once every 3 months (once per quarter). In certain embodiments, the iRNA, or a pharmaceutically acceptable salt thereof, is administered about once every 4 months. In certain embodiments, the iRNA, or a pharmaceutically acceptable salt thereof, is administered abou once every 5 months. In certain embodiments, the iRNA, or a pharmaceutically acceptable salt thereof, is administered about once every 6 months. In certain embodiments, the iRNA, or a pharmaceutically acceptable salt thereof, is administered about every 9 months. In certain embodiments, the iRNA, or a pharmaceutically acceptable salt thereof, is administered about every 12 months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 25 mg every three months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 100 mg every three months. 36 ME151169145v.1 36 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 300 mg every three months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 600 mg every three months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 900 mg every three months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 25 mg every six months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 100 mg every six months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 300 mg every six months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 600 mg every six months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 900 mg every six months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 25 mg every twelve months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 100 mg every twelve months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 300 mg every twelve months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 600 mg every twelve months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 900 mg every twelve months. In one embodiment, the method includes administering a composition featured herein such that expression of the target TTR gene is decreased, such as for about 1, 2, 3, 4, 5, 6, 7, 8, 12, 16, 18, 24 hours, 28, 32, or about 36 hours. In one embodiment, expression of the target TTR gene is decreased for an extended duration, e.g., at least about two, three, four days or more, e.g., about one week, two weeks, three weeks, or four weeks or longer. Administration of the dsRNA, or a pharmaceutically acceptable salt thereof, according to the methods of the invention may result in a reduction of the severity, signs, symptoms, and / or markers of such diseases or disorders in a patient. By “reduction” in this context is meant a statistically significant decrease in such level. The reduction can be, for example, at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or about 100%. 37 ME151169145v.1 37 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO Administration of the iRNA, or a pharmaceutically acceptable salt thereof, can reduce TTR levels, e.g., in a cell, tissue, blood, urine or other compartment of the patient by at least about 5%, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 39, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or at least about 99% or more. In one embodiment, administration of the iRNA, or a pharmaceutically acceptable salt thereof, can reduce TTR levels, e.g., in a cell, tissue, blood, urine or other compartment of the patient by at least 20%. Efficacy of treatment or prevention of disease can be assessed, for example by measuring disease progression, disease remission, symptom severity, reduction in pain, quality of life, dose of a medication required to sustain a treatment effect, level of a disease marker or any other measurable parameter appropriate for a given disease being treated or targeted for prevention. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters. Comparisons of the later readings with the initial readings provide a physician an indication of whether the treatment is effective. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters. In connection with the administration of an iRNA, or a pharmaceutically acceptable salt thereof, or pharmaceutical composition thereof, "effective against" a TTR-associated disorder indicates that administration in a clinically appropriate manner results in a beneficial effect for at least a statistically significant fraction of patients, such as a improvement of symptoms, a cure, a reduction in disease, extension of life, improvement in quality of life, or other effect generally recognized as positive by medical doctors familiar with treating the disorder and the related causes. In some embodiments, the efficacy of the methods of the invention can be measured by monitoring the severity of a symptom of a TTR-associated disorder, e.g., reduction insensory neuropathy (e.g., paresthesia, hypesthesia in distal limbs), autonomic neuropathy (e.g., gastrointestinal dysfunction, such as gastric ulcer, or orthostatic hypotension), motor neuropathy, seizures, dementia, myelopathy, polyneuropathy, carpal tunnel syndrome, autonomic insufficiency, cardiomyopathy, vitreous opacities, renal insufficiency, nephropathy, substantially reduced mBMI (modified Body Mass Index), cranial nerve dysfunction, and corneal lattice dystrophy. A treatment or preventive effect is evident when there is a statistically significant improvement in one or more parameters of disease status, or by a failure to worsen or to develop symptoms where they would otherwise be anticipated. As an example, a favorable change of at least 10% in a measurable parameter of disease, and preferably at least 20%, 30%, 40%, 50% or more can be indicative of effective treatment. Efficacy for a given iRNA drug or formulation of that drug can also be judged using an experimental animal model for the given disease as known in the art. In some embodiments, the methods further comprise determining the level of vitamin A, RBP4 and / or TTR in a sample(s) from the subject. 38 ME151169145v.1 38 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO The invention further provides administering to the subject an additional therapeutic agent for treating a subject that would benefit from reduction and / or inhibition of TTR expression, e.g., a subject having a TTR-associated disease disorder, or condition. The additional therapeutic agent can be any known pharmaceuticals and / or known therapeutic methods, such as, for example, those which are currently employed for treating these disorders. In some embodiments, the additional therapeutic agent is selected from the group consisting of an agent which inhibits the expression and / or activity of transthyretin (TTR), a TTR stabilizer, a non-steroidal anti-inflammatory agent (NSAIDS), e.g., diflunisal, and diuretics, a synthetic retinoid fenretinide, an anti-VEGF therapy, a corticosteroid, insulin, a glucagon-like peptide 1 agonist, a sulfonylurea, a seglitinide, a biguanide, a thiazolidinedione, an alpha-glucosidase inhibitor, an SGLT2 inhibitor, a DPP-4 inhibitor, an HMG- CoA reductase inhibitor, and a combination of any of the foregoing. A”TTR stabilizer” or a “therapeutic agent that stabilizes TTR” or “that stabilizes a TTR tetramer” is an agent that reduces or prevents the dissociation of the subunits of a TTR tetramer, e.g., into monomers. In some embodiments, the agent reduces the formation of TTR amyloid plaques, e.g., by reducing the level of TTR monomers or proteolytic fragments of TTR monomers that form TTR amyloid plaques. Such agents include, but are not limited to, tafamidis, diflunisal, and AG10. The iRNA agent and an additional therapeutic agent and / or treatment may be administered at the same time and / or in the same combination, e.g., subcutaneously, or the additional therapeutic agent can be administered as part of a separate composition or at separate times and / or by another method known in the art or described herein. III. Delivery of an iRNA of the Invention The delivery of an iRNA of the invention to a cell e.g., a cell within a subject, such as a human subject (e.g., a subject in need thereof, such as a subject having a TTR-associated disorder) can be achieved in a number of different ways. For example, delivery may be performed by contacting a cell with an iRNA of the invention either in vitro or in vivo. In vivo delivery may also be performed directly by administering a composition comprising a dsRNA, or a pharmaceutically acceptable salt thereof, to a subject. Alternatively, in vivo delivery may be performed indirectly by administering one or more vectors that encode and direct the expression of the iRNA. One or more injections may be used to deliver the desired fixed dose of iRNA to the subject. The injections may be repeated over a period of time. In some embodiments, the subcutaneous injection is achieved using a pre-filled syringe. The administration may be repeated on a regular basis. In certain embodiments, the iRNA is administered about once per month to about once per quarter, i.e., about every three months, or about once per quarter to about twice per year, i.e., about once every six months. In certain embodiments, the iRNA is administered once per month. In other embodiments, the iRNA is administered every three months (once per quarter). In yet another embodiment, the iRNA is administered every six months (biannually). In other embodiments, the iRNA is administer every twelve months (annually). 