Methods and compositions for treating an angiotensinogen- (agt-) associated disorder

IL328935A0Pending Publication Date: 2026-07-01ALNYLAM PHARMACEUTICALS INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
IL · IL
Patent Type
Applications
Current Assignee / Owner
ALNYLAM PHARMACEUTICALS INC
Filing Date
2024-12-11
Publication Date
2026-07-01

AI Technical Summary

Technical Problem

Current treatments for hypertension often require multiple antihypertensive medications, which can lead to reduced adherence and increased side effects, while also potentially worsening kidney function.

Method used

Administering a fixed dose of a double-stranded RNAi agent targeting the angiotensinogen (AGT) gene to reduce AGT expression, thereby decreasing blood pressure in subjects with hypertension and associated disorders.

Benefits of technology

The method effectively reduces blood pressure and AGT expression, potentially improving cardiovascular risk profiles and reducing the need for multiple antihypertensive medications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000087_0000
    Figure 00000087_0000
Patent Text Reader

Abstract

The present invention relates to methods of inhibiting the expression of an AGT gene in a subject, as well as methods for treating subjects having an AGT-associated disorder, e.g., hypertension, using RNAi agents, e.g., double stranded RNAi agents, targeting the AGT gene. The invention also relates to methods of decreasing blood pressure levels in a subject using such RNAi agents to inhibit expression of an AGT gene.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] METHODS AND COMPOSITIONS FOR TREATING AN ANGIOTENSINOGEN- (AGT-) ASSOCIATED DISORDER

[0002] Related Applications

[0003] This application claims the benefit of priority to U.S. Provisional Application No. 63 / 608,909, filed on December 12, 2023; the entire contents of which are expressly incorporated herein by reference.

[0004] Sequence Listing

[0005] The instant application contains a sequence listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on December 6, 2024, is named 121301-22920. xml and is 774,701 bytes in size.

[0006] Background of the Invention

[0007] The renin-angiotensin-aldosterone system (RAAS) plays a crucial role in the regulation of blood pressure. The RAAS cascade begins with the release of renin by the juxtaglomerular cells of the kidney into the circulation. Renin secretion is stimulated by several factors, including Na+ load in the distal tubule, P-sympathetic stimulation, or reduced renal perfusion. Active renin in the plasma cleaves angiotensinogen (produced by the liver) to angiotensin I, which is then converted by circulating and locally expressed angiotensin-converting enzyme (ACE) to angiotensin II. Most of the effects of angiotensin II on the RAAS are exerted by its binding to angiotensin II type 1 receptors (ATiR), leading to arterial vasoconstriction, tubular and glomerular effects, such as enhanced Na+ reabsorption or modulation of glomerular filtration rate. In addition, together with other stimuli such as adrenocorticotropin, anti-diuretic hormone, catecholamines, endothelin, serotonin, and levels of Mg2+ and K+, ATiR stimulation leads to aldosterone release which, in turn, promotes Na+ and K+ excretion in the renal distal convoluted tubule.

[0008] Dysregulation of the RAAS leading to, for example, excessive angiotensin II production or ATiR stimulation results in hypertension which can lead to, e.g, increased oxidative stress, promotion of inflammation, hypertrophy, and fibrosis in the heart, kidneys, and arteries, and result in, e. g; left ventricular fibrosis, arterial remodeling, and glomerulosclerosis.

[0009] Hypertension is the most prevalent, controllable disease in developed countries, affecting 20- 50% of adult populations. Hypertension is a major risk factor for various diseases, disorders and conditions such as, shortened life expectancy, chronic kidney disease, stroke, myocardial infarction, heart failure, aneurysms (e.g. aortic aneurysm), peripheral artery disease, heart damage (e.g., heart enlargement or hypertrophy) and other cardiovascular related diseases, disorders, or conditions. In addition, hypertension has been shown to be an important risk factor for cardiovascular morbidity and mortality accounting for, or contributing to, 62% of all strokes and 49% of all cases of heart disease. In 2017, changes in the guidelines for diagnosis, prevention, and treatment of hypertension were developed providing goals for even lower blood pressure to further decrease risk of development of diseases and disorders associated with hypertension (see, e.g., Reboussin et al. Systematic Review for the 2017 ACC / AHA / AAPA / ABC / ACPM / AGS / APhA / ASH / ASPC / NMA / PCNA Guideline for the Prevention, Detection, Evaluation, and Management of High Blood Pressure in Adults: A Report of the American College of Cardiology / American Heart Association Task Force on Clinical Practice Guidelines. J Am Coll Cardiol. 2017 Nov 7. pii: S0735-1097(17)41517-8. doi: 10.1016 / j.jacc.2017.11.004; and Whelton et al. (2017 ACC / AHA / AAPA / ABC / ACPM / AGS / APhA / ASH / ASPC / NMA / PCNA Guideline for the Prevention, Detection, Evaluation, and Management of High Blood Pressure in Adults: A Report of the American College of Cardiology / American Heart Association Task Force on Clinical Practice Guidelines. J Am Coll Cardiol. 2017 Nov 7. pii: S0735- 1097(17)41519-1. doi: 10.1016 / j.jacc.2017.11.006).

[0010] Despite the number of anti-hypertensive drugs available for treating hypertension, more than two-thirds of subjects are not controlled with one anti -hypertensive agent and require two or more antihypertensive agents selected from different drug classes. This further reduces the number of subjects with controlled blood pressure as adherence is reduced and side-effects are increased with increasing numbers of medications. Furthermore, several studies have suggested a potential relationship between chronic use of antihypertensive medications and deterioration in kidney function finding that antihypertensive agents to control blood pressure also impact kidney function independently of their effect on blood pressure (Tomlinson, et al (2013) PLoS ONE 8(11) Article ID e78465; The SPRINT Research Group (2015) NEJM 373(22) :2103— 2116, ClinicalTrials.gov number, NCT01206062; Kidney Disease: Improving Global Outcomes (KDIGO) CKD Work Group (2013) Kidney International Supplements 3 : 1-150; Kamaroff, et al. (2018( Hindawi International J Chron Dis Article ID 1382705 | doi.org / 10. 1155 / 2018 / 1382705).

[0011] Accordingly, there is a need in the art for additional methods and therapies to treat subjects having hypertension.

[0012] Summary of the Invention

[0013] The invention provides methods and compositions for inhibiting the expression of an angiotensinogen (AGT) gene, for treating a subject having a disorder that would benefit from reduction in AGT expression, for treating a subject having an AGT-associated disorder, and for decreasing blood pressure in a subject. The methods include administering to the subject a fixed dose of an RNAi agent, e.g., a double stranded RNAi agent, targeting an AGT gene.

[0014] In one aspect, the present invention provides a method for treating a subject that would benefit from reduction in angiotensinogen (AGT) expression, the method comprising selecting a subject having high cardiovascular (CV) risk and hypertension, and administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’- gsuscaucCfaCfAfAfugagaguaca-3 ’ of SEQ ID NO: 12 and the antisense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’-usGfsuac(Tgn)cucauugUfgGfaugacsgsa-3’ of SEQ ID NO: 11, wherein a is 2'-O-methyladenosine-3’- phosphate, c is 2'-O-methylcytidine-3’ -phosphate, g is 2'-O-methylguanosine-3’ -phosphate, u is 2'-O- methyluridine-3 ’ -phosphate, Af is 2 ’-fluoroadenosine-3’ -phosphate, Cf is 2’-fluorocytidine-3’- phosphate, Gf is 2’-fluoroguanosine-3’-phosphate, Ufis 2’-fhiorouridine-3’-phosphate, (Tgn) is thymidine -glycol nucleic acid (GNA) S-Isomer, and s is a phosphorothioate linkage, wherein the subject is taking at least two but not more than four antihypertensive medications; thereby treating the subject that would benefit from reduction in AGT expression.

[0015] In another aspect, the present invention provides a method for inhibiting the expression of an angiotensinogen (AGT) gene in a subject, the method comprising selecting a subject having high cardiovascular (CV) risk and hypertension, and administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’- gsuscaucCfaCfAfAfugagaguaca-3 ’ of SEQ ID NO: 12 and the antisense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’-usGfsuac(Tgn)cucauugUfgGfaugacsgsa-3’ of SEQ ID NO: 11, wherein a is 2'-O-methyladenosine-3’- phosphate, c is 2'-O-methylcytidine-3’ -phosphate, g is 2'-O-methylguanosine-3’ -phosphate, u is 2'-O- methyluridine-3 ’ -phosphate, Af is 2 ’-fluoroadenosine-3 ’-phosphate, Cf is 2’-fluorocytidine-3’- phosphate, Gf is 2’-fluoroguanosine-3’-phosphate, Ufis 2’-fhiorouridine-3’-phosphate, (Tgn) is thymidine -glycol nucleic acid (GNA) S-Isomer, and s is a phosphorothioate linkage, wherein the subject is taking at least two but not more than four antihypertensive medications; thereby inhibiting the expression of the AGT gene in the subject.

[0016] In another aspect, the present invention provides a method for treating a subject that having an AGT-associated disorder, the method comprising selecting a subject having high cardiovascular (CV) risk and, and administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5 ’-gsuscaucCfaCfAfAfugagaguaca-3’ of SEQ ID NO: 12 and the antisense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’-usGfsuac(Tgn)cucauugUfgGfaugacsgsa-3’ of SEQ ID NO: 11, wherein a is 2'-O-methyladenosine-3 ’ -phosphate, c is 2'-O-methylcytidine-3’ -phosphate, g is 2'-O- methylguanosine-3’ -phosphate, u is 2'-O-methyluridine-3’ -phosphate, Af is 2 ’-fluoroadenosine-3’- phosphate, Cf is 2’-fluorocytidine-3 ’-phosphate, Gf is 2’-fluoroguanosine-3’-phosphate, Ufis 2’- fluorouridine-3 ’ -phosphate, (Tgn) is thymidine -glycol nucleic acid (GNA) S-Isomer, and s is a phosphorothioate linkage, wherein the subject is taking at least two but not more than four antihypertensive medications; thereby treating the subject having an AGT-associated disorder.

[0017] In another aspect, the present invention provides a method for decreasing blood pressure level in a subject, the method comprising selecting a subject having high cardiovascular (CV) risk and hypertension, and administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’-gsuscaucCfaCfAfAfugagaguaca-3’ of SEQ ID NO: 12 and the antisense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’-usGfsuac(Tgn)cucauugUfgGfaugacsgsa-3’ of SEQ ID NO: 11, wherein a is 2'-O-methyladenosine-3 ’ -phosphate, c is 2'-O-methylcytidine-3’ -phosphate, g is 2'-O- methylguanosine-3’ -phosphate, u is 2'-O-methyluridine-3’ -phosphate, Af is 2’-fluoroadenosine-3’- phosphate, Cf is 2’-fluorocytidine-3 ’-phosphate, Gf is 2’-fhioroguanosine-3’-phosphate, Ufis 2’- fluorouridine-3 ’ -phosphate, (Tgn) is thymidine -glycol nucleic acid (GNA) S-Isomer, and s is a phosphorothioate linkage, wherein the subject is taking at least two but not more than four antihypertensive medications; thereby decreasing the blood pressure level in the subject.

[0018] In another aspect, the present invention provides a method for treating a subject that would benefit from reduction in angiotensinogen (AGT) expression, the method comprising selecting a subject having high cardiovascular (CV) risk and hypertension, wherein the subject having high cardiovascular (CV) risk and hypertension has atherosclerotic cardiovascular disease (ASCVD) risk with a >15% ASCVD risk score and, administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’-gsuscaucCfaCfAIAfiigagaguaca-3’ of SEQ ID NO: 12 and the antisense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’-usGfsuac(Tgn)cucauugUfgGfaugacsgsa-3’ of SEQ ID NO: 11, wherein a is 2'-O-methyladenosine-3’ -phosphate, c is 2'-O-methylcytidine-3’ -phosphate, g is 2'-O- methylguanosine-3’ -phosphate, u is 2'-O-methyluridine-3’ -phosphate, Af is 2’-fluoroadenosine-3’- phosphate, Cf is 2’-fluorocytidine-3 ’-phosphate, Gf is 2’-fhioroguanosine-3’-phosphate, Ufis 2’- fluorouridine-3 ’ -phosphate, (Tgn) is thymidine -glycol nucleic acid (GNA) S-Isomer, and s is a phosphorothioate linkage, wherein the subject is taking at least two but not more than four antihypertensive medications; thereby treating the subject that would benefit from reduction in AGT expression.

[0019] In another aspect, the present invention provides a method for inhibiting the expression of an angiotensinogen (AGT) gene in a subject, the method comprising selecting a subject having high cardiovascular (CV) risk and hypertension, wherein the subject having high cardiovascular (CV) risk and hypertension has atherosclerotic cardiovascular disease (ASCVD) risk with a >15% ASCVD risk score and, administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’-gsuscaucCfaCfAfAfugagaguaca-3’ of SEQ ID NO: 12 and the antisense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’-usGfsuac(Tgn)cucauugUfgGfaugacsgsa-3’ of SEQ ID NO: 11, wherein a is 2'-O-methyladenosine-3 ’ -phosphate, c is 2'-O-methylcytidine-3’ -phosphate, g is 2'-O- methylguanosine-3’ -phosphate, u is 2'-O-methyluridine-3’ -phosphate, Af is 2’-fluoroadenosine-3’- phosphate, Cf is 2’-fluorocytidine-3 ’-phosphate, Gf is 2’-fhioroguanosine-3’-phosphate, Ufis 2’- fluorouridine-3 ’ -phosphate, (Tgn) is thymidine -glycol nucleic acid (GNA) S-Isomer, and s is a phosphorothioate linkage, wherein the subject is taking at least two but not more than four antihypertensive medications; thereby inhibiting the expression of the AGT gene in the subject.

[0020] In another aspect, the present invention provides a method for treating a subject that having an AGT-associated disorder, the method comprising selecting a subject having high cardiovascular (CV) risk and hypertension, wherein the subject having high cardiovascular (CV) risk and hypertension has atherosclerotic cardiovascular disease (ASCVD) risk with a >15% ASCVD risk score and, administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’-gsuscaucCfaCfAfAfugagaguaca-3’ of SEQ ID NO: 12 and the antisense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’-usGfsuac(Tgn)cucauugUfgGfaugacsgsa-3’ of SEQ ID NO: 11, wherein a is 2'-O-methyladenosine-3’- phosphate, c is 2'-O-methylcytidine-3’ -phosphate, g is 2'-O-methylguanosine-3’ -phosphate, u is 2'-O- methyluridine-3 ’ -phosphate, Af is 2 ’-fluoroadenosine-3’ -phosphate, Cf is 2’-fluorocytidine-3’- phosphate, Gf is 2’-fluoroguanosine-3’-phosphate, Ufis 2’-fhiorouridine-3’-phosphate, (Tgn) is thymidine -glycol nucleic acid (GNA) S-Isomer, and s is a phosphorothioate linkage, wherein the subject is taking at least two but not more than four antihypertensive medications; thereby treating the subject having an AGT-associated disorder. In another aspect, the present invention provides a method for decreasing blood pressure level in a subject, the method comprising selecting a subject having high cardiovascular (CV) risk and hypertension, wherein the subject having high cardiovascular (CV) risk and hypertension has atherosclerotic cardiovascular disease (ASCVD) risk with a >15% ASCVD risk score and, administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’-gsuscaucCfaCfAfAfugagaguaca-3’ of SEQ ID NO: 12 and the antisense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’-usGfsuac(Tgn)cucauugUfgGfaugacsgsa-3’ of SEQ ID NO: 11, wherein a is 2'-O-methyladenosine-3’- phosphate, c is 2'-O-methylcytidine-3’ -phosphate, g is 2'-O-methylguanosine-3’ -phosphate, u is 2'-O- methyluridine-3 ’ -phosphate, Af is 2 ’-fluoroadenosine-3’ -phosphate, Cf is 2’-fluorocytidine-3’- phosphate, Gf is 2'-fluorogiianosinc-3'-phosphatc. Ufis 2>fhiorouridine-3 ’-phosphate, (Tgn) is thymidine -glycol nucleic acid (GNA) S-Isomer, and s is a phosphorothioate linkage, wherein the subject is taking at least two but not more than four antihypertensive medications; thereby decreasing the blood pressure level in the subject.

[0021] In some embodiments, the sense strand comprises a modified nucleotide sequence comprising at least 20 contiguous nucleotides of the modified nucleotide sequence 5’-gsuscaucCfaCfAfAfugagaguaca- 3’ of SEQ ID NO: 12, and the antisense strand comprises a modified nucleotide sequence comprising at least 20 contiguous nucleotides of the modified nucleotide sequence 5’- usGfsuac(Tgn)cucauugUfgGfaugacsgsa-3’ ofSEQ ID NO: 11.

[0022] In some embodiments, the sense strand comprises a modified nucleotide sequence comprising at least 20 contiguous nucleotides of the modified nucleotide sequence 5’-gsuscaucCfaCfAfAfugagaguaca- 3 ’of SEQ ID NO: 12, and the antisense strand comprises a modified nucleotide sequence comprising at least 21 contiguous nucleotides of the modified nucleotide sequence 5’- usGfsuac(Tgn)cucauugUfgGfaugacsgsa-3’of SEQ ID NO: 11.

[0023] In some embodiments, the sense strand comprises a modified nucleotide sequence comprising at least 20 contiguous nucleotides of the modified nucleotide sequence 5’-gsuscaucCfaCfAfAfugagaguaca- 3 ’of SEQ ID NO: 12, and the antisense strand comprises a modified nucleotide sequence comprising at least 22 contiguous nucleotides of the modified nucleotide sequence 5’- usGfsuac(Tgn)cucauugUfgGfaugacsgsa-3’of SEQ ID NO: 11.

[0024] In some embodiments, the sense strand comprises the modified nucleotide sequence 5’- gsuscaucCfaCfAfAfugagaguaca-3’of SEQ ID NO: 12, and the antisense strand comprises the modified nucleotide sequence 5’-usGfsuac(Tgn)cucauugUfgGfaugacsgsa-3’of SEQ ID NO: 11. In some embodiments, the sense strand consists of the modified nucleotide sequence 5’- gsuscaucCfaCfAfAfugagaguaca-3’of SEQ ID NO: 12, and the antisense strand consists of the modified nucleotide sequence 5’-usGfsuac(Tgn)cucauugUfgGfaugacsgsa-3’ of SEQ ID NO: 11.

[0025] In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, further comprises a ligand. In some embodiments, the ligand is conjugated to the 3’ end of the sense strand. In some embodiments, the ligand is an N-acetylgalactosamine (GalNAc) derivative. In some embodiments, the GalNAc derivative comprises one or more GalNAc derivatives attached through a monovalent, bivalent, or trivalent branched linker.

[0026] In some embodiments, the ligand is

[0027] In some embodiments, the 3’ end of the sense strand is conjugated to the ligand as shown in the following schematic is O.

[0028] In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, is present in a pharmaceutical composition.

[0029] In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, is present in an unbuffered solution.

[0030] In some embodiments, the unbuffered solution is saline or water. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, is present in a buffer solution. In some embodiments, the buffer solution comprises acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof. In some embodiments, the buffer solution is phosphate buffered saline (PBS).

[0031] In some embodiments, the subject is a human.

[0032] In some embodiments, the subject having high cardiovascular (CV) risk and hypertension has high cardiovascular (CV) risk and hypertension not adequately controlled by two to four antihypertensive medications. In some embodiments, the antihypertensive medication is selected from the group consisting of a thiazide, a thiazide-like diuretic, a loop diuretic, a beta blocker, an angiotensin-converting enzyme (ACE) inhibitor, an angiotensin II receptor blocker (ARB), a calcium channel blocker (CCB), a vasodilator, a centrally acting antihypertensive medication, and combinations thereof. In some embodiments, the antihypertensive medication is a calcium channel blocker (CCB), a loop diuretic, a thiazide or a thiazide-like diuretic. In some embodiments, the antihypertensive medication is a calcium channel blocker (CCB). In some embodiments, the antihypertensive medication is a loop diuretic. In some embodiments, the antihypertensive medication is a thiazide or a thiazide -like diuretic.

[0033] In some embodiments, the subject having high cardiovascular risk and hypertension is a subject that had a prior cardiovascular event. In some embodiments, the prior cardiovascular event is selected from the group consisting of a myocardial infarction and an ischemic stroke.

[0034] In some embodiments, the subject having high cardiovascular risk and hypertension is a subject having peripheral artery disease, coronary artery disease, carotid artery disease, or atherosclerotic cardiovascular disease (ASCVD) risk.

[0035] In some embodiments, the subject having ASCVD risk has an ASCVD risk score of >15%, >16%, >17%, >18%, >19%, >20%, >25%, >30%, >35%, >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, or >95%. In some embodiments, the subject having ASCVD risk has an ASCVD risk score of >15%. In some embodiments, the subject having ASCVD risk has an ASCVD risk score of >16%. In some embodiments, the subject having ASCVD risk has an ASCVD risk score of >17%. In some embodiments, the subject having ASCVD risk has an ASCVD risk score of >18%. In some embodiments, the subject having ASCVD risk has an ASCVD risk score of >19%. In some embodiments, the subject having ASCVD risk has an ASCVD risk score of >20%. In some embodiments, the subject having ASCVD risk has an ASCVD risk score of >25%. In some embodiments, the subject having ASCVD risk has an ASCVD risk score of >30%. In some embodiments, the subject having ASCVD risk has an ASCVD risk score of >35%. In some embodiments, the subject having ASCVD risk has an ASCVD risk score of >40%. In some embodiments, the subject having ASCVD risk has an ASCVD risk score of >45%. In some embodiments, the subject having ASCVD risk has an ASCVD risk score of >50%. In some embodiments, the subject having ASCVD risk has an ASCVD risk score of >55%. In some embodiments, the subject having ASCVD risk has an ASCVD risk score of >60%. In some embodiments, the subject having ASCVD risk has an ASCVD risk score of >65%. In some embodiments, the subject having ASCVD risk has an ASCVD risk score of >70%. In some embodiments, the subject having ASCVD risk has an ASCVD risk score of >75%. In some embodiments, the subject having ASCVD risk has an ASCVD risk score of >80%. In some embodiments, the subject having ASCVD risk has an ASCVD risk score of >85%. In some embodiments, the subject having ASCVD risk has an ASCVD risk score of >90%. In some embodiments, the subject having ASCVD risk has an ASCVD risk score of >95%.

[0036] In some embodiments, the subject had prior percutaneous coronary intervention, coronary artery bypass grafting, carotid endarterectomy, or carotid stenting.

[0037] In some embodiments, the subject having high cardiovascular risk and hypertension does not have moderate-to-severe obstructive sleep apnea not treated with continuous positive airway pressure therapy, renovascular hypertension, primary aldosteronism, pheochromocytoma, Cushing syndrome, aortic coarctation, or orthostatic hypotension.

[0038] In some embodiments, the subject having high cardiovascular risk and hypertension is not being administered more than 1 ARB, more than 1 ACE, a mineralocorticoid receptor antagonist (MRA), aliskiren, triamterene, amiloride, and aldosterone synthase inhibitor, an endothelin antagonist, or an aminopeptidase inhibitor.

[0039] In some embodiments, the subject has an estimated glomerular filtration rate (eGFR) of >45 mL / min / 1.73m2 or an estimated glomerular filtration rate (eGFR) of 30-44 mL / min / 1.73m2. In some embodiments, the subject has an estimated glomerular filtration rate (eGFR) of >30 mL / min / 1.73m2 to <60 mL / min / 1.73m2.

