RNA adeno-associated virus (RAAV) vectors and their uses

Abstract

The present invention provides an RNA sequence comprising an RNA sequence of interest and an RNA packaging signal. It further provides a recombinant DNA virus particle comprising an RNA sequence, said RNA sequence comprising an RNA sequence of interest and an RNA packaging signal, which is packaged into the protein shell of the DNA virus.

Description

REFERENCE TO RELATED APPLICATIONS

[0001] This international patent application claims priority to International Patent Application No. PCT / CN2021 / 075874, filed on February 7, 2021, the contents of which are incorporated by reference in their entirety into this specification. [Background technology]

[0002] Adeno-associated virus (AAV) is a small (approximately 20 nm in diameter), replication-deficient, non-enveloped virus that infects humans and other primate species. It belongs to the genus Dependoparvovirus in the family Parvoviridae. Wild-type AAV can infect both dividing and non-dividing cells and can integrate its genome into the genome of the host cell. It is named and classified according to its life cycle dependence on the presence of a helper virus, such as adenovirus (AdV).

[0003] AAVs have been found in multiple vertebrate species, including humans and non-human primates (NHPs). The current consensus is that AAVs do not cause any human disease and only elicit a very mild immune response. It consists of an icosahedral protein capsid that is approximately 20-25 nm in diameter and a single-stranded DNA (ssDNA) genome of approximately 4.7 kb, which may be either the positive (sense) or negative (antisense) strand.

[0004] The AAV capsid contains three types of subunits, VP1, VP2 and VP3, with a total of 60 copies in the ratio of 1:1:10 (VP1:VP2:VP3). At both ends of the genome, there are two T-shaped inverted terminal repeats (ITRs), which mainly serve as viral replication origins and packaging signals. The rep gene encodes four proteins required for viral replication. The Rep proteins are named Rep78, Rep68, Rep52 and Rep40 according to their molecular weights. The cap genes are encoded and translated from different initiation codons. A third gene encoding an assembly activating protein (AAP) is also encoded by the cap coding sequence in a different reading frame and has been shown to promote the assembly of viral particles.

[0005] Currently, thirteen AAV serotypes and many variants have been identified, which exhibit different tissue and cell type tropism spectra by recognizing different cell receptors. The in vivo tissue tropism of AAV1-13 has also been thoroughly studied in many animal models.

[0006] AAV ITR sequences each contain 145 nucleotides. The ITR sequences can each form a hairpin for self-priming, making the synthesis of the second DNA strand primase-independent. It has also been shown that ITRs are required for AAV DNA integration into and rescue from the host cell genome (human chromosome 19), for efficient encapsidation of AAV DNA, and for the generation of fully assembled DNA enzyme-resistant AAV particles.

[0007] The AAV2 ITR consists of two arm palindromic sequences (i.e., B-B' and C-C') embedded in a large stem palindromic sequence (A-A') as the origin of replication. The ITR can have two structures (i.e., Flip and Flop). See Figure 1. The flip and flop structures have the B-B' and C-C' palindromic sequences closest to the 3' end, respectively. The D sequence or D region, which has 20 nucleotides, remains single-stranded because it appears only once at each end of the AAV genome.

[0008] The ITRs further contain an approximately 22-bp sequence - the Rep-binding element (RBE) - that binds the AAV Rep78 and Rep68 proteins in a specific orientation. When the ITRs are in a palindromic (hairpin) structure, the Rep proteins further contact a 5-base sequence at one end of the short palindromic sequence (RBE') to activate the Rep DNA helicase and strand-specific endonuclease activity to assist in AAV replication and packaging (see Figure 1).

[0009] The RBE contains a tetranucleotide repeat (e.g., 4 repeats) with the consensus sequence 5'-GNGC-3'. The ATP-dependent DNA helicase activity of Rep78 and Rep68 remodels the A-A' region, generating a stem-loop that is located in a single-stranded form on top of the terminal release site (trs or TRS). In this structure, the strand-specific and site-specific endonuclease catalytic domains of Rep78 and Rep68 introduce an incision at the trs position. The nucleotide at the apex of the T-shaped structure corresponds to an additional RBE (RBE'), which stabilizes the association between the two largest Rep proteins and the ITR.

[0010] In the AAV life cycle, when AAV DNA is uncoated in the cell nucleus, the ITRs of the input single-stranded genome are fitted into a hairpin that provides a natural 3'-OH primer for the synthesis of the second strand. This produces a double-stranded molecule with a covalently closed (hairpin) end. The large Rep protein then binds to the RBE and RBE' in the hairpin, and the activated endonuclease cleaves the strand at a specific site within the recognition sequence called the terminal release site (trs). This produces a new 3'-OH primer that repairs the ITR to form a normal blunt-ended double-stranded molecule. During cleavage, a molecule of Rep78 or Rep68 covalently binds to the 5'-terminal phosphate via a tyrosine-phosphate linkage. It then reconstitutes the ITR as a double hairpin to produce a 3'-OH primer that guides strand displacement synthesis along the genome length with the cellular complex. This displaces the packaged single strand, remodeling the double-stranded molecule covalently closed at one end and initiating a new cycle of incision, repair, and strand displacement synthesis. Each time this cycle is repeated, a new single strand is generated for packaging. Because the two ends are identical, this process works equally well from the two ends, generating a plus and a minus strand for packaging.

[0011] AAVs are widely used in gene therapy because they have no evidence of toxicity, can transduce multiple species and tissues in vivo, and can generate moderate innate and adaptive immune responses.

[0012] AAV vectors consist of the same capsid sequence and structure as found in wild-type AAV (wtAAV). However, AAV vectors lack all AAV protein coding sequences and encapsidate the genome in which a transgene expression cassette is designed. The only sequences of the viral origin are the ITRs, which are necessary to guide genome replication and packaging during vector production. Complete removal of viral coding sequences maximizes the packaging capacity of AAV vectors and favors low immunogenicity and cytotoxicity during their in vivo delivery.

[0013] AAV vectors are optimally suited to accommodating genomes up to 4.7 kb, so the payload must be carefully designed to take into account not only the transgene sequence, but also the regulatory elements required for gene expression (e.g., promoters, enhancers, introns and polyadenylation signals).

[0014] The prevalent method for producing AAV vectors involves triple transfection of HEK293T cells with a packaging plasmid expressing the rep and cap genes, a transgene plasmid to be packaged into the AAV capsid, and a helper plasmid containing other AdV genes that play a helper role (e.g., E2A, E4, and VA RNA genes, which are crucial for replication, information RNA (mRNA) processing, and translation, respectively), and the HEK293T cells contain constitutively expressed AdV E1a and E1b genes. Fortunately, transgene expression cassettes constructed with AAV2 ITRs can be packaged into any serotype capsid by simply exchanging the capsid coding region in the packaging plasmid or helper virus.

[0015] AAV vectors recognize and bind to different cell receptors and enter cells by internalization. Complete AAV vector particles in endosomes undergo a series of pH-dependent structural changes necessary for transduction and transport through the cytosol via the cytoskeleton network. After endosomal escape, AAV vectors enter the cell nucleus via the nuclear pore complex, where they undergo capsid uncoating to release the genome.

[0016] The single-stranded AAV vector genome released in the cell nucleus does not immediately mediate gene expression until it is converted to a double-stranded form - this is a requirement for transcription and is the rate-limiting step for transduction.

[0017] The synthesis of the second strand initiates from the self-priming ITR at the 3'-end of the genome. The double-stranded genome can also be achieved by strand annealing, whereby the plus- and minus-stranded genomes packaged into a single viral particle are annealed by Watson-Crick base pairing upon entry into the cell nucleus. The double-stranded genome is then circularized by intra- or intermolecular genomic recombination at the ITRs. Such circularization and concatemerization processes stabilize the AAV vector genome into free DNA, resulting in sustained gene expression in postmitotic cells (Figure 2).

[0018] CRISPR has brought a new dynamic to gene therapy. CRISPR is a powerful genome editing tool that has shown potential for the treatment of genetic, acquired and infectious diseases. However, delivery of CRISPR cellular components remains a major obstacle to its clinical translation. To date, the most successful CRISPR in vivo gene editing has used AAV as a delivery vector.

[0019] However, conventional AAV delivery faces many practical challenges, including 1) increased off-target effects due to prolonged Cas9 expression, 2) stimulation of Cas9-specific immune responses, and 3) high frequency of viral integration at CRISPR-induced double-strand breaks. Recent studies have demonstrated that pre-existing immunity to Cas9 is widespread among people and may pose additional challenges to edited cells if Cas9 expression is continued.

[0020] Therefore, conventional gene editing tools, such as Cas9-mediated gene editing tools, need to be improved. Summary of the Invention

[0021] One aspect of the invention provides a ribonucleotide (RNA) sequence that can be packaged into a viral particle of a DNA virus, the RNA sequence being: (1) an RNA sequence of interest (RSI), e.g., an RNA coding sequence encoding a gene of interest (GOI), an RNA encoding a protein (e.g., a therapeutic protein, an antigenic protein, or a gene editing protein such as a CRISPR / Cas effector enzyme (abbreviated as "Cas protein"), a ZFN protein, a TALEN protein), e.g., an mRNA, or a non-coding functional RNA (e.g., transfer RNA (tRNA), ribosomal RNA (rRNA), small interfering RNA (siRNA), small hairpin RNA (shRNA), antisense RNA, antisense oligonucleotide, microRNA (miRNA), or a guide RNA (or gRNA), e.g., a single guide RNA (or sgRNA, chimeric RNA, RNA chimera), CRISPR RNA (crRNA), and tracrRNA). and (2) an RNA packaging signal (RPS) capable of directly or indirectly interacting with, e.g., binding to, an RPS-interacting molecule that facilitates packaging of the RNA sequence into viral particles of the DNA virus, and optionally, a DNA sequence encoding or corresponding to the RNA sequence, or a reverse complementary sequence of the DNA sequence, has a reduced, attenuated or substantially absent ability to be packaged into viral particles of the DNA virus (e.g., the DNA sequence or the reverse complementary sequence thereof lacks a DNA packaging signal, e.g., a functional AAV ITR for AAV packaging).

[0022] In some embodiments, the DNA virus particle is an AAV virus particle or an oncolytic virus particle.

[0023] In some embodiments, an RPS is located at or near the 5' end of the RSI, at or near the 3' end of the RSI, or within the RSI (eg, within an intron of an mRNA).

[0024] In some embodiments, the RNA sequence comprises more than one (eg, 1, 2, 3, or more) of the same or different RPSs.

[0025] In some embodiments, two or more (eg, three) of the more than one RPS are adjacent or tandemly linked to one another via the same or different linkers.

[0026] In some embodiments, an RNA sequence comprises two or more RPSs that are not adjacent to each other (eg, each located at or near one end of the RNA sequence of interest (RSI)).

[0027] In some embodiments, an RPS comprises a transcribed modified AAV inverted terminal repeat (ITR), wherein the transcribed modified AAV ITR (a) comprises a transcribed functional Rep binding element (RBE), optionally further comprises a transcribed functional RBE', and (b) lacks a transcribed terminal release site (TRS) or a transcribed reverse complementary TRS (rcTRS), or both, optionally wherein the transcribed modified AAV ITR further comprises a transcribed D region sequence (D sequence or D' sequence), and / or optionally wherein the RPS interacting molecule is Rep78, Rep68, Rep52, and / or Rep40.

[0028] In some embodiments, the transcribed modified AAV ITRs are within 1000 nucleotides, 800 nucleotides, 500 nucleotides, 300 nucleotides, or 200 nucleotides of the 3' end of the RNA, and optionally, the transcribed modified AAV ITRs are 5' of a polyA sequence, a polyA signal sequence (e.g., AAUAAA), or an RNA transcription termination sequence (e.g., a histone downstream element).

[0029] In some embodiments, the transcribed modified AAV ITR is modified based on a transcribed wild-type Flip or Flop ITR, optionally wherein the wild-type Flip or Flop ITR is from AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAVrh74, AAV8, AAV9, AAV10, AAV11, AAV12, or AAV13 (optionally, the wild-type Flop ITR has the nucleotide sequence of SEQ ID NO: 1).

[0030] In some embodiments, the transcribed modified AAV ITRs lack both the transcribed TRS and the transcribed rcTRS.

[0031] In some embodiments, the transcribed modified AAV ITRs comprise a transcribed D region sequence (optionally, the modified AAV ITRs have the nucleotide sequence of SEQ ID NO:3).

[0032] In some embodiments, the transcribed modified AAV ITRs lack the transcribed D region sequence (optionally, the modified AAV ITRs have the nucleotide sequence of SEQ ID NO:2).

[0033] In some embodiments, the RNA sequence further comprises a second transcribed modified AAV ITR having a second transcribed functional RBE sequence but lacking a second transcribed TRS or a second transcribed rcTRS, or both. Optionally, the second transcribed modified AAV ITR further comprises a second transcribed D region sequence.

[0034] In some embodiments, the transcribed modified AAV ITR and the second transcribed modified AAV ITR are the same (or different).

[0035] In some embodiments, the transcribed modified AAV ITR and the second transcribed modified AAV ITR (if present) comprise a deletion in the corresponding transcribed wild-type AAV ITR D region sequence or the corresponding transcribed wild-type TRS / rcTRS, a mutation in the corresponding transcribed wild-type AAV ITR D region sequence or the corresponding transcribed wild-type TRS / rcTRS, or an insertion in the corresponding transcribed wild-type AAV ITR D region sequence or the corresponding transcribed wild-type TRS / rcTRS.

[0036] In some embodiments, the second transcribed modified AAV ITR is within 1000 nucleotides, 800 nucleotides, 500 nucleotides, 250 nucleotides, or 150 nucleotides of the 5' end of the RNA sequence.

[0037] In some embodiments, the RPS comprises an MS2 sequence, a PP7 binding site, or a com binding site, and the RPS-interacting molecule comprises an RPS-interacting protein (RPSIP) that can directly or indirectly interact with, e.g., bind to, the RPS, such as a phage-derived MS2 coat protein (MCP) for the MS2 sequence, a PP7 phage coat protein (PCP) for the PP7 binding site, or a phage COM protein (COM) for the com binding site.

[0038] In some embodiments, the RPSIP is directly or indirectly associated with (e.g., fused to) a protein component of the viral packaging system of the DNA virus viral particle (e.g., Rep78 and / or Rep68 of adeno-associated virus 2 (AAV2), or an assembly activating protein (AAP)).

[0039] In some embodiments, the RNA sequence includes or preferably does not include a transcribed DNA packaging signal, e.g., transcribed wild-type AAV ITR sequences (e.g., the RNA sequence includes transcribed modified AAV ITR sequences having nucleotide additions, deletions, and / or substitutions of the corresponding transcribed wild-type AAV ITR sequences such that the DNA virus has a reduced ability to package DNA into viral particles).

[0040] In some embodiments, the RNA sequence further comprises (1) a transcribed transcriptional enhancer, (2) a transcribed intron or exon sequence (e.g., a transcribed intron or exon sequence for enhancing protein expression), (3) a 5' UTR sequence, (4) a 3' UTR sequence, (5) a polyA sequence or a polyadenylation (polyA) signal sequence, and optionally a GU-rich region downstream of the polyA signal sequence, (6) a post-transcriptional regulatory element or sequence, e.g., a transcribed Woodchuck Hepatitis Virus (WHP) post-transcriptional regulatory element (WPRE) sequence, and / or (7) a transcription termination sequence (e.g., a histone downstream element), and optionally the RNA sequence comprises an RPS located 3' of the post-transcriptional regulatory element or sequence and 5' of the polyA sequence or polyA signal sequence.

[0041] In some embodiments, the RNA sequence includes, in the 5' to 3' direction, an RSI, an optional transcribed WPRE sequence, an RPS (e.g., a transcribed modified AAV ITR, an MS2 sequence, a PP7 binding site, or a com binding site), and a polyA sequence or a polyA signal sequence.

[0042] In some embodiments, the GOI is a protein (e.g., a fluorescent protein, a therapeutic protein, an antigenic protein, or a gene editing protein, such as a Cas protein, a ZFN protein, a TALEN protein), an enzyme (e.g., a Cre protein or a CRISPR / Cas effector enzyme, such as Cas9, Cas12, Cas13, or a mutant thereof), a structural protein, an mRNA, a non-coding RNA (ncRNA), an siRNA, a piRNA, a small hairpin RNA or an shRNA, a microRNA (miRNA) or a precursor thereof, including a precursor miRNA (pre-miRNA) and a primary miRNA (pri-miRNA), a ribosomal RNA (rRNA), an antisense sequence or an oligonucleotide (ASO), a guide RNA (or gRNA), such as a single guide RNA (or sgRNA, chimeric RNA, RNA chimera), a CRISPR RNA (crRNA), and a tracrRNA. The RNA components of the CRISPR-Cas system include RNA and guide RNA or gRNA for CRISPR / Cas effector enzymes, rRNA, tRNA, snoRNA, snRNA, exRNA, scaRNA, lncRNA, Xist, and HOTAIR.

[0043] In some embodiments, the RNA sequence is a single stranded RNA that is less than about 8,900 nucleotides in length, less than about 8,000 nucleotides in length, less than about 7,000 nucleotides in length, less than about 6,000 nucleotides in length, less than about 5,200 nucleotides in length, less than about 4,000 nucleotides in length, less than about 3,000 nucleotides in length, less than about 2,000 nucleotides in length, about 4,700-5,200 nucleotides in length, about 4,700-5,000 nucleotides in length, about 4,700-4,800 nucleotides in length, or about 4,700 nucleotides in length.

[0044] Another aspect of the invention provides a polynucleotide, said polynucleotide comprising a cassette encoding an RNA sequence of the invention, optionally wherein said polynucleotide is a DNA sequence (e.g., a DNA plasmid), said DNA sequence optionally comprising a stuffer sequence in the backbone of said DNA plasmid, and / or optionally not comprising a functional DNA packaging signal, e.g., AAV ITRs.

[0045] In some embodiments, the polynucleotide further comprises a promoter operably linked to and driving transcription of the RNA sequence encoded by the cassette.

[0046] In some embodiments, the promoter is a ubiquitous promoter.

[0047] In some embodiments, the promoter is a tissue-specific promoter.

[0048] In some embodiments, the promoter is a constitutive promoter.

[0049] In some embodiments, the promoter is an inducible promoter.

[0050] In some embodiments, the polynucleotide further comprises an enhancer that enhances transcription of the RNA sequence driven by the promoter.

[0051] Another aspect of the invention provides a recombinant DNA viral particle, which comprises an RNA genome (e.g., an RNA sequence of the invention or an RNA sequence transcribed from a polynucleotide of the invention) packaged in a protein shell (e.g., a capsid) of a DNA virus (e.g., an AAV virus, or an oncolytic virus).

[0052] In some embodiments, the DNA virus is AAV and the recombinant DNA virus particle is a recombinant RNA adeno-associated virus (rRAAV) particle, which comprises (1) an AAV capsid and (2) an RNA sequence of the invention or an RNA sequence transcribed from a polynucleotide of the invention that is packaged within the AAV capsid.

[0053] In some embodiments, the AAV capsid comprises a capsid from an AAV of serotype AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-DJ, AAV PHP.eB, Anc80L65, Anc80L65AAP, AAVrh74, or 7m8.

[0054] Another aspect of the present invention provides a population of recombinant DNA viral particles (e.g., rRAAV particles) comprising a plurality of recombinant DNA viral particles (e.g., rRAAV particles) of the present invention, wherein at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or more of the recombinant DNA viral particles (e.g., rRAAV particles) in the population have an RNA sequence of the present invention or an RNA sequence transcribed from a polynucleotide of the present invention packaged therein.

[0055] Another aspect of the present invention provides a host cell, said host cell comprising an RNA sequence of the present invention, a polynucleotide of the present invention, an RNA sequence transcribed from a polynucleotide of the present invention, a viral particle of a recombinant DNA virus of the present invention (e.g., an rRAAV particle), and / or a population of viral particles of a recombinant DNA virus of the present invention (e.g., an rRAAV particle).

[0056] In some embodiments, the host cell further comprises a viral packaging system that facilitates packaging of the RNA sequences of the invention or RNA sequences transcribed from the polynucleotides of the invention into viral particles of the DNA virus.

[0057] In some embodiments, a viral packaging system comprises: (1) an AAV rep gene (e.g., a coding sequence for Rep78, Rep68, Rep52, and / or Rep40) and an AAV cap gene (e.g., a coding sequence for VP1, VP2, VP3, AAP, and / or MAAP), or expression products thereof, under the transcriptional control of one or more promoters driving transcription of said rep and cap genes; (2) one or more coding sequences for one or more proteins required for AAV packaging, e.g., the adenovirus E2A, E4, and VA genes, or said one or more proteins; and (3) an RPS interacting molecule or a coding sequence thereof, optionally, the ability of the viral packaging system to package a DNA sequence into viral particles of said DNA virus is reduced, attenuated, or substantially eliminated, for example, by: (1) removing a polynucleotide encoding an RNA sequence of the invention or a DNA packaging signal, e.g., a portion or all of an AAV ITR, in a polynucleotide encoding an RNA sequence of the invention; (2) removing a coding sequence for the AAV rep gene, the AAV modifying, e.g., mutating, the cap gene and / or the coding sequence of one or more proteins required for AAV packaging to reduce, attenuate, or substantially eliminate the ability of the corresponding translated protein to promote packaging of the DNA sequence into viral particles of the DNA virus (e.g., a Y156F mutation in the consensus sequence of Rep78 and Rep68 proteins, KDE-mu, or EKE-mu), and / or (3) expanding the size of a polynucleotide encoding an RNA sequence of the invention or a polynucleotide of the invention.

[0058] In some embodiments, the host cell is a mammalian cell (eg, a HEK293 cell) or an insect cell (eg, an Sf9 or Sf21 cell).

[0059] Another aspect of the invention provides a method of producing a recombinant DNA virus particle (e.g., rRAAV particle) of the invention or a population of recombinant DNA virus particles (e.g., rRAAV particle) of the invention, the method comprising: a) culturing a host cell of the invention for a sufficient time; and b) harvesting the recombinant DNA virus particle or the population of recombinant DNA virus particles.

[0060] In some embodiments, the methods further comprise isolating or purifying the recombinant DNA virus particle or the population of recombinant DNA virus particles.

[0061] Another aspect of the invention provides a method of generating recombinant DNA viral particles (e.g., rRAAV particles) or a population of recombinant DNA viral particles, the method comprising: a) contacting a viral packaging system (e.g., an AAV packaging system) with an RNA sequence of the invention or an RNA sequence transcribed from a polynucleotide of the invention for a time sufficient to produce said recombinant DNA viral particles or said population of recombinant DNA viral particles; b) harvesting said recombinant DNA viral particles or said population of recombinant DNA viral particles; and optionally c) isolating or purifying the harvested recombinant DNA viral particles or population of recombinant DNA viral particles.

[0062] In some embodiments, a viral packaging system (e.g., an AAV packaging system) comprises (1) one or more proteins, or one or more coding sequences thereof, for assembling a protein shell of a viral particle of the DNA virus into which the RNA sequence is packaged (e.g., VP1, VP2, and / or VP3 for assembling an AAV capsid), and (2) one or more proteins (e.g., VP2, VP3, and / or VP4 for assembling an AAV capsid) for facilitating assembly of the protein shell and / or packaging of the RNA sequence into the protein shell of a viral particle of the DNA virus (e.g., VP1, VP2, and / or VP4 for assembling an AAV capsid). and (3) an RPS interacting molecule or a coding sequence thereof for AV packaging (e.g., adenovirus E2a, E4, and VA genes), and optionally, the ability of the viral packaging system to package a DNA sequence into viral particles of said DNA virus is reduced, attenuated, or substantially eliminated, for example, by: (1) a polynucleotide encoding an RNA sequence of the invention or a DNA packaging signal in a polynucleotide of the invention, e.g., an AAV (2) modifying, e.g., mutating, the coding sequence for one or more of the AAV rep genes, the AAV cap genes, and / or one or more proteins required for AAV packaging to reduce, attenuate, or substantially eliminate the ability of the corresponding translated protein to promote packaging of the DNA sequence into viral particles of the DNA virus (e.g., a Y156F mutation in the consensus sequence for Rep78 and Rep68 proteins, KDE-mu, or EKE-mu), and / or (3) expanding the size of a polynucleotide encoding an RNA sequence of the invention or a polynucleotide of the invention.

[0063] Another aspect of the present invention provides a system for packaging an RNA sequence of the present invention or an RNA sequence transcribed from a polynucleotide of the present invention into a viral particle of a DNA virus, the system comprising: (1) one or more proteins, or coding sequences for one or more proteins for assembling a protein shell of a viral particle of the DNA virus for packaging the RNA sequence (e.g., VP1, VP2, and / or VP3 for assembling an AAV capsid), or one or more coding sequences thereof; and (2) one or more proteins for facilitating assembly of the protein shell and / or packaging of the RNA sequence into the protein shell of a viral particle of the DNA virus. and (3) an RPS interacting molecule or a coding sequence thereof, and optionally, the ability of the viral packaging system to package a DNA sequence into viral particles of said DNA virus is reduced, attenuated, or substantially eliminated, for example, by: (1) a polynucleotide encoding an RNA sequence of the invention or a DNA packaging signal in a polynucleotide of the invention, e.g., an AAV packaging protein, a polypeptide of the invention ... (2) modifying, e.g., mutating, the coding sequence for one or more of the AAV rep genes, the AAV cap genes, and / or one or more proteins required for AAV packaging to reduce, attenuate, or substantially eliminate the ability of the corresponding translated protein to promote packaging of the DNA sequence into viral particles of the DNA virus (e.g., a Y156F mutation in the consensus sequence for Rep78 and Rep68 proteins, KDE-mu, or EKE-mu), and / or (3) expanding the size of a polynucleotide encoding an RNA sequence of the invention or a polynucleotide of the invention.

[0064] Another aspect of the invention provides a method of delivering a gene of interest (GOI) to a cell, plant, or animal, the method comprising contacting the cell, plant, or animal with a recombinant DNA virus particle (e.g., rRAAV particle) of the invention, a population of recombinant DNA virus particles (e.g., rRAAV particles) of the invention, or a recombinant DNA virus particle (e.g., rRAAV particle) or a population of recombinant DNA virus particles (e.g., rRAAV particles) produced by a method of the invention, wherein the GOI is encoded by an RNA sequence of the invention.

[0065] Another aspect of the invention provides a method of delivering an RNA sequence of interest (RSI) to a cell, plant, or animal, the method comprising contacting the cell, plant, or animal with a recombinant DNA virus particle of the invention (e.g., rRAAV particle), a population of recombinant DNA virus particles (e.g., rRAAV particle) of the invention, or a population of recombinant DNA virus particles (e.g., rRAAV particle) or recombinant DNA virus particles (e.g., rRAAV particle) produced by a method of the invention.

[0066] Another aspect of the present invention provides a method of diagnosing, preventing, or treating a disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount or dosage of a population of viral particles (e.g., rRAAV particles) of a recombinant DNA virus of the present invention or produced by a method of the present invention.