39 ME151169145v.1 39 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO In some embodiments, the fixed dose is administered to the subject at an interval of once every month to every two months. In some embodiments, the fixed dose is administered to the subject at an interval of once every three to six months. In some embodiments, the fixed dose is administered to the subject at an interval of once every six to twelve months. In some embodiments, the fixed dose is administered to the subject at an interval of once every month. In some embodiments, the fixed dose is administered to the subject at an interval of once every two months. In some embodiments, the fixed dose is administered to the subject at an interval of once every three months. In some embodiments, the fixed dose is administered to the subject at an interval of once every four months. In some embodiments, the fixed dose is administered to the subject at an interval of once every five months. In some embodiments, the fixed dose is administered to the subject at an interval of once every six months. In some embodiments, the fixed dose is administered to the subject at an interval of once every twelve months. In some embodiments, the method comprises administering to the subject a fixed dose of about 25 mg to about 1200 mg, about 50 mg to about 1200 mg, about 75 mg to about 1200 mg, about 100 mg to about 1200 mg, about 150 mg to about 1200 mg, about 200 mg to about 1200 mg, about 250 mg to about 1200 mg, about 300 mg to about 1200 mg, about 350 mg to about 1200 mg, about 400 mg to about 1200 mg, about 450 mg to about 1200 mg, about 500 mg to about 1200 mg, about 550 mg to about 1200 mg, about 600 mg to about 1200 mg, about 700 mg to about 1200 mg, about 800 mg to about 1200 mg, about 900 mg to about 1200 mg, about 1000 mg to about 1200 mg, about 25 mg to about 600 mg, about 75 mg to about 600 mg, about 150 mg to about 600 mg, about 300 to about 600 mg, about 450 to about 600 mg, about 25 mg to about 100 mg, about 100 mg to about 150 mg, 150 mg to about 200 mg, 200 mg to about 250 mg, about 250 mg to about 300 mg, about 300 mg to about 350 mg, about 350 mg to about 400 mg, about 400 mg to about 450 mg, about 450 mg to about 500 mg, about 500 mg to about 550 mg, about 550 mg to about 600 mg, about 650 mg to about 700 mg, about 700 mg to about 750 mg, about 750 mg to about 800 mg, about 800 mg to about 850 mg, about 850 mg to about 900 mg, about 900 mg to about 950 mg, about 950 mg to about 1000 mg, about 1000 mg to about 1050 mg, about 1050 mg to about 1100 mg, about 1150 mg to about 1200 mg, about 25 mg to about 150 mg, about 75 mg to about 200 mg, about 100 mg to about 250 mg, about 150 mg to about 300 mg, about 200 mg to about 350 mg, about 250 mg to about 400 mg, about 300 mg to about 450 mg, about 350 mg to about 500 mg, about 400 mg to about 600 mg, about 500 mg to about 800 mg, about 600 mg to about 900 mg, or about 1100 mg to about 1200 mg, e.g., a fixed dose of about 25 mg, about 50 mg, about 75 mg, about 100 mg, about 150 mg, about 200 mg, about 250, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 600 mg, about 700 mg, about 800 mg, about 900 mg, about 1000 mg, about 1100 mg, or about 1200 mg, of a dsRNA agent, or a pharmaceutically acceptable salt thereof, that inhibits expression of TTR. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 25 mg every three months. 40 ME151169145v.1 40 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 100 mg every three months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 300 mg every three months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 600 mg every three months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 900 mg every three months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 25 mg every six months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 100 mg every six months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 300 mg every six months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 600 mg every six months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 900 mg every six months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 25 mg every twelve months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 100 mg every twelve months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 300 mg every twelve months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 600 mg every twelve months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 900 mg every twelve months. IV. iRNAs for Use in the Methods of the Invention Suitable double stranded RNAi agents for use in the methods of the invention include the dsRNA agent AD-649264. AD-649264 comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- csasagagUfaUfUfCfcauuuuuacu -3’ of SEQ ID NO:17 and the antisense strand comprises the nucleotide sequence 5’- asGfsuaaAfaauggaaUfaCfucuugsgsu -3’ of SEQ ID NO:19, wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; Af, Cf, Gf and Uf are 2’-fluoro (2’-F) A, C, G and U; 41 ME151169145v.1 41 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO and s is a phosphorothioate linkage; and wherein a ligand is conjugated to the 3’ end of the sense strand as shown in the following schematic wherein X is O. Suitable double stranded RNAi agents for use in the methods of the invention also include a pharmaceutically acceptable salt form of the dsRNA agent AD-649264. Any salt that is pharmaceutically acceptable, e.g., a sodium salt of the dsRNA agent, may be used. In one embodiment, the pharmaceutically acceptable salt of the dsRNA of the invention being used in the methods of the invention has the following structure: Additional dsRNA agents that may be used in the methods of the invention are described inInternational PCT Publication No. WO 2023 / 014677, the entire contents of which are incorporatedherein by reference. 42 ME151169145v.1 42 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO V. Pharmaceutical Compositions of the Invention The present invention also includes pharmaceutical compositions and formulations which include the iRNAs of the invention. In one embodiment, provided herein are pharmaceutical compositions containing an iRNA, as described herein, and a pharmaceutically acceptable carrier. The pharmaceutical compositions containing the iRNA of the invention are useful for treating a disease or disorder associated with the expression or activity of a TTR gene, e.g., a TTR-associated disease. Such pharmaceutical compositions are formulated based on the mode of delivery. The pharmaceutical compositions comprising RNAi agents of the invention may be, for example, solutions with or without a buffer, or compositions containing pharmaceutically acceptable carriers. Such compositions include, for example, aqueous or crystalline compositions, liposomal formulations, micellar formulations, emulsions, and gene therapy vectors. In the methods of the invention, the RNAi agent may be administered in a solution. In some embodiments, the solution is a sterile solution. An RNAi agent may be administered in an unbuffered solution, e.g., in saline or in water. Alternatively, the RNAi agent may also be administered in a suitable buffer solution. The buffer solution may comprise acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof. In one embodiment, the buffer solution is phosphate buffered saline (PBS). The pH and osmolarity of the buffer solution containing the RNAi agent can be adjusted such that it is suitable for administering to a subject. In some embodiments, the pharmaceutical composition comprises a sterile formulation in a phosphate buffer. In some embodiments, the pharmaceutical composition has a pH of 7.0. In some embodiments, the pharmaceutical composition comprises a sterile formulation in a 5 mM phosphate buffer with a pH of 7.0. In some embodiments, the pharmaceutical composition comprises a dsRNA agent (e.g., AD- 649264), or a pharmaceutically acceptable salt thereof. In some embodiments, the pharmaceutical composition comprises, per vial (e.g., a 0.5 mL vial), about 100 mg of a dsRNA agent (e.g., AD-649264), or about 106 mg of a pharmaceutically acceptable salt thereof, e.g., sodium form of AD-649264. In some embodiments, the pharmaceutical composition comprises about 200 mg / mL of a dsRNA agent (e.g., AD-649264), or about 212 mg / mL of a pharmaceutically acceptable salt thereof, e.g., sodium form of AD-649264. In some embodiments, the pharmaceutical composition comprises a dsRNA agent (e.g., AD- 649264), or a pharmaceutically acceptable salt thereof, and a buffer, e.g., sodium dihydrogen phosphate dihydrate, and / or di-sodium hydrogen phosphate anhydrous. In some embodiments, the pharmaceutical composition comprises, per vial (e.g., a 0.5 mL vial), about 100 mg of a dsRNA agent (e.g., AD-649264), or about 106 mg of a pharmaceutically acceptable salt thereof, e.g., sodium form of AD-649264, about 0.184 mg of sodium dihydrogen phosphate dihydrate, and about 0.188 mg of di-sodium hydrogen phosphate anhydrous. 