[0040] In some embodiments, the subject has a 24-hour mean systolic blood pressure (SBP) as assessed by ambulatory blood pressure monitoring (ABPM) of >130 mmHg.

[0041] In some embodiments, the subject has a seated office systolic blood pressure (SBP) of >140 mmHg to <170 mmHg

[0042] In some embodiments, the subject is male and >65 years of age. In some embodiments, the subject is female and >71 years of age.

[0043] In some embodiments, the fixed dose is administered to the subject at an interval of once every three months. In some embodiments, the fixed dose is administered to the subject at an interval of once every six months. In some embodiments, the subject is administered a fixed dose of about 150 mg or about 300 mg about once every three months. In some embodiments, the subject is administered a fixed dose of about 150 mg or about 300 mg about once every six months. In some embodiments, the subject is administered a fixed dose of about 600 mg about once every three months. In some embodiments, the subject is administered a fixed dose of about 600 mg about once every six months. In some embodiments, the double stranded RNAi agent, or a pharmaceutically acceptable salt thereof, is administered to the subject subcutaneously or intravenously. In some embodiments, the subcutaneous administration is subcutaneous injection.

[0044] In some embodiments, the blood pressure comprises systolic blood pressure and / or diastolic blood pressure.

[0045] In some embodiments, the method results in a decrease in systolic blood pressure and / or diastolic blood pressure. In some embodiments, the systolic blood pressure and / or diastolic blood pressure is decreased by at least 4 mmHg, 5 mmHg, 6 mmHg, 7 mmHg, 8 mmHg, 9 mmHg or 10 mmHg.

[0046] In some embodiments, the systolic blood pressure and / or diastolic blood pressure is seated office systolic blood pressure and / or diastolic blood pressure.

[0047] In some embodiments, the systolic blood pressure and / or diastolic blood pressure is ambulatory blood pressure monitoring (ABPM).

[0048] In some embodiments, the blood pressure decrease is decrease in daytime and night-time mean blood pressure.

[0049] In some embodiments, the method results in a decrease in AGT expression by at least 30%, 40% 50%, 60%, 70%, 80%, 90%, or 95%.

[0050] In some embodiments, the AGT protein level in a blood or a serum sample of the subject is decreased by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%.

[0051] In some embodiments, the AGT associated disorder is hypertension.

[0052] In some embodiments, the AGT associated disorder is selected from the group consisting of high blood pressure, hypertension, borderline hypertension, primary hypertension, secondary hypertension isolated systolic or diastolic hypertension, pregnancy-associated hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, labile hypertension; mild to moderate hypertension; hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vasculopathy, diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiac myopathy, nocturnal hypotension, glomerulosclerosis, coarctation of the aorta, aortic aneurism, ventricular fibrosis, heart failure, myocardial infarction, angina, stroke, renal disease, renal failure, systemic sclerosis, intrauterine growth restriction (IUGR) , fetal growth restriction, obesity, liver steatosis / fatty liver, non-alcoholic Steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD); glucose intolerance, type 2 diabetes, and metabolic syndrome.

[0053] In some embodiments, the method further comprises determining the serum level of AGT protein.

[0054] In some embodiments, the method further comprises determining the level of one or more cardiac biomarkers. In some embodiments, the one or more cardiac biomarkers is selected from the group consisting of high-sensitivity cardiac troponin (hsTn), high -sensitivity C-reactive protein (hsCRP), interleukin 6 (IL-6), and B-type natriuretic peptide prohormone (NT (proBNP)).

[0055] In some embodiments, the method further comprises determining the level of one or more renal biomarkers. In some embodiments, the one or more renal biomarkers is selected from the group consisting of albumin and creatinine. In some embodiments, the level of the one or more renal biomarkers is a urine albumin-creatinine ratio (uACR).

[0056] In some embodiments, the method further comprises determining the level of one or more renin- angiotensin-aldosterone system (RAAS) biomarkers. In some embodiments, the one or more RAAS biomarkers is selected from the group consisting of renin, angiotensin I, angiotensin II, and aldosterone.

[0057] In some embodiments, the dosage of at least one of the two or more antihypertensive medications is decreased following administration of the dsRNA agent. In some embodiments, the at least one of the two or more antihypertensive medications is discontinued following administration of the dsRNA agent.

[0058] In another aspect, the present invention provides a kit for performing any one or more methods described herein, comprising a) the dsRNA agent, or a pharmaceutically acceptable salt thereof, and b) instructions for use, and c) optionally, means for administering the dsRNA agent, or a pharmaceutically acceptable salt thereof, to the subject.

[0059] Brief Description of the Drawings

[0060] Figure 1 is a schematic of the randomized, double-blind study design for assessing the efficacy, safety, and pharmacodynamics of AD-85481 (Zilebesiran) administered subcutaneously as an add-on therapy in patients with established cardiovascular disease or at high cardiovascular risk with uncontrolled hypertension.

[0061] Detailed Description of the Invention

[0062] The present invention provides methods for inhibiting the expression of an angiotensinogen (AGT) gene. The present invention also provides methods for treating a subject having a disorder that would benefit from reduction in AGT expression, or treating an AGT-associated disorder in a subject. In addition, the present invention provides methods for decreasing blood pressure level in a subject. The methods include administering to the subject a fixed dose, e.g., about 150 mg to about 600 mg, of a double stranded RNAi agent, or salt thereof, targeting AGT, as described herein.

[0063] In one aspect the invention provides a method for treating a subject that would benefit from reduction in AGT expression, by selecting a subject having high cardiovascular (CV) risk and hypertension, and administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of one or more double stranded ribonucleic acid (dsRNA) agents described herein, or a pharmaceutically acceptable salt thereof, wherein the subject is taking at least two but not more than four antihypertensive medications, thereby treating the subject that would benefit from reduction in AGT expression.

[0064] In another aspect the invention provides a method for inhibiting the expression of an angiotensinogen (AGT) gene in a subject, by selecting a subject having high cardiovascular (CV) risk and hypertension, and administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of one or more double stranded ribonucleic acid (dsRNA) agents described herein, or a pharmaceutically acceptable salt thereof, wherein the subject is taking at least two but not more than four antihypertensive medications, thereby inhibiting the expression of the AGT gene in the subject.

[0065] In another aspect the invention provides a method for treating a subject that having an AGT- associated disorder, by selecting a subject having high cardiovascular (CV) risk and hypertension, and administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of one or more double stranded ribonucleic acid (dsRNA) agents described herein, or a pharmaceutically acceptable salt thereof, wherein the subject is taking at least two but not more than four antihypertensive medications, thereby treating the subject having an AGT-associated disorder.

[0066] In another aspect the invention provides a method for decreasing blood pressure level in a subject, by selecting a subject having high cardiovascular (CV) risk and hypertension, and administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of one or more double stranded ribonucleic acid (dsRNA) agents described herein, or a pharmaceutically acceptable salt thereof, wherein the subject is taking at least two but not more than four antihypertensive medications, thereby decreasing the blood pressure level in the subject. In some embodiments, the blood pressure comprises systolic blood pressure and / or diastolic blood pressure.

[0067] In another aspect the invention provides a method for treating a subject that would benefit from reduction in AGT expression, by selecting a subject having high cardiovascular (CV) risk and hypertension, wherein the subject having high cardiovascular (CV) risk and hypertension has atherosclerotic cardiovascular disease (ASCVD) risk with a >15% ASCVD risk score and, administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of one or more double stranded ribonucleic acid (dsRNA) agents described herein, or a pharmaceutically acceptable salt thereof, wherein the subject is taking at least two but not more than four antihypertensive medications, thereby treating the subject that would benefit from reduction in AGT expression.

[0068] In another aspect the invention provides a method for inhibiting the expression of an angiotensinogen (AGT) gene in a subject, by selecting a subject having high cardiovascular (CV) risk and hypertension, wherein the subject having high cardiovascular (CV) risk and hypertension has atherosclerotic cardiovascular disease (ASCVD) risk with a >15% ASCVD risk score and, administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of one or more double stranded ribonucleic acid (dsRNA) agents described herein, or a pharmaceutically acceptable salt thereof, wherein the subject is taking at least two but not more than four antihypertensive medications, thereby inhibiting the expression of the AGT gene in the subject. In another aspect the invention provides a method for treating a subject that having an AGT- associated disorder, by selecting a subject having high cardiovascular (CV) risk and hypertension, wherein the subject having high cardiovascular (CV) risk and hypertension has atherosclerotic cardiovascular disease (ASCVD) risk with a >15% ASCVD risk score and, administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of one or more double stranded ribonucleic acid (dsRNA) agents described herein, or a pharmaceutically acceptable salt thereof, wherein the subject is taking at least two but not more than four antihypertensive medications, thereby treating the subject having an AGT-associated disorder.

[0069] In another aspect the invention provides a method for decreasing blood pressure level in a subject, by selecting a subject having high cardiovascular (CV) risk and hypertension, wherein the subject having high cardiovascular (CV) risk and hypertension has atherosclerotic cardiovascular disease (ASCVD) risk with a >15% ASCVD risk score and, administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of one or more double stranded ribonucleic acid (dsRNA) agents described herein, or a pharmaceutically acceptable salt thereof, wherein the subject is taking at least two but not more than four antihypertensive medications, thereby decreasing the blood pressure level in the subject. In some embodiments, the blood pressure is systolic blood pressure and / or diastolic blood pressure.

[0070] In some embodiments, the double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’-gsuscaucCfaCfAfAfugagaguaca-3’ of SEQ ID NO: 12 and the antisense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’-usGfsuac(Tgn)cucauugUfgGfaugacsgsa-3’ of SEQ ID NO: 11, wherein a is 2'-O-methyladenosine-3’-phosphate, c is 2'-O-methylcytidine-3’ -phosphate, g is 2'-O-methylguanosine-3’ -phosphate, u is 2>O-methyluridine-3 ’-phosphate, Af is 2’-fluoroadenosine-3’- phosphate, Cf is 2’-fluorocytidine-3 ’-phosphate, Gf is 2’-fhroroguanosine-3’-phosphate, Ufis 2’- fluorouridine-3 ’ -phosphate, (Tgn) is thymidine -glycol nucleic acid (GNA) S-Isomer, and s is a phosphorothioate linkage.

[0071] The following detailed description discloses methods for inhibiting the expression of an AGT gene, methods for treating subjects that would benefit from reduction of the expression of an AGT gene, e.g., subjects susceptible to or diagnosed with an AGT-associated disorder, e.g., hypertension, using an double stranded RNAi agent, or salt thereof, targeting AGT, and pharmaceutical compositions comprising fixed doses of such RNAi agents, or salt thereof, for inhibiting the expression of an AGT gene. I. Definitions

[0072] In order that the present invention may be more readily understood, certain terms are first defined. In addition, it should be noted that whenever a value or range of values of a parameter are recited, it is intended that values and ranges intermediate to the recited values are also intended to be part of this invention.

[0073] The articles “a” and “an” are used herein to refer to one or to more than one (i. e. , to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element, e.g., a plurality of elements.

[0074] The term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to".

[0075] The term "or" is used herein to mean, and is used interchangeably with, the term "and / or," unless context clearly indicates otherwise. For example, “sense strand or antisense strand” is understood as “sense strand or antisense strand or sense strand and antisense strand.”

[0076] The term “about” is used herein to mean within the typical ranges of tolerances in the art. For example, “about” can be understood as about 2 standard deviations from the mean. In certain embodiments, about means +10%. In certain embodiments, about means +5%. When about is present before a series of numbers or a range, it is understood that “about” can modify each of the numbers in the series or range. The term “at least” prior to a number or series of numbers is understood to include the number adjacent to the term “at least”, and all subsequent numbers or integers that could logically be included, as clear from context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, “at least 19 nucleotides of a 21 nucleotide nucleic acid molecule” means that 19, 20, or 21 nucleotides have the indicated property. When at least is present before a series of numbers or a range, it is understood that “at least” can modify each of the numbers in the series or range.

[0077] As used herein, “no more than” or “less than” is understood as the value adjacent to the phrase and logical lower values or integers, as logical from context, to zero. For example, a duplex with an overhang of “no more than 2 nucleotides” has a 2, 1, or 0 nucleotide overhang. When “no more than” is present before a series of numbers or a range, it is understood that “no more than” can modify each of the numbers in the series or range. As used herein, ranges include both the upper and lower limit.

[0078] In the event of a conflict between a sequence and its indicated site on a transcript or other sequence, the nucleotide sequence recited in the specification takes precedence.

[0079] In the event of a conflict between a chemical structure and a chemical name, the chemical structure takes precedence.

[0080] As used herein, “angiotensinogen,” used interchangeably with the term “AGT” refers to the well- known gene and polypeptide, also known in the art as Serpin Peptidase Inhibitor, Clade A, Member 8; Alpha-1 Antiproteinase; Antitrypsin; SERPINA8; Angiotensin I; Serpin A8; Angiotensin II; Alpha-1 Antiproteinase angiotensinogen; antitrypsin; pre-angiotensinogen2; ANHU; Serine Proteinase Inhibitor; and Cysteine Proteinase Inhibitor. The term “AGT” includes human AGT, the amino acid and complete coding sequence of which may be found in for example, GenBank Accession No. GI: 188595658 (NM_000029.3; SEQ ID NO: 1); Maccicci fasciculciris AGT, the amino acid and complete coding sequence of which may be found in for example, GenBank Accession No. GI: 90075391 (AB170313.1: SEQ ID NO:3); mouse (Mus musculus) AGT, the amino acid and complete coding sequence of which may be found in for example, GenBank Accession No. GI: 113461997 (NM_007428.3; SEQ ID NO:5); and rat AGT (Rattus norvegicus) AGT the amino acid and complete coding sequence of which may be found in for example, for example GenBank Accession No. GE51036672 (NMJ34432; SEQ ID NO:7).

[0081] Additional examples of AGT mRNA sequences are readily available using publicly available databases, e.g. , GenBank, UniProt, OMIM, and the Macaca genome project web site.

[0082] The term “AGT,” as used herein, also refers to naturally occurring DNA sequence variations of the AGT gene, such as a single nucleotide polymorphism (SNP) in the AGT gene. Exemplary SNPs may be found in the dbSNP database available at www.ncbi.nlm.nih.gov / projects / SNP / snp- _ref.cgi?geneld=183. Non-limiting examples of sequence variations within the AGT gene include, for example, those described in U.S. Patent No. 5,589,584, the entire contents of which are incorporated herein by reference. For example, sequence variations within the AGT gene may include as a C^T at position -532 (relative to the transcription start site); a G^A at position -386; a G^A at position -218; a C^T at position -18; a G^A and a A^C at position -6 and -10; a C^T at position +10 (untanslated); a C^T at position +521 (T174M); a T^C at position +597 (P199P); a T^C at position +704 (M235T; also see, e.g., Reference SNP (refSNP) Cluster Report: rs699, available at www.ncbi.nlm.nih.gov / SNP); a A^G at position +743 (Y248C); a C^T at position +813 (N271N); a G^A at position +1017 (L339L); a C^A at position +1075 (L359M); and / or a G^A at position +1162 (V388M).

[0083] As used herein, “target sequence” refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of an AGT gene, including mRNA that is a product of RNA processing of a primary transcription product. The target portion of the sequence will be at least long enough to serve as a substrate for iRNA-directed cleavage at or near that portion of the nucleotide sequence of an mRNA molecule formed during the transcription of an AGT gene. In one embodiment, the target sequence is within the protein coding region of AGT.

[0084] The target sequence may be from about 19-36 nucleotides in length, e.g., preferably about 19-30 nucleotides in length. For example, the target sequence can be about 19-30 nucleotides, 19-30, 19-29,

[0085] 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25,

[0086] 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention.

[0087] As used herein, the term “strand comprising a sequence” refers to an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature. “G,” “C,” “A,” “T,” and “U” each generally stand for a nucleotide that contains guanine, cytosine, adenine, thymidine, and uracil as a base, respectively. However, it will be understood that the term “ribonucleotide” or “nucleotide” can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety. The skilled person is well aware that guanine, cytosine, adenine, and uracil can be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety. For example, without limitation, a nucleotide comprising inosine as its base can base pair with nucleotides containing adenine, cytosine, or uracil. Hence, nucleotides containing uracil, guanine, or adenine can be replaced in the nucleotide sequences of dsRNA featured in the invention by a nucleotide containing, for example, inosine. In another example, adenine and cytosine anywhere in the oligonucleotide can be replaced with guanine and uracil, respectively to form G-U Wobble base pairing with the target mRNA. Sequences containing such replacement moieties are suitable for the compositions and methods featured in the invention.

[0088] The terms “iRNA”, “RNAi agent,” “iRNA agent,”, “RNA interference agent” as used interchangeably herein, refer to an agent that contains RNA as that term is defined herein, and which mediates the targeted cleavage of an RNA transcript via an RNA-induced silencing complex (RISC) pathway. iRNA directs the sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). The iRNA modulates, e.g, inhibits, the expression of an AGT gene in a cell, e.g., a cell within a subject, such as a mammalian subject, preferably a human subject.

[0089] In one embodiment, an RNAi agent of the invention includes a single stranded RNA that interacts with a target RNA sequence, e.g., an AGT target mRNA sequence, to direct the cleavage of the target RNA. Without wishing to be bound by theory it is believed that long double stranded RNA introduced into cells is broken down into siRNA by a Type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, a ribonuclease-III-like enzyme, processes the dsRNA into 19-23 base pair short interfering RNAs with characteristic two base 3' overhangs (Bernstein, et al., (2001) Nature 409:363). The siRNAs are then incorporated into an RNA-induced silencing complex (RISC) where one or more helicases unwind the siRNA duplex, enabling the complementary antisense strand to guide target recognition (Nykanen, et al., (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleave the target to induce silencing (Elbashir, et al., (2001) Genes Dev. 15: 188). Thus, in one aspect the invention relates to a single stranded RNA (siRNA) generated within a cell and which promotes the formation of a RISC complex to effect silencing of the target gene, i.e., an AGT gene. Accordingly, the term “siRNA” is also used herein to refer to an iRNA as described above.

[0090] In certain embodiments, the RNAi agent may be a single-stranded siRNA (ssRNAi) that is introduced into a cell or organism to inhibit a target mRNA. Single-stranded RNAi agents bind to the RISC endonuclease, Argonaute 2, which then cleaves the target mRNA. The single-stranded siRNAs are generally 15-30 nucleotides and are chemically modified. The design and testing of single-stranded siRNAs are described in U.S. Patent No. 8,101,348 and in Uima et al., (2012) Cell 150:883-894, the entire contents of each of which are hereby incorporated herein by reference. Any of the antisense nucleotide sequences described herein may be used as a single-stranded siRNA as described herein or as chemically modified by the methods described in Lima et al., (2012) Cell 150:883-894.

[0091] In certain embodiments, an “iRNA” for use in the compositions, uses, and methods of the invention is a double stranded RNA and is referred to herein as a “double stranded RNA agent,” “double stranded RNA (dsRNA) molecule,” “dsRNA agent,” or “dsRNA”. The term “dsRNA”, refers to a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary nucleic acid strands, referred to as having “sense” and “antisense” orientations with respect to a target RNA, i.e., an AGT gene. In some embodiments of the invention, a double stranded RNA (dsRNA) triggers the degradation of a target RNA, e.g., an mRNA, through a post- transcriptional gene -silencing mechanism referred to herein as RNA interference or RNAi.

[0092] In general, the majority of nucleotides of each strand of a dsRNA molecule are nonribonucleotides, e.g., a deoxyribonucleotide or a modified nucleotide. In addition, as used in this specification, an “iRNA” may include ribonucleotides with chemical modifications; an iRNA may include substantial modifications at multiple nucleotides. As used herein, the term “modified nucleotide” refers to a nucleotide having, independently, a modified sugar moiety, a modified intemucleotide linkage, or modified nucleobase, or any combination thereof. Thus, the term modified nucleotide encompasses substitutions, additions, or removal of, e.g., a functional group or atom, to intemucleoside linkages, sugar moieties, or nucleobases. The modifications suitable for use in the agents of the invention include all types of modifications disclosed herein or known in the art. Any such modifications, as used in a siRNA type molecule, are encompassed by “iRNA” or “RNAi agent” for the purposes of this specification and claims.

[0093] The duplex region may be of any length that permits specific degradation of a desired target RNA through a RISC pathway, and may range from about 19 to 36 base pairs in length, e.g., about 19-30 base pairs in length, for example, about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length, such as about 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length. In certain embodiments, the duplex region is 19-21 base pairs in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention.

[0094] The two strands forming the duplex structure may be different portions of one larger RNA molecule, or they may be separate RNA molecules. Where the two strands are part of one larger molecule, and therefore are connected by an uninterrupted chain of nucleotides between the 3 ’-end of one strand and the 5 ’-end of the respective other strand forming the duplex structure, the connecting RNA chain is referred to as a “hairpin loop.” A hairpin loop can comprise at least one unpaired nucleotide. In some embodiments, the hairpin loop can comprise at least 4, 5, 6, 7, 8, 9, 10, 20, 23, or more unpaired nucleotides. In some embodiments, the hairpin loop can be 10 or fewer nucleotides. In some embodiments, the hairpin loop can be 8 or fewer unpaired nucleotides. In some embodiments, the hairpin loop can be 4-10 unpaired nucleotides. In some embodiments, the hairpin loop can be 4-8 nucleotides.

[0095] Where the two substantially complementary strands of a dsRNA are comprised by separate RNA molecules, those molecules need not be, but can be covalently connected. Where the two strands are connected covalently by means other than an uninterrupted chain of nucleotides between the 3 ’-end of one strand and the 5 ’-end of the respective other strand forming the duplex structure, the connecting structure is referred to as a “linker.” The RNA strands may have the same or a different number of nucleotides. The maximum number of base pairs is the number of nucleotides in the shortest strand of the dsRNA minus any overhangs that are present in the duplex. In addition to the duplex structure, an RNAi may comprise one or more nucleotide overhangs.

[0096] In certain embodiments, an iRNA agent of the invention is a dsRNA, each strand of which comprises 19-23 nucleotides, that interacts with a target RNA sequence, e.g., an AGT gene, to direct cleavage of the target RNA.

[0097] In some embodiments, an iRNA of the invention is a dsRNA of 24-30 nucleotides that interacts with a target RNA sequence, e.g. , an AGT target mRNA sequence, to direct the cleavage of the target RNA.

[0098] As used herein, the term “nucleotide overhang” refers to at least one unpaired nucleotide that protrudes from the duplex structure of a double stranded iRNA. For example, when a 3'-end of one strand of a dsRNA extends beyond the 5 '-end of the other strand, or vice versa, there is a nucleotide overhang. A dsRNA can comprise an overhang of at least one nucleotide; alternatively, the overhang can comprise at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides or more. A nucleotide overhang can comprise or consist of a nucleotide / nucleoside analog, including a deoxynucleotide / nucleoside. The overhang(s) can be on the sense strand, the antisense strand, or any combination thereof. Furthermore, the nucleotide(s) of an overhang can be present on the 5'-end, 3'-end, or both ends of either an antisense or sense strand of a dsRNA.

