Compositions and methods for treating skeletal muscle disorders

Abstract

Compositions and methods are provided for treating myopathy by administering a complex formed between a therapeutic mRNA polynucleotide and a 3E10 antibody or variant thereof or antigen-binding fragment thereof. In some cases, the complex is stabilized by a molar ratio of at least about 2:1 of the 3E10 antibody or variant thereof or antigen-binding fragment thereof to the therapeutic polynucleotide.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 63 / 156,070, filed March 3, 2021, and U.S. Provisional Patent Application No. 63 / 297,504, filed January 7, 2022, the contents of which are incorporated by reference in their entireties for all purposes.

[0002] Statement on Federally Sponsored Research This invention was made with Government support under R35CA197574 awarded by the National Institutes of Health. The Government has certain rights in this invention.

[0003] Technical Field The present disclosure relates generally to compositions and methods for treating skeletal muscle disorders by targeted delivery of mRNA to skeletal muscle tissue. [Background technology]

[0004] background Myopathies are clinical disorders of skeletal muscle. These disorders are typically characterized by abnormalities in muscle cell structure and / or metabolism, resulting in various patterns of muscle weakness and dysfunction. There are many types of hereditary myopathies caused by mutations in one or more of a large set of genes. Subjects with hereditary myopathies generally suffer from muscle weakness, motor delay, respiratory dysfunction, and bulbar muscle dysfunction. Because the pathogenesis of many different forms of hereditary myopathies is well characterized, protein replacement therapy, including nucleic acid-based therapy that delivers genes or transcripts that code for functional versions of proteins to affected tissues, offers an attractive option for treating these disorders. Indeed, clinical trials of such strategies have been initiated for several hereditary myopathies.

[0005] Therapeutic mRNA delivery is an attractive option for treating myopathy because it has the potential to circumvent many of the limitations and risks associated with viral vector and synthetic liposome-based gene therapy, including production complexities, limited packaging capacity, and unfavorable immunological characteristics that limit the application of gene therapy and hinder the possibility of prophylactic gene therapy (Seow and Wood, Mol Ther. 17(5):767-777 (2009)).

[0006] However, mRNA therapy is limited by the need for improved delivery systems. For example, mRNA does not easily cross cell membranes. Conventional approaches to overcome this obstacle include packaging mRNA in liposome-based delivery vehicles, which present similar immunological challenges as DNA-based therapies. Furthermore, mRNA is easily degraded by extracellular ribonucleases present in skin, tissues, and blood. Kowalski PS et al., Mol Ther., 27(4):710-28(2019), the contents of which are incorporated herein by reference. [Prior art documents] [Non-patent literature]

[0007] [Non-Patent Document 1] Seow and Wood, Mol Ther. 17(5):767-777(2009) [Non-Patent Document 2] Kowalski PS et al.,Mol Ther.,27(4):710-28(2019) Summary of the Invention

[0008] overview In view of the above background art, there is a need for improved methods for treating skeletal muscle diseases. mRNA therapy offers a promising avenue for the treatment of these diseases, as the genetics underlying the pathogenesis of these diseases have been well characterized. See, for example, Muscle Cell and Tissue-Current Status of Research Field, Edited by Kunihiro Sakuma, Chapter 6 "Genetic Myopathies" (2018), the contents of which are incorporated herein by reference. Advantageously, the present disclosure provides compositions and methods for mRNA therapy of skeletal muscle diseases that do not rely on liposome or viral vector-based nucleic acid delivery. In some aspects, these compositions and methods are based, at least in part, on the discovery that therapeutic mRNA molecules can be efficiently delivered to skeletal muscle tissue in vivo using the 3E10 antibody or a variant or antigen-binding fragment thereof.

[0009] In some embodiments, the advantageous properties of the compositions and methods described herein are based at least in part on the discovery that the 3E10 antibody or variants thereof or antigen-binding fragments thereof described below localize in vivo to skeletal muscle tissue (relative to other tissues or organs) after systemic or intramuscular administration. For example, as described in Example 3 and illustrated in FIG. 10, after intravenous administration, both the parent 3E10 antibody and the 3E10(D31N) variant antibody accumulated at higher concentrations in skeletal muscle than in other non-hepatic tissues, such as brain tissue, lung tissue, heart tissue, spleen tissue, and kidney tissue. Advantageously, this tropism for skeletal muscle tissue is exploited in the compositions and methods described herein to deliver therapeutic mRNA molecules to skeletal muscle tissue to treat various myopathies.

[0010] In some embodiments, the advantageous properties of the compositions and methods described herein are based at least in part on the discovery that the use of a higher molar ratio of 3E10 antibody or variants thereof or antigen-binding fragments thereof to mRNA molecules results in greater protection of the mRNA molecules from RNA degradation. For example, as described in Example 6 and illustrated in Figures 13A and 13B, parent 3E10 antibody and 3E10(D31N) variant antibody protected mRNA from RNAse A-mediated RNA degradation at molar ratios of 2:1 and 20:1, with the protection obtained at the 20:1 molar ratio being greater than that obtained at 2:1. Advantageously, mRNAs that obtained increased mRNA protection at higher 3E10 antibody or variants thereof or antigen-binding fragments thereof concentrations are utilized in the compositions and methods described herein to improve the pharmacokinetic properties of therapeutic compositions that deliver mRNA in vivo.

[0011] In some embodiments, the advantageous properties of the compositions and methods described herein are based at least in part on the discovery that sustained protein expression in skeletal muscle tissue from therapeutic mRNA is achieved by administration of a complex of a 3E10 antibody or variant thereof or an antigen-binding fragment thereof with a therapeutic mRNA. For example, as described in Example 5 and illustrated in Figures 12A-12B, intramuscular administration of a 3E10(D31N) variant antibody-mRNA complex resulted in sustained expression of luciferase encoded by the mRNA for at least 5 days. Advantageously, the sustained expression in skeletal muscle tissue resulting from administration of these complexes is utilized in the compositions and methods described herein to treat myopathy using long-acting compositions.

[0012] Thus, one aspect of the present disclosure provides a method for treating a genetic musculoskeletal disease in a subject in need thereof by parenterally administering a therapeutically effective amount of a composition comprising a complex formed between a therapeutic mRNA polynucleotide and a 3E10 antibody or a variant thereof, or an antigen-binding fragment thereof.

[0013] In another aspect, the present disclosure provides a pharmaceutical composition of a complex formed between a therapeutic mRNA polynucleotide encoding a skeletal muscle polypeptide and a 3E10 antibody or variant thereof, or an antigen-binding fragment thereof, the pharmaceutical composition having a molar ratio of the 3E10 antibody or variant thereof, or an antigen-binding fragment thereof to the therapeutic polynucleotide of at least 2:1.

[0014] In some embodiments of the methods and compositions described herein, the 3E10 antibody or variant thereof, or antigen-binding fragment thereof, comprises (a) a light chain variable region (VL) complementarity determining region (CDR) 1 comprising the amino acid sequence of 3E10-VL-CDR1 (SEQ ID NO: 9); (b) a VL CDR2 comprising the amino acid sequence of 3E10-VL-CDR2 (SEQ ID NO: 10); (c) a VL CDR3 comprising the amino acid sequence of 3E10-VL-CDR3 (SEQ ID NO: 11); (d) a heavy chain variable region (VH) CDR1 comprising the amino acid sequence of 3E10-VH-CDR1a (SEQ ID NO: 16); (e) a VH CDR2 comprising the amino acid sequence of 3E10-VH-CDR2 (SEQ ID NO: 4); and (f) a VH CDR3 comprising the amino acid sequence of 3E10-VH-CDR3 (SEQ ID NO: 5).

[0015] In some embodiments of the methods and compositions described herein, the 3E10 antibody or variant thereof, or antigen-binding fragment thereof, comprises: (a) a light chain variable region (VL) complementarity determining region (CDR)1 comprising an amino acid sequence having no more than two amino acid substitutions compared to 3E10-VL-CDR1 (SEQ ID NO: 9); (b) a VL CDR2 comprising an amino acid sequence having no more than two amino acid substitutions compared to 3E10-VL-CDR2 (SEQ ID NO: 10); (c) a VL CDR3 comprising an amino acid sequence having no more than two amino acid substitutions compared to 3E10-VL-CDR3 (SEQ ID NO: 11); (d) a heavy chain variable region (VH) CDR1 comprising an amino acid sequence having no more than two amino acid substitutions compared to 3E10-VH-CDR1a (SEQ ID NO: 16); (e) a VH CDR2 comprising an amino acid sequence having no more than two amino acid substitutions compared to 3E10-VH-CDR2 (SEQ ID NO: 4); and (f) a VH CDR3 comprising an amino acid sequence having no more than two amino acid substitutions compared to 3E10-VH-CDR3 (SEQ ID NO:5).

[0016] In some embodiments of the methods and compositions described herein, the 3E10 antibody or variant thereof, or antigen-binding fragment thereof, comprises (a) a light chain variable region (VL) complementarity determining region (CDR) 1 comprising the amino acid sequence of 3E10-VL-CDR1m (SEQ ID NO: 61); (b) a VL CDR2 comprising the amino acid sequence of 3E10-VL-CDR2m (SEQ ID NO: 62); (c) a VL CDR3 comprising the amino acid sequence of 3E10-VL-CDR3m (SEQ ID NO: 63); (d) a heavy chain variable region (VH) CDR1 comprising the amino acid sequence of 3E10-VH-CDR1m (SEQ ID NO: 58); (e) a VH CDR2 comprising the amino acid sequence of 3E10-VH-CDR2m (SEQ ID NO: 59); and (f) a VH CDR3 comprising the amino acid sequence of 3E10-VH-CDR3m (SEQ ID NO: 60). [Brief description of the drawings]

[0017] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Patent and Trademark Office upon request and payment of the necessary fee.

[0018] [Figure 1] 1 illustrates the amino acid sequence of the parent 3E10 monoclonal antibody. [Figure 2A] Figures 2A, 2B, and 2C illustrate the amino acid sequences of the D31N variant (Figure 2A), other CDR variants (Figure 2B), and additional contemplated CDR variants (Figure 2C) of the 3E10 monoclonal antibody according to some embodiments of the present disclosure. [Figure 2B] See legend to Figure 2A. [Figure 2C] See legend to Figure 2A. [Diagram 3] 1 illustrates examples of charge-conserving CDR variants of the 3E10 monoclonal antibody, according to various embodiments of the disclosure. [Figure 4] Examples of CDR variants that include combinations of amino acid substitutions, charge-conservative amino acid substitutions, and rationally-designed amino acid substitutions of the 3E10 monoclonal antibody are described in accordance with various embodiments of the present disclosure. [Diagram 5] 1 illustrates a sequence alignment of an example humanized 3E10 heavy chain variable region, with CDRs underlined as indicated. [Figure 6] 1 illustrates a sequence alignment of an example humanized 3E10 light chain variable region, with the CDRs and putative nuclear localization signal (NLS) underlined as indicated. [Figure 7A] Figures 7A, 7B, 7C, 7D, and 7E collectively illustrate sequence alignments of examples of humanized di-scFv constructs of the 3E10 monoclonal antibody. [Figure 7B] See legend to Figure 7A. [Figure 7C] See legend to Figure 7A. [Figure 7D] See legend to Figure 7A. [Figure 7E] See legend to Figure 7A. [Figure 8]1 illustrates a line graph showing 3E10-mediated delivery of mRNA to mouse muscle (IM) over time (days after IM injection) (bioluminescence (photons / sec)) according to some embodiments of the present disclosure. [Figure 9-1] Figures 9A, 9B, and 9C collectively show fluorescently labeled 3E10(D31N) antibody localization in mouse skeletal muscle following intravenous administration. Figures 9A and 9B are images of fluorescence in mouse skeletal muscle following intravenous injection of a control composition (Figure 9A) or fluorescently labeled 3E10(D31N) antibody (Figure 9B) acquired with an IVIS (Perkin Elmer) 24 hours after administration. Figure 9C is a bar graph quantitating the fluorescence in the IVIS images. [Figure 9-2] See description of Figure 9-1. [Figure 10] 1 is a bar graph quantitating fluorescence in IVIS images of dose-dependent tissue biodistribution of 3E10-D31N 24 hours after intravenous injection of 100 μg or 200 μg of VivoTag680-labeled 3E10-D31N into mice (Perkin Elmer). [Figure 11A] Figures 11A and 11B illustrate electrostatic surface potential renderings of a molecular model of the 3E10-scFv construct, revealing a putative nucleic acid binding pocket (NAB1). In addition, Figure 11A shows the predicted structural and electrostatic potential changes induced by an amino acid substitution at residue HC CDR1 residue 31. Figure 11B is an illustration of molecular modeling (Pymol) of 3E10-scFv with the NAB1 amino acid residue highlighted with a punctate dot. Figure 11C illustrates the mapping of the putative nucleic acid binding pocket identified by the molecular modeling shown in Figures 11A and 11B to the amino acid sequence of the 3E10-scFv construct. [Figure 11B] See legend to Figure 11A. [Figure 11C] See legend to Figure 11A. [Figure 12A]Figures 12A and 12B show expression of mRNA in skeletal muscle after intramuscular administration of 3E10(D31N)-mRNA construct. Figure 12A shows fluorescence images of mice over a 5-day time course after intramuscular administration of mRNA encoding luciferase complexed with 3E10(D31N). Figure 12B illustrates a bar graph quantifying the average radiance across all pixels, showing fluorescence in a single mouse in the image of a control mouse (untreated) and a mouse intramuscularly administered with 3E10(D31N)-mRNA construct. [Figure 12B] See legend to Figure 12A. [Figure 13A] 13A and 13B show gel electrophoresis analysis mRNA protection assays performed with 3E10(D31N)-mRNA constructs prepared at molar ratios of 20:1 (FIG. 13A) and 2:1 (FIG. 13B). [Figure 13B] See legend to Figure 13A. [Figure 14] 1 shows histograms of cytoplasmic, membrane, nuclear protein, and gDNA fractions following administration of 89Zr-labeled isotype control, 3E10-WT, and 3E10-D31N antibodies, as described in Example 7. [Figure 15] 1 shows a gel electrophoresis analysis of an mRNA protection assay performed using complexes formed between 3E10 and mRNA encoding the 14 kb human dystrophin protein prepared at molar ratios of 1:1, 2:1, 5:1, 10:1, and 100:1 (3E10:mRNA), as described in Example 8. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0019] Detailed Description The present disclosure provides compositions and methods for in vivo delivery of therapeutic mRNA molecules that do not rely on traditional viral or liposome-based delivery methodologies that are associated with difficult and expensive production, limited packaging capabilities, and adverse immunological events. In some aspects, described in more detail below, these compositions and methods are based, at least in part, on the discovery that 3E10 antibody or a variant thereof or an antigen-binding fragment thereof can be used to efficiently deliver therapeutic mRNA molecules to skeletal muscle tissue in vivo.

