METHOD FOR LABELING EUKARYOTIC CELLS.
Patent Information
- Application Number
- IT101993900318173
- Authority / Receiving Office
- IT · IT
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 1993-09-01
- Publication Date
- 1993-09-01
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
Existing methods for labeling eukaryotic cells using cell surface receptors, such as CD24, are limited by low expression levels and difficulty in distinguishing labeled cells from naturally expressing cells, necessitating improved methods for enhanced sensitivity and specificity in selection and highlighting.
A method involving the expression of a nucleic acid encoding a cell surface receptor with a modified intracellular domain that cannot perform signal transduction, such as the low affinity nerve growth factor receptor (LNGFR), is used to present the receptor in large quantities on the cell surface, enabling efficient labeling and selection through immunoselection.
This approach allows for easy selection and separation of labeled eukaryotic cells by using antibodies, facilitating diagnostic applications in gene therapy and monitoring cell transplants, particularly in bone marrow transplantation, by ensuring high expression and specificity of the receptor.
Description
PROSPECTUS A SUMMARY OF THE INVENTION WITH MAIN DRAWING. DESCRIPTION AND CLAIM FILING DATE l.Q t / iPl9 / ill5¾5 DATE OF ISSUE L.1J / L.....I 1 / L I I L .J TOMORROW NUMBER PATENT NUMBER S3 A 000587 REG B olitol L Method.for labeling eukaryotic cells L ................................................. .................. L.......... ...________ _ ._ . _ ....... L.................. Applicant;........FOUNDATION CENTRO SAN........ROMANELLODEL MONTE TABOR L. SUMMARY A method for marking a eukaryotic cell (mammal) by expressing in this cell a nucleic acid, called nucleic acid encoding a cell surface receptor, and subsequently presenting said receptor to the cell surface, characterized in that it uses a nucleic acid in which the coding region the intracellular domain of the receptor has been completely or partially aged or modified in such a way that the receptor presented at the cell surface cannot, after binding to its ligand, carry out any signal transductions, is effective and usable in gene therapy. M DRAWING RMq DESCRIPTION ^00587 accompanying a patent application for a Hindu invention* strial titled:-'"Method.. for marking eukaryan cells* you" on behalf: FOUNDATION CENTRO SAN ROHANELLO DEL MONTE TABOR Inventors: Bordignon Claudio, Mavilio Fulvio The invention relates to a method for arching eukaryotic (mammal) cells using a cell surface receptor with a modified intracellular domain as a selectable marker. The identification of cells into which a DNA sequence has been successfully introduced is an essential step in recombinant DNA technology. Since the DNA sequence to be introduced does not necessarily produce a phenotype which can be selected in a simple manner, additional DNA sequences coding for a selectable phenotype are normally introduced. There are as yet only a very limited number of such selectable marker genes for use in recombinant DNA technology of eukaryotic cells. Most of these marker genes available such as, for example, thymidine kinase of Herpes simple virus;-: type 1 (Wigler et al., Celi' 1, 1977, 223) or hypoxanthine - phosphoritosis 1 VW<& OCiVOZ $ '9tò transferases (Jolly et al., Proc. Natl. Acad. Sci. SO, 1983, 477) correspond to genes that are constitutively expressed in most normal cells or are identical to such genes. Therefore, these marker genes can be used in special mutant cells that do not express the corresponding gene. A preferred marker gene, on the other hand, should not be expressed in most mammalian cells, or at least not be expressed in certain tissues and cell types, so that they can be used as selectable marker genes in recombinant DNA technology involving those cells. Robert Pawl ink et al. described the use of the cell surface antigen CD24 as a dominant selectable marker in transfer retrovirus-mediated gene (Journal of Cellular-Biochemistry, Supplement 17 E, p. 203, abstract 8210). Using this marker, NIH-3T3 fibroblasts, BAF-3 pre~B cells as well as murine bone marrow cells can be labeled for retroviral infection and the so labeled cells are highlighted for analysis selection of fluorescence-activated cells (fluoressence activated cell sorting analysis). However, the CD24 cell surface antigen is normally expressed on some mammalian cells, and therefore the use of this marker will be limited by the difficulty of discriminating between cells normally expressing the CD24 cell surface antigen and cells labeled with this marker. Furthermore, it has been found that the cell surface antigen CD24, following heterologous expression, is presented on the cell surface only to a minor extent. It is therefore an object of the invention to provide a method for labeling eukaryotic cells, with the use of cell surface receptors, so that by means of this process the cell surface receptors are presented in large quantities on the cell surface, in which the sensitivity of selection and highlighting of labeled cells can be increased. This aim is achieved by means of a process of labeling eukaryotic (mammal) cells by expressing in these cells a nucleic acid, called nucleic acid encoding a cell surface receptor, and presenting the receptor to the cell surface, the process being characterized by use of a nucleic acid in which the coding region the The intracellular domain of the receptor is completely or partially deleted, or modified so that the surface-presented receptor cannot perform any signal transduction after binding to its ligand. Preferably, the intracellular domain is either completely deleted, or individual nudists are modified. preferably, the nucleic acid encoding the NGF-, CD24- or LDL receptor is used. The sequence of the NBF receptor, which will hereinafter be referred to as "low affinity nerve growth factor receptor, LNGFP", is disclosed in D. Johnson, Cell 47, 1986, 545-554 . Preferably, however, a nucleic acid is used in which the DNA region encoding the amino acids 245 to the C-terminus have been deist (SEO ID NO 1). The nucleic acid can be introduced into the target cell, for example, with a viral vector t (preferably retroviral) by lipofection or electroporation. A further object of the invention is a DNA, which codes for a modified LNGFP and which is disclosed in SEO ID NO 1, as well as eukaryotic cells containing called nucleic acid. A nucleic acid used to express a cell so modified, and to the cell surface can be used as of this type can be surface receptor to present the receptor so that the selectable marker receptor for transfected eukaryotic cells. It is also possible to isolate labeled cells by immuno-selection by introducing this nucleic acid into a eukaryotic cell. For this purpose, the transfected cells are identified, selected with a labeled antibody which specifically binds the receptor used according to the invention, and isolated by dissociating the antibody-cell complex. The DNA encoding the receptor or a derivative thereof will be introduced into a eukaryotic expression vector with methods known in the field. Suitable expression vectors are known to those skilled in the art, preferably retroviral vectors are used. Also other viral vectors can be used receptor (for example vaccinia virus), copy vectors (Yu et al., F'roc. 3194-3198 ) in which a rearranged and a titer according to the state of the art for DNA transfer herpes viruses, adenoviruses, retrovirals, double Natl vectors. Acad. Sci. 83, 1986, high frequency of provirus significantly lower of viruses were observed. Viral XSN vectors (Bio-Techniques, 7, 1989, 980-990 ) are preferred. Recombinant eukaryotic expression vectors are then introduced into eukaryotic host cells, either alone for a gene labeling protocol, or in combination with other DNA to be transduced, but with no selectable phenotype. The introduction of DNA into the host cell is achieved by viral infection methods known in the art. Furthermore, receptor gene transfer can also be achieved using non-viral transfer methods (e.g. electroporation, liposomal transfer, calcium precipitation). The cells they control exogenous DNA can then be recognized by their ability to produce a receptor at high