Combining Finasteride with Peptide
Patent Information
- Application Number
- IR139750140003005225
- Authority / Receiving Office
- IR · IR
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2018-05-16
- Publication Date
- 2026-04-18
- Estimated Expiration
- 2038-05-16
AI Technical Summary
Existing hair loss treatments, such as finasteride and peptides, are limited by high molecular weight, stability issues, and side effects, and require complex purification processes, making them inefficient for promoting hair growth and preventing hair loss.
A compound with a covalent bond between finasteride and a peptide, specifically designed to be water-soluble and enhance skin permeability, is developed to improve hair growth and prevent hair loss.
The compound effectively inhibits 5-alpha reductase, promotes keratinocyte and human hair dermal papilla cell growth, and enhances hair growth, while minimizing side effects and improving stability and solubility.
Smart Images

Figure 00000039_0000 
Figure 00000039_0001 
Figure 00000039_0002
Abstract
Description
Combining Finasteride with Peptide Technical background This invention relates to a compound having a conjugating structure of finasteride and a peptide with a covalent bond, and its uses for preventing hair loss or promoting hair growth. Prior knowledge The hair follicle is a unique organ of mammalian skin. The hair follicle is a downward outgrowth of the primary epidermis that extends into the deeper layers of the skin. At the base of the hair follicle is a plug of cells called the follicular or dermal papillae. The papillae are essential in the normal cycle of the hair follicle and in the growth of the hair shaft. The hair shaft is a cord-shaped structure composed of tightly packed, monolithic epithelial cells filled with keratin filaments and filament-binding proteins. Human hair periodically cycles through the anagen, catagen, and telogen phases, undergoing a process of hair loss and regrowth. The hair growth cycle is regulated by several hormones or growth factors. Severe stress or malnutrition may advance the catagen and telogen phases, leading to severe hair loss. The separation of hair from the scalp is called alopecia. Hair loss may be caused by various factors, including environmental factors such as exposure to weather, light or heat, etc., and internal factors such as illness, childbirth, hormonal secretions and changes, substance use, nutritional conditions, etc. 5-alpha reductase is the main hormone involved in the mechanism of hair loss. (Korean Patent No. 0077762-2008-10). 5-alpha reductase is an enzyme that increases sebum secretion by converting testosterone, a type of androgen, to dihydrotestosterone (DHT). Among the various products to prevent hair loss and promote hair growth in the hair loss product market, there may be products that aim to inhibit the effects of 5-alpha reductase. Hair loss may be caused by malnutrition, dry skin, stress, etc. in addition to enzymatic reactions (Eunju Ryu, et al., The Journal of Korean Society of Design Culture, 18(2), p. 89-100, 2012). Hair loss due to the above causes may be prevented and growth may be promoted by providing adequate nutrition, treating the skin, and absorbing or using antioxidant substances. Regardless of the cause, hair loss can ultimately lead to significant psychological, social, and sexual impairment, along with a loss of pride and self-esteem. In order to treat hair loss, various substances have been used in the form of drugs, but they have had disadvantages such as being too expensive or having very different effects on different people. In addition, herbal extracts have been used for cosmetic products, which are cheaper but have little effect. Treatments and solutions for hair loss have changed significantly over a long period of time. It may be possible to hide baldness with wigs, partial wigs, and hair extensions, but these cannot produce new hair. Also, the two drugs known to date (minoxidil and finasteride) can delay the increase in hair loss, but they cannot be used to regenerate hair follicles. Also, as hair cosmetic products, many hair loss prevention products are prepared using herbal extracts, etc., but it is difficult to find products that affect the production of new hair. Various factors are associated with the progression of hair growth and degeneration. For example, there are many reports that use a series of growth factors to promote keratinocyte growth factors, promote vascular endothelial growth factor activities, and promote hair growth by inhibiting the activity of BMP-type proteins. However, although such growth factors have shown excellent effects, they require a double regeneration process and more time to obtain natural factors, and a complex purification process is required to eliminate the source of contamination caused by coliform bacillus in the purification process. Also, due to its stability and molecular weight, it cannot easily suppress the protective coat of the hair, and therefore, along with its very high cost, its application has been declining. Also, there is a method that prevents hair thinning and thickens hair with finasteride versus 5-alpha-reductase based on the effect of finasteride on androgens. As a typical example, there is Propecia (Merck USA), which was approved by the US Food and Drug Administration (FDA) in December 1997 as the first oral hair loss treatment due to its effectiveness and stability, and was launched on the market as a hair loss treatment the following year. Finasteride is a drug that inhibits the enzyme 5-alpha-reductase, which converts testosterone, a type of androgen, into DHT and causes hair loss. Since the production of the DHT gene is inhibited by taking the drug, it plays the role of thickening and lengthening the hair again. However, it takes several months for finasteride to prevent hair loss. Also, in relation to women, there is a high probability that congenital changes will occur in the fetus, and in the case of men, there is a fear of side effects such as loss of libido, erectile dysfunction, ejaculation disorder, etc., and the concern that the effects of preventing hair loss can only be maintained if the drug is taken throughout life.Therefore, there are many limitations for actual clinical use (Korean Patent No. 0120912-2012-10). In this regard, the present inventors have prepared the nockin peptide (Korean Patent Application No. 0085407-2010-10) consisting of the amino acid sequence with SEQ ID NO: 3, the cremin 2 peptide (Korean Patent Application No. 0108323-2009-10) consisting of the amino acid sequence with SEQ ID NO: 2, and the WINT peptide (Korean Patent Application No. 0023991-201-10) consisting of the amino acid sequence with SEQ ID NO: 1 as peptides that have excellent stability to natural growth factors and can solve the problems caused by the high molecular weight of natural growth factors and have the same or similar functions and effects as natural growth factors. However, finasteride or peptides comprising amino acid sequences with SEQ ID NO:1 to 3 still need to be improved in terms of improving hair loss prevention and hair growth promotion, reducing side effects, and increasing water solubility. Detailed description of the invention Technical task The aim of the present invention is to