Methods of preparing and analyzing nucleic acid libraries

Abstract

To provide methods for detecting different mutations such as single nucleotide polymorphism (SNP) and copy number variation (CNV) in the same sample.SOLUTION: A method of detecting SNP and CNV in a sample comprises: a) obtaining a sample comprising nucleic acid molecules; b) subjecting the nucleic acid molecules to a population of primers for whole genome amplification or whole transcriptome amplification and to at least one target-specific primer for targeted amplification to generate a mixture of amplicons produced by the whole genome amplification or whole transcriptome amplification and the targeted amplification; c) sequencing the mixture of amplicons using a sequencing assay on a sequencer to generate sequencing reads; and d) assessing the sequencing reads to determine the SNP and CNV in the sample. The methods described herein can be useful in preimplantation genetic testing, carrier screening, or genotyping.SELECTED DRAWING: Figure 1

Description

Summary of the Invention [Problem to be solved by the invention]

[0001] Detecting different mutations in the same sample is essential, especially when the amount of sample is limited and when high-throughput methods are desired to detect mutations quickly. Routinely used methods in the art require separate assays to detect different mutations or mutation types (e.g., single nucleotide polymorphisms (SNPs) or copy number variations (CNVs)) in a sample. Using separate assays may result in the risk of missing clinically important mutations with limited amount of sample. [Means for solving the problem]

[0002] The present disclosure provides methods for detecting different mutations, such as SNPs and CNVs, in the same sample. The methods described herein may be useful for preimplantation genetic testing, carrier screening, or genotyping.

[0003] In one aspect, the present disclosure provides a method for detecting single nucleotide polymorphisms (SNPs) and copy number variations (CNVs) in a sample, comprising: a) obtaining a sample containing a nucleic acid molecule; b) exposing the nucleic acid molecule to a population of primers for whole genome or whole transcriptome amplification and at least one target-specific primer for target amplification to generate a mixture of amplicons generated by the whole genome or whole transcriptome amplification and the target amplification; c) sequencing the mixture of amplicons using a sequencing assay on a sequencer to generate sequencing reads; and d) evaluating the sequencing reads to determine the SNPs and CNVs in the sample.

[0004] In some embodiments, the nucleic acid molecules are amplified using the polymerase chain reaction. In some embodiments, the plurality of nucleic acid molecules is at least 50 base pairs. In some embodiments, the nucleic acid molecules comprise genomic DNA or RNA.

[0005] In some embodiments, the mixture of amplicons produced in step (b) is subjected to an additional target amplification using at least one nested primer pair to further amplify the amplicons produced by the target amplification.

[0006] In some embodiments, the method uses sequencing reads to genotype single nucleotide variations (SNVs), genotype microsatellites, detect insertions and / or deletions, determine zygosity, determine gender, detect gene fusions, detect one or more translocations, detect one or more mutations, or detect chromosomal abnormalities.

[0007] In some embodiments, the population of primers is non-self-complementary and non-complementary to other primers in the population, comprises a constant region and a variable region in a 5' to 3' direction, the sequence of the constant region has a known sequence that is constant among the multiple primers in the population, the sequence of the variable region is degenerate among the multiple primers in the population, and further, the sequences of the constituent constant region and variable region do not cross-hybridize or self-hybridize under conditions for carrying out steps (a)-(c).

[0008] In some embodiments, the primer as in (b) comprises at least 10 nucleotides. In some embodiments, the at least one target specific primer is specific for one or more target sequences. In some embodiments, the at least one target specific primer does not comprise an adapter sequence. In some embodiments, the at least one target specific primer comprises at least a portion of an adapter sequence. In some embodiments, the primer as in (b) comprises at least one modified nucleotide. In some embodiments, the melting temperature of the primer as in (b) is at least 30 degrees Celsius. In some embodiments, the at least one target specific primer comprises a single target specific primer pair. In some embodiments, the one or more target sequences comprise redundant genomic regions. In some embodiments, the redundant genomic regions comprise repetitive elements. In some embodiments, the repetitive elements comprise SVA elements.

[0009] In some embodiments, the sample is selected from the group consisting of blood, serum, plasma, cerebrospinal fluid, cheek scrape, nipple aspirate, biopsy sample, cervical sample, semen, body fluids, microorganisms, mitochondria, chloroplasts, cell lysates, urine, feces, hair follicles, saliva, sweat, immunoprecipitated or physically isolated chromatin, circulating tumor cells, tumor biopsy sample, exosomes, embryos, cell culture medium, spent medium for culturing cells, tissues, organoids or embryos, biopsy embryos, trophoblast cells, amniotic fluid, maternal blood, fetal cells, fetal DNA, cell free DNA, uterine washings, endometrial fluid, cumulus cells, granulosa cells, formalin fixed tissue, paraffin embedded tissue, or blastocyst cavity.

[0010] In one aspect, the disclosure provides a kit comprising: a) a population of primers for whole genome or transcriptome amplification, b) at least one target specific primer for target amplification, and d) a set of instructions for using the kit to detect copy number variation (CNV), genotype single nucleotide polymorphisms (SNPs), detect single nucleotide variations (SNVs), genotype microsatellites, detect insertions and / or deletions, determine zygosity, determine sex, detect gene fusions, detect translocations, detect one or more mutations, or detect chromosomal abnormalities. [Brief description of the drawings]

[0011] [Figure 1] FIG. 1 is a schematic diagram showing how the same nucleic acid sample can be used to perform whole genome amplification (WGA) using WGA primers to detect copy number variations (CNVs), and targeted amplification using target-specific primers to detect single nucleotide polymorphisms (SNPs). [Diagram 2] FIG. 1 shows an example of a protocol for preparing nucleic acid molecules to detect copy number variations (CNVs) and single nucleotide polymorphisms (SNPs) by performing whole genome amplification (WGA) and targeted amplification, respectively, using the same sample of nucleic acid molecules. [Diagram 3] 1 is a schematic diagram showing steps for generating nucleic acid library molecules for detecting SNPs and CNVs using the same sample of nucleic acid molecules. These steps may include a pre-amplification step with WGA and target amplification, an optional clean-up step, one or more library preparation steps such as a target amplification step using nested PCR, and an index PCR step to generate nucleic acid library molecules for sequencing. [Figure 4] FIG. 1 is a schematic diagram showing an embodiment of a redundant genomic element. [Diagram 5] 5A is a schematic diagram showing a SINE / VNTR / Alu (SVA) element (FIG. 5A) and a target-specific primer complementary to a region of the SVA element (FIG. 5B). [Figure 6]FIG. 1 is a schematic diagram showing a method for detecting SNPs and CNVs using the same sample of nucleic acid molecules by performing whole genome amplification (WGA) using WGA primers and targeted amplification using target-specific primers complementary to redundant genomic elements. [Figure 7] FIG. 1 is a schematic diagram showing the use of multiple target-specific primers spanning a target sequence. [Figure 8] 8A and 8B are graphs showing data from an experiment conducted using three different pre-amplification conditions: no target-specific primers, 30 target-specific primers, and 90 target-specific primers. Figure 8A shows the coverage in the three pre-amplification conditions. Figure 8B shows the variation in coverage as indicated by the coefficient of variation between the three pre-amplification conditions. [Figure 9] 9A and 9B are diagrams showing data from experiments in which preamplification was performed with or without target amplification. In both cases, i.e. with or without target amplification in the preamplification step, target amplification was performed after the preamplification step. Figure 9A shows the percentage of reads across the whole genome and target sequence, i.e., the CFTR gene, using assays with or without target amplification in the preamplification step. Figure 9B shows the average coverage of the whole genome and the CFTR gene with or without target amplification in the preamplification step. Figure 9C shows the coverage of sequencing reads across 15 different targets or variants in the CFTR gene from an assay in which the preamplification reaction includes target amplification, while Figure 9D shows the coverage from an assay in which the preamplification reaction does not include target amplification. [Figure 10] 10A-B are graphs showing coverage data of sequencing reads from experiments performed using five cells (FIG. 10A) or a single cell (FIG. 10B). [Figure 11] 11A-11B are graphs showing the distribution of sequencing reads from experiments performed using five cells (FIG. 11A) or a single cell (FIG. 11B). [Figure 12]12A and 12B are graphs showing data from experiments to assess correlation between replicates using 5 cell replicates (FIG. 12A) or a single cell replicate (FIG. 12B). FIG. 12C shows a genomic plot of the log2 ratio of reads in 1 Mb bins in two replicates. [Figure 13] FIG. 1 is a chart showing data from an experiment to demonstrate coverage across 15 different targets in the CFTR gene using target amplification alone without WGA for example carrier screening. [Figure 14-1] 14A and 14B are schematic diagrams showing a comparison between a conventional method (FIG. 14A) and the present method (FIG. 14B). [Figure 14-2]

[0023] Figures 14C and 14D show data using the present methods to detect single nucleotide polymorphisms (SNPs) and chromosomal aneuploidies in the CFTR gene in trophectoderm biopsies (n=4). Figure 14C provides data related to detecting SNPs in the CFTR gene, and Figure 14D provides data related to detecting aneuploidies using the present methods. [Figure 15] Figure 1. Visual representation of SNPs found within SVA elements across the human genome (assembly hg38). The bars at the top represent individual chromosomes 1-22, X, and Y. The graph at the bottom shows individual SNPs as dots across the genome. The Y-axis represents the minor allele frequency of each SNP. Black dots represent SNPs with a minor allele frequency of 0.05 or greater. Grey dots represent SNPs with a minor allele frequency of less than 0.05. [Figure 16] FIG. 1 shows an embodiment of target-specific primer pairs and the number of expected PCR products or amplicons for each target-specific primer pair. Sequences are listed from top to bottom as Alu-like primer sequences (SEQ ID NOs: 1-10); SINE-R primer sequences (SEQ ID NOs: 11-20). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0012] Methods are provided for preparing and analyzing nucleic acid molecules by amplifying whole genome or whole transcriptome (WGA or WTA) in combination with targeted amplification to amplify whole genome and target sequences from the same sample of nucleic acid molecules. The methods may be useful for detecting various mutations, such as copy number variations (CNVs), insertions and / or deletions (indels), single nucleotide polymorphisms (SNPs), etc., within the same sample. The methods are used in clinical trials (e.g., carrier screening, embryo screening, spent media testing), forensic analysis, etc.

[0013] Before describing the present invention in more detail, it is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

[0014] Where a range of values ​​is provided, unless the context clearly dictates otherwise, it is understood that each intervening value between the upper and lower limit of that range, to the tenth of the unit of the lower limit, and any other stated or intervening value in that stated range, is included in the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also included in the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

[0015] Certain ranges are set forth herein, with the numerical values ​​preceded by the term "about." The term "about" is used herein to provide literal support for the exact number it precedes, as well as a number that is close to or approximately the number it precedes. In determining whether a number is close to or approximately equal to a specifically stated number, the near or approximate unstated number may be a number that, in the context in which the number is presented, results in a substantial equivalence to the specifically stated number.

[0016] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, representative and illustrative methods and materials are described herein.

