hsa-miR-106b-5p and hsa-miR-15a-5p as biomarkers of antiepileptic drug response in patients with epilepsy

Description

I0207562 Description of the industrial invention entitled: “hsa-miR-106b-5p and hsa-miR-15a-5p as biomarkers of the response to antiepileptic drugs patients with epilepsy” By: GENECHRON SRL, Italian nationality, VIA GIUNIO ANTONIO RESTI, 63, 00143 Rome (Italy) Designated Inventors: SPEDALETTI, Valentina; ROSATO, Vittorio Camillo; ANGELUCCI, Emanuela Filed on: June 26, 2024 * * * DESCRIPTION The present invention falls within the field of diagnostics. In particular, it is refers to an in vitro procedure for the assessment of seizure frequency and response to antiepileptic drugs in patients suffering from epilepsy. The most long-term neurological condition A widespread disease affecting children is epilepsy, which presents a variety of etiologies, including those genetic, structural, metabolic, infectious or immunological. In some cases, the cause of epilepsy is still unknown. With drugs appropriate, about 70% of people with active epilepsy may experience remission long-term crises. More are available of thirty antiepileptic drugs (ASM); however, approximately 30% of epileptic patients experience epileptic seizures resistant to specific classes of drugs and is unable to reach independence from seizures with therapy inappropriate pharmacological treatment. The variability in response to ASMs therefore represents a challenge for effective management of epilepsy. At present it is not possible to predict in a precise way reliable as to how the individual patient will respond to the pharmacological treatment, which highlights the need to identify effective biomarkers useful in this regard. It should also be considered that, although the intensity and the frequency of epileptic seizures of a patient is evidently related to his response to the therapy administered, sometimes or crises also frequently occur in the form so light that it cannot be easily perceptible by simple observation. This determines the impossibility of detecting the occurrence of crises, and therefore to quantify them the frequency over time, if not through instrumental tests such as electroencephalography (EEG). However, these tests are complex to carry out, especially for pediatric patients, and in any case they do not allow monitoring constant over time but are limited to exam execution time only. In light of the above, it appears It is evident that the identification of biomarkers whose serum levels are correlated with frequency of epileptic seizures and therefore indicative of the response to the administered drug therapy It could be extremely advantageous, significantly improving management of epilepsy and reducing the burden on both patients and for the National Health System. MicroRNAs (miRNAs) are a family of small Non-coding RNAs that influence expression post-transcriptional of genes. The levels of miRNA expression therefore reflects the functions of the cell, given their regulatory function purposes of gene expression. When miRNAs are functionally associated with the process of interest, it is possible to identify the specificity temporospatial of their expression, generating a specific expression pattern for each organ, tissue, or cell type of interest. It is It has also been found that miRNAs are stable in serum, making the determination of levels of widely accessible miRNAs in the blood, quick, painless and convenient. Recently, several target and miRNA expression profiling at the human level genomics have revealed more than a hundred different miRNA in animal models or epileptic patients, providing strong evidence that epilepsy is linked to extensive modifications in the expression of miRNA. While several circulating miRNAs have been linked to epilepsy, further information is needed research to determine whether these miRNAs are accurate in diagnosing or predicting the risk of epilepsy. miR-106b-5p has been reported to be upregulated in patients with epilepsy (An et al. 2016). Furthermore, the cited study demonstrated the maximum diagnostic accuracy and better sensitivity and specificity for prediction of epilepsy when combined with miR-146a. toll-like receptors (TLRs) and mediators of the pathway of downstream cytokines, including kinase interleukin-1 receptor-associated (IRAK1) and receptor-associated factor 6 