improve the problems of conventional hair growth solutions. The technical task of the present invention is to provide a substance for preventing hair loss and / or promoting hair growth that has the same excellent performance or better than conventional hair growth solutions such as growth factors or peptides consisting of the amino acid sequences of SEQ ID NOS: 1 to 3 or finasteride and has excellent physiological properties such as better skin permeability and water stability. Technical tools to achieve a technical task In order to achieve the above technical task, the present invention provides a compound with a structure of conjugating finasteride and peptide with a covalent bond. According to one embodiment of the invention, the peptide may consist of 20 to 30 amino acids, preferably 5 to 20 amino acids, more preferably 8 to 15 amino acids, and most preferably 10 to 12 amino acids, but is not limited to this number. According to one embodiment of the invention, the peptide is preferably a water-soluble peptide, but is not limited thereto. According to one embodiment of the invention, the peptide has a water solubility of at least 50%, preferably 60%, more preferably at least 70%, more preferably 80%, more preferably at least 90%, and most preferably 100% of the amino acid with a hydrophilic side chain, and therefore, it is preferred that the amount thereof be high. According to one embodiment of the invention, the amino acid with a hydrophilic side chain may be an amino acid with an electrical charge, for example, arginine (Arg), histidine (His), lysine (Lys), aspartic acid (Asp), or glutamic acid (Glu), but is not limited thereto. According to one embodiment of the invention, the water-soluble peptide may comprise, but is not limited to, at least 3 amino acids with an electrical charge, preferably at least 5 amino acids with an electrical charge, and most preferably at least 7 amino acids with an electrical charge. According to a preferred embodiment of the invention, the water-soluble peptide has five or fewer amino acids with a hydrophilic side chain, preferably four or fewer, more preferably three or fewer, more preferably two or fewer, more preferably one or fewer, and most preferably no amino acids with a hydrophilic side chain. According to one embodiment of the invention, the peptide may be, but is not limited to, a Nokkin peptide comprising the amino acid sequence of SEQ ID NO:1, a Cremin2 peptide comprising the amino acid sequence of SEQ ID NO:2, a WINT peptide comprising the amino acid sequence of SEQ ID NO:3. Also, this invention provides a pharmaceutical composition for preventing hair loss or promoting hair growth comprising one or more compounds disclosed herein. Also, this invention provides a cosmetic composition for preventing hair loss or promoting hair growth comprising any of the compounds disclosed herein. According to one embodiment of the invention, the cosmetic composition may be a formulation such as, but not limited to, hair conditioner, milk lotion, nourishing cream, massage cream, essential oil, eye cream, cleansing cream, cleansing foam, cleansing water, packaging, spray, powder, hair tonic, hair cream, hair lotion, hair shampoo, hair rinse, hair conditioner, hair spray, hair aerosol, ointment, sol-gel, emulsion, oil, wax, and aerosol. Beneficial effects The compound of the present invention has a structure of conjugating finasteride and peptide with a covalent bond, and not only has excellent physiological activities such as preventing hair loss, promoting hair growth, promoting cell growth, etc., but also has excellent water stability and excellent skin permeability, and therefore can be used as a compound for preventing hair loss and promoting hair growth. Brief description of the shapes Figure 1 shows a photograph of the solubility of the compound of this invention and finasteride in water. Figures 2a and 2b are graphs showing the effect of the combination of the invention and finasteride on 5-alpha reductase activity. Figures 2a and 2b show the relative concentrations of DHT and testosterone, respectively, after treatment with the combination of the invention and finasteride. Figure 3a is an immunostaining photograph showing the shape and number of keratinocytes after treatment with the combination of the invention and finasteride, and Figure 3b is a graph showing the relative number of keratinocytes according to the concentration of the combined treatment. Figure 4a is an immunostaining photograph showing the shape and number of human hair dermal papilla cells (HHDPC) after treatment with the combination of the invention and finasteride, and Figure 4b is a graph showing the relative number of keratinocytes according to the concentration of the combined treatment. Figure 5a is a Western blot showing the translocation of beta-catenin to the nucleus in HHDPC cells after treatment with the combination of the invention and finasteride, and Figure 5b is a graph showing its conversion to numerical values relative to the negative control. Figure 6a is a Western blot showing the expression of phospho-AMD1 / 5 / 8 in HHDPC cells after treatment with the combination of the invention and finasteride, and Figure 6b is a graph of its conversion into numerical values in relation to BMP2. Figure 7a is an electrophoretic image showing the expression of DKK-1 mRNA in HHDPC cells after treatment with the combination of the invention and finasteride, and Figure 7b is a graph of its conversion into numerical values relative to the negative control. Figures 8a and 8b are photographs showing the effect of the compound of the present invention on hair growth through animal tests. Figure 8a confirms the hair growth rate of mice treated with finasteride and the compound of the present invention, and Figures 8b confirms the number of hair follicles by H&E staining of the hair of the back skin of mice treated with finasteride and the compound of the present invention with H&E. Figures 8a and 8b are graphs showing the results of a skin permeability test for a composition of the invention. The best way to implement this invention To accomplish the above technical task, the present invention provides a compound with a structure of conjugating finasteride and peptide with a covalent bond. Finasteride is N-(1,1-dimethylethyl)-3-oxo-(5α,17β)-4-azaandrost-1-ene-17-carboxamide and has a formula shown in Formula 1 below. [Formula 1] In this invention, the term "peptide" means a linear molecule formed by peptide linkage of amino acid residues. A peptide can be prepared by biological or chemical synthesis methods known in the art, in particular by solid-phase synthesis techniques. (Merrifield, J. Amer. Chem. Soc. 85:2149-54(1963); Stewart, et al., Solid Phase Peptide Synthesis, 2nd. ed., Pierce Chem. Co.: Rockford, 111(1984)). The peptide should increase the solubility of finasteride in water. In this regard, preferably, the peptide is a water-soluble peptide, but is not limited to this type of peptide. According to one embodiment of the invention, the peptide may consist of 20 to 30 amino acids, preferably 5 to 20 amino acids, more preferably 8 to 15 amino acids, and most preferably 10 to 12 amino acids. According to one embodiment of the invention, the peptide is preferably a water-soluble peptide, but is