levels. The recombinant eukaryotic cells controlling a DNA according to the present invention can also be more easily detected for their ability to produce a derivative of the receptor. The marker receptor of the eukaryotic cells obtained as described above allows easy selection and separation of such cells by using antibodies which bind the used receptor. Such antibodies are known in the art and described, for example, by A. Ross et al. (Proc. Natl. Acad. Sci. 81, 1984, 6681~663 Also, the antibody for the receptors can be obtained by known methods in the industry by immunizing an animal with a protein encoded by DNA according to present invention ed isolating the anti bodies i animal serum immunized, or fusing cells of animal spleen immunized with immortal cells as well as, for example, a murine myeloma cell line, eg obtain monoclonal antibodies. These antibodies can to be marked with methods known in the art (such as that 1i described for example, F'eters, Monoklonale Antiktirper, Springer Verlag, Auflags, Suitable markers will be fluorescent or chemolu.minescent dyes. By using an immobilized antibody instead of a labeled antibody, transfected cells can be selected. Therefore, the solid phase with the antibody immobilized against the receptor is used as a matrix in affinity chromatography. After separation of non-transfected cells that do not express the receptor, the bound cells are, for example, cultured and then expanded on petri dishes overnight. The processes as described above will be especially important as a diagnostic means for the identification of cells introduced into an organism mammal by means of gene therapy protocols. For some applications, such as, for example, bone marrow transplantation, it is of diagnostic value to differentiate between cells originating from bone marrow transplantation and cells deriving from residual host cells. In this case, bone marrow cells that contain the DNA encoding the receptor are transplanted to provide cells with a cell surface marker. Preferably progenitor or stem cells containing the gene according to the invention which had been enriched according to the state of the art (for example with immobilized anti-CD34 antibodies) will be transplanted. After transplantation, cells, especially those derived from tumor cells, can be differentiated between those derived from the transplanted cells or those from residual cells of the host organism. A further aspect of the present invention is therefore the use of the process for immunoselection of cells transfected according to the present invention for the diagnostic identification of cells, which have been marked by transfection with a DNA encoding a receptor, in particular a DNA according to the present invention The main application of the labeling of blood cells or bone marrow cells with the described modified receptors will be the monitoring of cells from autologous and also allogeneic transplants. In the treatment of leukemias and lymphomas it is often necessary to treat patients with sublethal doses of cytostatic drugs □ with comparable doses of irradiation or with a combination of these. To restore bone marrow function, either a reimplantation of bone marrow that was taken before treatment or an allogeneic marrow implant from a FILA-compatible donor is performed. In the case of autologous bone marrow transplantation the contamination of tumor cells in the reimplanted material could lead to a restart of the tumor. Selective methods to purify marrow of tumor cells are used, but such techniques are not reliable at present. In the case of a reboot* it is obviously not possible to distinguish between these potentially contaminating tumor cells and a reboot caused by residual cells after treatment. In the case of allogeneic bone marrow transplants the rejection of the allogeneic marrow is the main problem. If after autologous transplantation the transplanted cells are marked with a gene and consequently the gene product derived from this which is not expressed in these cells. It is possible to trace these cells directly after transplantation and in case of tumor restart to differentiate between tumor cells derived from the transplanted material and residual tumor cells. This information would lead to a very early definition of further treatment based on the source of tumor reboot. In addition to this diagnostic purpose. gene marking in autologous transplants would also lead to monitoring and comparing the efficiency of different methods of eliminating tumor cells in relatively small groups of patients. For autologous transplantation the main field of application will be monitoring the rejection of transplanted cells. The clinical protocol will contain the following steps: a) Explantation of the patient's cells. b) Purification of the explanted cells according to techniques known in the sector. c) Transduction in the patient's cells of a vector containing the gene for the receptor modified according to. present invention. d) Optionally the expansion of the patient's cells under selective conditions, for example with (541 Ej using the expression of the gene for resistance to neomycin encoded, by the vector containing the gene for the modified receptor. e) Immunoselection of labeled cells expressing the modified gene and representing the receptor on the cell surface. f) Reimplantation of the enriched and labeled cells into the patient. g) Monitoring of patient's blood / marrow cells for marker gene by FACS analysis or ELISA techniques. SCHEMATIC DIAGRAM FOR THE PROTOCOL OF GENE MARKING Bone marrow cell explantation Freezing of Purification of Treatment of at the rate cells patient Transduction of cells with i1 LNGFR carrier Expansion into selective conditions Immunoselection for LNGFR-positive cells Reimplantation of labeled cells^- Blood / bone cell monitoring No recurrence Ree i diva Cancer cells Cancer cells marked do not mark Recurrence caused by Recurrence caused cancer cells from cells contaminants in residual tumours cellular material transplanted A large number of studies have demonstrated that retroviral vectors are an effective means for the transfer of exogenous DMA into somatic cells <1). In the mouse hematopoietic system, efficient gene transfer and expression was achieved, both in progenitor cells and in pluripotent stem cells, in vitro as well as in vivo. Minor levels of gene transfer have been obtained in cultured human and canine hematopoietic progenitors, in which significant levels of expression of the transduced genes have been demonstrated (see reference = 5 ). Retrovirus-mediated gene transfer is currently used in gene therapy protocols for the treatment of inherited and acquired diseases, such as adenosine deaminase (ADA~) deficiency, the severe combined immunodeficiency (SCID) and advanced cancers (as reported in . Although there has been a significant effort to optimize human hematopoietic stem cell purification procedures and to find efficient conditions for gene transfer and expression, peripheral blood lymphocytes ( F'BLs) are still considered the safest cellular vehicle for gene therapy Human. They were engineered and used for the gene transfer into human hematopoietic cells different retroviral vectors, all derived from murine leukemia virus. of Moloney (MoMLV). The use of different promoters that direct the expression of the gene of interest, and the position of this sequence, with respect to the viral transcription units, were some of the parameters taken into consideration in generating alternative vectors (*' tB ' *•) . Some of these vectors have been used to transduce lymphoid cells c *,_ cZ> human under different conditions. Human lymphocytes "there OR tumor infiltrants (TILs) were transduced with r-r r-the N2 retroviral vector, with the gene for neomycin f phosphotransferase (Neo), and it has been shown that r maintained a normal phenotype and functional characteristics in vitro C 7 ' B ). The transduced cells are r..... Co were recovered from tumor sites up to 64 days after administration of the cells in vivo to melanoma patients ('). Gene transfer was achieved in spa subpopulations of human CD4* and CD8* T cells derived from TILs and PELsC 10 ). A retroviral vector for expression of a functional CD18 gene, directed by a viral LTR promoter, successfully transduced lymphocytes from patients