tumor necrosis factor (TRAF6), are targets of miR-146a-5p, known to be an important regulator of the immune system. Although the miR-146a-5p dysregulation has a reasonable diagnostic potential to differentiate patients epileptics from healthy controls, the most recent investigations recent ones have not detected any dysregulation substantial in patients who had epilepsy resistant and therefore no longer responsive to drugs (Organista-Juárez et al. 2019). Sun et al. (2016) demonstrated that the miR-106b and miR-15a levels are higher at the onset of crises, compared to the levels post-convulsions in the serum of patients with epilepsy. However, in this study the levels of expression of miR-106b and miR-15a are not results associated with age, sex, years subsequent to diagnosis or frequency of crisis. As regards the determination of drug-resistant epilepsy, WO2016139599 describes a method based on the identification of metabolites 3-OH-butyrate, acetoacetate, choline, alanine, glutamate, scyllo-inositol, glucose, lactate and citrate in a plasma sample. However, this method, requiring the determination of all the above metabolites with the aim of building a metabolic profile, it is rather complex and expensive. The research carried out by the present inventors has therefore aimed to overcome the limitations of the known art. With their research, the inventors now have identified two miRNAs that independently interacted proven suitable for use as markers indicative of drug response antiepileptics, particularly in a population pediatric or in any case of subjects of an age not over about 20 years. These miRNAs are the microRNA-106b-5p (hsa-miR-106b-5p) and microRNA 15a-5p (hsa-miR 15a-5p). Both molecules are known per se. The sequence of hsa-miR-106b-5p is available in miRBase under the accession number MIMAT0000680 (sequence: UAAAGUGCUGACAGUGCAGAU, SEQ ID NO:1). The sequence of hsa-miR-15a-5p is available in miRBase under the accession number MIMAT0000068 (sequence: UAGCAGCACAUAAUGGUUUGUG, SEQ ID NO:2). However, to the best of our knowledge of the inventors, until now no one had been described correlation between serum level of hsa-miR- 106b-5p or hsa-miR-15a-5p and the frequency of epileptic seizures and therefore with the evaluation of the response to antiepileptic drugs. It is therefore the object of the present invention an in vitro procedure for the evaluation of epileptic condition of a patient, in which the procedure involves determining, in a sample of the said patient's serum, the level of a microRNA selected between hsa-miR-106b-5p and hsa-miR-15a- 5p, this level being indicative of the frequency of the patient's epileptic seizures. In a preferred embodiment of the procedure, the patient is undergoing therapy antiepileptic drug and therefore the level in serum of the above mentioned microRNA, being correlated with the frequency of his epileptic seizures, he is indicative of the patient's response to therapy antiepileptic drug to which he is subjected. More preferably, in this form of creation of a serum level of the above microRNA lower than a reference value calculated from one or more reference patients responding to therapy is indicative of failure patient response to drug therapy antiepileptic. For the purposes of this description, the expression “failure to respond to therapy” indicates a condition of unresponsiveness to ongoing therapy, or reduced responsiveness to therapy, due to any cause known or unknown. According to a meaning included in the previous one but more specific, the expression “failure to respond to therapy” indicates a condition of drug resistance. In the context of this description, with “drug resistance” means epilepsy that does not responds to a drug therapy conducted in correct manner (for example at least 2 drugs and adequate doses) and for an observation period adequate. Additional features and benefits of the invention are defined in the claims employees. The claims are part integral to this description. According to a preferred embodiment of the process of the invention, the level of hsa-miR-106b-5p or hsa-miR-15a-5p is determined by reverse transcription-qPCR (RT ‐qPCR). The results obtained by the present inventors, described in detail in the experimental section which follows, show that the quantification of the serum levels of hsa-miR-106b-5p or hsa-miR-15a-5p allows