43 ME151169145v.1 43 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO In some embodiments, the pharmaceutical composition comprises about 200 mg / mL of a dsRNA agent (e.g., AD-649264), or about 212 mg / mL of a pharmaceutically acceptable salt thereof, e.g., sodium form of AD-649264, about 0.367 mg / mL of sodium dihydrogen phosphate dihydrate, and about 0.376 mg / mL of di-sodium hydrogen phosphate anhydrous. In some embodiments, the pharmaceutical composition further comprises a diluent, e.g., water, and / or an agent for adjusting the pH, e.g., phosphoric acid, and / or sodium hydroxide. In some embodiments, compendial grade phosphoric acid at 0.3N or sodium hydroxide at 0.25N may be used as needed to adjust the pH of the composition. In some embodiments, the pharmaceutical composition comprises, per vial (e.g., a 0.5 mL vial), about 100 mg of a dsRNA agent (e.g., AD-649264), or about 106 mg of a pharmaceutically acceptable salt thereof, e.g., sodium form of AD-649264, about 0.184 mg of sodium dihydrogen phosphate dihydrate, about 0.188 mg of di-sodium hydrogen phosphate anhydrous, water, phosphoric acid and sodium hydroxide. In some embodiments, the pharmaceutical composition comprises about 200 mg / mL of a dsRNA agent (e.g., AD-649264), or about 212 mg / mL of a pharmaceutically acceptable salt thereof, e.g., sodium form of AD-649264, about 0.367 mg / mL of sodium dihydrogen phosphate dihydrate, about 0.376 mg / mL of di-sodium hydrogen phosphate anhydrous, water, phosphoric acid and sodium hydroxide. In some embodiments, the buffer solution further comprises an agent for controlling the osmolarity of the solution, such that the osmolarity is kept at a desired value, e.g., at the physiologic values of the human plasma. Solutes which can be added to the buffer solution to control the osmolarity include, but are not limited to, proteins, peptides, amino acids, non-metabolized polymers, vitamins, ions, sugars, metabolites, organic acids, lipids, or salts. In some embodiments, the agent for controlling the osmolarity of the solution is a salt. In certain embodiments, the agent for controlling the osmolarity of the solution is sodium chloride or potassium chloride. In some embodiments, the pharmaceutical compositions of the invention are pyrogen free or non-pyrogenic. The pharmaceutical compositions of the present invention can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration can be topical (e.g., by a transdermal patch), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal, e.g., via an implanted device; or intracranial, e.g., by intraparenchymal, intrathecal or intraventricular, administration. One example is compositions that are formulated for systemic administration via parenteral delivery, e.g., by subcutaneous (SC), intramuscular (IM), or intravenous (IV) delivery. The pharmaceutical compositions of the invention may be administered in dosages sufficient to inhibit expression of a TTR gene. In some embodiments, a fixed dose of about 25 mg to about 1200 mg of 44 ME151169145v.1 44 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO the iRNA agents is administered to the subject. In some embodiments, the method comprises administering to the subject a fixed dose of about 25 mg to about 1200 mg, about 50 mg to about 1200 mg, about 75 mg to about 1200 mg, about 100 mg to about 1200 mg, about 150 mg to about 1200 mg, about 200 mg to about 1200 mg, about 250 mg to about 1200 mg, about 300 mg to about 1200 mg, about 350 mg to about 1200 mg, about 400 mg to about 1200 mg, about 450 mg to about 1200 mg, about 500 mg to about 1200 mg, about 550 mg to about 1200 mg, about 600 mg to about 1200 mg, about 700 mg to about 1200 mg, about 800 mg to about 1200 mg, about 900 mg to about 1200 mg, about 1000 mg to about 1200 mg, about 25 mg to about 600 mg, about 75 mg to about 600 mg, about 150 mg to about 600 mg, about 300 to about 600 mg, about 450 to about 600 mg, about 25 mg to about 100 mg, about 100 mg to about 150 mg, 150 mg to about 200 mg, 200 mg to about 250 mg, about 250 mg to about 300 mg, about 300 mg to about 350 mg, about 350 mg to about 400 mg, about 400 mg to about 450 mg, about 450 mg to about 500 mg, about 500 mg to about 550 mg, about 550 mg to about 600 mg, about 650 mg to about 700 mg, about 700 mg to about 750 mg, about 750 mg to about 800 mg, about 800 mg to about 850 mg, about 850 mg to about 900 mg, about 900 mg to about 950 mg, about 950 mg to about 1000 mg, about 1000 mg to about 1050 mg, about 1050 mg to about 1100 mg, about 1150 mg to about 1200 mg, about 25 mg to about 150 mg, about 75 mg to about 200 mg, about 100 mg to about 250 mg, about 150 mg to about 300 mg, about 200 mg to about 350 mg, about 250 mg to about 400 mg, about 300 mg to about 450 mg, about 350 mg to about 500 mg, about 400 mg to about 600 mg, about 500 mg to about 800 mg, about 600 mg to about 900 mg, or about 1100 mg to about 1200 mg, e.g., about 25 mg, about 50 mg, about 75 mg, about 100 mg, about 150 mg, about 200 mg, about 250, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 600 mg, about 700 mg, about 800 mg, about 900 mg, about 1000 mg, about 1100 mg, or about 1200 mg, of a dsRNA agent, or a pharmaceutically acceptable salt thereof, that inhibits expression of TTR. A repeat-dose regimen may include administration of a therapeutic amount of iRNA on a regular basis, such as every month, every two months, every three months, every four months, every five months, every six months, once every 3-6 months, or once a year. In certain embodiments, the iRNA is administered about once per month to about once per quarter to about once per six months to about once per twelve months. After an initial treatment regimen, the treatments can be administered on a less frequent basis. Duration of treatment can be determined based on the severity of disease. The skilled artisan will appreciate that certain factors can influence the dosage and timing required to effectively treat a subject, including but not limited to mutations present in the subject, previous treatments, the general health or age of the subject, and other diseases present. Moreover, treatment of a subject with a prophylactically or therapeutically effective amount, as appropriate, of a composition can include a single treatment or a series of treatments. The RNAi agent can be delivered in a manner to target a particular tissue (e.g., hepatocytes). 45 ME151169145v.1 45 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions can be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids, and self-emulsifying semisolids. Formulations include those that target the liver. The pharmaceutical formulations of the present invention, which can conveniently be presented in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers. VII. Kits The present invention also provides kits for performing any of the methods of the invention. Such kits include one or more RNAi agent(s) and instructions for use, e.g., instructions for administering a fixed dose of a double stranded RNAi agent(s). The double stranded RNAi agent may be in a vial or a pre-filled syringe. The kits may optionally further comprise means for administering the double stranded RNAi agent (e.g., an injection device, such as a pre-filled syringe), or means for measuring the inhibition of TTR (e.g., means for measuring the inhibition of TTR mRNA, TTR protein, and / or TTR activity). Such means for measuring the inhibition of TTR may comprise a means for obtaining a sample from a subject, such as, e.g., a plasma sample. The kit may be packaged in a number of different configurations such as one or more containers in a single box. The different components can be combined, e.g., according to instructions provided with the kit. The kits of the invention may optionally further comprise means for determining the therapeutically effective or prophylactically effective amount. The present invention also provides vials comprising the dsRNA agent, or a pharmaceutically acceptable salt thereof, of the invention or the pharmaceutical composition of the invention. The present invention further provides syringes comprising the dsRNA agent, or a pharmaceutically acceptable salt thereof, of the invention or the pharmaceutical composition of the invention. In some embodiments, the RNAi agent (e.g., AD-649264), or a pharmaceutically acceptable salt thereof, described herein is administered (e.g., subcutaneously) in a syringe, such as a pre-filled syringe to a subject in need thereof. Pre-filled syringes are designed to fit into specialized syringes, which can be used to administer the RNAi agent, or a pharmaceutically acceptable salt thereof, described herein. Pre-filled syringes offer several advantages including convenience, affordability, accuracy, sterility, and safety (Makwana et al., Int J Pharm Investig.2011 Oct-Dec; 1(4): 200–206; incorporated in its entirety herein by reference). Pre-filled syringes also assure that patients receive accurate dosages. This is especially advantageous for patients who need to self-inject medication, but have no medical training. In some embodiments, the RNAi agent (e.g., AD-649264) stored inside of a pre-filled syringe is in a sterile solution. 