not limited thereto. According to a preferred embodiment of the invention, the water-soluble peptide is at least 50%, preferably 60%, more preferably at least 70%, more preferably 80%, more preferably at least 90%, and most preferably 100% amino acids with a hydrophilic side chain, and therefore, it is preferred that the amount thereof be high. On the other hand, the solubility of the peptide in water is 50% or less, preferably 40% or less, more preferably 30% or less, more preferably 20% or less, more preferably at least 10% or less, and most preferably zero percent of the amino acid with a hydrophilic side chain, and therefore, it is preferred that the amount is low.In this invention, "amino acid with hydrophilic side chain" refers to arginine (Arg), histidine (His), lysine (Lys), aspartic acid (Asp), glutamic acid (Glu), serine (Ser), threonine (Thr), asparagine (Asn), glutamine (Gln), cysteine (Cys), selenocysteine (Sec), glycine (Gly) and proline (Pro), and "amino acid with hydrophobic side chain" refers to alanine (Ala), valine (Val), isoleucine (Ile), leucine (Leu), methionine (Met), phenylalanine (Phe), tyrosine (Tyr) and tryptophan (Trp), but is not limited to them. In addition to amino acids in the natural world, variants thereof can be used without limitation. According to one embodiment of the invention, the amino acid with hydrophilic side chain may be an amino acid with an electrical charge, for example, arginine (Arg), histidine (His), Lysine (Lys), aspartic acid (Asp) or glutamic acid (Glu) may be included, but are not limited to these.According to one embodiment of the invention, the water-soluble peptide may comprise, but is not limited to, at least 3 amino acids with an electrical charge, preferably at least 5 amino acids with an electrical charge, and most preferably at least 7 amino acids with an electrical charge. According to a preferred embodiment of the invention, the peptide comprises five or less, preferably four or less, more preferably three or less, more preferably two or less, more preferably one or less, and most preferably no amino acids with hydrophilic side chains. According to an embodiment of the invention, the peptide may be, but is not limited to, a Nokkin peptide comprising the amino acid sequence of SEQ ID NO: 1, a Cremin2 peptide comprising the amino acid sequence of SEQ ID NO: 2, a WINT peptide comprising the amino acid sequence of SEQ ID NO: 3. According to one embodiment of the invention, the compound of the invention is functionally active in promoting the growth of craniosynostosis and HHDPC cells. According to one embodiment of the invention, the compound of the invention is functionally active in activating the WNT signaling pathway. According to one embodiment of the invention, the compound of the invention alters the location of beta-catenin in the nucleus. The compound of the invention has excellent stability on its own, but its stability can be improved by changing any amino acid comprising the conjugated peptide to the compound. According to one embodiment of the invention, the N-terminal of the peptide may be conjugated with a protecting group selected from the group consisting of an acetyl group, a carbonyl methoxyfluorenyl group, a formyl group, a palmitoleic group, a myristyl group, a stearyl group, and polyethylene glycol (PEG) to further improve its stability. According to one embodiment of the invention, the peptide may be conjugated with a protecting group selected from the group consisting of an acetyl group, a carbonyl methoxyfluorenyl group, a formyl group, a palmitoleic group, a myristyl group, a stearyl group, and polyethylene glycol (PEG) to further improve its stability. Amino acid modification as described above improves the stability of the compound of the invention. In this invention, the term "stability" includes not only in vitro stability but also in vitro stability such as storage stability (e.g., storage stability at room temperature). Also, the protecting group in the above text protects the compound of the invention from in vitro or in vivo attack by putative enzymes. Also, the present invention provides a composition for treating or improving hair loss comprising the composition as an active ingredient. According to one embodiment of the present invention, the present invention provides a composition for improving skin condition. In the present invention, the composition may be in the form of a pharmaceutical composition or a health food, but is not limited to these. Since the composition of this invention includes the composition of this invention as an active ingredient, common descriptions between them are omitted to avoid unnecessary repetition of material that would make this text difficult to understand. According to one embodiment of the invention, the treatment or improvement of hair loss by the composition of the subject matter of the invention is hair strengthening or hair growth. According to a preferred embodiment of the invention, the composition of the invention has the ability to promote the growth of keratinocytes and HHDPC cells, and to promote the beta-catenin signaling pathway, which is a representative of the WNT protein signaling pathway. Through animal tests conducted based on these results, it can be seen that the composition of the invention significantly promotes hair growth. Therefore, the composition of the invention is very effective for improving hair growth and skin condition. Also, according to one embodiment of the invention, the improvement of skin condition by the composition of the invention includes improvement of wrinkles, improvement of skin elasticity, prevention of skin aging, improvement of skin moisture, improvement of scars or skin regeneration. Since the subject mixture of this invention comprises the compound of this invention as an active ingredient, the common description between them has been omitted to avoid unnecessary repetition of subject matter that would make the text difficult to understand. According to a preferred embodiment of the invention, the subject mixture of the present invention is a pharmaceutical composition comprising (a) an effective amount of the subject compound of the present invention that is pharmaceutically effective; and (b) a pharmaceutically acceptable carrier. In the present context, the term "pharmaceutically effective amount" means an amount sufficient to render the compound of the invention effective or active. Pharmaceutical carriers of the invention that are pharmaceutically acceptable and are commonly used for preparation include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, sorbate, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. In addition to the above materials, the pharmaceutical composition of the invention may also include a lubricant, wetting agent, sweetener, flavoring agent, emulsifier, suspending agent, preservative, etc. Suitable pharmaceutically acceptable carriers and materials are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995). The pharmaceutical composition of the present invention may be prepared in the form of a single dose or a multi-dose formulation using a pharmaceutical carrier and / or excipient according to a method that is readily performed by a person of ordinary skill in the art. In this case, the