[0099] In certain embodiments, the antisense strand of a dsRNA has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3’-end orthe 5’-end. In certain embodiments, the overhang on the sense strand or the antisense strand, or both, can include extended lengths longer than 10 nucleotides, e.g., 1-30 nucleotides, 2-30 nucleotides, 10-30 nucleotides, 10-25 nucleotides, 10-20 nucleotides, or 10-15 nucleotides in length. In certain embodiments, an extended overhang is on the sense strand of the duplex. In certain embodiments, an extended overhang is present on the 3 ’end of the sense strand of the duplex. In certain embodiments, an extended overhang is present on the 5 ’end of the sense strand of the duplex. In certain embodiments, an extended overhang is on the antisense strand of the duplex. In certain embodiments, an extended overhang is present on the 3 ’end of the antisense strand of the duplex. In certain embodiments, an extended overhang is present on the 5 ’end of the antisense strand of the duplex. In certain embodiments, one or more of the nucleotides in the extended overhang is replaced with a nucleoside thiophosphate. In certain embodiments, the overhang includes a self- complementary portion such that the overhang is capable of forming a hairpin structure that is stable under physiological conditions.

[0100] “Blunt” or “blunt end” means that there are no unpaired nucleotides at that end of the double stranded RNA agent, z.e., no nucleotide overhang. A “blunt ended” double stranded RNA agent is double stranded over its entire length, z.e., no nucleotide overhang at either end of the molecule. The RNAi agents of the invention include RNAi agents with no nucleotide overhang at one end (z.e., agents with one overhang and one blunt end) or with no nucleotide overhangs at either end. Most often such a molecule will be double-stranded over its entire length.

[0101] The term “antisense strand” or "guide strand" refers to the strand of an iRNA, e.g, a dsRNA, which includes a region that is substantially complementary to a target sequence, e.g., an AGT mRNA. As used herein, the term “region of complementarity” refers to the region on the antisense strand that is substantially complementary to a sequence, for example a target sequence, e.g., an AGT nucleotide sequence, as defined herein. Where the region of complementarity is not fully complementary to the target sequence, the mismatches can be in the internal or terminal regions of the molecule. Generally, the most tolerated mismatches are in the terminal regions, e.g., within 5, 4, or 3 nucleotides of the 5’- or 3’- end of the iRNA. In some embodiments, a double stranded RNA agent of the invention includes a nucleotide mismatch in the antisense strand. In some embodiments, a double stranded RNA agent of the invention includes a nucleotide mismatch in the sense strand. In some embodiments, the nucleotide mismatch is, for example, within 5, 4, 3 nucleotides from the 3’-end of the iRNA. In another embodiment, the nucleotide mismatch is, for example, in the 3 ’-terminal nucleotide of the iRNA.

[0102] The term “sense strand” or "passenger strand" as used herein, refers to the strand of an iRNA that includes a region that is substantially complementary to a region of the antisense strand as that term is defined herein.

[0103] As used herein, “substantially all of the nucleotides are modified” are largely but not wholly modified and can include not more than 5, 4, 3, 2, or 1 unmodified nucleotides.

[0104] As used herein, the term “cleavage region” refers to a region that is located immediately adjacent to the cleavage site. The cleavage site is the site on the target at which cleavage occurs. In some embodiments, the cleavage region comprises three bases on either end of, and immediately adjacent to, the cleavage site. In some embodiments, the cleavage region comprises two bases on either end of, and immediately adjacent to, the cleavage site. In some embodiments, the cleavage site specifically occurs at the site bound by nucleotides 10 and 11 of the antisense strand, and the cleavage region comprises nucleotides 11, 12 and 13.

[0105] Complementary sequences within an iRNA, e.g., within a dsRNA as described herein, include base-pairing of the oligonucleotide or polynucleotide comprising a first nucleotide sequence to an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the entire length of one or both nucleotide sequences. Such sequences can be referred to as “fully complementary” with respect to each other herein. However, where a first sequence is referred to as “substantially complementary” with respect to a second sequence herein, the two sequences can be fully complementary, or they can form one or more, but generally not more than 5, 4, 3, or 2 mismatched base pairs upon hybridization for a duplex up to 30 base pairs, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., inhibition of gene expression via a RISC pathway. However, where two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity. For example, a dsRNA comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 21 nucleotides that is fully complementary to the shorter oligonucleotide, can yet be referred to as “fully complementary” for the purposes described herein.

[0106] “Complementary” sequences, as used herein, can also include, or be formed entirely from, non- Watson-Crick base pairs or base pairs formed from non-natural and modified nucleotides, in so far as the above requirements with respect to their ability to hybridize are fulfilled. Such non-Watson-Crick base pairs include, but are not limited to, G:U Wobble or Hoogstein base pairing.

[0107] The terms “complementary,” “fully complementary” and “substantially complementary” herein can be used with respect to the base matching between the sense strand and the antisense strand of a dsRNA, or between the antisense strand of a double stranded RNA agent and a target sequence, as will be understood from the context of their use.

[0108] As used herein, a polynucleotide that is “substantially complementary to at least part of’ a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g. , an mRNA encoding an AGT gene). For example, a polynucleotide is complementary to at least a part of an AGT mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding an AGT gene.

[0109] Accordingly, in some embodiments, the sense strand polynucleotides and the antisense polynucleotides disclosed herein are fully complementary to the target AGT sequence. In other embodiments, the sense strand polynucleotides or the antisense polynucleotides disclosed herein are substantially complementary to the target AGT sequence and comprise a contiguous nucleotide sequence which is at least 80% complementary over its entire length to the equivalent region of the nucleotide sequence of any one of SEQ ID NOs: 1 and 2, or a fragment of any one of SEQ ID NOs: 1 and 2, such as at least 90%, or 95% complementary; or 100% complementary.

[0110] Accordingly, in some embodiments, the antisense strand polynucleotides disclosed herein are fully complementary to the target AGT sequence. In other embodiments, the antisense strand polynucleotides disclosed herein are substantially complementary to the target AGT sequence and comprise a contiguous nucleotide sequence which is at least about 90% complementary over its entire length to the equivalent region of the nucleotide sequence of SEQ ID NO: 1, or a fragment of SEQ ID NO: 1, such as about 90%, or about 95%, complementary. In certain embodiments, the fragment of SEQ ID NO: 1 is nucleotides 638-658 of SEQ ID NO: 1.

[0111] In certain embodiments, the nucleotide sequence of the antisense strand of an iRNA of the invention comprises at least 19, 20, 21, 22 or 23 contiguous nucleotides of the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9). In certain embodiments, the iRNA of the invention further comprises a sense strand comprising at least 19, 20, or 21 contiguous nucleotides of the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10).

[0112] In certain embodiments, the nucleotide sequence of the antisense strand of an iRNA of the invention comprises the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9). In certain embodiments, the iRNA of the invention further comprises a sense strand comprising the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10).

[0113] In certain embodiments, the nucleotide sequence of the antisense strand of an iRNA of the invention consists of UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9). In certain embodiments, the iRNA of the invention further comprises a sense strand consisting of the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10).

[0114] In certain embodiments, the modified nucleotide sequence of the antisense strand of an iRNA of the invention comprises at least 19, 20, 21, 22 or 23 contiguous nucleotides of the modified nucleotide sequence usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11). In certain embodiments the iRNA of the invention further comprises a sense strand comprising a modified nucleotide sequence comprising at least 19, 20 or 21 contiguous nucleotides of gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12). The chemical modifiecations are defined as follows: a is 2'-O-methyladenosine-3’ -phosphate, c is 2'-O- methylcytidine-3 ’-phosphate, g is 2'-O-methylguanosine-3 ’ -phosphate, u is 2'-O-methyluridine-3’- phosphate, Af is 2’-fluoroadenosine-3’-phosphate, Cf is 2 ’-fluorocytidine-3 ’-phosphate, Gf is 2’- fluoroguanosine-3 ’-phosphate, Uf is 2’-fluorouridine-3 ’-phosphate, (Tgn) is thymidine-glycol nucleic acid (GNA) S-isomer, and s is phosphorothioate linkage; and wherein the 3 ’end of the sense strand is optionally covalently linked to a ligand, e.g., a ligand with the following structure:

[0115] In certain embodiments, the modified nucleotide sequence of the antisense strand of an iRNA of the invention comprises the modified nucleotide sequence usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11). In certain embodiments the iRNA of the invention further comprises a sense strand comprising the modified nucleotide sequence gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12).

[0116] In certain embodiments, the modified nucleotide sequence of the antisense strand of an iRNA of the invention consists of usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11). In certain embodiments, the iRNA of the invention further comprises a sense strand wherein the modified nucleotide sequence of the sense strand consists of the modified nucleotide sequence gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12).

[0117] A “pharmaceutically acceptable salt” of the dsRNA of the invention being used in the methods of the invention includes any salt which is pharmaceutically acceptable, e.g., a sodium salt of the dsRNA agent. In one embodiment, the pharmaceutically acceptable salt of the dsRNA of the invention being used in the methods of the invention has the following structure:

[0118] 21 Na*

[0119] In general, an “iRNA” includes ribonucleotides with chemical modifications. Such modifications may include all types of modifications disclosed herein or known in the art. Any such modifications, as used in a dsRNA molecule, are encompassed by “iRNA” for the purposes of this specification and claims.

[0120] In an aspect of the invention, an agent for use in the methods and compositions of the invention is a single -stranded antisense oligonucleotide molecule that inhibits a target mRNA via an antisense inhibition mechanism. The single-stranded antisense oligonucleotide molecule is complementary to a sequence within the target mRNA. The single-stranded antisense oligonucleotides can inhibit translation in a stoichiometric manner by base pairing to the mRNA and physically obstructing the translation machinery, see Dias, N. et al., (2002) Mol Cancer Ther 1:347-355. The single-stranded antisense oligonucleotide molecule may be about 14 to about 30 nucleotides in length and have a sequence that is complementary to a target sequence. For example, the single -stranded antisense oligonucleotide molecule may comprise a sequence that is at least about 14, 15, 16, 17, 18, 19, 20, or more contiguous nucleotides from any one of the antisense sequences described herein. The phrase “contacting a cell with an iRNA,” such as a dsRNA, as used herein, includes contacting a cell by any possible means. Contacting a cell with an iRNA includes contacting a cell in vitro with the iRNA or contacting a cell in vivo with the iRNA. The contacting may be done directly or indirectly. Thus, for example, the iRNA may be put into physical contact with the cell by the individual performing the method, or alternatively, the iRNA may be put into a situation that will permit or cause it to subsequently come into contact with the cell.

[0121] Contacting a cell in vitro may be done, for example, by incubating the cell with the iRNA. Contacting a cell in vivo may be done, for example, by injecting the iRNA into or near the tissue where the cell is located, or by injecting the iRNA into another area, e.g. , the bloodstream or the subcutaneous space, such that the agent will subsequently reach the tissue where the cell to be contacted is located. For example, the iRNA may contain or be coupled to a ligand, e.g., N-acetylgalactosamine (GalNAc), that directs the iRNA to a site of interest, e.g., the liver. Combinations of in vitro and in vivo methods of contacting are also possible. For example, a cell may also be contacted in vitro with an iRNA and subsequently transplanted into a subject.

[0122] In certain embodiments, contacting a cell with an iRNA includes “introducing” or “delivering the iRNA into the cell” by facilitating or effecting uptake or absorption into the cell. Absorption or uptake of an iRNA can occur through unaided diffusion or active cellular processes, or by auxiliary agents or devices. Introducing an iRNA into a cell may be in vitro or in vivo. For example, for in vivo introduction, iRNA can be injected into a tissue site or administered systemically. In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection. Further approaches are described herein below or are known in the art.

[0123] As used herein, a “subject” is an animal, such as a mammal, including a primate (such as a human, a non-human primate, e.g. , a monkey, and a chimpanzee), or a non-primate (such as a cow, a pig, a horse, a goat, a rabbit, a sheep, a hamster, a guinea pig, a cat, a dog, a rat, or a mouse) that expresses the target gene, either endogenously or heterologously. In an embodiment, the subject is a human, such as a human being treated or assessed for a disease or disorder that would benefit from reduction in AGT expression; a human at risk for a disease or disorder that would benefit from reduction in AGT expression; a human having a disease or disorder that would benefit from reduction in AGT expression; or human being treated for a disease or disorder that would benefit from reduction in AGT expression as described herein. The diagnostic criteria for an AGT-associated disorder, e.g., hypertension, are provided below. In some embodiments, the subject is a female human. In other embodiments, the subject is a male human. In certain embodiments, the subject is part of a group susceptible to salt sensitivity, e.g., black or an older adult (> 65 years of age). In some embodiments, the subject is male and >65 years of age. In some embodiments, the subject is male and >70 years of age. In some embodiments, the subject is male and >75 years of age. In some embodiments, the subject is male and >80 years of age. In some embodiments, the subject is female and >71 years of age. In some embodiments, the subject is female and >75 years of age. In some embodiments, the subject is female and >80 years of age. In certain embodiments, the subject is overweight or obese, e.g., a subject that suffers from central obesity. In certain embodiments, the subject is sedentary. In certain embodiments, the subject is pregnant or planning to become pregnant. In certain embodiments, the subject has redueced kidney function. In certain embodiments the subject has type 1 diabetes. In certain embodiments, the subject has type 2 diabetes.

[0124] The phrase a “subject having high cardiovascular (CV) risk and hypertension,” as used herein refers to a subject having atherosclerotic cardiovascular disease (ASCVD) risk, for example, with an ASCVD risk score of greater than 15%. In some embodiments, the subject having high cardiovascular (CV) risk and hypertension is a subject having high cardiovascular (CV) risk and hypertension that is not adequately controlled by, for example, two, three, or four, but not more than four antihypertensive medications. The ASCVD risk score is a guideline developed by the American College of Cardiology, which refers to a calculation of a subject’s 10-year risk of having a cardiovascular problem, such as a heart attack or stroke (Wong / al., Am J Prev Cardiol. 2022 Jun; 10: 100335; incorporated herein in its entirety by reference). This risk estimate considers, for example, the subject’ age, sex, race, cholesterol levels, blood pressure, medication use, diabetic status, and / or smoking status. The ASCVD risk score is determined as a percentage, which is identified as a chance of having heart disease or stroke in 10 years.

[0125] The ASCVD risk score is categorized into those at low (<5%), borderline (5-<7.5%), intermediate (7.5-<20%), and high (>20%) risk. In some embodiments, the subject having atherosclerotic cardiovascular disease (ASCVD) risk described herein has an ASCVD risk score of >15%, >16%, >17%, >18%, >19%, >20%, >25%, >30%, >35%, >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, or >95%.

[0126] The ASCVD risk score may also be associated with one or more risk enhancers, inlcuding but not limited to, the subject’s family history of early-onset ASCVD; continually elevated LDL greater than or equal to 160 mg / dL ( >4.1 mmol / L); chronic kidney disease; metabolic syndrome; preeclampsia or premature menopause; inflammatory diseases such as rheumatoid arthritis, psoriasis, or HIV; a south Asian ancestry; continually elevated triglycerides greater than or equal to 175 mg / dL ( >2.0 mmol / L).

[0127] As used herein, the terms “treating” or “treatment” refer to a beneficial or desired result, such as reducing at least one sign or symptom of an AGT-associated disorder, e.g., hypertension in a subject. Treatment also includes a reduction of one or more sign or symptoms associated with unwanted AGT expression, e.g., angiotensin II type 1 receptor activation (ATiR) (e.g., hypertension, chronic kidney disease, stroke, myocardial infarction, heart failure, aneurysms, peripheral artery disease, heart disease, increased oxidative stress, e.g., increased superoxide formation, inflammation, vasoconstriction, sodium and water retention, potassium and magnesium loss, renin suppression, myocyte and smooth muscle hypertrophy, increased collagen sysnthesis, stimulation of vascular, myocardial and renal fibrosis, increased rate and force of cardiac contractions, altered heart rate, e.g., increased arrhythmia, stimulation of plasminogen activator inhibitor 1 (PAH), activation of the sympathetic nervous system, and increased endothelin secretion), symptoms of pregnancy -associated hypertension (e.g., preeclampsia, and eclampsia), including, but not limited to intrauterine growth restriction (IUGR) or fetal growth restriction, symptoms associated with malignant hypertension, symptoms associated with hyperaldosteronism; diminishing the extent of unwanted ATiR activation; stabilization (z.e., not worsening) of the state of chronic ATiR activation; amelioration or palliation of unwanted ATiR activation (e.g., hypertension, chronic kidney disease, stroke, myocardial infarction, heart failure, aneurysms, peripheral artery disease, heart disease, increased oxidative stress, e.g., increased superoxide formation, inflammation, vasoconstriction, sodium and water retention, potassium and magnesium loss, renin suppression, myocyte and smooth muscle hypertrophy, increased collagen sysnthesis, stimulation of vascular, myocardial and renal fibrosis, increased rate and force of cardiac contractions, altered heart rate, e.g., increased arrhythmia, stimulation of plasminogen activator inhibitor 1 (PAI1), activation of the sympathetic nervous system, and increased endothelin secretion) whether detectable or undetectable. AGT-associated disorders can also include obesity, liver steatosis / fatty liver, e.g., non-alcoholic Steatohepatitis (NASH) and non-alcoholic fatty liver disease (NAFLD); glucose intolerance, type 2 diabetes, and metabolic syndrome. “Treatment” can also mean prolonging survival as compared to expected survival in the absence of treatment.

[0128] In the methods of the invention, the term “add-on treatment” refers to a treatment, administration of a dsRNA agent targeting AGT as disclosed herein, to a subject as described herein who is also being administered an anti-hypertensive medication(s) that has not adequately controlled hypertension in the subject. The “add-on treatment” is administered to the subject while the subject remains on the hypertensive medication(s) to control hypertension in the subject, e.g., to further lower the subject’s blood pressure, e.g., systolic blood pressure, diastolic blood pressure, or both systolic and diastolic blood pressure. A subject administered an add-on treatment does not discontinue the hypertensive medication(s) when starting an add-on treatment, e.g., the add-on treatment is administered concurrently with the hypertensive medication(s).

[0129] As used herein, the term “add-on treatment” is used interchangeably with the terms “adjuvant therapy,” “adjunct therapy,” “adjuvant care,” and “augmentation therapy.”

[0130] As used herein, “reduced kidney function” and the like can be diagnosed using any of a number of recognized criteria, e.g., glomerular fdtration rate (GFR), albuminuria, creatinine, or BUN. As used herein, reduced kidney function can be transient or chronic. A GFR of at least 60 is considered to be normal. A GFR of 60 or less is indicative of reduced kidney function with a GFR of > 15-60 being indicative of kidney disease, and a GFR of less than 15 is indicative of kidney failure. GFR is typically determined based on urine creatinine levels, with a higher level of creatinine indicative of lower kidney function. The presence of albumin in the urine is also indicative of decreased kidney function. The absolute level of albumin can be determined to diagnose decreased kidney function. The ratio of albumin to creatinine can also be determined to assess kidney function. A urine albumin to creatinine ratio of 30 mg / g or less is indicative of normal kidney function. A urine albumin to creatinine ratio greater than 30 mg / g is indicative of reduced kiney function.

[0131] The term “lower” in the context of the level of AGT gene expression or agt protein production in a subject, or a disease marker or symptom refers to a statistically significant decrease in such level. The decrease can be, for example, at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or below the level of detection for the detection method in a relevant cell or tissue, e.g. , a liver cell, or other subject sample, e.g., blood or serum derived therefrom, urine. In certain embodiments, “lower” is a reduction of AGT protein in the serum after administration of one or more doses of an iRNA agent provided herein relative to AGT protein level in serum prior to administration of any doses of an iRNA agent provided herein.

[0132] As used herein, “prevention” or “preventing,” when used in reference to a disease or disorder, that would benefit from a reduction in expression of an AGT gene or production of agt protein, e.g. , in a subject susceptible to an AGT-associated disorder due to, e.g., aging, genetic factors, hormone changes, diet, and a sedentary lifestyle, wherein the subject does not yet meet the diagnostic criteria for the AGT- associated disorder. As used herein, prevention can be understood as administration of an agent to a subject who does not yet meet the diagnostic criteria for the AGT-associated disorder to delay or reduce the likelihood that the subject will develop the AGT-associated disorder. As the agent is a pharmaceutical agent, it is understood that administration typically would be under the direction of a health care professional capable of identifying a subject who does not yet meet the diagnostic criteria for an AGT-associated disorder as being susceptible to developing an AGT-associated disorder. Diagnosic criteria for hypertension and risk factors for hypertension are provided below. In certain embodiments, the disease or disorder is e.g., a symptom of unwanted ATiR activation, such as a hypertension, chronic kidney disease, stroke, myocardial infarction, heart failure, aneurysms, peripheral artery disease, heart disease, increased oxidative stress, e.g., increased superoxide formation, inflammation, vasoconstriction, sodium and water retention, potassium and magnesium loss, renin suppression, myocyte and smooth muscle hypertrophy, increased collagen synthesis, stimulation of vascular, myocardial and renal fibrosis, increased rate and force of cardiac contractions, altered heart rate, e.g., increased arrhythmia, stimulation of plasminogen activator inhibitor 1 (PAI1), activation of the sympathetic nervous system, and increased endothelin secretion. AGT-associated disorders can also include obesity, liver steatosis / fatty liver, e.g., non-alcoholic Steatohepatitis (NASH) and non-alcoholic fatty liver disease (NAFLD); glucose intolerance, type 2 diabetes, and metabolic syndrome. The likelihood of developing, e.g., hypertension, is reduced, for example, when an individual having one or more risk factors for a hypertension either fails to develop hypertension or develops hypertension with less severity relative to a population having the same risk factors and not receiving treatment as described herein. The failure to develop an AGT- associated disorder, e.g., hypertension or a delay in the time to develop hypertension by months or years is considered effective prevention. Prevention may require administration of more than one dose if the iRNA agent. Provided with appropriate methods to identify subjects at risk to develop any of the AGT- assocated diseases above, the iRNA agents provided herein can be used as pharmaceutical agents for or in methods of prevention of AGT-associated diseases. Risk factors for various AGT-associated diseases are discussed below.

[0133] As used herein, the term "angiotensinogen-associated disease” or “AGT-associated disease,” is a disease or disorder that is caused by, or associated with, renin-angiotensin-aldosterone system (RAAS) activation, or a disease or disorder the symptoms of which or progression of which responds to RAAS inactivation. The term "angiotensinogen-associated disease” includes a disease, disorder, or condition that would benefit from reduction in AGT expression. Such diseases are typically associated with high blood pressure. Non-limiting examples of angiotensinogen-associated diseases include hypertension, e.g., borderline hypertension (also known as prehypertension), primary hypertension (also known as essential hypertension or idiopathic hypertension), secondary hypertension (also known as inessential hypertension), isolated systolic or diastolic hypertension, pregnancy-associated hypertension (e.g., preeclampsia, eclampsia, and post-partum preelampsia), diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension (also known as renal hypertension), Goldblatt hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venouss hypertension, systolic hypertension, labile hypertension; hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vasculopathy (including peripheral vascular disease), diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiac myopathy, glomerulosclerosis, coarctation of the aorta, aortic aneurism, ventricular fibrosis, sleep apnea, heart failure (e.g., left ventricular systolic dysfunction, heart failure with decreased ejection fraction), myocardial infarction, angina, stroke, renal disease e.g., chronic kidney disease or diabetic nephropathy optionally in the context of pregnancy, renal failure, e.g., chronic renal failure, and systemic sclerosis (e.g., scleroderma renal crisis). In certain embodiments, AGT- associated disease includes intrauterine growth restriction (IUGR) or fetal growth restriction. In certain embodiments, AGT-associated disorders can also include obesity, liver steatosis / fatty liver, e.g., nonalcoholic Steatohepatitis (NASH) and non-alcoholic fatty liver disease (NAFLD); glucose intolerance, type 2 diabetes, metabolic syndrome, and nocturnal hypotension.