46 ME151169145v.1 46 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO In some embodiments the pre-filled syringe is made of glass. In some embodiments the pre- filled syringe is made of plastic. In some embodiments, the kit further comprises instructions, for example, for administering the RNAi agent (e.g., AD-649264), or a pharmaceutically acceptable salt thereof, in a syringe, such as a pre-filled syringe. For example, the instructions may be performed under the supervision of a drug investigator. These instructions simply embody the disclosure provided herein. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the iRNAs and methods featured in the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. 47 ME151169145v.1 47 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO EXAMPLES Example 1. A Phase 1, Randomized, Double-Blind, Placebo-Controlled, Single-Ascending Dose Study to Evaluate the Safety, Tolerability, Pharmacokinetics, and Pharmacodynamics of Subcutaneously Administered ALN-TTRsc04 in Healthy Subjects In this study, single ascending doses (SAD) of AD-649264 (ALN-TTRsc04) were administered subcutaneously in healthy subjects, including subjects of Japanese descent. The primary objective of this study was to evaluate the safety and tolerability of single doses of AD-649264. Secondary objectives included the evaluation of the pharmacokinetics (PK) and pharmacodynamic (PD) effects of AD-649264. The unmodified and modified sequences for AD-649264 are included in Table 2 below. The modified dsRNA agent used in the study was conjugated to the ligand L96, whose structure is shown in Table 1. Table 2. Sequences of AD-649264 Summary of Study Design This is a phase 1, randomized, double-blind, placebo-controlled single ascending dose studydesigned to evaluate the safety, tolerability, PK, and PD effects of AD-649264 administered subcutaneously (SC) in healthy subjects. Healthy male and female subjects, age 18 to 65 years, inclusive, were enrolled in this study. Subjects were enrolled in single ascending dose cohorts. Each cohort was randomized in a 3:1 ratio to receive a single dose of ALN-TTRsc04 or placebo. There were 8 subjects in each cohort. AD-649264 was supplied as a sterile solution for SC injection. The control drug for this study was a placebo (normal saline 0.9% for SC administration) administered identically to AD-649264. The estimated total duration of study participation is up to 20 months (approximately 2 months screening period + 12 months evaluation period + up to 6 months PD and safety monitoring period in subjects whose TTR levels have not returned to 80% of baseline by the end of the 12-month evaluation period), as follows: ^Screening Period: up to 6 weeks (Day -42 to Day -2)^ Evaluation Period: 12 months (Day -1 to Day 360)^ Monitoring Period (for certain subjects): up to 6 months after the last postdosefollow-up for subjects who received AD-649264 and have serum TTR levels that 48 ME151169145v.1 48 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO have not returned to ≥80% of predose Day 1 level by the last postdose follow-up visit (Day 360) Subjects were screened from Day -42 to Day -2. Eligible subjects were admitted to the clinical study center on Day -1 (but may be admitted as early as Day -2) to determine continued eligibility and for predose and postdose assessments. Subjects in each cohort were randomized on Day 1 predose and received a single dose of study drug (AD-649264 or placebo). Subjects were discharged from the clinical study center on Day 4 after completing the 72-hour postdose follow-up assessments. Subjects returned to the clinical study center on an outpatient basis for safety, tolerability, PK, and PD assessments at specific time points through the last postdose follow-up visit (Day 360). Subjects remained blinded to the treatment assignment through the last postdose follow-up visit (Day 360) until unblinding. Each cohort would be unblinded when all subjects in an individual cohort had completed the Day 360 visit or withdrawn from the study. For subjects who received active study drug, if serum TTR levels have not returned to ≥80% of their predose Day 1 level by the Day 360 follow-up visit, TTR, vitamin A levels, and safety would be monitored every 90 days at PD and Safety Monitoring Visits until serum TTR levels return to ≥80% of their predose Day 1 level, or for a maximum of 6 months after Day 360, whichever occurs first; exploratory blood samples were also collected on the same days TTR and vitamin A levels are collected after Day 360. For women of child-bearing potential, safety monitoring may be further assessed every 90 days (±14 days) until serum TTR levels return to ~80% of the predose D1 level or the normal range, whichever is lower, or until study participation is determined to be complete. Additional safety laboratory samples can be collected and assessed, including after the final postdose follow-up visit (Day 360), if the results show abnormal values. A subject would be considered to have reached the end of the study upon completing the End of Study (EOS) visit (ET or Day 360 visit). For subjects who have not achieved PD recovery to ≥80% of the predose Day 1 level TTR levels by the EOS visit, the end of study was defined as the date of PD recovery of TTR to ≥80% of the predose Day 1 level or 6 months after the EOS visit, whichever comes first. Figure 1 shows the overall study design and the cohort progression plan. Study cohort progression and dose escalation rules were based on safety findings. For each dose progression / escalation, the decision to proceed to dosing the next cohort and the actual dose administered would be determined based on review of at least 4 days of postdose safety and tolerability data from all subjects in the current cohort and cumulative safety data (e.g., if a safety signal is observed, then a de-escalation cohort maybe initiated). Inclusion Criteria Participants are eligible to be included in the study if all the following criteria apply: Age and Sex 49 ME151169145v.1 49 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO 1. Male or female, aged 18-65 years, inclusive Subject Characteristics 2. Body mass index (BMI) ≥18.0 kg / m2and ≤30 kg / m2assessed at Screening. 3. For Japanese cohorts, subjects of Japanese descent are defined as: the subject must have been born in Japan, and subject’s biological parents and grandparents must have been of Japanese origin. Informed Consent 4. Subject can understand and is willing and able to comply with the study requirements and to provide written informed consent. Exclusion Criteria Study participants are excluded from the study if any of the following criteria apply: Laboratory Assessments 1. Has an eGFR <90 mL / min / 1.73m2at screening (calculation will be based on the Chronic Kidney Disease Epidemiology Collaboration [CKD-EPI] formula). 2. Any safety laboratory result considered clinically significant and unacceptable by the Investigator (tests may be repeated to establish clinical significance), or any of the following: ^ALT, AST, or direct bilirubin above the upper limit of normal (ULN);^ Indirect bilirubin ≥1.5×ULN;^ Platelets or hemoglobin below the lower limit of normal; or^ Any white blood cell value outside the normal range at Screening that isclinically significant in the opinion of the Investigator. 3. Clinical laboratory evidence of active infection with human immunodeficiency virus or hepatitis B virus or hepatitis C virus (HCV) by serology. 4. Systolic blood pressure ≥140 mmHg or diastolic blood pressure of ≥90 mmHg after 10 minutes supine rest at Screening. 5. Any 12-lead electrocardiogram (ECG) finding considered clinically significant and unacceptable by the Investigator at Screening. Prior / Concomitant Therapy 6. Used prescription medications (or herbal or homeopathic preparations that the Investigator considers likely to interfere with the study) within 14 days or 7 half-lives (whichever is longer) before administration of study drug, with the exception of hormone replacement therapy and contraceptives. 7. Received blood or blood products within 90 days before administration of study drug. 8. Donated or plans to donate more than 500 mL of blood within 90 days before administration of study drug and for up to 90 days after postdose follow-up is completed. 