[0020] Specifically, it has been discovered that the 3E10 antibody or its variants or antigen-binding fragments thereof are useful for transporting mRNA across the cell membrane into the cytoplasm. Thus, compositions and methods are provided for enhancing the delivery of mRNA, particularly to skeletal muscle tissue, using the 3E10 antibody or its variants or antigen-binding fragments thereof.

[0021] definition The terms used in this disclosure are merely for describing certain embodiments and are not intended to limit the present invention. When used in the detailed description and the appended claims, the singular forms "a", "an" and "the" are intended to include the plural forms unless the context clearly indicates otherwise. It will also be understood that the term "and / or" as used herein refers to and encompasses any and all possible combinations of one or more of the associated listed items. It will be further understood that, unless the context requires otherwise, when used herein, the terms "includes", "comprising", or any variation thereof, specify the presence of stated features, integers, steps, operations, elements, and / or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups thereof. Additionally, to the extent the terms "including," "includes," "having," "has," "with," or variations thereof are used in any of the detailed description and / or claims, such terms are intended to be inclusive in a similar manner as the term "comprising."

[0022] Recitation of ranges of values ​​herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated herein as if it were individually recited herein.

[0023] Use of the term "about" is intended to describe a value that is either above or below the stated value within approximately ±10%.

[0024] "Antigen binding domain" or "ABD" herein refers to a set of six complementarity determining regions (CDRs) that, when present as part of a polypeptide sequence, specifically binds to a target antigen as discussed herein. Thus, a "nucleic acid binding domain" binds to a nucleic acid antigen as outlined herein. As known in the art, these CDRs generally exist as a first set of variable heavy chain CDRs (vhCDRs or VHCDRs) and a second set of variable light chain CDRs (vlCDRs or VLCDRs), each of which includes three CDRs, vhCDR1, vhCDR2, vhCDR3 for the heavy chain, and vlCDR1, vlCDR2, and vlCDR3 for the light chain. The CDRs are present in the variable heavy chain domain and the variable light chain domain, respectively, and together form the Fv region. (See Table 1 and related discussion above for CDR numbering scheme). Thus, in some cases, the six CDRs of the antigen binding domain are contributed by the variable heavy chain domain and the variable light chain domain. In the "Fab" format, the set of six CDRs is contributed by two distinct polypeptide sequences, namely a variable heavy domain (vh or VH; comprising vhCDR1, vhCDR2, and vhCDR3) and a variable light domain (vl or VL; comprising vlCDR1, vlCDR2, and vlCDR3), with the C-terminus of the vh domain attached to the N-terminus of the CH1 domain of the heavy chain and the C-terminus of the vl domain attached to the N-terminus of the constant light domain (thus forming the light chain). In the scFv format, the vh and vl domains are generally covalently linked into a single polypeptide sequence by the use of a linker ("scFv linker") as outlined herein, which can be either vh-linker-vl or vl-linker-vh (starting from the N-terminus), with the former generally being preferred (with optional domain linkers on each side depending on the format used). Generally, the C-terminus of the scFv domain is attached to the N-terminus of the hinge in the second monomer.

[0025] As one skilled in the art would understand, the exact numbering and arrangement of the CDRs may vary between various numbering systems. However, it should be understood that the disclosure of a variable heavy chain sequence and / or a variable light chain sequence includes the disclosure of the associated (unique) CDRs. Thus, the disclosure of each variable heavy chain region is the disclosure of the vhCDRs (e.g., vhCDR1, vhCDR2, and vhCDR3), and the disclosure of each variable light chain region is the disclosure of the vlCDRs (e.g., vlCDR1, vlCDR2, and vlCDR3). A useful comparison for CDR numbering is as follows, see Lafranc et al., Dev. Comp. Immunol. 27(1):55-77 (2003).

[0026] (Table 1) TIFF2024508309000002.tif82164

[0027] Throughout this specification, the Kabat numbering system is generally used when referring to residues in the variable domain (approximately residues 1-107 in the light chain variable region and residues 1-113 in the heavy chain variable region), and the EU numbering system is generally used when referring to the Fc region (e.g., Kabat et al., supra (1991)). The EU index or EU numbering scheme as in Kabat refers to EU antibody numbering. Kabat et al. collected a large number of primary sequences of heavy and light chain variable regions. Based on the degree of sequence conservation, Kabat et al. classified each primary sequence into CDRs and frameworks and created a list thereof. See SEQUENCES OF IMMUNOLOGICAL INTEREST, 5th edition, NIH publication, No. 91-3242, E.A. Kabat et al., Edelman et al., 1969, Proc Natl Acad Sci USA 63:78-85, the contents of which are incorporated herein by reference. Modifications can be additions, deletions, or substitutions.

[0028] As used herein, "target antigen" refers to a molecule that is specifically bound by an antigen-binding domain comprising a variable region of a given antibody. As discussed below, in this case, the target antigen is a nucleic acid.

[0029] As described below, in some embodiments, the parent polypeptide, e.g., the Fc parent polypeptide, is a human wild-type sequence, such as a heavy chain constant region or Fc region from IgG1, IgG2, IgG3, or IgG4, although human sequences having variants can also function as the "parent polypeptide", e.g., the IgG1 / 2 hybrids of US Publication No. 2006 / 0134105. The protein variant sequences herein preferably have at least about 75% identity to the parent protein sequence, or at least about 80% identity to the parent protein sequence, and most preferably at least about 90% identity, more preferably at least about 95%, or at least about 98%, or at least about 99% sequence identity. In some embodiments, a protein variant sequence herein has at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence identity to a parent protein sequence. Thus, an "antibody variant" or "variant antibody" as used herein means an antibody that differs from a parent antibody by at least one amino acid modification, an "IgG variant" or "variant IgG" as used herein means an antibody that differs from a parent IgG (again, often a human IgG sequence) by at least one amino acid modification, and an "immunoglobulin variant" or "variant immunoglobulin" as used herein means an immunoglobulin sequence that differs from that of the parent immunoglobulin sequence by at least one amino acid modification. An "Fc variant" or "variant Fc" as used herein means a protein that comprises an amino acid modification in the Fc domain compared to the Fc domain of human IgG1, IgG2, IgG3, or IgG4.

[0030] As used herein, "isotype" means any of the subclasses of immunoglobulins, which are defined by the chemical and antigenic properties of their constant regions. It is understood that therapeutic antibodies may also include hybrids of isotypes and / or subclasses.

[0031] As used herein, "Fab" or "Fab region" refers to a polypeptide that comprises the VH, CH1, VL, and CL immunoglobulin domains, generally on two different polypeptide chains (e.g., VH-CH1 on one chain and VL-CL on the other chain). Fab may refer to this region separately or may refer to this region in the context of an antibody of the present disclosure. In the context of Fab, Fab comprises the Fv region in addition to the CH1 and CL domains.

[0032] As used herein, "Fv" or "Fv fragment" or "Fv region" refers to a polypeptide comprising the VL and VH domains of the ABD. The Fv region can be formatted as both a Fab (which, as discussed above, are generally two different polypeptides (also including the constant regions outlined above)) and an scFv, where the vl and vh domains combine to form an scFv (generally with a linker as discussed herein).

[0033] By "single chain Fv" or "scFv" herein is meant a variable heavy domain covalently linked to a variable light domain, generally using an scFv linker as discussed herein to form an scFv domain or scFv domains. The scFv domains can be oriented either N-terminally to C-terminally (vh-linker-vl or vl-linker-vh). In the sequences shown in the sequence listing and figures, the order of the vh and vl domains is indicated in the name, e.g., H.X_L.Y means vh-linker-vl from N-terminal to C-terminal, and L.Y_H.X is vl-linker-vh.

[0034] As used herein, "Fc" or "Fc region" or "Fc domain" refers to a polypeptide comprising the CH2-CH3 domain of an IgG molecule, in some cases including the hinge. In the EU numbering of human IgG1, the CH2-CH3 domain comprises amino acids 231-447, and the hinge is 216-230. Thus, the definition of "Fc domain" includes both amino acids 231-447 (CH2-CH3) or 216-447 (hinge-CH2-CH3), or fragments thereof. An "Fc fragment" in this context may comprise a smaller number of amino acids from either or both the N-terminus and C-terminus, but still retains the ability to form a dimer with another Fc domain or Fc fragment, which can generally be detected using standard methods based on size (e.g., non-denaturing chromatography, size exclusion chromatography, etc.). Human IgG Fc domains are particularly useful in the present disclosure and can be Fc domains from human IgG1, IgG2, or IgG4.

[0035] A "variant Fc domain" comprises an amino acid modification compared to the parent Fc domain. Thus, a "variant human IgG1 Fc domain" comprises an amino acid modification (generally an amino acid substitution, but in the case of truncation variants, including an amino acid deletion) compared to a human IgG1 Fc domain. Generally, a variant Fc domain has at least about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, or about 99% identity (using the identity algorithms discussed below, one embodiment utilizing the BLAST algorithm known in the art, using default parameters) to the corresponding parent human IgG Fc domain. Alternatively, a variant Fc domain can have from 1 to about 20 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) amino acid modifications compared to the parent Fc domain. In addition, as discussed herein, the variant Fc domains herein retain the ability to form dimers with another Fc domain, as measured using known techniques described herein, such as non-denaturing gel electrophoresis.

[0036] By "heavy chain constant region" herein is meant the CH1-hinge-CH2-CH3 portion of an antibody (or fragment thereof) excluding the variable heavy domain, which in the EU numbering of human IgG1 is amino acids 118 to 447. By "heavy chain constant region fragment" herein is meant a heavy chain constant region that includes fewer amino acids from either or both of the N-terminus and C-terminus but still retains the ability to form a dimer with another heavy chain constant region.

[0037] As used herein, a "variable region" or "variable domain" refers to a region of an immunoglobulin that includes one or more Ig domains substantially encoded by any of the Vκ, Vλ, and / or VH genes that constitute the kappa, lambda, and heavy chain immunoglobulin loci, respectively, and includes CDRs that confer antigen specificity. Thus, a "variable heavy domain" pairs with a "variable light domain" to form an antigen-binding domain ("ABD"). In addition, each variable domain includes three hypervariable regions ("complementarity determining regions", "CDRs") (vhCDR1, vhCDR2, and vhCDR3 for the variable heavy domain, vlCDR1, vlCDR2, and vlCDR3 for the variable light domain) and four framework (FR) regions arranged from amino-terminus to carboxy-terminus in the following order: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4.

[0038] As used herein, "IgG subclass modification" or "isotype modification" refers to an amino acid modification that converts one amino acid of one IgG isotype to the corresponding amino acid of a different aligned IgG isotype. For example, an F296Y substitution in IgG2 is considered an IgG subclass modification because IgG1 contains a tyrosine and IgG2 contains a phenylalanine at EU position 296.

[0039] As used herein, "non-naturally occurring modification" refers to a non-isotypic amino acid modification. For example, 434S in IgG1, IgG2, IgG3, or IgG4 is considered a non-naturally occurring modification because none of the human IgGs contain serine at position 434.

[0040] The antibodies of the present disclosure are generally isolated or recombinant. "Isolated," as used to describe the various polypeptides disclosed herein, refers to a polypeptide that has been identified and separated and / or recovered from the cell or cell culture in which it is expressed. Typically, an isolated polypeptide is prepared by at least one purification step. "Isolated antibody" refers to an antibody that is substantially free of other antibodies having different antigen specificities. "Recombinant" means that the antibodies are produced in an exogenous host cell using recombinant nucleic acid techniques, and can also be isolated.

[0041] As used herein, the term "cell-permeable antibody" refers to an immunoglobulin protein, fragment thereof, variant thereof, or fusion protein based thereon that is transported into the cytoplasm and / or nucleus of a living mammalian cell. A "cell-permeable anti-DNA antibody" specifically binds to DNA (e.g., single-stranded and / or double-stranded DNA). In some embodiments, the antibody is transported into the cytoplasm of the cell without the aid of a carrier or conjugate. In other embodiments, the antibody is conjugated to a cell-permeable moiety, such as a cell-permeable peptide. In some embodiments, the cell-permeable antibody is transported into the nucleus with or without a carrier or conjugate.

[0042] By "skeletal muscle polypeptide" herein is meant a polypeptide having a structure and function substantially similar to a protein or its polypeptide chain that is genetically related to a protein or its polypeptide chain in which a mutation that results in a skeletal muscle disease, e.g., a skeletal muscle disease, exists. The term "skeletal muscle polypeptide" includes wild-type versions of skeletal muscle proteins and their polypeptide chains, naturally occurring variant versions of skeletal muscle proteins and their polypeptide chains, and engineered versions of skeletal muscle proteins and their polypeptide chains. Skeletal muscle polypeptides are also intended to include proteins and their polypeptide chains that have the function of partially or completely rescuing a function lost by a mutation in a protein or its polypeptide chain that is genetically related to a skeletal muscle disease, including, but not limited to, various homologs of skeletal muscle proteins or their polypeptide chains.

[0043] By "modification" herein is meant amino acid substitutions, insertions, and / or deletions in a polypeptide sequence.

[0044] As used herein, "variant protein" or "protein variant" or "variant" refers to a protein that differs from that of a parent protein by at least one amino acid modification. A protein variant has at least one amino acid modification compared to the parent protein, but not so many that the variant protein does not align with the parent protein using an alignment program such as those described below. Generally, the variant proteins (such as the variant Fc domains outlined herein) will generally be at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to the parent protein using an alignment program such as BLAST, as described below.

[0045] Sequence identity between two similar sequences (e.g., antibody variable domains) can be determined by the methods described in Smith, TF & Waterman, MS (1981) "Comparison Of Biosequences," Adv. Appl. Math. 2:482 [local homology algorithm], Needleman, SB & Wunsch, CD. (1970) "A General Method Applicable To The Search For Similarities In The Amino Acid Sequence Of Two Proteins," J. Mol. Biol., 48:443 [homology alignment algorithm], Pearson, WR & Lipman, DJ (1988) "Improved Tools For Biological Sequence Comparison," Proc. Natl. Acad. Sci. (USA) 85:2444 [search for similarity method], or Altschul, SF et al, (1990) "Basic Local Alignment Search The identity of sequences can be measured by algorithms such as those of the "BLAST" algorithm, see the URL website blast.ncbi.nlm.nih.gov / Blast.cgi. When using any of the aforementioned algorithms, default parameters (window length, gap penalty, etc.) are used. Unless otherwise specified, sequence identity is determined using the BLAST algorithm using default parameters.