[0134] Thresholds for high blood pressure and stages of hypertension are discussed in detail below.

[0135] In one embodiment, an angiotensinogen-associated disease is primary hypertension. “Primary hypertension” is a result of environmental or genetic causes (e.g., a result of no obvious underlying medical cause).

[0136] In one embodiment, an angiotensinogen-associated disease is secondary hypertension. “Secondary hypertension” has an identifiable underlying disorder which can be of multiple etiologies, including renal, vascular, and endocrine causes, e.g., renal parenchymal disease (e.g., polycystic kidneys, glomerular or interstitial disease), renal vascular disease (e.g., renal artery stenosis, fibromuscular dysplasia), endocrine disorders (e.g., adrenocorticosteroid or mineralocorticoid excess, pheochromocytoma, hyperthyroidism or hypothyroidism, growth hormone excess, hyperparathyroidism), coarctation of the aorta, or oral contraceptive use.

[0137] In one embodiment, an angiotensinogen-associated disease is pregnancy-associated hypertension, e.g., chronic hypertension of pregnancy, gestational hypertension, preeclampsia, eclampsia, preeclampsia superimposed on chronic hypertension, HELLP syndrome, and gestational hypertension (also known as transient hypertension of pregnancy, chronic hypertension identified in the latter half of pregnancy, and pregnancy-induced hypertension (PIH)). Diagnostic criteria for pregnancy-associated hypertension are provided below. In one embodiment, an angiotensinogen-associated disease is resistant hypertension. “Resistant hypertension” is blood pressure that remains above goal (e.g., above 130 mm Hg systolic or above 90 diastolic) in spite of concurrent use of three antihypertensive agents of different classes, one of which is a thiazide diuretic. Subjects whose blood pressure is controlled with four or more medications are also considered to have resistant hypertension.

[0138] A "therapeutically-effective amount" or “prophylactically effective amount” also includes an amount of an RNAi agent that produces some desired effect at a reasonable benefit / risk ratio applicable to any treatment. The iRNA employed in the methods of the present invention may be administered in a sufficient amount to produce a reasonable benefit / risk ratio applicable to such treatment.

[0139] The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human subjects and animal subjects without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0140] The phrase "pharmaceutically-acceptable carrier" as used herein means a pharmaceutically- acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g, lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject being treated. Such carriers are known in the art. Pharmaceutically acceptable carriers include carriers for administration by injection.

[0141] The term “sample,” as used herein, includes a collection of similar fluids, cells, or tissues isolated from a subject, as well as fluids, cells, or tissues present within a subject. Examples of biological fluids include blood, serum and serosal fluids, plasma, cerebrospinal fluid, ocular fluids, lymph, urine, saliva, and the like. Tissue samples may include samples from tissues, organs, or localized regions. For example, samples may be derived from particular organs, parts of organs, or fluids or cells within those organs. In certain embodiments, samples may be derived from the liver (e.g., whole liver or certain segments of liver or certain types of cells in the liver, such as, e.g., hepatocytes). In some embodiments, a “sample derived from a subject” refers to urine obtained from the subject. A “sample derived from a subject” can refer to blood or blood derived serum or plasma from the subject.

[0142] II. Methods of the Invention

[0143] The present invention provides methods for inhibiting the expression of an angiotensinogen (AGT) gene. The present invention also provides methods for treating a subject having a disorder that would benefit from reduction in AGT expression, or treating an AGT-associated disorder in a subject. In addition, the present invention provides methods for decreasing blood pressure level in a subject. The methods include administering to the subject a fixed dose, e.g., about 150 mg to about 600 mg, of a double stranded RNAi agent, or salt thereof, targeting AGT, as described herein.

[0144] In one aspect the invention provides a method for treating a subject that would benefit from reduction in AGT expression, by selecting a subject having high cardiovascular (CV) risk and hypertension, and administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of one or more double stranded ribonucleic acid (dsRNA) agents described herein, or a pharmaceutically acceptable salt thereof, wherein the subject is taking at least two but not more than four antihypertensive medications, thereby treating the subject that would benefit from reduction in AGT expression.

[0145] In another aspect the invention provides a method for inhibiting the expression of an angiotensinogen (AGT) gene in a subject, by selecting a subject having high cardiovascular (CV) risk and hypertension, and administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of one or more double stranded ribonucleic acid (dsRNA) agents described herein, or a pharmaceutically acceptable salt thereof, wherein the subject is taking at least two but not more than four antihypertensive medications, thereby inhibiting the expression of the AGT gene in the subject.In another aspect the invention provides a method for treating a subject that having an AGT-associated disorder, by selecting a subject having high cardiovascular (CV) risk and hypertension, and administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of one or more double stranded ribonucleic acid (dsRNA) agents described herein, or a pharmaceutically acceptable salt thereof, wherein the subject is taking at least two but not more than four antihypertensive medications, thereby treating the subject having an AGT-associated disorder.

[0146] In another aspect the invention provides a method for decreasing blood pressure level in a subject, by selecting a subject having high cardiovascular (CV) risk and hypertension, and administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of one or more double stranded ribonucleic acid (dsRNA) agents described herein, or a pharmaceutically acceptable salt thereof, wherein the subject is taking at least two but not more than four antihypertensive medications, thereby decreasing the blood pressure level in the subject. In some embodiments, the blood pressure comprises systolic blood pressure and / or diastolic blood pressure.

[0147] In one aspect the invention provides a method for treating a subject that would benefit from reduction in AGT expression, by selecting a subject having high cardiovascular (CV) risk and hypertension, wherein the subject having high cardiovascular (CV) risk and hypertension has atherosclerotic cardiovascular disease (ASCVD) risk with a >15% ASCVD risk score and, administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of one or more double stranded ribonucleic acid (dsRNA) agents described herein, or a pharmaceutically acceptable salt thereof, wherein the subject is taking at least two but not more than four antihypertensive medications, thereby treating the subject that would benefit from reduction in AGT expression.

[0148] In another aspect the invention provides a method for inhibiting the expression of an angiotensinogen (AGT) gene in a subject, by selecting a subject having high cardiovascular (CV) risk and hypertension, wherein the subject having high cardiovascular (CV) risk and hypertension has atherosclerotic cardiovascular disease (ASCVD) risk with a >15% ASCVD risk score and, administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of one or more double stranded ribonucleic acid (dsRNA) agents described herein, or a pharmaceutically acceptable salt thereof, wherein the subject is taking at least two but not more than four antihypertensive medications, thereby inhibiting the expression of the AGT gene in the subject.

[0149] In another aspect the invention provides a method for treating a subject that having an AGT- associated disorder, by selecting a subject having high cardiovascular (CV) risk and hypertension, wherein the subject having high cardiovascular (CV) risk and hypertension has atherosclerotic cardiovascular disease (ASCVD) risk with a >15% ASCVD risk score and, administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of one or more double stranded ribonucleic acid (dsRNA) agents described herein, or a pharmaceutically acceptable salt thereof, wherein the subject is taking at least two but not more than four antihypertensive medications, thereby treating the subject having an AGT-associated disorder.

[0150] In another aspect the invention provides a method for decreasing blood pressure level in a subject, by selecting a subject having high cardiovascular (CV) risk and hypertension, wherein the subject having high cardiovascular (CV) risk and hypertension has atherosclerotic cardiovascular disease (ASCVD) risk with a >15% ASCVD risk score and, administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of one or more double stranded ribonucleic acid (dsRNA) agents described herein, or a pharmaceutically acceptable salt thereof, wherein the subject is taking at least two but not more than four antihypertensive medications, thereby decreasing the blood pressure level in the subject. In some embodiments, the blood pressure is systolic blood pressure and / or diastolic blood pressure.

[0151] In some embodiments, the double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a modified nucleotide sequence comprising at least 19, 20 or 21 contiguous nucleotides of the modified nucleotide sequence 5’-gsuscaucCfaCfAfAfugagaguaca-3’ of SEQ ID NO: 12 and the antisense strand comprises a modified nucleotide sequence comprising at least 19, 20, 21, 22 or 23 contiguous nucleotides of the modified nucleotide sequence 5’- usGfsuac(Tgn)cucauugUfgGfaugacsgsa-3’ of SEQ ID NO: 11, wherein a is 2'-O-methyladenosine-3’- phosphate, c is 2'-O-methylcytidine-3’ -phosphate, g is 2'-O-methylguanosine-3’ -phosphate, u is 2'-O- methyluridine-3 ’ -phosphate, Af is 2 ’-fluoroadenosine-3’ -phosphate, Cf is 2’-fluorocytidine-3’- phosphate, Gf is 2'-fluorogiianosinc-3'-phosphatc. Ufis 2>fhiorouridine-3 ’-phosphate, (Tgn) is thymidine -glycol nucleic acid (GN A) S -Isomer, and s is a phosphorothioate linkage.

[0152] In some embodiments, the method comprises administering to the subject a fixed dose of about 150 mg to about 600 mg of one or more double -stranded ribonucleic acid (RNAi) agents described herein that inhibit expression of AGT. In some embodiments, the method comprises administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of one or more double-stranded ribonucleic acid (RNAi) agents described herein that inhibit expression of AGT. In some embodiments, the method comprises administering to the subject a fixed dose of about 150 mg of one or more doublestranded ribonucleic acid (RNAi) agents described herein that inhibit expression of AGT. In some embodiments, the method comprises administering to the subject a fixed dose of about 300 mg of one or more double -stranded ribonucleic acid (RNAi) agents described herein that inhibit expression of AGT. In some embodiments, the method comprises administering to the subject a fixed dose of about 600 mg of one or more double-stranded ribonucleic acid (RNAi) agents described herein that inhibit expression of AGT. In some embodiments, the method comprises administering to the subject a fixed dose of about 150 mg-200 mg, 200 mg-250 mg, 250 mg-300 mg, 300 mg-350 mg, 350 mg-400 mg, 400 mg-450 mg,

[0153] 450 mg-500 mg, 500 mg-550 mg, 550 mg-600 mg, 150 mg-250 mg, 150 mg-350 mg, 150 mg-450 mg,

[0154] 150 mg-550 mg, 200 mg-300 mg, 200 mg-400 mg, 200 mg-500 mg, 200 mg-600 mg, 300 mg-400 mg,

[0155] 300 mg-500 mg, 300 mg-600 mg, 400 mg-500 mg, 400 mg-600 mg, or 350 mg-450 mg, e.g., about 150,

[0156] 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, or 600 mg, of a double -stranded ribonucleic acid (RNAi) agent that inhibits expression of AGT. Values and ranges intermediate to the foregoing recited values are also intended to be part of this invention.

[0157] The term “inhibiting,” as used herein, is used interchangeably with “reducing,” “silencing,” “downregulating”, “suppressing”, and other similar terms, and includes any level of inhibition.

[0158] The phrase “inhibiting expression of an AGT” is intended to refer to inhibition of expression of any AGT gene (such as, e.g., a mouse AGT gene, a rat AGT gene, a monkey AGT gene, or a human AGT gene) as well as variants or mutants of an AGTgene. Thus, the AGT gene may be a wild-type AGT gene, a mutant AGT gene, or a transgenic AGT gene in the context of a genetically manipulated cell, group of cells, or organism.

[0159] “Inhibiting expression of an AGT gene” includes any level of inhibition of an AGT gene, e.g., at least partial suppression of the expression of an AGT gene. The expression of the AGT gene may be assessed based on the level, or the change in the level, of any variable associated with AGT gene expression, e.g., AGT mRNA level or AGT protein level. This level may be assessed in an individual cell or in a group of cells, including, for example, a sample derived from a subject. It is understood that AGT is expressed predominantly in the liver, but also in the brain, gall bladder, heart, and kidney, and is present in circulation.

[0160] Inhibition may be assessed by a decrease in an absolute or relative level of one or more variables that are associated with AGT expression compared with a control level. The control level may be any type of control level that is utilized in the art, e.g., a pre-dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control).

[0161] In some embodiments of the methods of the invention, expression of an AGT gene is inhibited by at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or to below the level of detection of the assay. In preferred embodiments, expression of an AGT gene is inhibited by at least 50%. It is further understood that inhibition of AGT expression in certain tissues, e.g. , in liver, without a significant inhibition of expression in other tissues, e.g. , brain, may be desirable. In preferred embodiments, expression level is determined using the assay method provided in Example 2 of PCT Application No. PCT / US2019 / 032150 with a 10 nM siRNA concentration in the appropriate species matched cell line.

[0162] In certain embodiments, inhibition of expression in vivo is determined by knockdown of the human gene in a rodent expressing the human gene, e.g., an AAV -infected mouse expressing the human target gene (i. e. , AGT), e.g. , when administered a single dose at 3 mg / kg at the nadir of RNA expression. Knockdown of expression of an endogenous gene in a model animal system can also be determined, e.g., after administration of a single dose at 3 mg / kg at the nadir of RNA expression. Such systems are useful when the nucleic acid sequence of the human gene and the model animal gene are sufficiently close such that the human iRNA provides effective knockdown of the model animal gene. RNA expression in liver is determined using the PCR methods provided in Example 2 of PCT Application No. PCT / US2019 / 032150, incorporated in its entirety herein by reference.

[0163] Inhibition of the expression of an AGT gene may be manifested by a reduction of the amount of mRNA expressed by a first cell or group of cells (such cells may be present, for example, in a sample derived from a subject) in which an AGT gene is transcribed and which has or have been treated (e.g., by contacting the cell or cells with an iRNA of the invention, or by administering an iRNA of the invention to a subject in which the cells are or were present) such that the expression of an AGT gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has not or have not been so treated (control cell(s) not treated with an iRNA or not treated with an iRNA targeted to the gene of interest). In preferred embodiments, the inhibition is assessed by the method provided in Example 2 of PCT Application No. PCT / US2019 / 032150 using a lOnM siRNA concentration in the species matched cell line and expressing the level of mRNA in treated cells as a percentage of the level of mRNA in control cells, using the following formula:

[0164] (mRNA in control cells) - (mRNA in treated cells) *

[0165] (mRNA in control cells)

[0166] In other embodiments, inhibition of the expression of an AGT gene may be assessed in terms of a reduction of a parameter that is functionally linked to AGT gene expression, e.g., AGT protein level in blood or serum from a subject. AGT gene silencing may be determined in any cell expressing AGT, either endogenous or heterologous from an expression construct, and by any assay known in the art.

[0167] Inhibition of the expression of an AGT protein may be manifested by a reduction in the level of the AGT protein that is expressed by a cell or group of cells or in a subject sample (e.g., the level of protein in a blood sample derived from a subject). As explained above, for the assessment of mRNA suppression, the inhibition of protein expression levels in a treated cell or group of cells may similarly be expressed as a percentage of the level of protein in a control cell or group of cells, or the change in the level of protein in a subject sample, e.g., blood or serum derived therefrom.

[0168] A control cell, a group of cells, or subject sample that may be used to assess the inhibition of the expression of an AGT gene includes a cell, group of cells, or subject sample that has not yet been contacted with an RNAi agent of the invention. For example, the control cell, group of cells, or subject sample may be derived from an individual subject (e.g., a human or animal subject) prior to treatment of the subject with an RNAi agent or an appropriately matched population control.

[0169] The level of AGT mRNA that is expressed by a cell or group of cells may be determined using any method known in the art for assessing mRNA expression. In one embodiment, the level of expression of AGT in a sample is determined by detecting a transcribed polynucleotide, or portion thereof, e.g., mRNA of the AGT gene. RNA may be extracted from cells using RNA extraction techniques including, for example, using acid phenol / guanidine isothiocyanate extraction (RNAzol B; Biogenesis), RNcasy1 1RNA preparation kits (Qiagen®) or PAXgene™ (PrcAnalytix1 1. Switzerland). Typical assay formats utilizing ribonucleic acid hybridization include nuclear run-on assays, RT-PCR, RNase protection assays, northern blotting, in situ hybridization, and microarray analysis.

[0170] In some embodiments, the level of expression of AGT is determined using a nucleic acid probe. The term “probe”, as used herein, refers to any molecule that is capable of selectively binding to a specific AGT. Probes can be synthesized by one of skill in the art or derived from appropriate biological preparations. Probes may be specifically designed to be labeled. Examples of molecules that can be utilized as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules.

[0171] Isolated mRNA can be used in hybridization or amplification assays that include, but are not limited to, Southern or northern analyses, polymerase chain reaction (PCR) analyses and probe arrays. One method for the determination of mRNA levels involves contacting the isolated mRNA with a nucleic acid molecule (probe) that can hybridize to AGT mRNA. In one embodiment, the mRNA is immobilized on a solid surface and contacted with a probe, for example by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane, such as nitrocellulose. In an alternative embodiment, the probe(s) are immobilized on a solid surface and the mRNA is contacted with the probe(s), for example, in an Affymetrix® gene chip array. A skilled artisan can readily adapt known mRNA detection methods for use in determining the level of AGT mRNA.

[0172] An alternative method for determining the level of expression of AGT in a sample involves the process of nucleic acid amplification or reverse transcriptase (to prepare cDNA) of for example mRNA in the sample, e.g. , by RT-PCR (the experimental embodiment set forth in Mullis, 1987, U.S. Patent No. 4,683,202), ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sci. USA 88: 189-193), self sustained sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87: 1874-1878), transcriptional amplification system (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86: 1173-1177), Q-Beta Replicase (Lizardi et al. (1988) Bio / Technology 6: 1197), rolling circle replication (Lizardi et al., U.S. Patent No. 5,854,033) or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers. In particular aspects of the invention, the level of expression of AGT is determined by quantitative Anorogenic RT-PCR (i.e., the TaqManISystem). In preferred embodiments, expression level is determined by the method provided in Example 2 of PCT Application No. PCT / US2019 / 032150 using a lOnM siRNA concentration in the species matched cell line.

[0173] The level of AGT protein expression may be determined using any method known in the art for the measurement of protein levels. Such methods include, for example, high performance liquid chromatography (HPLC), absorption spectroscopy, a colorimetric assays, spectrophotometric assays, flow cytometry, immunoelectrophoresis, western blotting, radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISAs), immunofluore scent assays, electrochemiluminescence assays, and the like.

[0174] In some embodiments, the efficacy of the methods of the invention are assessed by a decrease in AGT mRNA or protein level (e.g., in a liver biopsy). In certain embodiments, a puncture liver biopsy sample serves as the tissue material for monitoring the reduction in the AGT gene or protein expression. In other embodiments, a blood sample serves as the subject sample for monitoring the reduction in the agt protein expression.

[0175] In some embodiments of the methods of the invention, the iRNA is administered to a subject such that the iRNA is delivered to a specific site within the subject. The inhibition of expression of AGT may be assessed using measurements of the level or change in the level of AGT mRNA or agt protein in a sample derived from fluid or tissue from the specific site within the subject (e.g. , liver or blood).

[0176] In another aspect, the present invention provides a method of treating a subject having an AGT- associated disorder, e.g., high blood pressure, e.g., hypertension. In some embodiments, the method comprises administering to the subject a fixed dose of about 150 mg to about 600 mg of one or more double -stranded ribonucleic acid (RNAi) agents described herein that inhibit expression of AGT. In some embodiments, the method comprises administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of one or more double-stranded ribonucleic acid (RNAi) agents described herein that inhibit expression of AGT. In some embodiments, the method comprises administering to the subject a fixed dose of about 150 mg of one or more double -stranded ribonucleic acid (RNAi) agents described herein that inhibit expression of AGT. In some embodiments, the method comprises administering to the subject a fixed dose of about 300 mg of one or more double -stranded ribonucleic acid (RNAi) agents described herein that inhibit expression of AGT. In some embodiments, the method comprises administering to the subject a fixed dose of about 600 mg of one or more double -stranded ribonucleic acid (RNAi) agents described herein that inhibit expression of AGT. In some embodiments, the method comprises administering to the subject a fixed dose of about 150 mg-200 mg, 200 mg-250 mg, 250 mg -300 mg, 300 mg-350 mg, 350 mg -400 mg, 400 mg -450 mg, 450 mg -500 mg, 500 mg -550 mg, 550 mg -600 mg, 150 mg-250 mg, 150 mg-350 mg, 150 mg -450 mg, 150 mg -550 mg, 200 mg -300 mg, 200 mg-400 mg, 200 mg-500 mg, 200 mg-600 mg, 300 mg-400 mg, 300 mg-500 mg, 300 mg-600 mg, 400 mg-500 mg, 400 mg-600 mg, or 350 mg-450 mg, e.g., about 150, 175, 200, 225, 250, 275, 300,

[0177] 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, or 600 mg, of a double -stranded ribonucleic acid (RNAi) agent that inhibits expression of AGT. Values and ranges intermediate to the foregoing recited values are also intended to be part of this invention. In some embodiments, the AGT -associated disorder is selected from the group consisting of high blood pressure, hypertension, borderline hypertension, primary hypertension, secondary hypertension isolated systolic or diastolic hypertension, pregnancy-associated hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, labile hypertension; hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vasculopathy, diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiac myopathy, nocturnal hypotension, glomerulosclerosis, coarctation of the aorta, aortic aneurism, ventricular fibrosis, heart failure, myocardial infarction, angina, stroke, renal disease, renal failure, systemic sclerosis, intrauterine growth restriction (IUGR) , fetal growth restriction, obesity, liver steatosis / fatty liver, nonalcoholic Steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD); glucose intolerance, type 2 diabetes, and metabolic syndrome.

[0178] In one embodiment, the AGT-associate disorder is hypertension. In one embodiment, the hypertension is borderline hypertension, primary hypertension, secondary hypertension isolated systolic or diastolic hypertension, pregnancy-associated hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, labile hypertension; hypertensive heart disease, or hypertensive nephropathy.