[0017] All publications and patents cited herein are incorporated by reference as if each individual publication or patent was specifically and individually indicated to be incorporated by reference, and are incorporated by reference herein to describe or describe the methods and / or materials in connection with which the publications are cited. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the publication dates provided may be different from the actual publication dates which may need to be independently confirmed.

[0018] It should be noted that, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. It should be further noted that the claims may be drafted to exclude any and all optional elements. Thus, this statement is intended to serve as a prelude to using exclusive terminology such as "sole," "only," or "negative" limitations in connection with the recitation of claim elements.

[0019] As will be apparent to those skilled in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has distinct components and features which may be readily separated from or combined with the features of any of the other embodiments without departing from the scope or spirit of the invention. Any method described may be carried out in the order of events described or in any other order which is logically possible.

[0020] Although the apparatus and methods have been described or will be described for grammatical fluidity with functional descriptions, unless expressly recited under 35 U.S.C. 112, the claims should not be construed as necessarily limited in any way by means- or step-limitation constructions, but should be given the full scope of meaning and equivalents of the definitions provided by the claims under the doctrine of equivalents, and where a claim is expressly recited under 35 U.S.C. 112, it should be expressly understood that the full legal equivalents under 35 U.S.C. 112 are accorded.

[0021] method As summarized above, the methods described in this disclosure relate to the preparation and analysis of nucleic acid molecules for detecting various variations (e.g., copy number variations and single nucleotide polymorphisms) in the same sample, e.g., blood, cells, spent medium, or extracted nucleic acid. In general, the methods amplify nucleic acid molecules using primers for whole genome amplification (WGA) or whole transcriptome amplification (WTA) in combination with and / or followed by target amplification of target sequence(s) using target-specific primers. For example, as shown in FIG. 1, using the same nucleic acid sample, WGA using whole genome amplification (WGA) primers for detecting copy number variations (CNV) can be performed in combination with target amplification using target-specific primers containing SNPs for detecting SNPs.

[0022] The methods disclosed herein may include various steps. One example of such a protocol is provided in Figures 2 and 3. The protocol may include obtaining a sample containing nucleic acid molecules, lysing the sample to extract the nucleic acid molecules from the sample, subjecting the nucleic acid molecules to a pre-amplification step to amplify the whole genome using WGA / WTA primers and to amplify the target sequence(s) using target specific primers in combination with target amplification, optionally performing a clean-up step, and then subjecting the amplicons to a library preparation procedure to prepare library molecules for sequencing, etc. The library preparation step may include one or more steps for attaching sequences required for the sequencing assay. The library preparation step may include two or more steps, for example, the pre-amplification step does not include target amplification, or the pre-amplification step includes target amplification, but an additional target amplification may be applied after the pre-amplification step. If an additional target amplification is performed after the pre-amplification step, a nested PCR may be performed to further amplify the target sequence(s) and attach adapter sequences (e.g., P5 or P7). Nested PCR may be performed using primers that are nested within the target-specific primers used in the pre-amplification step. In some cases, the library may be prepared in a single step to attach adapter sequences and indexes in a single reaction. For example, the pre-amplification step may include target amplification, and an additional target amplification following the pre-amplification step may be optional. In this case, the library may be prepared in a single step, for example during index PCR. Index PCR may be performed following either the pre-amplification step and / or the target amplification to attach an index (e.g., index 1 or index 2) to the amplicon. The various steps of the method are described in more detail below in Figures 1-3.

[0023] sample The disclosed methods can be used with a variety of samples that contain nucleic acid molecules such as DNA or RNA. In some cases, the sample can be blood, serum, plasma, cerebrospinal fluid, cheek scrape, cervical fluid / cells, nipple aspirate, biopsy sample, semen, urine, feces, hair follicle, saliva, sweat, immunoprecipitated or physically isolated chromatin, circulating tumor cells, tumor biopsy sample, exosomes, embryo, cell culture medium, spent medium for culturing cells, tissues, organoids or embryos, biopsied embryo (such as one or more cells from the inner cell mass (ICM) of a blastocyst or one or more cells from the trophectoderm (TE) - i.e., trophectoderm cells), amniotic fluid, formalin-fixed tissue, maternal blood, fetal cell(s), cell-free DNA, uterine washings, endometrial fluid, cumulus cells, granulosa cells, cancer cell(s), paraffin-embedded tissue, or blastocyst. In some cases, the sample may be an oocyte or its polar body, a microorganism, a plant cell, an animal cell, a mitochondria, a chloroplast, a forensic sample, a cell lysate, a body fluid, a cervical sample, etc. Other types of samples that contain nucleic acid molecules may also be used.

[0024] Cell lysis and extraction of nucleic acid molecules A sample containing nucleic acid molecules can be lysed to release the nucleic acid molecules. In some cases, any method known in the art can be used to lyse the sample, including reagent-based and physical methods. For example, reagent-based methods can include the use of enzymes (e.g., lysozyme), and / or organic solvents (e.g., alcohol, chloroform, ether, EDTA, Triton, alkaline lysate). Examples of physical methods can include sonication, homogenizers, freeze-thaw cycles, grinding, and the like. In some cases, cell lysis may not be necessary, and the sample can be used directly to prepare nucleic acid molecules using the methods disclosed herein. For example, the sample can be cell-free DNA, which can be used in the methods of this disclosure.

[0025] In some embodiments, the amount / quantity of nucleic acid molecules that can be used in the methods described herein can be at least 0.5 picograms (pg), at least 1 pg, at least 2 pg, at least 5 pg, at least 10 pg, at least 20 pg, at least 30 pg, at least 40 pg, at least 50 pg, at least 100 pg, at least 200 pg, at least 500 pg, at least 1 nanogram (ng), or greater than 1 ng. Other amounts can be used in the methods of this disclosure.

[0026] In some embodiments, the quality of the nucleic acid molecules that can be used in the methods of this disclosure can be high quality nucleic acid molecules that do not contain significant amounts of inhibitors, such as DNA extracted using methods disclosed in the art. In some cases, the sample of nucleic acid molecules can contain inhibitors, such as formalin-fixed samples.

[0027] Preamplification The nucleic acid molecules may be subjected to a pre-amplification step. The pre-amplification step may include exposing the nucleic acid molecules to primers for whole genome amplification (WGA) or whole transcriptome amplification (WTA). In some embodiments, the pre-amplification step may include target-specific primers for target amplification to generate a mixture of amplicons from WGA / WTA and target amplification. In some cases, the pre-amplification step may not include target-specific primers, and thus the pre-amplification step may generate amplicons only from WGA. In this case, the pre-amplification step may be followed by target amplification to amplify the target sequence(s) using target-specific primers. In embodiments where the pre-amplification reaction may include WGA / WTA primers in combination with target-specific primers to generate a mixture of amplicons, the mixture of amplicons may further be subjected to target amplification using nested primers within the amplicons generated by the target amplification in the pre-amplification step. In some particular embodiments, the pre-amplification step may not be performed. In this case, the nucleic acid molecules are subjected to target amplification to amplify the target sequence(s) using target-specific primers.

[0028] WGA or WTA can amplify substantially all fragments of nucleic acid molecules in a sample. WGA or WTA can amplify substantially the entire genome or transcriptome without losing the representation of specific sites. Substantially all or substantially all can refer to about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, or more of all sequences in the genome or transcriptome. WGA or WTA can include, in some cases, unequal amplification of certain sequences compared to other sequences, although the relative difference in such amplification is not important in some cases. WGA / WTA can target one or more sequences of a genome or transcriptome. In most cases, WGA / WTA can target at least about 100, at least about 10,000, at least about 100,000, at least about 1,000,000, at least about 10,000,000, at least about 100,000,000, at least about 1,000,000,000, or more sites within a genome or transcriptome. WGA and / or WTA can be performed using any suitable primers.Suitable WGA / WTA primers include, but are not limited to, primers provided in PicoPLEX® WGA kits, SMARTer® PicoPLEX® Single Cell WGA kits, SMARTer® PicoPLEX® DNA-seq kits, SMARTer® PicoPLEX® Gold Single Cell DNA-Seq kits, Ion ReproSeq™ PGS kits, MALBAC® Single Cell WGA kits, GenomePlex® WGA kits, REPLI-g® WGA and WTA kits, Ampli1™ WGA and WTA kits, Transplex® WTA kits, TruePrime® WGA kits, Quantitect® Whole Transcriptome kits, Doplify® WGA kits, GenoMatrix™ WGA kits, PG-Seq™ kits, Sureplex™ DNA Amplification System kits, IllustraGenomiPhi™ DNA Amplification kits.Suitable WGA / WTA primers are described, for example, in U.S. Pat. Nos. 7,718,403; 8,206,913; 9,249,459; 9,617,598; 5,731,171; 6,365,375; 1,001,7761; 8,034,568; 6,617,137; 6,977,148; 1,019,0163; 9,840,732; 9,777,316; 8,512,956; 8,349,563, the contents of each of which are incorporated herein by reference, and U.S. Patent Application Publication No. 2016 / 0355879, the contents of each of which are incorporated herein by reference. US Patent Application Publication No. 2018 / 0030522; US Patent Application Publication No. 2019 / 0271033; US Patent Application Publication No. 2013 / 0085083; US Patent Application Publication No. 2007 / 0054311; US ​​Patent Application Publication No. 2007 / 0178457; US Patent Application Publication No. 2011 / 0033862; US Patent Application Publication No. 2016 / No. 0312276; U.S. Patent Application Publication No. 2009 / 0099040; U.S. Patent Application Publication No. 2010 / 0184152; U.S. Patent Application Publication No. 2015 / 0072899; U.S. Patent Application Publication No. 2011 / 0189679; U.S. Patent Application Publication No. 2019 / 0300933; U.S. Patent Application Publication No. 2016 / 0289740.

[0029] Similarly, a target specific primer can amplify one or more sequences of a genome or transcriptome during target amplification. In some cases, a target specific primer can amplify one sequence, two sequences, three sequences, ten sequences, one hundred sequences, one thousand sequences, ten,000 sequences, one hundred,000 sequences, one million sequences, ten million sequences, or more. In some cases, a target amplification can amplify the same sequence using one or more target specific primers. In other cases, a target amplification can amplify different sequences of a genome or transcriptome. In some cases, a "target specific primer" refers to a primer that selectively and predictably hybridizes to a target sequence under conditions suitable for hybridization. In some cases, a "target sequence" or a "target sequence of interest" and derivatives thereof generally refer to any single-stranded or double-stranded nucleic acid sequence that can be amplified according to the present disclosure, including any nucleic acid sequence suspected or expected to be present in a sample. In some embodiments, the target sequence is present in double-stranded form and includes at least a portion or a complement of a specific nucleotide sequence that is amplified or synthesized prior to the addition of the target-specific primer. The target sequence can include a nucleic acid to which the target-specific primer can hybridize prior to extension by the polymerase. In some cases, the target-specific primer amplifies a target sequence that includes one or more mutational hotspots, genomic markers, SNPs of interest, redundant genomic elements (e.g., SVA elements), coding regions, exons, genes, introns, non-coding regions, promoter regions, pseudogenes, intron-exon junctions, and intergenic regions. In some cases, the target-specific primer can amplify a target sequence that includes one or more genomic regions of interest, such as, for example, a gene of interest (e.g., the CFTR gene) or one or more regions of a gene of interest. In some cases, the target-specific primer can amplify a target sequence that includes one or more SNPs of interest. In some cases, the target-specific primer can amplify a target sequence that includes a gene or genomic region associated with a genetic disorder, such as any of the genetic disorders disclosed herein.