50 ME151169145v.1 50 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO 9. Received an investigational agent within the last 30 days or 5 half-lives of the agent, whichever is longer, prior to the first dose of study drug, or are in follow-up for another clinical study prior to study enrollment. Any agent that has received authorization (including for emergency use) by local or regional regulatory authorities is not considered investigational. Medical Conditions 10. Clinically relevant history or presence of respiratory, gastrointestinal, renal, cardiovascular, hepatic, hematological, lymphatic, neurological, psychiatric, musculoskeletal, genitourinary, immunological, and other inflammatory diseases, or dermatological (including eczema and dermatitis) or connective tissue diseases or disorders. 11. Active serious mental illness or psychiatric disorder, including but not limited to schizophrenia, bipolar disorder, or severe depression requiring current pharmacological intervention. 12. History of multiple drug allergies or history of allergic reaction to any component of or excipient in the study drug. 13. History of intolerance to SC injection(s) or significant abdominal scarring or tattoos that could potentially hinder study drug administration or evaluation of local tolerability. 14. Clinically significant illness within 7 days before the administration of study drug and other medical conditions or comorbidities which, in the opinion of the Investigator, would interfere with study compliance or data interpretation. Contraception, Pregnancy, and Breastfeeding 15. Is not willing to comply with the contraceptive requirements during the study period 16. Female patient is pregnant, planning a pregnancy, or breast-feeding. Alcohol and Drug Use 17. Unwilling or unable to limit alcohol consumption throughout the course of the study. Alcohol intake of >2 units / day is excluded during the study (unit:1 glass of wine [approximately 125 mL] = 1 measure of spirits [approximately 1 fluid ounce] = 1 / 2 pint of beer [approximately 284 mL]). 18. Use of tobacco in any form (eg, smoking or chewing) or other nicotine-containing products in any form (e.g., gum, patch, e-cigarettes). 19. History of alcohol abuse, within the last 12 months before screening, in the opinion of the Investigator. 20. History of drug abuse that in the opinion of the Investigator would interfere with compliance with study procedures or follow-up visits. 21. Urine drug test at Screening confirmed positive for 1 or more of the drugs (such as amphetamines, barbiturates, benzodiazepines, cannabinoids, opioids, cocaine, and methadone) inconsistent with the use of prescribed medication and / or an over-the-counter medication. 51 ME151169145v.1 51 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO Dose and Administration Subjects were administered study drug (AD-649264 or placebo) by SC injection. The startingdose of AD-649264 for subjects in Cohort 1 was 5 mg. The maximum dose administered did not exceed 1200 mg. Dosing regimens can be adjusted in line with evolving safety, tolerability, and available PD data. At least 9 cohorts were planned for this study; up to 6 additional cohorts may also be included. The following were planned cohorts and dose levels; ^Cohort 1: 5 mg^ Cohort 2: 25 mg^ Cohort 3: 100 mg^ Cohort 4: 300 mg^ Cohort 5: 600 mg^ Cohort 6: 900 mg^ Cohort 7 (Subjects of Japanese descent): To be determined (TBD)^ Cohort 8 (Subjects of Japanese descent): TBD^ Cohort 9 (Subjects of Japanese descent): TBD^ Cohort 10 (Optional): TBD^ Cohort 11 (Optional): TBD^ Cohort 12 (Optional): ≤1200 mg^ Cohort 13 (Optional – Vitamin A after Day 90 visit): TBD^ Cohort 14 (Optional – Vitamin A after Day 90 visit): TBD^ Cohort 15 (Optional – Vitamin A after Day 90 visit): TBDSubjects of Japanese descent are administered a dose that has shown to be safe and tolerable in a prior cohort. Japanese and Optional Cohorts may be enrolled prior to Cohort 6 but not given a dose higher than already administered in prior cohorts. Subjects in Optional Cohorts 13, 14, and 15 are not supplemented with vitamin A before their Day 90 visit. After the Day 90 visit, subjects in these cohorts are instructed to begin supplementation with vitamin A at the recommended daily allowance. These subjects are administered a study drug dose that has been shown to be safe and tolerable in a prior cohort. Additionally, optional cohorts may be enrolled and dosed according to the same eligibility criteria and randomization scheme as the planned cohorts to better define dose response and / or safety and tolerability. A decision to increase the size of an existing cohort from 8 subjects to 12 subjects may also be made to further characterize the safety, tolerability, and / or PD of the study drug; the additional 4 subjects are enrolled according to the same eligibility criteria and are randomized 3:1 to receive a single dose of ALN-TTRsc04 or placebo, respectively. Study Assessments 52 ME151169145v.1 52 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO Pharmacodynamic (PD) parameters include the levels of serum TTR, RBP, and vitamin A. Blood samples were collected for assessment of PD parameters at various time points during the study. PD analysis provides the comparison of change from baseline in TTR, RBP, and vitamin A for each subject in AD-649264 dose groups and placebo. An optional blood sample for exploratory biomarker analysis was also collected. Blood and urine samples were collected for assessment of ALN-TTRsc04 pharmacokinetic (PK) parameters at various time points. The concentration of ALN-TTRsc04 was determined using a validated assay. Single dose SC PK parameters include but will not be limited to maximum plasma concentration (Cmax), time to maximum plasma concentration, area under the concentration time curve (AUC), and fraction excreted in urine (fe). Other parameters may be calculated, if deemed necessary. Plasma concentrations, amount in urine, and PK parameters are summarized by dose and cohort. An optional blood sample for exploratory metabolite analysis was be collected at the time points (Exploratory PK Profiling). The assessment of safety during the course of the study consist of the surveillance and recording of adverse events (AEs), including serious adverse events (SAEs). Safety was also assessed through vital signs, ECG findings, clinical laboratory assessments, and physical examinations. Use of prior and concomitant medications and measurements of weight and height were also recorded. Results In this Phase I study, healthy subjects were subcutaneously administered a single 5 mg, 25 mg, 100 mg, 300 mg, 600 mg or 900 mg dose of AD-649264 or placebo on Day 1. Blood samples were collected prior to administration of AD-649264 or placebo, on Day 3, and weekly for 6 weeks after administration, and at week 8 post treatment, and then every 3 months during the follow-up period up to 180 days. All doses of AD-649264 had been well-tolerated to date. No adverse events were related to study drug, and all adverse events were mild or moderate in severity. Serum TTR level was determined by solid phase sandwich ELISA and lowering of TTR from baseline was determined at each of the time points. Figure 2 depicts the effects of administration of a single 5 mg, 25 mg and 100 mg dose of AD-649264 on the level of serum TTR. Figure 3 depicts the effects of administration of a single 300 mg of AD-649264 on the level of serum TTR. As demonstrated, a rapid and sustained serum TTR knockdown was achieved upon administration of a single dose of AD-649264. In particular, a single 300 mg dose of AD-649264 resulted in a rapid serum TTR reduction of >90% at Day 15, a mean TTR reduction of 97% at Day 29, and a sustained TTR reduction of >93% through to Day 180. These data demonstrate a durable dose-dependent reduction of TTR after treatment with a single dose of AD-649264. In addition, a greater than 90% reduction in serum TTR levels was observed in subjects receiving a single 300 mg dose of AD-649264, and the reduction in TTR 53 ME151169145v.1 53 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO persisted for 6 months, indicating that AD-649264 had a prolonged duration of action, and could be administered at an infrequent dosing interval, e.g, annual dosing regimen. 54 ME151169145v.1 54 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO Table 1. Abbreviations of nucleotide monomers used in nucleic acid sequence representation. It will be understood that these monomers, when present in an oligonucleotide, are mutually linked by 5'-3'- phosphodiester bonds; and it is understood that when the nucleotide contains a 2’-fluoro modification, then the fluoro replaces the hydroxy at that position in the parent nucleotide (i.e., it is a 2’-deoxy-2’- fluoronucleotide). It is to be further understood that the nucleotide abbreviations in the table omit the 3’-phosphate (i.e., they are 3’-OH) when placed at the 3’-terminal position of an oligonucleotide. 55 ME151169145v.1 55 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO 56 ME151169145v.1 56 Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO 57 ME151169145v.1 57

