FERMENTATIVE PRODUCTION OF ISOPRENOIDS.
Patent Information
- Application Number
- IT502026000034567
- Authority / Receiving Office
- IT · IT
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2020-10-30
- Filing Date
- 2021-11-01
- Publication Date
- 2026-07-15
- Estimated Expiration
- 2041-11-01
AI Technical Summary
Current chemical production methods for isoprenoids with less than C40 carbon backbone face issues such as high-energy consumption, complex purification steps, and undesirable by-products, with biological systems being industrially intractable and producing compounds at low levels, and two-phase culture systems using existing solvents suffer from solvent loss, toxicity, and impurity profiles that are not satisfactory.
A two-phase culture system using solvents like Isoparaffins and n-alkanes with minimal loss and disappearance during fermentation, such as Isopar M, Isopar N, and Isopar L, is employed to enhance the fermentative production of isoprenoids, reducing solvent consumption and evaporation by at least 50% compared to n-dodecane, and minimizing by-product formation by at least 10%.
This approach leads to increased productivity and improved purity of isoprenoids by maintaining solvent stability and reducing by-products, achieving a translucent color profile for products like retinyl acetate, thus enhancing the efficiency and quality of isoprenoid production.
Description
[0001] The present invention is related to fermentative production of isoprenoids, comprising cultivation of a suitable host cell, such as fungal host cell, particularly oleaginous host cell, in an improved two-phase culture system.
[0002] Current chemical production methods for isoprenoids with less than C40 carbon backbone, such as apocarotenoids, including but not limited to vitamins, have some undesirable characteristics such as e.g. high-energy consumption, complicated purification steps and / or undesirable by-products. Therefore, over the past decades, other approaches to manufacture these compounds, comprising microbial conversion steps have been investigated, which would lead to more economical as well as ecological production.
[0003] Such processes have been described for the production of retinoids including retinal, retinol and / or retinyl acetate using recombinant host cells selected from fungi or E. coli (see e.g. WO2019 / 05800 or Jang et al., Biotechnology and Bioengineering, vol. 112, no. 8, pp. 1604-1612, 2015).
[0004] In general, the biological systems that produce the herein defined isoprenoids are industrially intractable and / or produce the compounds at such low levels that commercial scale isolation is not practical. The most limiting factors include instability of intermediates in such biological systems and / or the relatively high production of by-products. As an example, formation of fatty acid retinyl esters (FAREs) in fermentative production of vitamin A, particularly using oleaginous host cells grown on triglycerides, is an important limiting factor in the process towards bio-based vitamin A / retinol.
[0005] In order to circumvent some of these issues in fermentative production of isoprenoids with less than 40 carbons as backbone, so-called two-phase cultivation systems have been developed, wherein the fermentation products are collected outside the cell in the so-called second phase comprising lipophilic solvents such as e.g. Drakeol ®< , silicone oil or n-dodecane (see e.g. Jang et al., Biotechnology Letters, vol. 36, no.3, pp.497-505, 2014; US2014 / 170720; US2016 / 130628; Sun et al., ACS Synthetic Biology, vol. 8, no. 9, pp. 2131-2140, 2019; Newman et al., Biotechnology and Bioengineering, vol. 95, pp. 684-981, 2006; Frohwitter et al., Journal of Biotechnology, vol. 191, pp. 205-213; Kang et al., Biotechnology Letters, vol. 36, no. 10, pp. 2069-2077; WO2020 / 141168 or Jang et al., Microbial Cell Factories 10:59, 2011). Various strategies have been reported for optimizing microbial production processes such as conversion of isoprenoids (see e.g. Schewe et al., Advances in Biochemical Engineering, Biotechnology, vol. 148, pp. 251-286, 2015) or bioconversion of fatty acids into methyl ketones using water-organic solvent (Creuly et al., Enzyme and Microbial Technology, vol. 14, no.8, pp. 669-678, 1992). However, the yield as well as impurity profile with the known solvents is not satisfactory.
[0006] Furthermore, toxicity issues have been reported in the bioproduction of jet fuel mixtures via two-phase extractive fermentation using Saccharomyces cerevisiae as host (Brennan et al., Biotechnology and Bioengineering, vol. 109, no. 10, pp. 2513-2522, 2012).
[0007] Thus, it is an ongoing task to look for more efficient production processes using the two-phase culture system, in particular to look for solvents with improved properties.
[0008] Surprisingly, we now identified an improved process for fermentative production of isoprenoids with less than 40 carbons as backbone, including apocarotenoids, using a two-phase culture system, wherein second phase solvents collecting the fermentation products are used that are not lost / disappearing during the fermentation and thus can lead to increased productivity and / or improved purity of the fermentation products.
[0009] Particularly, the present invention is directed to a two-phase culture system including an in vitro extraction system for fermentative production of isoprenoids with less than 40 carbons as backbone ("<C40-isoprenoids") including apocarotenoids, such as e.g. retinoids, sesquiterpenes, diterpenes or ionones, including but not limited to alpha-farnesene, abienol, alpha- and beta-ionone, wherein a suitable host cell, particularly fungal host cell, such as e.g. an oleaginous yeast, e.g. Yarrowia or Saccharomyces, is grown on a suitable carbon source and in the presence of a lipophilic solvent that is not disappearing during the fermentation.
[0010] A suitable lipophilic solvent, i.e. second phase solvent, with minimal loss and / or disappearance during the fermentation as defined herein and to be used for the present invention is a solvent comprising isoparaffins, such as e.g. mixtures of isoalkanes with alkanes, cycloparaffin, , cycloalkanes, or dodecanes. The solvents might be natural or synthetic ones. Examples of commercially available useful solvents might be selected from Total, e.g. Isane ®< solvents, Shell, e.g. ShellSolTD or ShellSolT, Exxon Mobile, e.g. Isopar ™< fluids, particularly such as e.g. Isopar M, Isopar N, Isopar H, Isopar K, Isopar L, or mixtures thereof or mixtures with iso-dodecane isomers, as e.g. commercially available under the tradename AC365770010 (Acros Organics). Preferably, the second phase solvent is selected from isoparaffins comprising, e.g. Isopar M, Isopar N, Isopar H, Isopar K, Isopar L, and mixtures thereof, more preferably comprising Isopar N, Isopar L and / or Isopar M.
[0011] Suitable lipophilic solvents, i.e. second phase solvents, with minimal loss and / or disappearance during the fermentation as defined herein and to be used for the present invention might be selected from lipophilic solvents comprising isoparaffins mixed with n-alkanes, isoalkanes, hydrocarbons. The solvents might be natural or synthetic ones. Examples of commercially available useful solvents might be selected from Exxon Mobil, as e.g. commercially available under the tradenames Exxsol D60, D80, D95 or D110.
[0012] It is understood that useful solvents include the above listed commercially available solvents as well as the respective solvents with the same or equivalent properties but known / available from other suppliers.
[0013] As used herein, a solvent has equivalent or identical properties as Isopar fluids, including Isopar M, Isopar H, Isopar K, Isopar L, and is defined as branched-chain isomers, preferably terminally methylated form of a straight-chain alkane, which contain six to twenty six carbons, perhaps chemically coupled from smaller alkane precursors in strong acid, hydrogenated with H 2 and catalyst, such as nickel or platinum, to remove unsaturation and trace aromatics. These are known in current industrial suppliers as Isopar (Exxon Mobil Chemical), Soltrol (Chevron Phillips Chemical Company), Shellsol OMS (Royal Dutch Shell), isooctane and iso-dodecane. Specifically, the use of Isopar M is preferred. The use of these in consumer products is outlined in a review by Johnson et al., Int J Toxicol. 2012 Nov-Dec;31(6 Suppl):269S-95S.