[0030] In certain embodiments, one or more target sequences of the target-specific primers comprise redundant genomic regions or redundant genomic elements, i.e., genomic regions present throughout the genome, for example, in humans. The redundant genomic regions may be present on all chromosomes, for example, in a uniform manner. In some cases, the redundant genomic regions are present at multiple locations in the genome, such as, for example, at 1000 or more locations in the genome, at 2000 or more locations in the genome, at 3000 or more locations in the genome, at 4000 or more locations in the genome, at 5000 or more locations in the genome, at 6000 or more locations in the genome, at 7000 or more locations in the genome, at 8000 or more locations in the genome, at 9000 or more locations in the genome, at 10,000 or more locations in the genome, at 100,000 or more locations in the genome, at 1,000,000 or more locations in the genome, at 10,000,000 or more locations in the genome, or at 100,000,000 or more locations in the genome. In some cases, the redundant genomic region is present at multiple locations within the genome, ranging from 1000 to 10,000,000 locations within the genome, from 1000 to 1,000,000 locations within the genome, from 10,000 to 500,000 locations within the genome, or from 50,000 to 200,000 locations within the genome.

[0031] Genomic regions that are present in multiple locations within a genome may vary in sequence, for example, such that the genomic regions are uniquely mapped across the genome. In some cases, the redundant genomic regions are polymorphic (e.g., contain SNPs). As used herein in its conventional sense, "polymorphism" refers to a state in which two or more variants of a particular genomic sequence can be found in a population. In some cases, the redundant genomic regions include one or more polymorphic regions. Polymorphic regions may include insertions, deletions, structural variant junctions, variable length tandem repeats, single nucleotide polymorphisms, single nucleotide variations, copy number variations, or combinations thereof. In some cases, the polymorphic regions have minor allele frequencies in the range of 0.01 or more, 0.02 or more, 0.03 or more, 0.04 or more, 0.05 or more, 0.06 or more, 0.07 or more, 0.08 or more, 0.09 or more, 0.1 or more, 0.2 or more, 0.3 or more, or 0.4 or more. In some cases, the one or more polymorphic regions result in one or more SNPs per region, such as, for example, 1-5 SNPs per region, 10-20 SNPs per region, 10-40 SNPs per region, 15-35 SNPs per region, 20-60 SNPs per region, or 20-50 SNPs per region. In some cases, the redundant genomic region includes one or more conserved regions. As used herein in its conventional sense, "conserved region" refers to a region in a heterologous polynucleotide or polypeptide sequence, or a polynucleotide or polypeptide sequence that is duplicated within a genome that exists in different species or where there is a relatively high degree of sequence identity between the different sequences. The sequence identity between the conserved regions may be at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%. In some cases, the redundant genomic region includes a polymorphic region flanked on both ends by conserved regions. In some cases, the redundant genomic region includes a non-coding region of the genome.A genomic region of interest may include, for example, one or more introns, one or more regulatory elements, one or more pseudogenes, one or more repeat sequences or elements, one or more viral elements (e.g., endogenous retroviral sequences), one or more telomeres, one or more transposable elements, one or more retrotransposons, one or more short tandem repeats, portions thereof, or combinations thereof.

[0032] The redundant genomic region may have any length suitable for amplification by the method. In some cases, the length of the redundant genomic region is in the range of 1000-4000 base pairs (bp), 1000-3000 bp, 1000-2000 bp, or 500-1500 bp. In some cases, the length of the genomic region is in the range of 1-500 base pairs (bp), 10-500 bp, or 100-500 bp.

[0033] 4 is a schematic diagram of an embodiment of a redundant genomic element present at multiple locations across the genome (top) and an embodiment of a redundant genomic element having a polymorphic region flanked by conserved regions on both ends (bottom). The redundant genomic elements may be found throughout the genome and are relatively uniformly present in all chromosomes. The genome may contain 1500-3000 or more copies, 3000-30000 or more copies, 30000-300000 or more copies of the redundant genomic element, which corresponds to approximately one region of SNP every 1-2 Mb of the genome.

[0034] In some cases, the redundant genomic regions contain repetitive elements or sequences. The repetitive elements may include one or more tandem repeats, one or more interspersed repeats, or a combination thereof.

[0035] The tandem repeats may include one or more satellite DNAs, one or more minisatellites (long tandem repeats; repeat units of 10-100 bp), one or more microsatellites (short tandem repeats; repeat units of less than 10 bp), or combinations thereof. In some cases, the redundant genomic regions include VNTRs (variable number of tandem repeats). In some cases, the redundant genomic regions include macrosatellites (repeat units longer than 100 bp).

[0036] Interspersed repeats may be dispersed throughout the genome within gene sequences or between genes. Interspersed repeats may include one or more transposons. Transposons may be mobile genetic elements. Mobile genetic elements may change their position within the genome. Transposons may be classified as class I transposable elements (class I TEs) or class II transposable elements (class II TEs). Class I TEs (e.g., retrotransposons) may copy themselves in two steps, first from DNA to RNA by transcription, and then from RNA back to DNA by reverse transcription. They may then insert the DNA copy into a new location in the genome. Class I TEs may include one or more long terminal repeats (LTRs), one or more long interspersed nuclear elements (LINEs), one or more short interspersed nuclear elements (SINEs), or a combination thereof. Examples of LTRs include, but are not limited to, human endogenous retroviruses (HERVs), intermediate repeat 4 (MER4), and retrotransposons. Examples of LINES include, but are not limited to, LINE1 and LINE2. A SINE may comprise one or more Alu sequences, one or more mammalian global interspersed repeats (MIRs), or a combination thereof. Class II TEs (e.g., DNA transposons) often do not contain an RNA intermediate. DNA transposons are often excised from one site and inserted into another site in the genome. Alternatively, DNA transposons are replicated and inserted into a new location in the genome. Examples of DNA transposons include, but are not limited to, MER1, MER2, and mariner.

[0037] Interspersed repeats may include one or more retrotransposable elements (REs), including long interspersed nuclear elements (LINEs), short interspersed nuclear elements (SINEs), and SVA elements. SINEs are a class of REs that are usually less than 500 nucleotides in length, while LINEs are usually more than 500 nucleotides in length. (AFASmit, The origin of interspersed repeats in the human genome, Current Opinion in Genetics Development, 6(6):743-748(1996); Batzer, MA et al., Alu repeats and human genomic diversity, Nature Reviews Genetics, 3(5):370-379(2002); Batzer, MA et al., African origin of human-specific polymorphic Alu insertions, Proceedings of the National Academy of Sciences, 91(25):12288(1994); Feng, Q. et al., Human L1 retrotransposon encodes a conserved endonuclease required for retrotransposition, Cell, 87(5):905-916(1996); Houck, C. M. et al., A ubiquitous family of repeated DNA sequences in the human genome. genome, Journal of Molecular Biology, 132(3):289-306(1979);Kazazian, HH et al., The impact of L1 retrotransposons on the human genome, Nature Genetics, 19(1):19-24(1998);Ostertag, EM et al., Biology of mammalian L1 retrotransposons, Annual Review of Genetics, 35(1):501-538(2001)).Full-length LINE elements are approximately 6 kb in length, contain a polymerase II internal promoter and two open reading frames (ORFs), and terminate with a polyA tail. SINEs include Alu elements, which are primate-specific SINEs that have reached copy numbers of over 1 million in the human genome. SINEs were originally defined by their interspersed nature and length (75-500 bp), but have been further characterized by their RNA polymerase III transcription.

[0038] The third type of RE is a composite retrotransposon known as SVA (SINE / VNTR / Alu) elements (Wang, H. et al., SVA Elements: A Hominid-specific Retroposon Family, J. Mol. Biol. 354:994-1007 (2005)). SVA is evolutionarily young and is putatively recruited in trans by LINE-1 reverse transcriptase. SVA is currently active and may affect the host through a variety of mechanisms, including insertional mutagenesis, exon shuffling, alternative splicing, and generation of differentially methylated regions (DMRs). Each domain of SVA is derived from either a retrotransposon or a repeat sequence. Canonical SVAs average about 2 kilobases (kb) (e.g., about 1,650 bp), but SVA insertions may range in size from 700 to 4000 base pairs (bp) (Hancks, DC, and Kazazian, HH, SVA Retrotransposons: Evolution and Genetic Instability, Semin. Cancer Biol. 20:234-45 (2010)). SVAs are composite elements named for their major components: SINEs, variable number tandem repeats (VNTRs), and Alu. SVA elements contain features of retrotransposons, which are flanked by target site duplications (TSDs), terminated with poly(A) tails, and may be truncated and inverted during integration into the genome. Canonical SVAs typically contain five distinct regions, namely, the 5'-terminal (CCCTCT) n(SEQ ID NO: 25) Contains hexameric repeats, Alu-like domains, variable number tandem repeats (VNTR), SINE-derived regions (e.g., SINE-R, where R indicates retroviral origin), and poly(A) tails. As a result of the repeat domains, e.g., VNTR regions, the size of full-length SVA elements can vary widely. SVA may be classified into six subfamilies, named SVA_A, SVA_B, SVA_C, SVA_D, SVA_E, and SVA_F. Family homology ranges from 90-95% using consensus sequences per family. In the seventh subfamily, SVA-F1, (CCCTCT) n (SEQ ID NO:25) The hexamer is replaced by 5' transduction of the first exon of the MAST2 gene (Quinn, J. et al., The Role of SINE-VNTR-Alu (SVA) Retrotransposons in Shaping the Human Genome, Int. J. Mol. Sci. 20:5977 (2019)).

[0039] In some cases, the SVA element is polymorphic (e.g., includes a SNP). The polymorphic region of the SVA element may include any one or more of the domains and regions of the SVA element described herein. In some cases, the Alu-like domain of the SVA element is polymorphic. In some cases, the SINE-R region of the SVA element is polymorphic. In some cases, the conserved regions of the SVA element include one or more of a target site duplication domain, a hexameric repeat, a VNTR, and a polyA tail. An embodiment of an SVA element is provided in FIG. 5A (adapted from Wang, H. et al., SVA Elements: A Hominid-specific Retroposon Family, J. Mol. Biol. 354:994-1007 (2005)). The SVA element comprises two adjacent target site duplication domains, a hexameric repeat (CCCTCT) n(SEQ ID NO: 25), an Alu-like domain (335 nt) containing two partial Alu elements connected by SVA-U, a VNTR region (varies from 48 to 2,306 bp; average length: 819 bp), a SINE-R region (490 nt) formed from segments from human endogenous retroviruses (env, U3, R), and a polyA tail.