[0046] As used herein, the term "subject" refers to any individual who is the target of administration. A subject can be a vertebrate, e.g., a mammal. Thus, a subject can be a human. The term does not denote a particular age or sex.

[0047] As used herein, the term "effective amount" means that the amount of the composition used is sufficient to ameliorate one or more causes or symptoms of a disease or disorder. Such amelioration requires only reduction or alteration, not necessarily elimination. The exact dosage will vary depending on a variety of factors, including subject-dependent variables (e.g., age, immune system health, etc.), the disease or disorder being treated, and the route of administration and pharmacokinetics of the drug being administered.

[0048] As used herein, the term "carrier" or "excipient" refers to an organic or inorganic, natural or synthetic inactive ingredient in a formulation with which one or more active ingredients are combined. The carrier or excipient will necessarily be selected to minimize degradation of the active ingredient or to minimize adverse side effects in the subject, as would be well known to one of skill in the art.

[0049] As used herein, the term "treating" refers to the medical management of a patient with the intent to cure, ameliorate, stabilize, or prevent a disease, pathological condition, or disorder. The term includes active treatment, i.e., treatment specifically aimed at ameliorating a disease, pathological condition, or disorder, and also includes causal treatment, i.e., treatment aimed at eliminating the cause of the associated disease, pathological condition, or disorder. In addition, the term includes palliative treatment, i.e., treatment designed for the relief of symptoms rather than a cure of the disease, pathological condition, or disorder, preventive treatment, i.e., treatment aimed at minimizing or partially or completely preventing the occurrence of the associated disease, pathological condition, or disorder, and supportive treatment, i.e., treatment used to complement another specific therapy aimed at ameliorating the associated disease, pathological condition, or disorder.

[0050] As used herein, the term "genetic skeletal muscle disease" refers to disorders with a genetic basis that primarily affect skeletal muscle tissue. Genetic myopathies are caused by mutations in various genes that code for proteins that function in muscle structure and function. Genetic myopathies typically manifest as skeletal muscle weakness and hypotonia. Non-limiting examples of different types of genetic myopathies are provided in Table 2.

[0051] 3E10 antibody, its variants, and fragments thereof In some aspects, the present disclosure relates to the use of 3E10 antibody and its derivatives for delivering therapeutic mRNA molecules to skeletal muscle tissue in a subject, for example, for treating genetic skeletal muscle disease.As discussed below, the term antibody is used generally.The antibody used in the present disclosure may take any of the forms described herein, including traditional antibodies, as well as antibody derivatives, fragments, and mimetics, as described herein in various embodiments.

[0052] Traditional antibody structural units typically include a tetramer. Each tetramer is typically composed of two identical pairs of polypeptide chains, each pair having one "light chain" (typically having a molecular weight of about 25 kDa) and one "heavy chain" (typically having a molecular weight of about 50-70 kDa). Human light chains are classified as kappa light chains and lambda light chains. The present disclosure is directed to antibodies generally based on the IgG class, which has several subclasses, including, but not limited to, IgG1, IgG2, IgG3, and IgG4. In general, IgG1, IgG2, and IgG4 are more frequently used than IgG3. It is noted that IgG1 has different allotypes with polymorphisms at 356 (D or E) and 358 (L or M).

[0053] The light chain generally comprises two domains: a variable light domain (which comprises the light chain CDRs and which together with the variable heavy domain form the Fv region) and a constant light domain (often referred to as CL or Cκ). The heavy chain comprises a variable heavy domain and a constant domain, comprising a CH1-optional hinge-Fc domain, which comprises CH2-CH3.

[0054] The hypervariable region of an antibody generally consists of amino acid residues from about 24-34 (LCDR1, "L" refers to light chain), 50-56 (LCDR2), and 89-97 (LCDR3) in the light chain variable region, and from about 31-35B (HCDR1, "H" refers to heavy chain), 50-65 (HCDR2), and 95-102 (HCDR3) in the heavy chain variable region (Kabat et al., SEQUENCES OF PROTEINS OF IMMUNOLOGICAL INTEREST, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991)), and / or residues forming hypervariable loops (e.g., residues 26-32 (LCDR1), 50-52 (LCDR2), and 91-96 (LCDR3) in the light chain variable region, and 26-32 (HCDR1), 53-55 (HCDR2), and 96-101 (HCDR3) in the heavy chain variable region (Chothia and Lesk (1987) J. Mol. Biol. 196:901-917). Particular CDRs useful in the compositions and methods described herein are described below.

[0055] As one skilled in the art would understand, the exact numbering and arrangement of the CDRs may vary between various numbering systems. However, it should be understood that the disclosure of a variable heavy chain sequence and / or a variable light chain sequence includes the disclosure of the associated (unique) CDRs. Thus, the disclosure of each variable heavy chain region is the disclosure of the vhCDRs (e.g., vhCDR1, vhCDR2, and vhCDR3), and the disclosure of each variable light chain region is the disclosure of the vlCDRs (e.g., vlCDR1, vlCDR2, and vlCDR3). A useful comparison for CDR numbering is given in Lafranc et al., Dev. Comp. Immunol. 27(1):55-77 (2003).

[0056] Throughout this specification, the Kabat numbering system is generally used when referring to residues in the variable domain (approximately residues 1-107 for light chain variable regions and residues 1-113 for heavy chain variable regions), and the EU numbering system is generally used when referring to the Fc region (e.g., Kabat et al., supra (1991)).

[0057] The present disclosure provides a number of different CDR sets. In this case, a "complete CDR set" includes three variable light chain and three variable heavy chain CDRs, e.g., vlCDR1, vlCDR2, vlCDR3, vhCDR1, vhCDR2, and vhCDR3. These may be part of a larger variable light chain domain or variable heavy chain domain, respectfully. In addition, as more fully outlined herein, the variable heavy chain domain and the variable light chain domain may be on separate polypeptide chains, if heavy and light chains are used (e.g., if a Fab is used), or on a single polypeptide chain, in the case of an scFv sequence.

[0058] CDRs contribute to the formation of the antigen-binding site of an antibody, more specifically, the epitope-binding site. "Epitope" refers to a determinant that interacts with a specific antigen-binding site in the variable region of an antibody molecule known as a paratope. An epitope is a grouping of molecules, such as nucleic acids, amino acids, or sugar side chains, that usually have specific structural characteristics, as well as specific charge characteristics. A single antigen may have more than one epitope. The antibodies described herein bind to nucleic acid epitopes in a partially sequence-independent manner. That is, while the antibodies described herein bind to some polynucleotide structures and sequences with higher affinity than other nucleic acid structures and sequences, they have some general affinity for polynucleotides.

[0059] The "Fc domain" of a heavy chain comprises the -CH2-CH3 domain and, optionally, the hinge domain (-H-CH2-CH3). In the case of IgG, the Fc domain comprises the immunoglobulin domains CH2 and CH3 (Cγ2 and Cγ3) and the lower hinge region between CH1 (Cγ1) and CH2 (Cγ2). Although the boundaries of the Fc region may vary, the human IgG heavy chain Fc region is usually defined to include residues C226 or P230 at its carboxyl terminus, numbering according to the EU index as in Kabat. Thus, the "CH" domains in the context of IgG are as follows: "CH1" refers to positions 118-215 according to the EU index as in Kabat. "Hinge" refers to positions 216-230 according to the EU index as in Kabat. "CH2" refers to positions 231-340 according to the EU index as in Kabat, and "CH3" refers to positions 341-447 according to the EU index as in Kabat. Thus, an "Fc domain" includes the -CH2-CH3 domain, and optionally a hinge domain (hinge-CH2-CH3). In embodiments herein, when an scFv is attached to an Fc domain, it is generally the C-terminus of the scFv construct that is attached to all or part of the hinge of the Fc domain, e.g., it is generally attached to the sequence EPKS, which is the beginning of the hinge. In some embodiments, as described more fully below, amino acid modifications are made to the Fc region, e.g., to alter binding to one or more FcγR or FcRn receptors, and to allow for the formation and purification of heterodimers, as outlined herein.

[0060] Another part of the heavy chain is the hinge region. By "hinge" or "hinge region" or "antibody hinge region" or "hinge domain" herein is meant a flexible polypeptide comprising amino acids between the first and second constant domains of an antibody. Structurally, the IgG CH1 domain ends at EU position 215 and the IgG CH2 domain starts at residue EU position 231. Thus, for IgG, the antibody hinge is defined herein as comprising positions 216 (E216 in IgG1) to 230 (p230 in IgG1), the numbering being according to the EU index as in Kabat. In some cases, "hinge fragments" are used that comprise fewer amino acids at either or both the N-terminus and C-terminus of the hinge domain.

[0061] An scFv comprises a variable heavy chain, an scFv linker, and a variable light chain domain. In many of the constructs and sequences outlined herein, the C-terminus of the variable heavy chain is attached to the N-terminus of the scFv linker, which is attached to the N-terminus of the variable light chain (N-vh-linker-vl-C), although this can be switched (N-vl-linker-vh-C).

[0062] Thus, the present disclosure relates to different antibody domains. As described herein and known in the art, the heterodimeric antibodies described in certain embodiments of the present disclosure comprise different domains in the heavy and light chains, which may overlap. These domains include, but are not limited to, Fc domain, CH1 domain, CH2 domain, CH3 domain, hinge domain, heavy chain constant domain (CH1-hinge-Fc domain or CH1-hinge-CH2-CH3), variable heavy chain domain, variable light chain domain, light chain constant domain, Fab domain, and scFv domain.

[0063] In certain embodiments, an antibody of the present disclosure comprises a heavy chain variable region derived from a particular germline heavy chain immunoglobulin gene and / or a light chain variable region derived from a particular germline light chain immunoglobulin gene. For example, such an antibody may comprise or consist of a human antibody comprising a heavy chain variable region or a light chain variable region that is "the product of" or "derived from" a particular germline sequence, e.g., the germline sequence of the 3E10 antibody. A human antibody that is "the product of" or "derived from" a human germline immunoglobulin sequence can be so identified (using the methods outlined herein) by comparing the amino acid sequence of the human antibody to the amino acid sequence of the human germline immunoglobulin and selecting the human germline immunoglobulin sequence that is closest (i.e., the highest % identity) to the sequence of the human antibody. A human antibody that is "the product of" or "derived from" a particular human germline immunoglobulin sequence may contain amino acid differences compared to the germline sequence, for example, due to the deliberate introduction of naturally occurring somatic mutations or site-specific mutations. However, a humanized antibody typically has at least 90% amino acid sequence identity with an amino acid sequence encoded by a human germline immunoglobulin gene and contains amino acid residues that identify the antibody as derived from a human sequence, as compared to germline immunoglobulin amino acid sequences of other species (e.g., mouse germline sequences). In certain cases, a humanized antibody may have at least 95%, 96%, 97%, 98%, or 99% amino acid sequence identity with an amino acid sequence encoded by a germline immunoglobulin gene, or even at least 96%, 97%, 98%, or 99% amino acid sequence identity. Typically, a humanized antibody derived from a particular human germline sequence will display no more than 10-20 amino acid differences from the amino acid sequence encoded by a human germline immunoglobulin gene. In certain cases, a humanized antibody may display no more than 5, or no more than 4, or no more than 3, or no more than 2, or no more than 1 amino acid difference from the amino acid sequence encoded by a germline immunoglobulin gene.

[0064] In one embodiment, the parent antibody is affinity matured as known in the art. Structure-based methods can be used for humanization and affinity maturation, for example as described in USSN 11 / 004,590, which is incorporated herein by reference. Selection-based methods can be used to humanize and / or affinity mature antibody variable regions, including, but not limited to, those described in Wu et al., 1999, J. Mol. Biol. 294:151-162; Baca et al., 1997, J. Biol. Chem. 272(16):10678-10684; Rosok et al., 1996, J. Biol. Chem. 271(37):22611-22618; Rader et al., 1998, Proc. Natl. Acad. Sci. USA 95:8910-8915; Krauss et al., 2003, Protein Engineering 16(10):753-759, all of which are incorporated herein by reference. Other humanization methods may involve grafting only portions of the CDRs, including, but not limited to, those described in USSN 09 / 810,510, Tan et al., 2002, J. Immunol. 169:1119-1125, and De Pascalis et al., 2002, J. Immunol. 169:3076-3084, all of which are incorporated herein by reference.

[0065] In some aspects, the present disclosure relates to the use of antigen binding domains (ABDs) that bind nucleic acids and specifically bind to mRNA molecules derived from the 3E10 antibody. The amino acid sequences of the heavy and light chains of the parent 3E10 antibody are shown in Figure 1. Thus, in some embodiments, the compositions described herein comprise the 3E10 antibody or a variant thereof or an antigen-binding fragment thereof.

[0066] In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof described herein comprises CDR sequences corresponding to the parent 3E10 antibody shown in Figure 1. Thus, in some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof comprises a light chain variable region (VL) complementarity determining region (CDR)1 comprising the amino acid sequence of 3E10-VL-CDR1 (SEQ ID NO: 9), a VL CDR2 comprising the amino acid sequence of 3E10-VL-CDR2 (SEQ ID NO: 10), a VL CDR3 comprising the amino acid sequence of 3E10-VL-CDR3 (SEQ ID NO: 11), a heavy chain variable region (VH) CDR1 comprising the amino acid sequence of 3E10-VH-CDR1 (SEQ ID NO: 3), a VH CDR2 comprising the amino acid sequence of 3E10-VH-CDR2 (SEQ ID NO: 4), and a VH CDR3 comprising the amino acid sequence of 3E10-VH-CDR3 (SEQ ID NO: 5).