[0014] As used herein, a solvent has equivalent or identical properties as Exxsol D60, D80, D95, D110. These Exxsol Ds are narrow boiling distillation cuts from cracked hydrocarbons that have been reduced by catalytic hydrogenation to remove aromatics and unsaturation.
[0015] A suitable <C40-isoprenoid that is produced in the two-phase culture system according to the present invention might be selected from isoprenoids, including but not limited to retinoids, e.g. retinol, retinal, retinyl acetate, including 4-keto- and 3-hydroxy-forms, alpha-ionone, beta-ionone, including dihydroxy forms, santalol, valencene, nootkatone, patchoulol, alpha-farnesene, abienol, steviol, i.e. fermentation products, typically 15 to 30 carbons in length, that can pass through the cell wall of the host cell to be collected outside the cell in the second phase solvent as defined herein.
[0016] As used herein, the term "not disappearing" in connection with the second phase solvents as defined herein means that the same amount of solvent present at the start of the fermentation is still detectable at the end of the fermentation process. A loss or disappearance of solvent might be due to e.g. consumption by the host cell and / or evaporation during the fermentation. The terms "loss" or "disappearance" are used interchangeably herein. Such solvent as used for the process of the present invention is also called a "stable" solvent. Thus, a stable solvent according to the present invention means a loss or disappearance of the solvent during the fermentation in the range of about 20% or less, e.g. in the range of about 20, 15, 10, 8, 5, 3, 2, 1% or even no loss or disappearance of the solvent during the fermentation.
[0017] In one embodiment of the present invention, the two-phase culture system as defined herein, including the use of the solvents as defined herein, results in a disappearance of solvents of about 20% or less, i.e. wherein at least about 80%, such as e.g. 85, 90, 92, 95, 97, 98, 99, 100% of solvent present at the start of the fermentation is still present at the end of the fermentation process. Particularly useful solvents that are still present at the end of the fermentation might be selected from solvents identical or equivalent to Isopar M, L, H, K or Exxsol D110.
[0018] Thus, the present invention is directed to fermentative production of <C40-isoprenoids including but not limited to apocarotenoids, sesquiterpenes, diterpenes or ionones, comprising cultivating a suitable host cell as defined herein under suitable culture conditions in a two-phase culture system, in the presence of a solvent as defined herein with a loss of solvent of about 20% or less during the fermentation.
[0019] As used herein, the term "solvent comprising isoparaffins" or "solvent comprising mixtures of alkanes" means that the percentage of isoparaffins and / or mixtures of alkanes is at least in the range of about 90%, preferably in the range of about 95, 98, 99, or 100% (v / v), including the solvents described herein, particularly solvents known under the tradename Isopar M, Isopar N, Isopar H, Isopar K, Isopar L, Exxsol D60, D80, D95, D110 or solvents with equivalent or identical properties but from other suppliers. Such range might be also applicable to solvents comprising other lipophilic compounds, such as e.g. a solvent comprising n-dodecane, silicone oil, hexadecane or Drakeol ®< . The use of a solvent with a percentage of isoparaffins and / or mixtures of alkanes as defined herein is used interchangeably with the term "in the presence of a lipophilic solvent".
[0020] In one embodiment, the present invention is related to a process for reducing or abolishing the consumption of the second phase solvent, i.e. consumption of the second phase solvent by the host cell, as compared to consumption using n-dodecane as second phase. Particularly, the consumption of the second phase might be reduced by at least about 50%, such as e.g. 60, 65, 70, 75, 80, 85, 90, 95, 97, 99 or 100% compared to consumption using n-dodecane as second phase solvent via a process using a lipophilic solvent as described herein. Preferably, the lipophilic solvent is selected from solvents known under the tradename Isopar M, Isopar N, Isopar H, Isopar K, Isopar L, Exxsol D110 or solvents with equivalent or identical properties but from other suppliers.
[0021] In a further embodiment, the present invention is related to a two-phase culture system for fermentative production of <C40-isoprenoids as defined herein in the presence of a lipophilic solvent as described herein, wherein the evaporation of the solvent is reduced or abolished, particularly reduced by at least about 50%, such as e.g. 60, 65, 70, 75, 80, 85, 90, 95, 97, 99 or 100%. Preferably, the lipophilic solvent is selected from solvents known under the tradename Isopar M, Isopar N, Isopar H, Isopar K, Isopar L, Exxsol D60, Exxsol D110, more preferably Isopar L, Isopar M, Exxsol D110, or solvents with equivalent or identical properties but from other suppliers.
[0022] Thus, a stable solvent according to the present invention means that the evaporation and / or consumption is reduced by at least about 50% compared to known solvents such as e.g. n-dodecane, silicone oil or hexadecane. Such solvents with increased evaporations and / or consumption during the fermentation in the range of about more than 50% compared to the stable solvents as defined herein are defined as "non-stable solvents". Examples of such non-stable solvents are n-dodecane, silicone oil or hexadecane.
[0023] Evaporation of a solvent used in a two-phase culture system, including the measurement of mass of fermentation over time, and measurement of second phase volume at the beginning and end of the fermentation can be measured by mass balancing using LCMS. Further the measurement of incorporation of second phase into the product, such as e.g. retinyl acetate, indicates consumption. Measurement of isotopic 13< C ratios in product weighted towards the ratio in petrol vs the corn derived ethanol feed can be done by 13< C NMR or mass spectroscopy. Consumption of the solvent, such as e.g. isoparaffins, according to the present invention by the host organism, such as e.g. Yarrowia, is detection of oxygen consumption (measured by a dissolved oxygen probe) in the presence of the second phase in the absence of another carbon source, wherein consumption of oxygen above the background being the same as with no solvent correlates with consumption of the solvent. Finally, measurement / mass spec analysis of off-gas or condensation in a cold trap from fermentation can be used to measure evaporation.
[0024] In one embodiment the present invention features a fermentative process for production of <C40-isoprenoids as defined herein using a two-phase culture system, wherein the formation of by-products could be reduced, particularly reduced by at least about 10% in comparison to the use of a non-stable solvent, such as e.g. in the range of about 15, 20, 25, 30, 35, 40, 45, 50% or more. Particularly, such process for reducing the formation of by-products as defined herein is performed in the presence of a lipophilic solvent as defined herein, preferably wherein the solvent is selected from solvents known under the tradename Isopar M, Isopar N, Isopar L, Exxsol D60, Exxsol D95, Exxsol D110, more preferably Isopar M, Exxsol D60, Exxsol D95, Exxsol D110, or solvents with equivalent or identical properties but from other suppliers. Compared to the use of n-dodecane or Drakeol ®< , the reduction might be in the range of a least about 25%.
[0025] As used herein, the terms "by-products", "side-products" or "undesired fermentation products" in connection with fermentative production of <C40-isoprenoids according to the present invention are used interchangeably herein and refer to undesired co-production of competing products, i.e. impurities, which have to be separated from the desired fermentation products and / or limit the yield and / or productivity of the desired fermentation products. Furthermore, it relates to undesired conversion processes, i.e. wherein the conversion of an intermediate into the desired fermentation product is competing with undesired conversion of the intermediate into a side-product or undesired by-product. The terms <C-40 isoprenoids and (desired) fermentation products are used interchangeably herein.
[0026] With regards to production of retinoids, particularly production of retinyl acetate, as an example of an apocarotenoid which is included in the present invention, undesired side-products include but are not limited to formation of retinal, retinol, fatty acid retinyl esters (FAREs) or dihydro-forms such as e.g. dihydro-retinol or dihydro-retinyl acetate, particularly FAREs, which should be reduced or abolished.
[0027] With regards to production of ionones, such as e.g. alpha-ionone or beta-ionone, as a further example of an apocarotenoid which is included in the present invention, undesired side-products include but are not limited to formation of rosafluene, phytoene, ergosterol, dihydro-beta-ionone, and other reduced forms.