[0040] In some cases, redundant genomic regions contain pseudogenes. As used herein, "pseudogene" and "pseudogenes" refer to sequences that have high sequence similarity or sequence identity to an identified gene, but are generally not transcribed and translated due to non-functional promoters, missing start codons, or other defects. Most pseudogenes lack introns and primarily represent the coding sequence of the parent gene. In some cases, it has been shown that functional activation can occur in different organisms or tissues.

[0041] In some cases, the target amplification comprises amplifying a target sequence using one or more target-specific primer pairs. In some cases, the one or more target-specific primer pairs comprise 50 or less primer pairs, 15 or less primer pairs, 10 or less primer pairs, 9 or less primer pairs, 8 or less primer pairs, 7 or less primer pairs, 6 or less primer pairs, 5 or less primer pairs, 4 or less primer pairs, 3 or less primer pairs, 2 or less primer pairs, or a single primer pair. In certain embodiments, the method comprises amplifying a nucleic acid molecule using primers for WGA / WTA in combination with at least one target-specific primer comprising a single target-specific primer pair and / or using such target-specific primer later.

[0042] In some cases, the target-specific primers for target amplification in the method include a single primer pair for amplifying a redundant genomic region as described above. In some cases, the primers of the single primer pair are specific or complementary to the redundant genomic region, or one or more portions of the redundant genomic region, such as a polymorphic region of the redundant genomic region. In some cases, the primers of the single primer pair are specific to one or more regions or domains of a repeat element, such as an SVA element. In FIG. 5B, a primer of the primer pair is provided that is complementary to a portion of an Alu-like domain or a portion of a SINE-R domain. In some cases, one or more primers of the single primer pair are complementary to an Alu-like domain or a portion of an Alu-like domain of an SVA element. In some cases, one or more primers of the single primer pair are complementary to a SINE-R region or a portion of a SINE-R region of an SVA element. In some cases, the methods, which include targeted amplification using a single primer pair specific for a redundant genomic element, e.g., an SVA element, in addition to the WGA / WTA quasi-random primers, are used to perform SNP-based CNV calling, detection of uniparental disomy, detection of chromosomal mosaicism, or linkage analysis.

[0043] Figure 6 provides an embodiment of a method for detecting various mutations, such as SNPs and CNVs, by WGA and targeted amplification of redundant genomic elements. In Figure 6, quasi-random WGA primers provide shallow and uniform coverage of the genome, while target-specific primers for redundant genomic elements provide reliable coverage of SNP-containing regions.

[0044] In some cases, the length of the WGA / WTA primers and / or target-specific primers can be at least about 5 base pairs (bp), 6 bp, 7 bp, 8 bp, 9 bp, 10 bp, 11 bp, 12 bp, 13 bp, 14 bp, 15 bp, 16 bp, 17 bp, 18 bp, 19 bp, 20 bp, 21 bp, 22 bp, 23 bp, 24 bp, 25 bp, 26 bp, 27 bp, 28 bp, 29 bp, 30 bp, 31 bp, 32 bp, 33 bp, 34 bp, 35 bp, 36 bp, 37 bp, 38 bp, 39 bp, 40 bp, 50 bp, 60 bp, 70 bp, 80 bp, 90 bp, 100 bp, or more.

[0045] In some cases, the melting temperature of the WGA / WTA primers and / or the target-specific primers can be at least about 10° C., 15° C., 20° C., 25° C., 30° C., 35° C., 40° C., 45° C., 50° C., 60° C., 65° C., 70° C., or higher. In some cases, the WGA / WTA primers can have the same melting temperature as the target-specific primers. In other cases, the WGA / WTA primers can have a different melting temperature than the target-specific primers.

[0046] In some cases, the GC content of the WGA / WTA primers and / or the target-specific primers can be at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, or more than 60%. In some cases, the WGA / WTA primers can have the same GC content as the target-specific primers. In other cases, the WGA / WTA primers can have a different GC content than the target-specific primers.

[0047] In some cases, the concentration of the WGA / WTA primers and / or target-specific primers can be 1 nanomolar (nM), 10 nM, 20 nM, 30 nM, 40 nM, 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, 100 nM, or more. In some cases, the concentration of the WGA / WTA primers and / or target-specific primers can be at least 5 micromolar (μM), 10 μM, 15 μM, 20 μM, 25 μM, 30 μM, 40 μM, 50 μM, 100 μM, 200 μM, 300 μM, 400 μM, 500 μM, 600 μM, 700 μM, 800 μM, 900 μM, or more. In some cases, the WGA / WTA primers can have the same primer concentration as the target-specific primers. In other cases, the WGA / WTA primers can have a different primer concentration than the target-specific primers.

[0048] In some cases, the size of the amplicon generated by the WGA / WTA primer and / or the target-specific primer can be at least about 50bp, 100bp, 150bp, 200bp, 250bp, 300bp, 350bp, 400bp, 450bp, 500bp, 550bp, 600bp, 650bp, 700bp, 750bp, 800bp, 850bp, 900bp, or more. In some cases, the WGA / WTA primer can generate an amplicon of substantially similar size to the target-specific primer. In other cases, the WGA / WTA primer can generate an amplicon of substantially different size from the target-specific primer. In some cases, the WGA / WTA primer can generate an amplicon of substantially similar size during WGA or WTA. In some cases, the WGA / WTA primer can generate an amplicon of substantially different size during WGA / WTA. In some cases, the target-specific primers can generate amplicons of substantially similar size during target-specific amplification of one or more target sequences. In some cases, the target-specific primers can generate amplicons of substantially different size during target-specific amplification of one or more target sequences. In some cases, the WGA / WTA primers and the target-specific primers amplify the same or substantially the same region of the genome. For example, the target-specific primers can be nested within the WGA / WTA primers, and vice versa. In some examples, the WGA / WTA primers and the target-specific primers can generate the same or substantially the same amplicons. For example, the WGA / WTA primers and the target-specific primers can share the same or substantially the same binding site in the nucleic acid molecule.

[0049] In some cases, the WGA / WTA primers and / or target-specific primers can have different nucleotide sequences. For example, all or substantially all of the WGA / WTA primers in the population can have different nucleotide sequences. Similarly, all or substantially all of the target-specific primers in the population can have different nucleotide sequences, especially when more than one sequence is targeted, such as in a multiplex reaction.

[0050] In some cases, the WGA / WTA primers and / or target-specific primers can include additional sequences, such as adapter sequences, or barcodes, such as unique molecular barcodes, as described in Winzeler et al., (1999) Science 285:901; Brenner (2000) Genome Biol. 1:1 Kumar et al., (2001) Nature Rev. 2:302; Giaever et al., (2004) Proc. Natl. Acad. Sci. USA 101:793; Eason et al., (2004) Proc. Natl. Acad. Sci. USA 101:11046; and Brenner (2004) Genome Biol. 5:240, each of which is incorporated by reference in its entirety. For example, the WGA / WTA primers can include substantially the entire or a portion of the Illumina adapter sequences, such as sequences for flow cell attachment sites (e.g., P5, P7), sequences for sequencing primer binding sites (e.g., read primer 1, read primer 2), index sequencing, etc. In some cases, the WGA / WTA primers and / or target specific primers do not include any additional sequences. In some other cases, the WGA / WTA primers can include additional sequences, but the target specific primers do not include any additional sequences. The target specific primers may include additional sequences based on the step in which the target amplification is performed and the number of target amplifications performed. For example, if target amplification is performed in combination with WGA and / or if target amplification is performed and then WGA is performed, the target specific primers used in the target amplification performed following WGA may include a complete or partial adapter sequence. On the other hand, if the target specific primers are included in combination with the WGA primers in the pre-amplification step and not in any subsequent steps, the target specific primers may include an adapter sequence.

[0051] In some cases, the WGA / WTA primer and / or target specific primer can have one or more modified nucleotides, such as locked nucleic acid (LNA), protein nucleic acid (PNA), methylated nucleic acid, etc. In some cases, the modifications can include nucleic acids with one or more phosphorothioate bonds, fluorophore(s), biotin, amino modifiers, thiol modifiers, alkyne modifiers, azide modifiers, spacers, etc. Modified nucleotides can be useful for crosslinking, duplex stabilization, or nuclease resistance. For example, modified nucleotides can be useful for protecting nucleic acid molecules from the activity of exonucleases or polymerases with exonuclease activity. In some cases, the WGA / WTA primer and / or target specific primer can have modified nucleotide(s) at one or both ends (e.g., 5' end, 3' end) of the oligonucleotide. In some cases, the WGA / WTA primer and / or target specific primer can have modified nucleotide(s) at one end (e.g., 5' end or 3' end) of the oligonucleotide.

[0052] In some cases, the WGA / WTA primers and / or target-specific primers may be designed to be substantially non-self-complementary and substantially non-complementary to other primers in the population. For example, the WGA / WTA primers may be designed to include non-complementary bases such as guanine (G) and thymine (T) or cytosine (C) and adenine (A) to limit base interactions within the population, prevent excessive primer-dimer formation, reduce dropout of complete or sporadic loci, reduce the generation of very short amplification products, and / or reduce the inability to amplify single-stranded, short or fragmented DNA and RNA molecules. In some cases, the WGA / WTA primers and / or target-specific primers may have one or more degenerate nucleotides, and identities may be selected from a variety of choices of nucleotides instead of a defined sequence. The degenerate nucleotides may be evenly spaced throughout the WGA / WTA and / or target-specific primers. Degenerate nucleotides may be evenly spaced by including degenerate nucleotides at specific positions, such as every other base, every third base, or every third base, or any other sequence that the experimenter finds useful for his particular application. In other cases, degenerate nucleotides may be restricted to the degenerate or variable region of the primer. An example of a degenerate or variable region may include one or more "N" residues, where N is any base. Such degenerate or variable regions may be at the 5' and / or 3' ends of the primer sequence. In some cases, the 5' end may include one or more nucleotides in addition to non-self-complementary and non-complementary bases. In some cases, the variable or degenerate region of the WGA primer may include an adapter sequence, such as, for example, an Illumina adapter sequence, P5 or P7. In some cases, additional sequences may be included between the constant region and the variable or degenerate region or either end of the WGA / WTA primer.

[0053] In some cases, the WGA / WTA primers and / or target-specific primers can be complementary to adjacent or overlapping positions on the nucleic acid molecule. For example, as shown in FIG. 7, both forward and reverse target-specific primers can be designed to be adjacent to each other on the nucleic acid molecule. Such target-specific primers can generate multiple amplicons resulting from various combinations of forward and reverse primers. As shown in FIG. 7, three forward primers and three reverse primers can generate nine different amplicons. Such an approach can result in greater amplification of target sequences with mutations, e.g., SNPs, which can help cover more of the regions of interest than the regions of little interest.

[0054] In some cases, the WGA / WTA primers and the target-specific primers can respectively amplify the entire genome or transcriptome and the target sequence(s) simultaneously, substantially simultaneously, or one after the other (e.g., WTA / WGA followed by target amplification, or vice versa) during a pre-amplification step.