with leukocyte adhesion deficiency (LAD), and led to LAD correction in vitro ( 11 ). Expression of human ADA from an ADA promoter in a double copy vector < 6 ’) in F'BLs cells obtained from ADA~SCID patients also led to correction of the enzymatic deficiency, allowing the reconstitution of immune functions ( ia - . Finally, retroviral constructs were successfully introduced into a lymphoid cell line for the overexpression of HIV structural RNA sequences (trans activation element, TAF:, Rev element, RRE), expressed by a promoter for RNA polymerase III, inducing partial intracellular immunization against HIVC 1- '''" xtB ). Although in all of these cases the retroviral vectors were capable of transducing human lymphoid cells and expressing the transferred genes, no attempt has yet been made to directly compare the different vectors for the stability, the efficiency of the gene transfer, and the expression of the transduced gene. , The human low-affinity nerve growth factor receptor (LNGFR) is not expressed on most human hematopoietic cells, thus allowing a quantitative analysis of the transduced gene expression for each vector and each target cell for analysis of immunof1 growth” even at the single cell level. Several human hematopoietic cell lines of myeloid and lymphoid origin, as well as CF'DMO normal peripheral blood mononuclear cells, were transduced with four vectors and analyzed for stability and number of viral integrations and for LNGFR expression, both at the RNA and protein level. An analysis by FACE of transduced T cell lines for coexpression of LNGFR and cell surface markers was performed to study gene expression in a specific subpopulation of T cells. Under appropriate conditions of high infection efficiency, all vectors retroviral could transduce a T cell population representative of the normal immune panel. Efficient gene transfer by means of retroviral vectors into hematopoietic stem cells still remains the first goal for gene therapy of various congenital diseases retroviral vectors are safe and effective for the of exogenous DNA in cells moment, all the gene transfer protocol in ce you or acquired. As vehicles, at the moment the tools are more human emo-1 infopoetic transfer and expression. Clinical grades approved for blood or marrow testing refer to retroviral vectors. ( 1 « 3 ) Although the ideal target cell is represented by the pluripotent stem cell, there is no definitive evidence regarding the ability of retroviral vectors to transduce such cells to an adequate efficiency, and to maintain stable gene expression in their progeny. Results of ongoing clinical protocols based on bone marrow gene transfer may clarify these issues shortly (*• Obviously, gene transfer could most easily be achieved in peripheral blood lymphocytes, a potential alternative to bone marrow cells, at least for congenital and acquired immune system disorders. However, for this purpose, it is necessary to define what proportion of F'BLs need to be transduced to represent the entire immune repertoire, and whether this can be stably maintained in vivo, both prerequisites for a gene transfer procedure that is of therapeutic relevance. To this end, gene transfer efficiency and vector design, which both influence persistence and gene expression levels, are crucial factors. The total efficiency of gene transfer in human FELs she was strictly related to infection protocol. Limited cell expansion by brief activation of lymphocytes in vitro, followed by gene transfer into F'E-iLs by exposure of the producing cellular supernatants, resulted in a limited proportion of G418-resistant cells (approximately 17 per cycle of infection), with an additional variability introduced by the supernatant title of the carrier. The efficiency of the transfer gene can be increased by more extensive in vitro expansion of target cells. Our analysis of the VA repertoire utilization in the PBLs population, after three rounds of infection of PBLs with vector-containing supernatants, followed by selection of transduced cells in G418, yielded an intact repertoire compared to the original control population of untransduced lymphocytes / not selected. These data suggest that limited expansion of target cells and the use of vector-containing supernatants produce adequate gene transfer, independently of the relative low frequency of gene transfer, at least when the vector supernatants have good viral titers (> 5 x 10“). However, low viral titers in vector supernatants produce limited repertoires of This has been confirmed by analysis for "Southern blot" of the TCR~$ chain rearrangement, which showed an oligoclonal pattern in the transduced / selected population. Therefore, we attempted to overcome this limitation by co-culture of F'BLs with irradiated vector-producing cells. Independently of the viral titer, this gene transfer procedure is significantly more effective, at least an order of magnitude.Taking advantage of the high efficiency of gene transfer by co-cultivation and expression of LN5FR on transduced lymphocytes, we set up a simple protocol involving co-cultivation and immunoselection that allows the production of transduced cells in a homogeneous way. In view of the fact that the protocols of co-culture are still considered unsafe for clinical use, we designed co-culture conditions in which the vector-producing cells and F'BLs cells are kept separate by means of a porous membrane, which allows passage of the virus while avoid cell-to-cell contact. In our hands, this procedure has not shown sufficient consistency and reproducibility of infection frequencies in serial experiments. However, this approach can offer some advantages when compared to infection with the supernatant. A double immunoflorescence analysis of selected T cells in G418 for coexpression of LNGFR and several T cell surface markers showed similar susceptibility of all subpopulations tested with apparently equal efficiency of gene transfer. Furthermore, we obtained sporadic, although significant evidence of gene transfer in immature CD4* / CDB* cells. We have already shown retroviral vector-mediated gene transfer into T-cell progenitors prior to TCRt rearrangement 1 ®). The current data further confirm the conclusion that retroviral infection of F'BMCs permits gene transfer into circulating progenitors at a low but detectable frequency. This could be an added advantage of transfer protocols that result in short-term in vitro culture and limited expansion of reactive lymphocytes. Finally, the influence of the vector construct on gene transfer efficiency and expression was analyzed in the following studies. In the vector constructs used, the gene of reference was alternately placed within the retroviral transcription unit under the control of internal promoters of SV40 or HSV-TK (NSV-N and NTK-N respectively), with MoMLV viral LTRs (LNSN), or above out of the retroviral transcription unit under the control of the human ADA promoter (the DCN "double copy" vector). The use of a surface receptor - LNGFR - as a reference gene has allowed the study of gene expression levels in L different subpopulations of PEL, with a resolution a single cell. Viral titres obtained for different vectors in selected producing clones were comparable, with the exception of DCN-producing cells which consistently produced titres of up to five times lower than those for the other three vectors, suggesting that the extra sequence in the LTRs viral can reduce the efficiency of transduction, protate 1mind interfering with the process of transcription reverse / integration. That is Also indicated by relatively high trend of DCN a integrate like proviruses re arranged, That r iduces u1 ter storms the total gene transfer efficiency that can be obtained with this type of vector. If that depends on the intrinsic characteristics of the sequence of LNGFR cDNA is to be determined. Re arrangements of the Integrated proviruses were observed with very low frequencies for the other three vectors. Gene expression levels demonstrate that vectors based on internal transcription units were the least efficient in terms of both mRNA accumulation and protein expression. The only exception was the very high level of transcripts generated from the SV40 promoter within two different vectors (NSV-N and LNSN) in the EBV-infected RIM B-cell