to discriminate between patients who have a high frequency of crises (daily, weekly and monthly) compared to patients who have low seizure frequencies (sporadic) or that are free of seizures. These results indicate the possibility of the aforementioned miRNAs for the evaluation, over time, of the epileptic condition of a patient and his actual response (or failure to respond) to the therapies used. Surprisingly, no evidence was found. relationship between the frequency of crises and the level in serum of miR-146a-5p, although in the technique earlier miR-146a-5p had been linked to the drug resistance. It is also important to emphasize that, advantageously, the correlation identified by the inventors between hsa-miR- levels 106b-5p or hsa-miR-15a-5p and seizure frequency is independent of the hemolysis state of the sample blood drawn, hemolysis which in clinical practice It is frequently observed, especially among the children. This means that the above mentioned miRNAs can easily be used as biomarkers useful in the clinical setting by implementing a normal blood collection without the need for precautions details. The research carried out by the present inventors and the The results obtained by them are described in the experimental section that follows, provided purely illustrative and non-limiting title of the scope of the invention as defined in the annexes Experimental section Methods Cohort of patients An observational study was conducted prospective single-center study at the Hospital Bambino Gesù Pediatric Hospital in Rome, starting November 2022 and May 2023. The cohort included 122 patients mainly in pediatric age with diagnosis of epilepsy, followed at the Neurology Unit, Epilepsy and Movement Disorders, and 29 controls healthy people matched for age and sex, followed at the Endocrinology Unit for suspected puberty early, subsequently excluded through diagnostic investigations. The controls were free from epilepsy or other neurological diseases. They have been excluding patients undergoing treatments experimental, affected by oncological diseases or by other progressive conditions, metabolic disorders, inflammatory and infectious, considering that the microRNAs may be influenced by a cause underlying condition other than epilepsy itself. The study was conducted according to the principles ethics for medical research involving human participants declared in the declaration of Helsinki and has been approved by the ethics committee local (protocol n. 2858_OPBG_2022). Informed consent After confirming eligibility through the inclusion and exclusion criteria, were obtained informed consent from participants or both parents of each participant, if minor or interdicted. The study used venous blood samples acquired during the regular follow-up visits of clinical practice both for cases and for controls, integrating essentially research in normal investigations of the blood. Data collection For all participants, data was collected age at the time of enrollment in the study and the sex. For the cases, additional data were collected information, including age at onset of epilepsy, the etiology of epilepsy, including genetic data and MRIs brain (MRI), seizure frequency, type of epilepsy (focal, generalized, combined), the presence of comorbidities such as disabilities intellectual disability (ID) and / or behavioral problems, the electroencephalogram (EEG) data, therapy with ongoing ASM. Seizures and epilepsy. have been classified according to the classification ILAE (Scheffer et al., 2017; Fisher et al., 2017). This simplified approach has made it easier a targeted analysis of the potential differences between the groups, ensuring that the study objectives were achieved with precision and relevance with respect to the research questions posed. Sample collection Blood (3-5 ml) was obtained using BD Vacutainer SST II Advance tubes (Becton Dickinson Italia SpA). The following were followed: standard venipuncture procedures which included using a 21 gauge needle to minimize hemolysis. The samples were allowed to clot for at least 30 minutes at room temperature. Subsequently, within 4 hours of collection, the samples were centrifuged at temperature room temperature (1300-2000 g for 10 minutes). The whey supernatant was removed, aliquoted and stored at -80°C until use. Serum samples are were anonymized and sent to