[0028] In a particular aspect of the present invention, the two-phase culture system as described herein is carried out in the presence of a lipophilic solvent comprising isoparaffins, such as e.g. selected from solvents that are commercially available as Isopar ™< fluids, particular selected from Isopar M, Isopar N, Isopar K, Isopar L, Isopar H or solvents with equivalent or identical properties but from other suppliers, wherein the color of the desired fermentation product, particularly apocarotenoids such as e.g. retinoids, more particularly retinyl acetate, that accumulates in said solvent is translucent, compared to dark / black (opaque) color such as e.g. obtained in the presence of a second phase solvent such as e.g. Drakeol ®< .
[0029] As known in the art, color can be precisely described in several different coordinate systems, such as XYZ, RGB, CYMK, or L*a*b*, including the Pantone ®< Matching System (PMS). In these systems, different values are assigned to variables like L*, a*, and b* as known in the art. The skilled person knows which instrument to use depending on the different color measurement systems and how to measure the color of the fermentation products present in the second phase solvents as described herein.
[0030] As used herein, the term "translucent" can be defined as a transmittance above 10%, where transmittance is the amount of light going through the solvent, i.e. defined as light exiting from solvent / light entering solvent, with 1 cm distance through the solvent. It can also be defined as the ability to read a newspaper through about 5 cm of the solvent.
[0031] With regards to the translucent color profile as indicated particularly in Table 9, it refers to light yellowish color of the fermentation product, particularly retinoids, more particularly retinyl acetate, present in the second phase solvent as defined herein. Thus, the translucent color of the retinoids present in second phase solvents such as e.g. Isopar M, H, K, L corresponds to a color according to PMS 120 - PMS 129 as defined by the Pantone ®< Matching System (PMS) color scheme. The terms "translucent", "transparent", "light yellow" or "light yellowish" are used interchangeably herein.
[0032] As used herein, the term "dark / black" is opaque and can be defined as transmittance less than 10%, according to the definition given above.
[0033] With regards to the dark / black color profile as indicated particularly in Table 9, it refers to the dark (opaque) color of the fermentation product, particularly retinoids, more particularly retinyl acetate, present in the second phase solvent as defined herein. Thus, the dark color of the retinoids present in second phase solvents such as e.g. Exxsols D60, D80, D95, D110 or Drakeol 5 corresponds to a color according to PMS 182 - PMS 209 as defined by the Pantone ®< Matching System (PMS) color scheme.
[0034] Production of <C40-isoprenoids as described above using the two-phase culture system as defined herein in the presence of a lipophilic solvent as defined herein includes cultivation of a suitable host cell, particularly fungal host cell, such as e.g. an oleaginous yeast, e.g. Yarrowia or Saccharomyces, said host cell being grown on a suitable carbon source.
[0035] Suitable host cells to be used for the present invention might be selected from any host cell capable of <C40-isoprenoid production including apocarotenoid, sesquiterpene, diterpene or ionone production, such as e.g. fungal host cell, more particularly an oleaginous host cell, such as e.g. Yarrowia, Rhodosporidium, Lipomyces, Saccharomyces or Rhodotorula, preferably Yarrowia or Saccharomyces, more preferably Yarrowia lipolytica or Saccharomyces cerevisiae. Depending on the fermentation product, the skilled person knows which host cell to select including the respective culture conditions.
[0036] Suitable carbon sources to be used for the present invention might be selected from linear alkanes, free fatty acids, including triglycerides, particularly vegetable oil, such as e.g. selected from the group consisting of oil originated from corn, soy, olive, sunflower, canola, cottonseed, rapeseed, sesame, safflower, grapeseed or mixtures thereof, including the respective free fatty acids, such as e.g. oleic acid, palmitic acid or linoleic acid. Suitable carbon sources might furthermore be selected from ethanol, glycerol or glucose and mixtures of one or more of the above-listed carbon sources.
[0037] In one embodiment, the present invention is directed to a process for the production of retinoids, in particular production of retinyl acetate, i.e. a two-phase culture system in the presence of a lipophilic solvent as defined herein, wherein a retinyl acetate producing host cell, preferably oleaginous yeast cell such as e.g. Yarrowia, is cultivated under suitable culture conditions, wherein the lipophilic solvent, preferably selected from solvents that are commercially available as Isopar ™< fluids, particular selected from Isopar M, Isopar N, Isopar K, Isopar L, Isopar H or solvents with equivalent or identical properties but from other suppliers, is not consumed or evaporated during the fermentation process, and / or wherein the formation of FAREs as by-product is reduced or abolished, particularly reduced to at least about 50%, such as e.g. at least about 40, 30, 20, 15, 10, 5, 3, 2, 1, or 0.5% based on total retinoids, and / or wherein the color of the retinyl acetate is translucent and not dark in comparison to e.g. the use of Drakeol ®< as second phase solvent.
[0038] Suitable retinoid-producing host cells, particularly retinyl acetate-producing host cells to be used for the present invention might be selected fungal host cells including oleaginous yeast cells, such as e.g. Rhodosporidium, Lipomyces, Saccharomyces or Yarrowia, preferably Yarrowia, more preferably Yarrowia lipolytica, particularly expressing genes coding for heterologous enzymes EC class [EC 2.3.1.84] catalyzing the enzymatic conversion of retinol into retinyl acetate and / or comprising one or more genetic modifications in the endogenous lipase activity, such as i.e. reduced or abolished activity of endogenous lipases involved in conversion of retinol into fatty acid retinyl esters (FAREs), one major undesired side-product in fermentative retinoid production. Suitable strains expressing such ATFs are described in e.g. WO2019058001 or WO2020141168.
[0039] Preferably, the retinyl acetate-producing host cell to be used in the present invention is expressing a heterologous ATF, particularly fungal ATF, comprising a highly conserved partial amino acid sequence of at least 7 amino acid residues selected from [NDEHCS]-H-x(3)-D-[GA] (motifs are in Prosite syntax, as defined in https: / / prosite.expasy.org / scanprosite / scanprosite_doc.html), wherein "x" denotes an arbitrary amino acid and with the central histidine being part of the enzyme's binding pocket, preferably wherein the 7 amino acid motif is selected from [NDE]-H-x(3)-D-[GA], more preferably selected from [ND]-H-x(3)-D-[GA], most preferably selected from N-H-x(3)-D-[GA] corresponding to position N218 to G224 in the polypeptide according to SEQ ID NO:13 in WO2019058001. Examples of such enzymes might be particularly selected from L. mirantina, L. fermentati, S. bayanus, or W. anomalus, such as e.g. LmATF1 according to SEQ ID NO:13 in WO2019058001, SbATF1, LffATF1, LfATF1, Wa1ATF1 or Wa3ATF1 as disclosed in WO2019058001, more preferably said ATFs comprising one or more amino acid substitution(s) in a sequence with at least about 20%, such as e.g. 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 92, 95, 97, 98, 99% or up to 100% identity to SEQ ID NO:13 in WO2019058001, wherein the one or more amino acid substitution(s) are located at position(s) corresponding to amino acid residue(s) selected from the group consisting of position 68, 69, 72, 73, 171, 174, 176, 178, 291, 292, 294, 301, 307, 308, 311, 312, 320, 322, 334, 362, 405, 407, 409, 480, 483, 484, 490, 492, 520, 521, 522, 524, 525, 526 and combinations thereof and as particularly exemplified in Table 4 of WO2020141168, most preferably comprising one or more amino acid substitution(s) on positions corresponding to amino acid residue(s) 69, 407, 409, 480, 484, and combinations thereof in SEQ ID NO:13 in WO2019058001.