Claims

Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO We claim:

1. A method of treating a subject suffering from a TTR-associated disease, the method comprising administering to the subject a fixed dose of about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a TTR gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- CAAGAGUAUUCCAUUUUUACU -3’ of SEQ ID NO:18 and the antisense strand comprises the nucleotide sequence 5’- AGUAAAAAUGGAAUACUCUUGGU -3’ of SEQ ID NO:20, thereby treating the subject suffering from the TTR-associated disease.

2. A method of preventing at least one symptom in a subject having a TTR-associated disease, the method comprising administering to the subject a fixed dose of about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a TTR gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- CAAGAGUAUUCCAUUUUUACU -3’ of SEQ ID NO:18 and the antisense strand comprises the nucleotide sequence 5’- AGUAAAAAUGGAAUACUCUUGGU -3’ of SEQ ID NO:20, thereby preventing at least one symptom in the subject having the TTR-associated disease.

3. A method for inhibiting the expression of a TTR gene in a subject suffering from orprone to suffering from a TTR-associated disease, the method comprising administering to the subject a fixed dose of about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a TTR gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- CAAGAGUAUUCCAUUUUUACU -3’ of SEQ ID NO:18 and the antisense strand comprises the nucleotide sequence 5’- AGUAAAAAUGGAAUACUCUUGGU -3’ of SEQ ID NO:20, thereby inhibiting the expression of the TTR gene in the subject.

4. A method for decreasing vitamin A levels in the eyes of a subject suffering from or prone to suffering from a TTR-associated disease, the method comprising administering to the subject a fixed dose of about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a TTR gene, 5598 ME151169145v.1Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- CAAGAGUAUUCCAUUUUUACU -3’ of SEQ ID NO:18 and the antisense strand comprises the nucleotide sequence 5’- AGUAAAAAUGGAAUACUCUUGGU -3’ of SEQ ID NO:20, thereby decreasing the vitamin A levels in the eyes of the subject.

5. A method for decreasing the formation of toxic Vitamin A metabolites in the retina of a subject suffering from or prone to suffering from a TTR-associated disease, the method comprising administering to the subject a fixed dose of about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a TTR gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- CAAGAGUAUUCCAUUUUUACU -3’ of SEQ ID NO:18 and the antisense strand comprises the nucleotide sequence 5’- AGUAAAAAUGGAAUACUCUUGGU -3’ of SEQ ID NO:20, thereby decreasing the formation of toxic Vitamin A metabolites in the retina of the subject.

6. A method for halting progression of vision loss in a subject suffering from or prone to suffering from a TTR-associated disease, the method comprising administering to the subject a fixed dose of about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a TTR gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- CAAGAGUAUUCCAUUUUUACU -3’ of SEQ ID NO:18 and the antisense strand comprises the nucleotide sequence 5’- AGUAAAAAUGGAAUACUCUUGGU -3’ of SEQ ID NO:20, thereby halting progression of vision loss in the subject.

7. The method of any one of claims 1-6, wherein the subject is a human subject.

8. The method of any one of claims 1-7, wherein the TTR-associated disease is selected from the group consisting of transthyretin-mediated amyloidosis (ATTR amyloidosis), senile systemic amyloidosis (SSA), systemic familial amyloidosis, familial amyloidotic polyneuropathy (FAP), familial amyloidotic cardiomyopathy (FAC), leptomeningeal / Central Nervous System (CNS) amyloidosis, and Stargardt’s disease.