[0179] In some embodiments, the AGT associated disorder is high blood pressure. In some embodiments, the AGT associated disorder is borderline hypertension. In some embodiments, the AGT associated disorder is primary hypertension. In some embodiments, the AGT associated disorder is secondary hypertension. In some embodiments, the AGT associated disorder is isolated systolic or diastolic hypertension. In some embodiments, the AGT associated disorder is pregnancy-associated hypertension. In some embodiments, the AGT associated disorder is diabetic hypertension. In some embodiments, the AGT associated disorder is resistant hypertension. In some embodiments, the AGT associated disorder is refractory hypertension. In some embodiments, the AGT associated disorder is paroxysmal hypertension. In some embodiments, the AGT associated disorder is renovascular hypertension. In some embodiments, the AGT associated disorder is Goldblatt hypertension. In some embodiments, the AGT associated disorder is ocular hypertension. In some embodiments, the AGT associated disorder is glaucoma. In some embodiments, the AGT associated disorder is pulmonary hypertension. In some embodiments, the AGT associated disorder is portal hypertension. In some embodiments, the AGT associated disorder is systemic venous hypertension. In some embodiments, the AGT associated disorder is systolic hypertension. In some embodiments, the AGT associated disorder is labile hypertension. In some embodiments, the AGT associated disorder is mild to moderate hypertension. In some embodiments, the AGT associated disorder is hypertensive heart disease. In some embodiments, the AGT associated disorder is hypertensive nephropathy. In some embodiments, the AGT associated disorder is atherosclerosis. In some embodiments, the AGT associated disorder is arteriosclerosis. In some embodiments, the AGT associated disorder is vasculopathy. In some embodiments, the AGT associated disorder is diabetic nephropathy. In some embodiments, the AGT associated disorder is diabetic retinopathy. In some embodiments, the AGT associated disorder is chronic heart failure. In some embodiments, the AGT associated disorder is cardiomyopathy. In some embodiments, the AGT associated disorder is diabetic cardiac myopathy. In some embodiments, the AGT associated disorder is nocturnal hypotension. In some embodiments, the AGT associated disorder is glomerulosclerosis. In some embodiments, the AGT associated disorder is coarctation of the aorta. In some embodiments, the AGT associated disorder is aortic aneurism. In some embodiments, the AGT associated disorder is ventricular fibrosis. In some embodiments, the AGT associated disorder is heart failure. In some embodiments, the AGT associated disorder is myocardial infarction. In some embodiments, the AGT associated disorder is angina. In some embodiments, the AGT associated disorder is stroke. In some embodiments, the AGT associated disorder is renal disease. In some embodiments, the AGT associated disorder is renal failure, In some embodiments, the AGT associated disorder is systemic sclerosis. In some embodiments, the AGT associated disorder is intrauterine growth restriction (IUGR). In some embodiments, the AGT associated disorder is fetal growth restriction. In some embodiments, the AGT associated disorder is obesity. In some embodiments, the AGT associated disorder is liver steatosis / fatty liver. In some embodiments, the AGT associated disorder is non-alcoholic Steatohepatitis (NASH). In some embodiments, the AGT associated disorder is non-alcoholic fatty liver disease (NAFLD). In some embodiments, the AGT associated disorder is glucose intolerance. In some embodiments, the AGT associated disorder is type 2 diabetes. In some embodiments, the AGT associated disorder is metabolic syndrome.

[0180] In a further aspect, the present invention provides a method of treating a subject that would benefit from reduction in AGT expression. In some embodiments, the method comprises administering to the subject a fixed dose of about 150 mg to about 600 mg of one or more double -stranded ribonucleic acid (RNAi) agents described herein that inhibit expression of AGT. In some embodiments, the method comprises administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of one or more double-stranded ribonucleic acid (RNAi) agents described herein that inhibit expression of AGT. In some embodiments, the method comprises administering to the subject a fixed dose of about 150 mg of one or more double -stranded ribonucleic acid (RNAi) agents described herein that inhibit expression of AGT. In some embodiments, the method comprises administering to the subject a fixed dose of about 300 mg of one or more double-stranded ribonucleic acid (RNAi) agents described herein that inhibit expression of AGT. In some embodiments, the method comprises administering to the subject a fixed dose of about 600 mg of one or more double-stranded ribonucleic acid (RNAi) agents described herein that inhibit expression of AGT. In some embodiments, the method comprises administering to the subject a fixed dose of about 150 mg -200 mg, 200 mg -250 mg, 250 mg -300 mg, 300 mg-350 mg, 350 mg -400 mg, 400 mg -450 mg, 450 mg-500 mg, 500 mg-550 mg, 550 mg-600 mg, 150 mg -250 mg, 150 mg-350 mg, 150 mg -450 mg, 150 mg-550 mg, 200 mg-300 mg, 200 mg -400 mg, 200 mg-500 mg, 200 mg-600 mg, 300 mg-400 mg, 300 mg-500 mg, 300 mg-600 mg, 400 mg-500 mg, 400 mg-600 mg, or 350 mg-450 mg, e.g., about 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, or 600 mg, of a double -stranded ribonucleic acid (RNAi) agent that inhibits expression of AGT. Values and ranges intermediate to the foregoing recited values are also intended to be part of this invention.

[0181] In a further aspect, the present invention provides a method of decreasing blood pressure level, e.g., systolic blood pressure and / or diastolic blood pressure, in a subject. In some embodiments, the method comprises administering to the subject a fixed dose of about 150 mg to about 600 mg of one or more double -stranded ribonucleic acid (RNAi) agents described herein that inhibit expression of AGT. In some embodiments, the method comprises administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of one or more double-stranded ribonucleic acid (RNAi) agents described herein that inhibit expression of AGT. In some embodiments, the method comprises administering to the subject a fixed dose of about 150 mg of one or more double -stranded ribonucleic acid (RNAi) agents described herein that inhibit expression of AGT. In some embodiments, the method comprises administering to the subject a fixed dose of about 300 mg of one or more double -stranded ribonucleic acid (RNAi) agents described herein that inhibit expression of AGT. In some embodiments, the method comprises administering to the subject a fixed dose of about 600 mg of one or more double -stranded ribonucleic acid (RNAi) agents described herein that inhibit expression of AGT. In some embodiments, the method comprises administering to the subject a fixed dose of about 150 mg-200 mg, 200 mg-250 mg, 250 mg -300 mg, 300 mg-350 mg, 350 mg-400 mg, 400 mg-450 mg, 450 mg-500 mg, 500 mg -550 mg, 550 mg-600 mg, 150 mg-250 mg, 150 mg-350 mg, 150 mg-450 mg, 150 mg -550 mg, 200 mg -300 mg, 200 mg-400 mg, 200 mg-500 mg, 200 mg-600 mg, 300 mg-400 mg, 300 mg-500 mg, 300 mg-600 mg, 400 mg-500 mg, 400 mg-600 mg, or 350 mg-450 mg, e.g., about 150, 175, 200, 225, 250, 275, 300,

[0182] 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, or 600 mg, of a double -stranded ribonucleic acid (RNAi) agent that inhibits expression of AGT. Values and ranges intermediate to the foregoing recited values are also intended to be part of this invention.

[0183] In the methods of the invention, a cell, e.g., a cell within a subject, such as a human subject (e.g., a subject in need thereof, such as subject having an AGT-associated disorder), may be contacted with the siRNA in vitro or in vivo, i.e., the cell may be within a subject.

[0184] A cell suitable for treatment using the methods of the invention may be any cell that expresses an AGT gene, e.g. , a liver cell, a brain cell, a gall bladder cell, a heart cell, or a kidney cell, but preferably a liver cell. A cell suitable for use in the methods of the invention may be a mammalian cell, e.g., a primate cell (such as a human cell, including human cell in a chimeric non-human animal, or a nonhuman primate cell, e.g. , a monkey cell or a chimpanzee cell), or a non-primate cell. In certain embodiments, the cell is a human cell, e.g., a human liver cell. In the methods of the invention, AGT expression is inhibited in the cell by at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or to a level below the level of detection of the assay. In one embodiment, a dsRNA agent targeting AGT is administered to a subject such that AGT levels, e.g., in a cell, tissue, blood, urine or other tissue or fluid of the subject are reduced by at least about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%.

[0185] 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%.

[0186] 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%.

[0187] 62%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%.

[0188] 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least about 99% or more.

[0189] In some embodiments, the methods described herein result in a decrease in AGT expression by at least 30%, 40% 50%, 60%, 70%, 80%, 90%, 95%, or 100%. In some embodiments, the methods described herein result in a decrease in AGT expression by at least 30%. In some embodiments, the methods described herein result in a decrease in AGT expression by at least 40%. In some embodiments, the methods described herein result in a decrease in AGT expression by at least 50%. In some embodiments, the methods described herein result in a decrease in AGT expression by at least 60%. In some embodiments, the methods described herein result in a decrease in AGT expression by at least 70%. In some embodiments, the methods described herein result in a decrease in AGT expression by at least 80%. In some embodiments, the methods described herein result in a decrease in AGT expression by at least 90%. In some embodiments, the methods described herein result in a decrease in AGT expression by at least 95%. In some embodiments, the methods described herein result in a decrease in AGT expression by 100%.

[0190] In some embodiments, the AGT protein level in a blood or a serum sample of the subject is decreased by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%. In some embodiments, the AGT protein level in a blood or a serum sample of the subject is decreased by at least 30%. In some embodiments, the AGT protein level in a blood or a serum sample of the subject is decreased by at least 40%. In some embodiments, the AGT protein level in a blood or a serum sample of the subject is decreased by at least 50%. In some embodiments, the AGT protein level in a blood or a serum sample of the subject is decreased by at least 60%. In some embodiments, the AGT protein level in a blood or a serum sample of the subject is decreased by at least 70%. In some embodiments, the AGT protein level in a blood or a serum sample of the subject is decreased by at least 80%. In some embodiments, the AGT protein level in a blood or a serum sample of the subject is decreased by at least 90%. In some embodiments, the AGT protein level in a blood or a serum sample of the subject is decreased by at least 95%. In some embodiments, the AGT protein level in a blood or a serum sample of the subject is decreased by 100%.

[0191] In another embodiment, a dsRNA agent targeting AGT is administered to a subject such that the blood pressure levels, e.g., systolic blood pressure and / or diastolic blood pressure, of the subject are reduced by at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mmHg or more. In some embodiments, the systolic blood pressure and / or diastolic blood pressure is decreased by at least 4 mmHg, 5 mmHg, 6 mmHg, 7 mmHg, 8 mmHg, 9 mmHg or 10 mmHg. In some embodiments, the systolic blood pressure and / or diastolic blood pressure is decreased by at least 4 mmHg. In some embodiments, the systolic blood pressure and / or diastolic blood pressure is decreased by at least 5 mmHg. In some embodiments, the systolic blood pressure and / or diastolic blood pressure is decreased by at least 6 mmHg. In some embodiments, the systolic blood pressure and / or diastolic blood pressure is decreased by at least 7 mmHg. In some embodiments, the systolic blood pressure and / or diastolic blood pressure is decreased by at least 8 mmHg. In some embodiments, the systolic blood pressure and / or diastolic blood pressure is decreased by at least 9 mmHg. In some embodiments, the systolic blood pressure and / or diastolic blood pressure is decreased by at least 10 mmHg.

[0192] In some embodiments, the systolic blood pressure and / or diastolic blood pressure is seated office systolic blood pressure and / or diastolic blood pressure.

[0193] In some embodiments, the systolic blood pressure and / or diastolic blood pressure is ambulatory blood pressure monitoring (ABPM).

[0194] In some embodiments, the blood pressure decrease is decrease in daytime and night-time mean blood pressure.

[0195] Administration of the dsRNA agent according to the methods and uses of the invention may result in a reduction of the severity, signs, symptoms, and / or markers of such diseases or disorders in a patient with primary hyperoxaluria. By “reduction” in this context is meant a statistically significant decrease in such level. The reduction can be, for example, at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or about 100%.

[0196] Efficacy of treatment or prevention of disease can be assessed, for example by measuring disease progression, disease remission, symptom severity, reduction in pain, quality of life, dose of a medication required to sustain a treatment effect, level of a disease marker or any other measurable parameter appropriate for a given disease being treated or targeted for prevention. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters. For example, efficacy of treatment of primary hyperoxaluria may be assessed, for example, by periodic monitoring of oxalate levels in the subject being treated. Comparisons of the later measurements with the initial measurements provide a physician an indication of whether the treatment is effective. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring such a parameter, or any combination of parameters. In connection with the administration of a dsRNA agent targeting AGT or pharmaceutical composition thereof, "effective against" primary hyperoxaluria indicates that administration in a clinically appropriate manner results in a beneficial effect for at least a statistically significant fraction of patients, such as improvement of symptoms, a cure, a reduction in disease, extension of life, improvement in quality of life, or other effect generally recognized as positive by medical doctors familiar with treating primary hyperoxaluria and the related causes.

[0197] A treatment or preventive effect is evident when there is a statistically significant improvement in one or more parameters of disease status, or by a failure to worsen or to develop symptoms where they would otherwise be anticipated. As an example, a favorable change of at least 10% in a measurable parameter of disease, and preferably at least 20%, 30%, 40%, 50% or more can be indicative of effective treatment. Efficacy for a given dsRNA agent drug or formulation of that drug can also be judged using an experimental animal model for the given disease as known in the art. When using an experimental animal model, efficacy of treatment is evidenced when a statistically significant reduction in a marker or symptom is observed.

[0198] Any positive change resulting in e.g., lessening of severity of disease measured using the appropriate scale, represents adequate treatment using a dsRNA agent or dsRNA agent formulation as described herein.

[0199] The in vivo methods of the invention may include administering to a subject a composition containing an iRNA, where the iRNA includes a nucleotide sequence that is complementary to at least a part of an RNA transcript of the AGT gene of the mammal to which the RNAi agent is to be administered. The composition can be administered by any means known in the art including, but not limited to oral, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), nasal, rectal, and topical (including buccal and sublingual) administration. In certain embodiments, the compositions are administered by intravenous infusion or injection. In certain embodiments, the compositions are administered by subcutaneous injection. In certain embodiments, the compositions are administered by intramuscular injection.

[0200] In some embodiments, the administration is via a depot injection. A depot injection may release the dsRNA agent in a consistent way over a prolonged time period. Thus, a depot injection may reduce the frequency of dosing needed to obtain a desired effect, e.g., a desired inhibition of AGT, or a therapeutic or prophylactic effect. A depot injection may also provide more consistent serum concentrations. Depot injections may include subcutaneous injections or intramuscular injections. In preferred embodiments, the depot injection is a subcutaneous injection.

[0201] In some embodiments, the administration is via a pump. The pump may be an external pump or a surgically implanted pump. In certain embodiments, the pump is a subcutaneously implanted osmotic pump. In other embodiments, the pump is an infusion pump. An infusion pump may be used for intravenous, subcutaneous, arterial, or epidural infusions. In preferred embodiments, the infusion pump is a subcutaneous infusion pump. In other embodiments, the pump is a surgically implanted pump that delivers the dsRNA agent to the liver.

[0202] Other modes of administration include epidural, intracerebral, intracerebroventricular, nasal administration, intraarterial, intracardiac, intraosseous infusion, intrathecal, and intravitreal, and pulmonary. The mode of administration may be chosen based upon whether local or systemic treatment is desired and based upon the area to be treated. The route and site of administration may be chosen to enhance targeting.

[0203] The iRNA is preferably administered subcutaneously, i.e., by subcutaneous injection. One or more injections may be used to deliver the desired dose of iRNA to a subject. The injections may be repeated over a period of time. The administration may be repeated on a regular basis. In certain embodiments, the iRNA is administered about once per month to about once per quarter, i. e. , about every three months, or about once per quarter to about twice per year, i. e. , about once every six months. In certain embodiments, the iRNA is administered once per month. In other embodiments, the iRNA is administered every three months, or once per quarter. In yet another embodiment, the iRNA is administered every six months or biannually.

[0204] In some embodiments, the fixed dose is administered to the subject at an interval of once every three to six months. In some embodiments, the fixed dose is administered to the subject at an interval of once every three months. In some embodiments, the fixed dose is administered to the subject at an interval of once every four months. In some embodiments, the fixed dose is administered to the subject at an interval of once every five months. In some embodiments, the fixed dose is administered to the subject at an interval of once every six months.

[0205] In some embodiments, the subject is administered a fixed dose of about 150 mg, about 300 mg, or about 600 mg, about once every three months. In some embodiments, the subject is administered a fixed dose of about 150 mg, about 300 mg, or about 600 mg, about once every four months. In some embodiments, the subject is administered a fixed dose of about 150 mg, about 300 mg, or about 600 mg, about once every five months. In some embodiments, the subject is administered a fixed dose of about 150 mg, about 300 mg, or about 600 mg, about once every six months.

[0206] In some embodiments, the double stranded RNAi agent, or a pharmaceutically acceptable salt thereof, is administered to the subject subcutaneously or intravenously. In some embodiments, the double stranded RNAi agent, or a pharmaceutically acceptable salt thereof, is administered to the subject subcutaneously. In some embodiments, the double stranded RNAi agent, or a pharmaceutically acceptable salt thereof, is administered to the subject intravenously.

[0207] A dsRNA agent of the invention may be administered in “naked” form, or as a “free dsRNA agent.” A naked dsRNA agent is administered in the absence of a pharmaceutical composition. The naked dsRNA agent may be in a suitable buffer solution. The buffer solution may comprise acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof. In one embodiment, the buffer solution is phosphate buffered saline (PBS). The pH and osmolarity of the buffer solution containing the dsRNA agent can be adjusted such that it is suitable for administering to a subject.

[0208] Alternatively, an iRNA of the invention may be administered as a pharmaceutical composition, such as a dsRNA liposomal formulation. The RNAi agent may be administered as a pharmaceutical composition in an unbffered solution. The unbuffered solution may comprise saline or water. Alternatively, the RNAi agent may be administered as a pharmaceutical composition in a buffer solution. The buffer solution may comprise acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof. In one embodiment, the buffer solution is phosphate buffered saline (PBS).

[0209] Subjects that would benefit from an inhibition of AGT gene expression are subjects susceptible to or diagnosed with an AGT-associated disease or disorder, e.g., high blood pressure, e.g., hypertension. The subjects may have a systolic blood pressure of at least 130, 135, 140, 145, 150, 155 or 160 mmHg or a diastolic blood pressure of at least 80, 85, 90, 95, 100, 105, 110 mmHg. The subject may be susceptible to salt sensitivity, overweight, obese, pregnant, or plarming to become pregnant. The subject may have type 2 diabetes, type 1 diabetes, or have reduced kidney function.

[0210] The method further comprises administering to the subject an additional therapeutic agent for treatment of hypertension. Exemplary therapeutic agents for use as a combination therapy may include, but are not limited to, a diuretic, an angiotensin converting enzyme (ACE) inhibitor, an angiotensin II receptor antagonist, a beta-blocker, a vasodialator, a calcium channel blocker, an aldosterone antagonist, an alpha2 -agonist, a renin inhibitor, an alpha-blocker, a peripheral acting adrenergic agent, a selective D 1 receptor partial agonist, a nonselective alpha-adrenergic antagonist, a synthetic, a steroidal antimineralocorticoid agent; a combination of any of the foregoing; and a hypertension therapeutic agent formulated as a combination of agents. In some embodiments, the additional therapeutic agent comprises an angiotensin II receptor antagonist, e.g, losartan, valsartan, olmesartan, eprosartan, irbesartan, and azilsartan.

[0211] In some embodiments, the additional therapeutic agent comprises a hypertension therapeutic agent. In some embodiments, the method comprises administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of the double stranded RNAi agent of the present invention, e.g., AD-85481, and a hypertension therapeutic agent.

[0212] Administration of the iRNA according to the methods of the invention may result prevention or treatment of an AGT associated disorder disorder, e.g., high blood pressure, e.g, hypertension. Diagnostic criteria for various types of high blood pressure are provided below.

[0213] III. Diagnostic Criteria, Risk Factors, and Treatments for Hypertension

[0214] Recently practice guidelines for prevention and treatment of hypertension were revised. Extensive reports were published by Reboussin et al. (Systematic Review for the 2017 ACC / AHA / AAPA / ABC / ACPM / AGS / APhA / ASH / ASPC / NMA / PCNA Guideline for the Prevention, Detection, Evaluation, and Management of High Blood Pressure in Adults: A Report of the American College of Cardiology / American Heart Association Task Force on Clinical Practice Guidelines. J Am Coll Cardiol. 2017 Nov 7. pii: S0735-1097(17)41517-8. doi: 10.1016 / j.jacc.2017.11.004.) and Whelton et al. (2017 ACC / AHA / AAPA / ABC / ACPM / AGS / APhA / ASH / ASPC / NMA / PCNA Guideline for the Prevention, Detection, Evaluation, and Management of High Blood Pressure in Adults: A Report of the American College of Cardiology / American Heart Association Task Force on Clinical Practice Guidelines. J Am Coll Cardiol. 2017 Nov 7. pii: S0735-1097(17)41519-1. doi:

[0215] 10. 1016 / j .jacc.2017.11.006.). Some highlights of the new Guidelines are provided below. However, the Guidelines should be understood as providing the knowledge of those of skill in the art regarding diagnostic and monitoring criteria and treatment for hypertension at the time of fding of this application and are incorporated herein by reference.

[0216] A. Diagnostic Criteria Although a continuous association exists between higher blood pressure and increased cardiovascular disease risk, it is useful to categorize blood pressure levels for clinical and public health decision making. Blood pressure can be categorized into 4 levels on the basis of average blood pressure measured in a healthcare setting (office pressures): normal, elevated, and stage 1 or 2 hypertension as shown in the table below (from Whelton et al., 2017).

[0217] *Individuals with systolic blood pressure and diastolic blood pressure in 2 categories should be designated to the higher blood pressure category.

[0218] Blood pressure indicates blood pressure based on an average of >2 careful readings obtained on >2 occasions. Best practices for obtaining careful blood pressure readings are detailed in Whelton et al. , 2017 and are known in the art.

[0219] This categorization differs from that previously recommended in the JNC 7 report (Chobanian et al; the National High Blood Pressure Education Program Coordinating Committee. Seventh Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure. Hypertension. 2003;42: 1206-52) with stage 1 hypertension now defined as a systolic blood pressure (SBP) of 130-139 or a diastolic blood pressure (DBP) of 80-89 mm Hg, and with stage 2 hypertension in the present document corresponding to stages 1 and 2 in the JNC 7 report. The rationale for this categorization is based on observational data related to the association between SBP / DBP and cardiovascular disease risk, randomized clinical trials of lifestyle modification to lower blood pressure, and randomized clinical trials of treatment with antihypertensive medication to prevent cardiovascular disease.

[0220] The increased risk of cardiovascular disease among adults with stage 2 hypertension is well established. An increasing number of individual studies and meta-analyses of observational data have reported a gradient of progressively higher cardiovascular disease risk going from normal blood pressure to elevated blood pressure and stage 1 hypertension. In many of these meta-analyses, the hazard ratios for coronary heart disease and stroke were between 1. 1 and 1 .5 for the comparison of SBP / DBP of 120- 129 / 80-84 mm Hg versus <120 / 80 mm Hg and between 1.5 and 2.0 for the comparison of SBP / DBP of 130-139 / 85-89 mm Hg versus <120 / 80 mm Hg. This risk gradient was consistent across subgroups defined by sex and race / ethnicity. The relative increase in cardiovascular disease risk associated with higher blood pressure was attenuated but still present among older adults. Lifestyle modification and pharmacological antihypertensive treatment are recommended for individuals with elevated blood pressure and stages 1 and 2 hypertension. Clinical benefit can be obtained by a reduction of the stage of elevated blood pressure, even if blood pressure is not normalized by a treatment.

[0221] In some embodiments, the subject has an estimated glomerular filtration rate (eGFR) of 30-44 mL / min / 1.73m2. In some embodiments, the subject has an estimated glomerular filtration rate (eGFR) of 30-35 mL / min / 1.73m2. In some embodiments, the subject has an estimated glomerular filtration rate (eGFR) of 35-40 mL / min / 1.73m2. In some embodiments, the subject has an estimated glomerular filtration rate (eGFR) of 40-44 mL / min / 1.73m2.

[0222] In some embodiments, the subject has an estimated glomerular filtration rate (eGFR) of >45 mL / min / 1.73m2. In some embodiments, the subject has an estimated glomerular filtration rate (eGFR) of >50 mL / min / 1.73m2. In some embodiments, the subject has an estimated glomerular filtration rate (eGFR) of >55 mL / min / 1.73m2.