[0040] In one particular embodiment, the retinyl acetate-producing host cell to be used for the process according to the present invention comprises an amino acid substitution at a position corresponding to residue 69 in the polypeptide according to SEQ ID NO:13 in WO2019058001 leading to asparagine, serine or alanine at said residue, such as e.g. via substitution of histidine by asparagine (H69N), serine (H69S) or alanine (H69A), with preference for H69A. Said modified enzyme might be originated from yeast, such as e.g. L. mirantina, L. fermentati, W. anomalus or S. bayanus, preferably from L. mirantina, optionally being combined with amino acid substitution at a position corresponding to residue 407 in the polypeptide according to SEQ ID NO:13 in WO2019058001 leading to isoleucine at said residue, such as e.g. via substitution of valine by isoleucine (V4071), optionally being combined with an amino acid substitution at a position corresponding to residue 409 in the polypeptide according to SEQ ID NO:13 in WO2019058001 leading to alanine at said residue, such as e.g. via substitution of glycine by alanine (G409A), optionally being combined with amino acid substitution at a position corresponding to residue 480 in the polypeptide according to SEQ ID NO:13 in WO2019058001 leading to glutamic acid, lysine, methionine, phenylalanine or glutamine at said residue, such as e.g. via substitution of serine by glutamic acid (S480E), lysine (S480L), methionine (S480M), phenylalanine (S480F) or glutamine (S480Q), optionally being combined with amino acid substitution at a position corresponding to residue 484 in the polypeptide according to SEQ ID NO:13 in WO2019058001 leading to leucine at said residue, such as e.g. via substitution of isoleucine by leucine (1484L). Said modified enzyme might be originated from yeast, such as e.g. L. mirantina, L. fermentati, W. anomalus or S. bayanus, preferably from L. mirantina. In a most preferred embodiment, the ATF to be used for the process according to the present invention is a modified ATF comprising amino acid substitutions S480Q_G409A_V407I_H69A_I484L and is obtainable from Lachancea mirantina.
[0041] As used herein, the term "retinyl-acetate producing host cell" is a host cell capable of synthesizing retinol and expressing ATF as defined herein resulting in retinyl acetate with a percentage of at least about 70-90% based on total retinoids produced by said host cell. Optionally, such retinyl acetate producing host cell is furthermore capable of producing carotenoids.
[0042] In one embodiment, the retinyl acetate-producing host cell to be used for the process according to the present invention might comprise further modifications, such as modification in endogenous enzyme activities leading to conversion of retinol into FAREs. Particularly, such modifications include reduction or deletion of endogenous lipase activities, particularly activity of one or more endogenous gene(s) encoding enzymes with activity equivalent to Yarrowia LIP2 and / or LIP3 and / or LIP4 and / or LIP8, being reduced or abolished, such as polypeptides with at least about 50%, such as 60, 70, 80, 90, 95, 98, or 100% identity to SEQ ID NO:1, 3, 5, 7, or combinations thereof, wherein SEQ ID NO:1 corresponds to LIP2 obtainable from Yarrowia lipolytica, SEQ ID NO:3 corresponds to LIP3 obtainable from Yarrowia lipolytica, SEQ ID NO:5 corresponds to LIP8 obtainable from Yarrowia lipolytica, SEQ ID NO:7 corresponds to LIP4 obtainable from Yarrowia lipolytica. Preferred is a modification in the activity of a lipase corresponding to activity of Yarrowia LIP8, such as particularly reduced or abolished activity, more particularly abolished activity, more preferably wherein a polypeptide with at least about 50% identity to SEQ ID NO:5 is abolished.
[0043] The term "lipase" is used interchangeably herein with the term "enzyme having lipase activity". It refers to enzymes involved in pre-digestion of triglyceride oils such as e.g. vegetable oil into glycerol and fatty acids that are normally expressed in oleaginous host cells. Suitable enzymes to be modified in a retinyl acetate-producing host cell as defined herein might be selected from endogenous enzymes belonging to EC class 3.1.1.-, including, but not limited to one or more enzyme(s) with activities corresponding to Yarrowia LIP2, LIP3, LIP4, or LIP8 activities.
[0044] As used herein, an enzyme having "activity corresponding to the respective LIP activity in Yarrowia" includes not only the genes originating from Yarrowia, e.g. Yarrowia lipolytica, such as e.g. Yarrowia LIP2, LIP3, LIP4, LIP8 or combinations thereof, but also includes enzymes having equivalent enzymatic activity but are originated from another source organism, particularly retinyl acetate-producing oleaginous host cell, wherein a modification of such equivalent endogenous genes would lead to an increase in retinol to retinyl acetate conversion as defined herein.
[0045] As used herein, an enzyme, particularly a lipase as defined herein, having "reduced or abolished" activity means a decrease in its specific activity, i.e. reduced / abolished ability to catalyze formation of a product from a given substrate into glycerol and fatty acids during fermentation, including reduced or abolished activity of the respective (endogenous) gene encoding such lipases. A reduction by 100% is referred herein as abolishment of enzyme activity, achievable e.g. via deletion, insertions, frameshift mutations, missense mutations or premature stop-codons in the endogenous gene encoding said enzyme or blocking of the expression and / or activity of said endogenous gene(s) with known methods.
[0046] As used herein, "deletion" of a gene leading to abolishment of gene activity includes all mutations in the nucleic acid sequence that can result in an allele of diminished function, including, but not limited to deletions, insertions, frameshift mutations, missense mutations, and premature stop codons, wherein deleted means that the corresponding gene / protein activity, such as particularly endogenous lipase activity, cannot be detected (any more) in the host cell.
[0047] Genetic modifications as defined herein include, but are not limited to, e.g. gene replacement, gene amplification, gene disruption, transfection, transformation using plasmids, viruses, or other vectors. An example of such a genetic modification may for instance affect the interaction with DNA that is mediated by the N-terminal region of enzymes as defined herein or interaction with other effector molecules. In particular, modifications leading to reduced / abolished specific enzyme activity may be carried out in functional, such as functional for the catalytic activity, parts of the proteins. Furthermore, reduction / abolishment of enzyme specific activity might be achieved by contacting said enzymes with specific inhibitors or other substances that specifically interact with them. In order to identify such inhibitors, the respective enzymes, such as e.g. certain endogenous lipases as defined herein, may be expressed and tested for activity in the presence of compounds suspected to inhibit their activity.
[0048] The generation of a mutation into nucleic acids or amino acids, i.e. mutagenesis, may be performed in different ways, such as for instance by random or side-directed mutagenesis, physical damage caused by agents such as for instance radiation, chemical treatment, or insertion of a genetic element. The skilled person knows how to introduce mutations.
[0049] As used herein, an enzyme is "expressed and active in vivo" if mRNA encoding for the protein can be detected by Northern blotting and / or protein is detected by mass spectrometry. With regards to the exogenous lipase activity as defined herein it means ability to improve triglyceride utilization of a host cell comprising modification of endogenous lipase activities as defined herein. With regards to ATFs as defined herein it means ability of a host cell for acetylation of retinol into retinyl acetate.
[0050] The terms "sequence identity", "% identity" are used interchangeable herein. For the purpose of this invention, it is defined here that in order to determine the percentage of sequence identity of two amino acid sequences or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes. In order to optimize the alignment between the two sequences gaps may be introduced in any of the two sequences that are compared. Such alignment can be carried out over the full length of the sequences being compared. Alternatively, the alignment may be carried out over a shorter length, for example over about 20, about 50, about 100 or more nucleic acids / bases or amino acids. The sequence identity is the percentage of identical matches between the two sequences over the reported aligned region. The percent sequence identity between two amino acid sequences or between two nucleotide sequences may be determined using the Needleman and Wunsch algorithm for the alignment of two sequences (Needleman, S. B. and Wunsch, C. D. (1970) J. Mol. Biol. 48, 443-453). Both amino acid sequences and nucleotide sequences can be aligned by the algorithm. The Needleman-Wunsch algorithm has been implemented in the computer program NEEDLE. For the purpose of this invention the NEEDLE program from the EMBOSS package was used (version 2.8.0 or higher, EMBOSS: The European Molecular Biology Open Software Suite (2000) Rice, Longden and Bleasby, Trends in Genetics 16, (6) pp276-277, http: / / emboss.bioinformatics.nl / ). For protein sequences EBLOSUM62 is used for the substitution matrix. For nucleotide sequence, EDNAFULL is used. The optional parameters used are a gap-open penalty of 10 and a gap extension penalty of 0.5. The skilled person will appreciate that all these different parameters will yield slightly different results but that the overall percentage identity of two sequences is not significantly altered when using different algorithms.