9. The method of any one of claims 1-8, wherein the TTR-associated disease is transthyretin-mediated amyloidosis (ATTR amyloidosis) and the method reduces an amyloid TTR deposit in the subject. 5609 ME151169145v.1Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO 10. The method of claim 9, wherein the ATTR is hereditary ATTR (hATTR).

11. The method of claim 9, wherein the ATTR is wild-type ATTR (wtATTR).

12. The method of any one of claims 1-8, wherein the TTR-associated disease is Stargardt’s disease.

13. The method of any one of claims 1-12, wherein the dsRNA agent comprises at least one nucleotide modification.

14. The method of any one of claims 1-13, wherein substantially all of the nucleotides of the sense strand comprise a nucleotide modification.

15. The method of any one of claims 1-14, wherein substantially all of the nucleotides of the antisense strand comprise a nucleotide modification.

16. The method of any one of claims 1-15, wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand comprise a nucleotide modification.

17. The method of any one of claims 13-16, wherein at least one of the nucleotide modifications is selected from the group consisting of a 2'-O-methyl nucleotide modification, and a 2'- fluoro nucleotide modification.

18. The method of any one of claims 1-17, wherein each strand of the dsRNA agent is no more than 30 nucleotides in length.

19. The method of any one of claims 1-18, wherein each strand of the dsRNA agent is independently 19-30 nucleotides in length.

20. The method of claim 19, wherein each strand of the dsRNA agent is independently 19-25 nucleotides in length.

21. The method of claim 20, wherein each strand of the dsRNA agent is independently 21-23 nucleotides in length. 6610 ME151169145v.1Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO 22. The method of any one of claims 1-21, wherein at least one strand of the dsRNA agent comprises a 3’ overhang of at least 1 nucleotide.

23. The method of any one of claims 1-22, wherein at least one strand of the dsRNA agent comprises a 3’ overhang of at least 2 nucleotides.

24. The method of any one of claims 1-23, wherein the dsRNA agent further comprises a ligand.

25. The method of claim 24, wherein the ligand is conjugated to the 3’ end of the sense strand of the dsRNA agent.

26. The method of claim 24 or 25, wherein the ligand is an N-acetylgalactosamine (GalNAc) derivative.

27. The method of any one of claims 24-26, wherein the ligand is28. The method of any one of claims 24-27, wherein the dsRNA agent is conjugated to the ligand as shown in the following schematic6621 ME151169145v.1Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO and, wherein X is O or S.

29. The method of claim 28, wherein X is O.

30. The method of any one of claims 1-29, wherein the sense strand comprises the nucleotide sequence 5’- csasagagUfaUfUfCfcauuuuuacu-3’ of SEQ ID NO:17 and the antisense strand comprises the nucleotide sequence 5’- asGfsuaaAfaauggaaUfaCfucuugsgsu -3’ of SEQ ID NO:19, wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; Af, Cf, Gf and Uf are 2’- fluoro (2’-F) A, C, G and U; and s is a phosphorothioate linkage.

31. The method of claim 30, wherein the dsRNA agent is conjugated to a ligand as shown in the following schematic32. A method of treating a subject suffering from a TTR-associated disease, the method comprising administering to the subject a fixed dose of about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a TTR gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’- csasagagUfaUfUfCfcauuuuuacu-3’ of SEQ ID NO:17, and the antisense strand comprises a modified nucleotide sequence comprising at 6632 ME151169145v.1Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO least 19 contiguous nucleotides of the modified nucleotide sequence 5’- asGfsuaaAfaauggaaUfaCfucuugsgsu -3’ of SEQ ID NO:19, wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; Af, Cf, Gf and Uf are 2’- fluoro (2’-F) A, C, G and U; and s is a phosphorothioate linkage; and wherein a ligand is conjugated to the 3’ end of the sense strand as shown in the following schematicwherein X is O, thereby treating the subject suffering from the TTR-associated disease.

33. A method of preventing at least one symptom in a subject having a TTR-associated disease, the method comprising administering to the subject a fixed dose of about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a TTR gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’- csasagagUfaUfUfCfcauuuuuacu-3’ of SEQ ID NO:17, and the antisense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’- asGfsuaaAfaauggaaUfaCfucuugsgsu -3’ of SEQ ID NO:19, wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; Af, Cf, Gf and Uf are 2’- fluoro (2’-F) A, C, G and U; and s is a phosphorothioate linkage; and wherein a ligand is conjugated to the 3’ end of the sense strand as shown in the following schematic 6643 ME151169145v.1Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WOthereby preventing at least one symptom in the subject having the TTR-associated disease.

34. A method of inhibiting the expression of a TTR gene in a subject suffering from or prone to suffering from a TTR-associated disease, the method comprising administering to the subject a fixed dose of about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a TTR gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’- csasagagUfaUfUfCfcauuuuuacu-3’ of SEQ ID NO:17, and the antisense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’- asGfsuaaAfaauggaaUfaCfucuugsgsu -3’ of SEQ ID NO:19, wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; Af, Cf, Gf and Uf are 2’- fluoro (2’-F) A, C, G and U; and s is a phosphorothioate linkage; and wherein a ligand is conjugated to the 3’ end of the sense strand as shown in the following schematic 6654 ME151169145v.1Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WOthereby inhibiting the expression of a TTR gene in the subject.

35. A method of decreasing vitamin A levels in the eyes of a subject suffering from orprone to suffering from a TTR-associated disease, the method comprising administering to the subject a fixed dose of about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a TTR gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’- csasagagUfaUfUfCfcauuuuuacu-3’ of SEQ ID NO:17, and the antisense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’- asGfsuaaAfaauggaaUfaCfucuugsgsu -3’ of SEQ ID NO:19, wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; Af, Cf, Gf and Uf are 2’- fluoro (2’-F) A, C, G and U; and s is a phosphorothioate linkage; and wherein a ligand is conjugated to the 3’ end of the sense strand as shown in the following schematic 6665 ME151169145v.1Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WOthereby decreasing vitamin A levels in the eyes of the subject.

36. A method of decreasing the formation of toxic Vitamin A metabolites in the retina of a subject suffering from or prone to suffering from a TTR-associated disease, the method comprising administering to the subject a fixed dose of about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a TTR gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’- csasagagUfaUfUfCfcauuuuuacu-3’ of SEQ ID NO:17, and the antisense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’- asGfsuaaAfaauggaaUfaCfucuugsgsu -3’ of SEQ ID NO:19, wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; Af, Cf, Gf and Uf are 2’- fluoro (2’-F) A, C, G and U; and s is a phosphorothioate linkage; and wherein a ligand is conjugated to the 3’ end of the sense strand as shown in the following schematic 6676 ME151169145v.1Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WOthereby decreasing the formation of toxic Vitamin A metabolites in the retina of the subject.