[0067] Another aspect of the present invention provides the use of a recombinant DNA viral particle (e.g., rRAAV particle) of the invention, a population of recombinant DNA viral particles (e.g., rRAAV particles) of the invention, or a recombinant DNA viral particle (e.g., rRAAV particle) or a population of recombinant DNA viral particles (e.g., rRAAV particles) produced by a method of the invention, in the manufacture of a medicament for diagnosing, preventing, or treating a disease or disorder in a subject in need thereof.

[0068] It should be understood that any one embodiment of the invention described herein, including those embodiments described only in the examples or claims, or only in one aspect / portion below, may be combined with any other one or more embodiments of the invention, unless expressly denied or deemed unjustified. [Brief description of the drawings]

[0069] [Figure 1A] Figure 1A shows the structure and sequence of the wild-type ITR of AAV2, including the A:A' stem region sequence, the B:B' and C:C' T region sequences, and the unpaired D region sequence in the flip and flop structure of the 3'ITR. The RBE, RBE', and TRS are also shown. [Figure 1B] 1B and 1C show multiple sequence alignments of the 5' (FIG. 1B) and 3' (FIG. 1C) ITR sequences of AAV1-7. [Figure 1C] 1B and 1C show multiple sequence alignments of the 5' (FIG. 1B) and 3' (FIG. 1C) ITR sequences of AAV1-7. [Diagram 2] FIG. 2 shows the life cycle of AAV vectors / viral particles and the tested RAAV vectors / viral particles. [Diagram 3] FIG. 3 is a schematic diagram of the transgene plasmids of the RAAV-ITR vector and the control vector, showing the relative positions and orientations of the promoter (e.g., the CAG promoter or "C"), the GOI coding sequence (e.g., the coding sequence of the reporter gene tdTomato or "T"), the WPRE sequence (or "W"), the SV40 polyA signal sequence (or "S") and the wild-type ITR, the mutated / optimized ITR (dITR or dITR-D). [Figure 4]Figure 4 is a schematic diagram showing the generation of AAV and RAAV-ITR vectors by the tri-plasmid system. Recombinant AAV or RAAV viral vectors can be generated by co-transfecting three plasmids (e.g., transgene plasmid, packaging plasmid, and helper plasmid) into appropriate packaging cells such as HEK293 cells. The green ITRs represent wild-type ITRs, and the yellow ITRs represent optimized ITRs. pCAG-transgene, pCAG-transgene-ITR, and pCAG-ITR-transgene-ITR are transgene plasmids, pAAV-rep / cap is a packaging plasmid, and pHelper is a helper plasmid. [Figure 5A] 5A and 5B show a representative viral vector titration method: Figure 5A is a flow chart of RAAV titration. [Figure 5B] Figures 5A and 5B show a representative method for titrating viral vectors. Figure 5B shows primers and probes for Q-PCR. [Figure 6] Figures 6A-6C show titration of RAAV-ITR vector. Figure 6A shows titration of CITWS group. Figure 6B shows titration of CTWIS group. Figure 6C shows titration of CITWIS group. [Figure 7] Figures 7A and 7B show titration and infection of RAAV-dITR-D vector. Figure 7A shows titration of RAAV-dITR-D vector. Figure 7B shows in vitro infection of RAAV-dITR-D vector. The same volume (5 μL) of purified RAAV-dITR-D vector was used to in vitro infect 2×105 HEK293T cells. Fluorescence photographs were taken 3 and 5 days after infection. [Figure 8A] FIG. 8A is a schematic diagram (not to scale) showing different plasmid constructs to demonstrate highly efficient packaging of RNA into RAAV particles. [Figure 8B]Figure 8B shows the results of specific DNA and RNA packaging of AAV-tdTomato and RAAV-tdTomato constructs by detection of the WPRE sequence in the packaged DNA or RNA. Efficient RNA packaging occurs when both the heterologous RNA packaging signal (RPS) and its cognate RPS-binding protein (RBP, e.g., MCP of MS2) are present. [Figure 9A] Figures 9A-9C show reduced DNA packaging when using extended plasmid backbones. Figure 9A is a schematic (not to scale) of various plasmids used to generate the results in Figures 9B and 9C, including a plasmid with a long backbone sequence due to an inserted stuffer region (L-CTWM3S). [Figure 9B] Figures 9A-9C show reduced DNA packaging using expanded plasmid backbones, and Figure 9B shows specific DNA packaging of AAV-tdTomato and RAAV-tdTomato by detection of the presence of the CAG promoter sequence using a CAG-specific primer pair. [Figure 9C] Figures 9A-9C show reduced DNA packaging when using an expanded plasmid backbone. Figure 9C shows specific DNA and RNA packaging of AAV-tdTomato and RAAV-tdTomato by detecting the presence of the WPRE sequence using a WPRE-specific primer pair. The results show that the use of an expanded / extended plasmid backbone sequence with a stuffer sequence can unexpectedly reduce unwanted DNA packaging by approximately two-fold. [Figure 10A] Figures 10A and 10B show highly efficient packaging of the Cre transgene into RAAV using the MS2 / MCP packaging system. Figure 10A shows specific DNA packaging of AAV-Cre and RAAV-Cre by detecting the presence of the CAG promoter sequence using a CAG-specific primer pair. Note that there is no CAG sequence in the RAAV RNA sequence and the detected RNA signal is a background signal. [Figure 10B] Figures 10A and 10B show highly efficient packaging of the Cre transgene into RAAV using the MS2 / MCP packaging system, and Figure 10B shows specific DNA and RNA packaging of AAV-Cre and RAAV-Cre by detection of the presence of the WPRE sequence using a WPRE-specific primer pair. [Figure 11A] 11A-11B are diagrams showing that RPS / RBP improved RNA packaging of conventional AAV. Fig. 11A shows the results of AAV genome packaging in the presence of only the DNA packaging signal (i.e., ITR). [Figure 11B] Figures 11A-11B show that RPS / RBP improved RNA packaging of conventional AAV. Figure 11B shows packaging of the AAV genome in the presence of both the DNA packaging signal (ITR) and the RNA packaging signal (MS2X3). [Figure 12A] 12A-12D show the results of optimizing the RAAV system and identifying the performance of the optimized RAAV. Figure 12A shows the specific genome packaging of AAV-Cre and RAAV-Cre by detection of the WPRE sequence. [Figure 12B] Figures 12A-12D show the results of optimizing the RAAV system and identifying the performance of the optimized RAAV. Figure 12B shows the specific genome packaging of AAV-Cre and RAAV-Cre by detection of the Cre sequence. [Figure 12C] Figures 12A-12D show the results of optimizing the RAAV system and identifying the performance of the optimized RAAV. Figure 12C shows a silver stain analysis of the composition of AAV and RAAV particles. [Figure 12D] 12A-12D show the results of optimizing the RAAV system and identifying the performance of the optimized RAAV. Figure 12D shows the morphological analysis of AAV and RAAV particles by TEM, scale bar is 100 nm. [Figure 13A]Figures 13A and 13B show the results of reducing AAV and RAAV DNA packaging: Figure 13A shows that engineered Rep reduces conventional AAV DNA packaging. [Figure 13B] Figures 13A and 13B show the results of reducing DNA packaging in AAV and RAAV. Figure 13B shows that various mutant MCP fusion proteins, including the double mutant MCP fusion protein DJ-MCPX2, reduce DNA packaging in RAAV. [Figure 14A] Figures 14A-14D show that RAAV viral particles express proteins encoded by functional transgenes. Samples are designated in the same manner in Figures 14A-14C. Figure 14A shows the time course of Cre mRNA levels in infected cells. [Figure 14B] Figures 14A-14D show that RAAV viral particles express proteins encoded by functional transgenes. Samples are designated in the same manner in Figures 14A-14C. Figure 14B shows the fold change in Cre mRNA levels in infected cells 20 hours post-infection. [Figure 14C] Figures 14A-14D show that RAAV viral particles express proteins encoded by functional transgenes. Samples are designated in the same manner in Figures 14A-14C. Figure 14C shows the time course of Cre DNA in infected cells. [Figure 14D] Figures 14A-14D show that RAAV viral particles express proteins encoded by functional transgenes. Samples are designated in the same manner as in Figures 14A-14C. Figure 14D shows the percent of infected cells quantified by flow cytometry 5 days post-infection, n=2 replicates. [Figure 15A] 15A to 15D show the results of DNA and mRNA analysis of Ai9-MEF cells infected with AAV or RAAV. Fig. 15A shows the Ct value of Cre mRNA. [Figure 15B] 15A to 15D show the results of DNA and mRNA analysis of Ai9-MEF cells infected with AAV or RAAV, and Fig. 15B shows the Ct value of Cre DNA. [Figure 15C] 15A to 15D show the results of DNA and mRNA analysis of Ai9-MEF cells infected with AAV or RAAV, and Fig. 15C shows the Ct value of GAPDH mRNA. [Figure 15D] 15A to 15D show the results of DNA and mRNA analysis of Ai9-MEF cells infected with AAV or RAAV, and Fig. 15D shows the Ct value of 36B4 DNA. [Figure 16] FIG. 16 shows genotyping of Ai9-MEF cells. [Figure 17A] Figures 17A-17B show the instantaneous translocation of RAAV particles. Figure 17A shows a Western blot analysis of Cre protein lifetime in infected cells after conventional AAV delivery. [Figure 17B] Figures 17A-17B show the instantaneous translocation of RAAV particles, and Figure 17B shows a Western blot analysis of Cre protein lifetime in infected cells following RAAV delivery. [Figure 18] FIG. 18 shows additional functional RPS / RBP pairs - PP7 / PCP pairs and com / COM pairs tested in the RAAV system. [Figure 19] FIG. 19 shows various AAV serotypes that the RAAV system has been applied to, including AAV-DJ, AAV5, AAV8, and AAV9. [Figure 20A] Figures 20A and 20B show that additional AAP and MCP fusion proteins increased RAAV yields. Figure 20A shows specific genome packaging of RAAV-Cre by detection of Cre sequences. [Figure 20B]Figures 20A and 20B show that additional AAP and MCP fusion proteins increased RAAV yields, and Figure 20B shows a comparison of RNA packaging efficiency between RAAV and AAP N- or C-terminal fusions (AM or MA fusion constructs). [Figure 21A] 21A to 21C are diagrams showing the results of instantaneous transfer of RAAV-Cre to the hippocampus of Ai9-mice. Fig. 21A shows the transfer of high-dose AAV-Cre to the hippocampus of Ai9-mice. [Figure 21B] Figures 21A to 21C are diagrams showing the results of instantaneous transfer of RAAV-Cre to the hippocampus of Ai9-mice. Figure 21B shows the transfer of low-dose AAV-Cre to the hippocampus of Ai9-mice. [Figure 21C] 21A to 21C are diagrams showing the results of instantaneous transfer of RAAV-Cre to the hippocampus of Ai9-mice. Fig. 21C shows the transfer of high-dose RAAV-Cre to the hippocampus of Ai9-mice. [Figure 21D] Fig. 21D shows the results in control mice. Red signal: tdTomato, green signal: Cre, blue signal: DAPI (nuclear staining). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0070] 1. Overview The invention described herein provides recombinant viral particles that include a DNA virus protein shell, and a "vector genome" that includes RNA, such as single-stranded RNA (rather than DNA). The "vector genome" may not be typical viral RNA, since it contains very little (if any) sequence of viral origin, except for the RNA packaging signal (RPS) described below. That is, while DNA viruses normally or naturally encapsidate the DNA virus vector genome within a protein shell, the recombinant versions of the viral particles of DNA viruses described herein encapsidate instead of RNA. "RNA" or "ribosomal nucleic acid" refers to a segment of ribonucleotides consisting of a phosphate, a ribosomal base, and a base (A (adenine), U (uracil), G (guanine), or C (cytosine)), respectively, in which any one of the ribonucleotides may be modified (e.g., base-modified, glycosyl-modified, phosphate-modified, e.g., oxygen-modified, fluorine-modified, sulfur-modified, pseudo-modified (e.g., pseudouridine-modified), methylated, blocked (e.g., 5-blocked)) or unmodified, and optionally directly or indirectly, to a phosphate, deoxyribosomal base, respectively. It can be fused to a segment of deoxynucleotides consisting of oxyribose and bases (A (adenine), T (thymine), G (guanine), or C (cytosine)), any one of which may be modified (e.g., base-modified, glycosyl-modified, phosphate-modified, e.g., oxygen-modified, fluorine-modified, sulfur-modified, pseudo-modified, methylated, blocked (e.g., 5-blocked)) or unmodified, e.g., RNA-DNA chimera, DNA-RNA-DNA chimera, RNA-DNA-RNA chimera.

[0071] A typical (non-limiting) example of such a recombinant DNA virus viral particle includes the adeno-associated virus (AAV), which normally / naturally encapsidates a single-stranded DNA (ssDNA) vector genome. Further non-limiting examples of such DNA viruses include oncolytic DNA viruses such as oncolytic herpes viruses (e.g., herpes simplex virus or HSV), oncolytic adenoviruses, cowpox virus (VACV), vesicular stomatitis virus (VSV), etc.

[0072] The present invention is based, in part, on the surprising discovery that the RNA form of transcribed AAV ITRs can promote highly efficient direct packaging of transcribed RNA including such transcribed AAV ITRs into conventional AAV viral particles.

[0073] The invention described herein is further based in part on the surprising discovery that in addition to the transcribed AAV ITRs (RNA), some artificial or heterologous RNA sequences and their cognate / corresponding / naturally occurring RNA binding proteins, as RNA packaging signal (RPS) and RPS interacting protein (RPSIP) pairs, can also package the RNA into a DNA virus protein shell that normally / naturally encapsidates the DNA vector genome by substituting the function of the wild-type packaging signal sequence and interacting protein useful for DNA virus packaging, as described herein.

[0074] For example, in wild-type AAV, the ITR sequences at the 5' and 3' ends of the DNA vector genome contain sequence elements, such as Rep-binding elements (RBE) and RBE', that can interact with Rep proteins (e.g., Rep68 and Rep78). Rep proteins bind to the ITRs and promote packaging of AAV ssDNA vector genomes containing such ITR sequence elements into AAV viral particles.

[0075] The inventors have discovered that by providing a transcribed ITR sequence and / or an artificial or heterologous RNA sequence, e.g., an MS2 sequence, as an RPS to an RNA sequence of interest (RSI), the resulting RNA sequence consisting of the RPS and RSI can be effectively packaged into an AAV virus protein shell in the presence of MCP-MS2 coat protein (MCP) from a bacterial phage, which naturally binds to MS2. The ability of an artificial RPS / RPSIP pair - e.g., MS2 / MCP - to promote packaging of RNA into a DNA virus protein shell does not depend on the presence of the natural ITR packaging signal for DNA packaging, but can function independently therefrom. In a sense, the heterologous MS2-MCP pair constitutes an artificial system of RPS and RPSIP pairs, which can effectively replace the natural ITR-Rep DNA packaging system, the former of which effectively promoted RNA packaging. Such RNA-containing DNA viruses, such as AAV, may be referred to herein as R-DNA virus particles (or RAAV in the case of AAV), or recombinant R-DNA virus particles (or rRAAV in the case of AAV).

[0076] The R-DNA and RAAV viral particles of the present invention can be used to deliver any transgene or gene of interest (GOI) RNA transcript or any guide RNA of suitable length (e.g., within the packaging limits of various DNA viruses or AAV) to a host cell that matches the tropism of the DNA viral protein shell or AAV viral capsid. As used herein, recombinant DNA viral particles such as recombinant AAV vectors, vector genomes, and recombinant AAV viral particles or recombinant AAV particles are referred to herein as rRAAV vectors (recombinant RNA adeno-associated viral vectors), vector genomes, and recombinant RAAV (rRAAV) viral particles or rRAAV particles, respectively ("rRAAV vectors" and "rRAAV particles" are used interchangeably herein).

[0077] Specifically, on the one hand, like any normal or conventional AAV vector, the subject RAAV vector may also be composed of any one of the same capsids found in any wild-type AAV carrying DNA as the viral genetic material, and therefore the subject RAAV vector has all the general advantages from the AAV coat, such as specificity / broad tropism and low immunogenicity.

[0078] On the other hand, however, the genome of the tested RAAV vector is composed of short-lived RNA (e.g., mRNA), thereby causing the transient expression of any encoded gene product in such RNA genetic material.

[0079] Such instantaneous expression is necessary in at least some cases. For example, the RAAV vector of the present invention is advantageous for in vivo DNA gene editing, since time-limited exposure to the DNA gene editor encoded by RAAV (e.g., mRNA coding sequence of CRISPR / Cas system effector enzyme Cas9 and its variants fused to base editor) can achieve effective gene editing. Compared to the sustained expression of the same DNA gene editor expressed in conventional DNA-based AAV vectors, such instantaneous expression of DNA editors can further improve the safety profile of gene therapy by reducing off-target gene targeting and reducing immunogenicity.

[0080] In addition, compared to conventional DNA-based AAV vectors, the tested AAV vectors are capable of carrying longer transgenes because they at least eliminate the promoter (and any non-transcribed enhancer sequences that may be required) required for expression of the GOI encoded by the DNA-based AAV vector.

[0081] Compared with conventional DNA-based AAV vectors, the test rRAAV vectors have different sequence elements and organization, but rRAAV virus particles have the same entry and intracellular transport process as conventional DNA-based AAV vectors. However, when they enter the nucleus of the host cell, they have a very different fate. After entering the nucleus, they release the mRNA genome of the test RAAV vector, which is then transported to the cytoplasm and undergoes translation. It is well known that the life span of mRNA is very short, usually from a few minutes to a few days, and is eventually degraded by many cellular mechanisms. However, the limited life span of mRNA still allows the host cell to complete protein synthesis without the delay of second strand cDNA synthesis in DNA-based AAV vectors, allowing the encoded protein to function quickly.

[0082] Many such RPS / RPSIP pairs may be used to package RNA into DNA viruses. The inventors have demonstrated that at least two additional such pairs, including a PP7 sequence and a PP7 bacterial phage coat protein (PCP) and a com sequence and a phage COM protein (COM), can efficiently package RNA containing a heterologous RPS (i.e., PP7 and com sequences, respectively). The three RPS / RPSIP pairs displayed encompass at least two classes. Unlike the natural viral packaging systems MS2 / MCP and PP7 / PCP, com / COM is not a natural viral packaging system but is a transcriptional regulator known to function in the transcription initiation of the bacterial phage Mu mom gene. Many transcribed modified AAV ITR sequences may also be used as RPSs in the present invention.

[0083] The invention described herein is not limited to a particular serotype of DNA virus (e.g., a particular AAV serotype). The inventors have demonstrated highly efficient packaging of RNA sequences with appropriate RPSs into representative AAV viruses (including AAV5, AAV8, AAV9 and AAV-DJ) in combination with the use of compatible RPSIPs in each case.

[0084] The invention described herein is further based on the discovery that the efficiency of packaging of unwanted DNA into viral particles of naturally occurring DNA viruses can be reduced by several independent methods.

[0085] In some embodiments, undesirable DNA packaging efficiency can be reduced by increasing the overall size of the DNA vector transcribing the RNA of interest. For example, in the triple transfection method commonly used for AAV production, the gene of interest (GOI) can be carried by a first plasmid, the necessary Rep and Cap proteins are encoded by the rep and cap genes in a second plasmid, while other components required for AAV packaging are provided by a third plasmid. According to this embodiment of the invention, the RNA sequence to be packaged into the DNA virus may be transcribed from a first plasmid, and the overall size of said first plasmid may be artificially increased by: random stuffer sequences (e.g., introns), such as stuffer sequences that are at least about 1 kb, 2 kb, 3 kb, 4 kb, 5 kb or more in length, or stuffer sequences that increase the overall size of the first plasmid by 1 kb, 2 kb, 3 kb, 4 kb, 5 kb or more, for example, a stuffer sequence that increases the overall size of the first plasmid by about 6 kb, 7 kb, 8 kb, 9 kb, 10 kb or more.

[0086] In some other embodiments, the efficiency of undesired DNA packaging can be reduced by inhibiting the function of classical elements that promote DNA packaging. Such classical elements used in DNA packaging may include protein elements involved in DNA packaging, such as DNA sequences (e.g., elements of the AAV ITR sequences that promote DNA packaging, including the trs sequences, the RBE or RBE' sequences, or the entire ITR sequences of AAV) and / or proteins that interact with the DNA sequences (e.g., mutant Rep68 or Rep78 proteins lacking or attenuated trs-endonuclease activity).

[0087] Thus, one aspect of the present invention provides a ribonucleotide (RNA) sequence that can be packaged into a viral particle of a DNA virus (e.g., a DNA virus that naturally packages DNA), wherein the RNA sequence comprises (1) an RNA sequence of interest (RSI) and (2) an RNA packaging signal (RPS), which can directly or indirectly interact with, e.g., bind to, an RPS-interacting molecule (e.g., an RPS-interacting protein or RPSIP), and which promotes packaging of the RNA sequence into a viral particle of the DNA virus.

[0088] Such RNA sequences may include any RSI (RNA) and may be encoded by a "gene of interest" or "GOI" (DNA).

[0089] As used herein, a "gene of interest" or "GOI" includes any coding sequence for a protein or polypeptide, including intron and exon sequences, and / or coding sequences for any non-translated or non-coding RNA (such as ncRNAs, piRNAs, small hairpin RNAs or shRNAs, microRNAs or miRNAs or precursors thereof, including precursor miRNAs and primary miRNAs, antisense sequences or oligonucleotides (ASOs), guide RNAs or gRNAs for CRISPR / Cas, rRNA, tRNA, snoRNA, snRNA, exRNA, scaRNA, lncRNA, Xist, and HOTAIR).

[0090] Similarly, representative (non-limiting) RSIs include, for example, RNAs encoding proteins (e.g., therapeutic proteins, antigenic proteins, or gene editing proteins such as CRISPR / Cas effector enzymes (abbreviated as "Cas proteins"), ZFN proteins, TALEN proteins), or non-coding functional RNAs (e.g., transfer RNA (tRNA), ribosomal RNA (rRNA), transfer-messenger RNA (tmRNA), small interfering RNA (siRNA), small hairpin RNA (shRNA), antisense RNA or oligonucleotides (ASO), microRNA (miRNA), RNA aptamers, or RNA components of CRISPR-Cas (e.g., Cas9, Cas12, Cas13) systems, such as single guide RNAs (or sgRNAs, chimeric RNAs, RNA chimeras), CRISPR RNAs (crRNAs), and tracrRNAs). RNA), or precursors thereof, or RNA components of the RISC complex or RNAi pathway (e.g., shRNA, miRNA, or siRNA), regulatory RNA, Piwi-interacting RNA (piRNA), small nucleolar RNA (snoRNA), long non-coding RNA (lncRNA) (intergenic lincRNA, intronic ncRNA, and sense / antisense lncRNA), long intervening / intergenic non-coding RNA (lincRNA), enhancer RNA, bacterial small RNA (sRNA), snRNA, exRNA, scaRNA, Xist, and HOTAIR, and precursors thereof.

[0091] The RNA sequence or GOI of the invention may comprise one coding sequence or more than one (e.g. 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) coding sequences. The length of the coding sequence, or the combined length of all coding sequences, may not exceed the maximum length of RNA that can be packaged into a viral particle of a particular or selected DNA virus (e.g. AAV viral particle) and may differ between viral particles of one particular DNA virus (e.g. AAV) and another DNA virus.

[0092] In some embodiments, the DNA sequence encoding or corresponding to the RNA sequence of the present invention, or the reverse complementary sequence of said DNA sequence, has a reduced, attenuated or substantially no ability to be packaged into viral particles of DNA viruses. For example, a DNA sequence can encode the RNA sequence of the present invention (e.g., said DNA sequence has a reverse complementary sequence of the RNA sequence of the present invention). The DNA sequence may also correspond to the RNA sequence of the present invention, since it has the same nucleotide sequence as the RNA sequence of the present invention in other aspects, except that it has T instead of U in the RNA sequence of the present invention. In any case, the DNA sequence or its reverse complementary sequence may lack a functional DNA packaging signal for packaging into viral particles of DNA viruses, such as AAV ITR for AAV packaging, thereby reducing, attenuating or substantially no ability of said DNA sequence or its reverse complementary sequence (DNA) to be packaged into viral particles of DNA viruses.

[0093] In some embodiments, the RNA sequences of the present invention are transcribed from a DNA construct, for example, a DNA plasmid encoding the RNA sequence, where the DNA construct / plasmid includes a stuffer sequence (e.g., an intron sequence) in its backbone sequence to enhance packaging of the RNA sequence of the present invention and / or reduce packaging of undesired DNA into the viral particles of the DNA virus. For example, the RNA sequences of the present invention may be transcribed from a DNA construct / plasmid, and the overall size of the DNA construct / plasmid can be artificially increased by: random DNA stuffer sequences, such as stuffer sequences at least about 1 kb, 2 kb, 3 kb, 4 kb, 5 kb or more in length, or stuffer sequences that increase the overall size of the DNA construct / plasmid by 1 kb, 2 kb, 3 kb, 4 kb, 5 kb or more, for example, about 6 kb, 7 kb, 8 kb, 9 kb, 10 kb or more. A stuffer sequence may be located upstream (e.g., immediately upstream) of a transcription unit comprising an RNA sequence coding sequence of the present invention (see FIG. 9A, where a >3 kb long stuffer sequence is inserted immediately upstream of a CAG promoter driving transcription of an exemplary RNA sequence of the present invention). In some embodiments, a stuffer sequence is inserted directly upstream of a promoter, which is operably linked to the codon sequence of the RNA sequence of the present invention. Optionally, in some embodiments, the coding sequence of the RNA sequence of the present invention lacks a functional native DNA packaging signal of a DNA virus viral particle, e.g., lacks a functional ITR sequence that is packaged into an AAV viral particle.

[0094] In some embodiments, the RNA sequence of the present invention can be packaged in a DNA virus virion, and the DNA virus virion is an AAV virion.Any AAV virus can be used to package the RNA sequence of the present invention, including but not limited to AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV 11, AAV 12, AAV 13, AAVrh10, AAVrh74, AAVhu32, AAVhu37, AAV-DJ, AAV PHP.eB, Anc80L65, Anc80L65AAP, AAVrh74, or 7m8.

[0095] In some embodiments, the RNA sequences of the present invention can be packaged into a DNA virus particle, said DNA virus particle being an oncolytic virus particle. Exemplary (non-limiting) oncolytic virus particles include oncolytic herpes viruses (e.g., herpes simplex virus or HSV), oncolytic adenoviruses, variola virus (VACV), vesicular stomatitis virus (VSV), and the like.

[0096] In the RNA sequence of the present invention, the position of the RPS may be flexible. In some embodiments, the RPS is located at or near the 5' end of the RNA sequence of the present invention, at or near the 3' end of the RNA sequence of the present invention, or internally in the RNA sequence of the present invention. In some embodiments, the RPS is located at or near the 5' end of the RNA sequence of interest (RSI), at or near the 3' end of the RNA sequence of interest (RSI), or internally in the RNA sequence of interest (within an intron of mRNA).