[0051] After alignment by the program NEEDLE as described above the percentage of sequence identity between a query sequence and a sequence of the invention is calculated as follows: number of corresponding positions in the alignment showing an identical amino acid or identical nucleotide in both sequences divided by the total length of the alignment after subtraction of the total number of gaps in the alignment. The identity as defined herein can be obtained from NEEDLE by using the NOBRIEF option and is labeled in the output of the program as "longest identity". If both amino acid sequences which are compared do not differ in any of their amino acids, they are identical or have 100% identity.
[0052] The enzymes as described herein to be expressed in a suitable host cell to be used in the present invention also encompass enzymes carrying (further) amino acid substitution(s) which do not alter enzyme activity, i.e. which show the same properties with respect to the enzymes defined herein. Such mutations are also called "silent mutations". Examples of silent mutations included in the present invention are host-optimized sequences.
[0053] The host cell including but not limited to the retinyl acetate producing host cells as defined herein is cultivated in an aqueous medium in the presence of suitable carbon sources and the lipophilic solvent as defined herein, optionally supplemented with appropriate nutrients under aerobic or anaerobic conditions and as known by the skilled person to enable production of the desired fermentation products, such as e.g. retinyl acetate. The fermentation may be conducted in batch, fed-batch, semi-continuous or continuous mode. Particularly, retinyl acetate fermentations are run in fed-batch stirred tank reactors. Fermentations can be run for 5 to 14 days, such as e.g. for around 118 h. Fermentation products including retinyl acetate accumulated in the second phase solvent as defined herein may be harvested at a suitable moment, e.g. when the tankfills due to addition of the feed. Depending on the host cell, cultivations can vary, as it is known to the skilled person. The desired fermentation products such as e.g. retinyl acetate, alpha-ionone, beta-ionone or the like might be used as ingredients / formulations in the food, feed, pharma or cosmetic industry. Cultivation and isolation of beta-carotene and retinoid-producing host cells selected from Yarrowia or Saccharomyces is described in e.g. WO2008042338.
[0054] With regards to the present invention, it is understood that organisms, such as e.g. microorganisms, fungi, algae or plants also include synonyms or basonyms of such species having the same physiological properties, as defined by the International Code of Nomenclature of Prokaryotes or the International Code of Nomenclature for algae, fungi, and plants (Melbourne Code). Thus, for example, strain Lachancea mirantina is a synonym of strain Zygosaccharomyces sp. IFO 11066, originated from Japan.
[0055] As used herein, the term "specific activity" or "activity" with regards to enzymes means its catalytic activity, i.e. its ability to catalyze formation of a product from a given substrate. The specific activity defines the amount of substrate consumed and / or product produced in a given time period and per defined amount of protein at a defined temperature. Typically, specific activity is expressed in µmol substrate consumed or product formed per min per mg of protein. Typically, µmol / min is abbreviated by U (= unit). Therefore, the unit definitions for specific activity of µmol / min / (mg of protein) or U / (mg of protein) are used interchangeably throughout this document. An enzyme is active, if it performs its catalytic activity in vivo, i.e. within the host cell as defined herein or within a suitable (cell-free) system in the presence of a suitable substrate. The skilled person knows how to measure enzyme activity. Analytical methods to evaluate the capability of lipases as defined herein involved in formation of retinyl fatty esters are known in the art and include measurement via HPLC and the like. With regards to activity of LIP2, LIP3, LIP8, LIP4 as defined herein, the skilled person might measure the formation of retinyl fatty esters from conversion of retinol in comparison to the formation of retinyl acetate from conversion of retinol, both measured with a modified and the respective wild-type host cell. Analytical methods to evaluate the capability of a suitable ATF (wild-type or modified) as defined herein for retinyl acetate production, i.e. acetylation of retinol, or enzymes with lipase activity as defined herein are known in the art, such as e.g. described in Example 4 of WO2014096992. In brief, titers of products such as retinyl acetate, retinol, trans-retinal, cis-retinal, beta-carotene and the like can be measured by HPLC.
[0056] Optionally, the host cell, such as e.g. Yarrowia, particularly retinyl acetate-producing Yarrowia, is expressing further enzymes used for biosynthesis of beta-carotene and / or additionally enzymes used for catalyzing conversion of beta-carotene into retinal and / or retinal into retinol. The skilled person knows which genes to be used / expressed for either biosynthesis of beta-carotene and / or bio-conversion of beta-carotene into retinol. Genes and methods to generate carotenoid-producing host cells are known in the art, see e.g. WO2006102342. Depending on the carotenoid to be produced, different genes might be involved.
[0057] In a particular embodiment, the host cell as used in a process defined herein might be originated from Yarrowia lipolytica as disclosed in WO2019058001 or WO2019057999, thus further genetically modified, wherein the formation of retinyl acetate from beta-carotene is optimized via heterologous expression of beta-carotene oxidases (BCO), retinol dihydrogenase (RDH) and / or acetyl-transferases (ATF). Particularly, a modified retinyl acetate-producing host cell to be used in a process as defined herein might be expressing a BCO originated from Drosophila melanogaster or Danio rerio, RDH originated from Fusarium, and fungal ATF, such as e.g. ATF originated from Lachancea or Saccharomyces. To enhance the conversion of beta-carotene into retinal into retinol into retinyl acetate in a process as defined herein, said enzymes might comprise one or more mutations leading to improved acetylation of retinol into retinyl acetate.
[0058] A host cell comprising the above-described modifications in endogenous gene activities, such as e.g. lipase-activities and or expression of heterologous genes, such as e.g. ATFs, is also referred to as "modified host cell".
[0059] As used herein, a "wild-type host cell" means the respective host cell which is wild-type, i.e. non-modified, with respect to the above-mentioned genetic modifications. Thus, in a wild-type host cell the corresponding endogenous enzymes as defined herein are (still) expressed and active in vivo and / or no heterologous enzymes are expressed.
[0060] Conversion according to the present invention is defined as specific enzymatic activity, i.e. catalytic activity of enzymes described herein, including but not limited to the enzymatic activity of lipases, in particular enzymes belonging to the EC class 3.1.1.- involved in conversion of retinol into retinyl fatty esters, beta-carotene oxidases (BCOs), retinol dehydrogenases (RDHs), acetyl transferases (ATFs).
[0061] Retinoids as used herein include beta-carotene cleavage products also known as apocarotenoids, including but not limited to retinal, retinolic acid, retinol, retinoic methoxide, retinyl acetate, retinyl esters, 4-keto-retinoids, 3 hydroxy-retinoids or combinations thereof. Biosynthesis of retinoids is described in e.g. WO2008042338.
[0062] A host cell capable of production of retinoids in e.g. a fermentation process is known as "retinoid-producing host cell". The genes of the vitamin A pathway and methods to generate retinoid-producing host cells are known in the art. As used herein, a "retinol-producing host cell" is a host cell, wherein the respective polypeptides are expressed and active in vivo, leading to production of retinol, e.g. via enzymatic conversion of retinal into retinol. A "retinyl acetate-producing host cell" is the respective host cell capable of acetylation of retinol into retinyl acetate via expression of the respective acetylating enzymes, e.g. ATFs as described herein.