formulation may be in the form of a solution in an oily or aqueous medium, a suspension or an emulsion, or may be in the form of an extract, powder, granule, tablet, capsule or gel (e.g. hydrogel) and may also include a spray or a stabilizer. The pharmaceutical compositions according to the present invention can be administered orally or intravenously in clinical use and are generally used as pharmaceutical materials. That is, the pharmaceutical composition of the present invention can be administered in various oral and injectable dosage forms during actual clinical use. When formulated, a diluent or additive such as a filler, thickening agent, binder, wetting agent, disintegrant, surfactant, etc. is usually used. Solid materials for oral use include tablets, pills, powders, granules, capsules, etc., and are prepared by mixing at least one additive such as starch, calcium carbonate, sucrose or lactose, gelatin, etc. with a plant extract or plant fermentation product. Also, in addition to simple additives, lubricants such as magnesium stearate or talc can be used.Liquid substances for oral administration include suspensions, solutions, emulsions, syrups, etc., and may contain various additives such as wetting agents, flavorings, aromatics, preservatives, etc., in addition to water and liquid paraffin, which are often used as diluents. Substances for intravenous injection include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, frozen substances and suppositories. As non-aqueous solvents or suspensions, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate, etc. may be used. As suppository bases, Vitacaps, McGrol, Tween 61, cocoa butter, lauric fat, glycerol, gelatin, etc. may be used. A single dose unit may contain 1, 2, 3 or 4 single doses or 1 / 2, 1 / 3 or 1 / 4 of an individual dose. An individual dose contains the amount of active drug that is administered at one time and this usually corresponds to 1 / 2, 1 / 3 or 1 / 4 of the total daily dose. The pharmaceutical compositions of the invention may be formulated in a single dose or multiple doses using a pharmaceutical carrier and / or excipient according to a method that may be readily carried out by a person of ordinary skill in the art. In this case, the formulation may be in the form of a solution in an oily or aqueous medium, a suspension or emulsion, or may be in the form of an extract, powder, granule, tablet, capsule or gel (e.g. hydrogel) and may also include a spray or a stabilizer. According to a preferred embodiment of the invention, the subject mixture of the present invention is a cosmetic composition comprising (a) a cosmetically effective amount of the subject compound of the present invention; and (b) a cosmetically acceptable carrier. In the present context, the term "cosmetically effective amount" means an amount sufficient for the composition of the present invention to be effective in improving the skin. The cosmetic composition of the present invention may be prepared in any general formulation in the art. For example, it may be formulated as a solution, suspension, emulsion, paste, gel, cream, lotion, powder, soap, surfactant-containing cleanser, oil, foundation powder, foundation emulsion, foundation wax and spray, etc., but is not limited to these. In particular, it may be in various forms such as skin lotion, milk lotion, skin nourishing cream, massage cream, essential oil, eye cream, cleansing cream, cleansing foam, cleansing water, pack, spray, powder, hair tonic, hair cream, hair lotion, hair shampoo, hair rinse, hair conditioner, hair spray, hair aerosol, ointment, gel-like solution, etc., sol-gel, emulsion, oil, wax, aerosol, etc., but is not limited to these. When the formulation of the present invention is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tragacanth, cellulose derivatives, polyethylene glycol, silicone, bentonite, silica, talc, and zinc oxide, etc. can be used as a carrier agent. When the formulation of the present invention is a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide may be used as a carrier material and, in particular, the spray formulation may include a propellant such as, but not limited to, a chlorofluorohydrocarbon, propane / butane or dimethyl ether. When the formulation of the present invention is a solution or emulsion, a solvent, solvent or emulsifier can be used as a carrier material. For example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, aliphatic glycerol ester, polyethylene glycol or sorbitan fatty acid ester may be used, but is not limited to these. When the formulation of the present invention is a suspension, a liquid diluent such as water, ethanol or propylene glycol, a suspension such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitan ester, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar or tragacanth, etc. can be used as a carrier material, but is not limited to these. When the formulation of the present invention is a surfactant-containing cleanser, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl tereate, sarcosinate, fatty acid ether amide sulfate, butynamidoalkyl, aliphatic alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative, or ethoxylated glycerol fatty acid ester, etc. can be used as a carrier, but are not limited to these. When the formulation of the present invention is a hair shampoo, basic ingredients for shampoo composition such as a thickening agent, surfactant, viscosity control agent, humectant, pH control agent, preservative, essential oil, etc. are mixed with the composition of the present invention. As a thickening agent, CDE may be used. As a surfactant, an anionic surfactant such as LES and an amphoteric surfactant such as coco betaine may be used. As a viscosity control agent, polyacrylate may be used. As a humectant, glycerin may be used. In addition, essential oils such as cedarwood, mint, rosemary, etc., and silk amino acid, pentane, vitamin E, etc. may be added. According to one embodiment of the invention, for 100 parts by weight of the compositions of the invention, 5 to 10 parts by weight of CDE, 30 to 40 parts by weight of LES, 10 to 20 parts by weight of coco betaine, 0.1 to 0.2 parts by weight, 5 to 10 parts by weight of glycerin, 0.1 to 1.01 parts by weight of grapefruit extract, 0.5 to 1 part by weight of silk amicocidal acid, 0.5 to 1 part by weight of pinastil, 0.5 to 2 parts by weight of vitamin E and 0.01 to 0.1 parts by weight each of cedarwood, peppermint, rosemary as essential oils, may be mixed, but are not limited to these. The ingredients contained in the cosmetic composition of the present invention include those commonly used in cosmetic compositions, in addition to the composition of the present invention and the active ingredient-containing materials. For example, it may also include a conventional adjuvant such as, but not limited to, a stabilizer, a solubilizer, a vitamin, a pigment, and a perfume. Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are provided for illustrative purposes only, and the scope of the invention is not limited by these examples. Example 1. Synthesis of the compound of the subject of this invention >1-1< Peptide synthesis >1-1-1< Peptide synthesis sequence identity number 3 700 mg of chlorotrityl chloride resin (CTL resin; Biochem Nova