line. This may be due to the interaction of trans activating EBV proteins with the enhancer 11 of SV-40. In contrast, vectors based on MoMLV LTRs and the human ADA promoter for expression of the reference gene functioned very efficiently in all hematopoietic lines. An analysis of the T-cell lines and clones yielded essentially the same results. Both LNSN and DCN carriers were very effective in the up direction gene expression levels in all subpopulations of T cells, including immature progenitors, and maintained these levels unchanged over a high number of passages. In conclusion, the retroviral vector based on LTR is probably the most reliable and effective for gene transfer and expression in human F'BLs, while the ' DCM vector, although very good for gene expression, generally causes low gene transfer efficacy both due to low titer and tendency of genomic rearrangements. This type of construct, however, could be the vector of choice when tissue- speci-Fica, indue ibi le some other way independent of both LTR and a mandatory requirement, or also in fabrics in which could be one inactivation of LTR. Although they have not been investigated these aspects in the present study, stem cells haematopoi et iche humans could be among them fabrics by analogy with that observed In the system murine hematopoietic. The use of a gene coding for a mo1ec o1 a of cell surface as a marker of cells after Retroviral vector-mediated transfer clearly represents an important advantage over vectors used in previous gene-marking experiments that utilize a marker gene, usually the NeoR gene, not expressed on the cell membrane. This type of vector should represent a potential advantage for preclinical and clinical in vivo studies cell marking. GRAPHIC BI BL IC REFERENCES 1) Miller AD: Human gene therapy comes of age. Natures 357:455, 1992 2) Karlsson S: Treatment of genetics defects in hematopoietic cell function by gene transfer. Blood 78:2481, 1991 3) Anderson WF: Human gene therapy. Science 256:808, 1992 4) Gilboa E, Eglitis MA, Kantoff F'W, Anderson WF: Transfer and expression off cloned genes using retroviral vectors. Biotechniques 4:504, 1986 5) Miller AD, Rosman GJ: Improved retroviral vectors for gene transfer and expression. Biotechniques 7:980, 1989 6) Hantzopoulos FA, Sul longer BA, Ungers G, Gilboa E: Improved gene expression upon transfer of the adenosine deaminase minigene outside the transcriptional unit of a retroviral vector. Proc. Natl. Acad. Sci. USA 86:3519, 1989 7) Kasid A, Morecki 8, Aebersold P, Cornetta K, Culver K, Freeman S, Director E, Lotze MT, Blaese RM, Anderson WF, Rosenberg SA: Human gene transfer: characterization of human tumor-infecting lymphocytes as vehicles for retroviral -mediated gene transfer in man. Proc: Natl. Acad. Sci. USA 87:473, 1990 8) Culver K, Cornet K, Morgan R, Morecki S, Aebersold F, KasidaA, Lotze M, Rosenberg SA, Anderson WF, Blaese RM: Lymphocytes as cellular vehicles For gene theraphy in mouse and man. proc. Natl. Acad. Sci. USA 88: 3155, 1991 9) Rosenberg SA, Aebersold P, Cornet K, Kasid A, Morgan RA, Moen R, Karson EM, Lotze MT, Yang JC, Topalian SL, Merini MJ, Culver K, Miller AD, Blaese RM, Anderson WF: Gene transfer into humans immunotherapy of patients with advanced melanoma, using tumorinfiitrating lymphocytes modified by retroviral gene transduct ion. New Eng. J, of Med. 323: 570, 1990 10) Morecki S, Karson E, Cornet K, Kasid A, Aebersold P, Blaese RM, Anderson WF, Rosenberg SA: Retrovirus-mediated gene transfer into CD4+ and CD8+ human T cell subsets derived from tumor-infiItrating lymphocytes and peripheral blood monuclear cells . Cancer Immunol. Immunother. 32:342, 1991 11) Wilson JM, Fing AJ, Krauss JC, Mayo-Bond L, Rogers CE, Anderson DC, Todd IRT: Correction of CD18-deficient lyimphocytes by retrovirus-mediated gene transfer. Science 24S:1413, 1990 12) Ferrari 5, Rossini S, Giavazzi R, Meggioni D, Nobili N, Soldati M, Ungers G, Mavilio F, Gilboa E, Bordignon C: An in vivo model of somatic cell gene therapy -For human sever combined immunodeficiency. Science 251:1363, 1991 13) Ferrari G, Rossini S, Nobili M, Meggioni D, Garofalo A, Biavazzi R, Mavilio F, Bordignon C: Transfer of the ADA gene into human ADA-deficient T-lymphocytes reconstitutes specific immune function. Blood 80:1120, 1992 14) Sullenger BA, Gallardo HF, Ungers GE, Gilboa E: Overexpression of TAR sequences renders cells resistant to human immunodeficiency virus replication. Cell 63:601, 1990 15) Lee TC, Sullenger BA, Gallardo HF, Ungers GE, Gilboa E: Overexpression of RRE-derived sequences inhibits HIV-1 replication in CEM cells. New Biol. 4:66, 1992 16) Johnson D, Lanahan A, Buck CR, Seghal A, Morgan C, Mercer E, Bothwell M, Chao M: Expression and structure of the human NGF receptor. Cell 47:545, 1986 17) Keller G, F'aige C, Gilboa E, Wagner EF: Expression of a foreign gene in myeloid and lymphoid cells derived from multipotent haematopoietic precursors. Natures 31B:149, 1985 18) Wiginton DA, Kaplan DJ, States JC, Akeson AL, Ferme CM, Bilyk I J, Vaughn AJ, Lattier DL, Hutton JJ: Complete sequences and structure of the gene for human adenosine deaminase. Biochem 8234. 1988 19) Mann'R, Mulligan RC, Baltimore D: Construction of a retrovirus packaging mutant and its use to produce helper-free defective retroviruses. cell Sambrook J, Fritsch EF Maniatis T: Molecular cloning: a laboratory manual 2nd and. 1989 Miller AD. Buttimore C Redesign of retrovirus packaging cell lines to avoid recombinat ion leading to helper virus production. Mol. Cell. Biol 6: 2895, 1986 Southern FJ, Berg P: Transformation of mama 1 i year cells to antibiotic resistance with bacterial gene under control! of the SY40 early region promoters . J. Mol. Appi Genet. 1 : 7, 1982 ) Yanagi Y, Yoshikai Y, Leggett K, Clark SP Alexander I Mak TW A human T cell-specific c DNA clone encodes immunoglobulin a protein having extensive homology to chains. Natures 308:145, 1Y84 Chirgwin JM, Przybyla AE, MacDonald RJ Rutter NJ: Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochem. 18: Thomas PS: Hybridization of denatured RNA and small DNA fragments transferred to nitrocellulose Proc. Natl. Acad. Sci. USA 77:5201, 1980 26) Chomczynski P, Sacchi N: Single-Step Method of ENA Isolation by Acid Guanidinium Thiocyanate-Phenol Chloroform Extraction. Analytical Biochemistry 162:156, 1987 27) Loh EY, Elliot JF, Cwirla S, Lanier LL, Davis MM: Polymerase single-sided specificity: analysis of T cell receptor chain. Science 243:217, 1989 28) Choi Y, Kotzin B, Herron L, Callahan J, Marrack P, Kappler J: Interaction of Staphylococcus aureus toxin "superantigens" with human T cells. Proc. Natl. Acad. Sci. USA, Vol. 86: 8941, 1989 29) Rosenberg WMC, PAH Moss, Bell JL.: Variation in human T cell receptor V / S and JjB finding! king: analysis using anchor polymerase chain reaction. Eur. J. Immunol. 22:541, 1992 30) Bordignon C: A clinical protocol for transfer of the ADA gene into bone marrow cells and peripheral blood lymphocytes for the treatment of patients affected by ADA deficient SCID. Human Sene Therapy (in press) TABLE 1 FACS analysis of the expression by LNGFR in lines hide them there human hematopoietics retroviral vectors transduced with four CELL LINE RETROVIRAL VECTOR NSV-N NTK-N LNSN DCN* 3 K562 4- * + + + + + + -«IS 4 KG 1 + + + + + + + RATI + + + + + ri;, DAUDI + + + + + + 4- + 4-4- c RIM ++ + + + + + -H- + •is - MDLT-4 + — ++ ++ C'-.'r C: J.M. ++ + + +++ +++ *ir-r- ' “ The quantitative expression of LNGFR was measured as : c>. C s of relative average intensity 0 arbitrary units (au) of fluorescence, to. u to. u. The relative average value of the line AS75 melanoma cell express mind cell receptors, was 190 BC. there.. The profiles for FACS of K562 cells, Diodes, RIM and J.M. they were biphasic and the measure refers only to positive peak (see results) LEGENDS OF FIGURES Figure 1. Retroviral vectors for LNGFR expression (A, C,''E, G) Schematic maps of the integrated proviral genomes of NSV-N (A), NTK-N CO, LNSN (E) and DCN (G) are shown, indicating the internal promoters of SV40 (SVI, HSV-TK <TK) and of ADA human (ADAp). The restriction sites XbB I and Hind III <h>They are indicated. RIMA species originating from each vector are represented with arrow numbers on the maps, and numbered on the columns for Northern blot. Figure 2. Southern blot analysis