[0063] "Retinal" as used herein is known under IUPAC name (2E,4E,6E,8E)-3,7-Dimethyl-9-(2,6,6-trimethylcyclohexen-1-yl)nona-2,4,6,8-tetraenal. It is herein interchangeably referred to as retinaldehyde or vitamin A aldehyde and includes both cis- and trans-isoforms, such as e.g. 11-cis retinal, 13-cis retinal, trans-retinal and all-trans retinal.
[0064] The term "carotenoids" as used herein is well known in the art. It includes long, 40 carbon conjugated isoprenoid polyenes that are formed in nature by the ligation of two 20 carbon geranylgeranyl pyrophosphate molecules. These include but are not limited to phytoene, lycopene, and carotene, such as e.g. beta-carotene, which can be oxidized on the 4-keto position or 3-hydroxy position to yield canthaxanthin, zeaxanthin, or astaxanthin. Biosynthesis of carotenoids is described in e.g. WO2006102342.
[0065] "Vitamin A" as used herein may be any chemical form of vitamin A found in aqueous solutions, in solids and formulations, and includes retinol, retinyl acetate and retinyl esters. It also includes retinoic acid, such as for instance undissociated, in its free acid form or dissociated as an anion. A preferred form of vitamin A is retinyl acetate, wherein the terms "retinyl acetate", "retinol acetate" and "vitamin A acetate" might be used interchangeably (see https: / / www.cancer.gov / publications / dictionaries / cancer-drug / def / retinyl-acetate?redirect=true).
[0066] The terms "triglycerides" and "triglyceride oils" are used interchangeably herein. "FAREs" or "retinyl fatty esters" as used interchangeably herein includes long chain retinyl esters. These long chain retinyl esters define hydrocarbon esters that consists of at least about 8, such as e.g. 9, 10, 12, 13, 15 or 20 carbon atoms and up to about 26, such as e.g. 25, 22, 21 or less carbon atoms, with preferably up to about 6 unsaturated bonds, such as e.g. 0, 1, 2, 4, 5, 6 unsaturated bonds. Long chain retinyl esters include but are not limited to linoleic acid, oleic acid, or palmitic acid.
[0067] The following examples are illustrative only and are not intended to limit the scope of the invention in any way.ExamplesExample 1: General methods and plasmids
[0068] All basic molecular biology and DNA manipulation procedures described herein are generally performed according to Sambrook et al. (eds.), Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press: New York (1989) or Ausubel et al. (eds). Current Protocols in Molecular Biology. Wiley: New York (1998).
[0069] Shake plate assay. Typically, 200µl of 0.25% yeast extract, 0.5% peptone (0.25X YP) is inoculated with 10µl of freshly grown Yarrowia and overlaid with 200µl of solvent. Candida rugosa Lipase (Creative enzymes) was resuspended in PBS and added to the growth media when the carbon source was 2% corn oil. Alternatively, 2% oleic acid was used as a carbon source. The second phase was Drakeol 5, or others listed in table 6 (Example 2). Transformants were purified by steaking to single colonies, grown in 24 well plates (Multitron, 30°C, 800RPM) in media described above for 4 days at 30°C. The second phase (Drakeol 5, or others listed in table 6) fraction was removed from the shake plate wells and analyzed by UPLC on a normal phase column and / or C4 HPLC, with a photodiode array detector (see details below).
[0070] DNA transformation. Strains were transformed by overnight growth on YPD plate media; 50µl of cells were scraped from a plate and transformed by incubation in 500µl with 1µg transforming DNA, typically linear DNA for integrative transformation, 40% PEG 3550MW, 100mM lithium acetate, 50mM Dithiothreitol, 5mM Tris-Cl pH 8.0, 0.5mM EDTA for 30 minutes at 40°C and plated directly to selective media or in the case of dominant antibiotic marker selection the cells were out grown on YPD liquid media for 4 hours at 30°C before plating on the selective media. URA3 marker recycling was performed using 5-fluoroorotic acid (FOA). Episomal hygromycin resistance marker (Hyg) plasmids were cured by passage on non-selective media, with identification of Hyg-sensitive colonies by replica plating colonies from non-selective media to hygromycin containing media (100 µg / mL). Selection of the nourseothricin-resistance marker (Nat) was performed on YPD media containing nourseothricin (100 µg / mL).
[0071] DNA molecular biology. Plasmid MB9523 containing expression systems for DrBCO, LmATF-S480Q_G409A_V4071_H69A_1484L, and FfRDH (SEQ ID NO:10) was synthesized at Genscript (Piscataway, NJ, USA). Plasmid MB9523 contains the 'URA3' for marker selection in Yarrowia lipolytica transformations. For clean gene insertion by random nonhomologous end joining of the gene and marker Sfil plasmid fragment (of MB9523) of interest was purified by gel electrophoresis and Qiagen gel purification column. Clones were verified by sequencing. Typically, genes are synthesized at GenScript (Piscataway, NJ). Plasmids MB9287 (SEQ ID NO:11) and MB9953 (SEQ ID NO:12), containing a Cas9, and guide RNA expression systems to target LIP2, LIP3, and LIP8 in the case of MB9287, and LIP4 in the case of MB9953, were synthesized at Genscript (Piscataway, NJ, USA).
[0072] Plasmid list. Plasmid, strains, nucleotide and amino acid sequences that were used are listed in Table 1, 2, 3, 11. In general, all non-modified sequences referred to herein are the same as the accession sequence in the database for reference strain CLIB122 (Dujon B, et al, Nature. 2004 Jul 1;430(6995):35-44). Table 1: list of plasmids used for construction of the strains for overexpression or deletion of the respective genes indicated as "insert". "LmATF1-mut" refers to Lachancea mirantina (LmATF1; SEQ ID NO:13 in WO2019058001) carrying aa substitutions S480Q_G409A_V407I_H69A_I484L. "DrBCO" refers to BCO originated from Danio rerio (see SEQ ID NO:18 in WO2020141168); "FfRDH" refers to RDH originated from Fusarium (see SEQ ID NO:22 in WO2020141168). For more explanation, see text.PlasmidInsertMarkerSEQ ID NO:M B7452Cas9Nat9MB9523DrBCO; LmATF1-mut; FfRDHURA310MB9287Cas9; LIP2, LIP3 and LIP8 targeting guide RNAsHyg11MB9953Cas9; LIP4 targeting guide RNAsHyg12 Table 2: list of Yarrowia lipolytica strains used. Construction of ML17544 is described in Table 2 of WO2020141168. For more details, see text. StrainDescriptionML18812ML17544 transformed with MB9523ML18743ML18812 with MB9287 lip8, lip2, lip3 deletionML18743-lip4ML18743 with MB9953 lip8, lip2, lip3, lip4 deletionML13149Abienol producing strain from WO2016172282ML15449Beta-ionone producing strain from WO2016172282ML13716Alpha-farnesene producing strain Table 3: DNA sequences targeted using Cas9 CRISPR for mutation of lipase genes. "Lip gene" means the respective lipase gene from Yarrowia lipolytica. "CRISPR targeting sequence" is the seed sequence used for Cas9 CRISPR targeting. The respective guide RNA expression plasmid for LIP8, LIP2 and LIP3 constructs is MB9287, for LIP4 it is MB9953. For more details, see text. Lip geneCRISPR targeting sequenceSEQ ID NO:LIP8ACAGCAGGCTGAACGAGGAT13LIP2TGGAGGCATGATCAACAGCG14LIP3TCACTCCTCAGCCTCCCAAG15LIP4GGTGGCCTGGATTCGAGTGG16LIP4TTACACCCACTCTATCGGAG17
[0073] Retinoid quantification. Analysis of retinoids were carried out with a C4 reverse phase retinoid method (see below) and C18 as described elsewhere (WO2020141168). The addition of all added intermediates gives the total amount of retinoids.