[0067] In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof described herein comprises the CDR sequences from a variant 3E10 antibody comprising a D31N amino acid substitution in VH CDR1 as shown in FIG. Thus, in some embodiments, the 3E10 antibody or variant thereof, or antigen-binding fragment thereof comprises a light chain variable region (VL) complementarity determining region (CDR) 1 comprising the amino acid sequence of 3E10-VL-CDR1_D31N (sequence number 22), a VL CDR2 comprising the amino acid sequence of 3E10-VL-CDR2_D31N (sequence number 23), a VL CDR3 comprising the amino acid sequence of 3E10-VL-CDR3_D31N (sequence number 24), a heavy chain variable region (VH) CDR1 comprising the amino acid sequence of 3E10-VH-CDR1_D31N (sequence number 15), a VH CDR2 comprising the amino acid sequence of 3E10-VH-CDR2_D31N (sequence number 17), and a VH CDR3 comprising the amino acid sequence of 3E10-VH-CDR3_D31N (sequence number 18).

[0068] In some embodiments, the 3E10 antibody or variants thereof or antigen-binding fragments thereof described herein refer to the CDR sequences corresponding to the parent 3E10 antibody shown in Figure 1, optionally comprising a D31N amino acid substitution in VH CDR1. Thus, in some embodiments, the 3E10 antibody or variant thereof, or antigen-binding fragment thereof comprises a light chain variable region (VL) complementarity determining region (CDR)1 comprising the amino acid sequence of 3E10-VL-CDR1 (SEQ ID NO: 9), a VL CDR2 comprising the amino acid sequence of 3E10-VL-CDR2 (SEQ ID NO: 10), a VL CDR3 comprising the amino acid sequence of 3E10-VL-CDR3 (SEQ ID NO: 11), a heavy chain variable region (VH) CDR1 comprising the amino acid sequence of 3E10-VH-CDR1a (SEQ ID NO: 16), a VH CDR2 comprising the amino acid sequence of 3E10-VH-CDR2 (SEQ ID NO: 10), and a VH CDR3 comprising the amino acid sequence of 3E10-VH-CDR3 (SEQ ID NO: 11).

[0069] In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof described herein comprises CDR sequences corresponding to the parent 3E10 antibody shown in Figure 1, with known amino acid substitutions in one or more CDRs. For example, Figure 2B shows the amino acid sequences of some known VH CDR2, VL CDR1, and VL CDR2 amino acid sequences. Thus, in some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof comprises one or more amino acid substitutions compared to the CDR sequence of the parent 3E10 (shown in Figure 1) or 3E10-D31N variant (shown in Figure 2), selected from a G to S substitution at position 5 of VH CDR2, a T to S substitution at position 14 of VH CDR2, a S to T substitution at position 5 of VL CDR1, a M to L substitution at position 14 of VL CDR1, a H to A substitution at position 15 of VL CDR1, and an E to Q substitution at position 6 of VL CDR2.

[0070] Thus, in some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof comprises a VH CDR2 comprising the amino acid sequence of 3E10-VH-CDR2.1 (SEQ ID NO:26) or 3E10-VH-CDR2.2 (SEQ ID NO:27). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1-3 and VH CRD1 and 3 in accordance with the parent 3E10 antibody (shown in FIG. 1). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1-3 and VH CRD1 and 3 in accordance with the 3E10-D31N variant (shown in FIG. 2A). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1-3 and VH CRD1 and 3 having one or more amino acid substitutions compared to the CDRs of the parent 3E10 antibody (shown in Figure 1) or compared to the 3E10-D31N variant (shown in Figure 2A).

[0071] Similarly, in some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof comprises a VL CDR1 comprising the amino acid sequence of 3E10-VL-CDR1.1 (SEQ ID NO:28) or 3E10-VL-CDR1.2 (SEQ ID NO:29). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR2 and 3 and VH CRD1-3 according to the parent 3E10 antibody (shown in FIG. 1). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR2 and 3 and VH CRD1-3 according to the 3E10-D31N variant (shown in FIG. 2A). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR2 and 3 and VH CRD1-3 having one or more amino acid substitutions compared to the CDRs of the parent 3E10 antibody (shown in Figure 1) or compared to the 3E10-D31N variant (shown in Figure 2A).

[0072] Similarly, in some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof comprises a VL CDR2 comprising the amino acid sequence of 3E10-VL-CDR2.1 (SEQ ID NO:30). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1 and 3 and VH CRD1-3 according to the parent 3E10 antibody (shown in FIG. 1). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1 and 3 and VH CRD1-3 according to the 3E10-D31N variant (shown in FIG. 2A). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1 and 3 and VH CRD1-3 with one or more amino acid substitutions compared to the CDRs of the parent 3E10 antibody (shown in FIG. 1) or compared to the 3E10-D31N variant (shown in FIG. 2A).

[0073] While some of the amino acid substitutions mentioned above, e.g., S to T at position 5 of VL CDR1, are fairly conservative substitutions, others, e.g., M to L at position 14 of VL CDR1, H to A at position 15 of VL CDR1, and E to Q at position 6 of VL CDR2, are for amino acids with very different properties. This suggests, without being bound by theory, that at least these positions within the 3E10 CDR framework are tolerant to other amino acid substitutions.

[0074] Thus, in some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof comprises a VH CDR2 comprising the amino acid sequence of 3E10-VH-CDR2.3 (SEQ ID NO:31). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1-3 and VH CRD1 and 3 in accordance with the parent 3E10 antibody (shown in FIG. 1). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1-3 and VH CRD1 and 3 in accordance with the 3E10-D31N variant (shown in FIG. 2A). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1-3 and VH CRD1 and 3 with one or more amino acid substitutions compared to the CDRs of the parent 3E10 antibody (shown in FIG. 1) or compared to the 3E10-D31N variant (shown in FIG. 2A), e.g., as described herein.

[0075] Similarly, in some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof comprises a VL CDR1 comprising the amino acid sequence of 3E10-VL-CDR1.3 (SEQ ID NO: 32). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR2 and 3 and VH CRD1-3 according to the parent 3E10 antibody (shown in FIG. 1). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR2 and 3 and VH CRD1-3 according to the 3E10-D31N variant (shown in FIG. 2A). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR2 and 3 and VH CRD1-3 with one or more amino acid substitutions compared to the CDRs of the parent 3E10 antibody (shown in FIG. 1) or compared to the 3E10-D31N variant (shown in FIG. 2A), e.g., as described herein.

[0076] Similarly, in some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof comprises a VL CDR2 comprising the amino acid sequence of 3E10-VL-CDR2.2 (SEQ ID NO: 33). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1 and 3 and VH CRD1-3 according to the parent 3E10 antibody (shown in FIG. 1). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1 and 3 and VH CRD1-3 according to the 3E10-D31N variant (shown in FIG. 2A). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1 and 3 and VH CRD1-3 with one or more amino acid substitutions compared to the CDRs of the parent 3E10 antibody (shown in FIG. 1) or compared to the 3E10-D31N variant (shown in FIG. 2A), e.g., as described herein.

[0077] Furthermore, because the 3E10 antibody or variants thereof or antigen-binding fragments thereof bind to nucleic acids in a partially sequence-independent manner, it was contemplated, without being bound by theory, that this interaction may be mediated by electrostatic interactions with the nucleotide backbone. To investigate this theory, electrostatic surface potential renderings were generated of molecular models of the 3E10-scFv constructs, as shown in Figures 11A and 11B, and the amino acid sequence is illustrated in Figure 11C. These models revealed a putative nucleic acid binding pocket (NAB1) that corresponds to a large basic region on the surface of the molecule, as illustrated in Figure 11A. The positions of the non-hydrogen atoms of the amino acids that contribute to the putative nucleic acid binding pocket in this model are superimposed in Figure 11B, and the amino acid residues are mapped onto the sequence of the construct in Figure 11C.

[0078] It is therefore contemplated that amino acid substitutions within the CDRs of the 3E10 antibody or variant thereof or antigen-binding fragment thereof described herein that maintain the electrostatic properties of this predicted nucleic acid binding pocket will also retain the nucleic acid binding properties of the construct. Thus, in some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof comprises one or more amino acid substitutions of a first basic amino acid to a second basic amino acid (e.g., K, R, or H). Similarly, in some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof comprises one or more amino acid substitutions of a first acidic amino acid to a second acidic amino acid (e.g., D or E). Examples of such charge-conserving variant 3E10 CDRs are shown in Figure 3.

[0079] Thus, in some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof comprises a VH CDR1 comprising the amino acid sequence of 3E10-VH-CDR1.c1 (SEQ ID NO: 34), 3E10-VH-CDR1.c2 (SEQ ID NO: 35), 3E10-VH-CDR1.c3 (SEQ ID NO: 36), 3E10-VH-CDR1.c4 (SEQ ID NO: 37), or 3E10-VH-CDR1.c5 (SEQ ID NO: 38). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1-3 and VH CRD2 and 3 in accordance with the parent 3E10 antibody (shown in FIG. 1). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1-3 and VH CRD1 and 3 having one or more amino acid substitutions compared to the CDRs of the parent 3E10 antibody (shown in FIG. 1), e.g., as described herein.

[0080] Similarly, in some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof comprises a VH CDR2 comprising the amino acid sequence of 3E10-VH-CDR2.c1 (SEQ ID NO: 39), 3E10-VH-CDR2.c2 (SEQ ID NO: 40), or 3E10-VH-CDR2.c3 (SEQ ID NO: 41). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1-3 and VH CRD1 and 3 in accordance with the parent 3E10 antibody (shown in FIG. 1). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1-3 and VH CRD1 and 3 in accordance with the 3E10-D31N variant (shown in FIG. 2A). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1-3 and VH CRD1 and 3 having one or more amino acid substitutions compared to the CDRs of the parent 3E10 antibody (shown in FIG. 1), e.g., as described herein.

[0081] Similarly, in some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof comprises a VH CDR3 comprising the amino acid sequence of 3E10-VH-CDR3.c1 (SEQ ID NO: 42), 3E10-VH-CDR3.c2 (SEQ ID NO: 43), or 3E10-VH-CDR3.c3 (SEQ ID NO: 44). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1-3 and VH CRD1 and 2 in accordance with the parent 3E10 antibody (shown in FIG. 1). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1-3 and VH CRD1 and 2 in accordance with the 3E10-D31N variant (shown in FIG. 2A). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1-3 and VH CRD1 and 2 having one or more amino acid substitutions compared to the CDRs of the parent 3E10 antibody (shown in Figure 1), e.g., as described herein.

[0082] Similarly, in some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof comprises a VL CDR1 comprising the amino acid sequence of 3E10-VL-CDR1.c1 (SEQ ID NO:45), 3E10-VL-CDR1.c2 (SEQ ID NO:46), 3E10-VL-CDR1.c3 (SEQ ID NO:47), 3E10-VL-CDR1.c4 (SEQ ID NO:48), 3E10-VL-CDR1.c5 (SEQ ID NO:49), or 3E10-VL-CDR1.c6 (SEQ ID NO:50). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR2 and 3 and VH CRD1-3 in accordance with the parent 3E10 antibody (shown in FIG. 1). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR2 and 3 and VH CRD1-3 according to the 3E10-D31N variant (shown in FIG. 2A). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR2 and 3 and VH CRD1-3 that have one or more amino acid substitutions compared to the CDRs of the parent 3E10 antibody (shown in FIG. 1), e.g., as described herein.

[0083] Similarly, in some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof comprises a VL CDR2 comprising the amino acid sequence of 3E10-VL-CDR2.c1 (SEQ ID NO:51). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1 and 3 and VH CRD1-3 according to the parent 3E10 antibody (shown in FIG. 1). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1 and 3 and VH CRD1-3 according to the 3E10-D31N variant (shown in FIG. 2A). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1 and 3 and VH CRD1-3 with one or more amino acid substitutions compared to the CDRs of the parent 3E10 antibody (shown in FIG. 1), e.g., as described herein.

[0084] Similarly, in some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof comprises a VL CDR3 comprising the amino acid sequence of 3E10-VL-CDR3.c1 (SEQ ID NO:52), 3E10-VL-CDR3.c2 (SEQ ID NO:53), 3E10-VL-CDR3.c3 (SEQ ID NO:54), 3E10-VL-CDR3.c4 (SEQ ID NO:55), 3E10-VL-CDR3.c5 (SEQ ID NO:56), or 3E10-VL-CDR3.c6 (SEQ ID NO:57). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1 and 2 and VH CRD1-3 in accordance with the parent 3E10 antibody (shown in FIG. 1). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1 and 2 and VH CRD1-3 according to the 3E10-D31N variant (shown in FIG. 2A). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1 and 2 and VH CRD1-3 that have one or more amino acid substitutions compared to the CDRs of the parent 3E10 antibody (shown in FIG. 1), e.g., as described herein.

[0085] It is also contemplated that the 3E10 antibodies or variants thereof or antigen-binding fragments thereof described herein may comprise any combination of the 3E10 CDR amino acid substitutions described above. Examples of 3E10 variant CDR sequences incorporating one or more of the amino acid substitutions described herein are shown in Figure 4.

[0086] Thus, in some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof comprises a VH CDR1 comprising the amino acid sequence of 3E10-VH-CDR1m (SEQ ID NO:58). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1-3 and VH CRD2 and 3 according to the parent 3E10 antibody (shown in FIG. 1). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1-3 and VH CRD1 and 3 with one or more amino acid substitutions compared to the CDRs of the parent 3E10 antibody (shown in FIG. 1), e.g., as described herein.

[0087] Similarly, in some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof comprises a VH CDR2 comprising the amino acid sequence of 3E10-VH-CDR2m (SEQ ID NO:59). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1-3 and VH CRD1 and 3 according to the parent 3E10 antibody (shown in FIG. 1). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1-3 and VH CRD1 and 3 according to the 3E10-D31N variant (shown in FIG. 2A). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1-3 and VH CRD1 and 3 with one or more amino acid substitutions compared to the CDRs of the parent 3E10 antibody (shown in FIG. 1), e.g., as described herein.

[0088] Similarly, in some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof comprises a VH CDR3 comprising the amino acid sequence of 3E10-VH-CDR3m (SEQ ID NO: 60). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1-3 and VH CRD1 and 2 according to the parent 3E10 antibody (shown in FIG. 1). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1-3 and VH CRD1 and 2 according to the 3E10-D31N variant (shown in FIG. 2A). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1-3 and VH CRD1 and 2 with one or more amino acid substitutions compared to the CDRs of the parent 3E10 antibody (shown in FIG. 1), e.g., as described herein.

[0089] Similarly, in some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof comprises a VL CDR1 comprising the amino acid sequence of 3E10-VL-CDR1m (SEQ ID NO: 61). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR2 and 3 and VH CRD1-3 according to the parent 3E10 antibody (shown in FIG. 1). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR2 and 3 and VH CRD1-3 according to the 3E10-D31N variant (shown in FIG. 2A). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR2 and 3 and VH CRD1-3 having one or more amino acid substitutions compared to the CDRs of the parent 3E10 antibody (shown in FIG. 1), e.g., as described herein.