[0097] There may be one or more RPSs in the RNA sequences of the invention. In some embodiments, the RNA sequences of the invention contain more than one (e.g., 1, 2, 3, or more) identical or substantially identical RPSs. In some embodiments, the RNA sequences of the invention contain more than one (e.g., 1, 2, 3, or more) RPSs, at least two of which are different from each other.

[0098] When there is more than one RPS on an RNA sequence of the invention, at least two of the more than one RPS are adjacent to each other, e.g., linked in tandem, with an optional linker sequence between them. The linkers between any two adjacent RPS sequences may be the same or different. The linker sequence may be a randomized RNA sequence that has no substantial secondary structure, no known functional sequences or elements, and / or may have a GC content of less than 50%. The length of the linker may be any length between 1-1 kb, 1-500 bases, 1-200 bases, 1-about 100 bases, 1-about 60 bases, about 5-about 55 bases, about 10-about 30 bases, or about 15-25 bases.

[0099] In some embodiments, an RNA sequence of the invention comprises three RPS sequences adjacent to one another and separated by two linker sequences, each linker sequence being independently about 20 or about 50 bases, for example, the first two of the three identical RPS sequences may be separated by a linker that is 20 bases, and / or the last two of the RPS sequences may be separated by a linker that is 51 bases.

[0100] In some embodiments, the RNA sequence of the invention comprises more than one RPS (e.g., 1, 2, 3, 4, or 5 RPS), where at least two of the more than one RPS are not adjacent to each other. For example, one of the RPSs may be located at the 5' end of the RNA sequence of the invention, while another RPS may be located at the 3' end of the RNA sequence of the invention, and an optional third RPS may be located within an intron of the mRNA as an RSI within the RNA sequence of the invention. The fourth and / or fifth RPS may be close to or adjacent to any one of the first, second, or third RPS.

[0101] In some embodiments, an RNA sequence of the invention comprises at least two (e.g., two or more) RPS sequences that are not adjacent to each other (e.g., each located at or near one end of the RNA sequence of interest (RSI)).

[0102] In some embodiments, the RPS comprises a transcribed modified AAV terminal inverted repeat (ITR), wherein the transcribed modified AAV ITR comprises (a) a transcribed functional Rep binding element (RBE), optionally further comprising a transcribed functional RBE', and (b) lacks a transcribed terminal release site (TRS) or a transcribed reverse-complementary TRS (rcTRS), or both. In some embodiments, the transcribed modified AAV ITR further comprises a transcribed D region sequence (D sequence or D' sequence). In some embodiments, the RPS interacting molecule is Rep78, Rep68, Rep52, and / or Rep40.

[0103] As used herein, "AAV viral particle" includes any wild-type capsid-containing viral particle of an adeno-associated virus (AAV) (belonging to the genus Dependoparvovirus, which belongs to the family Parvoviridae), having engineered or mutant versions with modified sequences and / or tissue or host tropism.

[0104] As used herein, "intron" refers to a non-coding segment of DNA or RNA, which is usually removed from the transcribed RNA by splicing. However, the RNA sequence of the present invention may contain an intron sequence, such as an intron sequence from a heterologous gene ("heterologous" to the gene of interest or GOI, which is expressed as a transgene delivered to the host cell via the rRAAV viral particle of the present invention), so as to enhance the expression of the GOI. Such an intron sequence in the RNA sequence of the present invention may or may not be removed by splicing. Also, such an intron sequence may further include a transcribed enhancer or a part thereof, since some enhancers may be located within the introns of the coding DNA.

[0105] As used herein, "exon" refers to a coding segment of DNA or RNA, where the exon is translated into a protein sequence. However, in some embodiments, an exon sequence within an RNA sequence of the invention can code for part or all of a GOI, which is expressed as a transgene delivered to a host cell via an rRAAV viral particle of the invention. In other embodiments, an exon sequence within an RNA sequence of the invention can belong to a heterologous gene (for the GOI), and the presence of such an exon can enhance expression of the GOI.

[0106] As used herein, a "coding sequence" includes a polynucleotide sequence of DNA or RNA that encodes a product, which may be (a) a protein or polypeptide, or (2) a product other than a protein or polypeptide (e.g., ncRNA such as siRNA, piRNA, small hairpin RNA or shRNA, microRNA or miRNA or precursors thereof, including precursor miRNA and primary miRNA, antisense sequences or oligonucleotides (ASO), CRISPR / Cas guide RNA or gRNA, rRNA, tRNA, snoRNA, snRNA, exRNA, scaRNA, lncRNA, Xist, and HOTAIR, etc.).

[0107] Once the RNA of the RAAV viral particle is isolated from the AAV capsid and released into the cell, the ribonucleotide coding sequence of the gene of interest can be further processed within the cell. Processing of the coding sequence can produce one or more RNA products, such as siRNA, miRNA and / or mRNA, which may be further translated into one or more protein products or may be incorporated into other cellular machinery, such as RISC complexes or CRISPR / Cas effector enzymes (e.g., class 2, type II, type V or type VI effector enzymes).

[0108] As used herein, the term "transcribed" and grammatical variations thereof refer to a nucleotide sequence that includes ribosomal nucleic acid (RNA) nucleotides, which are transcribed from a DNA template (e.g., double-stranded DNA and / or single-stranded DNA). The transcribed RNA molecule may correspond to the plus or minus strand of AAV ssDNA, where the transcribed plus strand RNA is transcribed from the minus strand of the DNA template, and the transcribed minus strand RNA is transcribed from the plus strand of the DNA template. In some embodiments, the transcribed RNA molecule may be transcribed from the sense or antisense strand of a double-stranded DNA template. For example, in some cases, when a dsDNA sequence is represented by only a single strand sequence (e.g., SEQ ID NO: 1), the transcribed RNA using the dsDNA as a template may have the same sequence as the sense or antisense strand. That is, RNA transcribed from the double-stranded DNA shown in SEQ ID NO:1 can have the same sequence as SEQ ID NO:1, or its reverse complementary sequence, except that U in the RNA replaces T in the DNA.

[0109] The transcribed modified AAV terminal inverted repeat (ITR) sequence of the present invention is an RNA sequence (opposite to the single-stranded DNA sequence in the conventional AAV viral genome encapsidated in AAV viral particles). As a wild-type AAV ITR DNA sequence, the transcribed modified AAV ITR sequence (RNA) can support the binding of the RNA sequence of the present invention to the AAV Rep protein and therefore the direct packaging of the RNA sequence of the present invention into AAV viral particles. In some embodiments, the transcribed modified ITR sequence includes a transcribed Rep binding element (RBE) (e.g., a transcribed functional RBE) and, optionally, a transcribed RBE' (e.g., a transcribed functional RBE') and is used for Rep binding. In some embodiments, the transcribed modified ITR sequence supports or promotes the packaging or encapsidation of the RNA sequence into AAV viral particles.

[0110] In some embodiments, the modified ITR comprises a wild-type RBE.

[0111] In some embodiments, the modified ITRs comprise a functional RBE that retains at least about 60%, 70%, 80%, 90%, 95%, 100% or more of the ability of a wild-type RBE to support AAV packaging (e.g., Rep binding). In some embodiments, a functional RBE comprises up to about 30%, 25%, 20%, 15%, 10% or 5% sequence variation compared to a wild-type RBE, e.g., due to insertions, deletions, substitutions, and / or other mutations of one or more nucleotides of the RBE.

[0112] In some embodiments, the modified AAV ITR DNA template from which the transcribed modified AAV ITR is transcribed is defective as an ITR because it lacks one or more features of the corresponding wild-type AAV ITR, such as the ability to be cleaved at a TRS (transcribed terminal release site, see below). This can be, for example, due to lack of a functional TRS. In one embodiment, the modified ITR is TRS-less, since the wild-type TRS is completely deleted. In one embodiment, the deletion, insertion, substitution and / or mutation of one or more nucleotide mutations in the wild-type TRS results in it not being recognized and cleaved by Rep during AAV replication.

[0113] In some embodiments, the modified AAV ITR DNA template retains an RBE or a functional variant thereof, and optionally an RBE' or a functional variant thereof, as described herein, in some embodiments, the RBE and / or RBE' is functional in binding to AAV Rep78 / 68.

[0114] The transcribed modified AAV terminal inverted repeat (ITR) of the present invention further lacks a transcribed terminal release site (TRS) or a transcribed reverse-complementary TRS (rcTRS), or both. In some embodiments, the TRS is located at the 5' end of the modified AAV ITR. In some embodiments, the TRS is located between the D region sequence and the RBE.

[0115] In some embodiments, the transcribed modified AAV ITRs lack both the transcribed TRS and the transcribed rcTRS.

[0116] As used herein, "terminal release site" or "TRS" refers to a single-stranded DNA sequence in a single-stranded AAV vector genome (plus or minus strand) that is recognized by the AAV Rep protein during AAV replication to generate an incision. As used herein, "reverse complementary TRS (rcTRS)" refers to a single-stranded DNA sequence in a single-stranded AAV vector genome (plus or minus strand), which is the reverse complementary sequence of the TRS. The rcTRS and the TRS are paired to form a double-stranded DNA region at one end of the A region stem. See Figures 1A-1C.

[0117] In the AAV2 ITR, the TRS contains the sequence TTGGC, and the Rep cleavage site is located between the two T's, and the rcTRS contains the sequence GCCAA. One TRS is located at the boundary between the D region and the A region sequence and at the 5'-most end of the A region sequence (e.g., between the D region sequence and the RBE). See Figures 1B and 1C for the TRS and rcTRS in a representative AAV 5' and 3' ITR multiple sequence alignment.

[0118] As used herein, a "transcribed TRS" is a single-stranded RNA sequence produced by TRS DNA template transcription. For an AAV2 TRS that contains TTGGC, the transcribed TRS contains GCCAA.

[0119] As used herein, "transcribed rcTRS" refers to a single-stranded RNA sequence produced by rcTRS DNA template transcription. For the AAV2 rcTRS containing GCCAA, the transcribed rcTRS contains UUGGC.

[0120] Thus, a transcribed modified AAV ITR "lacks a transcribed AAV2 TRS" if the transcribed modified AAV ITR does not have a GCCAA sequence at the position where the GCCAA sequence normally appears in the corresponding transcribed wild-type AAV2 ITR, e.g., by a complete deletion of the GCCAA sequence, or by an insertion, deletion, substitution and / or other mutation of one or more nucleotides in the GCCAA sequence. This may be caused by transcription of a modified AAV ITR that has a complete deletion of the TRS (TTGGC), or by an insertion, deletion, substitution and / or other mutation of one or more nucleotides in the wild-type TRS.

[0121] Thus, in some embodiments, the RNA sequences of the invention or the transcribed modified AAV ITRs lack a transcribed functional TRS.

[0122] Similarly, a transcribed modified AAV ITR "lacks a transcribed AAV2 rcTRS" if the transcribed modified AAV ITR does not have a UUGGC sequence at the position where the UUGGC sequence normally appears in the corresponding transcribed wild-type AAV2 ITR, e.g., by a complete deletion of the GCCAA sequence, or by an insertion, deletion, substitution and / or other mutation of one or more nucleotides in the GCCAA sequence. This may be caused by transcription of a modified AAV ITR that has a complete deletion of the rcTRS, or by an insertion, deletion, substitution and / or other mutation of one or more nucleotides in the wild-type rcTRS.

[0123] In some embodiments, the transcribed modified AAV ITRs further comprise a transcribed D region sequence (the D or D' sequence in the wild-type AAV ITR) or a mutant D region sequence (e.g., a sequence having one or more nucleotide insertions, deletions, substitutions, and / or other mutations), which substantially retains the function of the wild-type D region sequence. In other embodiments, the transcribed modified AAV ITRs do not comprise a transcribed D region sequence or do not comprise a mutant D region sequence (e.g., a sequence having one or more nucleotide insertions, deletions, substitutions, and / or other mutations), which substantially retains the function of the wild-type D region sequence.

[0124] In some embodiments, the transcribed modified AAV ITRs comprise a transcribed (functional) D region sequence. Optionally, the modified AAV ITR DNA template has the nucleotide sequence of SEQ ID NO:3. Optionally, the transcribed modified AAV ITRs comprise an RNA equivalent of SEQ ID NO:3 (i.e., the RNA equivalent has the same base sequence as the DNA sequence of SEQ ID NO:3). Optionally, the transcribed modified AAV ITRs comprise an RNA equivalent of the reverse complement of SEQ ID NO:3 (i.e., the RNA equivalent has the same base sequence as the DNA sequence of the reverse complement of SEQ ID NO:3).

[0125] In some embodiments, the transcribed modified AAV ITRs lack the transcribed (functional) D region sequence. Optionally, the modified AAV ITR DNA template has the nucleotide sequence of SEQ ID NO:2. Optionally, the transcribed modified AAV ITRs comprise an RNA equivalent of SEQ ID NO:2 (i.e., the RNA equivalent has the same base sequence as the DNA sequence of SEQ ID NO:2). Optionally, the transcribed modified AAV ITRs comprise an RNA equivalent of the reverse complementary sequence of SEQ ID NO:2 (i.e., the RNA equivalent has the same base sequence as the DNA sequence of the reverse complementary sequence of SEQ ID NO:2).

[0126] As used herein, "D region sequence" refers to the D sequence or its reverse complementary sequence, D' sequence. The location of the D region sequence depends on whether the ITR employs a "Flip" or "Flop" conformation. See Figures 1A-1C. For example, in the wild-type AAV2 ITR (see Figure 2 of Srivastava et al., J. Viol. 45(2):555-564, 1983, incorporated herein by reference), the positive strand ssDNA sequence includes, from 5' to 3', palindromic segments designated A, B, B', C, C', A', D, ..., D', A, C, C, B, B', and A', where A:A', B:B', C:C', and D:D' are reverse complementary sequences to each other and can form base-paired stem sequences (even though the D and D' sequences do not actually base pair with each other in the ssDNA AAV vector genome). The B:B' stem of the positive strand 5' ITR is closer to one end of the sequence (the 5' end) than the C:C' stem and is referred to as the Flip ITR. The C:C' stem of the 3' ITR of the positive strand is closer to one end (the 3' end) of the sequence than the B:B' stem and is called a Flop ITR.

[0127] For example, the transcribed modified AAV ITR sequences of the invention may lack a functional transcribed D region sequence (D or D' sequence) by deleting, inserting, substituting and / or otherwise mutating one or more nucleotides of the transcribed wild-type D region sequence.

[0128] In some embodiments, the RNA or transcribed modified AAV ITR sequences of the invention comprise a mutated transcribed D region sequence and / or a mutated transcribed TRS sequence, in some embodiments, the RNA or transcribed modified AAV ITR sequences of the invention do not comprise a transcribed D region sequence and / or do not comprise a transcribed TRS / rcTRS sequence.

[0129] In some embodiments, the transcribed modified AAV ITRs are modified based on the transcribed wild-type Flip ITR or wild-type Flop ITR.

[0130] In some embodiments, the wild-type Flip ITR or wild-type Flop ITR is from AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV 11, AAV 12, AAV 13, AAVrhlO, AAVrh74, AAVhu32, AAVhu37, AAV PHP.eB, Anc80L65, Anc80L65AAP, AAVrh74, or 7m8. Optionally, the wild-type Flop ITR has the nucleotide sequence of SEQ ID NO: 1.

[0131] In some embodiments, the transcribed D region sequence is present and is not within 50 nucleotides (eg, 40 nt, 30 nt, 25 nt, or 20 nt) of the 3' end of the RNA.

[0132] In some embodiments, the transcribed D region sequence is present and is within 50 nucleotides (eg, 40 nt, 30 nt, 25 nt, or 20 nt) of the 3' end of the RNA.

[0133] In some embodiments, the transcribed modified AAV ITRs are within 1000 nucleotides of the 3' end of the RNA. In some embodiments, the transcribed modified AAV ITRs are within 800 nucleotides of the 3' end of the RNA. In some embodiments, the transcribed modified AAV ITRs are within 500 nucleotides of the 3' end of the RNA. In some embodiments, the transcribed modified AAV ITRs are within 300 nucleotides of the 3' end of the RNA. In some embodiments, the transcribed modified AAV ITRs are within 200 nucleotides of the 3' end of the RNA.

[0134] In some embodiments, the transcribed modified AAV ITRs are 5' to a polyA sequence, a polyA signal sequence (eg, AAUAAA), or an RNA transcription termination sequence (eg, a histone downstream element).

[0135] As used herein, a "polyA sequence" or "polyA tail" is a string of adenine ribonucleotides or adenosine monophosphate (e.g., where each base is an RNA string of adenine). Such polyA tails are crucial for the nuclear export, translation and stability of mRNA. The length of the polyA sequence can vary in different mRNA or RNA sequences of the present invention and can be about 250 nucleotides of polyA, about 230 nucleotides of polyA, about 200 nucleotides of polyA, about 180 nucleotides of polyA, about 160 nucleotides of polyA, about 140 nucleotides of polyA, about 120 nucleotides of polyA, about 100 nucleotides of polyA, or less.

[0136] As used herein, "polyA signal sequence" refers to an RNA sequence (e.g., AAUAAA) located most downstream of a 3' exon that is recognized by an RNA cleavage complex that allows an RNA polymerase (e.g., Pol II) to cleave the 3' terminal sequence of the newly transcribed RNA, thereby allowing polyadenylation to occur. The polyadenylation polymerase then adds and extends the poly(A) tail by adding an adenosine monophosphate unit from ATP to the newly cleaved 3' end of the RNA. Initial RNA cleavage is usually catalyzed by the enzyme CPSF (cleavage / polyadenylation specificity factor) and occurs approximately 10-30 nucleotides downstream of its binding site - the polyA signal sequence (usually AAUAAA on the transcribed RNA). The sequence located 5' to and / or immediately adjacent to the RNA cleavage site is often (but not always) CA. The polyA signal sequences recognized by the RNA cleavage complex vary among different populations of eukaryotic cells, and while many human polyadenylation sites contain the AAUAAA sequence, such sequences are less common in plant and fungal mRNAs. There are also other variants that bind more weakly to CPSF. All of these sequence motifs recognized by the RNA cleavage complex to allow RNA cleavage and subsequent polyadenylation are within the polyA signal sequence.

[0137] Furthermore, as used herein, a "transcribed GU-rich region downstream of the polyA site" is a sequence (e.g., AAUAAA) that can be used by other proteins (e.g., cleavage stimulation factor or CstF) to enhance the binding specificity of CPSF to the polyA signal sequence.

[0138] In some embodiments, the RNA sequences of the invention further comprise a recognition sequence for CFI (cleavage factor I), such as a set of UGUAA sequences in mammals, which is capable of recruiting CPSF even in the absence of the AAUAAA polyA signal sequence.

[0139] As used herein, "sequences for RNA transcription termination" include RNA sequence motifs located at or near the 3' end of a transcriptionally terminated transcribed RNA (e.g., a transcribed RNA without a polyA tail). Except for metazoan replication-dependent histone mRNAs, almost all eukaryotic mRNAs are polyadenylated, where mRNA processing occurs at a site with a highly conserved stem-loop structure and a purine-rich region about 20 nucleotides downstream. These are the few, if not the only, eukaryotic mRNAs that lack a poly(A) tail and end with a stem-loop structure followed by a purine-rich sequence, called histone downstream element (HDE) or histone 3' UTR stem-loop. HDEs shape the 3' end of histone mRNAs by guiding where the RNA is cleaved during / after transcription. HDEs are involved in nucleocytoplasmic transport of histone mRNAs and regulating stability and translation efficiency in the cytoplasm.

[0140] In some embodiments, the RNA sequence of the present invention further comprises a second transcribed modified AAV ITR of the present invention. In some embodiments, the second transcribed modified AAV ITR has a transcribed functional RBE sequence but lacks a second transcribed TRS or a second transcribed rcTRS or both. Optionally, the second transcribed modified AAV ITR further comprises or lacks a second transcribed D region sequence. In some embodiments, the second transcribed modified AAV ITR comprises a second transcribed mutated D region sequence and / or a second transcribed mutated TRS sequence.

[0141] In some embodiments, for RNA sequences of the invention having two transcribed modified AAV ITRs, the transcribed modified AAV ITR and the second transcribed modified AAV ITR are the same.

[0142] In some embodiments, for RNA sequences of the invention having two transcribed modified AAV ITRs, the transcribed modified AAV ITR and the second transcribed modified AAV ITR are different.

[0143] In some embodiments, the transcribed modified AAV ITR, the second transcribed modified AAV ITR (if present), comprises a deletion in the corresponding transcribed wild-type AAV ITR D region sequence or the corresponding transcribed wild-type TRS / rcTRS, a mutation in the corresponding transcribed wild-type AAV ITR D region sequence or the corresponding transcribed wild-type TRS / rcTRS, or an insertion in the corresponding transcribed wild-type AAV ITR D region sequence or the corresponding transcribed wild-type TRS / rcTRS.

[0144] In some embodiments, for RNA sequences of the invention having two transcribed modified AAV ITRs, the second transcribed modified AAV ITR is within 1000 nucleotides, 800 nucleotides, 500 nucleotides, 250 nucleotides, or 150 nucleotides of the 5' end of the RNA sequence.

[0145] In some embodiments, the RPS comprises an MS2 sequence, a PP7 binding site, or a com binding site, and the RPS interacting molecule comprises an RPS interacting protein (RPSIP) that can directly or indirectly interact with, e.g., recognize and bind to, the RPS, such as a phage derived MS2 coat protein (MCP) for the MS2 sequence, a PP7 phage coat protein (PCP) for the PP7 binding site, or a phage COM protein (COM) for the com binding site. The sequences of these RPS / RPSIP pairs are described in the sequence section of the specification.

[0146] Any one of the one or more RPS sequences described above, including any one of the transcribed modified ITR sequences and any one of the MS2 sequence, PP7 binding site, and / or com binding site, alone or in combination, can promote packaging of the RNA sequence of the present invention into viral particles of a DNA virus in the presence of an appropriate / compatible cognate RPSIP.

[0147] In some embodiments, the RPSIP is or is directly or indirectly associated with a protein component of the viral packaging system of a DNA virus viral particle. For example, in some embodiments, the RPSIP is a protein component of the viral packaging system of a DNA virus, such as Rep78, Rep68, Rep52, and / or Rep40 of AAV. For example, in some embodiments, the RPSIP can be directly fused to a protein component of the viral packaging system of a DNA virus. Exemplary protein components of the viral packaging system of an AAV include any one of the Rep proteins (e.g., Rep78 and / or Rep68 of adeno-associated virus 2 (AAV2)) and / or any one of the assembly activating proteins (AAPs).

[0148] In some embodiments, the fusion is an N-terminal fusion, where an RPSIP (eg, MCP, PCP, or COM) is fused at the N-terminus of the Rep68 / 78 protein and / or AAP.

[0149] In some embodiments, the fusion is an N-terminal fusion, where an RPSIP (eg, MCP, PCP, or COM) is fused at the C-terminus of the Rep68 / 78 protein and / or AAP.

[0150] In some embodiments, the fusion is a direct fusion, with no linker sequence between them.

[0151] In some embodiments, the fusion is achieved through one or more linker sequences, such as flexible peptide linkers that may include Gly and Ser rich linkers or GS linkers. Exemplary GS linkers include GS, GSS, GSSS, GSSSS and repeats thereof (e.g., (GS p ) n , where p is an integer from 1 to 5 and n is an integer from 1 to 20). Exemplary such GS linkers are GS3 linkers or GS4 linkers. In some embodiments, p is 3 or 4 and n is 1.

[0152] In some embodiments, the RNA sequence of the present invention may, but preferably does not, include a transcribed DNA packaging signal, e.g., a transcribed wild-type AAV ITR sequence. For example, the RNA sequence of the present invention may include a transcribed modified AAV ITR sequence, which has nucleotide additions, deletions, and / or substitutions of the corresponding transcribed wild-type AAV ITR sequence so as to reduce the DNA packaging ability of the viral particles of the DNA virus.

[0153] In some embodiments, the RNA sequences of the invention include (1) a coding sequence for a protein (e.g., an mRNA encoding a therapeutic protein or a CRISPR / Cas effector enzyme (including any one of the Cas effectors in the following description, e.g., Cas9 or a variant thereof, optionally fused to a base editor), a non-coding RNA (ncRNA), or a functional RNA (e.g., a tRNA, a ribosomal RNA (rRNA), an RNAi reagent or precursor thereof, an siRNA including a precursor miRNA and a primary miRNA, an shRNA, an miRNA or precursor thereof, an antisense RNA (ASO), a piRNA, a guide RNA (or gRNA), a single guide RNA (or sgRNA, chimeric RNA, RNA chimera), a CRISPR RNA (crRNA), or a tracrRNA). The CRISPR-Cas system may further include one or more of the following: (1) a transcribed transcriptional enhancer; (2) a transcribed intronic or exonic sequence (e.g., a sequence for enhancing expression of a protein); (3) a 5' UTR sequence; (4) a 5' UTR sequence; (5) a 3' UTR sequence; (6) a polyA sequence, or a (transcribed) polyadenylation (polyA) signal sequence, and optionally a transcribed polyA site and a transcribed downstream GU-rich region of said polyA site; (7) a post-transcriptional regulatory element or sequence, for example, a transcribed Woodchuck Hepatitis Virus (WHP) post-transcriptional regulatory element (WPRE) sequence; and / or (8) a transcription termination sequence (e.g., a histone downstream element).

[0154] In some embodiments, an RNA sequence of the invention comprises an RPS located 3' of a post-transcriptional regulatory element or sequence and 5' of a polyA sequence or polyA signal sequence.

[0155] For example, in some embodiments, an RNA sequence of the invention includes, in the 5' to 3' direction, an RSI, an optional transcribed WPRE sequence (which may or may not be present), an RPS (e.g., a transcribed modified AAV ITR, an MS2 sequence, a PP7 binding site, or a com binding site), and a polyA sequence or a polyA signal sequence.

[0156] In some embodiments, the nucleic acid sequence includes a protein (e.g., a Cas protein, a ZFN protein, a fluorescent protein such as a TALEN protein, a therapeutic protein, an antigenic protein, or a gene editing protein), an enzyme (e.g., a Cre protein or a CRISPR / Cas effector enzyme, e.g., Cas9, Cas12, Cas13, or a mutant thereof), a structural protein, an mRNA, a non-coding RNA (ncRNA), an siRNA, a piRNA, a small hairpin RNA or an shRNA, a microRNA (miRNA) or a precursor thereof (including precursor miRNA and primary miRNA), a ribosomal RNA (rRNA), an antisense sequence or an oligonucleotide (ASO), a single guide RNA (or sgRNA, chimeric RNA, RNA chimera), a CRISPR RNA (crRNA), and a tracrRNA. The RNA components of the CRISPR-Cas system, including guide RNA (or gRNA) such as RNA, and guide RNA or gRNA for CRISPR / Cas effector enzymes, rRNA, tRNA, snoRNA, snRNA, exRNA, scaRNA, lncRNA, Xist, and HOTAIR, are encoded by an RNA sequence of the invention or contained in the GOI.