[0074] C4 reverse phase chromatography. For exact determination of discrete retinoids the long run reverse phase system was used. We separated analytes at 230nm and 325nm through the Agilent 1290 instrument with YMC Pro C4, 150 x 3.0mm 3µm column (YMC America, Allentown PA) stationary phase, and a 5µl injection loop volume and column and sample tray controlled at 23°C with gradients described in Table 4B. Analytes were detected at 230nm and 325nm and the peaks identity verified with LCMS. The analytes separated as discrete peaks that were assigned according to Table 4A. Table 4A: list of analytes using C4-reverse phase method. The addition of all added intermediates gives the total amount retinoids. "RT" means retention time. For more details, see text.IntermediatesRT [min]λ max [nm]trans-retinol20.21325cis-retinol20.32325dihydro-retinol20.75290trans-retinal20.89380cis-retinal21.02380trans-retinyl-acetate22.15325cis-retinyl-acetate22.35325dihydro-retinyl acetate22.60290retinyl esters26-30325 Table 4B: UPLC Method Gradient with solvent A: acetonitrile; solvent B: water; solvent C: water / acetonitrile / methanesulfonic acid 1000:25:1. For more details, see text. Time [min]%A%B%CFlow [ml / min]0585100.52098020.53598020.535.1585100.540585100.5
[0075] Method Calibration. Method is calibrated using high purity retinyl acetate received from DSM Nutritional Products, Kaiseraugst, CH. Retinols and retinal are quantitated against retinyl acetate. Dilutions described in Table 4C are prepared as follows. 40 mg of retinyl acetate is weighed into a 100 mL volumetric flask, and dissolved in ethanol, yielding a 400 µg / mL solution. This solution is sonicated as required to ensure dissolution. 5mL of this 400 µg / mL solution is diluted into 50 mL (1 / 10 dilution, final concentration 40µg / mL), 5mL into 100mL (1 / 20 dilution, final concentration 20µg / mL), 5mL of 40µg / mL into 50mL (1 / 10 dilution, final concentration 4µg / mL), 5mL of 20 µg / mL into 50mL (1 / 10 dilution, 2µg / mL), using 50 / 50 methanol / methyl tert-butyl ether(MTBE) as the diluent. All dilutions are done in volumetric flasks. Purity of retinyl acetate is determined by further diluting the 400 µg / mL stock solution 100-fold (using a 2 mL volumetric pipet and a 200 mL volumetric flask) in ethanol. Absorbance of this solution at 325nm using ethanol is taken as the blank, with adjustment of the initial concentration using the equation (Abs * dilution (100) * molecular weight (328.5) / 51180 = concentration in mg / mL). Because of quick out-maximization of UV absorbance of retinyl acetate, lower concentrations are better. Table 4C: preparation of calibration standards. For more explanation, see text.Stock [RA], dilutionFinal concentration20 µg / mL, 1 / 102 µg / mL40 µg / mL, 1 / 104 µg / mL400 µg / mL, 1 / 2020 µg / mL400 µg / ml, 1 / 1040 µg / mL
[0076] Sample preparation. Top second phase layer samples from each strain were diluted at a 25-fold dilution or higher into tetrahydrofuran (THF). Fermentation whole broth was prepared using a 2 mL Precellys (Bertin Corp, Rockville, MD) tube, add 25µl of well mixed broth and 975 µl of THF. Precellys 3x15x7500 rpm for two cycles with a freeze at -80°C for 10 minutes between cycles. Cell debris was spun down via centrifugation for 1 minute at 13000 rpm. These samples were diluted 10-fold in THF.
[0077] Color measurement. Colors here are defined by the Pantone color scheme for light yellow / translucent (PMS 120-129) and black / dark (PMS 182-209) described elsewhere at http: / / www.bcslabel.com / pdf / pms_color_chart.pdf).
[0078] Fermentation conditions. Fed-batch fermentations were identical to the previously described conditions except using Drakeol 5 (Penreco, Karns City, PA, USA) or another 2 nd< phase overlay (listed in Table 5) and stirred tankthat was corn oil, glucose or ethanol fed in a bench top reactor with 0.5L to 5L total volume (see WO2016172282). The batch medium carbon source composition and feed medium are listed in Table 5. Feeding was initiated after the initial batch carbon had been consumed, with feed added in a controlled manner to maintain a dissolved oxygen level (DO) setpoint.
[0079] Briefly, the fermentations were run in 3.0L flood volume in glass New Brunswick or Eppendorf fermentation systems. The fermentor was batched with an autoclaved 1.6 kg aqueous solution consisting of MgSO 4 •7H 2 O (1.96g / kg), NaCl (0.20g / kg), CaCl 2 •2H 2 O (0.33g / kg), (NH 4 ) 2 SO 4 (8.18g / kg), KH 2 PO 4 (8.47g / kg), Tastone yeast extract (6.13g / kg, Marcor, Leominster, MA), DF204 antifoam (8.13g / kg), thiamine-HCl (0.2g / kg of a 4mg / g solution), trace elements stock solution (3.27g / kg of solution consisting of: citric acid (200g / kg), FeSO 4 •7H 2 O (27.3 g / kg), Na 2 MoO 4 •2H 2 O (19.6 g / kg), CuSO 4 •5H 2 O (18.7 g / kg), H 3 BO 3 (4.9 g / kg), MnSO 4 •H 2 O (21.9 g / kg), ZnSO 4 •7H 2 O (30.2 g / kg)).
[0080] After cooling a carbon source was added along with 400mL Drakeol 5 or other second phase. The fermentation was inoculated with 200ml overnight shake flask cultures of YP media grown with 250RPM agitation at 30°C and the specific carbon sources shown in Table 3. Fermentation parameters were agitation at 1000RPM, airflow at 2.3LPM for ethanol and 2.3 LPM for oil and mixed fatty acids, pH controlled at 5.5 control with NH 4 OH, and the temperature set to 30°C. At feed start, the DO setpoint was set at 40%. The DO setpoint was ramped down to 20% in a linear fashion over the following 24 hours. The DO was then maintained at 20% via feed addition for the remainder of the fermentation. Table 5: fermentation feeding protocol. Fermentation 2 nd< phase was always 400ml in volume. For more explanation, see text.Run:Batch:Feed:Ethanol5% glucose (w / v)100% ethanol (w / v)1% ethanol (w / v) Example 2: Evaluations of solvents to be used as second phases for collections of retinoids produced in Yarrowia lipolytica
[0081] To identify optimal second phases for collection of retinoids produced in strain ML18743, various solvents were tested as second phases and as listed in Table 6. Shake plate assays were performed as described in Example 1. These second phases all had a lower density than the growth medium, which together with their hydrophobicity, enabled convenient supernatant sampling from a centrifuged culture sample. Table 6: list of solvents tested as 2 nd< phases with Yarrowia strains ML18743 and 18812 in shake plate assay. "Abbrev." Means abbreviation. For more details, see text.SolventManufacturerdescriptionAbbrev.n-dodecaneSigmaCH 3 (CH 2 ) 10 CH 3 dodeIso-dodecane mixAcros OrganicsIsododecane mixed isomersdode mixDrakeol 5PenrecoBranched mineral oilDrake 5Isopar HExxon MobileSynthetic isoparaffin fluidsIso HIsopar KExxon MobileSynthetic isoparaffin fluidsIso KIsopar LExxon MobileSynthetic isoparaffin fluidsIso LIsopar MExxon MobileSynthetic isoparaffin fluidsIso MExxsol D60Exxon MobileParaffins / isoparaffins / cycloparaffinsE D60Exxsol D80Exxon MobileParaffins / isoparaffins / cycloparaffinsE D80Exxsol D95Exxon MobileParaffins / isoparaffins / cycloparaffinsE D95Exxsol D110Exxon MobileAlkanes / isoalkanes / cyclicE D110
[0082] The performance of said 2 nd< phases were tested with regards to growth, loss (consumption, evaporation or other ways of disappearance) of the solvents during the fermentation and the density and viscosity of the cultivation medium, wherein the test was carried out after 4 days of growth period. The results are shown in Table 7. Table 7: Growth, evaporation and density in dependence of the solvent used as 2 nd< phase. Viscosity was measured at 20° C. For more details, see text.SolventgrowthLossDensity [g / ml]Viscositynone++N / AN / AN / Adode++100%0.751.34dode mix++20%0.751.3Drake 5++<5%0.846.9Iso H++20%0.761.9Iso K++20%0.761.86Iso L++<5%0.772.11Iso M++<5%0.794.23E D60++20%0.81.77E D80++20%0.82.28E D95++20%0.812.81E D110++<5%0.814.1