[0090] Similarly, in some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof comprises a VL CDR2 comprising the amino acid sequence of 3E10-VL-CDR2m (SEQ ID NO: 62). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1 and 3 and VH CRD1-3 according to the parent 3E10 antibody (shown in FIG. 1). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1 and 3 and VH CRD1-3 according to the 3E10-D31N variant (shown in FIG. 2A). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1 and 3 and VH CRD1-3 with one or more amino acid substitutions compared to the CDRs of the parent 3E10 antibody (shown in FIG. 1), e.g., as described herein.

[0091] Similarly, in some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof comprises a VL CDR3 comprising the amino acid sequence of 3E10-VL-CDR3m (SEQ ID NO: 63). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1 and 2 and VH CRD1-3 according to the parent 3E10 antibody (shown in FIG. 1). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1 and 2 and VH CRD1-3 according to the 3E10-D31N variant (shown in FIG. 2A). In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof further comprises VL CDR1 and 2 and VH CRD1-3 with one or more amino acid substitutions compared to the CDRs of the parent 3E10 antibody (shown in FIG. 1), e.g., as described herein.

[0092] In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof described herein comprises a light chain variable region (VL) complementarity determining region (CDR)1 comprising the amino acid sequence of 3E10-VL-CDR1m (SEQ ID NO: 61), a VL CDR2 comprising the amino acid sequence of 3E10-VL-CDR2m (SEQ ID NO: 62), a VL CDR3 comprising the amino acid sequence of 3E10-VL-CDR3m (SEQ ID NO: 63), a heavy chain variable region (VH) CDR1 comprising the amino acid sequence of 3E10-VH-CDR1m (SEQ ID NO: 58), a VH CDR2 comprising the amino acid sequence of 3E10-VH-CDR2m (SEQ ID NO: 59), and a VH CDR3 comprising the amino acid sequence of 3E10-VH-CDR3m (SEQ ID NO: 60).

[0093] In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof described herein refers to CDR sequences having no more than one amino acid substitution compared to the parent 3E10 antibody shown in Figure 1, optionally including a D31N amino acid substitution in VH CDR1. Thus, in some embodiments, the 3E10 antibody or variant thereof, or antigen-binding fragment thereof, comprises a light chain variable region (VL) complementarity determining region (CDR)1 comprising an amino acid sequence having no more than one amino acid substitution compared to 3E10-VL-CDR1 (SEQ ID NO: 9), a VL CDR2 comprising an amino acid sequence having no more than one amino acid substitution compared to 3E10-VL-CDR2 (SEQ ID NO: 10), a VL CDR3 comprising an amino acid sequence having no more than one amino acid substitution compared to 3E10-VL-CDR3 (SEQ ID NO: 11), a heavy chain variable region (VH) CDR1 comprising an amino acid sequence having no more than one amino acid substitution compared to 3E10-VH-CDR1a (SEQ ID NO: 16), a VH CDR2 comprising an amino acid sequence having no more than one amino acid substitution compared to 3E10-VH-CDR2 (SEQ ID NO: 4), and a VH CDR3 comprising an amino acid sequence having no more than one amino acid substitution compared to 3E10-VH-CDR3 (SEQ ID NO: 5).

[0094] In some embodiments, the 3E10 antibody or variant thereof or antigen-binding fragment thereof described herein refers to CDR sequences having no more than two amino acid substitutions compared to the parent 3E10 antibody shown in Figure 1, optionally including a D31N amino acid substitution in VH CDR1. Thus, in some embodiments, the 3E10 antibody or variant thereof, or antigen-binding fragment thereof, comprises a light chain variable region (VL) complementarity determining region (CDR)1 comprising an amino acid sequence having no more than two amino acid substitutions compared to 3E10-VL-CDR1 (SEQ ID NO: 9), a VL CDR2 comprising an amino acid sequence having no more than two amino acid substitutions compared to 3E10-VL-CDR2 (SEQ ID NO: 10), a VL CDR3 comprising an amino acid sequence having no more than two amino acid substitutions compared to 3E10-VL-CDR3 (SEQ ID NO: 11), a heavy chain variable region (VH) CDR1 comprising an amino acid sequence having no more than two amino acid substitutions compared to 3E10-VH-CDR1a (SEQ ID NO: 16), a VH CDR2 comprising an amino acid sequence having no more than two amino acid substitutions compared to 3E10-VH-CDR2 (SEQ ID NO: 4), and a VH CDR3 comprising an amino acid sequence having no more than two amino acid substitutions compared to 3E10-VH-CDR3 (SEQ ID NO: 5).

[0095] Other variants of the 3E10 antibody or variants or antigen-binding fragments thereof are also known in the art, for example, as disclosed in Zack, et al., J. Immunol., 157(5):2082-8 (1996). For example, amino acid position 31 of the heavy chain variable region of 3E10 has been determined to affect the ability of the antibody and fragments thereof to penetrate the nucleus and bind to DNA (shown in bold in SEQ ID NO: 13 and SEQ ID NO: 14). The D31N mutation in CDR1 (shown in bold in SEQ ID NO:2 and SEQ ID NO:13) penetrates the nucleus and binds to DNA much more efficiently than the original antibody (Zack, et al., Immunology and Cell Biology, 72:513-520 (1994); Weisbart, et al., J. Autoimmun., 11, 539-546 (1998); Weisbart, Int. J. Oncol., 25, 1867-1873 (2004)). In some embodiments, the antibody has a D31N substitution.

[0096] Although generally referred to herein as "3E10" or "3E10 antibody," it will be understood that fragments and binding proteins, such as antigen-binding fragments, variants, and fusion proteins, such as scFv, di-scFv, tr-scFv, and other single chain variable fragments, as well as other cell-permeable nucleic acid transport molecules disclosed herein, are encompassed by this phrase and are expressly provided for use in the compositions and methods disclosed herein. Thus, antibodies and other binding proteins are also referred to herein as cell-permeable.

[0097] In a preferred embodiment, the 3E10 antibody is transported into the cytoplasm and / or nucleus of a cell without the aid of a carrier or conjugate. For example, monoclonal antibody 3E10 and its active fragments, which are transported in vivo to the nucleus of mammalian cells without cytotoxic effects, are disclosed in U.S. Patent Nos. 4,812,397 and 7,189,396 to Richard Weisbart.

[0098] Antibodies useful in the compositions and methods described herein include whole immunoglobulins of any class (i.e., intact antibodies), fragments thereof, and synthetic proteins that contain at least the antigen-binding variable domain of an antibody. The variable domain differs in sequence between antibodies and is used in the binding and specificity of each particular antibody for its particular antigen. However, variability is usually not evenly distributed throughout the variable domain of an antibody. It is typically condensed into three segments called complementarity determining regions (CDRs) or hypervariable regions in both the light chain variable domain and the heavy chain variable domain. The more highly conserved parts of the variable domain are called frameworks (FRs). Natural heavy and light chain variable domains each contain four FR regions and predominantly adopt a beta-sheet configuration connected by three CDRs that form loops that connect and in some cases form part of the beta-sheet structure. The CDRs in each chain are held together in close proximity to the CDRs from the other chain by the FR regions and contribute to the formation of the antigen-binding site of the antibody. Thus, the antibodies typically include at least those CDRs necessary to maintain DNA binding and / or prevent DNA repair.

[0099] The 3E10 antibody is typically a monoclonal 3E10, or a variant, derivative, fragment, fusion, or humanized form thereof that binds to the same or a different epitope as 3E10.

[0100] Deposit under the terms of the Budapest Treaty of a hybridoma cell line producing monoclonal antibody 3E10 was received on September 6, 2000 and accepted by the American Type Culture Collection (ATCC), 10801 University Blvd., Manassas, VA 20110-2209, USA, and was assigned patent deposit number PTA-2439.

[0101] Thus, the antibody may have the same or different epitope specificity as monoclonal antibody 3E10 produced by ATCC No. PTA2439 hybridoma. The antibody may have the paratope of monoclonal antibody 3E10. The antibody may be a single chain variable fragment of 3E10, or a variant thereof, such as a conservative variant thereof. For example, the antibody may be a single chain variable fragment of 3E10 (3E10 Fv), or a variant thereof.

[0102] Additionally or alternatively, the heavy chain complementarity determining regions (CDRs) can be defined according to the IMGT system. The complementarity determining regions (CDRs) identified by the IMGT system include CDR H1.3 (original sequence): GFTFSDYG (SEQ ID NO: 99), CDR H1.4 (with D31N mutation): GFTFSNYG (SEQ ID NO: 100), CDR H2.2: ISSGSSTI (SEQ ID NO: 101) and variant ISSSSTI (SEQ ID NO: 102), CDR H3.2: ARRGLLDY (SEQ ID NO: 103).

[0103] Additionally or alternatively, the light chain complementarity determining regions (CDRs) can be defined according to the IMGT system. The complementarity determining regions (CDRs) identified by the IMGT system include CDR L1.2 KSVSTSSYSY (SEQ ID NO: 104) and variant KTVSTSSYSY (SEQ ID NO: 105), CDR L2.2: YAS (SEQ ID NO: 106), CDR L3.2: QHSREFPWT (SEQ ID NO: 107).

[0104] In some embodiments, the antibody is a humanized antibody. Methods for humanizing non-human antibodies are well known in the art. In general, a humanized antibody has one or more amino acid residues introduced from a source that is non-human. These non-human amino acid residues are often referred to as "import" residues, and they typically come from an "import" variable domain. Antibody humanization techniques generally require the use of recombinant DNA technology to manipulate the DNA sequence that codes for one or more polypeptide chains of an antibody molecule.

[0105] Exemplary 3E10 humanized 3E10 heavy chain variable region (SEQ ID NOs: 64-73) and light chain variable region (SEQ ID NOs: 74-82) sequences are discussed in WO2015 / 106290 (US10,221,250), WO2016 / 033324 (US10,501,554), WO2019 / 018426 (US2020 / 216567), and WO / 2019 / 018428 (US2020 / 216568), the disclosures of which are incorporated by reference in their entireties for all purposes, and are provided in Figures 5 and 6, respectively. In some embodiments, the 3E10 antibodies described herein comprise a heavy chain variable region selected from SEQ ID NOs: 64-73, and a light chain variable region selected from SEQ ID NOs: 74-82. In some embodiments, the 3E10 antibodies described herein comprise a heavy chain variable region having at least 99% amino acid identity with a heavy chain variable region selected from SEQ ID NOs: 64-73, and a light chain variable region having at least 99% amino acid identity with a light chain variable region selected from SEQ ID NOs: 74-82. In some embodiments, the 3E10 antibodies described herein comprise a heavy chain variable region having at least 98% amino acid identity with a heavy chain variable region selected from SEQ ID NOs: 64-73, and a light chain variable region having at least 98% amino acid identity with a light chain variable region selected from SEQ ID NOs: 74-82. In some embodiments, the 3E10 antibodies described herein comprise a heavy chain variable region having at least 97% amino acid identity with a heavy chain variable region selected from SEQ ID NOs: 64-73, and a light chain variable region having at least 97% amino acid identity with a light chain variable region selected from SEQ ID NOs: 74-82. In some embodiments, the 3E10 antibodies described herein comprise a heavy chain variable region having at least 96% amino acid identity to a heavy chain variable region selected from SEQ ID NOs: 64-73, and a light chain variable region having at least 96% amino acid identity to a light chain variable region selected from SEQ ID NOs: 74-82. In some embodiments, the 3E10 antibodies described herein comprise a heavy chain variable region having at least 95% amino acid identity to a heavy chain variable region selected from SEQ ID NOs: 64-73, and a light chain variable region having at least 95% amino acid identity to a light chain variable region selected from SEQ ID NOs: 74-82.In some embodiments, the 3E10 antibody described herein comprises a heavy chain variable region having at least 90%, 91%, 92%, 93%, or 94% amino acid identity to a heavy chain variable region selected from SEQ ID NOs: 64-73, and a light chain variable region having at least 90%, 91%, 92%, 93%, or 94% amino acid identity to a light chain variable region selected from SEQ ID NOs: 74-82.

[0106] The disclosed compositions and methods typically utilize antibodies that maintain the ability to penetrate the cell and optionally the nucleus.

[0107] The mechanisms of cell internalization by autoantibodies are diverse: some are taken up into cells by electrostatic interactions or FcR-mediated endocytosis, whereas others utilize mechanisms based on association with cell surface myosin or calreticulin followed by endocytosis (Ying-Chyi et al., Eur J Immunol 38, 3178-3190 (2008); Yanase et al., J Clin Invest 100, 25-31 (1997)). 3E10 penetrates cells by an Fc-independent mechanism (as evidenced by the ability of an Fc-less 3E10 fragment to penetrate cells), but requires the presence of the nucleoside transporter ENT2 (Weisbart et al., Sci Rep 5:12022. doi:10.1038 / srep12022. (2015); Zack et al., J Immunol 157, 2082-2088 (1996); Hansen et al., J Biol Chem 282, 20790-20793 (2007)). Thus, in some embodiments, the antibodies utilized in the disclosed compositions and methods penetrate cells by an Fc-independent mechanism, but require the presence of the nucleoside transporter ENT2.

[0108] Mutations in 3E10 that disrupt the ability of 3E10 to bind to DNA may render the antibody incapable of nuclear penetration. Thus, typically, the disclosed variants and humanized forms of the antibody maintain the ability to bind to nucleic acids, particularly DNA. In addition, it has previously been shown that 3E10 scFv can penetrate living cells and nuclei in an ENT2-dependent manner, with impaired uptake efficiency in ENT2-deficient cells (Hansen, et al., J. Biol. Chem. 282, 20790-20793 (2007)). Thus, in some embodiments, the disclosed variants and humanized forms of the antibody maintain the ability to penetrate cell nuclei in an ENT-dependent manner, preferably in an ENT2-dependent manner.

[0109] Nucleic acid binding The disclosed compositions and methods typically utilize antibodies that maintain the ability to penetrate the cell and optionally the nucleus.

[0110] Example 4 describes molecular modeling of 3E10 and additional 3E10 variants. Molecular modeling (Pymol) of 3E10 revealed a putative nucleic acid binding pocket (NAB1) (see, e.g., Figures 11A and 11B), which is illustrated in underlined form in Figure 11C.