[0055] In some cases, WGA / WTA and target amplification may occur in the same tube, well, cavity, chamber, drop, droplet, solution, reaction, etc. In some cases, reagents for WGA / WTA and target amplification may be mixed together and dispensed into a reaction volume. In some other cases, reagents for WGA / WTA may be dispensed into a reaction volume first, followed by reagents for target amplification, or vice versa. In other words, reagents for target amplification may be layered on top of reagents for WGA / WTA. In some cases, target amplification and WGA / WTA amplification are performed simultaneously or substantially simultaneously in the same reaction mixture. In some cases, target amplification and WGA / WTA amplification are performed sequentially in the same reaction mixture. For example, a target-specific primer may amplify its target sequence before a WGA / WTA primer amplifies its target sequence, or vice versa. In another example, a target-specific primer and a WGA / WTA primer may amplify their target substantially simultaneously or simultaneously.

[0056] In some cases, the target-specific primers can be substantially complementary to the target sequence(s). For example, the target-specific primers can be at least about 50%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% complementary to the target sequence(s). In some cases, the target-specific primers can amplify target sequence(s) that are likely to contain mutation(s), such as SNPs. In some cases, the target-specific primers can amplify target sequence(s) that contain two or more mutations, such as two different SNPs. In some cases, the target-specific primers can amplify target sequence(s) that contain two or more different types of mutations, such as SNPs and SNVs.

[0057] In some embodiments, WGA / WTA in combination with target amplification can result in a mixture of amplicons including WGA / WTA amplicons and target amplicons. In some cases, the mixture of amplicons may include equal or substantially equal portions of WGA / WTA amplicons and target amplicons. In some cases, the mixture of amplicons may include a portion of WGA / WTA amplicons that is larger or substantially larger than the target amplicons. For example, the WGA / WTA amplicons can comprise 90% or more of the mixture of amplicons, while the target amplicons can comprise 10% or less of the mixture of amplicons.

[0058] In some embodiments, the mixture of amplicons can be sequenced directly on a sequencer. In some cases, the mixture of amplicons can be subjected to a cleaning procedure, target amplification, index PCR, and / or any additional amplification procedure before sequencing. For example, the mixture of amplicons can be cleaned to remove primers and other reagents (e.g., amplification reagents, lysis reagents, etc.), and then a nested PCR can be performed to amplify the target amplicons before sequencing both the WGA amplicons and the target amplicons on a sequencer.

[0059] Cleaning Step A cleaning step can be performed after cell lysis or after one or more amplification steps. The cleaning step can be useful in any cleaning step to remove polymerases, lysis reagents, amplification reagents, primers, unincorporated dNTPs, etc., that may interfere with and / or inhibit downstream processes such as target amplification, index PCR, sequencing assays, etc. The cleaning step can be performed using any one of the procedures known in the art. For example, the mixture of amplicons generated by WGA in combination with target amplification can be cleaned to remove unincorporated dNTPs, amplification reagents, etc., by column-based, gel-based, enzyme-based, and / or bead-based purification techniques.

[0060] Target Amplification Target amplification can be performed after WGA / WTA in combination with WGA / WTA in a pre-amplification step. In other cases, the pre-amplification step may include only WGA / WTA, and target amplification may be performed after the pre-amplification step. In some other cases, a pre-amplification step may not be performed, and the nucleic acid molecule is subjected to target amplification to amplify the target sequence(s) using target-specific primers.

[0061] Target amplification performed in combination with WGA / WTA in a pre-amplification step may generate a mixture of amplicons. This mixture of amplicons may be further amplified using nested primers within the target-specific primers used in the pre-amplification step of nested PCR. Nested PCR may result in sufficient representation of the target sequence(s) for sequencing in a sequencing assay. For example, a target sequence occurring at a low frequency may be first amplified in a pre-amplification step using target-specific primers and then amplified in an additional target amplification in nested PCR using nested primers. This ensures sufficient representation of the target sequence as indicated by sufficient coverage, as determined by the number of unique reads in the sequencing assay. The nested primers may share one or more characteristics with the WGA / WTA primers or the target-specific primers. For example, the nested primers may have a substantially similar GC content compared to the WGA / WTA primers or the target-specific primers. The nested primer may also include an adapter sequence (e.g., P5 or P7) as in the WGA / WTA primer, so that the generated nested amplicon can be further amplified by an index primer, allowing sequencing on a sequencing platform, such as Illumina. The adapter sequence present in the WGA / WTA primer or target-specific primer (e.g., nested primer) may include a partial Illumina sequence (e.g., GCTCTTCCGATCT) (SEQ ID NO: 21) or a complete sequence (e.g., AATGATACGGCACCACCGAGATCTACACXXXXXXXXACACTCTTTCCCTACACGACGCTCTTCCGATCT) (SEQ ID NO: 22), where X is A, C, G, or C, as part of the barcode index (e.g., sample index), depending on whether the user wishes to add a sequencing index indirectly via an index PCR step or directly during an additional target amplification step.The adapters do not have to be specific only to the Illumina sequencing platform; users may modify the adapter sequences to match any sequence suitable for their chosen sequencing platform.

[0062] In some cases, the length of nested primers used for target amplification can be at least about 5 base pairs (bp), 6 bp, 7 bp, 8 bp, 9 bp, 10 bp, 11 bp, 12 bp, 13 bp, 14 bp, 15 bp, 16 bp, 17 bp, 18 bp, 19 bp, 20 bp, 21 bp, 22 bp, 23 bp, 24 bp, 25 bp, 26 bp, 27 bp, 28 bp, 29 bp, 30 bp, 31 bp, 32 bp, 33 bp, 34 bp, 35 bp, 36 bp, 37 bp, 38 bp, 39 bp, 40 bp, 50 bp, 60 bp, 70 bp, 80 bp, 90 bp, 100 bp, or more, either in full length or in the target specific region.

[0063] In some cases, the melting temperature of the nested primer, with or without the adapter sequence(s), can be at least about 40° C., 45° C., 50° C., 60° C., 65° C., 70° C., or higher. In some cases, the nested primer can have the same melting temperature as the target-specific primer. In other cases, the nested primer can have a different melting temperature than the target-specific primer.

[0064] In some cases, the GC content of the nested primers can be at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, or more than 60%. In some cases, the nested primers can have the same GC content as the target-specific primers and / or WGA / WTA primers. In other cases, the nested primers can have a different GC content than the target-specific primers and / or WGA / WTA primers.

[0065] In some cases, the concentration of nested primers in a nested PCR can be at least 1 nanomolar (nM), 10 nM, 20 nM, 30 nM, 40 nM, 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, 100 nM, 5 micromolar (μM), 10 μM, 15 μM, 20 μM, 25 μM, 30 μM, 40 μM, 50 μM, 100 μM, 200 μM, 300 μM, 400 μM, 500 μM, 600 μM, 700 μM, 800 μM, 900 μM, or more.

[0066] In some cases, the amplicons generated by the nested primers in a nested PCR can be at least about 50 bp, 100 bp, 150 bp, 200 bp, 250 bp, 300 bp, 350 bp, 400 bp, 450 bp, 500 bp, 550 bp, 600 bp, 650 bp, 700 bp, 750 bp, 800 bp, 850 bp, 900 bp, or more.

[0067] In some cases, the nested primer can have one or more modified nucleotides, such as locked nucleic acid (LNA), protein nucleic acid (PNA), methylated nucleic acid, etc. In some cases, the modifications can include nucleic acids with one or more phosphorothioate bonds, fluorophore(s), biotin, amino modifiers, thiol modifiers, alkyne modifiers, azide modifiers, spacers, and modified nucleotides can be useful to protect nucleic acid molecules from the activity of exonucleases or polymerases with exonuclease activity. In some cases, the nested primer can have modified nucleotide(s) at one or both ends (e.g., 5' end, 3' end) of the oligonucleotide. In some cases, the nested primer can have modified nucleotide(s) at one end (e.g., 5' end or 3' end) of the oligonucleotide.

[0068] Index PCR Either after the pre-amplification reaction or after target amplification (e.g., nested PCR), the amplicons or mixture of target amplicons can be subjected to an index PCR assay to add additional nucleic acid sequence(s), such as index 1, index 2, P5, P7, etc., that are necessary to perform a sequencing assay on a sequencer. For example, index primers containing Illumina adapter sequences required for compatibility and library clustering on different Illumina sequencers, such as MiSeq, NextSeq, MiniSeq, HiSeq, iSeq, NovaSeq, etc., can be added to the amplicons to generate nucleic acid libraries for further sequencing. Index primers containing barcodes can be used to demultiplex libraries after pooling into a single run or lane.

[0069] analysis After sequencing, a custom pipeline can be used to analyze the data to detect variants such as aneuploidy, copy number variation, etc. In some cases, the pipeline can include features such as trimming additional bases (e.g., adapter sequences), alignment to a reference sequence (e.g., hg19), sorting and marking of duplicate reads, and / or variant calling. In some cases, the pipeline can be customized to accommodate different index sequences. In some cases, shallow and uniform coverage of the genome as indicated by the number of unique reads may be sufficient (e.g., about 0.025×). In some cases, robust and deep coverage (e.g., >30×) may be required to detect variants such as SNPs or small indels. In some cases, shallow coverage can be used for detection of SNPs or small indels, such as using a pre-amplification step as described herein. Sequencing reads may need to be assigned based on the application, such as detection of CNVs, SNPs, or both.