[0064] catalog number 01-64-0021) was placed in a reactor and stirred for 3 min after adding 10 mL of methylene chloride (MC). After removing the solution, 10 mL of dimethylformamide (DMF) was added. Then, after shaking for 3 min, the solvent was removed again. After adding 10 mL of dichloromethane (DCM) to the reactor, 200 mmol of Fmoc-Cys(trt)-OH (Bachem, Switzerland) and 400 mmol of diisopropylethylamine (DIEA) were added and dissolved well by stirring. After reacting for 1 h with stirring, the mixture was washed and dissolved with methanol and DIEA (2:1) in DCM. After reacting for 10 min, the mixture was washed with additional DCM / DMF (1:1). After removing the solution, and adding 10 mL of DMF and stirring for 3 min, the solvent was removed again. After adding 10 mL of deprotection solution (20% piperidine / DMF) to the reactor, the mixture was stirred for 10 min at room temperature, then the solution was removed.After adding the same amount of deprotecting solution and carrying out the reaction for 10 min, the solution was removed and the Cys(trt)-CTL resin was prepared by washing twice with DMF, once with MC and once with DMF for 3 min, respectively. After adding 10 ml of DMF to another reactor, 200 mmol of Fmoc-His(trt)-OH (Bachem, Switzerland) and 200 mmol of Bop were added and dissolved well by stirring. After adding 400 mmol of DIEA to the reactor in two portions, the mixture was stirred for at least 5 min to decompose all the solid. The specific amino acid mixture solution was added to the reactor containing the deprotected resin and reacted for one hour at room temperature with shaking. After removing the reaction solution, and then stirring with DMF solution 3 times, 5 min, respectively, the solution was removed. A small amount of the reactive resin was taken and the Kaiser test (nihydrin test) was performed to determine the extent of the reaction. His(trt)-Cys(trt)-CTL resin was prepared by the same method as described above, with 2 times of deprotection with anti-rust solution.After sufficient washing with DMF and MC and performing the Kaiser test once more, amino acid coupling was performed in the same manner as described above. According to the selected amino acid sequence, the chain reaction was carried out in the following order: Fmoc-Cys(trt), Fmoc-Arg, Fmoc-Gln(trt), Fmoc-Val, Fmoc-Arg, Fmoc-Thr, Fmoc-Gln(trt), and Fmoc-Arg(pbf). After the Fmoc protecting group was reacted with the deprotection solution twice for 10 min, the solution was removed by washing well. After acetylation for 1 h by adding acetic anhydride, DIEA and HoBt, the prepared peptidyl resin was washed 3 times with DMF, MC and methanol, and then dried slowly in a stream of nitrogen gas and completely reduced under pressure in the presence of P2O5. It was reacted with 30 ml of a deactivating solution (containing 95% trifluoroacetic acid, 2.5% distilled water and 2.5% thioanisole) for 2 h at room temperature with intermittent evaporation. The resin was filtered and washed with a small amount of TFA solution, after which the filtrate was combined with the mother liquor. After distillation under reduced pressure to reduce the total volume to approximately half, 50 ml of cold ether was added, with the precipitates formed by centrifugation, washed twice with cold ether, collected. After removal of the mother liquor, the resulting material was sufficiently dried under nitrogen to obtain 0.65 g of crude NH2-Arg-Gln-Thr-Arg-Val-Gln-Arg-Cys-His-Cys-OH peptide (SEQ ID NO: 3) (yield: 92.6%).The molecular weight was measured as 1287.1 (theoretical value: 1286.5) using a molecular weight analyzer. The molecular weight was measured as 1287.1 (theoretical value: 1286.5) using a molecular weight analyzer. >1-1-2< Synthesis of peptide sequence identity number 1 and sequence identity number 2 Peptide sequence identity number 1 (Glu- Leu-Ile-Glu-His-Gly-Gly-Gly-Arg-Pro-Ala-Asp: ELIEHGGGRPAD) and peptide sequence identity number 2 (Ac-Tyr-Lys-Ser-Lys-Lys-Gly-Gly-Trp-Thr-His: Ac-YKSKKGGWTH) were synthesized using the same method as in Example 1. [Table 1] Sequence Identity Amino Acid Sequence Number Measured Value (Molecular Weight Analyzer) Measured Value Theoretical Value 1 ELIEHGGGRPAD 1250. 9 1250. 35 2 Ac-YKSKKGGWTH 1233. 8 1233. 4 3 RQTRVERCHC 1287. 1 1286. 5 >1-2< Synthesis of the compound of this invention 1 mmol of peptidyl resin and 10 mL of 1-methyl-2-pyrrolidone (NMP) were placed in a peptide reactor, and 30 min after adding 270 mg (2.0 times) of 1-hydroxybenzotriazole (HOBt) and 759 mg of N,N,N',N'-tetramethyl-O-(1H-benzotriazole-1-yl) uronium hexafluorophosphate O-(benzotriazole-1-yl)-N,O-(benzotriazole-1-yl)-N,N,N',N'-tetramethyl uronium hexafluorophosphate. After adding 388 mg (3 times) of N,N-N,N-diisopropylethylamine (DIEA) and 624 mg (2.0 times) of finasteride analog, the mixture was reacted for 24 to 72 h at room temperature to obtain the reacted peptidyl resin by filtration. After the resulting resin was reacted for 2 hours at room temperature using a denaturing solution, the resin and the protecting group were removed. After crystallization using 10 mL (10 mmol) of diet, the hybrid peptide was obtained. The reaction schemes of this compound having the structure of finasteride and the covalently bonded peptide are described below. [Reaction Scheme 1] Reaction Scheme of CG–Peptide-Finasteride Hybrid Peptide [Reaction Scheme 2] Reaction Scheme CG– Nokkin-Finasteride Hybrid Peptide [Reaction Scheme 3] Reaction Scheme of CG-Ceramin2-Finasteride Hybrid Peptide [Reaction Scheme 4] Reaction Scheme of CG-WINT-Finasteride Hybrid Peptide Experimental Example 1. Testing the solubility of the composition of this invention The finasteride-CG-Nokkin compound (compound 1), the finasteride-CG-Ceramin2 compound (compound 2), the finasteride-CG-WINT compound (compound 3) in Example >1-2<, and finasteride are respectively dissolved in distilled water each at a concentration of 10 mg / ml. As a result, it was confirmed that finasteride itself was hardly soluble in water, while compounds 1 to 3 of the present invention were completely soluble in water (Figure 1). Experimental Example 2. Analysis of the effect of the compound of this invention on 5α-reductase activity In order to confirm the effect of the compound of the invention on 5α reductase activity, liver cell extracts containing high levels of 5α reductase were first extracted by protein extraction. After reacting testosterone with finasteride or compounds 1 to 3 of the invention, the liver cell extracts were placed in the corresponding solution and reacted for 1 hour at 37°C. The reaction of the liver cell extracts in testosterone and reacting it for 1 hour at 37°C is the control. After the reaction was complete, the amount of testosterone and DHT was confirmed by HPLC. HPLC analysis was performed under the following conditions: - C18 column - UV 240 nm - Flow rate: 1 ml / min - Mobile phase: A: 0.1% formic acid in water B: 0.1% formic acid in acetonitrile - Slope: 0 min B 5% ~ -3 min B 80% As a result, when compared with the control, testosterone concentration increased during treatment with finasteride and the compounds of the invention and DHT concentration decreased proportionally. Also, compared with those used with finasteride, it was confirmed that the increase in testosterone