[0157] The overall length of the RNA sequence of the present invention depends on the packaging capacity of the AAV viral particle. The packaging capacity of the majority of AAV viral particles is about 4,700 to 5,200 nucleotides, but some AAV viral particles, such as AAV5 particles, can package up to 8,900 nucleotides.

[0158] Thus, in some embodiments, the RNA sequences of the invention that are packaged into AAV viral particles are single-stranded RNA (ssRNA) less than about 8,900 nucleotides in length.

[0159] In some embodiments, the RNA sequence is a ssRNA less than about 8,000 nucleotides in length. In some embodiments, the RNA sequence is a ssRNA less than about 7,000 nucleotides in length. In some embodiments, the RNA sequence is a ssRNA less than about 6,000 nucleotides in length. In some embodiments, the RNA sequence is a ssRNA less than about 5,200 nucleotides in length. In some embodiments, the RNA sequence is a ssRNA less than about 4,000 nucleotides in length. In some embodiments, the RNA sequence is a ssRNA less than about 3,000 nucleotides in length. In some embodiments, the RNA sequence is a ssRNA less than about 2,000 nucleotides in length.

[0160] In some embodiments, the RNA sequence is a ssRNA of about 4,700-5,200 nucleotides in length. In some embodiments, the RNA sequence is a ssRNA of about 4,700-5,000 nucleotides in length. In some embodiments, the RNA sequence is a ssRNA of about 4,700-4,800 nucleotides in length. In some embodiments, the RNA sequence is a ssRNA of about 4,700 nucleotides in length.

[0161] Another aspect of the invention provides a polynucleotide, said polynucleotide comprising a cassette encoding (transcribes) an RNA sequence of the invention, optionally said polynucleotide is a DNA sequence (e.g. a DNA plasmid), said DNA sequence optionally comprising a stuffer sequence in the backbone of said DNA plasmid, and / or optionally not comprising a functional DNA packaging signal, e.g. AAV ITRs.

[0162] In some embodiments, the polynucleotide comprising the cassette is a DNA vector encoding an RNA sequence of the invention. Such a DNA vector and / or cassette thereof can be used, for example, to transcribe and produce an RNA sequence of the invention for further packaging into an AAV viral particle.

[0163] In some embodiments, the polynucleotide further comprises a promoter that is operably linked to and drives transcription of an RNA sequence of the invention encoded by the cassette to produce the RNA sequence of the invention.

[0164] In some embodiments, the promoter is a ubiquitous promoter.

[0165] In some embodiments, the promoter is a tissue-specific promoter.

[0166] In some embodiments, the promoter is a constitutive promoter.

[0167] In some embodiments, the promoter is an inducible promoter.

[0168] In some embodiments, the polynucleotide further comprises an enhancer that enhances transcription of the RNA sequence driven by the promoter.

[0169] Another aspect of the invention provides a recombinant DNA viral particle, which comprises an RNA genome (e.g., an RNA sequence of the invention or an RNA sequence transcribed from a polynucleotide of the invention) packaged in a protein shell (e.g., a capsid) of a DNA virus (e.g., an AAV virus, or an oncolytic virus).

[0170] In some embodiments, the DNA virus is AAV and the recombinant DNA virus particle is a recombinant RNA adeno-associated virus (rRAAV) particle, which comprises (1) an AAV capsid and (2) an RNA sequence of the invention or an RNA sequence transcribed from a polynucleotide of the invention that is packaged within the AAV capsid.

[0171] In some embodiments, the AAV capsid comprises a capsid from an AAV of serotype AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAVrh74, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-DJ, AAV PHP.eB, Anc80L65, Anc80L65AAP, or 7m8.

[0172] A related aspect of the invention provides a population of recombinant DNA viral particles (e.g., rRAAV particles), the population comprising a plurality of recombinant DNA viral particles (e.g., rRAAV particles) of the invention, wherein at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or more of the recombinant DNA viral particles (e.g., rRAAV particles) in the population have an encapsidated RNA sequence of the invention or an RNA sequence transcribed from a polynucleotide of the invention packaged therein.

[0173] In some embodiments, the population of recombinant viral particles (e.g., rRAAV particles) is at least 1×10 4 Virus particles, at least 2 x 10 4 Virus particles, at least 5 x 10 4 Virus particles, at least 1 x 10 5 Virus particles, at least 2 x 10 5 Virus particles, at least 5 x 10 5 Virus particles, at least 1 x 10 6 Virus particles, at least 2 x 106 Virus particles, at least 5 x 10 6 Virus particles, at least 1 x 10 7 Virus particles, at least 2 x 10 7 Virus particles, at least 5 x 10 7 Virus particles, at least 1 x 10 8 Virus particles, at least 2 x 10 8 Virus particles, at least 5 x 10 8 Virus particles, at least 1 x 10 9 Virus particles, at least 2 x 10 9 Virus particles, at least 5 x 10 9 Virus particles, at least 1 x 10 10 Virus particles, at least 2 x 10 10 Virus particles, at least 5 x 10 10 Virus particles, at least 1 x 10 11 Virus particles, at least 2 x 10 11 Virus particles, at least 5 x 10 11 Virus particles, at least 1 x 10 12 Virus particles, at least 2 x 10 12 Virus particles, at least 5 x 10 12 Virus particles, at least 1 x 10 13 Virus particles, at least 2 x 10 13 Virus particles, at least 5 x 10 13 Virus particles, at least 1 x 10 14 Virus particles, at least 2 x 10 14 Virus particles, at least 5 x 10 14 Virus particles, at least 1 x 10 15 Virus particles, at least 2 x 10 15 Virus particles, at least 5 x 10 15 Virus particles, at least 1 x 10 16 Virus particles, at least 2 x 10 16 virus particles, or at least 5 x 10 16 It contains virus particles.

[0174] In some embodiments, at most 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 3%, 2%, 1%, 0.1%, 0.01% or less of a population of recombinant viral particles have non-RNA (e.g., DNA) encapsidated within the viral particles.

[0175] Another aspect of the invention provides a host cell, said host cell comprising an RNA sequence of the invention, a polynucleotide of the invention, an RNA sequence transcribed from a polynucleotide of the invention, a viral particle of a recombinant DNA virus of the invention (e.g., an rRAAV particle), and / or a population of viral particles of a recombinant DNA virus of the invention (e.g., an rAAV particle).

[0176] In some embodiments, the host cell further comprises a viral packaging system that facilitates packaging of the RNA sequences of the invention or RNA sequences transcribed from the polynucleotides of the invention into viral particles of the DNA virus.

[0177] In some embodiments, the viral packaging system comprises: (1) an AAV rep gene (e.g., coding sequences for Rep78, Rep68, Rep52, and / or Rep40) and an AAV cap gene (e.g., coding sequences for VP1, VP2, and / or VP3, AAP, and / or MAAP) or their expression products under the transcriptional control of one or more promoters driving transcription of the rep and cap genes; (2) one or more coding sequences for one or more proteins required for AAV packaging, e.g., the adenovirus E2A, E4, and VA genes, or said one or more proteins; and (3) an RPS interacting molecule or a coding sequence thereof.

[0178] In some embodiments, the ability of a viral packaging system to package a DNA sequence into viral particles of the DNA virus is reduced, attenuated, or substantially eliminated, for example, by: (1) deleting a DNA packaging signal, e.g., part or all of the AAV ITRs, in a polynucleotide encoding an RNA sequence of the invention or in a polynucleotide of the invention; (2) modifying, e.g., mutating, the coding sequence of the AAV rep gene, the AAV cap gene, and / or one or more proteins required for AAV packaging to reduce, attenuate, or substantially eliminate the ability of the corresponding translated protein to promote packaging of the DNA sequence into viral particles of the DNA virus (e.g., a Y156F mutation in the consensus sequence for Rep78 and Rep68 proteins, KDE-mu, or EKE-mu), and / or (3) expanding the size of a polynucleotide encoding an RNA sequence of the invention or in a polynucleotide of the invention. In an embodiment, a polynucleotide encoding an RNA sequence of the invention or a polynucleotide of the invention is expanded in size by inserting stuffer sequences (eg, introns) into (eg, the backbone of) the polynucleotide (eg, a DNA plasmid).

[0179] In some embodiments, the AAV rep gene, the AAV cap gene, and / or proteins required for AAV packaging contain mutations that attenuate or reduce their ability to promote packaging of DNA into DNA virus viral particles.

[0180] In some embodiments, the Rep68 / Rep78 protein required for DNA packaging contains a mutation that impairs or attenuates its trs-endonuclease activity, which is believed to be necessary to release AAV replication (DNA) intermediates at the trs sequence or site so that single units of AAV ssDNA can be released before being packaged into the AAV capsid.

[0181] In some embodiments, the trs-endonuclease mutation comprises a Y156F mutation in the consensus sequence of the Rep78 and Rep68 proteins.

[0182] In some embodiments, the Rep78 / Rep68 protein comprises a KDE-mu mutation (see sequence in the sequence section below).

[0183] In some embodiments, the Rep78 / Rep68 protein comprises an EKE-mu mutation (see sequence in the sequence section below).

[0184] In some embodiments, the Rep78 / Rep68 protein comprises two or more mutations selected from a Y156F mutation, a KDE-mu mutation, and an EKE-mu mutation.

[0185] In some embodiments, Rep68 / Rep78 is from any one of the AAV serotypes AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-DJ, AAV PHP.eB, Anc80L65, Anc80L65AAP, AAVrh74, or 7m8, and the corresponding trs-endonuclease mutation having a Y156F mutation, a KDE-mu mutation, and / or an EKE-mu mutation.

[0186] In some embodiments, the host cell further comprises (1) an AAV rep gene and an AAV cap gene coding sequence under the transcriptional control of one or more promoters that drive transcription of the rep gene and the cap gene, and (2) protein coding sequences required for AAV packaging, such as the adenovirus E2A, E4, and VA genes.

[0187] In some embodiments, the host cell is a mammalian cell, such as a HEK293 cell or a mutant thereof (eg, a HEK293T cell), or an insect cell, such as an Sf9 or Sf21 cell.

[0188] Another aspect of the invention provides a method of producing a recombinant DNA virus particle (e.g., rRAAV particle) or a population of recombinant DNA virus particles (e.g., rRAAV particle) of the invention, the method comprising: a) culturing a host cell of the invention for a sufficient period of time; and b) harvesting the recombinant DNA virus particle or the population of recombinant DNA virus particles.

[0189] In some embodiments, the methods further comprise isolating or purifying the recombinant DNA virus particle or the population of recombinant DNA virus particles.

[0190] Another aspect of the invention provides a method of generating recombinant DNA viral particles (e.g., rRAAV particles) or a population of recombinant DNA viral particles, the method comprising: a) contacting a viral packaging system (e.g., an AAV packaging system) with an RNA sequence of the invention or an RNA sequence transcribed from a polynucleotide of the invention for a time sufficient to produce said recombinant DNA viral particles of the invention or a population of recombinant DNA viral particles of the invention; b) harvesting said recombinant DNA viral particles of the invention or a population of recombinant DNA viral particles of the invention; and optionally c) isolating or purifying the harvested recombinant DNA viral particles of the invention or a population of recombinant DNA viral particles of the invention.

[0191] In some embodiments, a viral packaging system (e.g., an AAV packaging system) comprises: (1) one or more proteins, or one or more coding sequences thereof, for assembling a protein shell of a viral particle of the DNA virus for packaging the RNA sequence (e.g., VP1, VP2, and / or VP3 for assembling an AAV capsid); (2) one or more proteins, or one or more coding sequences thereof, for promoting assembly of the protein shell and / or packaging of the RNA sequence into the protein shell of a viral particle of the DNA virus (e.g., Rep78, Rep68, Rep52, and / or Rep40 for AAV packaging); and (3) an RPS interacting molecule or a coding sequence thereof. Optionally, the ability of a viral packaging system to package a DNA sequence into viral particles of the DNA virus is reduced, attenuated, or substantially eliminated, for example, by: (1) deleting a DNA packaging signal, e.g., part or all of the AAV ITRs, in a polynucleotide encoding an RNA sequence of the invention or a polynucleotide of the invention; (2) modifying, e.g., mutating, the coding sequence of the AAV rep gene, the AAV cap gene, and / or one or more proteins required for AAV packaging to reduce, attenuate, or substantially eliminate the ability of the corresponding translated protein to promote packaging of the DNA sequence into viral particles of the DNA virus (e.g., a Y156F mutation in the consensus sequence for Rep78 and Rep68 proteins, KDE-mu, or EKE-mu), and / or (3) expanding the size of a polynucleotide encoding an RNA sequence of the invention or a polynucleotide of the invention.

[0192] Another aspect of the present invention provides a system for packaging an RNA sequence of the present invention or an RNA sequence transcribed from a polynucleotide of the present invention into a viral particle of a DNA virus, the system comprising: (1) one or more proteins for assembling a protein shell of a viral particle of the DNA virus for packaging the RNA sequence (e.g., VP1, VP2, and / or VP3 for assembling an AAV capsid), or one or more coding sequences thereof; (2) one or more proteins for facilitating the assembly of the protein shell and / or packaging of the RNA sequence of the present invention into the protein shell of a viral particle of the DNA virus (e.g., Rep78, Rep68, Rep52, and / or Rep40 for AAV packaging), or one or more coding sequences thereof (e.g., adenovirus E2a, E4, and VA genes); and (3) an RPS interacting molecule, or a coding sequence thereof. Optionally, the ability of a viral packaging system to package a DNA sequence into viral particles of the DNA virus is reduced, attenuated, or substantially eliminated, for example, by: (1) deleting a DNA packaging signal, e.g., part or all of the AAV ITRs, in a polynucleotide encoding an RNA sequence of the invention or a polynucleotide of the invention; (2) modifying, e.g., mutating, the coding sequence of the AAV rep gene, the AAV cap gene, and / or one or more proteins required for AAV packaging to reduce, attenuate, or substantially eliminate the ability of the corresponding translated protein to promote packaging of the DNA sequence into viral particles of the DNA virus (e.g., a Y156F mutation in the consensus sequence for Rep78 and Rep68 proteins, KDE-mu, or EKE-mu), and / or (3) expanding the size of a polynucleotide encoding an RNA sequence of the invention or a polynucleotide of the invention.

[0193] Another aspect of the invention provides a method of delivering an RNA sequence of interest (RSI) to a cell, plant, or animal, said method comprising contacting said cell, plant, or animal with a recombinant DNA virus particle (e.g., rRAAV particle) of the invention, a population of recombinant DNA virus particles (e.g., rRAAV particle) of the invention, or a recombinant DNA virus particle (e.g., rRAAV particle) or a population of recombinant DNA virus particles (e.g., rRAAV particle) produced by a method of the invention, wherein said GOI is optionally encoded by an RNA sequence of the invention.

[0194] Another aspect of the present invention provides a method of diagnosing, preventing, or treating a disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount or dosage of a population of viral particles (e.g., rRAAV particles) of a recombinant DNA virus of the present invention or produced by a method of the present invention.

[0195] Another aspect of the present invention provides the use of a recombinant DNA viral particle (e.g., rRAAV particle) of the invention, a population of recombinant DNA viral particles (e.g., rRAAV particles) of the invention, or a recombinant DNA viral particle (e.g., rRAAV particle) or a population of recombinant DNA viral particles (e.g., rRAAV particles) produced by a method of the invention, in the manufacture of a medicament for diagnosing, preventing, or treating a disease or disorder in a subject in need thereof.

[0196] Another aspect of the present invention provides a fusion protein or conjugate comprising an RPSIP of the present invention fused or conjugated to a protein component of a viral packaging system of a DNA virus, wherein said RPSIP interacts / binds with an RPS in an RNA sequence of the present invention to promote packaging of said RNA sequence into a DNA virus.

[0197] In some embodiments, the RPS is MS2 and the RPSIP is MCP.

[0198] In some embodiments, the RPS is a PP7 binding site and the RPSIP is PCP.

[0199] In some embodiments, the RPS is com and the RPSIP is a phage COM protein.

[0200] In some embodiments, the fusion or conjugate comprises more than one RPSIP, each of which independently binds to one or more RPSs in an RNA sequence of the invention. In some embodiments, at least two of the more than one RPSIPs are the same. In some embodiments, at least two of the more than one RPSIPs are different.

[0201] In some embodiments, the fusion or conjugate comprises two MCPs linked in tandem.

[0202] In some embodiments, the protein component of the viral packaging system of a DNA virus comprises an AAV Rep protein, such as Rep68 or Rep78 of said AAV.

[0203] In some embodiments, the Rep protein comprises one or more mutations that impair or reduce trs-endonuclease activity, hi some embodiments, the mutations comprise a Y156F mutation, a KDE-mu mutation, and / or an EKE-mu mutation.

[0204] In some embodiments, the protein component of the viral packaging system of a DNA virus comprises an assembly activating protein (AAP).

[0205] In some embodiments, RPSIP is directly fused to a protein component of the viral packaging system of a DNA virus (eg, a Rep protein or AAP).

[0206] In some embodiments, RPSIP is fused to a protein component of the viral packaging system of a DNA virus (eg, a Rep protein or AAP) via a peptide linker.

[0207] In some embodiments, the peptide linker is a flexible linker, such as a linker containing Gly and Ser. In some embodiments, the linker containing Gly and Ser is a linker containing GS n In some embodiments, the amino acid sequence includes 1 to 20 repeats (e.g., 1 to 5 or 1 to 3 repeats) of the amino acid sequence, where n is 1, 2, 3, 4, or 5. n The linker is GS2, GS3, or GS4, having 1 to 4 (e.g., 2) repeats. In some embodiments, the linker is GSSGSS.

[0208] In some embodiments, the fusion protein comprises MCP and Rep, wherein the Rep optionally comprises a Y156F mutation, a KDE-mu mutation, and / or an EKE-mu mutation. In some embodiments, the MCP is fused at the N-terminus of Rep (MCP-Rep). In some embodiments, the Rep fused to the MCP comprises a Y156F mutation, a KDE-mu mutation, and / or an EKE-mu mutation. In some embodiments, the MCP-Rep fusion comprises a GS mutation, such as GSSGSS. n In some embodiments, the MCP-Rep comprises two MCPs linked in series (e.g., without any linker between the two MCP moieties). In some embodiments, the MCP is linked to another GS such as GSSGSS. n It is at the C-terminus of the linker.

[0209] In some embodiments, the fusion protein comprises PCP and Rep, wherein the Rep optionally comprises a Y156F mutation, a KDE-mu mutation, and / or an EKE-mu mutation. In some embodiments, PCP is fused at the N-terminus of Rep (PCP-Rep). In some embodiments, the Rep fused to PCP comprises a Y156F mutation, a KDE-mu mutation, and / or an EKE-mu mutation. In some embodiments, the PCP-Rep fusion comprises a GS mutation, such as GSSGSS. n In some embodiments, a PCP-Rep comprises two PCPs linked in series (e.g., without any linker between the two PCP moieties). In some embodiments, a PCP is linked to another GS, such as GSSGSS. n It is at the C-terminus of the linker.

[0210] In some embodiments, the fusion protein comprises COM and Rep, wherein the Rep optionally comprises a Y156F mutation, a KDE-mu mutation, and / or an EKE-mu mutation. In some embodiments, the COM is fused at the N-terminus of Rep (COM-Rep). In some embodiments, the Rep fused to the COM comprises a Y156F mutation, a KDE-mu mutation, and / or an EKE-mu mutation. In some embodiments, the COM-Rep fusion comprises a GS mutation, such as GSSGSS. n In some embodiments, a COM-Rep comprises two COMs linked in series (e.g., there is no linker between the two COM moieties). In some embodiments, a COM is linked to another GS, such as GSSGSS. n It is at the C-terminus of the linker.

[0211] In some embodiments, the fusion protein comprises an MCP and an AAP. In some embodiments, the MCP is fused at the N-terminus of the AAP (MCP-AAP, or MA). In some embodiments, the MCP is fused at the C-terminus of the AAP (AAP-MCP, or AM). In some embodiments, the MCP-AAP or AAP-MCP fusion contains a GS fusion such as GSSGSS. n In some embodiments, the MCP-AAP fusion is linked to another GS such as GSSGSS via a linker. n In some embodiments, the AAP-MCP fusion is at the C-terminus of another GS such as GSSGSS. n At the N-terminus of the linker.

[0212] Another aspect of the invention provides a polynucleotide, the polynucleotide encoding any one of the fusions between the RPSIP of the invention and a protein component of the viral packaging system of a DNA virus (e.g., an AAP or Rep protein).

[0213] With the general aspects of the invention described above, the following sections provide additional details of the specific elements of the invention described herein. It is contemplated that each specific element may be combined with any one or more additional elements of the invention, even if all possible combinations or arrangements of the elements are not explicitly recited.

[0214] 2.AAV serotype AAV particles that package ribosomal polynucleotides of the invention can comprise or be derived from any natural or recombinant AAV serotype.

[0215] In accordance with the present disclosure, the AAV particles may utilize or be based on any one of the following serotypes and variants thereof: AAV1, AAV10, AAV106.1 / hu.37, AAV11, AAV114.3 / hu.40, AAV 12, AAV127.2 / hu.41, AAV127.5 / hu.42, AAV128.1 / hu.43, AAV128.3 / hu.44, AAV130.4 / hu.48, AAV145.1 / hu.53, AAV145.5 / hu.54, AAV145.6 / hu.55, AAV16.12 / hu.1, AAV16.12 / hu.2, AAV16.12 / hu.3, AAV16.12 / hu.4, AAV16.12 / hu. ...5, AAV16.12 / hu.6, AAV16.12 / hu.7, AAV16.12 / hu.8, AAV16.12 / hu.9, AAV16.12 / hu.10, AAV16.12 / hu.11, AAV16.12 / hu.12, AAV16.12 / hu.13, AAV16.12 / hu.14, AAV16.12 / hu.15, AAV16.12 / hu.16, AAV16.12 / hu.17, AAV16.12 / hu.18, AAV16.12 / hu.19, AAV16.12 / hu.29, AAV16.1 1, AAV16.3, AAV16.8 / hu.10, AAV161.10 / hu.60, AAV161.6 / hu.61, AAVl-7 / rh.48, A AVl-8 / rh.49, AAV2, AAV2.5T, AAV2-15 / rh.62, AAV223.1, AAV223.2, AAV223.4, AAV 223.5, AAV223.6, AAV223.7, AAV2-3 / rh.61, AAV24.1, AAV2-4 / rh.50, AAV2-5 / rh .51, AAV27.3, AAV29.3 / bb.l, AAV29.5 / bb.2, AAV2G9, AAV-2-precursor miRNA-101, AAV 3, AAV3.1 / hu.6, AAV3.1 / hu.9, AAV3-11 / rh.53, AAV3-3, AAV33.12 / hu.l7, AAV33 .4 / hu.l5, AAV33.8 / hu.l6, AAV3-9 / rh.52, AAV3a, AAV3b, AAV4, AAV4-19 / rh.55, AAV42.12, AAV42-10, AAV42-11, AAV42-12, AAV42-13, AAV42-15, AAV42-1b, AAV4 2-2, AAV42-3a, AAV42-3b, AAV42-4, AAV42-5a, AAV42-5b, AAV42-6b, AAV42-8, AA V42-aa, AAV43-1, AAV43-12, AAV43-20, AAV43-21, AAV43-23, AAV43-25, AAV43-5 , AAV4-4, AAV44.1, AAV44.2, AAV44.5, AAV46.2 / hu.28, AAV46.6 / hu.29, AAV4-8 / r 11.64, AAV4-8 / rh.64, AAV4-9 / rh.54, AAV5, AAV52.1 / hu.20, AAV52 / hu.19、AAV5-22 / rh.58、AAV5-3 / rh.57、AAV54.1 / hu.21、AAV54.2 / hu.22、AAV54.4R / hu.27、AAV54.5 / hu.23、AAV54.7 / hu.24、AAV58.2 / hu.25、AAV6、AAV6.1、AAV6.1.2、AAV6.2、AAV7、AAV7.2、AAV7.3 / hu.7、AAV8、AAV-8b、AAV-8h、AAV9、AAV9.11、AAV9.13、AAV9.16、AAV9.24、AAV9.45、AAV9.47、AAV9.61、AAV9.68、AAV9.84、AAV9.9、AAV A3.3、AAV A3.4、AAV A3.5、AAV A3.7、AAV-b、AAVC1、AAVC2、AAVC5、AAVCh.5、AAVCh.5R1、AAVcy.2、AAVcy.3、AAVcy.4、AAVcy.5、AAVCy.5R l、AAVCy.5R2、AAVCy.5R3、AAVCy.5R4、AAVcy.6、AAV-DJ、AAV-DJ8、AAVF3、AAVF5、AAV-h、AAVH-1 / hu.l、AA VH2、AAVH-5 / hu.3、AAVH6、AAVhE1.1、AAVhER1.14、AAVhErl.16、AAVhErl.18、AAVhER1.23、AAVhErl.35、AAVhErl. AVhErl.36、AAVhErl.5、AAVhErl.7、AAVhErl.8、AAVhEr2.16、AAVhEr2.29、AAVhEr2.30、AAVhEr2.31、AAV hEr2.36、AAVhEr2.4、AAVhEr3.1、AAVhu.l、AAVhu.10、AAVhu.ll、AAVhu.l、AAVhu.12、AAVhu.13、AAVhu.1 4 / 9、AAVhu.15、AAVhu.16、AAVhu.17、AAVhu.18、AAVhu.19、AAVhu.2、AAVhu.20、AAVhu.21、AAVhu.22、AAV hu.23.2、AAVhu.24、AAVhu.25、AAVhu.27、AAVhu.28、AAVhu.29、AAVhu.29R、AAVhu.3、AAVhu.31、AAVhu.3 2、AAVhu.34、AAVhu.35、AAVhu.37、AAVhu.39、AAVhu.4、AAVhu.40、AAVhu.41、AAVhu.42、AAVhu.43、AAVhu.44、AAVhu.44Rl、AAVhu.44R2、AAVhu.44R3、AAVhu.45、AAVhu.46、AAVhu.47、AAVhu.48、AAVhu.48Rl、AAVhu.48R2、AAVhu.48R3、AAVhu.49、AAVhu.5、AAVhu.51、AAVhu.52、AAVhu.53、AAVhu.54、AAVhu.55、AAVhu.56、AAVhu.57、AAVhu.58、AAVhu.6、AAVhu.60、AAVhu.61、AAVhu.63、AAVhu.64、AAVhu.66、AAVhu.67、AAVhu.7、AAVhu.8、AAVhu.9、AAVhu.t 19、AAVLG-10 / rh.40、AAVLG-4 / rh.38、AAVLG-9 / hu.39、AAVLG- 9 / hu.39、AAV-LK01、AAV-LK02、AAVLK03、AAV-LK03、AAV-LK04、AAV-LK05、AAV-LK06、AAV-LK07、AAV-LK08、AAV-LK09、AAV-LK10、AAV-LK11、AAV- LK12、AAV-LK13、AAV-LK14、AAV-LK15、AAV-LK17、AAV-LK18、AAV-LK19、AAVN721-8 / rh.43、AAV-PAEC、AAV-PAEC11、AAV-PAEC12、AAV-PAEC2、AAV- PAEC4、AAV-PAEC6、AAV-PAEC7、AAV-PAEC8、AAVpi.l、AAVpi.2、AAVpi.3、AAVrh.10、AAVrh.12、AAVrh.13、AAVrh.l3R、AAVrh.14、AAVrh.17、AAVrh.18、AAVrh.19、AAVrh.2、AAVrh.20、AAVrh.21、AAVrh.22、AAVrh.23、AAVrh.24、AAVrh.25、AAVrh.2R、AAVrh.31、AAVrh.32、AAVrh.33、AAVrh.34、AAVrh.35、AAVrh.36、AAVrh.37、AAVrh.37R2、AAVrh.38、AAVrh.39、AAVrh.40、AAVrh.43、AAVrh.44、AAVrh.45、AAVrh.46、AAVrh.47、AAVrh.48、AAVrh.48、AAVrh.48.1、AAVrh.48.1.2、AAVrh.48.2、AAVrh.49、AAVrh.50, AAVrh.51, AAVrh.52, AAVrh.53, AAVrh.54, AAVrh.55, AAVrh.56, AAVrh.57, AAVrh.58, AAVrh.59, AAVrh.60, AAVrh.61, AAVrh.62, AAVrh.64, AAV rh.64Rl, AAVrh.64R2, AAVrh.65, AAVrh.67, AAVrh.68, AAVrh.69, AAVrh.70, AAVrh.72, AAVrh.73, AAVrh.74, AAVrh.8, AAVrh.8R, AAVrh8R, AAVrh8R A586R mutant, AAVrh8R R533A mutant, BAAV, BNP61 AAV, BNP62 AAV, BNP63 Including, but not limited to, AAV, bovine AAV, caprine AAV, Japan AAV 10, True Type AAV (ttAAV), UPENN AAV 10, AAV-LK16, AAAV, AAV Shuffle 100-1, AAV Shuffle 100-2, AAV Shuffle 100-3, AAV Shuffle 100-7, AAV Shuffle 10-2, AAV Shuffle 10-6, AAV Shuffle 10-8, AAV SM 100-10, AAV SM 100-3, AAV SM 10-1, AAV SM 10-2, and / or AAV SM 10-8.