of the integration of the four retroviral vectors (A-D) in Xba I digests of K562 (1), KG 1 (2), Raji (3), Daudi (4), RIM (5) DNA , MOLT-4 (6) and J.M. (7), hybridized with a Neo probe. The bands corresponding to intact integrated proviruses are indicated, as well as their molecular weight (in kb). The rearrangement bands are indicated with Arrow. Figures 3a and 3b. Different vector constructs. MATERIALS AND METHODS Retroviral vectors Four different retroviral vectors were generated for LNGFR expression as a reference gene, using the 1.5 Kb Sst I fragment fully encoding human LNGFR cDNA i 1 **). The NSV-N and NTK-N vectors were obtained by cloning the LNGFF cDNA at the unique sites Hind III and Bgl II of the NSV and NTK vectors, respectively. The NSV vector was derived from the original M2 vector ( ir ) by insertion of the 0.4 kb Kpn I / Hind III fragment containing the early enhancer promoter of 8040 and the origin of replication at the unique Xho I cloning site. The NTK vector was also derived from N2 by insertion of 852 bp of the promoter for herpes simplex virus (HSV) thymidine kinase (T1O). Both vectors were given by E. Gilboa. The LNSN vector was constructed by inserting the LNGFR cDNA into the Hpa I site of the LXSN vector (=). In the DCN vector (double copy LNGFR) the cDNA for LNGFR was cloned under the control of the 0.8 kb Ssp I / Nco I fragment of the human adenosine deaminase (ADA) promoter ( 1EI ) in the E<gl Il / Sna 81 sites of the polyi inker of the retroviral vector N2A (^). The different vector constructs are shown in Figures 3a and 3b. The DNAs of the vectors were converted into the corresponding viruses per transfection protocol. Briefly, the DNA of the vector has been transfected into the ecotropic assembly cell line y2 ( 1<? ) by standard co-precipitation with calcium -phosphate ( so ). 48 hours post transfection, 2 y supernatants were collected and used' to infect the line PA317 cell of amphotropic assembly < = 1 ) for 16 hours in the presence of 8 / tg / ml of polybrene. The cells infected F'A317 were selected in DMEM medium (GIBCD, Grand Island, NY) supplemented with 107. FCS (Hyclone, Logan, UT) and containing 0.8 mg / ml, G418 (GIBCO), and then used to generate virus-containing supernatants, free from helper virus with titers reaching 10* to 5>:10 E cfu / ml. All vectors contain the NeoR gene encoding neomycin phosphotransferase, which confers in vitro resistance to the neomycin analogue 8418. Infection of hematopoietic cell lines All cell lines described in this study, with the exception of RIM and J.M., were <£ c*. '<✓5 c f.V CP t".' c. ru 0":- ; rv ft' or obtained from ATCC, and grown in RF'MI 1640 medium (GIEiCD) supplemented with FCS 107.. The K562 and KG1 lines are myeloid cell lines, derived respectively from chronic and acute myelogenic leukemias, the Raji and Daudi lines are derived from two Burkitt lymphomas; the MOLT-4 line is considered a cell line of stable T-cell leukemia (CDS*); the RIM line is one cell line 1 i nfob 1 ast day de transformed with EBV; the J.M line is a 1infoblastcide T cell line CD4* / CD8*5 the A875 cell line is a human melanoma cell line expressing about 10* LNGFfc per cell. 5x10® target cells were infected for 16 hours with undiluted viral supernatants containing 8 g / ml of polybrene, grown for an additional 24 hours in complete medium and then sorted in the presence of a predetermined dose of 8418 (0.5 to 1.5 mg / ml ). Further analyzes were performed on cultured cells selected in 8418. Infection of human lymphocytes Peripheral blood mononuclear cells (PBMCs) were obtained from healthy donors by Ficol 1-l-lypaque gradient separation (Pharmacia, Uppsala, Sweden) and grown for 72 hours under stimulation of phytohaemagglutinin (PHA) and recombinant human interleukin-2 (hu-rIL2) (2 µg / ml purified PHA, Wellcome, Labs., Dartfortd, Ul<; 100 U / ml hu-rIL2, Roche, Nutley, NY). Viral infection was performed by exposure of stimulated PBLs to a viral cell sample for 6 hours in the presence of polybrene (8 Hg / ml). 48 hours after infection, PBLs were selected in RPMI 1640 supp1 exempt medium with mN L-glutamine, 17. non-essential amino acids, 17. sodium pyruvate, 57. human serum (HS) and 100 U / ml of hu-rIL2 (complete medium), containing 0.4 m2 / ml of 5416. Cell density was kept constant (5x10° cells / ml) during 2 weeks of selection with 5418. Human T lymphocytes transduced by the retrovirus were also cloned in Terasaki plates at different cell concentrations (1-10 3 cells per well) in complete medium containing 0.4 mg / ml of 6418,, in presence of irradiated human F'BLs as feed cells. To improve retroviral infection efficacy, human F'BLs were co-cultured with virus-producing cells for 48-72 hours in complete medium. Co-cultivation was performed in Transwell plates (Costar, Cambridge, MA) to prevent cell-to-cell contact. 3xlO K Producing cells were seeded into wells of 6-well plates and incubated at 37°C overnight. 5x10® stimulated F'ELs were added to Transwell wells and grown for 4B-72 hours in the presence of 8 p.g / ml polybrene. The retroviral transduced cells were analyzed by flow cytometry for the expression of receptor and expanded for further analysis. DNA analysis High molecular weight DMA was obtained from cells by phenol / chloroform extraction standard < =o ), and extensively digested in 5 P>g aliquots with appropriate restriction enzymes (GIBCO-BRL), electrophresis was performed in 0.87. agarose gel at 1.5 V / cm in tris-acetate-EDTA buffer, and transferred to a nylon membrane (Hybond-N, Amersham, Buckinghamshire, UK) by Southern capillary transfer ( so ) and hybridized with a probe labeled with s S2 F' at 10 r dpm. DNA probes were 1.2 Kb Hind Ill / Sma I fragments of pSV2-neo (--) and the Hine II fragment 3 ? of the cDNA clone YTJ-2, containing the constant region of human TCR-^ (=^) . The filters were washed under high stringency conditions and exposed to Kodak X-AR film at -70°C. RNA analysis Total cellular RNA was extracted with the guanidine isotiocyanate technique ( ZJ *> and selected for poly(A)* on oligo ( dT)-cellulose chromatography ( 3 °). 5 kg g of poly(A)* RNA was fractionated by size on 17. agorose-in-formaldehyde gels, transferred to a nylon capillary transfer membrane Northern ( fflS5 ), and hybridized, washed, and exposed as described for Southern transfers. The probes of DNA were the 1.2Kb Hind III / Sma I fragment of pSV2-neo and the 1.5Kb Est I fragment of LNGFR cDNA ( 1<s ). Cell surface phenotyping The cell surface expression of LNGFR was monitored by flow cytometry using mouse monoclonal antibody to human LNGFR 20.4 (ATCC) with an indirect florescence labeling method. The cell surface phenotype of L T lymphocyte lines and clones was determined by flow cytometry using FÉ-conjugated monoclonal antibodies against human CD4 (T4), CDS (T8), CD5, E4, CD25R, Leu7, Cd34 human (Coulter Immunology, Hialeah, FL). In short, 5x10 s Cells were stained with 100 M1 of diluted antibody at 4°C for 30 min, washed twice in FCS-free medium, and resuspended in 0.5 mL of F'BS for FACS analysis or in 100 mL of diluted FITC-conjugated secondary antibody. The analysis for double staining was performed by sequential incubation of FITC- and F'E-conjugated antibodies. Analysis of the use of the V& TCR chain Total RNA was extracted from cell lines PPL and T using GTC, ( 2 *l Reverse transcribed into cDNA using oligo dT and oligo dG tails, < =z ) and one twentieth of the DNA obtained was used for PCR with use of specific V& -C / J oligonucles ( 2 °) and with a specific oligonucleotide C / i (5'-TGCTGACCCCACTGTCbACCTCTCCCCCATT-3'), as described in reference 27. The amplification cycles of F'CF: were performed at 94°C for 45", 57°C for 45", and 72°C for 1'. The amplified product was gel purified and cloned into the bluescript plasmid vector. The C$ positive colonies were replicated on several plates and transferred to cellulose filters and hybridized with specific oligonucleotides = 9 ) under the following conditions: 6 x in SSC, 17. biotto. 