the laboratory Genechron Srl (Rome) to be analyzed for the processing after blood sampling is performed at the OPBG during the patients' periodicity. Frozen serum aliquots were thawed on ice before extraction of RNA. miRNA extraction Total RNA, including small RNAs, was extracted from 200 µL of thawed serum using the miRNeasy Serum / Plasma Advanced kit (Qiagen, Germantown, MD; catalog number 217204), according to the manufacturer's instructions. For the normalization, an oligonucleotide control not human Caenorhabditis elegans cel-miR-39-3p is was added to each serum sample in a fixed quantity (1.5 10 copies) first of RNA extraction. Total RNA was eluted in 20 µL of nuclease-free water and stored at -80°C until further use. cDNA synthesis cDNA was prepared in 20 μL reactions using the Qiagen miRCURY LNA RT Kit (3393404; Qiagen) according to the manufacturer's instructions and containing 4 μL of RNA. The reaction conditions for each 20 μL sample were as follows: reverse transcription phase, 42°C, 60 minutes; inactivation of the reaction at 95 °C, 5 min, maintenance at 4°C, using a thermal cycler Thermo Scientific 2720. The cDNA (20 μL) was aliquoted to avoid repeated cycles of Freezing and thawing and stored at -20°C until it was needed for qPCR. Quantification of miRNAs Reverse transcription-qPCR (RT-qPCR) has been performed using the miRCURY LNA SYBR Green kit PCR Kit (339347; Qiagen) and 6 miRCURY LNA assays miRNA PCR (Table A). One replicate for each sample was combined with each primer in triplicate on each 384-well plate. A 2-cycle qPCR protocol was conducted phases (95 °C for 2 minutes followed by 40 cycles at 95 °C for 10 seconds and 56 °C for 60 seconds) using a Bio‐Rad CFX384 thermal cycler, Real-time C1000 Touch (Bio-Rad laboratories, ltd.). RT-qPCR involved no-template controls (NTC) and no-reverse transcriptase controls (NRTC) performed with all 6 primers. Serum miRNAs have been normalized and the −∆∆Ct method Ct =2 . Table A. Description of the 6 miRCURY LNA PCR assays miRNAs used for reverse transcription-qPCR miRNA primer assays Function of miRNAs A non-human miRNA (Caenorhabditis elegans) and exogenous used for the standardization and evaluation cel-miR-39-3p miRCURY LNA of RNA synthesis efficiency and miRNA PCR Assay - 339306 cDNA hsa-miR-106b-5p miRCURY miRNA analyzed expressed in a LNA miRNA PCR Assay - stable hsa-miR-146a-5p miRCURY miRNA analyzed expressed in a LNA miRNA PCR Assay - stable hsa-miR-15a-5p miRCURY miRNA analyzed expressed in a LNA miRNA PCR Assay - stable stably expressed miRNA used hsa-miR-451a miRCURY LNA for normalization and detection miRNA PCR Assay - 339306 of hemolysis hsa-miR-23a-3p miRCURY stably expressed miRNA used LNA miRNA PCR Assay - for normalization and detection 339306 of hemolysis Quality control and standardization Serum hemolysis was analyzed with miR- 23a-3p and miR-451a. MiR-23a-3p is stably present in serum / plasma and is not affected from hemolysis, while miR-451a is expressed in red blood cells. Samples with a delta Ct (miR-23a- miR-451) greater than 7 were considered affected by hemolysis. miR-23a-3p, miR-451a and cel-miR- 39-3p spike-ins were used for the data normalization. Data analysis and statistical analysis The mean Ct values ​​and the variance of the triplicates performed for each sample were calculated for the 6 miRNA primers. They were samples affected by hemolysis were identified (n=42). After normalization, the Ct 2−∆∆Ct method to evaluate the “fold change” between cases and controls. The statistical methodology was designed to study the distribution and expression differential of the four miRNAs of interest in a cohort divided between epileptic patients and subjects of control. This included a thorough examination of miRNA levels in relation to health status hemolysis of samples (hemolyzed vs. non-hemolyzed) hemolyzed). Data normality and descriptive analysis The initial steps involved the evaluation of the normality of the distribution of data for each of the 3 miRNAs tested (miR-106b-5p, miR-146a-5p, miR-15a-5p) using the assay Shapiro-Wilk. They were then calculated descriptive statistics to provide a basic understanding of data distribution among all groups. Differential analysis of miRNAs To identify differences in levels of miRNA between epileptic patients and controls, it was the non-parametric Mann-Whitney test was used due