concentration and the decrease in DHT concentration during treatment with the compounds of the invention were significant (see Figures 2a and 2b). Experimental Example 3. Effect of the compound of this invention on the growth of cratonists In order to analyze the similar effects and growth factor inhibitory effects with respect to the compounds synthesized in Example <1-2>, the sulfohodomine B (SRB) calorimetric assay was performed using HaCaT keratinocytes (Korean cell line bank) according to the method of Rizzino et al. (Rizzino, et al. Cancer Res. 48:4266(1988)). HaCaT keratinocytes were cultured at 24 °C in modified Eagle's medium (DMEM, Gibco, USA) containing 10% fetal bovine serum (FBS, Sigma) at 37 °C under 5% CO2 after seeding each well of a 96-inch plate with 3000 cells. The cultured cell lines were treated with 1% trypsin solution to detach the cultured cell lines from the culture flask and centrifuged to collect the cell pellets. They were released into DMEM culture medium and incubated at 37 °C under 5% CO2 for 24 h. After 24 hours, the medium was replaced with serum-free medium and the cells were cultured for 72 hours under the same conditions as described above with a blank sample cultured in 10% DMSO under sterilized conditions as a reference, the compounds of Formulae 1 to 3 of this invention (50 μM), finasteride (50 μM) and EGF (100 nM) were used as a positive reference. After removing the supernatant and fixing the cells using ethanol, the cells were washed three times with phosphate buffered saline (PBS).After removing the washing solution and treating with SRB calorimetric solution followed by sufficient washing with 1% acetic acid, the cells were examined under a microscope to assess cell viability. In addition, the absorbance at 560 nm ultraviolet light was measured to assess cell proliferation. After treating keratinocytes with the compound of the invention and observing the morphological changes of the cells 72 hours later, it was confirmed that the compound of the invention changed the growth and morphological shape of keratinocytes (Figure 3a). It was also confirmed that the growth of keratinocytes was significantly increased when treated with the compound of the invention compared to the case treated with finasteride (Figure 3b). Experimental Example 4. Effect of the compound of this invention on the growth of HHDPC cells The effect of the compounds of this invention on the growth of HHDPC cells (ATCC / USA) was confirmed in the same manner as in Experimental Example 3. In this case, MNX (10 uM) and IGF-1 (1uM) were used as positive controls. As a result, it was confirmed that the compound of the invention changed the growth pattern and morphological shape of HHDPC cells (Figure 4a). It was also confirmed that the growth of HHDPC cells was significantly increased when treated with the compound of the invention compared to the case treated with finasteride (Figure 4b). Experimental Example 5. Analysis of the effect of the compound of this invention on the translocation of beta-catenin to the nucleus 5 hours after treatment of HHDPC cells cultured for 48 hours with the compounds of the present invention produced in Example >1-2<, the effect of the present invention on the localization of beta-catenin, which is a signal substance essential for promoting hair growth in the nucleus, was measured by the representative WNT protein pathway. The expression of beta-catenin was observed by Western blotting using an antibody against beta-catenin (Santa Cruz, USA) and it was confirmed whether beta-catenin was localized by immunohistochemistry using the same antibody. Specifically, HHDPC cells were cultured in a CO2 incubator for 24 hours at 37°C after inoculation of each well in a 6-well plate with 100,000 cells. The medium was changed to serum-free DMEM medium, and then after treatment of the cells with finasteride, finasteride-WINT and WINT at concentrations of 5 and 50 μM, respectively, the cells were cultured for 24 hours. After nuclear and cytoplasmic protein extraction using a protein extraction kit, Western blotting was performed under the following conditions: - Preparation of 12% SDS-PAGE - Loading with 15 μg of protein to SDS-PAGE - Transfer to PVDF membrane - Blocking with 5% dried milk solution for one hour at room temperature - Primary antibody reaction (anti-beta-catenin antibody, anti-HDAC antibody, anti-alpha tubulin antibody) at room temperature for 2 hours at a concentration of 1 / 3000 - Wash three times with PBST for 10 minutes. - Reaction of the second antibody at room temperature for 1 hour at a concentration of 1 / 5000 - Wash three times with PBST for 15 minutes. - Diagnosis. As a result, it was confirmed that the expression of beta-catenin was increased upon treatment with the compound of the present invention. It was also confirmed that even when measuring whether beta-catenin was translocated to the nucleus using immunohistochemistry in HHDPC cells and that the compound of the present invention was still present in the cytoplasm and was active (Figures 5a and 5b), beta-catenin was translocated from the cytoplasm to the nucleus by the compounds of the present invention. Experimental Example 6. Analysis of the effect of the compound of this invention on the inhibition of BMP signal transduction 5 hours after treatment of HHDPC cells cultured for 48 hours with the compounds of the present invention produced in Example >1-2<, the effect of the compound of the present invention on the activity of phospho-SMD 1 / 5 / 8, which is a signal substance essential for inhibiting hair loss, was measured by the BMP protein signaling pathway. The expression of phospho-SMD 1 / 5 / 8 was confirmed by Western blotting using an antibody against phospho-SMD 1 / 5 / 8. Specifically, HHDPC cells were cultured in a CO2 incubator for 24 hours at 37°C after inoculation of each well in a 6-well plate with 100,000 cells. The medium was changed to serum-free DMEM medium, and then after treatment of the cells with finasteride, finasteride-WINT, and WINT at concentrations of 5 and 50 μM, respectively, the cells were cultured for 24 hours. After nuclear and cytoplasmic protein extraction using a protein extraction kit, Western blotting was performed under the following conditions: - Preparation of 12% SDS-PAGE - Loading with 15 μg of protein to SDS-PAGE - Transfer to PVDF membrane - Blocking with 5% dried milk solution for one hour at room temperature - First antibody reaction (antiphospho-Smd 1 / 5 / 8 antibody, anti-HDAC, anti-alpha tubulin antibody) at room temperature for 2 hours at a concentration of 1 / 3000 - Wash three times with PBST for 10 minutes. - Reaction of the second antibody at room temperature for 1 hour at a concentration of 1 / 5000 - Wash three times with PBST for 15 minutes. - Diagnosis. As a result, it was confirmed that when treated with the compound of the invention, the expression of phospho-Smd1 / 5 / 8 in the nucleus was reduced (Figures 6a and 6b). Experimental Example 7. Analysis of the effect of the compound of this invention on DKK-1 expression The effect of the compound of the present invention on the expression of DKK-1 mRNA, which is a hair loss protein expressed by DHT, was confirmed. Specifically, HHDPC cells were cultured in a CO2 incubator for 24 hours at 37°C after