[0216] In some embodiments, the AAV serotype may include mutations in the AAV9 sequence, e.g., sequences described by Pulicherla (Molecular Therapy 19(6):1070-1078, 2011), such as AAV9.9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84.

[0217] In some embodiments, the AAV serotype may include sequences described in US 6,156,303, such as AAV3B (SEQ ID NOs: 1 and 10 in US 6,156,303), AAV6 (SEQ ID NOs: 2, 7 and 11 in US 6,156,303), AAV2 (SEQ ID NOs: 3 and 8 in US 6,156,303), AAV3A (SEQ ID NOs: 4 and 9 in US 6,156,303), or derivatives thereof.

[0218] In some embodiments, the serotype may be AAV-DJ or a variant thereof, such as AAVDJ8 (or AAV-DJ8) described by Grimm et al. (Journal of Virology 82(12):5887-5911, 2008). The amino acid sequence of AAV-DJ8 may include two or more mutations to remove the heparin binding domain (HBD). As a non-limiting example, the AAV-DJ sequence described in US 7,588,772 as SEQ ID NO: 1 may include two mutations: (1) R587Q (Arg at amino acid 587 changed to glutamine Gln), and (2) R590T. As another non-limiting example, the AAV-DJ sequence may include three mutations: (1) K406R, (2) R587Q, and (3) R590T.

[0219] In some embodiments, the AAV serotype may comprise a sequence described in WO 2015 / 121501, such as true type AAV (ttAAV) (SEQ ID NO: 2 in WO 2015 / 121501), the so-called UPenn AAV10 (SEQ ID NO: 8 in WO 2015 / 121501), or the so-called Japan AAV10 (SEQ ID NO: 9 in WO 2015 / 121501), or a variant thereof.

[0220] AAV capsid serotypes may be selected or used from multiple species. In some embodiments, the AAV may be avian AAV (aAAV). The aAAV serotypes may include sequences described in US 9,238,800, such as aAAV (SEQ ID NOs: 1, 2, 4, 6, 8, 10, 12, and 14 in US 9,238,800), or variants thereof.

[0221] In some embodiments, the AAV may be bovine AAV (bAAV). The bAAV serotype may include sequences described in US 9,193,769, such as bAAV (SEQ ID NOs: 1 and 6 in US 9,193,769), or variants thereof. The bAAV serotype may include sequences described in US 7,427,396, such as bAAV (SEQ ID NOs: 5 and 6 in US 7,427,396), or variants thereof.

[0222] In some embodiments, the AAV may be a caprine AAV. Caprine AAV serotypes may include sequences described in US 7,427,396, such as caprine AAV (SEQ ID NO: 3 in US 7,427,396), or variants thereof.

[0223] In some embodiments, an AAV may be engineered into a hybrid AAV from two or more parental serotypes.

[0224] In some embodiments, the AAV may be AAV2G9, which includes sequences from AAV2 and AAV9. The AAV2G9 AAV serotype may include sequences described in US 2016-0017005 A1. (Incorporated herein by reference).

[0225] In some embodiments, the AAV may be a serotype generated from an AAV9 capsid library, which has mutations at amino acids 390-627 (VP1 numbering) as described by Pulicherla et al. (Molecular Therapy 19(6):1070-1078, 2011, incorporated herein by reference). The serotypes and corresponding nucleotide and amino acid substitutions are AAV9.1 (G1594C, D532H), AAV6.2 (T1418A and T1436X, V473D and I479K), AAV9.3 (T1238A, F413Y), AAV9.4 (T1250C and A1617T, F417S), AAV9.5 (A1235G, A1314T, A1642G, C1760T, Q412R, T548A, A587V), AAV9.6 (T1231A, F411I), AAV9.9(G1203A, G1785T, W595C), AAV9.10(A1500G, T1676C, M559T), AAV9.11(A1425T, A1702C, A17 69T, T568P, Q590L), AAV9.13 (A1369C, A1720T, N457H, T574S), AAV9.14 (T1340A, T1362C, T1560C, G1713A, L447H), AA V9.16 (A1775T, Q592L), AAV9.24 (T1507C, T1521G, W503R), AAV9.26 (A1337G, A1769C, Y446C, Q590P), AAV9.33 (A166 7C, D556A), AAV9.34(A1534G, C1794T, N512D), AAV9.35(A1289T, T1450A, C1494T, A1515T, C1794A, G1816A, Q430L, Y4 84N, N98K, V606I), AAV9.40(A1694T, E565V), AAV9.41(A1348T, T1362C, T450S), AAV9.44(A1684C, A1701T, A1737G, N 562H, K567N), AAV9.45(A1492T, C1804T, N498Y, L602F), AAV9.46(G1441C, T1525C, T1549G, G481R, W509R, L517V), 9.47 (G1241A, G1358A, A1669G, C1745T, S414N, G453D, K557E, T582I), AAV9.48 (C1445T, A1736T, P482L, Q579L), AAV9.50(A1638T, C1683T, T1805A, Q546H, L602H), AAV9.53(G1301A, A1405C, C1664T, G1811T, R134Q, S469R, A5 55V, G604V), AAV9.54(C1531A, T1609A, L511I, L537M), AAV9.55(T1605A, F535L), AAV9.58(C1475T, C1579A, T4 92I, H527N), AAV.59(T1336C, Y446H), AAV9.61(A1493T, N498I), AAV9.64(C1531A, A1617T, L511I), AAV9.65(C 1335T, T1530C, C1568A, A523D), AAV9.68(C1510A, P504T), AAV9.80(G1441A, G481R), AAV9.83(C1402A, A1500T , P468T, E500D), AAV9.87(T1464C, T1468C, S490P), AAV9.90(A1196T, Y399F), AAV9.91(T1316G, A1583T, C1782 The antibody may be, but is not limited to, AAV9.93 (A1273G, A1421G, A1638C, C1712T, G1732A, A1744T, A1832T, S425G, Q474R, Q546H, P571L, G578R, T582S, D611V), AAV9.94 (A1675T, M559L) and AAV9.95 (T1605A, F535L).

[0226] In some embodiments, the AAV comprises at least one AAV capsid CD8 + It may be a serotype that contains a T-cell epitope. By way of non-limiting example, the serotype may be AAV1, AAV2 or AAV 8.

[0227] In some embodiments, the AAV may be a mutant such as PHP.A or PHP.B as described in Deverman (Nature Biotechnology. 34(2):204-209, 2016, incorporated herein by reference).

[0228] In some embodiments, the AAV may be a serotype generated by Cre recombination-based AAV targeted evolution (CREATE) as described by Deverman et al. (Nature Biotechnology 34(2):204-209, 2016, incorporated herein by reference). In some embodiments, AAV serotypes generated in such a manner have improved CNS transduction and / or neuronal and astrocyte tropism relative to other AAV serotypes.

[0229] In some embodiments, the AAV serotype may be an AAV9 derivative with a seven amino acid insertion between amino acids 588 and 589. Non-limiting examples of these seven amino acid insertions include PHP.A, PHP.B, PHP.B2, PHP.B3, PHP.N, PHP.S, G2A12, G2A15, G2A3, G2B4, and G2B5.

[0230] In some embodiments, the AAV may be any serotype in Table 2 selected from SEQ ID NOs: 4,734-5,302 and WO 2018 / 002719 A1, which are incorporated herein by reference. In some embodiments, the AAV may be encoded by a sequence, fragment or variant set forth in SEQ ID NOs: 4,734-5,302 of WO 2018 / 002719 A1, which are incorporated herein by reference.

[0231] In some embodiments, the AAV VP1 capsid sequence is one of AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-DJ, AAV PHP.eB, Anc80L65, Anc80L65AAP, or 7m8.

[0232] Provided below are the protein sequences of the representative VP1 capsids.

[0233] [ka] [ka] [ka] [ka] [ka] [ka] [ka]

[0234] 3. Modified AAV ITRs According to the disclosure herein, any transcribed AAV ITR sequence (RNA) can be modified, for example, by engineering a modified AAV ITR coding DNA template to remove or inactivate the TRS or equivalent and / or remove the D region sequence thereof, and the transcribed modified AAV ITR obtained by transcribing such a modified AAV ITR DNA template retained the ability to promote packaging of the RNA sequence of the invention into AAV viral particles.

[0235] During AAV DNA replication, the ITRs are incised at terminal release sites (TRSs) by the virally encoded Rep protein. This initiation function requires three DNA sequence elements: the Rep binding element (RBE), a small palindromic sequence containing a single tip of an internal hairpin within the terminal repeat (RBE'), and the TRS. During TRS incision formation, Rep is tethered on the RBE (DNA) in a specific orientation. This orientation appears to align Rep on the AAV ITRs, allowing specific nucleotides to contact the RBE', and direct incision relative to the TRS. Changes in the polarity or position of the RBE relative to the TRS greatly inhibited Rep incision formation. Substitutions within the RBE' also reduced Rep specific activity, but to a lesser extent. During TRS incision formation, the interactions of Rep with the RBE and RBE' are functionally distinct, as contacts between Rep and the RBE are required for both DNA helicase activity and TRS cleavage. Together, the interaction of Rep with RBE' is required primarily for ITR unwinding and formation of the TRS stem-loop structure, rather than for TRS cleavage.

[0236] At least one transcribed modified ITR sequence (RNA) of the invention is present on the RNA sequence of the invention. The transcribed modified ITR sequence of the invention is preferably closer to the 3' end of the RNA sequence of the invention.

[0237] In some embodiments, an RNA sequence of the invention comprises two transcribed modified ITR sequences.

[0238] In some embodiments, the two transcribed modified ITR sequences may be from the same AAV serotype.

[0239] In another embodiment, the two transcribed modified ITR sequences may be derived from two different AAVs of different serotypes.

[0240] In some embodiments, one or more of the transcribed modified ITR sequences contain insertions, deletions, and / or mutations.

[0241] In some embodiments, an rRAAV RNA sequence of the invention comprises one transcribed modified / mutated ITR sequence and one transcribed wild-type ITR sequence.

[0242] In some embodiments, one or more of the transcribed modified ITR sequences are based on the wild-type ITRs in a flip or flop orientation.

[0243] Based on wild-type ITR sequences known in the art, the transcribed modified test ITR sequences or their coding DNA sequences can be easily prepared.

[0244] Representative (non-limiting) wild-type ITR sequences (DNA) include at least the following sequences listed in Table 1. Figures 1B and 1C show multiple sequence alignments of the 5' and 3' ITR sequences of AAV1-AAV7, respectively, including consensus sequences, TRS, RBE, and D region sequences.

[0245] [Table 1-1]

[0246] [Table 1-2]

[0247] As used herein, "RBE sequence" or "RBE" refers to an AAV ITR sequence in the A:A' palindromic stem sequence, which when base paired forms a stem (usually a double-stranded region that is about 21-23 or about 22 bp) and promotes binding of the ITR to the AAV Rep proteins (Rep78 and Rep68). In Figure 1A, a representative RBE sequence is shown in both the flip and flop structures of the wild-type AAV2 ITR.

[0248] Wild-type ITR sequences for many AAV serotypes known in the art are readily available and can be aligned with any other AAV ITR, as shown in Figures 1B and 1C, and the resulting alignments can be used to identify the RBE sequence of any AAV ITR.

[0249] "Transcribed (functional) RBE" refers to a transcribed RNA corresponding to an RBE DNA template, which may be a wild-type RBE or a functional variant thereof having one or more nucleotide insertions, deletions, substitutions, and / or other mutations, where the functional variant RBE substantially retains the ability to bind Rep (e.g., retains at least about 60%, 70%, 80%, 90%, 95% or enhanced binding to Rep of the same serotype). In some embodiments, the RBE DNA template or transcribed RBE RNA differs from the wild-type sequence by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotides. In some embodiments, a functional RBE contains up to about 30%, 25%, 20%, 15%, 10%, or 5% sequence variation compared to a wild-type RBE, e.g., due to one or more nucleotide insertions, deletions, substitutions, and / or other mutations in the RBE.

[0250] In some embodiments, the nucleotide sequence difference does not result in the loss of a paired base pair (e.g., a GC pair in a wild-type RBE may change to CG, AT / AU, or TA / UA in a mutant RBE, but without the loss of the original paired base pair).

[0251] In some embodiments, the transcribed modified ITR sequence (RNA) retains a transcribed Rep-binding element (transcribed RBE) or a functional variant thereof to facilitate Rep-mediated packaging. For example, the RBE DNA sequence of the wild-type AAV2 ITR is SEQ ID NO:5.

[0252] In some embodiments, the transcribed modified ITR sequence (RNA) further retains the transcribed Rep-binding element (transcribed RBE') sequence. For example, in Figure 1A, the CTTTG DNA sequence that forms a hairpin or loop structure in the B:B' fragment of the Flip ITR is the RBE' sequence.

[0253] In some embodiments, the transcribed modified ITR sequences lack a transcribed TRS and / or a transcribed rcTRS, or both.

[0254] In some embodiments, the RNA sequences of the invention lack a transcribed (functional) TRS sequence because the corresponding DNA sequence lacks some sequence elements of the wild-type TRS, thereby resulting in loss of wild-type TRS function in the DNA (e.g., the sequence or internal strand normally occupied by the wild-type TRS sequence between the A:A' fragment and the D region sequence is normally recognized and cleaved by an endonuclease during AAV replication, but is not cleaved if present in the ssDNA vector genome at the AAV ITRs).

[0255] For example, in some embodiments, the reverse complementary sequence of the TRS may be deleted or mutated, for example, in the dITR and dITR-D sequences used in the Examples.

[0256] Alternatively or additionally, the TRS, which is normally between the A:A' fragment and the D region sequence, may be missing one or more nucleotides or have one or more nucleotide substitutions or mutations (e.g., four nucleotides are missing or substituted / mutated in the dITR sequence used in the examples).

[0257] In some embodiments, all or almost all of the TRS / rcTRS in the wild-type sequence is deleted, such that the resulting RNA transcript lacks a functional TRS sequence.

[0258] In some embodiments, a portion of the wild-type TRS / rcTRS sequence is modified / mutated, for example, by having insertions, deletions, substitutions, and / or other mutations in the wild-type sequence, such that the mutated TRS / rcTRS produces a corresponding RNA transcript that lacks a transcribed functional TRS. For example, in some embodiments, 1, 2, 3, 4, or 5 consecutive or non-consecutive TRS and / or rcTRS nucleotides may be deleted or substituted in the mutated sequence.

[0259] In some embodiments, the transcribed modified ITR sequence is transcribed from a modified ITR that lacks a D region sequence or at least lacks a functional D region sequence (D or D' sequence, depending on the flip or flop structure). For example, in some embodiments, the entire D region sequence is deleted, such that the resulting RNA transcript lacks a functional transcribed D region sequence. In other embodiments, at least a portion of the D region sequence is mutated (e.g., has deletions, insertions, substitutions, and / or other mutations), such that the resulting RNA transcript lacks a functional transcribed D region sequence. In some embodiments, the mutated D region sequence has no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide of the wild-type sequence.

[0260] In some embodiments, the modified ITR sequence (DNA template) lacks the 5'-most 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides of the wild-type ITR sequence. For example, both the dITR sequence (SEQ ID NO:2) and the dITR-D sequence (SEQ ID NO:3) lack the 5'-most 8 nucleotides compared to the wild-type ITR sequence (SEQ ID NO:1).

[0261] Corresponding DNA sequences encoding any one of the above transcribed RNA coding sequences (DNA coding sequences of the GOI), transcribed modified AAV ITRs (modified AAV ITRs), transcribed functional RBEs (functional RBEs), transcribed functional D region sequences (functional D region sequences) and transcribed functional TRS sequences (functional TRS sequences) are expressly contemplated within the scope of the present invention.

[0262] 4. Introns, exons, UTRs, enhancers, and other elements The RNA sequence of the present invention that is encapsidated into the rRAAV viral particle of the present invention may further comprise additional optional sequence elements (e.g., expression control elements) that can enhance or regulate GOI expression.

[0263] The expression control elements present in the RNA sequences of the present invention include, for example, splicing signals of introns and maintenance of the correct reading frame of the gene to facilitate proper heterologous polynucleotide (e.g., GOI) transcription and / or translation, allowing in-frame translation of mRNA and termination codons, etc.

[0264] Typically, expression control elements (some present in the RNA sequence of the invention, others present on the DNA encoding the RNA sequence of the invention) are promoters and enhancers that affect expression of one or more nucleic acid sequences, e.g., heterologous polynucleotides (e.g., GOIs) to which they are operably linked. These elements typically function in cis, but may also function in trans. Expression control may occur at the levels of transcription, translation, splicing, information stability, etc. Typically, expression control elements that regulate transcription are juxtaposed near the 5' end (i.e., "upstream") of the transcribed polynucleotide. Expression control elements may also be located at the 3' end (i.e., "downstream") of the transcribed sequence or within the transcript (e.g., in an intron). Expression control elements may be located away from the transcribed gene sequence of interest (e.g., 100-500, 500-1000, 2,000-5,000 or more nucleotides away from the gene polynucleotide of interest). However, due to polynucleotide length limitations of viral vectors (e.g., AAV vectors), these expression control elements are typically within 1-1,000, 1-500, 1-250, or 1-100 nucleotides away from the transcribed gene sequence of interest.

[0265] Some non-limiting expression control elements that may be present on the RNA sequences of the invention or on the DNA encoding the RNA sequences of the invention are described in more detail below.

[0266] Introns Introns are known to carry post-transcriptional regulatory elements, efficiently directing the transport of mRNA from the cell nucleus and enhancing mRNA stability.

[0267] In some embodiments, the rRAAV may include one or more introns or fragments thereof. In some embodiments, the one or more introns are fragments of a gene of interest. In some embodiments, the one or more introns are heterologous to the gene of interest.

[0268] Introns have been reported to affect gene expression levels. Such an effect is called intron-mediated enhancement (IME) of gene expression (Lu et al., Mol Genet Genomics 279:563-572, 2008). In some embodiments, the gene expression level is increased by about 1.5-fold, about 2-fold, about 2.5-fold, about 3-fold, about 3.5-fold, about 4-fold, about 4.5-fold, about 5-fold, about 5.5-fold, about 6-fold, about 6.5-fold, about 7-fold, about 7.5-fold, about 8-fold, about 8.5-fold, about 9-fold, about 9.5-fold, or about 10-fold, compared to gene expression from a sequence without one or more introns.

[0269] Non-limiting introns include the SV40 intron, the beta globin intron, and the shoot chimeric intron (CIB). Other introns include the ColE2-RNA-OUT, OIPR, and R6K-RNA-OUT introns described in Lu et al., Hum Gene Ther. 2017;28(1):125-134 (incorporated by reference), and the human hemoglobin subunit beta (HBB2) synthesis intron (Snyder et al., Hum Gene Ther. 8 (1997), pp. 1891-1900, incorporated by reference).

[0270] In some embodiments, one or more introns may be fewer than 25 nucleotides, fewer than 50 nucleotides, fewer than 100 nucleotides, fewer than 150 nucleotides, fewer than 200 nucleotides, fewer than 250 nucleotides, fewer than 300 nucleotides, fewer than 350 nucleotides, fewer than 400 nucleotides, fewer than 450 nucleotides, or fewer than 500 nucleotides.

[0271] In some embodiments, one or more introns may be more than 25 nucleotides, more than 50 nucleotides, more than 100 nucleotides, more than 150 nucleotides, more than 200 nucleotides, more than 250 nucleotides, more than 300 nucleotides, more than 350 nucleotides, more than 400 nucleotides, more than 450 nucleotides, or more than 500 nucleotides.

[0272] In some embodiments, the one or more introns may be about 50 to about 100 nucleotides, about 50 to about 200 nucleotides, about 50 to about 300 nucleotides, about 50 to about 400 nucleotides, about 50 to about 500 nucleotides, about 100 to about 200 nucleotides, about 100 to about 300 nucleotides, about 100 to about 400 nucleotides, about 100 to about 500 nucleotides, about 200 to about 300 nucleotides, about 200 to about 400 nucleotides, about 200 to about 500 nucleotides, about 300 to about 400 nucleotides, about 300 to about 500 nucleotides, or about 400 to about 500 nucleotides.

[0273] Enhancer As used herein, the term "enhancer" can refer to a sequence located near a gene of interest. Enhancer elements are typically located upstream of a promoter element in the DNA encoding the RNA sequence of the present invention, but may also be located downstream or within an intron sequence (e.g., a gene of interest) and retain function. Thus, an enhancer or a portion thereof may be present in the transcribed RNA sequence of the present invention.

[0274] Non-limiting examples of suitable enhancers include the CMV enhancer.

[0275] In some embodiments, an enhancer element may be located 100 base pairs, 200 base pairs, or 300 or more base pairs upstream or downstream of a gene of interest (e.g., in an RNA sequence of the invention or its DNA coding sequence). Enhancer elements typically increase expression of a gene of interest up to the increased expression provided by a promoter element.

[0276] Untranslated Regions (UTRs) As used herein, "untranslated region" ("UTR") refers to the untranslated RNA after transcription. For example, the 5' UTR is located upstream of the gene of interest start codon, and the 3' UTR is located downstream of the gene of interest stop codon. In some embodiments, the 5' and / or 3' UTR may have insertions, deletions, or modifications to enhance the stability of the transcribed gene of interest. For example, the 5' UTR may contain translation initiation sequences such as, but not limited to, Kozak sequences and internal ribosome entry sites (IRES). Kozak sequences have the consensus CCR(A / G)CCAUGG, where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), followed by another 'G'.

[0277] 3′ UTRs are known to contain embedded segments of adenosines and uridines. These AU-rich features are especially prevalent in genes with high turnover. Based on their sequence features and functional properties, AU-rich elements (AREs) may be divided into three types (Chen et al., 1995): Class I AREs contain several dispersed copies of the AUUUA motif within the U-rich region. C-Myc and MyoD contain class I AREs. Class II AREs have two or more overlapping UUAUUUA(U / A)(U / A) nonamers. Molecules containing such AREs include GM-CSF and TNF-a. Class III AREs are less clearly defined. These U-rich regions do not contain the AUUUA motif. c-Jun and myoglobin are two of the well-studied examples among them. Although the majority of proteins that bind to AREs are known to disrupt messenger stability, it has been described that members of the ELAV family, especially HuR, can enhance mRNA stability. HuR binds to all three classes of AREs. Engineering a HuR-specific binding site into the 3' UTR of a nucleic acid molecule stabilizes the messenger in vivo by inducing HuR binding. Any one of these 5' and / or 3' UTR sequences can be present in the RNA sequences of the invention.

[0278] In some embodiments, the 5' UTR and / or 3' UTR may comprise sequences that are heterologous to the gene of interest. In some embodiments, the 5' UTR and / or 3' UTR are native to the gene of interest.

[0279] In some embodiments, 5' UTRs and / or 3' UTRs from mRNAs normally expressed in specific tissues or organs, such as lung, liver, pancreas, endothelial cells, CNS, neurons, astrocytes, skeletal muscle, cardiac muscle, smooth muscle, blood, hematopoietic cells, may be used in the RNA sequences of the invention, which contain a GOI that targets one or more of these tissues.

[0280] Polyadenylation sequence In some embodiments, an RNA sequence of the invention comprises a transcribed modified AAV ITR, which is 5' to a polyA sequence, a polyA signal sequence (e.g., AAUAAA), or an RNA transcription termination sequence (e.g., a histone downstream element).

[0281] The terms "polyA sequence," "polyA tail," "polyA signal sequence," and "sequence for RNA transcription termination" have been defined above.

[0282] In some embodiments, the RNA sequences of the invention include a polyA tail. Such RNA sequences may be packaged into rRAAV viral particles of the invention and delivered directly to target cells, and the GOI encoded by the RNA sequences of the invention may be directly translated.

[0283] In some embodiments, the RNA sequence of the present invention comprises a polyA signal sequence and a transcribed GU-rich region downstream of any polyA site. Such an RNA sequence may be packaged into the rRAAV viral particle of the present invention and delivered directly to a target cell. Once in the target cell, the polyA signal sequence may be recognized and further processed by the cytoplasmic polyA-adding enzyme to produce a polyA tail, and translate the GOI encoded by the RNA sequence of the present invention.

[0284] Representative polyA signal sequences and surrounding sequences include the human growth hormone (hGH) polyA sequence (see Liu et al., Gene Ther 20:308-317, 2013, incorporated by reference), the bovine growth hormone polyadenylation signal (bGHpA) (Goodwin and Rottman, J Biol Chem. 1992 Aug. 15;267(23):16330-4, incorporated by reference), the SV40 early or late polyadenylation signals, and the synthetic polyA signal used by Choi et al. (Mol Brain. 2014;7:17, incorporated by reference herein).

[0285] Transcriptional enhancers As used herein, a "transcriptional enhancer" refers to a cis-acting nucleotide sequence that can increase the transcription of a gene of interest. In some embodiments, a transcriptional enhancer may be located in an intron or partially in an exon region of a transcribed RAAV RNA sequence of the present invention.