[0111] In some embodiments, the disclosed antibodies comprise some or all of the underlined NAB1 sequences. In some embodiments, the antibodies comprise variant sequences that have altered ability to bind nucleic acids. In some embodiments, mutations (e.g., substitutions, insertions, and / or deletions) in NAB1 improve binding of the antibodies to nucleic acids, such as RNA. In some embodiments, the mutations are conservative substitutions. In some embodiments, the mutations increase the cationic charge of the NAB1 pocket.

[0112] As discussed and exemplified herein, mutation of the aspartic acid at residue 31 of CDR1 to asparagine increased the cationic charge of this residue and enhanced in vivo nucleic acid binding and delivery (3E10-D31N). Additional exemplary variants include mutation of the aspartic acid at residue 31 of CDR1 to arginine (3E10-D31R), which modeling shows an expansion of the cationic charge, or to lysine (3E10-D31K), which modeling shows a change in charge orientation. Thus, in some embodiments, the 3E10 binding protein includes a D31R or D31K substitution.

[0113] All sequences disclosed herein having residues corresponding to 3E10 D31 or N31 are expressly disclosed with an internal D31R or D31K or N31R or N31K substitution.

[0114] Molecular modeling (Pymol) of 3E10 revealed a putative nucleic acid binding pocket (NAB1) (Figures 11A-11B). Mutation of the aspartate at residue 31 of CDR1 to asparagine increased the cationic charge of this residue and enhanced nucleic acid binding and delivery in vivo (3E10-D31N). Mutation of the aspartate at residue 31 of CDR1 to arginine (3E10-D31R) further expanded the cationic charge, while mutation to lysine (3E10-D31K) altered the charge orientation (Figure 11A).

[0115] In the heavy and light chain sequences in Figure 11C, the NAB1 amino acids predicted from molecular modeling are underlined. Figure 11B is a diagram showing molecular modeling (Pymol) of 3E10-scFv with the NAB1 amino acid residues illustrated using punctuated dots.

[0116] Hereditary myopathies Gene replacement therapy refers to several therapeutic techniques for delivering a functional copy of a gene to tissues that require the protein encoded by the gene, including, for example, DNA-based gene therapy techniques in which a functional copy of the gene is transcribed intracellularly, with or without stable integration into the subject's genome, gene editing therapies such as CRISPR / Cas, which repair or replace mutated copies of genes or specific nucleotides in the host's genome, and mRNA delivery-based approaches in which mRNA encoding a protein is delivered to cells, eliminating the need to transcribe an exogenous copy of the gene. Researchers have developed and continue to develop gene replacement therapies for a diverse set of disorders, most notably genetic disorders and cancers, in subjects with one or two mutated or non-functional copies of a gene, due to, for example, mutations in the gene causing partial or complete loss of function, mutations in associated regulatory regions that downregulate gene transcription, and / or small genomic deletions.

[0117] Myopathies are clinical disorders of skeletal muscle. These disorders are typically characterized by abnormalities in muscle cell structure and / or metabolism, resulting in various patterns of muscle weakness and dysfunction. There are many types of hereditary myopathies caused by mutations in one or more of a large set of genes. Subjects with hereditary myopathies generally suffer from muscle weakness, motor delay, respiratory dysfunction, and bulbar muscle dysfunction. Since the etiology of many different forms of hereditary myopathies is well characterized, gene therapy offers an attractive option for treating these disorders. Indeed, clinical trials of such gene therapy have been initiated for several hereditary myopathies.

[0118] One such disorder for which gene therapy has been developed is X-linked myotubular myopathy (XLMTM). MTM is a congenital myopathy caused by loss-of-function mutations in the myotubularin (MTM1) gene that affects 1 in 50,000 live male births. Pierson CR, Ann Transl Med., 3(5):61 (2015), the contents of which are incorporated herein by reference. Adeno-associated virus (AAV)-mediated delivery of a gene therapy vector encoding a functional MTM1 gene has shown promise for the treatment of MTM in mice, dogs, and human subjects. See Buj-Bello, Anna et al., Human molecular genetics, (17) 14: 2132-43 (2008), Childers MK, Sci Transl Med., 6 (220): 220ra10 (2014), and Kaiser J., "Boys with a rare muscle disease are breathing on their own, thanks to gene therapy" doi: 10.1126 / science.aax9005, the contents of which are incorporated herein by reference. Furthermore, AAV-mediated delivery of a gene therapy vector encoding myotubularin-related protein 2 (MTMR2), a homolog of the MTM1 gene, improves motor activity and muscle strength in MTM1-deficient knockout mice. Daniele N. et al., J Neuropathol Exp Neurol., 77 (4): 282-95 (2018), the contents of which are incorporated herein by reference.

[0119] Similarly, gene therapy has been developed to treat Duchenne muscular dystrophy (DMD). DMD is an X-linked myopathy caused by loss-of-function mutations in the dystrophin (DMD) gene that affects 1 in 3,500-5,000 live-born males. Several human clinical trials have been conducted for the treatment of DMD by AAV-mediated delivery of a gene encoding a smaller functional version of the dystrophin protein, sometimes referred to as mini-dystrophin or micro-dystrophin. Duan D., Mol Ther., 26(10):2337-56(2018), the contents of which are incorporated herein by reference. Further examples of skeletal muscle diseases that have been initiated in clinical trials include Becker muscular dystrophy and limb-girdle muscular dystrophy. Braun R.et al., Am J Phys Med Rehabil., 93(11 Suppl 3):S97-S107(2014), the contents of which are incorporated herein by reference.

[0120] Thus, in one aspect, the present disclosure provides a method for treating a skeletal muscle disease in a subject by delivering a complex of a therapeutic mRNA encoding a skeletal muscle protein described herein and a 3E10 antibody or a variant thereof or an antigen-binding fragment thereof to the subject's skeletal muscle.

[0121] In some embodiments, the polypeptide encoded by the mRNA is a wild-type version of a skeletal muscle protein, although it will be understood that naturally occurring variants or synthetically engineered versions of skeletal muscle proteins may also be used in the compositions and methods described herein. For example, when mRNA therapy is used for enzyme replacement therapy, it is common for the enzyme encoded by the mRNA to be engineered to improve enzymatic activity. Furthermore, in certain cases, when the wild-type version of a therapeutic protein is particularly large and / or contains one or more domains that are particularly sensitive to proteolysis, it is common for the protein encoded by the gene therapy vector to be engineered to make the protein smaller and / or to remove sensitive regions that are not necessary for protein function.

[0122] In some embodiments, the therapeutic mRNA molecule encodes a skeletal muscle protein, including, but not limited to, nebulin (NEB), skeletal alpha-actin (ACTA), alpha-tropomyosin-3 (TPM3), beta-tropomyosin-2 (TPM2), troponin T1 (TNNT1), cofilin-2 (CFL2), Kelch repeat and BTB domain containing-13 (KBTBD13), Kelch-like family member-40 (KLHL40), Kelch-like protein 4 (KLHL4), Kelch-like family member 41 (KLHL41), leiomodin-3 (LMOD 3), myopalladin (MYPN), ryanodine receptor (RYR1), selenoprotein N (SEPN1), myotubularin (MTM1), dynamin-2 (DNM2), amphiphysin-2 (BIN1), titin (TTN), striated muscle preferentially expressed protein kinase (SPEG), slow skeletal / beta-cardiac myosin heavy chain (MYH7), cytochrome b, cytochrome c oxidase, thymidine kinase (TK2), polymerase gamma 1 (POLG1), lysosomal enzyme acid alpha-glucosidase (GAA), glycogen dehydrogenase (GDH) Branching enzyme (AGL), muscle phosphorylase (PYGM), carnitine transporter OCTN2 (SLC22A5), electron transfer flavoprotein (ETF), ETF-dehydrogenase (ETFH), adipose triglyceride lipase (PNPLA2), skeletal muscle chloride channel (ClC1), skeletal muscle sodium channel alpha-subunit (SCN4A), myotonin protein kinase (DMPK), zinc finger 9 (ZNF9), dystrophin (DMD), myotilin (MYOT), lamin A / C (LMNA), caveolin 3 (CAV3), DnaJ heat shock protein family (Hsp40) member B6 (DNAJB6), desmin (DES), transportin 3 (TNPO3), heterogeneous nuclear ribonucleoprotein D-like (HNRPDL), calpain 3, dysferlin (DYSF), gamma-sarcoglycan (SGCG), alpha-sarcoglycan (SGCA), beta-sarcoglycan (SGCB), delta-sarcoglycan (SGCD), telethonin (TCAP), E3 ubiquitin-protein ligase TRIM32 (TRIM32),Fukutin-related protein (FKRP), protein O-mannosyl-transferase 1 (POMT1), anoctamin 5 (ANO5), fukutin, protein O-mannosyl-transferase 2 (POMT2), O-linked mannose beta-1,2-N-acetylglucosaminyltransferase (POMTnG1), dystroglycan (DAG1), plectin (PLEC1), LGMD2R, transport protein particle complex subunit 11 (TRAPPC11), mannose-1-phosphate guanyltransferase beta (GMPPB), D-ribitol-5-phosphate cytidylyltransferase (ISP) D), alpha-glucosidase, LIM and senescent cell antigen-like containing domain protein 2 (LIMS2), isoprenoid synthase domain containing (ISPD), Popeye domain containing 1 (POPDC1), lamina-associated polypeptide 1B (TOR1AIP1), O-glycosyltransferase 1 (POGLUT1), laminin subunit alpha-2 (LAMA2), collagen alpha-1 (VI) chain (COL6A1), collagen alpha-2 (VI) chain (COL6A2), collagen alpha-3 (VI) chain (COL6A3), double homeobox 4 (DUX4), and emerin (EMD).

[0123] In some embodiments, the subject has a genetic skeletal muscle disease. For example, in some embodiments, the subject carries a skeletal muscle gene with a partial or complete loss-of-function mutation. Thus, in some embodiments, the therapeutic mRNA administered to the subject encodes a functional copy of a polypeptide corresponding to the mutated gene in the subject. However, in some cases, such as MTMR2-mediated gene therapy for X-linked myotubular myopathy (discussed above), the mRNA encodes a homolog of the protein encoded by the mutated gene in the subject, a protein with a partially redundant function, and / or a protein that functions in a partially redundant pathway as the protein encoded by the mutated gene in the subject.

[0124] In some embodiments, the genetic skeletal muscle disease is a non-dystrophic hereditary myopathy. Non-limiting examples of non-dystrophic hereditary myopathy include nemaline myopathy, core myopathy (central and multiminicore), centronuclear myopathy / myotubular myopathy (XLMTM), congenital fiber-type uneven distribution myopathy, myosin storage myopathy, mitochondrial myopathy, hereditary myopathy, metabolic myopathy (lipid storage disease), myotonia congenita, and paramyotonia congenita. For a review of examples of non-dystrophic hereditary myopathy, see, for example, Muscle Cell and Tissue - Current Status of Research Field, Edited by Kunihiro Sakuma, Chapter 6 "Genetic Myopathies" (2018), the contents of which are incorporated herein by reference.

[0125] In some embodiments, the genetic skeletal muscle disease is a dystrophic hereditary myopathy.Non-limiting examples of dystrophic hereditary myopathy include myotonic dystrophy (DM1 / DM2), Duchenne muscular dystrophy, Becker muscular dystrophy, autosomal dominant limb-girdle muscular dystrophy (LGMD1), autosomal recessive limb-girdle muscular dystrophy (LGMD2), congenital muscular dystrophy, facioscapulohumeral muscular dystrophy, and Emery-Dreifuss muscular dystrophy.For a review of examples of dystrophic hereditary myopathy, see, for example, Muscle Cell and Tissue-Current Status of Research Field, Edited by Kunihiro Sakuma, Chapter 6 "Genetic Myopathies" (2018), the contents of which are incorporated herein by reference.

[0126] Each of the classes of myopathy listed above is associated with mutations in one or more skeletal muscle genes. Examples of genes found to be associated with specific skeletal muscle diseases are listed in Table 2 below. Thus, in some embodiments, subjects with specific skeletal muscle diseases are treated by administration of a 3E10-mRNA complex, where the mRNA encodes a polypeptide corresponding to the relevant gene in Table 2. For example, in one embodiment, an mRNA molecule encoding a polypeptide related to myotubularin (MTM1) protein is used to treat certain types of myotubular myopathy, such as X-linked myotubular myopathy (XLMTM).

[0127] Table 2. Examples of genes found to be mutated in various skeletal muscle diseases. TIFF2024508309000003.tif192166TIFF2024508309000004.tif173166TIFF2024508309000005.tif247166 TIFF2024508309000006.tif218166TIFF2024508309000007.tif127166TIFF2024508309000008.tif137166

[0128] Compositions for treating hereditary myopathies In one aspect, the disclosure provides a pharmaceutical composition comprising a complex formed between a therapeutic mRNA polynucleotide encoding, for example, a skeletal muscle polypeptide described herein and a 3E10 antibody or variant thereof or an antigen-binding fragment thereof described herein.

[0129] In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic mRNA of at least 2: 1. As reported in Example 6 and Example 8, the use of a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide in the compositions described herein protects the mRNA molecules from RNA degradation.

[0130] Furthermore, as illustrated in Figures 13A and 13B, while the parent 3E10 antibody protected mRNA from RNAse A-mediated RNA degradation at molar ratios of 2:1 and 20:1, the protection obtained at the 20:1 molar ratio was greater than that obtained at the 2:1 molar ratio. Thus, in some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variants thereof or antigen-binding fragments thereof to therapeutic polynucleotide of at least about 2:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variants thereof or antigen-binding fragments thereof to therapeutic polynucleotide of at least about 5:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variants thereof or antigen-binding fragments thereof to therapeutic polynucleotide of at least about 7.5:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variants thereof or antigen-binding fragments thereof to therapeutic polynucleotide of at least about 10:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of at least about 15:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of at least about 20:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of at least about 25:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of at least about 30:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of at least about 40:1.In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof, or antigen-binding fragment thereof to therapeutic polynucleotide of at least about 50:1.