inoculating each well in a 6-well plate with 100,000 cells. After reacting testosterone with finasteride or the finasteride-Nokkin compound of compounds 1 to 3 of the present invention, the finasteride-Ceramine2 compound and the finasteride-WINT compound, liver cell extracts were placed in the corresponding solution and reacted for 1 hour at 37°C. The medium was changed to serum-free DMEM medium, and then after treatment with finasteride and the finasteride-Nokkin compound, the finasteride-Ceramine2 compound and the finasteride-WINT compound at a concentration of 50 μM, respectively, the cells were cultured for 24 hours. After extracting RNA from cells using an RNA extraction kit, RT-PCR was performed using the following primers: 1. DKK-1 - Forward primer: (5') TGATGAGTACTGCGCTAGTC (3') (sequence identity number 4) - Reverse primer: (5') CTCCTATGCTTGGTACACAC (3') (sequence identity number 5) 2. GAPDH - Forward primer: (5') GGAGCCAAAAGGGTCATCAT (3') (sequence identity number 6) - Reverse primer: (5') GTGATGGCATGGACTGTGGT (3') (sequence identity number 7) As a result, it was confirmed that the compounds of the invention inhibit the increased expression of DKK-1 in the positive control more than those used with finasteride, and in particular, can inhibit the expression of DKK-1 to a level even lower than the negative control that was not treated with anything (Figures 7a and 7b). Experimental Example No. 8. Hair Growth Test The effect of the compound of the invention on hair growth was confirmed by animal testing. Specifically, the hair on the back of a 7-week-old male C57BL / 6 mouse was removed using a hair removal cream. After preparing PBS, finasteride and the finasteride-WINT compound of the invention at concentrations of 100 μg / ml, they were applied evenly to the skin of the back of the mice once a day, and by taking photographs, it was observed that the color of the skin of the back of the mice began to turn black from that point. Then the mice were killed and the hair on the back of the skin was observed by H&E staining. For this purpose, after collecting the back skin of the mice and fixing it in 4% paraformaldehyde (PFA), paraffin embedding was performed. After the back skin of the mice was sectioned at a thickness of 4 μm, the number of hair follicles was confirmed by H&E staining. As a result, it was confirmed that mice treated with the finasteride-WINT combination of this invention showed a faster rate of hair growth in mice than mice treated with PBS or finasteride (Figure 8a), indicating that the number of hair follicles was significantly increased compared to the control group and the finasteride drug group (Figure 8b). Experimental Example No. 9. Skin Permeability Test Since finasteride is a steroid-type hormone control drug that is taken orally, side effects such as systemic toxicity may occur as it spreads through the blood. Therefore, even when applied to the skin, if it penetrates into the skin, it is likely to penetrate completely and cause toxicity, and if it does not penetrate the skin, since it is applied to the scalp and does not spread to the whole body, the side effects of finasteride may be suppressed. In this regard, after using finasteride and finasteride-WINT compounds of the present invention in the 3D artificial skin, the present inventors confirmed whether it penetrates into the skin. For this purpose, the finasteride and finasteride-WINT compounds of the present invention are mixed in a mixed solution of 10% ethanol, 40% propylene glycol and 50% purified water, respectively. The Franz cell expansion test was performed using a three-dimensional artificial skin. The solution of the finasteride and finasteride-WINT compound was applied to the three-dimensional artificial skin in 1 ml and left for 24 hours. After sampling the receptor chamber solution, the finasteride and finasteride-WINT compounds penetrating the skin were detected using HPLC. The detection conditions of finasteride HPLC were C18 column, UV 210 nm, flow rate 1.6 ml / min, acetonitrile:water = 45:55 and detection RT 9 to 10 minutes. In order to detect the finasteride-WINT combination of this invention, a multiple reaction monitoring (MRM) assay, which is a method for detecting the corresponding molecular weight, was performed using an LC-MS / MS instrument (3200 Qtrap). As a result, it was confirmed that the drug treated with finasteride alone penetrated the skin and was detected, and that the drug treated with the finasteride-WINT combination of the present invention was not detected with a substance that does not penetrate the skin and remained in the skin (Figures 9a and 9b). In summary, from the results of Experimental Examples 1 to 9, it can be seen that the composition of the present invention excellently promotes hair growth, inhibits hair loss, and has an anti-aging effect. Formulation Example 1: Emollient Lotion An emollient lotion comprising the composition of this invention prepared in Example <1-2> and comprising the following composition was prepared according to the general method for preparing a lotion. [Table 2] Ingredient Content (wt%) Composition of this invention 2.5 1,3-butylene glycol 6 Glycerin 4 PEG 1500 1 Sodium hyaluronate 1 Polysaccharide 20 0.5 Ethanol 8 Preservative, pigment qs Benzophenone 9 0.05 Negligible fragrance Pure water Balance Total 100 Formulation Example 2: Nourishing Cream A nourishing cream comprising the composition of this invention prepared in Example <1-2> and comprising the following composition was prepared according to the general method for preparing a nourishing cream. [Table 3] Ingredient Content (wt%) Composition of this invention 2.5 Meadowfoam oil 3 Ceftaryl alcohol 1.5 Stearic acid 1.5 Glyceryl stearate 1.5 Liquid paraffin 10 Beeswax 2 Polysaccharide 60 0.6 Sorbitan sesquioleate 2.5 Squalane 3 3,1-butylene glycol 3 Glycerin 5 Triethanolamine 0.5 Tocopheryl acetate 0.5 Preservative, pigment qs Perfume qs Purified water Total balance 100 Formulation Example 3: Milk Lotion A milk lotion comprising the composition of this invention prepared in Example <1-2> and comprising the following composition was prepared according to the general method for preparing a milk lotion cream. [Table 4] Ingredient Content (wt%) Composition of this invention 5.2 3,1-butylene glycol 4 glycerin 4 ceftaryl alcohol 0.8 glyceryl stearate 1 triethanolamine 0.13 tocopheryl acetate 0.3 liquid paraffin 5 squalane 3 macadamia oil 2 polysaccharide 60 1.5 sorbitan sesquioleate 0.5 carboxyvinyl polymer 1 preservative, pigment qs perfume qs purified water balance total 100 Formulation Example 4: Essential Oil The essential oil comprising the composition of this invention prepared in Example <1-2> and comprising the following composition was prepared according to the general method for preparing essential oil. [Table 5] Ingredient Content (wt%) Composition of this invention 5.2 Glyceryl 10 3,1-butylene glycol 5 PEG 1500 2 Altoin 0.1 DL-panthenol 0.3 EDTA-2Na 0.02 Hydroxyethylcellulose 0.1 Sodium hyaluronate 8 Carboxyvinyl polymer 0.2 Triethanolamine 0.18 Octyldodeceth-16 0.4 Ethanol 6 Fragrance, preservative, pigment qs Purified water Balance Total 100 Formulation Example 5: Hair Serum A hair serum comprising the composition of this invention prepared in Example <1-2> and comprising the following