[0286] WPRE In some embodiments, an RNA sequence of the invention comprises a transcribed WPRE sequence that is encoded by a WPRE sequence in the coding DNA.

[0287] The Woodchuck Hepatitis Virus (WHP) post-transcriptional regulatory element (WPRE) is a DNA sequence of approximately 600 bp which, upon transcription, produces a tertiary structure that enhances expression.

[0288] WPRE is often used in molecular biology to increase the expression of genes delivered by viral vectors. It is a tripartite regulatory element with gamma, alpha and beta components. The alpha component is 80 bp in length: GCCACGGCGGAACTCATCGCCGCTGCCTGCCTGCAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGT (SEQ ID NO: 39). When used alone, the activity of the alpha component is only 9% of that of the complete tripartite WPRE sequence, which has 100% identity to base pairs 1093-1684 of the woodchuck hepatitis B virus (WHV8) genome.

[0289] In some embodiments, the transcribed WPRE sequence or a portion thereof (e.g., gamma, alpha and beta elements, preferably in a given order) is present in the 3' UTR region of the GOI in a test RNA sequence encapsidated in an rRAAV viral particle of the present invention, thereby significantly improving the stability and protein yield of the RNA sequence of the present invention.

[0290] In some embodiments, the WPRE sequence is a shoot WPRE (WPRE2) that contains a minimal gamma element and some alpha-beta elements (see Kalev-Zylinska, J Neurosci. 2007, 27:10456-10467, incorporated by reference).

[0291] In some embodiments, the WPRE sequence is a shoot WPRE (WPRE3) that contains minimal gamma and alpha elements (see Choi et al., Mol Brain 7, 17 (2014), incorporated by reference).

[0292] In some embodiments, an RNA sequence of the invention comprises a WPRE sequence and a GOI that lacks an intron.

[0293] promoter As used herein, the term "promoter" is defined as a DNA sequence recognized by the cellular synthetic machinery, or introduced synthetic machinery, necessary to initiate the specific transcription of a polynucleotide sequence.

[0294] Thus, the RNA sequences of the invention do not comprise a promoter. In another embodiment, the DNA encoding the RNA sequence of the invention (e.g., an expression cassette or expression vector encoding the RNA sequence of the invention) comprises a promoter for transcribing the RNA sequence of the invention.

[0295] As used herein, the term "promoter / regulatory sequence" refers to a nucleic acid sequence necessary to express a gene product operably linked to the promoter / regulatory sequence. In some cases, such a sequence may be a core promoter sequence. In other cases, such a sequence may further include an enhancer sequence and other regulatory elements necessary to express the gene product. The promoter / regulatory sequence may be, for example, a promoter / regulatory sequence that expresses a gene product (e.g., an RNA sequence of the present invention) in a tissue or cell type specific manner.

[0296] As used herein, the term "operably linked" or "operably linked" refers to the physical or functional juxtaposition of the components thus described, allowing them to function in the manner intended. In the example of an expression control element operably linked to a heterologous polynucleotide, such a relationship allows the control element to regulate the expression of the heterologous polynucleotide. More specifically, for example, two DNA sequences that are operably linked refer to two DNAs arranged in such a relationship (in cis or trans) such that at least one of the DNA sequences can act physiologically on the other sequence.

[0297] In some embodiments, the promoter is a constitutive promoter.

[0298] As used herein, a "constitutive" promoter refers to a nucleotide sequence that, when operably linked to a polynucleotide that encodes or specifies a gene product, causes the production of the gene product in a cell under most or all physiological conditions of the cell.

[0299] In some embodiments, promoters that may be used to constitutively drive expression from DNA encoding an RNA sequence of the invention may include the β-glucuronidase (GUSB) promoter, the cytomegalovirus (CMV) immediate-early (Ie) enhancer and / or promoter, the chicken β-actin (CBA) promoter or derivatives thereof, such as the CAG promoter, the CB promoter, the (human) elongation factor 1 α-subunit (EF1α) promoter, and the ubiquitin C (UBC) promoter.

[0300] In some embodiments, the promoter is an inducible promoter.

[0301] As used herein, an "inducible" promoter refers to a nucleotide sequence that, when operably linked to a polynucleotide encoding or specifying a gene product, causes production of the gene product in a cell substantially only when an inducer corresponding to the promoter is present in the cell.

[0302] In some embodiments, the promoter is a tissue-specific promoter, a species-specific promoter, or a cell cycle-specific promoter. See Parr et al., Nat. Med. 3:1145-9, 1997, the entire contents of which are incorporated herein by reference.

[0303] As used herein, a "tissue or cell type specific" promoter is a nucleotide sequence which, when operably linked to an encoded or genetically specified polynucleotide, causes production of a gene product in a particular cell type or in a particular cell, preferably because, e.g., the cell / tissue is the cell type or tissue type in which the promoter is normally active.

[0304] Tissue or cell type specific promoters may include neuronal tissue specific promoters, CNS- or PNS-specific promoters such as astrocyte, oligodendrocyte, or neuronal promoters, hematopoietic specific promoters such as B cell promoters, T cell promoters, NK cell promoters, monocyte promoters, leukocyte promoters, macrophage promoters, endothelial cell promoters, pancreatic promoters, liver / hepatic cell promoters, lung tissue promoters, etc.

[0305] Representative tissue-specific promoters include prion promoter, neuron-specific enolase (NSE), neurofilament light chain (NFL) promoter, neurofilament heavy chain (NFH) promoter, platelet-derived growth factor (PDGF), platelet-derived growth factor B chain (PDGF-β), synapsin (Syn), synapsin 1 (Syn1), methyl-CpG binding protein 2 (MeCP2), Ca2+ / calmodulin-dependent protein kinase II (CaMKII), metabotropic glutamate receptor 2 (mGluR2), neurofilament light chain (NFL) or neurofilament heavy chain (NFH), β-globin minigene nβ2, preproenkephalin (PPE), enkephalin (Enk), and excitatory amino acid transporter 2 (EAAT2) promoter.

[0306] Astrocyte-specific promoters include the glial fibrillary acidic protein (GFAP) and EAAT2 promoters.

[0307] Oligodendrocyte-specific promoters include the myelin basic protein (MBP) promoter.

[0308] In some embodiments, the promoter is heterologous to the gene of interest. In some embodiments, the promoter is the native promoter of the gene of interest. In some embodiments, the heterologous promoter contains insertions, deletions, substitutions, and / or other mutations. In some embodiments, the native promoter contains insertions, deletions, substitutions, and / or other mutations.

[0309] In some embodiments, the promoter is a Pol II promoter. In some embodiments, the promoter is a Pol III promoter, such as the U6 promoter.

[0310] 5. Vector (plasmid or bacmid) As used herein, a "vector" refers to a composition of matter that usually contains an isolated nucleic acid (DNA or RNA) and can be used to deliver the isolated nucleic acid inside a cell.

[0311] The term "expression vector" refers to a vector containing a recombinant polynucleotide, which contains an expression control sequence operably linked to the nucleotide sequence to be expressed. An expression vector contains sufficient cis-acting elements for expression; other elements used for expression may be provided by the host cell or in an in vitro expression system. Expression vectors include all expression vectors known in the art, such as cosmids, plasmids, bacmids (e.g., exposed or contained in liposomes) and viruses (e.g., lentiviruses, reverse transcription viruses, adenoviruses and adeno-associated viruses) incorporating the recombinant polynucleotide.

[0312] The rRAAV RNA sequence of the present invention containing a GOI is a vector for delivery of said GOI to a target / host cell by an rRAAV viral particle that encapsulates the vector.

[0313] In some embodiments, the rRAAV RNA sequences of the invention are encoded by a DNA expression vector, such as a plasmid or bacmid (e.g., a vector that can be maintained or replicated, such as a baculovirus in an insect cell). Such a DNA expression vector is capable of transcribing the RNA sequences of the invention in a suitable host cell, such as a mammalian packaging cell (e.g., HEK293T cell) or an insect packaging cell (e.g., Sf9 cell), thereby producing a subject rRAAV viral particle in the presence of other elements required for rRAAV packaging (e.g., rep and cap coding sequences).

[0314] Many vectors are known in the art, including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term "vector" includes self-replicating plasmids or viruses. The term should be construed to include non-plasmid and non-viral compounds that facilitate the transfer of nucleic acid to cells, such as polylysine compounds, liposomes, etc. Examples of viral vectors include, but are not limited to, adenoviral vectors, adeno-associated viral vectors, reverse transcription viral vectors, etc.

[0315] In some embodiments, the RAAV is transcribed from a plasmid or bacmid. The plasmid or bacmid may contain a gene sequence of interest. In some embodiments, a promoter is operably linked to the gene of interest and is located upstream of the gene of interest. In some embodiments, the promoter is not present in the transcribed RAAV.

[0316] 6. AAV Particles and Populations of AAV Particles In some embodiments, the present invention provides an isolated rRAAV viral particle, the viral particle comprising any one of the RNA sequences of the present invention encapsidated within any one of the AAV capsids or viral particles described herein.

[0317] In some embodiments, the AAV capsid or viral particle is of a serotype or a combination of one or more serotypes described herein.

[0318] In the rRAAV vectors or RNA sequences of the present invention, the rRAAV genome (RNA) may be a single-stranded (ss) nucleic acid or a double-stranded (ds), self-complementary (sc) nucleic acid.

[0319] A related aspect of the invention provides a population of recombinant viral particles (e.g., rRAAV particles), the population comprising a plurality of recombinant viral particles (e.g., rRAAV particles) of the invention, wherein at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or more of the recombinant viral particles (e.g., rRAAV particles) in the population have an encapsidated RNA sequence of the invention.

[0320] In some embodiments, a population of rRAAV particles contains a plurality of rRAAV viral particles of the present invention, wherein about 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or more of the rRAAV particles in the population have an encapsidated RNA sequence of the present invention.

[0321] In some embodiments, the population of recombinant viral particles (e.g., rRAAV particles) is at least 1×10 4 Virus particles, at least 2 x 10 4 Virus particles, at least 5 x 10 4 Virus particles, at least 1 x 10 5 Virus particles, at least 2 x 10 5Virus particles, at least 5 x 10 5 Virus particles, at least 1 x 10 6 Virus particles, at least 2 x 10 6 Virus particles, at least 5 x 10 6 Virus particles, at least 1 x 10 7 Virus particles, at least 2 x 10 7 Virus particles, at least 5 x 10 7 Virus particles, at least 1 x 10 8 Virus particles, at least 2 x 10 8 Virus particles, at least 5 x 10 8 Virus particles, at least 1 x 10 9 Virus particles, at least 2 x 10 9 Virus particles, at least 5 x 10 9 Virus particles, at least 1 x 10 10 Virus particles, at least 2 x 10 10 Virus particles, at least 5 x 10 10 Virus particles, at least 1 x 10 11 Virus particles, at least 2 x 10 11 Virus particles, at least 5 x 10 11 Virus particles, at least 1 x 10 12 Virus particles, at least 2 x 10 12 Virus particles, at least 5 x 10 12 Virus particles, at least 1 x 10 13 Virus particles, at least 2 x 10 13 Virus particles, at least 5 x 10 13 Virus particles, at least 1 x 10 14 Virus particles, at least 2 x 10 14 Virus particles, at least 5 x 10 14 Virus particles, at least 1 x 10 15 Virus particles, at least 2 x 10 15 Virus particles, at least 5 x 10 15 Virus particles, at least 1 x 10 16Virus particles, at least 2 x 10 16 virus particles, or at least 5 x 10 16 It contains virus particles.

[0322] In some embodiments, at most 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 3%, 2%, 1%, 0.1%, 0.01% or less of a population of recombinant viral particles have non-RNA (e.g., DNA) encapsidated within the viral particles.

[0323] 7. Host Cells and AAV Production The general principles of rAAV production are known in the art, see the following reviews, e.g., Carter, Current Opinions in Biotechnology, 1533-539, 1992, and Muzyczka, Curr. Topics in Microbial, and Immunol 158:97-129, 1992, both of which are incorporated herein by reference. Various methods are described in the following publications: Ratschin et al. (Mol. Cell. Biol. 4:2072, 1984; Hermonat et al. (Proc. Natl. Acad. Sci. USA 81:6466, 1984); Tratschin et al. (Mol. Cell. Biol. 5:3251, 1985); McLaughlin et al. (J. Virol 62:1963, 1988); Lebkowski et al. (Mol. Cell. Biol. 7:349, 1988); Samulski et al. (J. Virol 63:3822-3828, 1989); US 5,173,414; WO 2004 / 023333; 95 / 13365 and US 5,658,776, WO 95 / 13392, WO 96 / 17947, PCT / US98 / 18600, WO 97 / 09441, WO 97 / 08298, WO 97 / 21825, WO 97 / 06243, WO 99 / 11764, Perrin et al. (Vaccine 13:1244-1250, 1995; Paul et al. (Human Gene Therapy 4:609-615, 1993); Clark et al. (Gene Therapy 3:1124-1132, 1996; US 5,786,211; US ​​5,871,982; and US 6,258,595.

[0324] The AAV vector serotype can be matched to the target cell type. For example, Table 2 of WO 2018002719 A1 lists exemplary cell types that can be transduced by specific AAV serotypes (herein incorporated by reference).

[0325] The packaging cells are for forming viral particles capable of infecting a host cell. Such cells include HEK293 and Sf9 cells, which are for packaging AAV and adenovirus.

[0326] Typically, viral vectors used in gene therapy are generated by packaging a nucleic acid vector in a producer cell line in a viral particle. The vector typically contains the minimal viral sequences required for packaging and subsequent integration into a host cell (if appropriate), with other viral sequences being replaced by expression cassettes that code for the proteins to be expressed. Missing viral functions can be provided in trans by the packaging cell line, typically as a result of these viral functions / proteins (e.g., the rep and cap genes of AAV) being expressed as transgenes integrated into the packaging cell or in a second viral or expression vector introduced into said packaging cell.

[0327] For example, AAV vectors used in gene therapy typically only have the inverted terminal repeat (ITR) sequences from the AAV genome, which are necessary for packaging and integration into the host genome. The viral DNA is packaged into a cell line, which contains a helper plasmid that encodes other AAV genes, namely rep and cap, but lacks ITR sequences. The cell line is also infected with adenovirus as a helper. The helper virus promotes AAV vector replication and AAV gene expression from the helper plasmid. The helper plasmid is not packaged in large quantities because it lacks ITR sequences. Adenovirus contamination can be reduced, for example, by heat treatment, to which adenovirus is more sensitive than AAV.

[0328] In some embodiments, recombinant AAV can be produced using a triple transfection method (described in detail in U.S. Pat. No. 6,001,650). Typically, recombinant AAV is produced by transfecting a host cell with a recombinant AAV vector (containing a gene of interest) to be packaged into an AAV particle, an AAV helper function vector, and an accessory function vector. The AAV helper function vector encodes "AAV helper function" sequences (e.g., rep and cap) that function in trans and are used for productive AAV replication and encapsidation. Preferably, the AAV helper function vector supports efficient AAV vector production but does not generate any detectable wild-type AAV virions (e.g., AAV virions containing functional rep and cap genes). The accessory function vector encodes nucleotide sequences used for non-AAV derived viral and / or cellular functions (e.g., "accessory functions") on which AAV depends to replicate. The accessory functions include functions necessary for AAV replication, including, but not limited to, moieties involved in activation of AAV gene transcription, stage-specific AAV mRNA splicing, AAV DNA replication, cap expression product synthesis, and AAV capsid assembly. Viral-based accessory functions may be derived from any one of the known helper viruses, such as adenovirus, herpesvirus (excluding herpes simplex virus-1), and cowpox virus.

[0329] In some embodiments, the test rRAAV is produced using a baculovirus expression system packaged in insect cells (e.g., Sf9 cells).See, e.g., WO 2007046703, WO 2007148971, WO 2009014445, WO 2009104964, WO 2013036118, WO 2011112089, WO 2016083560, WO 2015137802, and WO 2019016349, all of which are incorporated herein by reference.

[0330] Vector titers are usually expressed as viral genomes / ml (vg / ml). In some embodiments, the viral titer is greater than or equal to 1x10 9 Higher, 5x10 10 Higher, 1x10 11 Higher, 5x10 11 Higher, 1x10 12 Higher, 5x10 12 Higher or 1x10 13 Higher than vg / ml.

[0331] 8. Gene of interest (GOI) or RNA sequence of interest (RSI) The rRAAV viral particles of the present invention can be used to deliver any gene of interest (GOI) or RNA sequence of interest (RSI) to a host cell, where for any purpose the GOI may be an RNA that is within the packaging limits of the selected AAV viral capsid or AAV viral particle shell, e.g., for the majority of AAV viral particles, the total length is about 4,700 nucleotides, and for some larger capacity AAV viral particles (e.g., AAV5), the total length can reach about 8,900 nucleotides.

[0332] In some embodiments, representative (non-limiting) RNA sequences of interest (RSI) include, for example, protein-coding RNA, mRNA, non-coding RNA (ncRNA), tRNA, ribosomal RNA (rRNA), transfer-messenger RNA (tmRNA), antisense oligonucleotides (ASO), RNA aptamers, single guide RNA (or sgRNA, chimeric RNA, RNA chimeras), CRISPR RNA (crRNA), tracrRNA, ... RNA or RNA components of the CRISPR-Cas system such as the RISC complex or the RNA components of the RNAi pathway (e.g., shRNA, miRNA, or siRNA), regulatory RNA, Piwi-interacting RNA (piRNA), small nucleolar RNA (snoRNA), long non-coding RNA (lncRNA) (including intergenic lincRNA, intronic ncRNA, and sense / antisense lncRNA), long intervening / intergenic non-coding RNA (lincRNA), enhancer RNA, bacterial small RNA (sRNA), snRNA, exRNA, scaRNA, Xist, and HOTAIR and precursors thereof.

[0333] In some embodiments, an RNA sequence of the present invention comprises a coding sequence for a protein or polypeptide.

[0334] In some embodiments, the protein or polypeptide is a wild-type protein or a functional equivalent or mutant thereof (e.g., an enzyme or structural protein) that can be used to replace a defective protein in a target cell, tissue or organism.

[0335] In some embodiments, the protein or polypeptide is a wild-type protein or a functional equivalent or variant thereof (e.g., an enzyme or structural protein) that can be used to antagonize a compound (small molecule compound or large molecule such as lipids, fatty acids, proteins, nucleic acids) in a target cell, tissue or organism.

[0336] For example, in some embodiments, an RNA sequence of the invention comprises a coding sequence for an effector enzyme of the CRISPR / Cas system.

[0337] In some embodiments, the CRISPR-Cas system is a Class 1 system and the effector enzyme is a Type I, III, or IV effector enzyme.

[0338] In some embodiments, the CRISPR-Cas system is a class 2 system and the effector enzyme is a type II, V, or VI effector enzyme.

[0339] For example, in some embodiments, the effector enzyme is a class 2 type II enzyme, such as Cas9, including Streptococcus pyogenes (SpCas9) or SaCas9 (see WO 2014 / 093622 (PCT / US 2013 / 074667), incorporated by reference).

[0340] In some embodiments, the Cas effector enzyme is a class 2 V-type Cas protein, including Cas12a (formerly called Cpf1, e.g., Francisella novicida Cas12a), C2c1, and C2c3.

[0341] In some embodiments, the Cas effector enzyme is a class 2 type VI Cas protein, including Cas13a (also called C2c2), Cas13b, Cas13c, Cas13d, Cas13e, and Cas13f, which recognize target RNA sequences using their crRNA, but not target DNA sequences as in Cas9 and Cas12a.

[0342] In some embodiments, the Cas effector enzyme is any one of the Cas effector enzymes described in WO 2020 / 028555, the entire contents of which are incorporated herein by reference, including any one of Cas9, Cas12 (e.g., Cas12a, Cas12b, Cas12c, Cas12d, etc.), Cas13 (e.g., Cas13a, Cas13b (e.g., Cas13b-t1, Cas13b-t2, Cas13b-t3), Cas13c, Cas13d, etc.), Cas14, CasX, and CasY.

[0343] In some embodiments, the Cas effector enzyme is fused to a DNA and / or RNA base editor, such as a cytosine or adenine base editor (CBE or ABE). In some embodiments, the base editor preferably edits DNA bases, and optionally has reduced or substantially no off-target RNA base editing capabilities. In some embodiments, the base editor preferably edits RNA bases, and optionally has reduced or substantially no off-target DNA base editing capabilities. In some embodiments, the base editor edits both DNA and RNA bases.

[0344] In some embodiments, the base editor is a first, second (BE2), third (BE3) or fourth generation (BE4) base editor. In some embodiments, the base editor is a dual base editor.

[0345] In some embodiments, the base editor is an RNA adenosine deaminase (ADAR), such as ADAR1, ADAR2, or ADARDD, including ADAR2DD(E488Q).

[0346] In any of the above embodiments, the RNA sequence of the present invention may further comprise a guide RNA sequence, which is designed to be loaded into the encoded CRISPR / Cas effector enzyme to bind to the target polynucleotide sequence complementary to the guide RNA. After the rRAAV viral particle of the present invention delivers the RNA sequence of the present invention to the target host cell, such gRNA sequence can be processed by cellular nucleases and released / isolated from the RNA sequence of the present invention. For example, gRNA can be present in the unpaired 5' or 3' flanking region sequence of the primary miRNA hairpin structure as part of the RNA sequence of the present invention, and released / isolated from the initial primary miRNA transcript after the primary miRNA is processed by cellular enzymes such as Drosha.

[0347] In some embodiments, the RNA sequence of the invention comprises a coding sequence for an effector enzyme of a CRISPR / Cas system and further comprises a coding sequence for a DNA or RNA base editing enzyme or domain, such that a fusion of the Cas effector enzyme and the DNA / RNA base editing enzyme / domain is encoded by the RNA sequence. In some embodiments, the Cas effector enzyme is defective in nuclease activity, such that it can bind to a target polynucleotide sequence via a guide RNA bound to it, but is unable to cleave a DNA / RNA target polynucleotide.

[0348] In some embodiments, the RNA sequences of the invention comprise coding sequences for mutants or derivatives of CRISPR / Cas system effector enzymes, where the mutants comprise deletions (e.g., N- and / or C-terminal deletions, e.g., up to 210 residues deleted at the N-terminus of Cas13e or Cas13f and / or up to 180 residues deleted at the C-terminus), insertions or substitutions of a wild-type CRISPR / Cas system effector enzyme, but substantially retain the ability of the wild-type effector enzyme to bind to a gRNA and / or cleave a target polynucleotide. In some embodiments, the mutants lack the activity to cleave a target polynucleotide.

[0349] In some embodiments, the RNA base editing domain encoded by the RNA sequence of the invention is an adenosine deaminase, such as double-stranded RNA-specific adenosine deaminase (e.g., ADAR1 or ADAR2), apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like (APOBEC), or activation-induced cytidine deaminase (AID).

[0350] In some embodiments, the RNA base editing domain encoded by the RNA sequence of the invention comprises an adenosine deaminase and / or cytidine deaminase such as a cytidine deaminase acting on RNA (CDAR), a double-stranded RNA-specific adenosine deaminase (ADAR) (e.g., ADAR1 or ADAR2), an apolipoprotein B mRNA editing enzyme, a catalytic polypeptide-like (APOBEC such as APOBEC1, APOBEC2, APOBEC3A, APOBEC3B, APOBEC3C, APOBEC3D, APOBEC3E, APOBEC3F, APOBEC3G, APOBEC3H, and APOBEC4), activation-induced cytidine deaminase (AID), cytidine deaminase 1 (CDA1), or a mutant thereof.

[0351] In some embodiments, the ADAR has an E488Q / T375G double mutation or ADAR2DD.

[0352] In some embodiments, the base editing domain is further fused to an RNA binding domain, such as MS2.

[0353] In some embodiments, the encoded mutant or derivative CRISPR / Cas effector enzyme further comprises an RNA methyltransferase, an RNA demethylase, an RNA splicing modifier, a localization factor, or a translation modifier.

[0354] In some embodiments, the Cas effector enzyme, the variant / derivative or functional fragment thereof comprises a nuclear localization signal (NLS) sequence or a nuclear export signal (NES).

[0355] In some embodiments, the Cas effector enzyme, variant / derivative thereof, or functional fragment thereof is fused to a heterologous functional domain. In some embodiments, the heterologous functional domain is a nuclear localization signal (NLS), a reporter protein or detectable marker (e.g., GST, HRP, CAT, GFP, HcRed, DsRed, CFP, YFP, BFP), a localization signal, a protein targeting moiety, a DNA binding domain (e.g., MBP, Lex A DBD, Gal4 DBD), epitope tag (e.g., His, myc, V5, FLAG, HA, VSV-G, Trx, etc.), transcriptional activator domain (e.g., VP64 or VPR), transcriptional repressor domain (e.g., KRAB portion or SID portion), nuclease (e.g., FokI), deamination domain (e.g., ADAR1, ADAR2, APOBEC, AID or TAD), methylase, demethylase, transcription release factor, HDAC, polypeptide having ssRNA cleavage activity, polypeptide having dsRNA cleavage activity, polypeptide having ssDNA cleavage activity, polypeptide having dsDNA cleavage activity, DNA or RNA ligase, or any combination thereof. In some embodiments, the heterologous functional domain is fused at the N-terminus, C-terminus or internally of the fusion protein.

[0356] In some embodiments, the RNA sequence of the invention comprises a coding sequence for a CasPR (CRISPR associated protein used in processing class 1 precursor crRNA) fusion protein, said fusion protein comprising CasPR (or a homolog, ortholog, paralog, mutant, derivative or functional fragment thereof), or a functional variant thereof, fused to a heterologous functional domain.

[0357] In some embodiments, the CasPR is Cas5d, Cas6, or Csf5.

[0358] In some embodiments, the CasPR is MtCas6(IA) (sequence 1), MmCas6(IB) (sequence 2), SpCas5d(I-C1) (sequence 3), BhCas5d(I-C2) (sequence 4), SaCas6(ID) (sequence 5), EcCas6e(IE) (sequence 6), PaCas6f(IF) (sequence 7), MtCas6(III-A) (sequence 8), PfCas6(III-B) (sequence 9), PaCsf5(IV-A1) (sequence 10), or MtCsf5(IV-A2) (sequence 11). All sequences are incorporated herein by reference.

[0359] [Table 2]

[0360] [ka] [ka] [ka] [ka]

[0361] In some embodiments, the heterologous functional domain fused to CasPR is a nuclear localization signal (NLS), a reporter protein or detectable marker (e.g., GST, HRP, CAT, GFP, HcRed, DsRed, CFP, YFP, BFP), a localization signal, a protein targeting moiety, a DNA binding domain (e.g., MBP, Lex A DBD, Gal4 DBD), epitope tag (e.g., His, myc, V5, FLAG, HA, VSV-G, Trx, etc.), transcription activation domain (e.g., VP64 or VPR), transcription repression domain (e.g., KRAB portion or SID portion), nuclease (e.g., FokI), deamination domain (e.g., ADAR1, ADAR2, APOBEC, AID or TAD), methylase, demethylase, transcription release factor, HDAC, polypeptide having ssRNA cleavage activity, polypeptide having dsRNA cleavage activity, polypeptide having ssDNA cleavage activity, polypeptide having dsDNA cleavage activity, DNA or RNA ligase, or any combination thereof. In some embodiments, the heterologous functional domain comprises an RNA base editor. In some embodiments, the RNA base editor edits an A→G single base change. In some embodiments, the RNA base editor edits a C→U single base change. In some embodiments, the RNA base editor comprises ADAR2DD or a derivative thereof. In some embodiments, the ADAR2DD derivative comprises an E488Q / T375A double mutation.