0.17. SDS and 5mM EDTA at 42°C for 3-6 hours, were washed for 1 hour at the same temperature in 6 x SSC and exposed for 6-12 hours to X-ray film at room temperature. RESULTS Generation of recombinant retroviruses by LN5FR expression Four different retroviral constructs for LN&FR expression were developed and used for the generation of virus-producing cell lines. The constructs N3V-N (figure 1A> and NTK-N (figure 1C) are based on internal promoters, which direct the expression of the LNGFR cDNA, i.e. the early promoter of SV40 and the HSV-TK promoter, respectively. In the LNSN vector ( Figure 1E ), the LNSFR gene is expressed by the viral LTR. In the DCN construct ( Figure 1G ) the LMGFR cDNA is under the control of the human ADA promoter, in the region (J3 of the 3' LTR. After infection of the target cells, the transduced gene is duplicated and transferred to the 5' LTR<*) , thus generating a provirus containing two copies of the ADA-LNGFR minigene. All vectors carry the NeoR gene, under the control of either viral LTR (NSV-N, NTK-N and DCN) or SV40 early promoter (LNSN). The four vectors have been used to transduce the LNGFR gene in human hematopoietic cell lines of different derivations and in human PE<Ls, and show: i) ability to transduce human target cells, ii) integration and stability of intact proviruses, and iii) reference gene expression. The viral titre of the amphotropic producer cell lines ranges from IxlO 4 at 5:-:10 3 cfu / ml for NSV-N, NTK-N and LNSN vectors, and from 5:-:10 3 to IxlO** cfu / ml for the DCN vector. Molecular analysis of viral integration in human hematopoietic cell lines For an initial examination of the different vectors, different tumor cell lines were used of haemato-1infopoietic origin as target cells for the transfer of gene intent. Two myeloid cell lines (K562 and KG1), two Burkitt lymphoma (Raji and Daudi), and one EBV-transformed 1 phobiastoid cell line (RIM), and two lymphoblastoid cell lines (M0LT--4 and J.M.) were transduced with the four retroviral vectors and selected in the presence of G41B. A molecular analysis of retroviral integrations was performed by Southern transfer. Genomic DNAs were digested with Xba I, which cuts both the 5' and 3' LTRs of all vectors (figure 1), allowing the size of the integrated proviruses to be highlighted, and with Bgl II, which cuts only in genomic DNAs, allowing an estimate of the number of integration sites. The Xba I and Bgl II digested DNAs were sequentially hybridized with specific probes for the NeoR and LNGFR genes. Integration of the NSV-N vector generated a single Xba I band of the expected size of 5.1 kb, corresponding to an intact provirus, in all cell lines selected in G41B (Figure 2A). In Raji cells an additional toast of smaller size is observed, indicating integration of a rearranged provirus (Figure 2A, column 3). Similarly, digestion with Xba I generated a single band of the expected size of 5.4 kb in DNA from all e four NTK-N infected cell lines (figure 2E0). An additional band, probably due to the presence of rearranged provirus, was detected only in the RIM sample (figure 2D, column 5). A single band of 4.3 kb is observed in all samples transduced with the LNSN vector with no evidence of viral rearrangements overview of DCN-infected integrations and rearrangements (figure transduced with DCN show 5.4 kb, corresponding to an additional band of (K51) cell lines, two bands were ranging from one (MQLT-4, figure 2D, that rearranged at a Repeated infections variable in column predominance (Ra j i, with lo (figure 2C). In contrast, the viral DNA from cells characterized by frequent All cell lines the presence of a band of intact provirus, but as high as 3.2 kb in all but 1 The relative proportion of the samples tested, of intact provirus 6) to a prevalence of figure 2D, column 3). same retroviral sample they indicated that the proportion Between virus intact e re arranged is a random event, Not cell-specific As cell lines transduced by all other vectors the picture with E'gl The showed That 1 infection with DCN generates a polyclonal integration in all cell lines. To elucidate the nature of the mechanism responsible for the generation of rearranged proviruses, we performed additional digestions of genomic DNAs with Hind III, which cuts twice in the ADA-LNGFR minigene followed by hybridization with the LNGFR probe. The comparative analysis of the patterns of restriction with Xba I and with Xba I / Hind III with both probes indicated that the 3.2 kb band corresponded to a rearranged provirus lacking the ADA-LNGFR minigene from both LTRs. Defective proviruses were also detected at high frequency during selection of DCN-producing cell lines. The clone used in all of our experiments carried only intact provirus, indicating that the generation of defective proviruses occurs during integration into target cells, and is not due to defects in the productive cell line. In summary, infection of all cell lines with NSV-N, NTK-N, and LNSN resulted in G41B-resistant populations carrying few copies of pristine non-rearranged provirus 1, whereas infection with the DCN vector resulted in a commonly high-frequency rearranged provirus, most likely resulting from loss of the ADA-LNGFR minigene from the retroviral vector 3' LTR during the integration process. This problem may be due to the size and nature of the inserted gene in viral LTR. similar limitations with other "double copy" vector constructs were not observed ( 1 2— I"'-), Vector-mediated expression of LNGFR i n 1 i nee human hematopoietic cells The expression of the transduced LNGFR in different retroviral vectors was evaluated both a L protein and RNA level. Cell surface expression of LNGFR in G41B-selected cell lines was quantitatively analyzed by flow cytometry with an anti-LNGFR monoclonal antibody. The results are summarized in Table I. Most of the cell lines transduced with NSV-N and NTK-N showed a low mean level of LNGFR surface expression, expressed as mean relative fluorescence (< of ICO units arbitrary). High expression of LNGFR (202 a.u.) was observed only in the EE<V-infected RIM cell line transduced with NSV-N. LNGFR expression was not detectable in the NTK-N-transduced MOLT-4 cell line, although no proviral genome rearrangements were detectable in an Xba I digest of genomic DNA (Figure 2B, column 6). repeated with this vector in the same cell line produced consistently negative results. All cell lines transduced with the LNSN retroviral vector expressed LNGFF: at medium-high levels (50-200 a.u.) (Table I). Most DCN-transduced cell lines expressed medium or low levels of LNGFR (50-200 a.u.). The FACS profiles of DCN-transduced cellar cell lines correlated with the results 1 __ obtained by "Southern" analysis, in which the cell lines carrying a rearranged provirus in addition to an intact provirus showed biphasic curves, with a positive peak and a negative peak proportional to the relative intensity of the bands corresponding to the rearranged and intact proviruses respectively. Expression of specific vector RNAs in transduced cells (K562) was determined by "Northern" transfer analysis of poly(A)* RNA isolated from cell lines selected with 5418, and hybridized to LNGFR and Neo probes. The results achieved were consistent with the expected transcript profiles of each retroviral vector. In cells transduced with NSV-N and NTK-N, unripened and matured RNA species hybridized to both the NLGFR probe and the Neo probe. Subgenomic transcripts derived from SV40 e da Tl< containing LN5FR-specific mRNA were observed only after -hybridization with the LNGFR probe. Cells transduced with LNSN expressed only the unripened form of RNA, hybridizing to both the NeoR probe and the LNGFR probe. This is consistent with inactivation of the donor site of maturation in the LXSN vector, from which LNSN was derived (®). A shorter transcript, corresponding to the SV40-derived NeoR mRNA hybridized only to the NeoR probe. The DON vector generated two LTR-derived genomic transcripts, immature and mature, respectively. A third RNA species was transcribed from the ADA promoter, and probably used as the main mRNA template for LNGFR synthesis. The relative contribution of the ADA promoter to the 5' or 3' LTR for the LNGFR transcript cannot be attributed with this technique. A slower migrating form of RNA might represent a read-through transcript starting at the ADA promoter at the 5' LTR and terminating at the poly<A) addition site at the 3' LTR. Also highlighted were two additional RNA species not considered that hybridized only with the NeoR probe. These transcripts, present in all cell lines transduced with DON, were