composition was prepared according to the general method for preparing hair serum. [Table 6] Ingredient Content (wt%) Composition of this invention 1 Glyceryl 10 3,1-butylene glycol 5 PEG 1500 2 Altoin 0.1 DL-panthenol 0.3 EDTA-2Na 0.02 Hydroxyethylcellulose 0.1 Sodium hyaluronate 8 Carboxyvinyl polymer 0.2 Triethanolamine 0.18 Octyldodeceth-16 0.4 Ethanol 6 Fragrance, preservative, pigment qs Pure water Balance Total 100 Formulation Example 6: Hair Toner A hair toner comprising the composition of this invention prepared in Example <1-2> and comprising the following composition was prepared according to a general method for preparing hair toner. [Table 7] Ingredient Content (wt%) Composition of this invention 1 Glyceryl 2 3,1-butylene glycol 2 PEG 1500 2 Altoin 0.1 DL-panthenol 0.3 EDTA-2Na 0.02 Sodium hyaluronate 8 Carboxyvinyl polymer 0.2 Triethanolamine 0.18 Ethanol 10 Perfume, preservative, pigment qs Pure water Balance Total 100 What is claimed is as follows: 1. A compound having a conjugating structure of finasteride and a peptide with a covalent bond. 2. The composition of claim 1, wherein the peptide is 2 to 30 amino acids. 3. The composition of claim 1, wherein the peptide is 8 to 15 amino acids. 4. The composition of claim 1, wherein the peptide is a water-soluble peptide. 5. The composition of claim 4, wherein the water-soluble peptide is at least 70% amino acids with hydrophilic side chains. 6. The composition of claim 5, wherein the amino acid with a hydrophilic side chain is selected from the group consisting of arginine (Arg), histidine (His), lysine (Lys), aspartic acid (Asp), glutamic acid (Glu), serine (Ser), threonine (Thr), asparagine (Asn), glutamine (Gln), cysteine (Cys), selenocysteine (Sec), glycine (Gly) and proline (Pro). 7. The compound of claim 5, wherein the amino acid with a hydrophilic side chain is an amino acid with an electrical charge selected from the group consisting of arginine (Arg), histidine (His), lysine (Lys), aspartic acid (Asp) and glutamic acid (Glu). 8. The composition of claim 4, wherein the water-soluble peptide is at least three amino acids with an electrical charge selected from the group consisting of arginine (Arg), histidine (His), lysine (Lys), aspartic acid (Asp), and glutamic acid (Glu). 9. The composition of claim 4, wherein the water-soluble peptide has five or fewer amino acids with a hydrophilic side chain. 10. The composition of claim 9, wherein the water-soluble peptide has three or fewer amino acids with a hydrophilic side chain. 11. The composition of claim 9, wherein the amino acid with a hydrophobic chain is selected from the group consisting of alanine (Ala), valine (Val), isoleucine (Ile), leucine (Leu), methionine (Met), phenylalanine (Phe), tyrosine (Tyr) and tryptophan (Trp). 12. The composition of claim 1, wherein the peptide is selected from the group consisting of a Nokkin peptide comprising the amino acid sequence of SEQ ID NO:1, a Cremin2 peptide comprising the amino acid sequence of SEQ ID NO:2, a WINT peptide comprising the amino acid sequence of SEQ ID NO:3. 13. A pharmaceutical composition for preventing hair loss or promoting hair growth comprising the compound of any one of claims 1 to 12. 14. A cosmetic composition for preventing hair loss or promoting hair growth comprising the composition of any one of claims 1 to 12. 15. The cosmetic composition of claim 14, wherein a selected formulation is selected from the group consisting of skin lotion, milk lotion, skin nourishing cream, massage cream, essential oil, eye cream, cleansing cream, cleansing foam, cleansing water, pack, spray, powder, hair tonic, hair cream, hair lotion, hair shampoo, hair rinse, hair conditioner, hair spray, hair aerosol, ointment, sol gel, emulsion, oil, wax and aerosol. Abstract of the invention The present invention relates to a composition for preventing hair loss, and more specifically, to a composition having a structure in which finasteride and a peptide are covalently linked, and a pharmaceutical composition or cosmetic composition for preventing hair loss or promoting hair growth comprising the same. The composition of the present invention has a structure in which finasteride and a peptide are covalently linked, and has excellent physiological activities such as improving hair loss, promoting hair growth, promoting cell growth, etc., its stability in water and its penetration rate into the skin are excellent, and therefore it can be used as a composition for preventing hair loss and promoting hair growth.
Claims
What is claimed is as follows:
1. A compound having a structure conjugating finasteride to a peptide in which the exocyclic carboxylic acid group of finasteride is directly conjugated by an amide bond to the N-terminal group of an a-amino acid of the peptide, and the peptide is composed of 8 to 15 amino acids, and the peptide is a water-soluble peptide, and the water-soluble peptide has at least 70% of an amino acid comprising a hydrophilic side chain, and the amino acid having the hydrophilic side chain is from the group consisting of arginine (Arg), histidine (His), lysine (Lys), aspartic acid (Asp), glutamic acid (Glu), serine (Ser), threonine (Thr), asparagine (Asn), glutamine (Gln), cysteine (Cys), selenocysteine (Sec), glycine (Gly) and proline (Pro).
2. The compound of claim 1, wherein the amino acid with a hydrophilic side chain is an amino acid with an electrical charge selected from the group consisting of arginine (Arg), histidine (His), lysine (Lys), aspartic acid (Asp) and glutamic acid (Glu).
3. The composition of claim 1, wherein the water-soluble peptide is at least three amino acids with an electrical charge selected from the group consisting of arginine (Arg), histidine (His), lysine (Lys), aspartic acid (Asp) and glutamic acid (Glu).
4. The composition of claim 1, wherein the water-soluble peptide has five or fewer amino acids with a hydrophilic side chain.
5. The composition of claim 4, wherein the water-soluble peptide has three or fewer amino acids with a hydrophilic side chain.
6. The composition of claim 5, wherein the amino acid with a hydrophobic chain is selected from the group consisting of alanine (Ala), valine (Val), isoleucine (Ile), leucine (Leu), methionine (Met), phenylalanine (Phe), tyrosine (Tyr) and tryptophan (Trp).
7. The composition of claim 1, wherein the peptide is selected from the group consisting of a Nokkin peptide comprising the amino acid sequence of SEQ ID NO: 1, a Cremin2 peptide comprising the amino acid sequence of SEQ ID NO: 2, a WINT peptide comprising the amino acid sequence of SEQ ID NO:
3.
8. A pharmaceutical composition for preventing hair loss or promoting hair growth comprising the compound of any one of claims 1 to 7.
9. A cosmetic composition for preventing hair loss or promoting hair growth comprising the composition of any one of claims 1 to 7.
10. The cosmetic composition of claim 9, wherein a selected formulation is selected from the group consisting of skin lotion, milk lotion, skin nourishing cream, massage cream, essential oil, eye cream, cleansing cream, cleansing foam, cleansing water, pack, spray, powder, hair tonic, hair cream, hair lotion, hair shampoo, hair rinse, hair conditioner, hair spray, hair aerosol, ointment, sol gel, emulsion, oil, wax and aerosol.