[0223] In some embodiments, the subject has an estimated glomerular filtration rate (eGFR) of >30 mL / min / 1.73m2to <60 mL / min / 1.73m2. In some embodiments, the subject has an estimated glomerular filtration rate (eGFR) of >40 mL / min / 1.73m2to <60 mL / min / 1.73m2. In some embodiments, the subject has an estimated glomerular filtration rate (eGFR) of >50 mL / min / 1.73m2to <60 mL / min / 1.73m2.

[0224] In some embodiments, the subject has a 24-hour mean systolic blood pressure (SBP) as assessed by ambulatory blood pressure monitoring (ABPM) of >130 mmHg. In some embodiments, the subject has a 24-hour mean systolic blood pressure (SBP) as assessed by ambulatory blood pressure monitoring (ABPM) of >140 mmHg. In some embodiments, the subject has a 24-hour mean systolic blood pressure (SBP) as assessed by ambulatory blood pressure monitoring (ABPM) of >150 mmHg. In some embodiments, the subject has a 24-hour mean systolic blood pressure (SBP) as assessed by ambulatory blood pressure monitoring (ABPM) of >160 mmHg.

[0225] In some embodiments, the subject has a seated office systolic blood pressure (SBP) of >140 mmHg to <170 mmHg. In some embodiments, the subject has a seated office systolic blood pressure (SBP) of >140 mmHg to <170 mmHg.

[0226] In some embodiments, the subject is male and >65 years of age. In some embodiments, the subject is male and >70 years of age. In some embodiments, the subject is male and >75 years of age. In some embodiments, the subject is male and >80 years of age. In some embodiments, the subject is female and >71 years of age. In some embodiments, the subject is female and >75 years of age. In some embodiments, the subject is female and >80 years of age.

[0227] In some embodiments, the methods described herein further comprise determining the level of one or more cardiac biomarkers. In some embodiments, the one or more cardiac biomarkers is selected from the group consisting of high-sensitivity cardiac troponin (hsTn), high-sensitivity C-reactive protein (hsCRP), interleukin 6 (IL-6), and B-type natriuretic peptide prohormone (NT (proBNP)). In some embodiments, the one or more cardiac biomarkers is high-sensitivity cardiac troponin (hsTn). In some embodiments, the one or more cardiac biomarkers is high-sensitivity C-reactive protein (hsCRP). In some embodiments, the one or more cardiac biomarkers is interleukin 6 (IL-6). In some embodiments, the one or more cardiac biomarkers is B-type natriuretic peptide prohormone (NT (proBNP)). In some embodiments, the methods described herein further comprise determining the level of one or more renal biomarkers. In some embodiments, the one or more renal biomarkers is selected from the group consisting of albumin and creatinine. In some embodiments, the one or more renal biomarkers is albumin. In some embodiments, the one or more renal biomarkers is creatinine.

[0228] In some embodiments, the level of the one or more renal biomarkers is a urine albumincreatinine ratio (uACR).

[0229] In some embodiments, the methods described herein further comprise determining the level of one or more renin-angiotensin-aldosterone system (RAAS) biomarkers. In some embodiments, the one or more RAAS biomarkers is selected from the group consisting of renin, angiotensin I, angiotensin II, and aldosterone. In some embodiments, the one or more RAAS biomarkers is renin. In some embodiments, the one or more RAAS biomarkers is angiotensin I. In some embodiments, the one or more RAAS biomarkers is angiotensin II. In some embodiments, the one or more RAAS biomarkers is aldosterone.

[0230] In some embodiments, the dosage of at least one of the two or more antihypertensive medications is decreased following administration of one or more dsRNA agents described herein.

[0231] In some embodiments, at least one of the two or more antihypertensive medications is discontinued following administration of the dsRNA agent.

[0232] B. Risk Factors

[0233] Hypertension is a complex disease that results from a combination of factors including, but not limited to, genetics, lifestyle, diet, and secondary risk factors. Hypertension can also be associated with pregnancy. It is understood that due to the complex nature of hypertension, it is understood that multiple interventions may be required for treatment of hypertension. Moreover, non-pharmacological interventions, including modification of diet and lifestyle, can be useful for the prevention and treatment of hypertension. Further, an intervention may provide a clinical benefit without fully normalizing blood pressure in an individual.

[0234] 1. Genetic risk factors

[0235] Several monogenic forms of hypertension have been identified, such as glucocorticoid- remediable aldosteronism, Liddle’s syndrome, Gordon’s syndrome, and others in which single-gene mutations fully explain the pathophysiology of hypertension, these disorders are rare. The current tabulation of known genetic variants contributing to blood pressure and hypertension includes more than 25 rare mutations and 120 single nucleotide polymorphisms. However, although genetic factors may contribute to hypertension in some individuals, it is estimated that genetic variation accounts for only about 3.5% of blood pressure variability.

[0236] 2. Diet and alcohol consumption

[0237] Common environmental and lifestyle risk factors leading to hypertension include poor diet, insufficient physical activity, and excess alcohol consumption. These factors can lead to a person to become overweight or obese, further increasing the likelihood of developing or exacerbating hypertension. Elevated blood pressure is even more strongly correlated with increased waist-to-hip ratio or other measures of central fat distribution. Obesity at a young age and ongoing obesity is strongly correlated with hypertension later in life. Achieving a normal weight can reduce the risk of developing high blood pressure to that of a person who has never been obese.

[0238] Intake of sodium, potassium, magnesium, and calcium can also have a significant effect on blood pressure. Sodium intake is positively correlated with blood pressure and accounts for much of the age- related increase in blood pressure. Certain groups are more sensitive to increased sodium consumption than others including black and older adults (> 65 years old), and those with a higher level of blood pressure or comorbidities such as chronic kidney disease, diabetes mellitus, or metabolic syndrome. In aggregate, these groups constitute more than half of all US adults. Salt sensitivity may be a marker for increased cardiovascular disease and all-cause mortality, independent of blood pressure. Currently, techniques for recognition of salt sensitivity are impractical in a clinical setting. Therefore, salt sensitivity is best considered as a group characteristic.

[0239] Potassium intake is inversely related to blood pressure and stroke, and a higher level of potassium seems to blunt the effect of sodium on blood pressure. A lower sodium-potassium ratio is associated with a lower blood pressure than that noted for corresponding levels of sodium or potassium on their own. A similar observation has been made for risk of cardiovascular disease.

[0240] Alcohol consumption has long been associated with high blood pressure. In the US, it has been estimated that alcohol consumption accounts for about 10% of the population burden of hypertension, with the burden being greater in men than women.

[0241] It is understood that changes in diet or alcohol consumption can be an aspect of prevention or treatment of hypertension.

[0242] 3. Physical activity

[0243] There is a well-established inverse correlation between physical activity / physical fitness and blood pressure levels. Even modest levels of physical activity have been demonstrated to be beneficial in decreasing hypertension.

[0244] It is understood that an increase in physical activity can be an aspect of prevention or treatment of hypertension.

[0245] 4. Secondary risk factors

[0246] Secondary hypertension can underlie severe elevation of blood pressure, pharmacologically resistant hypertension, sudden onset of hypertension, increased blood pressure in patients with hypertension previously controlled on drug therapy, onset of diastolic hypertension in older adults, and target organ damage disproportionate to the duration or severity of the hypertension. Although secondary hypertension should be suspected in younger patients (<30 years of age) with elevated blood pressure, it is not uncommon for primary hypertension to manifest at a younger age, especially in blacks, and some forms of secondary hypertension, such as renovascular disease, are more common at older age (> 65 years of age). Many of the causes of secondary hypertension are strongly associated with clinical findings or groups of findings that suggest a specific disorder. In such cases, treatment of the underlying condition may resolve the findings of elevated blood pressure without administering agents typically used for the treatment of hypertension.

[0247] 5. Pregnancy

[0248] Pregnancy is a risk factor for high blood pressure, and high blood pressure during pregnancy is a risk factor for cardiovascular disease and hypertension later in life. A Report on pregnancy associated hypertension was published in 2013 by the American College of Obstetrics and Gynecology (ACOG) (American College of Obstetricians and Gynecologists, Task Force on Hypertension in Pregnancy. Hypertension in pregnancy. Report of the American College of Obstetricians and Gynecologists' Task Force on Hypertension in Pregnancy. Obstet Gynecol. 2013;122: 1122-31). Some highlights of the Report are provided below. However, the Report should be understood as providing the knowledge of those of skill in the art regarding diagnostic and monitoring criteria and treatment for hypertension in pregnancy at the time of filing of this application and are incorporated herein by reference.’

[0249] The diagnostic criteria for preeclampsia are provided in the table below (from Table 1 of the ACOG report, 2013). Blood Pressure management during pregnancy is complicated by the fact that many commonly used antihypertensive agents, including ACE inhibitors and ARBs, are contraindicated during pregnancy because of potential harm to the fetus. The goal of antihypertensive treatment during pregnancy includes prevention of severe hypertension and the possibility of prolonging gestation to allow the fetus more time to mature before delivery. A review of treatment for pregnancy-associated severe hypertension found insufficient evidence to recommend specific agents; rather, clinician experience was recommended in this setting (Duley L, Meher S, Jones L. Drugs for treatment of very high blood pressure during pregnancy. Cochrane Database Syst Rev. 2013;7:CD001449.).

[0250] C. Treatments

[0251] Treatment of high blood pressure is complex as it is frequently present with other comorbidities, often including reduced renal function, for which the subject may also be undergoing treatment. Clinicians managing adults with high blood pressure should focus on overall patient health, with a particular emphasis on reducing the risk of future adverse cardiovascular disease outcomes. All patient risk factors need to be managed in an integrated fashion with a comprehensive set of nonpharmacological and pharmacological strategies. As patient blood pressure and risk of future cardiovascular disease events increase, blood pressure management should be intensified.

[0252] Whereas treatment of high blood pressure with blood pressure-lowering medications on the basis of blood pressure level alone is considered cost effective, use of a combination of absolute cardiovascular disease risk and blood pressure level to guide such treatment is more efficient and cost effective at reducing risk of cardiovascular disease than is use of blood pressure level alone. Many patients started on a single agent will subsequently require >2 drugs from different pharmacological classes to reach their blood pressure goals. Knowledge of the pharmacological mechanisms of action of each agent is important. Drug regimens with complementary activity, where a second antihypertensive agent is used to block compensatory responses to the initial agent or affect a different pressor mechanism, can result in additive lowering of blood pressure. For example, thiazide diuretics may stimulate the renin-angiotensin- aldosterone system. By adding an ACE inhibitor or ARB to the thiazide, an additive blood pressure lowering effect may be obtained. Use of combination therapy may also improve adherence. Several 2- and 3 -fixed-dose drug combinations of antihypertensive drug therapy are available, with complementary mechanisms of action among the components.

[0253] In some embodiments, the subject having high cardiovascular (CV) risk and hypertension has high cardiovascular (CV) risk and hypertension not adequately controlled by two to four antihypertensive medications. In some embodiments, the subject having high cardiovascular (CV) risk and hypertension, has high cardiovascular (CV) risk and hypertension not adequately controlled by two antihypertensive medications. In some embodiments, the subject having high cardiovascular (CV) risk and hypertension, has high cardiovascular (CV) risk and hypertension not adequately controlled by three antihypertensive medications. In some embodiments, the subject having high cardiovascular (CV) risk and hypertension, has high cardiovascular (CV) risk and hypertension not adequately controlled by four antihypertensive medications. In some embodiments, the subject having high cardiovascular (CV) risk and hypertension, has high cardiovascular (CV) risk and hypertension not adequately controlled by four or more antihypertensive medications.

[0254] In some embodiments, the antihypertensive medication is selected from the group consisting of a thiazide, a thiazide-like diuretic, a loop diuretic, a beta blocker, an angiotensin-converting enzyme (ACE) inhibitor, an angiotensin II receptor blocker (ARB), a calcium channel blocker (CCB), a vasodilator, a centrally acting antihypertensive medication, and combinations thereof. In some embodiments, the antihypertensive medication is a thiazide. In some embodiments, the antihypertensive medication is a thiazide-like diuretic. In some embodiments, the antihypertensive medication is a loop diuretic. In some embodiments, the antihypertensive medication is a beta blocker. In some embodiments, the antihypertensive medication is an angiotensin-converting enzyme (ACE) inhibitor. In some embodiments, the antihypertensive medication is an angiotensin II receptor blocker (ARB). In some embodiments, the antihypertensive medication is a calcium channel blocker (CCB). In some embodiments, the antihypertensive medication is a vasodilator. In some embodiments, the antihypertensive medication is a centrally acting antihypertensive medication.

[0255] In some embodiments, the subject having high cardiovascular risk and hypertension is a subject that had a prior cardiovascular event. In some embodiments, the prior cardiovascular event is selected from the group consisting of a myocardial infarction and an ischemic stroke.

[0256] In some embodiments, the subject having high cardiovascular risk and hypertension is a subject having peripheral artery disease, coronary artery disease, carotid artery disease, or atherosclerotic cardiovascular disease (ASCVD) risk. In some embodiments, the subject having atherosclerotic cardiovascular disease (ASCVD) risk has a >15% ASCVD risk score. In some embodiments, the subject having atherosclerotic cardiovascular disease (ASCVD) risk score described herein has an ASCVD risk score of >15%, >16%, >17%, >18%, >19%, >20%, >25%, >30%, >35%, >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, or >95%.

[0257] In some embodiments, the subject having high cardiovascular risk and hypertension is a subject having peripheral artery disease. In some embodiments, the subject having high cardiovascular risk and hypertension is a subject having coronary artery disease. In some embodiments, the subject having high cardiovascular risk and hypertension is a subject having carotid artery disease. In some embodiments, the subject having high cardiovascular risk and hypertension is a subject having atherosclerotic cardiovascular disease (ASCVD) risk.

[0258] In some embodiments, the subject having high cardiovascular risk and hypertension previously had prior percutaneous coronary intervention, coronary artery bypass grafting, carotid endarterectomy, and / or carotid stenting. In some embodiments, the subject having high cardiovascular risk and hypertension previously had prior percutaneous coronary intervention. In some embodiments, the subject having high cardiovascular risk and hypertension previously had coronary artery bypass grafting. In some embodiments, the subject having high cardiovascular risk and hypertension previously had carotid endarterectomy. In some embodiments, the subject having high cardiovascular risk and hypertension previously had carotid stenting.

[0259] In some embodiments, the subject having high cardiovascular risk and hypertension does not have moderate-to-severe obstructive sleep apnea not treated with continuous positive airway pressure therapy, renovascular hypertension, primary aldosteronism, pheochromocytoma, Cushing syndrome, aortic coarctation, or orthostatic hypotension.

[0260] In some embodiments, the subject having high cardiovascular risk and hypertension does not have moderate-to-severe obstructive sleep apnea not treated with continuous positive airway pressure therapy. In some embodiments, the subject having high cardiovascular risk and hypertension does not have moderate-to-severe obstructive sleep apnea not treated with renovascular hypertension. In some embodiments, the subject having high cardiovascular risk and hypertension does not have moderate-to- severe obstructive sleep apnea not treated with primary aldosteronism. In some embodiments, the subject having high cardiovascular risk and hypertension does not have moderate-to-severe obstructive sleep apnea not treated with pheochromocytoma. In some embodiments, the subject having high cardiovascular risk and hypertension does not have moderate-to-severe obstructive sleep apnea not treated with Cushing syndrome. In some embodiments, the subject having high cardiovascular risk and hypertension does not have moderate-to-severe obstructive sleep apnea not treated with aortic coarctation. In some embodiments, the subject having high cardiovascular risk and hypertension does not have moderate-to- severe obstructive sleep apnea not treated with orthostatic hypotension.

[0261] In some embodiments, the subject having high cardiovascular risk and hypertension is not being administered more than 1 Angiotensin II receptor blocker (ARB), more than 1 Angiotensin converting enzyme (ACE), a mineralocorticoid receptor antagonist (MRA), aliskiren, triamterene, amiloride, and aldosterone synthase inhibitor, an endothelin antagonist, or an aminopeptidase inhibitor.

[0262] In some embodiments, the subject having high cardiovascular risk and hypertension is not being administered more than 1 Angiotensin II receptor blocker (ARB). In some embodiments, the subject having high cardiovascular risk and hypertension is not being administered more than more than 1 Angiotensin converting enzyme (ACE). In some embodiments, the subject having high cardiovascular risk and hypertension is not being administered more than a mineralocorticoid receptor antagonist (MRA). In some embodiments, the subject having high cardiovascular risk and hypertension is not being administered more than an aliskiren. In some embodiments, the subject having high cardiovascular risk and hypertension is not being administered more than a triamterene. In some embodiments, the subject having high cardiovascular risk and hypertension is not being administered more than an amiloride. In some embodiments, the subject having high cardiovascular risk and hypertension is not being administered more than an aldosterone synthase inhibitor. In some embodiments, the subject having high cardiovascular risk and hypertension is not being administered more than an endothelin antagonist. In some embodiments, the subject having high cardiovascular risk and hypertension is not being administered more than an aminopeptidase inhibitor. Table 18 from Whelton et al. 2017 listing oral antihypertensive drugs is provided below. Classes of therapeutic agents for the treatment of high blood pressure and drugs that fall within those classes are provided. Dose ranges, frequencies, and comments are also provided.

[0263] *Dosages may vary from those listed in the FDA approved labeling (available at ACE indicates angiotensin-converting enzyme; ARB, angiotensin receptor blocker; BP, blood pressure; BPH, benign prostatic hyperplasia; CCB, calcium channel blocker; CKD, chronic kidney disease; CNS, central nervous system; CVD, cardiovascular disease; ER, extended release; GFR, glomerular filtration rate; HF, heart failure; HFrEF, heart failure with reduced ejection fraction; IHD, ischemic heart disease; IR, immediate release; LA, long-acting; and SR, sustained release.

[0264] From, Chobanian et al. (2003) The JNC 7 Report. JAMA 289(19):2560.

[0265] IV. Delivery of an iRNA Agent for Use in the Methods of the Invention The delivery of an iRNA agent to a cell e.g., a cell within a subject, such as a human subject (e.g., a subject in need thereof, such as a subject having an AGT-associated disorder, e.g., hypertension), for use in the methods of the invention, can be achieved in a number of different ways. For example, delivery may be performed by contacting a cell with an iRNA of the invention either in vitro or in vivo. In vivo delivery may also be performed directly by administering a composition comprising an iRNA, e.g., a dsRNA, to a subject.

[0266] In some embodiments, the dsRNAi agent, or salt thereof, and / or the pharmaceutical composition thereof described herein is administered to the subject subcutaneously. In some embodiments, the subcutaneous administration is subcutaneous injection, e.g., subcutaneous self-administration.

[0267] One or more injections may be used to deliver the desired fixed dose of iRNA to the subject. The injections may be repeated over a period of time. In some embodiments, the injection is a pre-filled injection.

[0268] The administration may be repeated on a regular basis. In certain embodiments, the iRNA is administered about once per month to about once per quarter, i. e. , about every three months, or about once per quarter to about twice per year, i. e. , about once every six months. In certain embodiments, the iRNA is administered once per month. In other embodiments, the iRNA is administered every three months, or once per quarter. In yet another embodiment, the iRNA is administered every six months or biannually.

[0269] In some embodiments, the fixed dose is administered to the subject at an interval of once every three to six months. In some embodiments, the fixed dose is administered to the subject at an interval of once every three months. In some embodiments, the fixed dose is administered to the subject at an interval of once every four months. In some embodiments, the fixed dose is administered to the subject at an interval of once every five months. In some embodiments, the fixed dose is administered to the subject at an interval of once every six months.

[0270] In some embodiments, the method comprises administering to the subject a fixed dose of about 150 mg to about 600 mg of one or more double -stranded ribonucleic acid (RNAi) agents described herein that inhibit expression of AGT. In some embodiments, the method comprises administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of one or more double-stranded ribonucleic acid (RNAi) agents described herein that inhibit expression of AGT. In some embodiments, the method comprises administering to the subject a fixed dose of about 150 mg of one or more doublestranded ribonucleic acid (RNAi) agents described herein that inhibit expression of AGT. In some embodiments, the method comprises administering to the subject a fixed dose of about 300 mg of one or more double -stranded ribonucleic acid (RNAi) agents described herein that inhibit expression of AGT. In some embodiments, the method comprises administering to the subject a fixed dose of about 600 mg of one or more double-stranded ribonucleic acid (RNAi) agents described herein that inhibit expression of AGT. In some embodiments, the method comprises administering to the subject a fixed dose of about 150 mg-200 mg, 200 mg-250 mg, 250 mg-300 mg, 300 mg-350 mg, 350 mg-400 mg, 400 mg-450 mg, 450 mg-500 mg, 500 mg-550 mg, 550 mg-600 mg, 150 mg-250 mg, 150 mg-350 mg, 150 mg-450 mg, 150 mg-550 mg, 200 mg-300 mg, 200 mg-400 mg, 200 mg-500 mg, 200 mg-600 mg, 300 mg-400 mg, 300 mg-500 mg, 300 mg-600 mg, 400 mg-500 mg, 400 mg-600 mg, or 350 mg-450 mg, e.g., about 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, or 600 mg, of a double -stranded ribonucleic acid (RNAi) agent that inhibits expression of AGT.

[0271] In some embodiments, the subject is administered a fixed dose of about 150 mg, about 300 mg or about 600 mg about once every three months. In some embodiments, the subject is administered a fixed dose of about 150 mg, about 300 mg or about 600 mg about once every four months. In some embodiments, the subject is administered a fixed dose of about 150 mg, about 300 mg or about 600 mg about once every five months. In some embodiments, the subject is administered a fixed dose of about 150 mg, about 300 mg or about 600 mg about once every six months.

[0272] V. Double Stranded iRNAs Agents for Use in the Methods of the Invention

[0273] Suitable double -stranded RNAi agents for use in the methods of the invention include the dsRNA agent AD-85481, also known as Zilebesiran®.

[0274] AD-85481 comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’ - gsuscaucCfaCfAfAfugagaguaca -3’ (SEQ ID NO: 12) and the antisense strand comprises the nucleotide sequence 5’- usGfsuac(Tgn)cucauugUfgGfaugacsgsa -3’ (SEQ ID NO: 11), wherein a, g, c, and u are 2'-O-methyl (2'- OMe) A, G, C, and U, respectively; Af, Gf, Cf and Uf are 2'-fluoro A, G, C and U, respectively; s is a phosphorothioate linkage; and (Tgn) is a thymidine-glycol nucleic acid (GNA) S-Isomer; and wherein the 3 ’-end of the sense strand is conjugated to a ligand as shown in the following schematic

[0275] 3’ wherein X is O.

[0276] Further, a pharmaceutically acceptable salt form of the dsRNA of the invention being used in the methods of the invention includes any salt that is pharmaceutically acceptable, e.g., a sodium salt of the dsRNA agent. In one embodiment, the pharmaceutically acceptable salt of the dsRNA of the invention being used in the methods of the invention has the following structure: 21 Nsr

[0277] Additional dsRNA agents that may be used in the methods of the invention are described in International PCT Publication Nos WO 2015 / 179724 and WO 2019 / 222166, the entire contents of each of which are incorporated herein by reference.

[0278] VI. Pharmaceutical Compositions of the Invention

[0279] The present invention also includes pharmaceutical compositions and formulations which include the iRNAs for use in the methods of the invention. In one embodiment, provided herein are pharmaceutical compositions containing an iRNA, as described herein, and a pharmaceutically acceptable carrier. The pharmaceutical compositions containing the iRNA are useful for preventing or treating an AGT asociated disorder, e.g., hypertension. Such pharmaceutical compositions are formulated based on the mode of delivery.