[0362] In some embodiments, the fusion protein has an amino acid sequence of any one of sequences 45-55. [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka]

[0363] In some embodiments, the heterologous functional domain is fused at the N-terminus, C-terminus, or internally to the fusion protein.

[0364] In some embodiments, a functional variant of a CasPR fusion comprises a protein having the following amino acid sequence: (1) any one of sequences 1-11, except for 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid substitutions, additions, or deletions, wherein the protein maintains the ability of one of sequences 1-11 to bind to a direct repeat sequence of a class 1 I, III, or IV CRISPR system (e.g., any one of sequences 12-33); or (2) any one of sequences 12-33. having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any one of sequences 1-11, wherein the protein maintains the ability of one of the CasPRs of sequences 1-11 to bind to a direct repeat sequence of a Class 1I, III or Type IV CRISPR system (e.g., any one of sequences 12-33), optionally with the proviso that the protein is not any one of sequences 1-11. All sequences are incorporated herein by reference.

[0365] In some embodiments, the RNA sequence of the present invention further encodes a CasPR guide RNA comprising a guide sequence capable of hybridizing to a target RNA, and a direct repeat (DR) sequence 3' (or 5') of the guide sequence. In some embodiments, the DR sequence has a secondary structure substantially the same as the secondary structure of any one of SEQ ID NO:12-33. In some embodiments, the DR sequence is encoded by any one of SEQ ID NO:12-33 or a functional portion thereof that binds to a cognate wild-type CasPR. In some embodiments, the target RNA is encoded by eukaryotic DNA. In some embodiments, the eukaryotic DNA is non-human mammal DNA, non-human primate DNA, human DNA, plant DNA, insect DNA, avian DNA, reptile DNA, rodent DNA, fish DNA, worm / nematode DNA, yeast DNA. In some embodiments, the target RNA is mRNA.

[0366] In some embodiments, the CasPR guide sequence is between 15-120 nucleotides, between 20-100 nucleotides, between 25-80 nucleotides, between 15-55 nucleotides, between 25-35 nucleotides, or about 30 nucleotides.

[0367] In some embodiments, the CasPR guide sequence is 90%-100% complementary to the target RNA. In some embodiments, the CasPR guide RNA is produced by processing of a pre-crRNA transcript by CasPR, and wherein the precursor crRNA comprises two or more guide RNAs, the two or more guide RNAs having different guide sequences for different target RNAs.

[0368] In some embodiments, the CasPR fusion variant or derivative comprises a conservative amino acid substitution of one or more residues of any one of sequences 1-11, and optionally, the CasPR fusion variant or derivative comprises only conservative amino acid substitutions. In some embodiments, the CasPR fusion derivative is capable of binding to a CasPR guide sequence hybridized to the target RNA, but does not have RNA enzymatic catalytic activity due to a mutation in the RNA enzymatic catalytic site of the CasPR. In some embodiments, the CasPR fusion derivative has an N-terminal deletion of no more than 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 residues, and / or a C-terminal deletion of no more than 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 residues.

[0369] In some embodiments, the CasPR is Cas5d, Cas6, or Csf5, e.g., MtCas6(IA), MmCas6(IB), SpCas5d(I-C1), BhCas5d(I-C2), SaCas6(ID), EcCas6e(IE), PaCas6f(IF), MtCas6(III-A), PfCas6(III-B), PaCsf5(IV-A1), or MtCsf5(IV-A2).

[0370] In some embodiments, the heterologous functional domain of the CasPR fusion comprises an RNA base editing domain. In some embodiments, the RNA base editing domain comprises an adenosine deaminase and / or cytidine deaminase, such as a cytidine deaminase acting on RNA (CDAR), a double-stranded RNA-specific adenosine deaminase (ADAR) (e.g., ADAR1 or ADAR2), an apolipoprotein B mRNA editing enzyme, a catalytic polypeptide-like (APOBEC, e.g., APOBEC1, APOBEC2, APOBEC3A, APOBEC3B, APOBEC3C, APOBEC3D, APOBEC3E, APOBEC3F, APOBEC3G, APOBEC3H, and APOBEC4), an activation-induced cytidine deaminase (AID), a cytidine deaminase 1 (CDA1), or a mutant thereof. In some embodiments, the ADAR comprises an E488Q / T375G double mutation or comprises ADAR2DD. In some embodiments, the base editing domain is further fused to an RNA binding domain, such as MS2.

[0371] In some embodiments, the CasPR fusion derivative further comprises an RNA methyltransferase, an RNA demethylase, an RNA splicing modifier, a localization factor, or a translation modifier.

[0372] In some embodiments, the CasPR, homolog, ortholog, paralog, variant, derivative or functional fragment comprises a nuclear localization signal (NLS) sequence or a nuclear export signal (NES).

[0373] In some embodiments, targeting of the target RNA results in a modification to the target RNA. In some embodiments, the target RNA modification is cleavage of the target RNA. In some embodiments, the target RNA modification is deamination of adenosine (A) to inosine (I) and / or deamination of cytidine (C) to uracil (U).

[0374] In some embodiments, the RNA sequence of the invention encodes a codon-optimized polynucleotide, the polynucleotide encoding a wild-type CasPR (e.g., Cas5d, Cas6, or Csf5), a homolog thereof, an ortholog thereof, a paralog thereof, a variant or derivative thereof, or a functional fragment thereof, wherein the polynucleotide is codon-optimized for mammalian (e.g., human) expression, and optionally the wild-type CasPR has an amino acid sequence of any one of sequences 1-11. In some embodiments, the codon-optimized polynucleotide has an amino acid sequence of any one of sequences 34-44. In some embodiments, the codon-optimized polynucleotide further comprises a sequence encoding a heterologous functional domain. In some embodiments, the heterologous functional domain comprises an RNA base editor. [ka] [ka] [ka] [ka]

[0375] In some embodiments, an RNA sequence of the invention encodes a non-naturally occurring polynucleotide, the non-naturally occurring polynucleotide comprising a derivative of any one of sequences 12-33, the derivative (i) having one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleotide additions, deletions, substitutions, and / or other mutations compared to any one of sequences 12-33, and (ii) having at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 410%, 420%, 430%, 440%, 450%, 460%, 470%, 480%, 490%, 500%, 510%, 520%, 530%, 540%, 550%, 560%, 570%, 580%, 590%, 600%, 610%, 620%, 630%, 640%, 650%, 660%, 670%, 680%, 700%, 710%, 720%, 730%, 740%, 750%, 760%, 770%, 780%, 790%, 800%, (iii) hybridizes under stringent conditions to any one of sequences 12-33 or any one of (i) and (ii), or (iv) is a complementary sequence to any one of (i)-(iii), with the proviso that the derivative is not any one of sequences 12-33, and the derivative encodes an RNA (or RNAs) that maintain substantially the same secondary structure (e.g., stems, loops, bulges, single-stranded regions) as any one of the RNAs encoded by sequences 12-33. In some embodiments, the derivative functions as a DR sequence of any one of the CasPRs of the present invention, their orthologs, their paralogs, their variants, their derivatives, or their functional fragments.

[0376] In some embodiments, an RNA sequence of the invention comprises a coding sequence for an engineered clustered regularly interspaced short palindromic repeats (CRISPR)-Cas13 effector enzyme, wherein the engineered Cas13 (1) comprises a mutation in a region spatially proximal to the endonuclease catalytic domain of a corresponding wild-type Cas13 effector enzyme, (2) substantially retains the specific endonuclease cleavage activity of wild-type Cas13 against a guide sequence of a target RNA that is complementary to the guide sequence, and (3) substantially lacks the independent concomitant endonuclease cleavage activity of wild-type Cas13 against a guide sequence of a non-target RNA that does not bind to the guide sequence.

[0377] In some embodiments, Cas13 is Cas13a, Cas13b, Cas13c, Cas13d (including CasRx), Cas13e, or Cas13f.

[0378] In some embodiments, the Cas13e has the amino acid sequence of SEQ ID NO: 4 in PCT / CN2020 / 119559 (herein incorporated by reference).

[0379] In some embodiments, the region includes residues that are within 120, 110, 100, 90, or 80 amino acids away from any residue in the endonuclease catalytic domain (e.g., the RXXXXH domain) in the primary sequence of Cas13.

[0380] In some embodiments, the region includes residues that are more than 100, 110, 120, or 130 residues away from any residue of the endonuclease catalytic domain in the primary sequence of Cas13, but are spatially located within 1-10 or 5 angstroms of a residue of the endonuclease catalytic domain.

[0381] In some embodiments, the endonuclease catalytic domain is a HEPN domain, optionally comprising a HEPN domain of a RXXXXH motif. In some embodiments, the RXXXXH motif comprises a R{N / H / K}X1X2X3H sequence. In some embodiments, in the R{N / H / K}X1X2X3H sequence, X1 is R, S, D, E, Q, N, G, or Y, X2 is I, S, T, V, or L, and X3 is L, F, N, Y, V, I, S, D, E, or A. In some embodiments, the RXXXXH motif is an N-terminal RXXXXH motif, comprising a RNXXXH sequence, such as a RN{Y / F}{F / Y}SH sequence. In some embodiments, the N-terminal RXXXXH motif comprises a RNYFSH sequence. In some embodiments, the N-terminal RXXXXH motif comprises a RNFYSH sequence. In some embodiments, the RXXXXH motif is a C-terminal RXXXXH motif comprising the sequence R{N / A / R}{A / K / S / F}{A / L / F}{F / H / L}H. In some embodiments, the C-terminal RXXXXH motif has the sequence RN(A / K)ALH. In some embodiments, the C-terminal RXXXXH motif has the sequence RAFFHH or RRAFFH.

[0382] In some embodiments, the region comprises, consists essentially of, or consists of residues corresponding to residues 2-187, 227-242, or 634-755 of SEQ ID NO:4 of PCT / CN2020 / 119559 (incorporated by reference). In some embodiments, the region comprises, consists essentially of, or consists of residues corresponding to residues 35-51, 52-67, 156-171, 666-682, or 712-727 of SEQ ID NO:4 of PCT / CN2020 / 119559 (incorporated by reference).

[0383] In some embodiments, the mutation comprises, consists essentially of, or consists of the substitution of one or more charged or polar residues with a charged neutral short chain aliphatic residue (e.g., A) in a segment of 15-20 contiguous amino acids in said region. In some embodiments, said segment is about 16 or 17 residues. In some embodiments, substantially all charged and polar residues in said segment are substituted, except for up to 1, 2, or 3. In some embodiments, a total of about 7, 8, 9, or 10 charged and polar residues in said segment are substituted. In some embodiments, two residues at the N- and C-termini of said segment are substituted with amino acids whose coding sequence contains a restriction enzyme recognition sequence. In some embodiments, the two residues at the N-terminus are VF and the two residues at the C-terminus are ED, and the restriction enzyme is BpiI. In some embodiments, the one or more charged or polar residues include N, Q, R, K, H, D, E, Y, S, and T residues. In some embodiments, the one or more charged or polar residues comprise R, K, H, N, Y and / or Q residues. In some embodiments, one or more Y residues in the segment are substituted. In some embodiments, the one or more Y residues correspond to Y672, Y676 and / or Y751 of wild type Cas13e.1 (SEQ ID NO: 4 of PCT / CN2020 / 119559, which is incorporated by reference). In some embodiments, the segment is residues 35-51, 52-67, 156-171, 666-682 or 712-727 of SEQ ID NO: 4 in PCT / CN2020 / 119559, which is incorporated by reference. In some embodiments, the mutation comprises one or more Ala substitutions corresponding to any one or more of SEQ ID NOs: 37-39, 45, and 48 in PCT / CN2020 / 119559 (incorporated by reference). In some embodiments, the charged neutral short chain aliphatic residue is Ala (A).In some embodiments, the mutations comprise, consist essentially of, or consist of a substitution within a segment of 2, 3, 4, or 5 within said region having 15-20 contiguous amino acids:

[0384] In some embodiments, the engineered Cas13 retains at least about 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% of the guide sequence-specific endonuclease cleavage activity of wild-type Cas13 against the target RNA.

[0385] In some embodiments, the engineered Cas13 lacks at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the guide sequence-independent concomitant endonuclease cleavage activity of wild-type Cas13 against non-target RNAs.

[0386] In some embodiments, the engineered Cas13 retains at least about 80%-90% of the guide sequence-specific endonuclease cleavage activity of wild-type Cas13 on target RNA and lacks at least about 95%-100% of the guide sequence-independent concomitant endonuclease cleavage activity of wild-type Cas13 on non-target RNA.

[0387] In some embodiments, the engineered Cas13 of the present invention has an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.86% identity to any one of SEQ ID NOs: 6-10 in PCT / CN2020 / 119559 (incorporated by reference), and does not include any one or more of the regions defined in SEQ ID NOs: 16, 20, 24, 28, and 32 of PCT / CN2020 / 119559 (incorporated by reference).

[0388] In some embodiments, the amino acid sequence has up to 1, 2, 3, 4 or 5 differences, respectively, in any one of one or more of the regions defined in SEQ ID NOs: 16, 20, 24, 28 and 32 of PCT / CN2020 / 119559 (incorporated by reference), compared to SEQ ID NOs: 17, 21, 25, 29 and 33 of PCT / CN2020 / 119559 (incorporated by reference).

[0389] In some embodiments, an engineered Cas13 of the invention has the amino acid sequence of any one of SEQ ID NOs: 6-10 in PCT / CN2020 / 119559 (incorporated by reference). In some embodiments, an engineered Cas13 of the invention has the amino acid sequence of SEQ ID NO: 9 or 10 in PCT / CN2020 / 119559 (incorporated by reference).

[0390] In some embodiments, the engineered Cas13 of the invention further comprises a nuclear localization signal (NLS) sequence or a nuclear export signal (NES). In some embodiments, the engineered Cas13 comprises an N- and / or C-terminal NLS.

[0391] In some embodiments, the RNA sequences of the invention encoding the engineered CRISPR / Cas13 effector enzymes of the invention are codon-optimized and for expression in a eukaryote, a mammal (e.g., a human or non-human mammal), a plant, an insect, an avian, a reptile, a rodent (e.g., a mouse, a rat), a fish, a worm / nematode, or a yeast.

[0392] In some embodiments, the RNA sequence of the invention comprises a coding sequence for an engineered clustered regularly interspaced short palindromic repeats (CRISPR)-Cas13 effector enzyme, the coding sequence (i) having one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleotide additions, deletions, substitutions, and / or other mutations compared to a wild-type sequence; (ii) having at least 50%, 60%, 70%, 80%, 90%, 95%, or 97% sequence identity to the wild-type sequence; (iii) hybridizing to the wild-type sequence or any one of (i) and (ii) under stringent conditions; or (iv) being the complementary sequence of any one of (i)-(iii).

[0393] In some embodiments, the RNA sequences of the present invention include coding sequences for: siRNA, piRNA, small hairpin RNA or shRNA, including precursor miRNA and primary miRNA, non-coding RNA (ncRNA) such as microRNA or miRNA or precursors thereof, antisense sequences or oligonucleotides (ASO), CRISPR / Cas guide RNA or gRNA, rRNA, tRNA, snoRNA, snRNA, exRNA, scaRNA, lncRNA, Xist, and HOTAIR, etc.

[0394] 9.How to use The rRAAV viral particles and RNA sequences of the present invention can be for delivering any GOI / RSI to any suitable target cell, tissue or organism for use in any gene therapy.

[0395] In some embodiments, the rRAAV viral particles and RNA sequences of the present invention may be used in therapeutic methods, where a function-deficient or missing disease gene may be replaced with a functional version of the gene to restore the lost function. For example, in some embodiments, a wild-type coding sequence or a mutant coding sequence encoding a mutant protein of a wild-type protein that retains at least one desired function of the wild-type protein may be delivered to a target cell / tissue / organ and the wild-type variant encoded therein may be expressed to compensate for the lost function of the disease gene.

[0396] In some other embodiments, the rRAAV viral particles and RNA sequences of the present invention may be used in therapeutic methods, where a defective or gain-of-function disease gene may be knocked out, knocked down, or otherwise downregulated by a gene-targeted drug to alleviate the deleterious effects of the disease gene. The gene-targeted drug may be a CRISPR / Cas effector enzyme (such as an engineered Cas9 or Cas13 effector enzyme described herein), optionally with a guide RNA provided simultaneously (or separately), which co-targets the disease gene. In some embodiments, the gene-targeted drug may be a Cas effector enzyme linked to a DNA or RNA base editor for DNA-RNA base editing. In some embodiments, the gene-targeted drug is an siRNA, shRNA, microRNA, or antisense RNA.

[0397] In some embodiments, the present invention provides a method of modifying a target RNA in a target cell, the method comprising contacting the target cell with an rRAAV viral particle or RNA sequence of the present invention encoding a CasPR or engineered CRISPR / Cas effector enzyme (or an ortholog, paralog, variant, derivative or functional fragment thereof) described herein, wherein a guide sequence of the CasPR / Cas effector enzyme is complementary to at least 15 nucleotides of the target RNA, and wherein the CasPR / engineered Cas effector enzyme, in association with the guide sequence, forms a complex that binds to and modifies the target RNA.

[0398] In some embodiments, the present invention provides a method of treating a disorder or disease in a subject in need thereof, the method comprising administering to the subject a composition comprising an rRAAV viral particle or RNA sequence of the present invention encoding a CasPR or engineered CRISPR / Cas effector enzyme (or an ortholog, paralog, variant, derivative or functional fragment thereof) as described herein, wherein a guide sequence of the CasPR / Cas effector enzyme is complementary to at least 15 nucleotides of a target RNA, and wherein the CasPR / engineered Cas effector enzyme, in association with the guide sequence, forms a complex that binds to and modifies the target RNA, thereby treating the disorder or disease in the subject.

[0399] In some embodiments, the target RNA is modified by cleavage by CasPR or an engineered Cas effector enzyme complex. In some embodiments, the target RNA is modified by deamination by a derivative comprising a double-stranded RNA-specific adenosine and / or cytidine deaminase. In some embodiments, the target RNA is mRNA, tRNA, rRNA, non-coding RNA, lncRNA, or nuclear RNA. In some embodiments, the target RNA is in a cell. In some embodiments, the cell is a cancer cell. In some embodiments, the cell is infected with an infectious agent. In some embodiments, the infectious agent is a virus, a prion, a protozoan, a fungus, or a parasite. In some embodiments, the cell is a neuronal cell (e.g., an astrocyte, a neuroglial cell (e.g., a Muller glial cell, an oligodendrocyte, an ependymal cell, a Schwann cell, an NG2 cell, or a satellite cell)).

[0400] In some embodiments, the disorder or disease is a cancer or an infectious disease. In some embodiments, the cancer is Wilms' tumor, Ewing's sarcoma, neuroendocrine tumor, glioblastoma, neuroblastoma, melanoma, skin cancer, breast cancer, colon cancer, rectal cancer, prostate cancer, liver cancer, kidney cancer, pancreatic cancer, lung cancer, biliary tract cancer, cervical cancer, endometrial cancer, esophageal cancer, gastric cancer, head and neck cancer, medullary thyroid cancer, ovarian cancer, glioma, lymphoma, leukemia, myeloma, acute lymphocytic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, Hodgkin's lymphoma, non-Hodgkin's lymphoma, or bladder cancer. In some embodiments, the method is an in vitro method, an in vivo method, or an ex vivo method. In some embodiments, the engineered Cas13 does not exhibit significant (or detectable) incidental RNA enzymatic activity after the complex binds to the target RNA.

[0401] In some embodiments, the disorder or disease is a neurological disorder, e.g., glaucoma, age-related RGC loss, optic nerve damage, retinal ischemia, Leber's hereditary optic neuropathy, a neurological disorder associated with RGC neuron degeneration, a neurological disorder associated with functional neuron degeneration in the striatum of a subject in need thereof, Parkinson's disease, Alzheimer's disease, Huntington's disease, schizophrenia, depression, drug addiction, movement disorders such as chorea, choreoathetosis and dyskinesia, bipolar disorder, autism spectrum disorder (ASD), or dysfunction.

[0402] In some embodiments, the methods of the invention result in one or more of the following: (i) induction of cellular senescence in vitro or in vivo, (ii) cell cycle arrest in vitro or in vivo, (iii) cytostasis and / or cytostasis in vitro or in vivo, (iv) induction of anergy in vitro or in vivo, (v) induction of apoptosis in vitro or in vivo, and (vi) induction of necrosis in vitro or in vivo.

[0403] Another embodiment of the present invention 1. A polynucleotide sequence, including but not limited to ribose nucleic acid (RNA), deoxyribose nucleic acid (DNA), threose nucleic acid (TNA), glycol nucleic acid (GNA), peptide nucleic acid (PNA), locked nucleic acid (LNA, including LNA having a β-D-ribose structure, α-LNA (a non-enantiomer of LNA) having an α-L-ribose structure, 2'-amino-LNA having a 2'-amino functionalization, and 2'-amino-α-LNA having a 2'-amino functionalization), or hybrids thereof, capable of being packaged into viral particles of a DNA virus, said polynucleotide sequence being (1) A polynucleotide sequence of interest (PSI), e.g., an RNA coding sequence of a gene of interest (GOI), an RNA coding for a protein (e.g., a therapeutic protein, an antigenic protein, or a gene editing protein such as a CRISPR / Cas effector enzyme (abbreviated as "Cas protein"), a ZFN protein, or a TALEN protein), e.g., an mRNA, or a non-coding functional RNA (e.g., transfer RNA (tRNA), ribosomal RNA (rRNA), small interfering RNA (siRNA), small hairpin RNA (shRNA), antisense RNA, antisense oligonucleotide, microRNA (miRNA), or a guide RNA (or gRNA), e.g., a single guide RNA (or sgRNA, chimeric RNA, RNA chimera), a CRISPR RNA (crRNA), and an RNA component of a CRISPR-Cas (e.g., Cas9, Cas12, Cas13) system, including tracr RNA), or a precursor thereof; (2) a polynucleotide packaging signal (PPS) capable of interacting, e.g., binding, directly or indirectly, to a PPS-interacting molecule that facilitates packaging of the polynucleotide sequence into a viral particle of the DNA virus; Optionally, a DNA sequence encoding or corresponding to the polynucleotide sequence, or a reverse complementary sequence of the DNA sequence, has a reduced, attenuated or substantially absent ability to be packaged into viral particles of the DNA virus (e.g., the DNA sequence or its reverse complementary sequence lacks a DNA packaging signal, e.g., a functional AAV ITR for AAV packaging).

[0404] 2. The polynucleotide sequence of any one of the preceding embodiments, wherein the DNA virus particle is an AAV virus particle or an oncolytic virus particle.

[0405] 3. The polynucleotide sequence of any one of the preceding embodiments, wherein the PPS is located at or near the 5' end of the PSI, at or near the 3' end of the PSI, or within the PSI (e.g. within an intron of an mRNA).

[0406] 4. The polynucleotide sequence of any one of the preceding embodiments, comprising more than one (e.g., 1, 2, 3, or more) of the same or different PPSs.

[0407] 5. The polynucleotide sequence of any one of the preceding embodiments, wherein two or more (e.g., three) of the more than one PPS are adjacent or tandemly linked to each other via the same or different linkers.

[0408] 6. A polynucleotide sequence according to any one of the preceding embodiments, comprising two or more PPSs that are not adjacent to each other (e.g., each located at or near one end of the polynucleotide sequence of interest (PSI)).

[0409] 7. The PPS comprises a transcribed modified AAV inverted terminal repeat (ITR), wherein the transcribed modified AAV ITR comprises: (a) comprising a transcribed functional Rep binding element (RBE), and optionally further comprising a transcribed functional RBE'; and (b) lacking a transcribed terminal release site (TRS) or a transcribed reverse-complementary TRS (rcTRS), or both; Optionally, the transcribed modified AAV ITRs further comprise a transcribed D region sequence (D sequence or D′ sequence); and / or Optionally, the PPS interacting molecule is Rep78, Rep68, Rep52, and / or Rep40.

[0410] 8. The polynucleotide sequence of any one of the preceding embodiments, wherein the transcribed modified AAV ITRs are within 1000 nucleotides, 800 nucleotides, 500 nucleotides, 300 nucleotides, or 200 nucleotides of the 3' end of the RNA, and optionally the transcribed modified AAV ITRs are 5' of a polyA sequence, a polyA signal sequence (e.g., AAUAAA), or an RNA transcription termination sequence (e.g., a histone downstream element).

[0411] 9. The polynucleotide sequence of any one of the preceding embodiments, wherein the transcribed modified AAV ITR is modified based on a transcribed wild-type Flip or Flop ITR, and optionally the wild-type Flip or Flop ITR is from AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAVrh74, AAV8, AAV9, AAV10, AAV11, AAV12, or AAV13 (optionally, the wild-type Flop ITR has the nucleotide sequence of SEQ ID NO: 1).

[0412] 10. The polynucleotide sequence of any one of the preceding embodiments, wherein the transcribed modified AAV ITRs lack both the transcribed TRS and the transcribed rcTRS.

[0413] 11. The polynucleotide sequence of any one of the preceding embodiments, wherein the transcribed modified AAV ITRs comprise the transcribed D region sequence (optionally, the modified AAV ITRs have the nucleotide sequence of SEQ ID NO:3).

[0414] 12. The polynucleotide sequence of any one of the preceding embodiments, wherein the transcribed modified AAV ITRs lack the transcribed D region sequence (optionally, the modified AAV ITRs have the nucleotide sequence of SEQ ID NO: 2).

[0415] 13. The polynucleotide sequence of any one of the preceding embodiments, further comprising a second transcribed modified AAV ITR, wherein said second transcribed modified AAV ITR has a second transcribed functional RBE sequence but lacks a second transcribed TRS or a second transcribed rcTRS, or both, and optionally wherein said second transcribed modified AAV ITR further comprises a second transcribed D region sequence.

[0416] 14. The polynucleotide sequence of any one of the preceding embodiments, wherein the transcribed modified AAV ITR and the second transcribed modified AAV ITR are the same (or different).

[0417] 15. The polynucleotide sequence of any one of the preceding embodiments, wherein the transcribed modified AAV ITR and the second transcribed modified AAV ITR (if present) comprise a deletion in the corresponding transcribed wild-type AAV ITR D region sequence or the corresponding transcribed wild-type TRS / rcTRS, a mutation in the corresponding transcribed wild-type AAV ITR D region sequence or the corresponding transcribed wild-type TRS / rcTRS, or an insertion in the corresponding transcribed wild-type AAV ITR D region sequence or the corresponding transcribed wild-type TRS / rcTRS.