[0131] Furthermore, as shown in Figure 15, the use of a higher stoichiometric ratio provides better protection of longer polynucleotides from degradation. Thus, in some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variants thereof or antigen-binding fragments thereof to therapeutic polynucleotide of at least about 50:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variants thereof or antigen-binding fragments thereof to therapeutic polynucleotide of at least about 75:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variants thereof or antigen-binding fragments thereof to therapeutic polynucleotide of at least about 100:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variants thereof or antigen-binding fragments thereof to therapeutic polynucleotide of at least about 125:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variants thereof or antigen-binding fragments thereof to therapeutic polynucleotide of at least about 150:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variants thereof or antigen-binding fragments thereof to therapeutic polynucleotide of at least about 200:1. In some embodiments, the longer polynucleotide is at least 1000 nucleotides in length, e.g., 1000 nucleotides in length for single stranded polynucleotides and 1000 base pairs in length for double stranded polynucleotides. In some embodiments, the longer polynucleotide is at least 1500 nucleotides in length. In some embodiments, the longer polynucleotide is at least 2000 nucleotides in length. In some embodiments, the longer polynucleotide is at least 2500 nucleotides in length. In some embodiments, the longer polynucleotide is at least 3000 nucleotides in length. In some embodiments, the longer polynucleotide is at least 4000 nucleotides in length. In some embodiments, the longer polynucleotide is at least 5000 nucleotides in length.In some embodiments, the longer polynucleotide is at least 7500 nucleotides in length. In some embodiments, the longer polynucleotide is at least 10,000 nucleotides in length.

[0132] In some embodiments, the pharmaceutical compositions described herein provide a ratio of 3E10 antibody or variants thereof, or antigen-binding fragments thereof to a therapeutic polynucleotide of at least about 3:1, at least about 4:1, at least about 5:1, at least about 6:1, at least about 7:1, at least about 8:1, at least about 9:1, at least about 10:1, at least about 11:1, at least about 12:1, at least about 13:1, at least about 14:1, at least about 15:1, at least about 16:1, at least about 17:1, at least about 18:1, at least about 19:1, at least about 20:1, at least about 21:1, at least about 22:1, at least about 23:1, at least about 24:1, at least about 25:1, at least about 26:1, at least about 27:1, at least about 28:1, at least about 29:1, at least about 30:1, at least about 31:1, at least about 32:1, at least about 33: 1, at least about 34:1, at least about 35:1, at least about 36:1, at least about 37:1, at least about 38:1, at least about 39:1, at least about 40:1, at least about 41:1, at least about 42:1, at least about 43:1, at least about 44:1, at least about 45:1, at least about 50:1, at least about 55:1, at least about 60:1, at least about 70:1, at least about 75:1, at least about 80:1, In some embodiments, the molar ratio is at least about 85:1, at least about 90:1, at least about 95:1, at least about 100:1, at least about 110:1, at least about 120:1, at least about 125:1, at least about 130:1, at least about 140:1, at least about 150:1, at least about 160:1, at least about 170:1, at least about 175:1, at least about 180:1, at least about 190:1, at least about 200:1, or more.

[0133] In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of at least about 2:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of at least 5:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of at least 7.5:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of at least 10:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of at least 15:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of at least 20:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of at least 25:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of at least 30:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of at least 40:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of at least 50:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of at least 75:1.In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of at least 100:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of at least 125:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of at least 150:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of at least 200:1.

[0134] In some embodiments, the pharmaceutical compositions described herein comprise a ratio of 3E10 antibody or variants thereof or antigen-binding fragments thereof to a therapeutic polynucleotide of at least 3:1, at least 4:1, at least 5:1, at least 6:1, at least 7:1, at least 8:1, at least 9:1, at least 10:1, at least 11:1, at least 12:1, at least 13:1, at least 14:1, at least 15:1, at least 16:1, at least 17:1, at least 18:1, at least 19:1, at least 20:1, at least 21:1, at least 22:1, at least 23:1, at least 24:1, at least 25:1, at least 26:1, at least 27:1, at least 28:1, at least 29:1, at least 30:1, at least 31:1, at least 32:1, at least 33:1, at least 34:1, at least 35:1, at least 36:1, at least 37:1, at least 38:1, at least 39:1, at least 40:1, at least 41:1, at least 42:1, at least 43:1, at least 44:1, at least 45:1, at least 46:1, at least 47:1, at least 48:1, at least 49:1, at least 50:1, at least 51:1, at least 52:1, at least 53:1, at least 54:1, at least 55:1, at least 56:1, at least 57:1, at least 58:1, at least 59:1, at least 60:1, at least 61:1, at least 62:1, at least 3:1, at least 34:1, at least 35:1, at least 36:1, at least 37:1, at least 38:1, at least 39:1, at least 40:1, at least 41:1, at least 42:1, at least 43:1, at least 44:1, at least 45:1, at least 50:1, at least 55:1, at least 60:1, at least 70:1, at least 75:1, at least 80:1, at least 85:1, at least 90:1, at least 95:1, at least 100:1, at least 110:1, at least 120:1, at least 125:1, at least 130:1, at least 140:1, at least 150:1, at least 160:1, at least 170:1, at least 175:1, at least 180:1, at least 190:1, at least 200:1, or more.

[0135] In some embodiments, the pharmaceutical compositions described herein comprise a combination of 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 21:1, 22:1, 23:1, 24:1, 25:1, 26:1, 27:1, 28:1, 29:1, 30:1, 31:1, 32:1, 33:1, 34:1, 35:1, 36:1, 37:1, 38:1, 39:1, 40:1, 41:1, 42:1, 43:1, 44:1, 45:1, 46:1, 47:1, 48:1, 49:1, 50:1, 51:1, 52:1, 53:1, 54:1, 55:1, 56:1, 57:1, 58:1, 59:1, 60:1, 61:1, 62:1, 63:1, 64:1, 65:1, 66:1, 67:1, 68:1, 69:1, 70:1, 71:1, 72:1, 73:1, 74:1, 75:1, 76:1, 77:1, 78:1, 79:1, 80:1, 81:1, 82:1, 83:1, 84:1, 85:1, 8 1, 32:1, 33:1, 34:1, 35:1, 36:1, 37:1, 38:1, 39:1, 40:1, 41:1, 42:1, 43:1, 44:1, 45:1, 50:1, 55:1, 60:1, 70:1, 75:1, 80:1, 85:1, 90:1, 95:1, 100:1, 110:1, 120:1, 125:1, 130:1, 140:1, 150:1, 160:1, 170:1, 175:1, 180:1, 190:1, 200:1 or more molar ratios.

[0136] In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of about 200:1 or less. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of about 150:1 or less. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of about 100:1 or less. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of about 50:1 or less. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of about 40:1 or less. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of about 30:1 or less. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of about 25:1 or less. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of about 20:1 or less. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of about 15:1 or less. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of about 10:1 or less.

[0137] In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof, or antigen-binding fragment thereof to therapeutic polynucleotide of about 200:1 or less, about 175:1 or less, about 150:1 or less, about 125:1 or less, about 100:1 or less, about 75:1 or less, about 50:1 or less, about 45:1 or less, about 40:1 or less, about 35:1 or less, about 30:1 or less, about 25:1 or less, about 20:1 or less, or less.

[0138] In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 200:1 or less. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 150:1 or less. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 100:1 or less. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 50:1 or less. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 40:1 or less. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 30:1 or less. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 25:1 or less. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 20:1 or less. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 15:1 or less. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 10:1 or less.

[0139] In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof, or antigen-binding fragment thereof to therapeutic polynucleotide of 200:1 or less, 175:1 or less, 150:1 or less, 125:1 or less, 100:1 or less, 75:1 or less, 50:1 or less, 45:1 or less, 40:1 or less, 35:1 or less, 30:1 or less, 35:1 or less, 30:1 or less, 25:1 or less, 20:1 or less, or less.

[0140] In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 2:1 to 200:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 2:1 to 175:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 2:1 to 150:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 2:1 to 125:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 2:1 to 100:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 2:1 to 75:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 2:1 to 50:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 2:1 to 40:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 2:1 to 30:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 2:1 to 25:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof, or antigen-binding fragment thereof to therapeutic polynucleotide of between 2:1 and 20:1.In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 2:1 to 15:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 2:1 to 10:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 2:1 to 7.5:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 2:1 to 5:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 2:1 to 3:1.

[0141] In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 3:1 to 200:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 3:1 to 175:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 3:1 to 150:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 3:1 to 125:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 3:1 to 100:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 3:1 to 75:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 3:1 to 50:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 3:1 to 40:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 3:1 to 30:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 3:1 to 25:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof, or antigen-binding fragment thereof to therapeutic polynucleotide of between 3:1 and 20:1.In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 3:1 to 15:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 3:1 to 10:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 3:1 to 7.5:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 3:1 to 5:1.

[0142] In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 5:1 to 200:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 5:1 to 175:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 5:1 to 150:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 5:1 to 125:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 5:1 to 100:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 5:1 to 75:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 5:1 to 50:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 5:1 to 40:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 5:1 to 30:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 5:1 to 25:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof, or antigen-binding fragment thereof to therapeutic polynucleotide of between 5:1 and 20:1.In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 5:1 to 15:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 5:1 to 10:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 5:1 to 7.5:1.

[0143] In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 7.5:1 to 200:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 7.5:1 to 175:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 7.5:1 to 150:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 7.5:1 to 125:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 7.5:1 to 100:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 7.5:1 to 75:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 7.5:1 to 50:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 7.5:1 to 40:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 7.5:1 to 30:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 7.5:1 to 25:1.In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 7.5:1 to 20:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 7.5:1 to 15:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 7.5:1 to 10:1.

[0144] In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 10:1 to 200:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 10:1 to 175:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 10:1 to 150:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 10:1 to 125:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 10:1 to 100:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 10:1 to 75:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 10:1 to 50:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 10:1 to 40:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 10:1 to 30:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 10:1 to 25:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof, or antigen-binding fragment thereof to therapeutic polynucleotide of between 10:1 and 20:1.In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof, or antigen-binding fragment thereof to therapeutic polynucleotide of between 10:1 and 15:1.

[0145] In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 15:1 to 200:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 15:1 to 175:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 15:1 to 150:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 15:1 to 125:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 15:1 to 100:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 15:1 to 75:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 15:1 to 50:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 15:1 to 40:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 15:1 to 30:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 15:1 to 25:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof, or antigen-binding fragment thereof to therapeutic polynucleotide of between 15:1 and 20:1.

[0146] In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 20:1 to 200:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 20:1 to 175:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 20:1 to 150:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 20:1 to 125:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 20:1 to 100:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 20:1 to 75:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 20:1 to 50:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 20:1 to 40:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 20:1 to 30:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 20:1 to 25:1.

[0147] In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 25:1 to 200:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 25:1 to 175:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 25:1 to 150:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 25:1 to 125:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 25:1 to 100:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 25:1 to 75:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 25:1 to 50:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 25:1 to 40:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of 25:1 to 30:1.

[0148] In yet other embodiments, other ranges within the range of about 2:1 to about 200:1 are contemplated.

[0149] In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of about 1:1 to about 200:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of about 1:1 to about 175:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of about 1:1 to about 150:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of about 1:1 to about 125:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of about 1:1 to about 100:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of about 1:1 to about 75:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of about 1:1 to about 50:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of about 1:1 to about 30:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of about 1:1 to about 20:1. In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof or antigen-binding fragment thereof to therapeutic polynucleotide of about 1:1 to about 10:1.In some embodiments, the pharmaceutical compositions described herein have a molar ratio of 3E10 antibody or variant thereof, or antigen-binding fragment thereof to therapeutic polynucleotide of about 1:1 to about 5:1.

[0150] As reported in Example 3, the 3E10 antibody or its variants or antigen-binding fragments thereof localize in skeletal muscle tissue in vivo after systemic administration. Thus, the compositions described herein are well suited for delivery of therapeutic mRNAs that code for proteins useful for treating disorders of skeletal muscle tissue. Thus, in some embodiments, the therapeutic mRNA polynucleotide codes for a skeletal muscle polypeptide.

[0151] Examples of proteins mutated in various myopathies and their associated genes are presented in Table 2. Generally, any one of these proteins and their variants that retain the function of the full-length protein may be encoded by the therapeutic mRNA disclosed herein. Thus, in some embodiments, the skeletal polypeptide is selected from the group consisting of nebulin (NEB), skeletal alpha-actin (ACTA), alpha-tropomyosin-3 (TPM3), beta-tropomyosin-2 (TPM2), troponin T1 (TNNT1), cofilin-2 (CFL2), Kelch repeat and BTB domain containing-13 (KBTBD13), Kelch-like family member-40 (KLHL40), Kelch-like protein 4 (KLHL4), Kelch-like family member-5 (KLHL5), Kelch-like family member-6 (KLHL6), Kelch-like family member-7 (KLHL7), Kelch-like family member-8 (KLHL8), Kelch-like family member-9 (KLHL9), Kelch-like family member-10 (KLHL9), Kelch-like family member-11 (KLHL9), Kelch-like family member-12 (KLHL9), Kelch-like family member-13 (KLHL9), Kelch-like family member-14 (KLHL9), Kelch-like family member-15 (KLHL9), Kelch-like family member-16 (KLHL9), Kelch-like family member-17 (KLHL9), Kelch-like family member-18 (KLHL9), Kelch-like family member-19 (KLHL9), Kelch-like family member-20 (KLHL9), Kelch-like family member-21 (KLHL9), Kelch-like family member-22 (KLHL9), Kelch-like family member-23 (KLHL9), Kelch-like family member-24 (KLHL9), K -member 41 (KLHL41), leiomodin-3 (LMOD3), myopalladin (MYPN), ryanodine receptor (RYR1), selenoprotein N (SEPN1), myotubularin (MTM1), dynamin-2 (DNM2), amphiphysin-2 (BIN1), titin (TTN), striated muscle preferentially expressed protein kinase (SPEG), slow skeletal / beta-cardiac myosin heavy chain (MYH7), cytochrome b, cytochrome c oxidase, thymidine kinase (TK2), polymerase POLG1, lysosomal enzyme acid alpha-glucosidase (GAA), glycogen-debranching enzyme (AGL), muscle phosphorylase (PYGM), carnitine transporter OCTN2 (SLC22A5), electron transfer flavoprotein (ETF), ETF-dehydrogenase (ETFH), adipose triglyceride lipase (PNPLA2), skeletal muscle chloride channel (ClC1), skeletal muscle sodium channel alpha-subunit (SCN4A), myotonin protein kinase DMPK, zinc finger 9 (ZNF9), dystrophin (DMD), myotilin (MYOT), lamin A / C (LMNA), caveolin 3 (CAV3), DnaJ heat shock protein family (Hsp40) member B6 (DNAJB6), desmin (DES), transportin 3, heterogeneous nuclear ribonucleoprotein D-like (HNRPDL), calpain 3, dysferlin (DYSF), gamma-sarcoglycan (SGCG), alpha-sarcoglycan (SGCA),beta-sarcoglycan (SGCB), delta-sarcoglycan (SGCD), telethonin (TCAP), E3 ubiquitin-protein ligase TRIM32 (TRIM32), fukutin-related protein (FKRP), protein O-mannosyl-transferase 1 (POMT1), anoctamin 5 (ANO5), fukutin, protein O-mannosyl-transferase 2 (POMT2), O-linked mannose beta-1,2-N-acetylglucosaminyltransferase (POMTnG1), dystroglycan (DAG1), plectin (PLEC1), LGMD2R, transport protein particle complex subunit 11 (TRAPPC11), mannose-1-phosphate guanyltransferase beta (G MPPB), D-ribitol-5-phosphate cytidylyltransferase (ISPD), alpha-glucosidase, LIM and senescent cell antigen-like domain protein 2 (LIMS2), isoprenoid synthase domain containing (ISPD), Popeye domain containing 1 (POPDC1), lamina-associated polypeptide 1B (TOR1AIP1), O-glycosyltransferase 1 (POGLUT1), laminin subunit alpha-2 (LAMA2), collagen alpha-1 (VI) chain (COL6A1), collagen alpha-2 (VI) chain (COL6A2), collagen alpha-3 (VI) chain (COL6A3), double homeobox 4 (DUX4), and emerin (EMD).