the only RNA species detectable in Raji cells, which did not they expressed LNGFR and had only rearranged provirus, as demonstrated by "Southern" transfer assays. It is therefore probable that these transcripts are specific for the rearranged provirus, lacking the ADap-LNGFR minigene. The RNA expression observed in the other cell lines was comparable with that obtained from the K562 line, with the only exception of the EBV-infected RIM cell line, which showed significantly consistent high levels of SV4Q-derived transcripts from both NSV-N and LNSN. Efficiency of vector-mediated gene transfer in human PBLs Human peripheral blood lymphocytes were infected with retroviral vectors under stimulation of PHA and 1L-2. To highlight the frequencies of infections, human T cells were cultured 48 hours after infection under serial dilution conditions (1 to 10* cells per well). Infected and uninfected control cells were cultured in the presence or absence of 0.4 mg / ml of G418. Cell growth was assessed 14 days after plating, when no cells could be detected in wells containing uninfected cells grown in the presence of G418. The frequency of infection ranged from less than 17. to 5.17., in -Function of the viral titre- of the supernatants of the vector. However, significant variability was observed between different donors. The efficiency of the transfer gene can be increased by multiple infection cycles or by co-cultivation. Co-cultivation of TBLs with irradiated virus-producing cell lines for 48 hours consistently provides good gene transfer efficiency (10-157.). A dual fluorescence analysis of LNGFF: and T-cell markers ruled out the possibility of contamination of vector-producing cells in the LNGFR-positive population. In the experiment the LNGFR expression frequency was entirely due to the expression of the transduced gene in infected F'BLs, since all FACS-positive cells co-expressed human CD3. Independently of the initial transfer efficiency gene, the transduced F'&Ls can be selected to homogeneity. either by negative selection with (^418 which immunoselection positive with magnetic balls pair with monoclonal antibodies against LNGFR In the experiment representative, a single cycle of immunose1 action it was sufficient For separate the population of cells transduced from F'BLs not infected A. Once the magnetic galls have been removed, a homogenous population of transduced lymphocytes is obtained without significant cell loss transduced. To evaluate the efficiency of viral vectors in the infection of human F'ELs, different F'BL cultures were independently transduced upon exposure to supernatants containing different vectors retroviral and was selected with S418 for the presence and expression of the vectors. Ten of the cultures transduced with vectors <2 from NSV-N, 3 from NTK-N, 2 from LNSN and 3 from DON) were tested for proviral integrations by "Southern" analysis. Hybridization to the Neofc probe digested with Xba I, which cuts both at the 5' and 3' of all LTRs vectors (figure 1), allows the highlighting of integrated proviruses, and with Bgl II, which cuts only in genomic DNA, allows an estimate of the number of integration sites. In all crops of lymphocytes transduced by NSV-N, NTK-N and LNSN, only le bands corresponding to intact integrated proviruses were detectable, while an additional band corresponding to rearranged provirus was observed in all DCN-transduced cultures. Finally, an analysis of the integrations provirals revealed that transduced T cell cultures with NSV-N, MTK-N and LNSN were largely poiiclonal, while the DCIM-transduced cultures were essentially oligoclonal, as indicated by 'the presence of one predominant band and only a few minor bands. As already suggested, this is likely due to a lower viral titer and could be avoided by various gene transfer protocols including co-cultivation of target cells with vector-producing cell lines. Vector-mediated expression of LNGFF: in human T lymphocytes Cell surface expression of LN8FF: was detected by FACS analysis in a total of 23 cultures of T lymphocytes transduced with retroviral vectors (5 NSV-N, 8 NTK-N, 5 LNSN and 5 DCN). LNGFR expression was low in all cells transduced with NSV-N, and in six of eight cell cultures transduced with NTK-N. The two remaining NTK-N transduced T cell lines showed levels LNGFR expression intermediates. Levels of expression heterogeneous differences were observed in LNSN cell cultures, with two lines expressing low levels, two intermediate levels, and one high level of LNGFR. In cells transduced with DCN, four of the five lines expressed low levels and one intermediate levels of LNGFR extension. To characterize infected cells, we assayed 13 transduced cell lines for expression of lymphocyte cell surface differentiation antigens, using anti-CD4, CD8, CDS, B4, Leu?, CD25R and CD34 monoclonal antibodies. All cell lines tested were positive for CDS and CD25R expression and negative for Leu7, B4 and CD34 expression (not shown). Eight of the thirteen cultures tested were LNGFR* / CD8*, one was LN6FR* / CD4* and four were positive for LNGFR and contained different percentages of cells that coexpressed CDS and CD4. The predominance of the phenotype CDS* in cultures stimulated with F'HA and IL~2 was also observed in the lines cellphones of check not infected, and probab Irniente represents a phenomenon procedure constant cell culture T. In general, we do not have observed a transduction preferential to one. particular cell subspecies by any of the four retroviral vectors. T-cell clones were obtained from dahlias crops of vector-transduced T cells for plating of the cells in limiting dilutions (1000, 100 e 10 cells for cockpit), considering a average infection rate of approximately 17. Of all clones tested, 727 were LNGFR* / CD4* and 287 were LNbFR* / CD8*-. The predominance of the CD4* phenotype was also observed in control uninfected T-cell clones from the same donors, and is considered a standard phenomenon in our cloning conditions. In addition, 1b retroviral transduction and LNGFR expression was obtained in double positive, CD4* / CD8* clones. These results demonstrate that retroviral infection could occur not only in mature CD4* and CD8* cells, but also in CD4* / CD8* doubly positive peripheral blood lymphocytes. Analysis of the T-cell repertoire in vector-transduced T lymphocytes As already shown, a 'Southern' transfer assay of viral integrations demonstrated the polyclonal nature of vector-infected T-cell cultures. This was further confirmed by molecular analysis of rearrangements of the chain^ of the receptor T cells (TCf?) on camp i oni of DNA digested with Xba I e hybridized to one probe specific For there constant region of chain^ of the TCP: A pattern then Iona le, with none predominant band additional to the scheme of the line germinal, was evidenced in cultures of T cells transduced with NSV, NTK-N and LNtìN. The presence of numbers A limited number of predominant rearranged bands was observed in DCN-infected cultures, as well as for oligologic cell populations. Further confirmation of these observations was obtained by a systematic analysis of the use of the TCR vft chain in transduced lymphocytes. After a single round of infection of PBLs with the vector-containing supernatants, followed by selection of cells transduced with (5418, 1' total RNA of the The selected lymphocyte population was subjected to reverse transcription and the DNA obtained was subjected to F'CR with the use of oligonucleotide 1 eot i of specific vjì -Cfì , and to "anchor" PCR using a specific oligonucleotide cfi as described in the section on methods. An analysis of the amplified products from the specific o1igonuc1eotides showed an identical repertoire compared to the original control population of untransduced / unselected lymphocytes. Figure 9 shows the substantially normal repertoire of use in one polyclonal population of lymphocytes transduced with LNSN. Similar to the results of "Southern" transfer analysis of TCR-jB chain rearrangements, low viral titers in vector supernatants produced a limited repertoire (not shown). This limitation of low title carriers could be resolved by multiple infection cycles or by co-cultivation of F'BLs with the producing cell line. UN i ANi > / .. AèìlO for ;«• c for the others 'Antonio Toliercìo SEQ ID NO 1 