[0280] The pharmaceutical compositions comprising RNAi agents of the invention may be, for example, solutions with or without a buffer, or compositions containing pharmaceutically acceptable carriers. Such compositions include, for example, aqueous or crystalline compositions, liposomal formulations, micellar formulations, emulsions, and gene therapy vectors.

[0281] In the methods of the invention, the RNAi agent may be administered in a solution. In some embodiments, the solution is a sterile solution. A free RNAi agent may be administered in an unbuffered solution, e.g., in saline or in water. Alternatively, the free siRNA may also be administered in a suitable buffer solution. The buffer solution may comprise acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof. In one embodiment, the buffer solution is phosphate buffered saline (PBS). The pH and osmolarity of the buffer solution containing the RNAi agent can be adjusted such that it is suitable for administering to a subject.

[0282] In some embodiments, the buffer solution further comprises an agent for controlling the osmolarity of the solution, such that the osmolarity is kept at a desired value, e.g., at the physiologic values of the human plasma. Solutes which can be added to the buffer solution to control the osmolarity include, but are not limited to, proteins, peptides, amino acids, non-metabolized polymers, vitamins, ions, sugars, metabolites, organic acids, lipids, or salts. In some embodiments, the agent for controlling the osmolarity of the solution is a salt. In certain embodiments, the agent for controlling the osmolarity of the solution is sodium chloride or potassium chloride.

[0283] In some embodiments, the pharmaceutical compositions of the invention are pyrogen free or non-pyrogenic.

[0284] The pharmaceutical compositions of the present invention can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration can be topical (e.g., by a transdermal patch), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal, e.g., via an implanted device; or intracranial, e.g., by intraparenchymal, intrathecal or intraventricular, administration.

[0285] One example is compositions that are formulated for systemic administration via parenteral delivery, e.g., by subcutaneous (SC), intramuscular (IM), or intravenous (IV) delivery. The pharmaceutical compositions of the invention may be administered in dosages sufficient to inhibit expression of an AGT gene.

[0286] The pharmaceutical compositions of the invention may be administered in dosages sufficient to inhibit expression of an AGT gene. In some embodiments, a fixed dose of about 150 mg to about 600 mg of the iRNA agents are administered to the subject. In some embodiments, the method comprises administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of one or more double -stranded ribonucleic acid (RNAi) agents described herein that inhibit expression of AGT. In some embodiments, the method comprises administering to the subject a fixed dose of about 150 mg of one or more double -stranded ribonucleic acid (RNAi) agents described herein that inhibit expression of AGT. In some embodiments, the method comprises administering to the subject a fixed dose of about 300 mg of one or more double-stranded ribonucleic acid (RNAi) agents described herein that inhibit expression of AGT. In some embodiments, the method comprises administering to the subject a fixed dose of about 600 mg of one or more double -stranded ribonucleic acid (RNAi) agents described herein that inhibit expression of AGT. In some embodiments, the method comprises administering to the subject a fixed dose of about 150 mg-200 mg, 200 mg-250 mg, 250 mg-300 mg, 300 mg-350 mg, 350 mg-400 mg, 400 mg -450 mg, 450 mg -500 mg, 500 mg-550 mg, 550 mg-600 mg, 150 mg-250 mg, 150 mg-350 mg, 150 mg-450 mg, 150 mg-550 mg, 200 mg-300 mg, 200 mg-400 mg, 200 mg-500 mg, 200 mg-600 mg, 300 mg-400 mg, 300 mg-500 mg, 300 mg-600 mg, 400 mg-500 mg, 400 mg-600 mg, or 350 mg-450 mg, e.g., about 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, or 600 mg, of a double-stranded ribonucleic acid (RNAi) agent that inhibits expression of AGT.

[0287] A repeat-dose regimen may include administration of a therapeutic amount of iRNA on a regular basis, such as every month, every two months, every three months, every four months, every five months, every six months, once every 3-6 months, or once a year. In certain embodiments, the iRNA is administered about once per month to about once per quarter to about once per six months.

[0288] After an initial treatment regimen, the treatments can be administered on a less frequent basis. Duration of treatment can be determined based on the severity of disease.

[0289] The skilled artisan will appreciate that certain factors can influence the dosage and timing required to effectively treat a subject, including but not limited to mutations present in the subject, previous treatments, the general health or age of the subject, and other diseases present. Moreover, treatment of a subject with a prophylactically or therapeutically effective amount, as appropriate, of a composition can include a single treatment or a series of treatments.

[0290] The iRNA can be delivered in a manner to target a particular tissue (e.g. , hepatocytes).

[0291] Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome -containing formulations. These compositions can be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids, and selfemulsifying semisolids. Formulations include those that target the liver.

[0292] The pharmaceutical formulations of the present invention, which can conveniently be presented in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers.

[0293] VII. Kits

[0294] The present invention also provides kits for performing any of the methods of the invention. Such kits include one or more double stranded RNAi agent(s) and instructions for use, e.g., instructions for administering a fixed dose of a double stranded RNAi agent(s).

[0295] The double stranded RNAi agent may be in a vial or a pre-filled syringe. The kits may optionally further comprise means for administering the double stranded RNAi agent (e.g., an injection device, such as a pre-filled syringe), or means for measuring the inhibition of AGT (e.g., means for measuring the inhibition of AGT mRNA, AGT protein, and / or AGT activity). Such means for measuring the inhibition of AGT may comprise a means for obtaining a sample from a subject, such as, e.g, a plasma sample. The kit may be packaged in a number of different configurations such as one or more containers in a single box. The different components can be combined, e.g., according to instructions provided with the kit. The kits of the invention may optionally further comprise means for determining the therapeutically effective or prophylactically effective amount. The present invention also provides vials comprising the dsRNA agent, or salt thereof, of the invention or the pharmaceutical composition of the invention. The present invention further provides syringes comprising the dsRNA agent, or salt thereof, of the invention or the pharmaceutical composition of the invention.

[0296] In some embodiments, the RNAi agent (e.g., AD-85481), or salt thereof, described herein is administered (e.g, subcutaneously) in a syringe, such as a pre-filled syringe to a subject in need thereof. Pre-fdled syringes are designed to fit into specialized syringes, which can be used to administer the RNAi agent, or salt thereof, described herein. Pre-filled syringes offer several advantages inlcuding convenience, affordability, accuracy, sterility, and safety (Makwana et al. , Int J Pharm Investig. 2011 Oct-Dec; 1(4): 200-206; incorporated in its entirety herein by reference). Pre-filled syringes also assure that patients receive accurate dosages. This is especially advantageous for patients who need to self-inject medication, but have no medical training. In some embodiments, the RNAi agent (e.g., AD-85481) stored inside of a pre-filled syringe is in a sterile solution.

[0297] In some embodiments the pre-filled syringe is made of glass. In some embodiments the pre-filled syringe is made of plastic.

[0298] In some embodiments, the kit further comprises instructions, for example, for administering the RNAi agent (e.g. , AD-85481), or salt thereof, in a syringe, such as a pre-filled syringe. For example, the instructions may be performed under the supervision of a drug investigator. These instructions simply embody the disclosure provided herein.

[0299] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the iRNAs and methods featured in the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

[0300] This invention is further illustrated by the following examples which should not be construed as limiting. The entire contents of all references, patents and published patent applications cited throughout this application, as well as the Sequence Listing, are hereby incorporated herein by reference.

[0301] EXAMPLES

[0302] Table 1. Abbreviations of nucleotide monomers used in nucleic acid sequence representation. It will be understood that these monomers, when present in an oligonucleotide, are mutually linked by 5'-3'- phosphodiester bonds; and it is understood that when the nucleotide contains a 2’-fluoro modification, then the fluoro replaces the hydroxy at that position in the parent nucleotide (i.e., it is a 2’-deoxy-2’- fluoronucleotide). It is to be further understood that the nucleotide abbreviations in the table omit the 3’- phosphate (z.e., they are 3 ’-OH) when placed at the 3 ’-terminal position of an oligonucleotide.

[0303]

[0304] Example 1. Phase II Clinical Trial of AGT dsRNA

[0305] A randomized, double-blind, placebo-controlled, multi-center study is designed to evaluate the efficacy, safety, and pharmacodynamics (PD) of zilebesiran, administered subcutaneously (SC), as an add-on therapy in adult patients with high cardiovascular (CV) risk and hypertension not adequately controlled by 2 to 4 standard of care antihypertensive medications. The primary objective of the study is to evaluate the efficacy of zilebesiran as an add-on therapy for the treatment of hypertension in patients with high CV risk by evaluating the change in 24-hour mean systolic blood pressure (SBP), assessed by ambulatory blood pressure monitoring (ABPM), from baseline to Month 3, relative to placebo. Secondary and exploratory objectives of the study include evaluating the add-on efficacy of zilebesiran on other measures of blood pressure response and evaluating the PD effect of zilebesiran, including reduction in circulating AGT concentration.

[0306] Objectives and Endpoints

[0307] Abbreviations: ABPM=ambulatory blood pressure monitoring; ADA=anti-drug antibody; AE=adverse event; AGT=angiotensinogen; Ang=angiotensin; DBP=diastolic blood pressure; HbAlc=hemoglobin

[0308] Ale; HBPM=home blood pressure monitoring; hsCRP=high-sensitivity C-reactive protein; hsTn=high- sensitivity troponin I; IL-6=interleukin 6; NT-proBNP=N-terminal prohormone B-type natriuretic peptide; PD=pharmacodynamic; PK=pharmacokinetic; RAS=renin-angiotensin system; SBP=systolic blood pressure; UACR=urine albumin-to-creatinine ratio.

[0309] Summary of Study Design

[0310] In this Phase 2 randomized, double-blind (DB), placebo-controlled, multicenter study the efficacy, safety, and pharmacodynamics (PD) of zilebesiran administered subcutaneously (SC) as an add-on therapy in patients with established cardiovascular disease (CVD) or at high cardiovascular (CV) risk with uncontrolled hypertension despite treatment with at least 2 standard of care antihypertensive medications are evaluated. A schematic of the study design is provided in Figure 1. All patients are on stable doses of at least 2, but not more than 4, background antihypertensive medications for at least 30 days prior to screening and planned to remain on stable doses of these medications during screening and during the DB Treatment period.

[0311] The study includes a Screening period of up to 45 days to determine eligibility of patients. All patients must be on stable doses of at least 2, but not more than 4, antihypertensive medications for at least 30 days prior to screening and plan to remain on stable doses of these medications during screening and during the DB Treatment period. Background antihypertensive medications must include 2 to 4 of the following classes: a thiazide or thiazide -like diuretic, a loop diuretic, beta blocker, angiotensin-converting enzyme (ACE) inhibitor or angiotensin II receptor blocker (ARB), calcium channel blocker (CCB), vasodilator, or centrally acting antihypertensive medication. At least 1 of the background antihypertensive medications must be a CCB or a thiazide or thiazide-like diuretic.

[0312] Patients who meet all of the inclusion and none of the exclusion criteria after the Screening period are randomized 1 : 1 : 1 to receive 300 mg, or 600 mg zilebesiran or placebo SC; or 1 : 1 : 1 : 1 to receive 150 mg, 300 mg, or 600 mg zilebesiran or placebo SC on Day 1 of a 6 month DB Treatment period as add-on therapy to their background antihypertensive medications. Randomization of patients with eGFR >30 to <60 mL / min / 1.73m2(eGFR > 45 mL / min / 1.73m2(N-270) in a first cohort, and eGFR 30 - 44 mL / min / 1.73m2(N-60-120) in a second cohort) at screening is targeted to at least 20% of all patients.

[0313] Randomization on Day 1 is stratified by race (black or all other races), screening eGFR (<60 or >60 mL / min / 1.73m2), and baseline 24-hour mean SBP (<145 or >145 mmHg). Initiation, discontinuation, or changes in the dose of background antihypertensive medications should be avoided during the DB Treatment period through Month 3, unless medication changes are medically necessary, in the opinion of the Investigator.

[0314] Starting at Month 3, antihypertensive medications may be intensified (defined as an increase in the dose of at least 1 background antihypertensive medication and / or addition of conventional oral antihypertensives to the patient’s background antihypertensive medications) per Investigator judgement for elevated blood pressure as described in the Table below, according to the local guidelines and / or institutional protocols.

[0315] Recommended Interventions for Potentially Clinically Significant Blood Pressure Elevation

[0316] Abbreviations: ABPM=ambulatory blood pressure monitoring; ACE=angiotensin converting enzyme;

[0317] ARB=angiotensin II-receptor blocker; CCB=calcium channel blocker; DBP=diastolic blood pressure; eCRF=electronic case report form; HBPM=home blood pressure monitoring; RAS=renin-angiotensin system; SBP=systolic blood pressure.

[0318] After the 6-month DB Treatment period, patients enter the Safety Follow-up period. Patients have 1 Safety Follow-up visit at Month 12, 6 months after the DB Treatment period.

[0319] An interim analysis is conducted after all patients complete the Month 3 visit or withdraw from the study prior to the Month 3 visit. The interim analysis informs Phase 3 study design and planning. The planned enrollment for this study is approximately 300 patients.

[0320] The duration of treatment with Zilebesiran is 6 months. The estimated total time on study for each patient is up to approximately 14 months, including up to 45 days in the Screening period, 6 months of treatment, and 6 months in the Safety Follow-up period.

[0321] Inclusion Criteria

[0322] Patients are eligible to be included in the study if all the following criteria apply:

[0323] Age and Sex

[0324] 1 . Male or female age 40 years or older at the time of initial informed consent Patient and Disease Characteristics

[0325] 2. History or high risk of CVD (1 or more of the following): a. Prior documented CV event / history (1 or more of the following):

[0326] - Prior myocardial infarction

[0327] - History of ischemic stroke

[0328] - Diagnosis of peripheral artery disease, coronary artery disease, or carotid artery disease, including history of percutaneous coronary intervention, coronary artery bypass grafting, carotid endarterectomy, or carotid stenting b. 10-year ACC AHA atherosclerotic cardiovascular disease (ASCVD) risk estimator of >15% at screening or any male patient >65 years old or female patient >71 years old. c. eGFR >30 to <60 mL / min / 1 ,73m2at screening (calculation is based on the CKD Epidemiology Collaboration [CKD-EPI] equation).

[0329] 3. Treated hypertension on stable therapy with 2 to 4 antihypertensive medications. Fixed-dose combination medications is considered as multiple medications based on their individual components. Stable therapy is defined as having no change in the prescription of antihypertensive medication or dosing regimen within 30 days prior to screening, and no plans to modify therapy during the study period. Antihypertensive medications should be prescribed at therapeutic antihypertensive doses consistent with the local label and must include: a. a medication from the CCB or thiazide / thiazide-like diuretic class, AND b. at least 1 additional antihypertensive medication from the following classes that is different from (a):

[0330] - Thiazide or thiazide-like diuretic

[0331] - Loop diuretic

[0332] - CCB

[0333] - Beta blocker

[0334] - ACE inhibitor or ARB

[0335] - Vasodilator (eg, hydralazine, minoxidil, alpha blocker)

[0336] - Centrally acting antihypertensive medication (eg, clonidine)

[0337] 4. Seated automated mean office SBP at screening >140 mmHg and <170 mmHg

[0338] Note: Retesting of office blood pressure is permitted once if in the Investigator’s judgement, the result is not accurate.

[0339] 5. 24-hour mean SBP >130 mmHg as assessed by ABPM within 7 days prior to randomization. Note: Retesting of 24-hour ABPM is permitted once.

[0340] Informed Consent

[0341] 6. Patient is able to understand and is willing and able to comply with the study requirements and to provide written informed consent. Exclusion Criteria

[0342] Patients are excluded from the study if any of the following criteria apply:

[0343] Disease-specific Conditions

[0344] 1 . Known secondary hypertension (including, but not limited to, due to known history of moderate-to-severe obstructive sleep apnea not treated with continuous positive airway pressure therapy, renovascular hypertension, primary aldosteronism, pheochromocytoma, Cushing syndrome, or aortic coarctation)

[0345] 2. Orthostatic hypotension, defined as a fall of >20 mmHg SBP or >10 mmHg DBP within approximately 1 to 3 minutes of standing up from a seated position by office blood pressure that is accompanied by symptoms (eg, accompanied by dizziness, weakness, lightheadedness, or syncope) during screening

[0346] Laboratory Assessments

[0347] 3. Has any of the following laboratory parameter assessments during screening: a. ALT or AST >2xULN b. Total bilirubin >1.5 xULN. Patients with elevated total bilirubin that is secondary to documented Gilbert’s syndrome are eligible if the total bilirubin is <2xULN c. INR >2.0 (patients on oral anticoagulant [eg, warfarin] with an INR <3.5 is allowed) d. Potassium >5.0 mEq / L or serum potassium > 4.8 mEq / L e. eGFR of <30 mL / min / 1 ,73m2(calculation is based on the CKD-EPI formula)

[0348] 4. Has known active human immunodeficiency virus infection; or known current or chronic hepatitis C virus or hepatitis B virus infection

[0349] Prior / Concomitant Therapy

[0350] 5. Received an investigational agent within the last 30 days or 5 half-lives, whichever is longer, prior to the first dose of study drug, or are in follow-up of another clinical study prior to study enrollment. Any agent that has received health agency authorization (including for emergency use) by local or regional regulatory authorities is not considered investigational.

[0351] 6. Currently taking, taken within 30 days prior to randomization, or anticipated to receive during the DB Treatment period, any medication known to significantly affect blood pressure (with the exception of medications for the treatment of essential hypertension). Patients who require medications such as monoamine oxidase inhibitors that are associated with hypertensive crisis are excluded. [Whelton 2018]

[0352] 7. Changes, such as initiation or discontinuation, of sodium-glucose co-transporter 2 (SGLT2) inhibitor therapy within 30 days prior to screening. Patients on a stable dose of SGLT2 therapy for at least 30 days prior to screening with no anticipated changes during screening and through the DB Treatment period are permitted.

[0353] 8. Currently taking >4 antihypertensive medications

[0354] 9. Currently taking more than 1 RAS inhibitor (ie, an ARB and an ACE inhibitor)

[0355] 10. Currently taking a mineralocorticoid receptor antagonist (MRA) or aliskiren

[0356] 11 . Currently taking triamterene or amiloride

[0357] 12. Prior treatment with renal denervation therapy

[0358] 13. Currently taking aldosterone synthase inhibitor, endothelin antagonist, or aminopeptidase inhibitor 14. Chronic or intermitent use of a potassium binder for the treatment of hyperkalemia within 3 months prior to screening

[0359] 15. Recipient of a major organ transplant or expected to undergo organ transplantation within the study period

[0360] 16. Currently being treated with, treated within 3 months prior to screening, or plans to be treated during the study period with anti -obesity drugs or procedures that are associated with significant weight loss (eg, surgery, aggressive diet regimen, GLP-1 agonists)

[0361] 17. Currently taking, taken within 6 months prior to randomization, or anticipated to receive a ribonucleic acid interference (RNAi) therapeutic (approved or investigational) during the study

[0362] 18. Previously treated with at least 1 dose of zilebesiran in another clinical study

[0363] Medical Conditions

[0364] 19. Current or prior history of intolerance to an ARB or ACE inhibitor (other than cough)

[0365] 20. History of potassium >5.0 mEq / L or serum potassium > 4.8 mEq / L within 1 year prior to screening, unless due to a transient condition

[0366] 21. Diabetes mellitus with hemoglobin Ale (HbAlc) >9% within 3 months prior to randomization, hospitalization due to diabetes mellitus within 3 months prior to randomization, or other poorly controlled diabetes mellitus, in the opinion of the Investigator

[0367] 22. History of clinically significant cardiovascular event (eg, stroke, transient ischemic attack, myocardial infarction, unstable angina, coronary artery bypass grafting or other cardiothoracic surgeries, percutaneous coronary intervention, hospitalization due to heart failure) within 3 months prior to randomization

[0368] 23. Any hemodynamically unstable atrial or ventricular arrhythmias

[0369] 24. New onset or untreated atrial fibrillation in the 3 months prior to randomization

[0370] 25. Known history of angioedema

[0371] 26. Clinically significant valvular heart disease

[0372] 27. NYHA class IV or III heart failure

[0373] 28. Known history of left ventricular ejection fraction <40%, unless transient in the seting of an acute cardiac event

[0374] 29. History of severe proteinuria (>3 g / d) or severe proteinuria during screening

[0375] 30. Has other medical conditions or comorbidities which, in the opinion of the Investigator, would interfere with study compliance or data interpretation; or, in the opinion of the Investigator, taking part in the study would jeopardize the safety of the patient.

[0376] 31 . History of multiple drug allergies or history of allergic reaction to any component of or excipient in the study drug

[0377] 32. History of intolerance to SC injection(s)

[0378] 33. Active malignancy (except for non-melanoma skin cancers, cervical in situ carcinoma, breast ductal carcinoma in situ, or stage 1 prostate cancer)

[0379] 34. Active psychiatric disorder, including, but not limited to schizophrenia, bipolar disorder, or severe depression despite current pharmacological intervention

[0380] 35. Known medical history or evidence of chronic liver disease or cirrhosis 36. Has planned major surgery or general anesthesia during the study

[0381] Contraception, Pregnancy, and Breastfeeding

[0382] 37. Is not willing to comply with the contraceptive requirements during the study period.

[0383] 38. Known history of alcohol abuse or alcohol dependency, within the last 12 months before screening

[0384] Other Restrictions

[0385] 39. Night shift or 24-hour shift workers

[0386] 40. Blood pressure cannot be accurately assessed by study blood pressure instruments provided by the Sponsor (eg, due to cuff size limitations).

[0387] Efficacy Analyses

[0388] The primary endpoint is the change from baseline at Month 3 in 24-hour mean SBP, assessed by ABPM. The primary hypothesis is that either low-dose or high-dose zilebesiran is superior to placebo in terms of the mean change from baseline at Month 3. The analysis is based on the mixed model with repeated measures (MMRM) with treatment, visit, treatment-by-visit, ACE inhibitor / ARB (yes or no) and race (black or all other races) as fixed factors and baseline 24-hour mean SBP and eGFR as covariates.

[0389] In the primary analysis, ABPM assessed while patients have modified their antihypertensive regimen is censored. However, in the supportive analysis, all collected ABPM measurements are analyzed by the same model, regardless of modification of antihypertensive regimen.

[0390] The hypothesis test is tested at a significance level of 0.025 (1 -sided test), and a multiple test procedure is not implemented.

[0391] The analysis method for the following endpoints are the same as for the primary endpoint.

[0392] • Change from baseline at Month 6 in 24-hour mean SBP

[0393] • Change from baseline at Month 3 and 6 in daytime mean and nighttime mean SBP

[0394] • Change from baseline at Month 3 and 6 in office SBP

[0395] • Change from baseline at Month 3 and 6 in 24-hour mean DBP

[0396] • Change from baseline at Month 3 and 6 in daytime mean and nighttime mean DBP

[0397] • Change from baseline at Month 3 and 6 in office DBP

[0398] • Time-adjusted change from baseline through Month 6 in 24-hour mean SBP

[0399] • Time-adjusted change from baseline through Month 6 in office SBP.