37. A method of halting progression of vision loss in a subject suffering from or prone to suffering from a TTR-associated disease, the method comprising administering to the subject a fixed dose of about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a TTR gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’- csasagagUfaUfUfCfcauuuuuacu-3’ of SEQ ID NO:17, and the antisense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’- asGfsuaaAfaauggaaUfaCfucuugsgsu -3’ of SEQ ID NO:19, wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; Af, Cf, Gf and Uf are 2’- fluoro (2’-F) A, C, G and U; and s is a phosphorothioate linkage; and wherein a ligand is conjugated to the 3’ end of the sense strand as shown in the following schematic 6687 ME151169145v.1Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WOwherein X is O, thereby halting progression of vision loss in the subject.

38. The method of any one of claims 32-37, wherein the sense strand comprises a modified nucleotide sequence comprising at least 20 contiguous nucleotides of the modified nucleotide sequence of 5’-csasagagUfaUfUfCfcauuuuuacu-3’ of SEQ ID NO:17 and the antisense strand comprises a modified nucleotide sequence comprising at least 20 contiguous nucleotides of the modified nucleotide sequence of 5’-asGfsuaaAfaauggaaUfaCfucuugsgsu-3’ of SEQ ID NO:

19.

39. The method of any one of claims 32-38, wherein the sense strand comprises a modified nucleotide sequence comprising at least 21 contiguous nucleotides of the modified nucleotide sequence of 5’-csasagagUfaUfUfCfcauuuuuacu-3’ of SEQ ID NO:17 and the antisense strand comprises a modified nucleotide sequence comprising at least 21 contiguous nucleotides of the modified nucleotide sequence of 5’-asGfsuaaAfaauggaaUfaCfucuugsgsu-3’ of SEQ ID NO:

19.

40. The method of any one of claims 32-39, wherein the sense strand comprises a modified nucleotide sequence comprising at least 21 contiguous nucleotides of the modified nucleotide sequence of 5’-csasagagUfaUfUfCfcauuuuuacu-3’ of SEQ ID NO:17 and the antisense strand comprises a modified nucleotide sequence comprising at least 22 contiguous nucleotides of the modified nucleotide sequence of 5’-asGfsuaaAfaauggaaUfaCfucuugsgsu-3’ of SEQ ID NO:

19.

41. The method of any one of claims 32-40, wherein the sense strand comprises the nucleotide sequence of 5’-csasagagUfaUfUfCfcauuuuuacu-3’ of SEQ ID NO:17 and the antisense strand comprises the nucleotide sequence of 5’-asGfsuaaAfaauggaaUfaCfucuugsgsu-3’ of SEQ ID NO:

19. 6698 ME151169145v.1Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO 42. The method of any one of claims 32-41, wherein the sense strand consists of the nucleotide sequence of 5’-csasagagUfaUfUfCfcauuuuuacu-3’ of SEQ ID NO:17 and the antisense strand consists of the nucleotide sequence of 5’-asGfsuaaAfaauggaaUfaCfucuugsgsu-3’ of SEQ ID NO:

19.

43. The method of any one of claims 32-42, wherein the subject is a human subject.

44. The method of any one of claims 32-43, wherein the TTR-associated disease is selected from the group consisting of transthyretin-mediated amyloidosis (ATTR amyloidosis), senile systemic amyloidosis (SSA), systemic familial amyloidosis, familial amyloidotic polyneuropathy (FAP), familial amyloidotic cardiomyopathy (FAC), leptomeningeal / Central Nervous System (CNS) amyloidosis, and Stargardt’s disease.

45. The method of any one of claims 34-44, wherein the TTR-associated disease is transthyretin-mediated amyloidosis (ATTR amyloidosis) and the method reduces an amyloid TTR deposit in the subject.

46. The method of claim 45, wherein the ATTR is hereditary ATTR (hATTR).

47. The method of claim 45, wherein the ATTR is wild-type ATTR (wtATTR).

48. The method of any one of claims 32-44, wherein the TTR-associated disease is Stargardt’s disease.

49. The method of any one of claims 1-48, further comprising measuring the level of TTR mRNA expression or TTR protein expression in a sample from the subject.

50. The method of any one of claims 1-49, further comprising measuring the level of vitamin A or RBP4 protein in a sample from the subject.

51. The method of any one of claims 1-50, wherein the administration of the dsRNA agent, or a pharmaceutically acceptable salt thereof, to the subject causes a decrease in TTR enzymatic activity, a decrease in TTR protein accumulation, a decrease in vitamin A level, and / or a decrease in RBP4 level in the subject. 6709 ME151169145v.1Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO 52. The method of any one of claims 1-51, wherein the TTR mRNA level in the subject is reduced to at least about 70%, 65%, 60%, 55%, or 50% of baseline level 6 months after the administration of the dsRNA agent, or a pharmaceutically acceptable salt thereof.

53. The method of any one of claims 1-52, further comprising administering an additional therapeutic to the subject.

54. The method of any one of claims 1-53, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 25 mg, about 100 mg, about 300 mg, about 600 mg, or about 900 mg.

55. The method of any one of claims 1-54, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject every month, every 2 months, every 3 months, every 4 months, every 5 months, every 6 months, or every 12 months.

56. The method of any one of claims 1-55, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 25 mg every three months.

57. The method of any one of claims 1-55, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 100 mg every three months.

58. The method of any one of claims 1-55, wherein the dsRNA agent, or salt thereof, is administered to the subject at a dose of about 300 mg every three months.

59. The method of any one of claims 1-55, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 600 mg every three months.

60. The method of any one of claims 1-55, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 900 mg every three months.

61. The method of any one of claims 1-55, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 25 mg every six months. 7710 ME151169145v.1Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO 62. The method of any one of claims 1-55, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 100 mg every six months.

63. The method of any one of claims 1-55, wherein the dsRNA agent, or salt thereof, is administered to the subject at a dose of about 300 mg every six months.

64. The method of any one of claims 1-55, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 600 mg every six months.

65. The method of any one of claims 1-55, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 900 mg every six months.

66. The method of any one of claims 1-55, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 25 mg every twelve months.

67. The method of any one of claims 1-55, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 100 mg every twelve months.

68. The method of any one of claims 1-55, wherein the dsRNA agent, or salt thereof, is administered to the subject at a dose of about 300 mg every twelve months.

69. The method of any one of claims 1-55, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 600 mg every twelve months.

70. The method of any one of claims 1-55, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 900 mg every twelve months. 7721 ME151169145v.1Attorney Docket No.: 121301-23620 Alnylam Reference No.: ALN-519-WO 71. The method of any one of claims 1-70, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject intravenously, intramuscularly, or subcutaneously.

72. The method of any one of claims 1-71, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject subcutaneously.

73. A kit for performing the method of any one of claims 1-72, comprising a) the dsRNA agent, or a pharmaceutically acceptable salt thereof, and b) instructions for use, and c) optionally, means for administering the dsRNA agent, or a pharmaceutically acceptable salt thereof, to the subject. 7732 ME151169145v.1