GCCGCGGCCAGCTCCGGCGGGCAGGGGGGGCCGCTGGAGCGCAGCGCAGCGCAGCCCCATC 1--------- + ---------+ ---------+---------+---------+---------+ 60 CGGCGCCGGTCGAGGCCGCCCGTCCCCCCCGCGACCTCGCGTCGCGTCGCGTCGGGGTAG AGTCCGCAAAGCGGACCGAGCTGGAAGTCGAGCGCTGCCGCGGGAGGCGGGCGATGGGGG 61 --------- + -- — ————+---------+------ — ——+ — - — — — 12 0 TCAGGCGTTTCGCCTGGCTCGACCTTCAGCTCGCGACGGCGCCCTCCGCCCGCTACCCCC CAGGTGCCACCGGCCGCGCCATGGACGGGCCGCGCCTGCTGCTGTTGCTGCTTCTGGGGG 121---------+---------+---------+---------+-------- +---------+ 180 GTCCACGGTGGCCGGCGCGGTACCTGCCCGGCGCGGACGACGACAACGACGAAGACCCCC TGTCCCTTGGAGGTGCCAAGGAGGCATGCCCCACAGGCCTGTACACACACAGCGGTGAGT j 181 ---------+---------+---------+---------+--------- +----------+240"*3 ACAGGGAACCTCCACGGTTCCTCCGTACGGGGTGTCCGGACATGTGTGTCGCCCCÀCTCA c / 5 GCTGCÀAAGCCTGCAACCTGGGCGAGGGTGTGGCCCAGCCTTGTGGAGCCAACCAGACCG f'll 241 ---------+---------+---------+---------+--------- +---------+ 300 k- CGACGTTTCGGACGTTTGGACCCGCTCCCACACCGGGTCGGAACACCTCGGTTGGTCTGGC ¢-- TGTGTGAGCCCTGCCTGGACAGCGTGACGTTCTCCGACGTGGTGAGCGCGÀCCGAGCCGT 301 --------- + --------- + ----------+--------- + --------- + --------- + 36Q ij, ACACACTCGGGACGGACCTGTCGCACTGCAAGAGGCTGCACCACTCGCGCTGGCTCGGCA r "" There<' GCAAGCCGTGCACCGAGTGCGTGGGGCTCCAGAGCATGTCGGCGCCGTGCGTGGAGGCCG < 361 ---------- + --------- + --------- + ----------+---------+--------- + 420 -- CGTTCGGCACGTGGCTCACGCACCCCGAGGTCTCGTACAGCCGCGGCACGCACCTCCGGC & ACGACGCCGTGTGCCGCTGCGCCTACGGCTACTACCAGGATGAGACGACTGGGCGCTGCG 421 ---------+---------+---------+---------+--------- +---------+ 480 3E TGCTGCGGCACACGGCGACGCGGATGCCGATGATGGTCCTACTCTGCTGACCCGCGACGC AGGCGTGCCGCGTGTGCGAGGCGGGCTCGGGCCTCGTGTTCTCCTGCCAGGACAAGCAGA 481 ---------+---------+---------+---------+--------- +---------+ 540 TCCGCACGGCGCACACGCTCCGCCCGAGCCCGGAGCACAAGAGGACGGTCCTGTTCGTCT ACACCGTGTGCGAGGAGTGCCCCGACGGCACGTATTCCGACGAGGCCAACCACGTGGACC 541--------- + --------- + --------- + ----------+--------- + --------- + goo TGTGGCACACGCTCCTCACGGGGCTGCCCGTGCATAAGGCTGCTCCGGTTGGTGCACCCTGG CGTGCCTGCCCTGCACCGTGTGCGAGGACACCGAGCGCCAGCTCCGCGAGTGCACACGCT 601----—— — ----- + ----— ——+ 660 GCACGGACGGGACGTGGCACACGCTCCTGTGGCTCGCGGTCGAGGCGCTCACGTGTGCGA GGGCCGACGCCGAGTGCGAGGAGATCCCTGGCCGTTGGATTACACGGTCCACACCCCCAG 661 ---------+---------+---------+------- — +---------+ ----------+ 720 CCCGGCTGCGGCTCACGCTCCTCTAGGGACCGGCAACCTAATGTGCCAGGTGTGGGGGTC AGGGCTCGGACAGCACAGCCCCCAGCACCCAGGAGCCTGAGGCACCTCCAGAACAAGACC 721--------- + --------- + --------- 4 ----------+---------4--------- + 780 TCCCGAGCCTGTCGTGTCGGGGGTCGTGGGTCCTCGGACTCCGTGGAGGTCTTGTTCTGG SEQ ID NO 1 (continued): 55 TCATAGCCAGCACGGTGGCAGGTGTGGTGACCACAGTGATGGGCAGCTCCCAGCCCGTGG 781--------- + ---------+---------+----------+---------+--------- , + g 4 Q AGTATCGGTCGTGCACACCGTCCACACCACTGGTGTCACTACCCGTCGAGGGGTCGGGCACC TGACCCGAGGCACCACCGACAACCTCATCCCTGTCTATTGCTCCATCCTGGCTGCTGGTGG 841 -- — + — ---+ ---------+ -___-- — -+-------- + 900 ACTGGGCTCCGTGGTGGCTGTTGGAGTAGGGACAGATAACGAGGTAGGACCGACGACACC P v u THE THE TTGTGGGCCTTGTGGCCTACATAGCCTTCAAGAGGTGGAACAGCTGCAAGCAGAACAAGC 901 ---------+---------+---------+---------+--------- +---------+ 960 AACACCCGGAACACCGGATGTATCGGAAGTTCTCCACCTTGTCGACGTTCGTCTTGTTCG AAGGAGCCAACAGCCGGCCAGTGAACCAGACGCCCCCACCAGAGGGAGAAAAACTCCACA 961--------- + ----------+--------- + --------- + --------- + --------- + J020 TTCCTCGGTTGTCGGCCGGTCACTTGGTCTGCGGGGGTGGTCTCCCTCTTTTTGAGGTGT GCGACAGTGGCATCTCCGTGGACAGCCAGAGCCTGCATGACCAGCAGCCCCACACGCAGA 1021 ---------+---------+---------+---------+--------- +---------+ 1080 CGCTGTCACCGTAGAGGCACCTGTCGGTCTCGGACGTACTGGTCGTCGGGGTGTGCGTCT CAGCCTCGGGCCAGGCCCTCAAGGGTGACGGAGGCCTCTACAGCAGCCTGCCCCCAGCCA 1081---------+---------+---------+---------+-------- +---------+ 1140 GTCGGÀGCCCGGTCCGGGAGTTCCCCACTGCCTCCGGAGATGTCGTCGGACGGGGGTCGGT AGCGGGAGGAGGTGGAGAAGCTTCTCAACGGCTCTGCGGGGGACACCTGGCGGCACCTGG 1141---------+--------- + --------- + --------- + --------- + --------- + i2oo TCGCCCTCCTCCACCTCTTCGAAGAGTTGCCGAGACGCCCCCTGTGGACCGCCGTGGACC CGGGCGAGCTGGGCTACCAGCCCGAGCÀCATAGACTCCTTTACCCATGAGGCCTGCCCCG 1201---------+---------+---------4---------+-------- +---------+ 1260 GCCCGCTCGACCCGATGGTCGGGCTCGTGTATCTGAGGAAATGGGTACTCCGGACGGGGC TTCGCGCCCTGCTTGCAAGCTGGGCCACCCAGGACAGCGCCACACTGGACGCCCTCCTGG 1261 ---------+ ---------+---------+---------+--------- +---------+ 1320 AAGCGCGGGACGAACGTTCGAACCCGGTGGGTCCTGTCGCGGTGTGACCTGCGGGAGGACC CCGCCCTGCGCCGCATCCAGCGAGCCGACCTCGTGGAGAGTCTGTGCAGTGAGTCCACTG 1321 ---------+---------+---------+---------+--------- +---------+ 1380 GGCGGGACGCGGCGTAGGTCGCTCGGCTGGAGCACCTCTCAGACACGTCACTCAGGTGAC CCACATCCCCGGTGTGAGCCCAACCGGGGAGCCCCCGCCCCGCCCCACATTCCGACAACC _ — ——----+ _---------+------ — - - + — + GGTGTAGGGGCCACACTCGGGTTGGCCCCTCGGGGGCGGGGCGGGGGTGTAAGGCTGTTGG GATGCTCCAGCCAACCCCTGTGGAGCCCGCACCCCCACCCTTTGGGGGGCCCGCCT] — — — —---—+——————---+ — - —----— — + — ——+ — —-----+—— —- -- CTACGAGGTCGGTTGGGGGACACCTCGGGCGTGGGGGTGGGAAACCCCCCCCGGGC«$® St s t THE CAGAACTGAGCTCCTCTGGGCàGGACCTCAGAGTCCAGGCCCCAAAACCACAGCÓ^Sj^g^L^ GTCTTGACTCGAGGAGACCCGTCCTGGAGTCTCAGGTCCGGGGTTTTTTGGTGTCGGGACAG uh msNoa.akio for re and for & u altri ' in Hereto AGTGCAGCCCGTGTGGCCCCTTCACTTCTGAGACACACTTC ---------4.---------+--------- + --------- + 1600 (-'&f-irr'r.r,r,GAAGTGAAGACTGGTGGTGAAG in HM93 a
Claims
CLAIMS 1. A method of mixing a eukaryotic (mammalian) cell by expressing in that cell a nucleic acid, said nucleic acid encoding a cell surface receptor, and subsequently presenting said receptor to the cell surface, characterized by the use of a nucleic acid in which the The region coding for the intracellular domain of the receptor has been completely or partially deleted or modified in such a way that the receptor presented on the surface cannot, after binding to its ligand, carry out any signal transduction.
2. Method according to claim 1, characterized in that the coding region for the intracellular domain is modified by nucleotide substitution.
3. The method according to claim 1 or 2, characterized in that a nucleic acid encoding the NGF, CD24 or LDL receptor is used.
4. Method according to claims 1 to 3, characterized in that as the nucleic acid, the nucleic acid of the NGF receptor is used in which the coding region from amino acids 245 to the C-terminus is deleted. Method according to claims 1 to 4 characterized by -The fact that the nucleic acid is introduced into the cell, by means of a viral vector, or by 1 hypo-Infection.
6. DNA encoding a modified NGF receptor which is shown in SEQ ID NO 1, as well as its complementary sequence.
7. A eukaryotic cell containing an acid nucleic according to claim 6. Use of a nucleic acid, which encodes a receptor of cell surface and in which the region coding domain intrace1 lui are was completely or partially delete modified such that so that the domain does not be able to essentially more carry out any transduction of signal by means of expression of said receptor of cell surface modified and presentation of the receptor at the cell surface in such a way that it can be used as a marker such that the receptor selectable for transfected eukaryotic cells 9. Method for the immunoselection of transfected cells, by introducing a nucleic acid that encodes for a cell surface receptor in which the region encoding the intracellular domain of the receptor has been completely or partially deleted or modified in such a way that the receptor presented on the surface cannot, after bind to its ligand, perform any signal transduction, identify transfected cells by incubating the cells with a labeled antibody that specifically binds to said receptor, and recover the cells by dissociating the antibody / cell complex.
10. Method for the immunoseparation of transfected cells, by introducing a DNA that I encodes for a cell surface receptor in which the coding region for the intracellular domain of the receptor has been completely or partially deleted or modified such that the receptor presented on the surface cannot, after binding to its ligand, perform any signal transduction, incubating the cells with an antibody against the immobilized receptor before or after incubation, separating the immobilized cells from the 1 5antibody from non-bound cells, and isolation of the cells for dissociation of the antibody-receptor bond. Rome, , j p.: Foundation Centro San Romanello del Monte Tabor ING. GARZANO’ & ZANARDO ROMA S.p.A. U / J 7<. ! / O for king and for the others Antonio Tedierei© »cr. 171)