[0400] A logistic regression model with treatment and race (black or all other races) as factors and baseline 24-hour mean SBP and eGFR as covariates are used to analyze the endpoint below:

[0401] • Proportion of patients with 24-hour mean SBP assessed by ABPM <130 mmHg and / or reduction >20 mmHg without intensification of antihypertensive regimen at Month 6.

[0402] Other secondary and exploratory endpoints are summarized by descriptive statistics by treatment group unless specified in the SAP.

[0403] Details of the analysis method for the primary, secondary, and exploratory endpoints are described in the SAP. Pharmacodynamic Analysis

[0404] Pharmacodynamic analyses includes the evaluation of changes in levels of serum AGT and other exploratory biomarkers of the RAS pathway. Descriptive statistics for observed levels and the relative change from baseline for all measured biomarkers is presented for each of the postdose time points.

[0405] Statistical comparison of the biomarker levels (absolute and / or change from baseline) across treatment groups may be explored. Details of the analysis are specified in the SAP.

[0406] Population PK / PD analysis may be conducted to evaluate the dose-response relationships for PD reduction after zilebesiran treatment. Additionally, the relationship between lowering of serum AGT and blood pressure may be explored within a modeling framework. If conducted, these analyses are described in a pharmacometrics analysis plan and results are presented in a separate report.

[0407] Pharmacokinetic Analysis

[0408] Plasma concentrations of zilebesiran and its metabolite AS(N-1)3' zilebesiran are summarized using descriptive statistics by treatment group.

[0409] Population PK analysis may be conducted on the PK data from this study. If conducted, the analysis methods are described in a pharmacometrics analysis plan and results are presented in a separate report.

[0410] Safety Analyses

[0411] The primary safety assessment is the frequency of treatment-emergent AEs (hereafter referred to simply as AEs). Safety assessments also include vital signs, ECGs, and clinical laboratory assessments. Extent of exposure to study drug is summarized by treatment group and overall.

[0412] Prior and concomitant medications are coded using the World Health Organization (WHO) Drug Dictionary. Results are tabulated by Anatomical Therapeutic Chemical (ATC) Classification System and Preferred Term (PT).

[0413] Adverse events are classified according to the Medical Dictionary for Regulatory Activities (MedDRA) System Organ Class and Preferred Term [by dose level and overall]. AEs, SAEs, related AEs, AEs leading to withdrawal from the study, and AEs leading to death are summarized by System Organ Class (SOC) and PT for each treatment arm. By-patient listings are provided for deaths, and SAEs.

[0414] Descriptive statistics are provided for clinical laboratory parameters, ECG, and vital signs summarizing the observed values and changes from baseline overtime. Laboratory shift tables from baseline grade (or category) to worst post-baseline grade (or category) are presented for laboratory parameters that are graded or categorized. EQUIVALENTS

[0415] Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments and methods described herein. Such equivalents are intended to be encompassed by the scope of the following claims.

Claims

We claim:

1. A method for treating a subject that would benefit from reduction in angiotensinogen (AGT) expression, the method comprising selecting a subject having high cardiovascular (CV) risk and hypertension, and administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’-gsuscaucCfaCfAfAfugagaguaca-3’ of SEQ ID NO: 12 and the antisense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’- usGfsuac(Tgn)cucauugUfgGfaugacsgsa-3’ of SEQ ID NO: 11, wherein a is 2'-O-methyladenosine-3’- phosphate, c is 2'-O-methylcytidine-3’ -phosphate, g is 2'-O-methylguanosine-3’ -phosphate, u is 2'-O- methyluridine-3’ -phosphate, Af is 2’-fluoroadenosine-3’-phosphate, Cf is 2 ’-fluorocytidine -3’- phosphate, Gf is 2’-fhioroguanosine-3’-phosphate, Ufis 2’-fhiorouridine-3’-phosphate, (Tgn) is thymidine-glycol nucleic acid (GNA) S-Isomer, and s is a phosphorothioate linkage, wherein the subject is taking at least two but not more than four antihypertensive medications; thereby treating the subject that would benefit from reduction in AGT expression.

2. A method for inhibiting the expression of an angiotensinogen (AGT) gene in a subject, the method comprising selecting a subject having high cardiovascular (CV) risk and hypertension, and administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’-gsuscaucCfaCfAfAfugagaguaca-3’ of SEQ ID NO: 12 and the antisense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’-usGfsuac(Tgn)cucauugUfgGfaugacsgsa-3’ of SEQ ID NO: 11, wherein a is 2'-O-methyladenosine-3’ -phosphate, c is 2'-O-methylcytidine-3’-phosphate, g is 2'-O-methylguanosine-3 ’ -phosphate, u is 2'-O-methyluridine-3’ -phosphate, Af is 2’-fluoroadenosine- 3’-phosphate, Cf is 2’-fhiorocytidine-3’-phosphate, Gfis 2’-fhioroguanosine-3’-phosphate, Ufis 2’- fluorouridine-3 ’ -phosphate, (Tgn) is thymidine-glycol nucleic acid (GNA) S-Isomer, and s is a phosphorothioate linkage, wherein the subject is taking at least two but not more than four antihypertensive medications; thereby inhibiting the expression of the AGT gene in the subject.

3. A method for treating a subject that having an AGT-associated disorder, the method comprising selecting a subject having high cardiovascular (CV) risk and, and administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’-gsuscaucCfaCfAfAfugagaguaca-3’ of SEQ ID NO: 12 and the antisense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’- usGfsuac(Tgn)cucauugUfgGfaugacsgsa-3’ of SEQ ID NO: 11, wherein a is 2'-O-methyladenosine-3’- phosphate, c is 2'-O-methylcytidine-3’ -phosphate, g is 2'-O-methylguanosine-3’ -phosphate, u is 2'-O- methyluridine-3’ -phosphate, Af is 2’-fhioroadenosine-3’-phosphate, Cf is 2 ’-fluorocytidine -3’- phosphate, Gf is 2’-fhioroguanosine-3’-phosphate, Ufis 2’-fhiorouridine-3’-phosphate, (Tgn) is thymidine-glycol nucleic acid (GNA) S-Isomer, and s is a phosphorothioate linkage, wherein the subject is taking at least two but not more than four antihypertensive medications; thereby treating the subject having an AGT-associated disorder.

4. A method for decreasing blood pressure level in a subject, the method comprising selecting a subject having high cardiovascular (CV) risk and hypertensionand administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’-gsuscaucCfaCfAfAfugagaguaca-3’ of SEQ ID NO: 12 and the antisense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’- usGfsuac(Tgn)cucauugUfgGfaugacsgsa-3’ of SEQ ID NO: 11, wherein a is 2'-O-methyladenosine-3’ -phosphate, c is 2'-O-methylcytidine-3’-phosphate, g is 2'-O-methylguanosine-3 ’ -phosphate, u is 2'-O-methyluridine-3’ -phosphate, Af is 2’-fluoroadenosine- 3’-phosphate, Cf is 2’-fhiorocytidine-3’-phosphate, Gfis 2’-fhioroguanosine-3’-phosphate, Ufis 2’- fluorouridine-3 ’ -phosphate, (Tgn) is thymidine-glycol nucleic acid (GNA) S-Isomer, and s is a phosphorothioate linkage, wherein the subject is taking at least two but not more than four antihypertensive medications; thereby decreasing the blood pressure level in the subject.

5. A method for treating a subject that would benefit from reduction in angiotensinogen (AGT) expression, the method comprising selecting a subject having high cardiovascular (CV) risk and hypertension, wherein the subject having high cardiovascular (CV) risk and hypertension has atherosclerotic cardiovascular disease (ASCVD) risk with a >15% ASCVD risk score and, administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’-gsuscaucCfaCfAfAfugagaguaca-3’ of SEQ ID NO: 12 and the antisense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’- usGfsuac(Tgn)cucauugUfgGfaugacsgsa-3’ of SEQ ID NO: 11, wherein a is 2'-O-methyladenosine-3’- phosphate, c is 2'-O-methylcytidine-3’ -phosphate, g is 2'-O-methylguanosine-3’ -phosphate, u is 2'-O- methyluridine-3’ -phosphate, Af is 2>fluoroadenosine-3 ’-phosphate, Cf is 2 ’-fluorocytidine -3’- phosphate, Gf is 2’-fhioroguanosine-3’-phosphate, Ufis 2’-fhiorouridine-3’-phosphate, (Tgn) is thymidine-glycol nucleic acid (GNA) S-Isomer, and s is a phosphorothioate linkage, wherein the subject is taking at least two but not more than four antihypertensive medications; thereby treating the subject that would benefit from reduction in AGT expression.

6. A method for inhibiting the expression of an angiotensinogen (AGT) gene in a subject, the method comprising selecting a subject having high cardiovascular (CV) risk and hypertension, wherein the subject having high cardiovascular (CV) risk and hypertension has atherosclerotic cardiovascular disease (ASCVD) risk with a >15% ASCVD risk score and, administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’-gsuscaucCfaCfAfAfugagaguaca-3’ of SEQ ID NO: 12 and the antisense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’-usGfsuac(Tgn)cucauugUfgGfaugacsgsa-3’ of SEQ ID NO: 11, wherein a is 2'-O-methyladenosine-3’ -phosphate, c is 2'-O-methylcytidine-3’-phosphate, g is 2'-O-methylguanosine-3 ’ -phosphate, u is 2'-O-methyluridine-3’ -phosphate, Af is 2’-fluoroadenosine- 3’-phosphate, Cf is 2’-fhiorocytidine-3’-phosphate, Gfis 2’-fhioroguanosine-3’-phosphate, Ufis 2’- fluorouridine-3 ’ -phosphate, (Tgn) is thymidine-glycol nucleic acid (GNA) S-Isomer, and s is a phosphorothioate linkage,wherein the subject is taking at least two but not more than four antihypertensive medications; thereby inhibiting the expression of the AGT gene in the subject.

7. A method for treating a subject that having an AGT-associated disorder, the method comprising selecting a subject having high cardiovascular (CV) risk and hypertension, wherein the subject having high cardiovascular (CV) risk and hypertension has atherosclerotic cardiovascular disease (ASCVD) risk with a >15% ASCVD risk score and, administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’-gsuscaucCfaCfAfAfugagaguaca-3’ of SEQ ID NO: 12 and the antisense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’- usGfsuac(Tgn)cucauugUfgGfaugacsgsa-3’ of SEQ ID NO: 11, wherein a is 2'-O-methyladenosine-3’- phosphate, c is 2'-O-methylcytidine-3’ -phosphate, g is 2'-O-methylguanosine-3’ -phosphate, u is 2'-O- methyluridine-3’ -phosphate, Af is 2>fluoroadenosine-3 ’-phosphate, Cf is 2 ’-fluorocytidine -3’- phosphate, Gf is 2’-fhioroguanosine-3’-phosphate, Ufis 2’-fhiorouridine-3’-phosphate, (Tgn) is thymidine-glycol nucleic acid (GNA) S-Isomer, and s is a phosphorothioate linkage, wherein the subject is taking at least two but not more than four antihypertensive medications; thereby treating the subject having an AGT-associated disorder.

8. A method for decreasing blood pressure level in a subject, the method comprising selecting a subject having high cardiovascular (CV) risk and hypertension, wherein the subject having high cardiovascular (CV) risk and hypertension has atherosclerotic cardiovascular disease (ASCVD) risk with a >15% ASCVD risk score and, administering to the subject a fixed dose of about 150 mg, about 300 mg, or about 600 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’-gsuscaucCfaCfAfAfugagaguaca-3’ of SEQ ID NO: 12 and the antisense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence 5’- usGfsuac(Tgn)cucauugUfgGfaugacsgsa-3’ of SEQ ID NO: 11, wherein a is 2'-O-methyladenosine-3’ -phosphate, c is 2'-O-methylcytidine-3’-phosphate, g is 2'-O-methylguanosine-3 ’ -phosphate, u is 2'-O-methyluridine-3’ -phosphate, Af is 2’-fluoroadenosine- 3’-phosphate, Cf is 2’-fhiorocytidine-3’-phosphate, Gfis 2’-fhioroguanosine-3’-phosphate, Ufis 2’-fluorouridine-3 ’ -phosphate, (Tgn) is thymidine -glycol nucleic acid (GNA) S-Isomer, and s is a phosphorothioate linkage, wherein the subject is taking at least two but not more than four antihypertensive medications; thereby decreasing the blood pressure level in the subject.

9. The method of any one of claims 1-8, wherein the sense strand comprises a modified nucleotide sequence comprising at least 20 contiguous nucleotides of the modified nucleotide sequence 5’-gsuscaucCfaCfAfAfugagaguaca-3’ of SEQ ID NO: 12, and the antisense strand comprises a modified nucleotide sequence comprising at least 20 contiguous nucleotides of the modified nucleotide sequence 5’-usGfsuac(Tgn)cucauugUfgGfaugacsgsa-3’ ofSEQ ID NO: 11.

10. The method of any one of claims 1-9, wherein the sense strand comprises a modified nucleotide sequence comprising at least 20 contiguous nucleotides of the modified nucleotide sequence 5 ’ -gsuscaucCfaCfAfAfugagaguaca-3 ’ of SEQ ID NO: 12, and the antisense strand comprises a modified nucleotide sequence comprising at least 21 contiguous nucleotides of the modified nucleotide sequence 5 ’ -usGfsuac(Tgn)cucauugUfgGfaugacsgsa-3 ’ of SEQ ID NO: 11.

11. The method of any one of claims 1-10, wherein the sense strand comprises a modified nucleotide sequence comprising at least 20 contiguous nucleotides of the modified nucleotide sequence 5 ’ -gsuscaucCfaCfAfAfugagaguaca-3 ’ of SEQ ID NO: 12, and the antisense strand comprises a modified nucleotide sequence comprising at least 22 contiguous nucleotides of the modified nucleotide sequence 5 ’ -usGfsuac(Tgn)cucauugUfgGfaugacsgsa-3 ’ of SEQ ID NO: 11.

12. The method of any one of claims 1-11, wherein the sense strand comprises the modified nucleotide sequence 5 ’ -gsuscaucCfaCfAfAfugagaguaca-3 ’ of SEQ ID NO: 12, and the antisense strand comprises the modified nucleotide sequence 5 ’ -usGfsuac(Tgn)cucauugUfgGfaugacsgsa-3 ’ of SEQ ID NO: 11.

13. The method of any one of claims 1-12, wherein the sense strand consists of the modified nucleotide sequence 5 ’ -gsuscaucCfaCfAfAfugagaguaca-3 ’ of SEQ ID NO: 12, and the antisense strand consists of the modified nucleotide sequence 5 ’ -usGfsuac(Tgn)cucauugUfgGfaugacsgsa-3 ’ of SEQ ID NO: 11.

14. The method of any one of claims 1-13, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, further comprises a ligand.

15. The method of claim 14, wherein the ligand is conjugated to the 3’ end of the sense strand.

16. The method of claim 14 or 15, wherein the ligand is an N-acetylgalactosamine (GalNAc) derivative.

17. The method of claim 16, wherein the GalNAc derivative comprises one or more GalNAc derivatives attached through a monovalent, bivalent, or trivalent branched linker.

18. The method of claim 17, wherein the ligand is19. The method of claim 18, wherein the 3’ end of the sense strand is conjugated to the ligand as shown in the following schematic20. The method of any one of claims 1-19, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is present in a pharmaceutical composition.

21. The method of claim 20, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is present in an unbuffered solution.

22. The method of claim 21, wherein the unbuffered solution is saline or water.

23. The method of claim 20, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is present in a buffer solution.

24. The method of claim 23, wherein the buffer solution comprises acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.

25. The method of claim 24, wherein the buffer solution is phosphate buffered saline (PBS).

26. The method of any one of claims 1-25, where the subject is a human.

27. The method of any one of claims 1-4 and 9-26, wherein the subject having high cardiovascular (CV) risk and hypertension has high cardiovascular (CV) risk and hypertension not adequately controlled by two to four antihypertensive medications.

28. The method of any one of claims 1-4 and 9-27, wherein the antihypertensive medication is selected from the group consisting of a thiazide, a thiazide-like diuretic, a loop diuretic, a beta blocker, an angiotensin-converting enzyme (ACE) inhibitor, an angiotensin II receptor blocker (ARB), a calcium channel blocker (CCB), a vasodilator, a centrally acting antihypertensive medication, and combinations thereof.

29. The method of claim 28, wherein the antihypertensive medication is a calcium channel blocker (CCB), a loop diuretic, a thiazide or a thiazide -like diuretic.

30. The method of any one of claims 1-4 and 9-29, wherein the subject having high cardiovascular risk and hypertension is a subject that had a prior cardiovascular event.

31. The method of claim 30, wherein the prior cardiovascular event is selected from the group consisting of a myocardial infarction and an ischemic stroke.

32. The method of any one of claims 1-4 and 9-31, wherein the subject having high cardiovascular risk and hypertension is a subject having peripheral artery disease, coronary artery disease, carotid artery disease, or atherosclerotic cardiovascular disease (ASCVD) risk.

33. The method of any one of claims 5-8 and 32, wherein the subject having ASCVD risk has an ASCVD risk score of >15%, >16%, >17%, >18%, >19%, >20%, >25%, >30%, >35%, >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, or >95%.

34. The method of claim 32, wherein the subject had prior percutaneous coronary intervention, coronary artery bypass grafting, carotid endarterectomy, or carotid stenting.

35. The method of any one of claims 1-4 and 9-34, wherein the subject having high cardiovascular risk and hypertension does not have moderate-to-severe obstructive sleep apnea not treated with continuous positive airway pressure therapy, renovascular hypertension, primary aldosteronism, pheochromocytoma, Cushing syndrome, aortic coarctation, or orthostatic hypotension.

36. The method of any one of claim 1-4 and 9-35, wherein the subject having high cardiovascular risk and hypertension is not being administered more than 1 ARB, more than 1 ACE, a mineralocorticoid receptor antagonist (MRA), aliskiren, triamterene, amiloride, and aldosterone synthase inhibitor, an endothelin antagonist, or an aminopeptidase inhibitor.

37. The method of any one of claims 1-4 and 9-36, wherein the subject has an estimated glomerular filtration rate (eGFR) of >45 mL / min / 1.73m2or an estimated glomerular filtration rate (eGFR) of 30-44 mL / min / 1.73m2.

38. The method of any one of claims 1-4 and 9-37, wherein the subject has an estimated glomerular filtration rate (eGFR) of >30 mL / min / 1.73m2to <60 mL / min / 1.73m2.

39. The method of any one of claims 1-38, wherein the subject has a 24-hour mean systolic blood pressure (SBP) as assessed by ambulatory blood pressure monitoring (ABPM) of >130 mmHg.

40. The method of any one of claims 1-39, wherein the subject has a seated office systolic blood pressure (SBP) of >140 mmHg to <170 mmHg41. The method of any one of claims 1-40, wherein the subject is male and >65 years of age.

42. The method of any one of claims 1-40, wherein the subject is female and >71 years of age.

43. The method of any one of claims 1-42, wherein the fixed dose is administered to the subject at an interval of once every three months.

44. The method of any one of claims 1-42, wherein the fixed dose is administered to the subject at an interval of once every six months.

45. The method of any one of claims 1-42, wherein the subject is administered a fixed dose of about 150 mg or about 300 mg about once every three months.

46. The method of any one of claims 1-42, wherein the subject is administered a fixed dose of about 150 mg or about 300 mg about once every six months.

47. The method of any one of claims 1-42, wherein the subject is administered a fixed dose of about 600 mg about once every three months.

48. The method of any one of claims 1-42, wherein the subject is administered a fixed dose of about 600 mg about once every six months.

49. The method of any one of claims 1-48, wherein the double stranded RNAi agent, or a pharmaceutically acceptable salt thereof, is administered to the subject subcutaneously or intravenously.

50. The method of claim 49, wherein the subcutaneous administration is subcutaneous injection.

51. The method of claim 4 or 8, wherein the blood pressure comprises systolic blood pressure and / or diastolic blood pressure.

52. The method of any one of claims 1-51, where the method results in a decrease in systolic blood pressure and / or diastolic blood pressure.

53. The method of claim 52, wherein the systolic blood pressure and / or diastolic blood pressure is decreased by at least 4 mmHg, 5 mmHg, 6 mmHg, 7 mmHg, 8 mmHg, 9 mmHg or 10 mmHg.

54. The method of claim 52 or 53, wherein the systolic blood pressure and / or diastolic blood pressure is seated office systolic blood pressure and / or diastolic blood pressure.

55. The method of claim 52 or 53, wherein the systolic blood pressure and / or diastolic blood pressure is ambulatory blood pressure monitoring (ABPM).

56. The method of claim 52, wherein blood pressure decrease is decrease in daytime and nighttime mean blood pressure.

57. The method of any one of claims 1-56, wherein the method results in a decrease in AGT expression by at least 30%, 40% 50%, 60%, 70%, 80%, 90%, or 95%.

58. The method of any one of claims 1-57, wherein the AGT protein level in a blood or a serum sample of the subject is decreased by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%.

59. The method of claim 3 or 7, wherein the AGT associated disorder is hypertension.

60. The method of claim 3 or 7, wherein the AGT associated disorder is selected from the group consisting of high blood pressure, hypertension, borderline hypertension, primary hypertension, secondary hypertension isolated systolic or diastolic hypertension, pregnancy-associated hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, labile hypertension; mild to moderate hypertension; hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vasculopathy, diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiac myopathy, nocturnal hypotension, glomerulosclerosis, coarctation of the aorta, aortic aneurism, ventricular fibrosis, heart failure, myocardial infarction, angina, stroke, renal disease, renal failure, systemic sclerosis, intrauterine growth restriction (IUGR) , fetal growth restriction, obesity, liver steatosis / fatty liver, non-alcoholic Steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD); glucose intolerance, type 2 diabetes, and metabolic syndrome.

61. The method of any one of claims 1-60, further comprising determining the serum level of AGT protein.

62. The method of any one of claims 1-61, further comprising determining the level of one or more cardiac biomarkers.

63. The method of claim 62, wherein the one or more cardiac biomarkers is selected from the group consisting of high-sensitivity cardiac troponin (hsTn), high-sensitivity C-reactive protein (hsCRP), interleukin 6 (IL-6), and B-type natriuretic peptide prohormone (NT (proBNP)).

64. The method of any one of claims 1-63, further comprising determining the level of one or more renal biomarkers.

65. The method of claim 64, wherein the one or more renal biomarkers is selected from the group consisting of albumin and creatinine.

66. The method of claim 64, wherein the level of the one or more renal biomarkers is a urine albumin-creatinine ratio (uACR).

67. The method of any one of claims 1-66, further comprising determining the level of one or more renin-angiotensin-aldosterone system (RAAS) biomarkers.

68. The method of claim 67, wherein the one or more RAAS biomarkers is selected from the group consisting of renin, angiotensin I, angiotensin II, and aldosterone.

69. The method of any one of claims 1-68, wherein dosage of at least one of the two or more antihypertensive medications is decreased following administration of the dsRNA agent.

70. The method of any one of claims 1-4 and 9-69, wherein at least one of the two or more antihypertensive medications is discontinued following administration of the dsRNA agent.

71. A kit for performing the method of any one of claims 1-70, comprising a) the dsRNA agent, or a pharmaceutically acceptable salt thereof, and b) instructions for use, and c) optionally, means for administering the dsRNA agent, or a pharmaceutically acceptable salt thereof, to the subject.