to the non-normal distribution of the data. This test allowed us to compare the values median miRNAs between the two groups, with a statistical significance established at p<0.05 and a 95% confidence interval (CI). Comparison of hemolysis status The analysis was extended to the evaluation of the potential variations in miRNA expression correlated to the hemolysis status of the samples. Following a similar approach, the Shapiro-Wilk test to assess the normality of data, followed by the Mann-Whitney test for compare miRNA levels between samples hemolyzed and non-hemolyzed, according to the same significance criteria. Correlation with correlated variables to epilepsy The study also aimed to explore the correlations between miRNA expression and different epilepsy-related variables, including sex, type of epilepsy, etiology, age at the onset of crises, the frequency of seizures, type of epilepsy, ASMs, ID and behavioral comorbidities. For this analysis, descriptive statistics were generated using contingency tables, focusing exclusively on the group of cases. Based on the normality test results, the differences between miRNA levels and related factors epilepsy were assessed using the Mann-Whitney and Kruskal-Wallis tests, such as appropriate for categorical variables in question. The selection of these tests does not parametric is due to the non-normal distribution of miRNA data, with significance levels set at p-value <0.05 and a 95% CI. Significantly, to further investigate the differences observed, analyses were conducted post-hoc following Kruskal-Wallis tests. These analyses were essential for identify specific group comparisons that drive the significant differences observed, thus providing a deeper understanding of the relationships between miRNA levels and specific factors related to epilepsy. Sub-cohort analysis In a more detailed analysis, it was examined a sub-cohort composed only of epileptic patients and non-hemolyzed samples, for discern any statistical differences significant in miRNA levels when consider factors related to epilepsy. This sub-cohort analysis was fundamental to understand the specific impact of epilepsy, regardless of hemolysis, on the expression of miRNAs. Results Study population The study enrolled 151 participants, classified in 122 cases of epilepsy (56% males) and 29 healthy controls (31% males). It was achieved the age correspondence between the groups, with an age mean of 8.3 years (range: 0.6-19.5 years) for the epilepsy group and 8.4 years (range: 2-15.3 years) for the controls. The results of the characteristics of the cohort are represented in Table 1. The average age of onset of epilepsy in patients was 2.5 years old (range: 0-14.6 years), with a mean disease duration of 5.8 years (range: 0.1-17.9 years), reflecting the chronic nature of the condition in the cohort. Epileptic etiologies were predominantly genetic (49.2%, n=60), followed by those structural (28.7%, n=35) and unknown (22.1%, n=27). Clinical classification showed the most diagnoses of focal epilepsy (64%, n=78), with a lower number of cases of generalized epilepsy (34%, n=42) and an incidence minimum of combined forms (1.6%, n=2). The frequency of the seizures varied according to significant: 34.4% (n=42) of patients had sporadic seizures and 24.6% (n=30) were free from seizures (SF), while others have reported monthly episodes (23%, n=28), daily (13.9%, n=17) or weekly (41%, n=5). The cohort was divided into two groups: the "sporadic / SF" group, which includes patients who were SF or had seizures sporadic, and the "other" group, which includes patients who experience seizures frequently monthly, weekly or daily. As far as regarding treatment, almost half of the patients (48.4%, n=59) were on polytherapy with ASM, 45.9% (n=56) received monotherapy and a small minority (5.7%, n=7) were not on ASM therapy. Valproic acid was the most frequently prescribed drug administered (n=48), followed by carbamazepine (n=39), levetiracetam (n=26) and clobazam (n=26). EEG analyses indicated that more than half of patients (54.1%, n=66) had abnormalities epileptic, while the rest showed anomalies focal (37.7%, n=46) or generalized (8.2%, n=10). Brain MRI was found to be normal in 41.8% (n=51) of cases, showed structural malformations underlying epilepsy in 32% (n=39), showed nonspecific abnormalities in 19.7% (n=24) and