[0070] kit Aspects of the present disclosure further include kits. The kits may include, for example, a population of primers for WGA / WTA, at least one target-specific primer for target amplification, etc. The kits may include a set of instructions for using the kit to detect CNVs, genotype SNPs, SNVs, genotype microsatellites, detect insertions and / or deletions, determine zygosity, detect gene fusions, detect translocation(s), or detect any other mutation(s). In some cases, the kits include proteases such as thermolysin, alkaline lysate (NaOH), sodium dodecyl sulfate (SDS), Triton X-100, digitonin, guanidine, 3-[(3-cholamidopropyl)dimethylammonio]-1-propane-sulfonate, laser pulse, electric pulse, sonication, glycerol, 1,2 propanediol, betaine monohydrate, Tween-20, formamide, tetramethylammonium chloride (AC), 7-deaza-2'-deoxyguanosine, dimethylsulfoxide (DMSO), Triton X-100, NP-40, magnesium, bovine serum albumin (BSA), ethylene glycol, dithiothreitol (DTT), KAPA HiFi and KAPA HiFi Uracil+, VeraSeq Ultra DNA polymerase, VeraSeq2.0 High Fidelity DNA polymerase, Takara PrimeSTAR DNA Polymerase, Agilent Pfu Turbo CX Polymerase, Phusion U DNA Polymerase, Deep VentR DNA Polymerase, LongAmp Tag DNA Polymerase, Phusion High-Fidelity DNA Polymerase, Phusion Hot Start High-Fidelity DNA Polymerase, Kapa High-Fidelity DNA Polymerase, Q5 High-Fidelity DNA Polymerase, Platinum Pfx High-Fidelity Polymerase, Pfu High-Fidelity DNA Polymerase, Pfu Ultra High-Fidelity DNA Polymerase, KOD High-Fidelity DNA Polymerase, iProofHigh-Fidelity Polymerase, High-Fidelity 2 DNA Polymerase, Velocity High-Fidelity DNA Polymerase, ProofStart High-Fidelity DNA Polymerase, Tigo High-Fidelity DNA Polymerase, Accuzyme High-Fidelity DNA Polymerase, VentR DNA Polymerase, DyNAzyme II Hot Start DNA Polymerase, Phire Hot Start DNA Polymerase, Phusion Hot Start High-Fidelity DNA Polymerase, Crimson LongAmp Tag DNA Polymerase, DyNAzyme EXT DNA Polymerase, LongAmp Tag DNA Polymerase, Phusion High-Fidelity DNA Polymerase, Standard Taq (Mg-free) Buffered Tag DNA Polymerase, Standard Tag Buffered Tag DNA Polymerase, ThermoPol II (Mg-free) Buffered Tag DNA Polymerase, ThermoPol Buffered Tag DNA Polymerase, Crimson Taq DNA polymerase, Crimson Taq DNA polymerase with (Mg-free) buffer, Phire Hot Start DNA polymerase, VentR (exo-) DNA polymerase, Hemo KlenTaq, Deep VentR (exo-) DNA polymerase, Deep VentR DNA polymerase, DyNAzyme EXT DNA polymerase, Hemo KlenTaq, LongAmp Tag DNA polymerase, Prot Script AMV First Strand cDNA Synthesis Kit, Prot Script M-MuLV First Strand cDNA Synthesis Kit, Bst DNA polymerase, full length, Bst DNA polymerase, large fragment, 9Nm DNA polymerase, DyNAzyme II Hot Start DNA polymerase, Hemo KlenTaq, Sulfolobus DNA polymerase IV, Therminator y DNA polymerase, Therminator DNA polymerase, TherminatorII DNA polymerase, Therminator III DNA polymerase, Bsu DNA polymerase, large fragment, DNA polymerase I (E. coli), DNA polymerase I, large (Klenow) fragment, Klenow fragment (3'¨>5'exo¨), phi29 DNA polymerase, T4 DNA polymerase, T7 DNA polymerase (unmodified), terminal transferase, reverse transcriptase and RNA polymerase, E. coli poly(A) polymerase, AMV reverse transcriptase, M-MuLV reverse transcriptase, phi6 RNA polymerase (RdRP), poly(U) polymerase, 5P6 RNA polymerase, and T7 RNA polymerase, magnesium salts, nucleotide triphosphates (dNTPs) and their derivatives, sodium chloride, potassium chloride, AMPure-Beckman Coulter, NucleoMag-MACHEREY-NAGEL, MagJet-ThermoFisher, Mag-Bind-Omega Magnetic (polystyrene) beads coated with negatively charged carboxyl groups like Biotek, ProNex beads-Promega, Kapa Pure Beads-Kapa Biosystems, QIAquick PCR Purification Kit and MinElute PCR Purification Kit-Qiagen, PureLink-Thermo Fisher Scientific, GenElute PCR Clean-Up Kit-Sigma, silica columns like NucleoSpin® gels and PCR Clean-up-MACHEREY-NAGEL, agarose or acrylamide gels, ethanol or isopropanol precipitation, phenol chloroform extracts, Tris buffer, tween-20, SDS, nucleotide triphosphates (dNTPs), dimethyl sulfoxide, dimethylformamide, Tris-HCIThe reagents may include one or more reagents selected from the group consisting of pH 8.4, ammonium sulfate, ammonium nitrate, potassium nitrate, TMA-SO4 (tetramethylammonium sulfate), TMA-Cl (tetramethylammonium chloride), glycerol, reagents required for sequencing (e.g., MiSeq reagents, NextSeq reagents), modified or unmodified primer oligonucleotides (e.g., LNA with phosphorothiolated bases), AMPureXP beads, silica membrane columns, ethanol, phenol-chloroform extracts, PEG extracts, or agarose gels.

[0071] usefulness The method is used to detect various mutations, such as SNPs, SNVs, CNVs, aneuploidies, translocations, gene fusions, etc., associated with genetic disorders. In certain embodiments, the method is used to detect chromosomal abnormalities and aneuploidies, such as uniparental disomy, to detect somatic variants in uterine washings, endometrial fluids, etc., to understand the cause of implantation failure or the cause of miscarriage, clinical samples, etc. In certain embodiments, the method is used to perform genome mapping and genome-wide association analysis, such as performing SNP-based CNV calling, determining the accuracy of CNV analysis by using SNPs, detecting chromosomal mosaicism, and performing linkage analysis. The method is used for carrier screening to screen individuals suspected of carrying potential mutations or known to carry those mutations. The method is used for screening embryos before implantation (e.g., using one or more cells of the embryo, using the medium in which the embryo was cultured, etc.) to detect mutations associated with genetic disorders. The method is used for screening fetal DNA or cell-free DNA from maternal samples (blood, cervix, etc.). The method is also used in determining contamination, such as maternal or paternal DNA or RNA contamination, in biopsied embryos or culture medium (such as spent medium in which embryos, cells, tissues, or organoids have grown). The method is used to determine heterozygosity or clonality in a sample. For example, the method can be used to screen samples, such as tumor biopsy samples, blood samples, circulating tumor cells, cell-free DNA, or exosomes, for genetic alterations, such as CNVs and SNPs. Such screening can help identify heterogeneity / clonality within a tumor cell population. This can help clinicians determine treatment options. In some cases, the method is used for human identification applications, forensic applications, DNA fingerprinting, DNA profiling, DNA typing (e.g., during transplantation or engraftment monitoring), or sex determination. In some cases, the method is used for biological ancestry or phylogenetic applications, kinship analysis, paternity testing, phylogenetic analysis, or evolutionary studies. In some cases, the method is used for pharmacogenetics and determining variability in response to drug therapy.

[0072] Examples of genetic disorders include achondroplasia, adrenoleukodystrophy, alpha thalassemia, alpha-1-antitrypsin deficiency, Alport syndrome, amyotrophic lateral sclerosis, beta thalassemia, Charcot-Marie-Tooth, congenital glycosylation disorder type 1a, Crouzon syndrome, cystic fibrosis, Duchenne and Becker muscular dystrophy, dystonia 1, torsion syndrome, Emery-Dreyfus muscular dystrophy, facioscapulohumeral dystrophy, familial adenomatous polyposis, familial amyloidotic polyneuropathy, familial dysautonomia, Fanconi anemia, fragile X syndrome, glutaric aciduria type 1, hemophilia A and B, hemophagocytic lymphohistiocytosis, Holt-Oram syndrome, Huntington's disease, hyperinsulinemic hypoglycemia, hypokalemic periodic paralysis, pigmentary incontinence, Lynch syndrome, Marfan syndrome, Menkes disease, aberrant urinary incontinence, and dysbiosis. chromatid leukodystrophy, mucopolysaccharidosis type II (Hunter syndrome), multiple endocrine neoplasms (MEN2), multiple exostoses, muscular dystrophy, neurofibromatosis types I and II, nonsyndromic sensorineural deafness, Norrie syndrome, osteogenesis imperfecta (brittle bone disease), polycystic kidney disease, autosomal dominant, polycystic kidney disease, autosomal recessive, Pompe syndrome, sickle cell anemia, Smith-Lemli-Opitz syndrome, spastic paraplegia, spinal and bulbar muscular atrophy, spinal cord ... , spinocerebellar ataxia 1, 2 and 3, spondyloarthritis (Schmidt), Tay-Sachs disease, Treacher Collins syndrome, tubercular sclerosis, von Hippel-Lindau syndrome, X-linked dystonia parkinsonism (XDP), X-linked agammaglobulinemia, leukemia, hereditary elliptocytosis and pyropoikilocytosis, autosomal recessive hypercholesterolemia, Fukuyama muscular dystrophy. The following example(s) are provided by way of illustration and not by way of limitation.

[0073] (Example) Example 1: Detection of copy number variations (CNV) and single nucleotide polymorphisms (SNPs) CNVs and SNPs were detected in the same sample using the present disclosure. Briefly, CNVs and SNPs were detected in samples containing a limited number of cells (e.g., a single cell or 5 cells) or genomic DNA (e.g., 30 pg of genomic DNA) using a pre-amplification step with WGA / WTA primers combined with target-specific primers, followed by target amplification using nested PCR assays with nested primers, and index PCR to add the necessary sequences to run the sequencing assay on a sequencer. Next-generation sequencing (NGS) assays were performed to generate sequence reads that were analyzed by a custom bioinformatics pipeline for the detection of CNVs and SNPs. This method allowed the detection of different mutations at a low sequencing depth of about 1 million reads.

[0074] The assay was performed using the SMARTer® PicoPLEX® Gold Single Cell DNA-Seq Kit (Takara Bio USA, R300669) with some modifications. The kit includes the following steps: cell lysis, whole genome amplification (WGA), DNA purification, and the addition of Illumina adapters for sequencing compatibility. The kit was modified to amplify specific regions of the CFTR gene using target-specific primers along with WGA. Therefore, the target-specific primers were added at the pre-amplification step and the nested primers were added after the pre-amplification step.

[0075] Target-specific primers were designed to amplify specific regions of the genome that contained the relevant SNP or variant, such as an indel, and were designed to have higher specificity for the target sequence than the rest of the genome. When designing the target-specific primers, the chromosomal location of other frequent SNPs that may affect primer specificity for the target sequence was considered. Target-specific primers that generated amplicons of approximately 600 base pairs (bp) were selected. To increase the likelihood of covering the desired target sequence, multiple target-specific primers were designed and mixed together to target multiple sequences. Target-specific primers were designed using tools such as ThermoBLAST (dnasoftware). A total of 90 target-specific primers were designed to target 15 regions of the CFTR gene, such that three primer pairs would amplify one target region. Primers were purchased from Integrated DNA Technology (Coralville, Iowa, USA).

[0076] First, the effect of the number of target-specific primers on the coverage of the CFTR gene was determined using 90 target-specific primers, 30 target-specific primers, or no target-specific primers combined with WGA primers. The 90 target-specific primers included three primer pairs per target region, while the 30 target-specific primers included one primer pair per target region. Preamplification reactions using the number of target-specific primers along with WGA primers were performed using 30 picograms (pg) of gDNA purchased from Coriell Institute (Camden, New Jersey, USA). Target-specific primers were included in the PreAmp Buffer and PreAmp Enzyme included in the SMARTer® PicoPLEX® Gold Single Cell DNA-Seq Kit at a concentration of approximately 20 nM of each target-specific primer.