[0152] Furthermore, since the 3E10 antibody or variant thereof or antigen-binding fragment thereof localizes in skeletal muscle tissue in vivo after systemic administration, the compositions of the present disclosure may be formulated for and subsequently administered by one of many common routes of administration. In some embodiments, the pharmaceutical composition is formulated for parenteral administration. In some embodiments, the parenteral administration is intramuscular, intravenous, or subcutaneous.

[0153] In some embodiments, the mRNA of the compositions described herein is codon-optimized, for example, to improve half-life or increase translation in skeletal muscle tissue. Codon optimization refers to a polynucleotide sequence that encodes a polypeptide (e.g., a skeletal muscle protein polypeptide), where at least one codon of a native polynucleotide encoding the polypeptide has been altered to improve the properties of the polynucleotide sequence. In some embodiments, the improved properties facilitate increased transcription of the mRNA encoding the polypeptide, increased stability of the mRNA (e.g., improved mRNA half-life), increased translation of the polypeptide, and / or increased packaging of the polynucleotide in a vector. Non-limiting examples of modifications that can be used to achieve improved properties include altering the codon usage and / or distribution for particular amino acids, adjusting the global and / or local GC content, removing AT-rich sequences, removing repetitive sequence elements, adjusting the global and / or local CpG dinucleotide content, removing cryptic regulatory elements (e.g., TATA box elements and CCAAT box elements), removing intron / exon splice sites, improving regulatory sequences (e.g., introduction of Kozak consensus sequences), and removing sequence elements that can form secondary structures (e.g., stem loops) in the transcribed mRNA.

[0154] Similarly, in some embodiments, the mRNA of the compositions described herein comprises one or more non-standard nucleotides, e.g., to improve the stability and / or half-life of the mRNA in vivo. Examples of non-standard nucleotides suitable for inclusion in the mRNA molecules described herein are described in U.S. Patent No. 9,181,319, the contents of which are incorporated herein by reference. EXAMPLES

[0155] For the following experiments, the standard 3E10 sequence was used, except where noted (e.g., Example 4) as was the D31N variant. Both the standard 3E10 and the D31N variant were used as full-length antibodies.

[0156] Example 1 Carrier DNA enhances mRNA delivery to non-tumor tissues 2ug of fluorescently labeled mRNA was mixed with 20ug of 3E10-D31N with or without carrier DNA (5ug) for 15 minutes at room temperature. mRNA complexed with 3E10 was injected into fetuses at E15.5. 24-48 hours after treatment, fetuses were harvested and analyzed for mRNA delivery using IVIS imaging.

[0157] Without carrier DNA, 3E10-D31N complexed with mRNA was rapidly cleared from the fetus at 24 h, but the addition of carrier DNA resulted in detectable mRNA signals in multiple tissues of the fetus at 48 h.

[0158] Example 2 3E10(D31N) complexed with mRNA and carrier DNA results in sustained levels of protein expression 10 ug of luciferase mRNA and 10 ug of single-stranded carrier DNA (60 nt) were mixed with 100 ug of 3E10 (WT) or 3E10 (D31N) at room temperature for 15 minutes. The mRNA complexed with 3E10 was injected intramuscularly (IM) into the right quadriceps of each mouse. Luciferase expression was monitored over a period of 6 days.

[0159] As can be seen in Figure 8, administration of 3E10(D31N) complexed with mRNA and carrier DNA resulted in sustained levels of luciferase expression, while 3E10(WT) complexed with mRNA and carrier DNA did not produce any discernible signal above background.

[0160] Example 3 Distribution of IV-Injected 3E10 In Vivo The distribution of 3E10 injected IV into muscle was investigated. Mice were intravenously injected with 200 μg of 3E10 (WT or D31N) and labeled with VivoTag680 (Perkin Elmer). Four hours after injection, muscles were harvested and imaged with IVIS (Perkin Elmer) (Figures 9A and 9B). Quantification of IVIS images demonstrates that 3E10-D31N achieves higher distribution into muscle compared to 3E10-WT (Figure 9C).

[0161] The dose-dependent biodistribution of 3E10-D31N to tissues was investigated. Mice were intravenously injected with 100 μg or 200 μg of 3E10-D31N labeled with VivoTag680 (Perkin Elmer). Twenty-four hours after injection, tissues were harvested and imaged with IVIS (Perkin Elmer). Quantification of tissue distribution demonstrated a two-fold dose-dependent increase in muscle accumulation without a comparable increase in multiple tissues, including liver (FIG. 10).

[0162] Example 4 Molecular Modeling of 3E10 and Its Engineered Variants WT heavy chain scFv sequence E VQLVESGGGL VKPGGSRKLS CAASGFTFSD YGMHWVRQAP EKGLEWVAYI SSGSSTIYYA DTVKGRFTIS RDNAKNTLFL QMTSLRSEDT AMYYCARRGL LLDYWGQGTT LTVS (SEQ ID NO: 108) Light chain scFv sequence D IVLTQSPASL AVSLGQRATI SCRASKSVST SSYSYMHWYQ QKPGQPPKLL IKYASYLESG VPARFSGSGS GTDFTLNIHP VEEEDAATYY CQHSREFPWT FGGGTKLEIK RADAAPGGGG SGGGGSGGGGS (SEQ ID NO: 109)

[0163] Molecular modeling (Pymol) of 3E10 revealed a putative nucleic acid binding pocket (NAB1) (Figures 11A-11B). Mutation of residue 31 of CDR1 from aspartic acid to asparagine increased the cationic charge of this residue and enhanced nucleic acid binding and delivery in vivo (3E10-D31N).

[0164] Mutation of residue 31 of CDR1 from aspartic acid to arginine (3E10-D31R) further extended the cationic charge, while mutation to lysine (3E10-D31K) altered the charge orientation (FIG. 14A).

[0165] In the heavy and light chain sequences above, the NAB1 amino acids predicted from molecular modeling are underlined. Figure 11B is a diagram showing molecular modeling (Pymol) of 3E10-scFv with the NAB1 amino acid residues illustrated using punctuated dots.

[0166] Example 5 Intramuscular injection of 3E10(D31N) complexed with mRNA results in sustained protein expression in skeletal muscle We next investigated whether intramuscular administration of 3E10(D31N)-mRNA complexes would result in sustained expression of mRNA in skeletal muscle. Briefly, a complex of 3E10(D31N) and mRNA encoding green fluorescent protein (luciferase) with sequence GFP_mRNA shown below as (SEQ ID NO: 110) was formed by mixing 3E10(D31N) and mRNA at a molar ratio of 20:1. The resulting complex was administered by intramuscular injection into the hindlimb skeletal muscle of mice. Bioluminescence in skeletal muscle, indicating expression of luciferase from the injected mRNA, was imaged ( FIG. 12A ) and quantified over a period of 5 days ( FIG. 12B ). As shown in FIG. 12B, the expression level of luciferase encoded by the mRNA was maintained for at least 5 days.

[0167] Example 6 3E10(D31N) protects mRNA from RNA degradation We next investigated whether complexing mRNA with 3E10(D31N) protects the mRNA from degradation. Briefly, a complex between 3E10(D31N) and an mRNA encoding green fluorescent protein (luciferase) having the sequence GFP_mRNA shown below as (SEQ ID NO: 110) was formed by mixing 3E10(D31N) and mRNA at a molar ratio of 20:1. The complex of free mRNA and 3E10-mRNA was then incubated with 1% serum, 10% serum, or 16 μg / mL RNAse A at 37° C. for 10 minutes. Gel electrophoretic analysis of these reactions was performed (FIG. 13A). As shown in FIG. 13A, free mRNA was degraded by incubation with each of 1% serum, 10% serum, and RNAse A. However, no obvious RNA degradation was observed when the complexed mRNA was incubated with either 1% serum, 10% serum, or RNAse A, suggesting that 3E10(D31N) protects the mRNA from degradation.

[0168] GFP_mRNA- AUGGUGAGCAAGGGCGAGGAGCUGUUCACCGGGGUGGUGCCCAUCCUGGUCGAGCUGGACGGCGACGUAAACGGCCACAAGUUCAGCGUGUCCGGCGAGGGCGAGGGCGAUGCCACCUACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCCGUGCCCUGGCCCACCCUCGUGACCACCCUGACCUACGGCGUGCAGUGCUUCAGCCGCUACCCCGACCACAUGAAGCAGCACGACUUCUUCAAGUCCGCCAUGCCCGAAGGCUACGUCCAGGAGCGCACCAUCUUCUUCAAGGACGACGGCAACUACAAGACCCGCGCCGAGGUGAAGUUCGAGGGCGACACCCUGGUGAACCGCAUCGAGCUGAAGGGCAUCGACUUCAAGGAGGACGGCAACAUCCUGGGGCACAAGCUGGAGUACAACUACAACAGCCACAACGUCUAUAUCAUGGCCGACAAGCAGAAGAACGGCAUCAAGGUGAACUUCAAGAUCCGCCACAACAUCGAGGACGGCAGCGUGCAGCUCGCCGACCACUACCAGCAGAACACCCCCAUCGGCGACGGCCCCGUGCUGCUGCCCGACAACCACUACCUGAGCACCCAGUCCGCCCUGAGCAAAGACCCCAACGAGAAGCGCGAUCACAUGGUCCUGCUGGAGUUCGUGACCGCCGCCGGGAUCACUCUCGGCAUGGACGAGCUGUACAAGUAA(SEQ ID NO: 110).

[0169] We next investigated whether mRNA complexed at a lower molar ratio was also protected from RNA degradation. Briefly, a complex between 3E10(D31N) and mRNA encoding green fluorescent protein (GFP_mRNA, SEQ ID NO: 110) was formed by mixing 3E10(D31N) and mRNA at a molar ratio of 2:1. The complex between free mRNA and 3E10-mRNA was then incubated with RNAse A under the conditions described above. Gel electrophoretic analysis of these reactions was performed (Figure 13B). As shown in Figure 13B, free mRNA was completely degraded by incubation with RNAse A. However, complexing mRNA with 3E10(D31N) at a molar ratio of 2:1 provided some protection of the mRNA from degradation, as indicated by the presence of an RNA signal in the wells, indicating the presence of an intact 3E10(D31N)-mRNA complex. The protection afforded by the 2:1 molar ratio appears to be less than that afforded to the mRNA when complexed at a 20:1 molar ratio.

[0170] Example 7 3E10-D31N is internalized and associates with gDNA in vivo The internalization and cell location experiments of 3E10-D31N were investigated. Isotype control, 3E10-WT (GMAB WT ) antibody, and 3E10-D31N (GMAB D31N ) antibodies 89 Zr was labeled and administered to cells in vivo. After a certain period of time, the cellular components (cytosol, membrane, nuclear proteins, and gDNA) were fractionated. 89 The Zr signal (counts per minute, CPM) was assayed. As shown in FIG. WT Antibodies and GMAB D31N The majority of the antibody was found to be localized in the nucleus and associated with both the nuclear protein and gDNA fractions of the nucleus. WT A higher proportion of GMAB D31N As a result, GMAB was associated with the gDNA fraction. D31N GMAB WT These results suggest that it localizes to chromatin more easily than

[0171] Example 8 3E10(D31N) protects dystrophin mRNA from RNA degradation We investigated whether 3E10-D31N protects dystrophin-encoding mRNA from enzymatic degradation when complexed, and whether a higher stoichiometric amount of 3E10-D31N is required. Briefly, complexes of 3E10-D31N with 14 kb mRNA encoding full-length human dystrophin were formed by mixing 3E10-D31N with mRNA at molar ratios of 1:1, 2:1, 5:1, 10:1, 20:1, and 100:1 (3E10:mRNA). The complexes of free mRNA and 3E10-mRNA were then incubated with 6 μg / mL RNAse A in the presence of proteinase K at 37° C. for 10 min to promote proteolysis. Figure 15 shows the agarose gel electrophoresis analysis of the protection assay. As shown in Figure 15, free dystrophin mRNA and dystrophin mRNA complexed at 1:1, 2:1, 5:1, and 10:1 molar ratios (3E10:mRNA) were completely degraded by incubation with RNAse A. However, as shown in Figure 15, complexing dystrophin mRNA with 3E10 at 20:1 and 100:1 molar ratios increased protection of the mRNA from degradation by RNAse A, as indicated by bands migrating at similar distances on the gel as undegraded mRNA. These results, coupled with those of Example 6, suggest that 3E10 protects polynucleotides in a size-dependent manner.

[0172] CITED REFERENCES AND ALTERNATIVE EMBODIMENTS All references cited in this specification are incorporated herein by reference in their entirety for all purposes to the same extent as if each individual publication or patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety for all purposes.

[0173] Many modifications and variations of the present invention can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. The specific embodiments described herein are provided merely as examples. These embodiments have been chosen and described in order to best explain the principles of the invention and its practical application, so as to enable those skilled in the art to best utilize the invention and its various embodiments with various modifications suited to the particular use contemplated. The present invention is limited only by the terms of the appended claims, along with the full scope of equivalents to which such claims are entitled.

Claims

[Claim 1] The invention described in the specification.

Images