was not performed in 6.5% (n=8) of cases diagnosed a self-limiting epilepsy. Cognitive assessments revealed that the 45.1% (n=55) of patients showed a normal intellectual functioning. The remaining patients they were classified as having intellectual disabilities mild (20.5%, n=25), moderate (13.9%, n=17) or severe (20.5%, n=25). Psychiatric evaluation revealed that the 23.7% (n = 29) had behavioral disorders (such as oppositional defiant disorder, attention deficit / hyperactivity disorder, behavior aggressive), 3.3% spectrum disorder autistic disorder (ASD) (n = 4) and 4.1% of mood (n = 5). Demographic and clinical data are reported in Table 1. Table 1. Demographic and clinical data Case Control Variables Male, n (%) 68 (56%) 9 (31%) Age at study 8.3 [0.6-19.5] 8.4 [2-15.3] (years), average [interval] Age at onset 2.5 [0-14.6] of epilepsy (years), average [range] Duration of epilepsy 5.8 [0.1-17.9] (years), average [interval] Etiology Genetic 60 (49.2%) Structural 35 (28.7%) Unknown 27 (22.1%) Type of epilepsy Focal 78 (64%) Generalized 42 (34%) Combined 2 (1.6%) Frequency of convulsions 50 (41%) Other (daily, 72 (59%) weekly, monthly) Sporadic / SF Treatment Polytherapy 59 (48.4%) Monotherapy 56 (45.9%) None 7 (5.7%) EEG results Normal 66 (54.1%) Focal anomalies 46 (37.7%) Anomalies 10 (8.2%) generalized Results of the resonance 51 (41.8%) magnetic 39 (32%) Normal 31 (26.2%) Malformations structural Other Comorbidities psychiatric 29 (23.7%) Disorders of 4 (3.3%) behavior 5 (4.1%) ASD 84 (68.9%) Mood disorders Nobody Disability intellectual 25 (20.5%) Mild 17 (13.9%) Moderate 25 (20.5%) Strong 55 (45.1%) Nobody miRNA expression patterns The study included 151 samples, 122 from patients with epilepsy (80.8%) and 29 controls (19.2%). The hemolyzed samples represented the 27.8% (n=42) of the total and non-hemolyzed samples were 72.2% (n=109) of the cohort. In each of the following tables the values of the mean ± SD correspond to the mean value of the natural logarithm of the RQ values ​​for each miRNA, where RQ corresponds to the Relative Quantification = 2^(-delta_Ct) while delta_Ct = Ct_mean_miRNA - Ct_mean_ cel-miR-39-3p. The values reported, therefore, quantify in mode logarithmic expression ratios. For this reason reason, with negative values ​​in absolute value higher corresponds to lower expressions of the miRNA (under-expression). Table 2 describes the miRNA analysis in the entire cohort and reveals a difference statistically significant in the mean values ​​of the miRNA between cases and controls. In particular, miR-106b-5p, miR-146a-5p, miR-15a-5p all have demonstrated statistically average values significant higher in cases compared to controls, with p-values ​​of 0.001, respectively, 0.001, 0.014 and 0.015, as determined by the Mann-Whitney (MW). This model suggests a potential role of these miRNAs in epilepsy. In the non-hemolyzed samples, the differences in miRNA levels remained statistically significant between cases and controls (p = 0.002, p = 0.000, p = 0.005 and p = 0.0025) as described in Table 2, strengthening the potential diagnostic relevance of the profile of the miRNAs in epilepsy. In particular, the 3 miRNAs were higher in cases than in controls. Table 2. miRNA analysis in case and group of control miRNA in the case and in the Case Control p-value control group Hemolyzed samples + 122 (80.8%) 29 (19.2%) non-hemolyzed, n (%) miR-106b-5p, media -2.942 ±0.238 -2.751 ±0.261 .001* ±SD miR-146a-5p, media -3.593 ±0.196 -3.389 ±0.354 .001* ±SD miR-15a-5p, media -2.651 ±0.248 -2.505 ±0.285 .015* ±SD Samples not 95 (87.2%) 14 (12.8%) hemolyzed, n (%) miR-106b-5p, media -2.997 ±0.202 -2.822 ±0.153 .002* ±SD miR-146a-5p, media -3.581 ±0.179 -3.225 ±0.387 .000* ±SD miR-15a-5p, media -2.713 ±0.201 -2.555 ±0.223 .002* ±SD Further distinctions were observed between hemolyzed and non-hemolyzed samples of the group cases, as reported in Table 3. In In particular, the levels of miR-106b-5p and miR-15a-5p differed significantly between these two groups (p = 0.000), with lower levels in hemolyzed samples using the statistical test Mann-Whitney syndrome. No anomalies were found. significant differences for miR-146a-5p (p=.062). Table 3. miRNA analysis in the hemolyzed group and not hemolyzed miRNA in the Non-Samples group Hemolyzed samples p-value of hemolyzed cases Patients, n (%) 27 (22%) 95 (78%) miR-106b-5p, media -2.725 ±0.281 -2.975 ±0.204 .000* ±SD miR-146a-5p, media -3.604 ±0.246 -3.535 ±0.246 .062 ±SD miR-15a-5p, media -2.441 ±0.295 -2.693 ±0.209 .000* ±SD Furthermore, the study investigated the relationship between miRNA levels and various related variables to epilepsy such as sex, type of epilepsy, the etiology, the frequency of the seizures, the ASMs, the behavioral abnormalities and ID. They have not been found significant associations between the levels of miRNAs and sex, ASMs, anomalies behavioral or ID with p-value >0.05. However, a variation was observed significant in miRNA levels based on seizure frequencies (p = 0.017 and p = 0.004). Post hoc analysis showed that the levels of miR-106b-5p and miR-15a-5p showed variations statistically significant with frequency of crises (p = 0.017 and p = 0.004). The value median of both miR-106b-5p and miR-15a-5p is lowest in the "other" group (daily / weekly / monthly) compared to SF and sporadic group. Table 4. Relationship between miRNA levels and epilepsy-related variables MiRNA Variables Mean ±SD p-value Frequency of seizures miR- Other -2.883 ±0.251 .017* 106b-5p Sporadic / SF -2.984 ±0.221 miR- Other -3.596 ±0.209 .614 146a-5p Sporadic / SF -3.592 ±0.188 miR-15a- Other -2.578 ±0.273 .004* 5p Sporadic / SF -2.701 ±0.218 After further analysis of a sub-cohort comprising only cases and only non-samples hemolyzed, no differences were observed statistically significant between miRNA values and all the epilepsy factors considered (p>0.05). This analysis highlights the complexity of miRNA expression patterns and their interactions with clinical features of epilepsy. The results highlight the value of miRNAs as biomarkers in patients with epilepsy. In particular, miR-106b-5p and miR-15a-5p show the ability to distinguish between patients with different convulsive frequencies, which indicates their relevance in identifying individuals who do not respond to medications or are at risk of developing drug resistance. It is important to emphasize that the stability of miRNAs in serum provides a non-invasive and accessible method to evaluate them, enabling routine clinical application. BIBLIOGRAPHY An N, Zhao W, Liu Y, Yang X, Chen P Elevated serum miR-106b and miR-146a in patients with focal and generalized epilepsy. Epilepsy Res 127:311–316 (2016). D. Organista-Ju ́arez, A. Jim ́enez, L. Rocha, M. Alonso-Vanegas, R. Guevara- Guzma ́n, Differential expression of miR-34a, 451, 1260, 1275 and 1298 in the neocortex of patients with mesial temporal lobe epilepsy, Epilepsy Res. 157 (2019). Sun J, Cheng W, Liu L, et al Identification of Serum miRNAs Differentially Expressed in Human Epilepsy at Seizure Onset and Post-Seizure. Mol Med Rep. (2016);14(6):5318. Scheffer, I. E. et al. ILAE classification of the epilepsies: Position paper of the ILAE Commission for Classification and Terminology. Epilepsia 58, (2017). Fisher, R. S. et al. The ILAE classification of seizures. Stanford Epilepsy Centre 58, (2017).

Claims

1. In vitro procedure for the evaluation of the epileptic condition of a patient, wherein the procedure comprises determining, in a serum sample from said patient, the level of a microRNA chosen from hsa-miR-106b-5p and hsa-miR-15a5p, said level being indicative of the frequency of the patient's epileptic seizures.

2. In vitro method according to claim 1, wherein the patient is undergoing antiepileptic drug therapy and wherein said serum level of microRNA is indicative of the patient's response to antiepileptic drug therapy.

3. In vitro method according to claim 2, wherein a serum level of microRNA lower than a reference value calculated from one or more reference patients responding to antiepileptic drug therapy is indicative of a patient's failure to respond to antiepileptic drug therapy.

4. In vitro method according to claim 3, wherein the failure to respond is indicative of a drug-resistant condition.

5. In vitro method according to any one of claims 1 to 4, wherein said microRNA is hsa-miR-106b-5p.

6. In vitro method according to claim 5, wherein the serum level of hsa-miR-106b-5p is determined by reverse transcription-qPCR.

7. In vitro method according to any of claims 1 to 4, wherein said microRNA is hsa-miR-15a-5p.

8. In vitro method according to claim 7, wherein the serum level of hsa-miR-15a-5p is determined by reverse transcription-qPCR.