[0077] Preamplification reactions were carried out using the following cycling conditions: Hot start: 95°C for 3 minutes - 1 cycle Target-specific amplification: 95°C for 15 s, 55°C for 90 s, 68°C for 90 s - 0 to 6 cycles WGA: 95°C for 15 s, 15°C for 50 s, 25°C for 40 s, 35°C for 30 s, 65°C for 40 s, 75°C for 40 s - 14 to 18 cycles

[0078] The number of amplification cycles was adjusted to obtain sufficient amounts of amplicons (e.g., 0.5-5 nanograms) for further analysis. If desired, target-specific amplification can be performed in a separate reaction from WGA. In this case, target-specific primers can efficiently amplify the target sequence(s) with optimal cycling conditions. The amplified DNA was then cleaned to remove primers, for example, using AMPure XP beads (Beckman Coulter, Cat. No. A63882).

[0079] As shown in Figure 8A, the coverage of 15 different target regions in the CFTR gene was compared between three different primer combinations - 0 target specific primers (0 booster primers), 30 target specific primers (15 forward primers and 15 reverse primers; 30 booster primers), and 90 target specific primers (45 forward primers and 45 reverse primers; 90 booster primers) were compared for coverage and variation in coverage across the gene. As shown in Figure 8A, the number of target specific primers was directly related to the coverage across the CFTR target sequence. The X-axis shows the 15 target regions within the CFTR target sequence. The Y-axis shows the number of sequencing reads or coverage, as indicated by the number of unique reads, across the CFTR target gene. For example, when 90 target-specific primers are used, a wider coverage of the target sequence is observed compared to when 30 target-specific primers or no target-specific primers are used. Next, as shown in FIG. 8B, 90 target-specific primers reduce the variation of coverage of the CFTR target sequence compared to when 30 target-specific primers or no target-specific primers are used. In other words, a more uniform coverage is observed when 90 target-specific primers are used compared to the coverage when 30 target-specific primers are used. The X-axis shows the number of primers in each reaction, and the Y-axis shows the coefficient of variation. When 90 target-specific primers are used, the coefficient of variation of coverage is less than 0.5, whereas when 30 target-specific primers or no target-specific primers are used, the coefficient of variation of coverage is close to 1.

[0080] Furthermore, targeted amplification of the CFTR region was performed using nested primers in a nested PCR assay. A total of 15 nested primer pairs were designed, with each primer containing two functional fragments at each end, i.e., one at the 5' end and one at the 3' end. The 5' fragment of the primer contained an Illumina adapter sequence. More specifically, the forward and reverse primers contained the 13 common bases of the P5 and P7 Illumina adapters. The forward primer contained 6 additional bases specific to P5, which are underlined (read 1): CACGAC GCTCTTCCGATCT (SEQ ID NO: 23), whereas the reverse primer contained seven additional bases specific for the underlined P7 (read 2); GACGTGTGCTCTTCCGATCT (SEQ ID NO: 24). The 3'-end fragment of the nested primer was designed to amplify a segment of the amplicon generated by the target-specific primer in the preamplification step. Primer specificity was considered during the selection and design of the nested primer. Similar to the target-specific primers used in the preamplification step, the target-specific nested primers were designed using tools such as ThermoBLAST (dnasoftware), and primers with restricted affinity to other regions of the genome compared to the region of interest were selected. When designing the nested primers, the chromosomal location of other frequent SNPs that may affect the specificity of the primers to the target sequence was also taken into consideration. Nested primers that generate amplicons of approximately 150 base pairs (bp) were selected. The location of the variant, SNP, or indel of interest in the amplicon generated by the nested PCR was considered to ensure that the variant was included in the sequencing reads generated by the sequencer. For example, because 2 × 75 base pair paired end reads were desired, nested PCR was performed such that the target SNP or mutation was included in the first 75 bases (e.g., 15-60 or 30-40 bases from the 3' end of either of the nested primers used to generate the amplicon). Multiple nested primers were mixed together to multiplex the number of targets amplified. Thirty nested primers at a final concentration of 25 nM were mixed with the Amplification Buffer (reduced magnesium version) and Amplification Enzyme from the SMARTer® PicoPLEX® Gold Single Cell DNA-Seq Kit. The nested PCR assay was performed using the following cycling conditions: 95°C for 3 minutes - 1 cycle 95°C for 30 s, 56°C for 2 min, 68°C for 30 s - 14 cycles

[0081] All contents of the nested PCR step were added to the Amplification Buffer and Amplification Enzyme of the SMARTer® PicoPLEX® Gold Single Cell DNA-Seq Kit and the index primers SMARTer DNA HT Dual Index Kit-24N (Takara Bio, Cat. No. R400664) or SMARTer DNA Unique Dual Index Kit-24U Sets A-D (Takara Bio, Cat. Nos. R400665-R400668) or SMARTer DNA HT Dual Index Kit-96N Sets A-D (Takara Bio, Cat. Nos. R400660-R400663). All index primers contained the required Illumina adapter sequences required for compatibility and library clustering on different Illumina sequencers such as Miseq, NextSeq, Miniseq, HiSeq, iSeq or NovaSeq. Barcodes were also included in the index primers to allow for demultiplexing of libraries generated from multiple different samples and sequenced simultaneously in the same sequencing run or sequencing lane.

[0082] Index PCR was carried out using the following cycling conditions: 95°C for 3 minutes - 1 cycle 95°C for 30 s, 63°C for 30 s, 68°C for 60 s - 4 cycles 95°C for 30 s, 68°C for 60 s - 6 to 10 cycles

[0083] The number of cycles was adjusted to obtain adequate product yields (e.g., 100-500 nanograms) during index PCR. The amplified libraries were cleaned to remove amplification reagents, primers, DNA polymerase, and others using AMPure XP beads (Beckman Coulter, Cat. No. A63882) according to the manufacturer's instructions. Libraries were further processed for 2 × 75 cycles on a MiSeq or NextSeq.

[0084] After sequencing, data were analyzed using a custom pipeline. First, fastq files were downsampled to a total of 1 million reads. Adapter sequences and the first 14 bases of the reads were trimmed, and low-quality reads were filtered using Trimmomatic (Bolger AM, Lohse M, and Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data, Bioinformatics. 2014 Aug 1;30(15):2114-2120). Alignment to the human genome assembly GRCh37 (Church DM et al. Modernizing reference genome assemblies, PLoS Biol. 2011 Jul;9(7):e1001091) was then performed with Bowtie2 (Langmead B, Salzberg S. Fast gapped-read alignment with Bowtie 2. Nature Methods. 2012,9:357-359). Variant calling was performed using Vardict (Lai Z, Markovets A, Ahdesmaki M, Chapman B, Hofmann O, McEwen R, Johnson J, Dougherty B, Barrett JC, and Dry JR. VarDict: a novel and versatile variant caller for next-generation sequencing in cancer research. Nucleic Acids Res. 2016, pii:gkw227).

[0085] CNVs can be detected with shallow but uniform coverage, whereas variants such as SNPs, SNVs or small indels may require deeper coverage. Therefore, the number of sequencing reads allocated to the coverage of the whole genome and the coverage of the targeted region of the CFTR gene was optimized to detect CNVs and SNPs, SNVs. To do so, the coverage of the genome and the CFTR gene was compared in two conditions: pre-amplification with WGA and targeted amplification and pre-amplification with WGA without targeted amplification. In both cases, targeted amplification was performed after the pre-amplification step. Thirty picograms of genomic DNA were used for the assay.

[0086] As shown in FIG. 9A, a higher percentage of reads of the CFTR gene was obtained when the pre-amplification step included target amplification compared to a pre-amplification step without target amplification. The X-axis shows the results of two assays - one with target amplification of the CFTR gene in the pre-amplification step and one without target amplification of the CFTR gene. The Y-axis shows the percentage of reads. A higher percentage of reads (12%) was obtained when the pre-amplification step included target amplification compared to the percentage of reads where the pre-amplification step did not include target amplification (4.3%). Conversely, a higher percentage of reads from WGA was observed when the pre-amplification step did not include target amplification (95.7%) compared to the reads from the assay where the pre-amplification step included target amplification (88%). As shown in FIG. 9B, a greater coverage was observed as indicated by the number of unique reads of the CFTR gene (8633×) in the assay with target amplification in the pre-amplification step compared to the coverage obtained in the assay without target amplification in the pre-amplification step (3184×). The X-axis shows the two different assays - with and without target amplification of the CFTR gene in a pre-amplification step. The Y-axis shows the average coverage. Furthermore, the uniformity of coverage across the 15 different regions in the CFTR gene was improved in the assay with target amplification included in the pre-amplification step (Figure 9C) when compared to the coverage without target amplification in the pre-amplification step (Figure 9D). The X-axis shows the 15 different target regions in the CFTR gene and the Y-axis shows the coverage or number of unique reads in each target region.

[0087] The uniformity of coverage across the 15 amplicons of the CFTR gene was assessed using 90 target-specific primers using single cells (n=4) and five sorted cells (n=4) in a preamplification step and index PCR to generate library molecules for subsequent target amplification and sequencing. As shown in Figure 10A and Figure 10B, more uniform coverage across the 15 target regions in the CFTR gene was observed in the five cell samples compared to the single cell samples. However, the uniformity of coverage was fully acceptable in both sample types for further analysis.

[0088] Next, the sequencing reads were analyzed to detect variants in the CFTR gene. As shown in Table 1, different variants and their allele frequencies were detected using single cells or five sorted cells for both GM07552 and GM012785. GM07552 cells contain the known variants Phe508DEL, Arg553TER, and have 7T / 9T alleles in the CFTR gene. GM12785 cells contain the known variants ARG347PRO, GLY551ASP, and 7T / 7T in the CFTR gene. In experiments performed on five sorted cells using GM07552 or GM12785, all heterozygous variants were accurately identified with allele frequencies between 0.2 and 0.8. No other variants were reported with an allele frequency above 0.1 when all bases covered by the panel (2,250 bases) were investigated. The false positive rate was virtually 0%. Similarly, heterozygous variants were identified using single cells.

[0089] [Table 1]

[0090] The distribution of sequencing reads in 1 Mb bins was determined using GM12785-5 cells or single cells, as shown in Figures 11A and 11B, respectively. As shown in Figures 11A and 11B, the number of reads per bin showed similar patterns between the 5 cell and single cell samples across the various bins, demonstrating the sensitivity and reproducibility of the assay.

[0091] The reproducibility of read distribution between GM12785 replicates of five sorted cells (N=4) as shown in FIG. 12A and single cell (N=4) as shown in FIG. 12B was assessed by calculating Pearson's correlation and Spearman's correlation. Strong correlation was observed in both replicates of five cells and single cells, indicating the reliability of whole genome amplification even in the presence of targeted primers. The log2 ratio of each bin was calculated between two replicates of five GM12785 sorted cells or single cells and plotted using IGV (Broad Institute) as shown in FIG. 12C. As shown, the bins were conserved between the two replicates and the expected copy number variation was observed in chromosome 9 and chromosome 4 of GM05067 and GM22601, respectively.