[0083] None of the second phases listed caused growth inhibition, as compared to cells grown without a second phase, while aromatic second phases such as Exxon Solvesso 150 ™< and Exxon Solvesso 200 ™< (not shown) are not favorable to growth. Interestingly, 2 nd< phase comprising Isopar M, Exxsol D110 or Drakeol 5 were more or less still present at the end of the fermentation, i.e. did neither evaporate nor were consumed by the host cell. Other second phases, including Exxsol D60, Exxsol D80, Exxsol D95, Isopar L, Isopar K, Isopar H, and dodecane (mixture of isomers) lost approximately 20% of the initial volume during the test period. One second phase, n-dodecane, completely disappeared over the test period, most likely attributable to consumption.Example 3: Impact of solvents to be used as second phases on lipases in Yarrowia lipolytica producing retinyl acetate
[0084] To test the impact of second phases on lipases, we measured the inhibition of heterologous Candida rugosa lipase CrLIP (Creative Enzymes, US) by comparing retinoid output from strains grown with each of these second phases (see Table 8). Strain ML18743 and ML18743-lip4 are unable to consume triglyerides without the addition of a lipase, such as CrLIP. To determine the effect of CrLIP inhibition, total retinoid production of the cells grown in oleic was compared to cells grown in corn oil in the presence of CrLIP in a lipase-deletion strain (see Example 1). With the exception of Drakeol 5 and Exxsol D60, all the second phases inhibited lipase by at least 20%, with maximum inhibition by Isopar L of 40%. In addition, the impact of second phases on fatty acid retinyl esters (FAREs) was measured. Briefly, the percentage of FAREs (%FARE) based on total retinoids was calculated for each of the second phases, and the %FARE was then compared to %FARE with Drakeol 5 as second phase. As shown in Table 8, percentage of FARE could be reduced by using selected 2 nd< phase solvents as compared to the use of Drakeol 5 as second phase. Table 8: Impact of second phases on lipase inhibition and FARE production. "%FARE" was calculated as a percent of total retinoids for cells grown with the indicated second phase in corn oil together with heterologous CrLIP, and then compared to the %FARE present in cultures with corn oil together with heterologous CrLip and Drakeol 5 as second phase. For more details, see text.SolventCrLIP inhibition%FARE compared to %FARE with Drakeol 5 [%]Drake 50%100Iso L40%73Iso M29%56.8E D604%58.6E D8021%98.5E D9535%28.2E D11037%49.9 Example 4: Impact of solvents to be used as second phases on color in Yarrowia lipolytica producing retinyl acetate
[0085] In accordance to Example 2, experiments were performed using different solvents as second phases with subsequent color measurement of the fermentation product, i.e. retinyl acetate accumulated in the 2 nd< phase.
[0086] Whereas the color of the fermentation product was dark in the case of Drakeol 5 and the Exxsols (Exxsol D60, D80, D95 or D110), a light yellow translucent color was obtained with the Isopars and with the Iso-dodecane mix (Acros Organics). The results are shown in Table 9. Table 9: Color profile in dependence of the solvent used as 2 nd< phase. Color was measured according to the method described in Example 1. For more details, see text.SolventVisible colordodeN / Adode mixLight yellowDrake 5Dark / blackIso HtranslucentIso KtranslucentIso LtranslucentIso MtranslucentE D60Dark / blackE D80Dark / blackE D95Dark / blackE D110Dark / black Example 5: Impact of solvents to be used as second phases on total retinoid production and purity in Yarrowia lipolytica
[0087] Fermentation experiments were performed as described in Example 1, using different solvents as second phases with subsequent measurement of retinoids accumulated in the 2 nd< phase.
[0088] As indicated in Table 10, use of Isopar K and Isopar M as a second phase demonstrated an improvement in total retinoid output when compared to the use of Exxol D110 as a second phase. In addition, use of Isopar K and Isopar M each improved %retinyl acetate based on total retinoids. Similar results are obtained with other Isopars, i.e. Isopar L and H. Table 10: Total retinoids compared to Exxsol D110 and %retinyl acetate based on total retinoids ("purity %") for isopars as second phase solvent. For more details, see text.Second PhaseTotal Retinoids (% of E D110)purity %E D110100.0070I K150.2290I M156.3090 Table 11: sequences. SEQ ID NOs:2, 4, 6, 8 refer to the polynucleotides expressing LIP2, LIP3, LIP4, LIP8, respectively, according to SEQ ID NOs:1, 3, 5, 7. For more details, see text. SEQ ID NO:sequence 5' to 3'123456789101112
Claims
1. Fermentative production of isoprenoids with less than 40 carbons as backbone in a two-phase culture system, comprising in situ extraction of said isoprenoids, wherein a suitable host cell is cultivated in the presence of a carbon source and a lipophilic solvent, wherein the lipophilic solvent is different from the carbon source and wherein the lipophilic solvent comprises isoparaffins and wherein the loss of lipophilic solvent during the fermentation is in the range of 20% or less.
2. The production according to claim 1, wherein the isoparaffins further comprise alkanes selected from iso-alkane or cycloalkanes.
3. The production according to claims 1 or 2, wherein the fermentation product is selected from the group consisting of apocarotenoids and sesquiterpenes comprising retinoids or ionones.
4. The production according to any one of claims 1 to 3, wherein the carbon source is selected from linear alkanes, free fatty acids, ethanol, glucose, triglycerides, and / or vegetable oil.
5. The production according to claim 4, wherein the carbon source is selected from the group consisting of oil originated from corn, soy, olive, sunflower, canola, cottonseed, rapeseed, sesame, safflower, grapeseed or mixtures thereof, including the respective free fatty acids comprising oleic acid, palmitic acid or linoleic acid.
6. The production according to any one of claims 1 to 5, wherein the consumption of the solvent by the host cell is reduced by at least about 50%.
7. The production according to claim 6, wherein the evaporation of the solvent is reduced by at least about 50%.
8. The process according to any one of claims 1 to 7, wherein the formation of by-products or impurities is reduced by at least about 25.
9. The production according to claim 8, wherein the impurities are selected from retinal, retinol, fatty acid retinyl esters (FAREs) or dihydro-forms including dihydro-retinol or dihydro-retinyl acetate or dihydro-beta-ionone, rosafluene, phytoene, and / or ergosterol.
10. The production according to any one of claims 1 to 9, wherein the host cell is selected from fungal host cells.
11. The production according to claim 10, wherein the fungal host cell is selected from oleaginous yeast.
12. The production according to claim 11, wherein the oleaginous yeast is selected from Yarrowia, Rhodosporidium, Lipomyces, Saccharomyces or Rhodotorula.
13. The production according to any one of claims 1 to 12 for production of retinyl acetate, comprising collection of the fermentation product in said lipophilic solvent, optionally further isolating and / or purification, and measuring the color of the fermentation product, wherein the color is translucent or light yellow.
14. The production according to claim 13, wherein the translucent color corresponds to PMS 120-129 according to the Pantone Matching System (PMS).