[0092] In summary, the addition of target-specific and nested primers to SMARTer® PicoPLEX® Gold Single-Cell DNA-Seq enabled robust and uniform coverage of the genome and deep coverage of 15 key regions of the CFTR gene from a single cell or five cells in a single tube workflow. The assay performed well when a total of 1 million reads were used. When five sorted cells were used, detection of the five different characterized heterozygous mutations was virtually 100%. No false positives were detected with the 2,250 base panel.

[0093] Example 2: Target Amplification for SNP Detection This example illustrates the use of target-specific primers to detect SNPs, for example, in carrier screening. 15 ng of genomic DNA, NA07552 or NA012785, was extracted from GM07552 or GM12785 cells, respectively. GM07552 cells contain known variants of CFTR, Phe508DEL, Arg553TER, and have alleles 7T / 9T. GM12785 cells contain known variants of CFTR gene, Arg347Pro, Gly551Asp, and have alleles 7T / 7T. The extracted genomic DNA, NA07552 or NA012785, was subjected to target amplification using 15 pairs of target-specific primers to amplify 15 different variants in the CFTR gene. Target-specific primers at a final concentration of 25 nM were mixed with the Amplification Buffer (reduced magnesium version) and Amplification Enzyme from the SMARTer® PicoPLEX® Gold Single Cell DNA-Seq Kit. Target amplification PCR was performed as follows. 95°C for 3 minutes - 1 cycle 95°C for 30 s, 56°C for 2 min, 68°C for 30 s - 14 cycles

[0094] The contents of the target amplification were Amplification Buffer and Amplification Enzyme from the SMARTer® PicoPLEX® Gold Single Cell DNA-Seq Kit, plus index primers SMARTer DNA HT Dual Index Kit-24N (Takara Bio, Cat. No. R400664) or SMARTer DNA Unique Dual Index Kit-24U Sets A-D (Takara Bio, Cat. No. R400665-R400668) or SMARTer DNA HT Dual Index Kit-96N Sets A-D (Takara Bio, Cat. No. R400660-R400663). All index primers contained Illumina adapter sequences required for compatibility and library clustering on different Illumina sequencers such as Miseq, NextSeq, Miniseq, HiSeq, iSeq, NovaSeq, etc. The index primers also contained barcodes used to demultiplex the libraries after pooling into a single run.

[0095] Index PCR was performed as follows. 95°C for 3 minutes - 1 cycle 95°C for 30 s, 63°C for 30 s, 68°C for 60 s - 4 cycles 95°C for 30 s, 68°C for 60 s - 6 cycles

[0096] The amplified libraries were cleaned to remove amplification reagents, primers, DNA polymerase, and others using AMPure XP beads (Beckman Coulter, Cat. No. A63882). The libraries were further processed on a MiSeq 2x75 cycles.

[0097] After sequencing, the data were analyzed using a custom bioinformatics pipeline. First, fastq files were downsampled to a total of 1 million reads. Adapter sequences and the first 14 bases of the reads were trimmed, and low-quality reads were filtered using Trimmomatic (Bolger AM, Lohse M, and Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data, Bioinformatics. 2014 Aug 1;30(15):2114-2120). Alignment to the human genome assembly GRCh37 (Church DM et al. Modernizing reference genome assemblies, PLoS Biol. 2011 Jul;9(7):e1001091) was then performed with Bowtie2 (Langmead B, Salzberg S. Fast gapped-read alignment with Bowtie 2. Nature Methods. 2012,9:357-359). Variant calling was performed using Vardict (Lai Z, Markovets A, Ahdesmaki M, Chapman B, Hofmann O, McEwen R, Johnson J, Dougherty B, Barrett JC, and Dry JR. VarDict: a novel and versatile variant caller for next-generation sequencing in cancer research. Nucleic Acids Res. 2016, pii:gkw227).

[0098] As shown in FIG. 13, uniform coverage across the 15 target regions in the CFTR gene was observed with only targeted amplification using the target-specific primers described in this disclosure. The X-axis shows the 15 target regions or variants in the CFTR gene. The Y-axis shows the coverage as indicated by the number of unique reads per target region. As further shown in Table 2, using only targeted amplification, all five heterozygous variants could be accurately identified with allele frequencies between 0.4 and 0.6. No other variants were reported with an allele frequency above 0.05 when all bases covered by the panel (2,250 bases) were surveyed. The false positive rate was virtually 0%.

[0099] [Table 2]

[0100] Based on this experiment, we conclude that targeted amplification can be used to detect SNPs, especially when WGA is not required or large amounts of input DNA are available. One such example may include the detection of SNPs in parental carrier screening.

[0101] Example 3: Detection of CFTR mutations in clinical samples This study was performed using trophectoderm biopsy samples collected from embryos that had already been subjected to conventional SNP and CNV analysis using a two-step method, whereby the first biopsy was used for SNP determination, and then the second biopsy was used for copy number determination. This is outlined in Figure 14A. Four embryos were derived from a mother who was determined to be a carrier of the pathogenic CFTR variant SNP, F1052V, and a father who was determined to be a carrier of the R117H variant. As shown in Figure 14A, the first biopsy revealed that Embryo 3 and Embryo 4 were compound heterozygotes, carrying pathogenic variants from both the mother and the father. Thus, these two embryos were not further screened for possible copy number variations (CNVs) using a second biopsy. Embryo 1 and Embryo 2 were carried forward for a second biopsy, and possible CNV aneuploidies were identified in Embryo 1 and Embryo 2.

[0102] In this example, a third biopsy was performed from the same four embryos using the methods described herein and was used to demonstrate how the methods of the present disclosure can identify both SNP and CNV abnormalities from a single biopsy test. This is shown diagrammatically in FIG. 14B. Trophectoderm biopsy samples (n=4), each containing approximately five cells, were taken and the methods of the present disclosure using a combination of WGA and targeted amplification were performed. The experiment was repeated twice from the same biopsy sample, and the results are shown in FIG. 14C. As shown in the top panel (FIG. 14C), the zygosity of each of the four embryos for maternal and paternal pathogenic CFTR variants was evaluated and found to be consistent with conventional methods in both cases, revealing that embryos 3 and 4 were compound heterozygotes, embryo 1 was a carrier of the maternal CFTR variant, and embryo 2 was wild type. The bottom panel (FIG. 14D) further shows the CNV analysis of the four embryos from one of the pairs of assays performed. This revealed that Embryo 1, Embryo 3 and Embryo 4 had normal karyotypes, whereas Embryo 2 showed partial loss of chromosome 19q, confirming the results obtained with the conventional two-step method. Embryo 1 was found to be wild type, which may reflect embryo mosaicism. In conclusion, the combined WGA / targeted sequencing method of the present invention is shown to be capable of determining SNP and CNV alterations from a single embryo biopsy, thus providing improved utility over the conventional two-step method of evaluating SNPs and CNVs separately.

[0103] Example 4: Detection of variants in SVA elements SNPs and CNVs were detected using samples of human genomic DNA and a preamplification procedure involving a single target-specific primer pair to amplify the redundant genomic element in combination with a primer pair for whole genome amplification. SVA elements were selected as candidates for redundant genomic elements because they are found on all autosomes and sex chromosomes at a density that allows for SNP-based analysis on all chromosomes (Table 3).

[0104] [Table 3]

[0105] The number and location of SVA elements were accessed from the Dfam database of repetitive DNA families using the hg38 human genome assembly. The density of SVA elements is based on the mappable portion of each chromosome using the hg38 human genome assembly.

[0106] To determine the number of SNPs contained within these SVA elements, the latest release of the Human SNP Database from the National Center for Biotechnology Information was used as a reference to determine the total number of SNPs and the number of informative SNPs (minor allele frequency ≧0.05) found within SVA elements (Table 4). The estimated 146,856 informative SNPs found within SVA elements occur on average once every 67,109 bp. Informative SNPs occur within SVA elements across all chromosomes (Figure 15).

[0107] [Table 4]

[0108] The SVA element contains seven different regions (Figure 5). Target-specific primer pairs were designed to amplify regions of the SVA element, such as the Alu-like or SINE-R regions. Fifty candidate target-specific primers were screened for their ability to amplify the target SVA element. The target-specific primers were designed using tools such as BiSearch Primer Design and Search Tool (Figure 16) (Aranyi et al., (2006)). Twenty-five different primer pair combinations of forward and reverse primers disclosed in Figure 16 were tested per region, i.e., per Alu-like or SINE-R region. A total of 50 primer pair combinations were tested, and target-specific primers that successfully amplified the target region and generated amplicon products close to the expected size were selected for incorporation into the pre-amplification step of the WGA / WTA method, as provided in this disclosure. From the 50 primer pairs, a total of 37 SVA-specific primer pairs were selected.

[0109] In summary, by incorporating SVA-specific primer pairs into the pre-amplification step of the whole genome amplification process, SNP-containing regions of SVA elements are amplified at a density and distribution across the human genome, and SNP-based analyses are performed as described in detail in the methods section of this patent application.

[0110] Although the foregoing invention has been described in some detail by way of illustration and example for clarity of understanding, it will be readily apparent to those skilled in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.

[0111] Thus, the above merely illustrates the principles of the invention. It is understood that those skilled in the art may devise various configurations that embody the principles of the invention and fall within its spirit and scope, although not expressly described or shown herein. Furthermore, all examples and conditional language described herein are intended primarily to aid the reader in understanding the principles of the invention and the concepts the inventors contribute to furthering the art, and should not be construed as being limited to such specifically described examples and conditions. Furthermore, all statements herein describing the principles, aspects, and embodiments of the invention, as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. Furthermore, such equivalents are intended to include both currently known equivalents and equivalents developed in the future, i.e., any elements developed that perform the same function, regardless of structure. Furthermore, nothing disclosed herein is intended to be dedicated to the public benefit, regardless of whether such disclosure is expressly set forth in the claims.

[0112] Therefore, the scope of the present invention is not intended to be limited to the exemplary embodiments shown and described herein. Rather, the scope and spirit of the present invention is embodied in the appended claims. With respect to claims, 35 U.S.C. 112(f) or 35 U.S.C. 112(6) is expressly defined to apply to a claim limitation only if the exact phrase "means for" or the exact phrase "step for" is recited in the claim at the beginning of such limitation, and if such exact phrase is not used in the claim limitation, 35 U.S.C. 112(f) or 35 U.S.C. 112(6) does not apply.

[0113] (CROSS-REFERENCE TO RELATED APPLICATIONS) Pursuant to 35 U.S.C. §119(e), this application claims priority to the filing date of U.S. Provisional Application No. 62 / 806,698, filed February 15, 2019, the disclosure of which is incorporated herein by reference.

Claims

[Claim 1] 1. A method for detecting single nucleotide polymorphisms (SNPs) and copy number variations (CNVs) in a sample, comprising: a) obtaining a sample containing a nucleic acid molecule; b) exposing said nucleic acid molecule to a population of primers for whole genome or whole transcriptome amplification and to at least one target specific primer for target amplification to generate a mixture of amplicons generated by said whole genome or whole transcriptome amplification and said target amplification; c) sequencing the mixture of amplicons using a sequencing assay in a sequencer to generate sequencing reads; d) evaluating the sequencing reads to determine SNPs and CNVs in the sample.

Images