[0418] 16. The polynucleotide sequence of any one of the preceding embodiments, wherein the second transcribed modified AAV ITR is within 1000 nucleotides, 800 nucleotides, 500 nucleotides, 250 nucleotides, or 150 nucleotides of the 5' end of the polynucleotide sequence.

[0419] 17. The polynucleotide sequence of any one of the preceding embodiments, wherein the PPS comprises an MS2 sequence, a PP7 binding site, or a com binding site, and the PPS interacting molecule comprises a PPS interacting protein (PPSIP) that can directly or indirectly interact with, e.g., bind to, the PPS, such as a phage-derived MS2 coat protein (MCP) for the MS2 sequence, a PP7 phage coat protein (PCP) for the PP7 binding site, or a phage COM protein (COM) for the com binding site.

[0420] 18. The polynucleotide sequence of any one of the preceding embodiments, wherein the PPSIP is directly or indirectly associated with (e.g., fused to) a protein component of a viral packaging system of a viral particle of the DNA virus (e.g., Rep78 and / or Rep68 of adeno-associated virus 2 (AAV2), or an assembly activating protein (AAP)).

[0421] 19. The polynucleotide sequence of any one of the preceding embodiments, wherein the polynucleotide sequence comprises or preferably does not comprise a transcribed DNA packaging signal, e.g., a transcribed wild-type AAV ITR sequence (e.g., the polynucleotide sequence comprises a transcribed modified AAV ITR sequence having nucleotide additions, deletions, and / or substitutions of the corresponding transcribed wild-type AAV ITR sequence such that the DNA virus has a reduced ability to package DNA in viral particles).

[0422] 20. (1) Transcribed transcriptional enhancers, (2) transcribed intron or exon sequences (e.g., transcribed intron or exon sequences for enhancing protein expression); (3) 5' UTR sequence, (4) 3' UTR sequence, (5) a polyA sequence, or a polyadenylation (polyA) signal sequence, and optionally a GU-rich region downstream of the polyA signal sequence; (6) a post-transcriptional regulatory element or sequence, such as a transcribed Woodchuck Hepatitis Virus (WHP) post-transcriptional regulatory element (WPRE) sequence, and / or (7) further comprising a transcription termination sequence (e.g., a histone downstream element); Optionally, the polynucleotide sequence of any one of the preceding embodiments comprises a PPS located 3' of the post-transcriptional regulatory element or sequence and 5' of the polyA sequence or polyA signal sequence.

[0423] 21. The polynucleotide sequence of any one of the preceding embodiments, comprising, in the 5' to 3' direction, the PSI, an optional transcribed WPRE sequence, the PPS (e.g., the transcribed modified AAV ITR, the MS2 sequence, the PP7 binding site, or the com binding site), and the polyA sequence or the polyA signal sequence.

[0424] 22. The GOI may be a protein (e.g., a fluorescent protein, a therapeutic protein, an antigenic protein, or a gene editing protein, e.g., a Cas protein, a ZFN protein, a TALEN protein), an enzyme (e.g., a Cre protein or a CRISPR / Cas effector enzyme, e.g., Cas9, Cas12, Cas13, or a mutant thereof), a structural protein, an mRNA, a non-coding RNA (ncRNA), an siRNA, a piRNA, a small hairpin RNA or an shRNA, a microRNA (miRNA) or a precursor thereof (including precursor miRNA and primary miRNA), a ribosomal RNA (rRNA), an antisense sequence or an oligonucleotide (ASO), a guide RNA (or gRNA), e.g., a single guide RNA (or sgRNA, chimeric RNA, RNA chimera), a CRISPR RNA (crRNA) and a tracrRNA. 2. The polynucleotide sequence of any one of the preceding embodiments, comprising RNA and an RNA component of the CRISPR-Cas system, including guide RNA or gRNA for a CRISPR / Cas effector enzyme, rRNA, tRNA, snoRNA, snRNA, exRNA, scaRNA, lncRNA, Xist, and HOTAIR.

[0425] 23. The polynucleotide sequence of any one of the preceding embodiments, which is a single stranded RNA that is less than about 8,900 nucleotides in length, less than about 8,000 nucleotides in length, less than about 7,000 nucleotides in length, less than about 6,000 nucleotides in length, less than about 5,200 nucleotides in length, less than about 4,000 nucleotides in length, less than about 3,000 nucleotides in length, less than about 2,000 nucleotides in length, between about 4,700 and 5,200 nucleotides in length, between about 4,700 and 5,000 nucleotides in length, between about 4,700 and 4,800 nucleotides in length, or about 4,700 nucleotides in length.

[0426] 24. A polynucleotide comprising a cassette encoding the polynucleotide sequence of any one of the preceding embodiments, optionally wherein the polynucleotide is a DNA sequence (e.g., a DNA plasmid), optionally comprising a stuffer sequence in the backbone of the DNA plasmid, and / or optionally not comprising a functional DNA packaging signal, e.g., AAV ITRs.

[0427] 25. The polynucleotide of any one of the preceding embodiments, further comprising a promoter operably linked to and driving transcription of the polynucleotide sequence encoded by the cassette.

[0428] 26. The polynucleotide of any one of the preceding embodiments, wherein the promoter is a ubiquitous promoter.

[0429] 27. The polynucleotide of any one of the preceding embodiments, wherein the promoter is a tissue-specific promoter.

[0430] 28. The polynucleotide of any one of the preceding embodiments, wherein the promoter is a constitutive promoter.

[0431] 29. The polynucleotide of any one of the preceding embodiments, wherein the promoter is an inducible promoter.

[0432] 30. The polynucleotide of any one of the preceding embodiments, further comprising an enhancer that enhances transcription of the polynucleotide sequence driven by the promoter.

[0433] 31. A recombinant DNA viral particle, comprising a polynucleotide genome (e.g., a polynucleotide sequence described in any one of the preceding embodiments or a polynucleotide sequence transcribed from a polynucleotide sequence described in any one of the preceding embodiments) packaged in a protein shell (e.g., a capsid) of a DNA virus (e.g., an AAV virus, or an oncolytic virus).

[0434] 32. The DNA virus is AAV, and the recombinant DNA virus particle is a recombinant polynucleotide adeno-associated virus (rPAAV) particle, and the recombinant polynucleotide adeno-associated virus particle is (1) an AAV capsid; (2) A virus particle of the recombinant DNA virus described in any one of the preceding embodiments, comprising a polynucleotide sequence described in any one of the preceding embodiments or a polynucleotide sequence transcribed from the polynucleotide described in any one of the preceding embodiments, packaged within the AAV capsid.

[0435] 33. The recombinant DNA virus virus particle of any one of the preceding embodiments, wherein the AAV capsid comprises a capsid from an AAV of the serotype AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-DJ, AAV PHP.eB, Anc80L65, Anc80L65AAP, AAVrh74, or 7m8.

[0436] 34. A population of recombinant DNA viral particles (e.g., rPAAV particles) comprising a plurality of the recombinant DNA viral particles (e.g., rPAAV particles) of any one of the preceding embodiments, wherein at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or more of the recombinant DNA viral particles (e.g., rPAAV particles) in the population have a polynucleotide sequence described in any one of the preceding embodiments or a polynucleotide sequence transcribed from a polynucleotide described in any one of the preceding embodiments packaged therein.

[0437] 35. A host cell comprising a polynucleotide sequence described in any one of the preceding embodiments, a polynucleotide described in any one of the preceding embodiments, a polynucleotide sequence transcribed from a polynucleotide described in any one of the preceding embodiments, a recombinant DNA virus particle (e.g., rPAAV particle) described in any one of the preceding embodiments, and / or a population of recombinant DNA virus particles (e.g., rPAAV particles) described in any one of the preceding embodiments.

[0438] 36. A host cell described in any one of the previous embodiments, further comprising a viral packaging system that promotes packaging of a polynucleotide sequence described in any one of the previous embodiments or a polynucleotide sequence transcribed from a polynucleotide described in any one of the previous embodiments into viral particles of the DNA virus.

[0439] 37. The viral packaging system, (1) an AAV rep gene (e.g., coding sequences for Rep78, Rep68, Rep52, and / or Rep40) and an AAV cap gene (e.g., coding sequences for VP1, VP2, VP3, AAP, and / or MAAP), or their expression products, under the transcriptional control of one or more promoters that drive transcription of the rep and cap genes; (2) one or more coding sequences for one or more proteins required for AAV packaging, e.g., the adenovirus E2A, E4, and VA genes, or said one or more proteins; (3) the PPS-interacting molecule or its coding sequence, Optionally, the host cell of any one of the preceding embodiments, wherein the ability of the viral packaging system to package a DNA sequence into viral particles of the DNA virus is reduced, attenuated, or substantially eliminated, e.g., by: (1) deleting a DNA packaging signal, e.g., part or all of an AAV ITR, in the polynucleotide encoding the polynucleotide sequence of any one of the preceding embodiments or the polynucleotide of any one of the preceding embodiments; (2) modifying, e.g., mutating, the coding sequence of the one or more of the AAV rep genes, the AAV cap genes, and / or one or more proteins required for AAV packaging to reduce, attenuate, or substantially eliminate the ability of the corresponding translated protein to facilitate packaging of the DNA sequence into viral particles of the DNA virus (e.g., a Y156F mutation in the consensus sequence of Rep78 and Rep68 proteins, KDE-mu, or EKE-mu); and / or (3) expanding the size of the polynucleotide encoding the polynucleotide sequence of any one of the preceding embodiments or the polynucleotide of any one of the preceding embodiments.

[0440] 38. The host cell of any one of the preceding embodiments, which is a mammalian cell (e.g., a HEK293 cell) or an insect cell (e.g., an Sf9 or Sf21 cell).

[0441] 39. A method for producing a recombinant DNA virus particle (e.g., rPAAV particle) according to any one of the preceding embodiments, or a population of recombinant DNA virus particles (e.g., rPAAV particles) according to any one of the preceding embodiments, the method comprising: a) culturing a host cell according to any one of the preceding embodiments for a sufficient period of time; b) harvesting said recombinant DNA virus particles or a population of said recombinant DNA virus particles.

[0442] 40. The method of any one of the preceding embodiments, further comprising isolating or purifying the recombinant DNA virus particle or the population of recombinant DNA virus particles.

[0443] 41. A method for producing recombinant DNA virus particles (e.g., rPAAV particles) or a population of recombinant DNA virus particles, the method comprising: a) contacting a viral packaging system (e.g., an AAV packaging system) with a polynucleotide sequence as described in any one of the preceding embodiments, or a polynucleotide sequence transcribed from a polynucleotide sequence as described in any one of the preceding embodiments, for a period of time sufficient to produce a viral particle of said recombinant DNA virus, or a population of viral particles of said recombinant DNA virus; b) harvesting the recombinant DNA virus particles or a population of recombinant DNA virus particles, and optionally c) isolating or purifying the harvested recombinant DNA virus particles or population of recombinant DNA virus particles.

[0444] 42. The viral packaging system (e.g., an AAV packaging system): (1) one or more proteins for assembling the protein shell of a viral particle of the DNA virus for packaging the polynucleotide sequence (e.g., VP1, VP2, and / or VP3 for assembling an AAV capsid), or one or more coding sequences thereof; (2) one or more proteins (e.g., Rep78, Rep68, Rep52, and / or Rep40 for AAV packaging) or one or more coding sequences thereof (e.g., adenovirus E2a, E4, and VA genes) for facilitating assembly of the protein shell and / or packaging of the polynucleotide sequence into the protein shell of a viral particle of the DNA virus; (3) the PPS-interacting molecule or its coding sequence, Optionally, the ability of the viral packaging system to package a DNA sequence into viral particles of the DNA virus is reduced, attenuated, or substantially eliminated, e.g., by: (1) deleting part or all of a DNA packaging signal, e.g., an AAV ITR, in the polynucleotide encoding the polynucleotide sequence described in any one of the preceding embodiments or the polynucleotide described in any one of the preceding embodiments; (2) modifying, e.g., mutating, the coding sequence of the one or more of the AAV rep genes, the AAV cap genes, and / or one or more proteins required for AAV packaging to reduce, attenuate, or substantially eliminate the ability of the corresponding translated protein to facilitate packaging of the DNA sequence into viral particles of the DNA virus (e.g., a Y156F mutation in the consensus sequence of Rep78 and Rep68 proteins, KDE-mu, or EKE-mu); and / or (3) expanding the size of the polynucleotide encoding the polynucleotide sequence described in any one of the preceding embodiments or the polynucleotide described in any one of the preceding embodiments.

[0445] 43. A system for packaging a polynucleotide sequence according to any one of the preceding embodiments or a polynucleotide sequence transcribed from a polynucleotide according to any one of the preceding embodiments into viral particles of a DNA virus, the system comprising: (1) one or more proteins for assembling the protein shell of a viral particle of the DNA virus for packaging the polynucleotide sequence (e.g., VP1, VP2, and / or VP3 for assembling an AAV capsid), or one or more coding sequences thereof; (2) one or more proteins (e.g., Rep78, Rep68, Rep52, and / or Rep40 for AAV packaging) or one or more coding sequences thereof (e.g., adenovirus E2a, E4, and VA genes) for facilitating assembly of the protein shell and / or packaging of the polynucleotide sequence into the protein shell of a viral particle of the DNA virus; (3) the PPS-interacting molecule or its coding sequence, Optionally, the ability of the virus packaging system to package a DNA sequence into viral particles of the DNA virus is reduced, attenuated, or substantially eliminated, e.g., by: (1) removing part or all of a DNA packaging signal, e.g., an AAV ITR, in a polynucleotide encoding a polynucleotide sequence described in any one of the preceding embodiments or in a polynucleotide described in any one of the preceding embodiments; (2) modifying, e.g., mutating, the coding sequence of one or more of the AAV rep genes, the AAV cap genes, and / or one or more proteins required for AAV packaging to reduce, attenuate, or substantially eliminate the ability of the corresponding translated protein to facilitate packaging of the DNA sequence into viral particles of the DNA virus (e.g., a Y156F mutation in the consensus sequence for Rep78 and Rep68 proteins, KDE-mu, or EKE-mu), and / or (3) expanding the size of a polynucleotide encoding a polynucleotide sequence described in any one of the preceding embodiments or in a polynucleotide described in any one of the preceding embodiments.

[0446] 44. A method of delivering a gene of interest (GOI) to a cell, plant, or animal, the method comprising contacting the cell, plant, or animal with a recombinant DNA viral particle (e.g., rPAAV particle) described in any one of the previous embodiments, a population of recombinant DNA viral particles (e.g., rPAAV particles) described in any one of the previous embodiments, or a recombinant DNA viral particle (e.g., rPAAV particle) or a population of recombinant DNA viral particles (e.g., rPAAV particles) produced by a method described in any one of the previous embodiments, wherein the GOI is encoded by the polynucleotide sequence (described in any one of the previous embodiments).

[0447] 45. A method for delivering a polynucleotide sequence of interest (PSI) to a cell, plant, or animal, the method comprising contacting the cell, plant, or animal with a recombinant DNA viral particle (e.g., rPAAV particle) described in any one of the preceding embodiments, a population of recombinant DNA viral particles (e.g., rPAAV particles) described in any one of the preceding embodiments, or a recombinant DNA viral particle (e.g., rPAAV particle) or a population of recombinant DNA viral particles (e.g., rPAAV particles) produced by a method described in any one of the preceding embodiments.

[0448] 46. ​​A method for diagnosing, preventing, or treating a disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount or dosage of a population of recombinant DNA virus particles (e.g., rPAAV particles) described in any one of the preceding embodiments or produced by the method described in any one of the preceding embodiments.

[0449] 47. Use of a recombinant DNA viral particle (e.g., rPAAV particle) described in any one of the preceding embodiments, a population of recombinant DNA viral particles (e.g., rPAAV particles) described in any one of the preceding embodiments, or a recombinant DNA viral particle (e.g., rPAAV particle) or a population of recombinant DNA viral particles (e.g., rPAAV particles) produced by a method described in any one of the preceding embodiments, in the manufacture of a medicament for diagnosing, preventing, or treating a disease or disorder in a subject in need thereof.

[0450] Working Example The examples provided below are intended to illustrate some exemplary embodiments of the present invention and are not intended to be limiting in any manner.

[0451] Example 1 Highly efficient packaging of RNA into RAAV viral particles This example demonstrates that RNA vector genomes can be packaged highly efficiently into AAV viral capsids, specifically using modified / recombinant RNAs designed for direct packaging into the AAV capsid.

[0452] First, it has been unexpectedly shown that the AAV packaging signal-ITR (DNA), when transcribed (as RNA), can promote packaging of an RNA sequence of the invention (e.g., an rRAAV vector genome RNA) into AAV particles, particularly when present as several structures (e.g., when the transcribed modified AAV ITR sequence is close to the 3' end of the transcribed RNA sequence of the invention).

[0453] In particular, wild-type and modified AAV ITR sequences (DNA) from the ends of the AAV vector genome were moved to their respective transgene expression cassettes to ensure that all transgene transcripts (RNA) contained the candidate packaging signal. Optimized ITRs (dITR and dITR-D) were used in place of the wild-type ITRs to block the production of conventional AAV vectors with ssDNA genomes during the RAAV production process (Table 2).

[0454] [Table 3]

[0455] Specifically, in the wild-type AAV2 ITR (ITR2) sequence in the Flop structure, the TRS ("TTGGC") is located at the 5' end of the ITR, and its reverse complementary sequence GCCAA is double underlined. Such a sequence can be cloned into the coding plasmid in any orientation (i.e., the sequence shown in SEQ ID NO: 1 or its reverse complementary sequence can be used as a template to transcribe the RNA sequence of the invention). In the experiments herein, the wild-type AAV2 ITR sequence is cloned in such an orientation, so that the transcribed RNA has the same sequence as SEQ ID NO: 1 (or SEQ ID NO: 2 or 3 below), except that T in the transcribed RNA is replaced by U. In any case, after transcribing such a sequence or its reverse transcript, the resulting transcribed RNA of wild-type ITR2 contains a palindrome transcribed RBE (shaded in grey). In the experiments herein, the transcribed RNA contains a transcribed wild-type AAV2 ITR equivalent to SEQ ID NO: 1, except that all Ts are replaced by Us. When the reverse complement of SEQ ID NO: 1 is used as a DNA template, the transcribed RNA contains a transcribed TRS (UUGGC) encoded by GCCAA. The transcribed TRS is located between the transcribed RBE and the transcribed D sequence.

[0456] One of the modified ITR sequences is the "δITR" (or abbreviated "dITR"), which is defective because, except for the first G, the dITR lacks the D region sequence (bold italics), the TRS at the 5' end, and the reverse complementary TRS sequence ("GCCAA"). After transcription of such a sequence, the transcribed RNA of the dITR contains a palindrome transcribed RBE (shaded in grey) and a transcribed defective ITR that lacks the transcribed TRS (UUGGC) encoded by GCCAA. However, in this experiment, the reverse complementary sequence of SEQ ID NO:2 was used as the DNA template, such that the transcribed RNA has a transcribed modified AAV2 ITR (transcribed dITR) that has the same sequence as SEQ ID NO:2, except that all Ts are replaced with Us.

[0457] Another modified ITR sequence, "dITR-D," retains its D sequence ("CTCCATCACTAGGGGTTCCT," SEQ ID NO: 4), but is defective because it lacks the 5'-terminal TRS (TTGGC). Also, only the first G in the reverse complementary TRS (GCCAA) is retained in dITR-D, and the remaining CCAA sequence is replaced with an unrelated ACTAG sequence. In this experiment, the reverse complementary sequence of SEQ ID NO: 3 was used as the DNA template, so that the transcribed RNA has a transcribed modified AAV2 ITR (transcribed dITR) with the same sequence as SEQ ID NO: 3, except that all Ts are replaced with Us.

[0458] It is to be noted that both the dITR and dITR-D sequences contain the shaded palindrome RBE sequence SEQ ID NO: 5 (CTGCGCGCTCGCTCGCTCACTG...CAGTGAGCGAGCGAGCGCGCAG) and the corresponding transcribed modified ITRs also contain the RBE sequence.

[0459] Such optimized ITR coding sequences (DNA) were inserted into two locations of the tdTomato expression cassette, one located between the promoter and the tdTomato coding sequence, and the other located between the Woodchuck Hepatitis Virus (WHP) posttranscriptional regulatory element (WPRE) and the SV40 polyA signal.

[0460] A series of different ITR-based RAAV vectors were constructed based on the sequence, number and location of the optimized ITRs used (see Figure 3).

[0461] A conventional AAV vector with a ssDNA vector genome and no ITR sequences at the two ends ("CTWS", representing the sequence elements CAG promoter, tdTomato transgene, WPRE sequence, and SV40 polyA signal sequence) was used as a control. For this experiment, AAV serotype DJ was chosen because it has excellent transduction efficiency in the cultured cells used. AAV-DJ is a synthetic serotype and has a chimeric capsid of AAV-2, 8, and 9. The capsid contains a heparin-binding domain, which allows it to transduce multiple cell types with high efficiency and evade immune neutralization (Grimm et al., J. Virol. 82:5887-5911, 2008).

[0462] The various RAAV-ITR and control viral particles were all generated by using an avian plasmid transfection system (Figure 4).

[0463] In particular, the RAAV vector was generated by co-transfecting the transgene plasmid, packaging plasmid and helper plasmid (weight ratio 1:1:2) into HEK293T cells. HEK293T cells were cultured in competent DMEM medium and inoculated 24 hours before transfection. Before transfection, the medium was replaced with fresh DMEM containing 2% FBS. PEI-MAX was used as the transfection reagent. Then, the supernatant was collected on the second and fifth days after transfection, and the transfected cells were harvested on the fifth day. The RAAV vector was purified by iodixanol density gradient ultracentrifugation.

[0464] Viral titers (DNA and RNA titers) were determined by Q-PCR and reverse transcription-PCR (RT-PCR), respectively, using the procedures in FIG. 5A.

[0465] Briefly, the harvested purified RAAV virions were first processed with DNA enzyme I and RNA enzyme I at 37°C for 2 hours to remove all nucleic acids outside the protein shell of the virions, then the nucleases were denatured at 100°C for approximately 30 min, and the RAAV virions were denatured and ruptured to release the RAAV nucleic acid content for further analysis.

[0466] Q-PCR was used to analyze the nuclease-resistant product and titrate the DNA vector genome encapsidated in RAAV virus particles.In particular, in one set of Q-PCR, a primer pair specific to the promoter sequence was used to detect / quantify any functional DNA, and in another set of Q-PCR, a primer pair specific to the WPRE sequence was used to detect / quantify any DNA vector genome encapsidated in RAAV virus particles.See Figure 5B.

[0467] In addition, in another sample, any RAAV-encapsidated DNA was first removed by DNA enzyme I digestion, and the remaining RNA was reverse transcribed, and the resulting cDNA was used as a Q-PCR template to detect / quantify the WPRE sequence transcribed into RNA. To detect / quantify any residual DNA that may be present after incomplete DNA removal, the sample after the DNA removal step was directly amplified by Q-PCR to detect any WPRE (DNA) sequence that may be present in the sample. See Figure 5A.

[0468] When a conventional pssDNA construct (with wild-type ITR sequences at both ends) is used to generate viral particles to test the packaging efficiency of the CITWS construct (see FIG. 6A), the vast majority of viral particles contain a functional DNA vector genome with a promoter sequence and a WPRE sequence. Very rarely (two orders of magnitude, or about 1% of the time), an RNA vector genome is also packaged into the viral particle (see the bar labeled "RNA", about two orders of magnitude lower than the bars labeled "DNA" and "functional DNA"). Residual DNA is one order of magnitude lower than the packaged RNA vector genome.

[0469] Together, removing the ITR sequences from both ends of the AAV vector genome essentially eliminated packaging, with the CTWS construct in Figure 6A (without ITRs) producing 2-2.5 orders of magnitude less packaged DNA and even less RNA.

[0470] Compared to the CTWS control, the addition of only one optimized ITR sequence (dITR or dITR-D sequence) between the 3' of the promoter and the 5' of the GOI coding sequence appears to slightly improve DNA packaging, but fails to enhance RNA packaging, see Figure 6A.

[0471] Interestingly, quite different results were obtained from Figure 6B, where the CTWIS construct was tested. In particular, for the packaging pssDNA construct (compare Figure 6A and Figure 6B), virtually the same results were obtained - the majority of packaged viral particles contain DNA (99% or more) and negligible amounts (1% or less) of RNA. However, adding an optimized ITR sequence (dITR) between the 3' end of the WPRE sequence and the 5' end of the polyA sequence significantly reduced and even reversed the difference in packaging efficiency between DNA and RNA. When using the dITR-D sequence, such an effect is more pronounced when the majority of the packaged nucleic acid is RNA (1-2 orders of magnitude higher than the packaged DNA).

[0472] Essentially the same result is achieved by inserting an additional (i.e., second) optimized ITR sequence between the promoter and the GOI coding sequence in the CITWIS construct, see Figure 6C.

[0473] These results suggest that the optimized ITRs (dITR and dITR-D) reduce the DNA packaged into RAAV viral particles by inhibiting the replication of conventional AAV vectors.

[0474] Compared with the control vector CTWS (no ITR) and the RAAV-dITR vector, the RAAV vector with dITR-D optimized ITR appears to be more capable of directly encapsidating transcribed mRNA into RAAV particles, especially when the dITR-D ITR is located downstream of the mRNA coding sequence and the WPRE sequence (e.g., just 5' of the polyA signal). See Figures 6A-6C. In comparison, the dITR-D sequence located upstream of the mRNA coding sequence (e.g., just after the promoter sequence in the expression construct) hardly promotes direct packaging of the mRNA into RAAV viral particles. In addition, if another dITR-D sequence is inserted downstream of the mRNA coding sequence (e.g., just 5' of the polyA sequence), the packaging of the resulting RAAV mRNA was highly increased as well (Figure 6C).

[0475] In summary, CITWIS-D, which carries dITR-D signals at both ends of its mRNA genome, has the best ability to encapsidate specific mRNA, even though its yield (particles carrying mRNA) is 20-fold lower than that of conventional AAV vectors with ssDNA vector genomes (pssAAV group).Unlike conventional AAV vectors, the RAAV vector CITWIS-D has impaired DNA packaging, and the particles of DNA it carries account for about 20% or less of the RAAV vector volume, and the percentage of particles carrying functional DNA is even lower (e.g., less than 10%) (Figures 6A-6C).

[0476] Because AAV packaging capacity is limited (<4700 nt), undesired AAV DNA packaging may be reduced by expanding the size of the transgene plasmid, and functional DNA packaging may be further reduced by increasing the length of the transgene cassette and, for example, by inserting cis-acting elements (e.g., enhancers, introns, etc.) or nonfunctional stuffer sequences into the cassette.

[0477] Example 2 RAAV viral particles are functional This example demonstrates that the tested RAAV-dITR-D vector is infectious and can function as a gene delivery vector.

[0478] The same volume of purified RAAV-dITR-D (CITWIS-D) vector was used to infect 2 × 10 cells at the same MOI of approximately 50,000 (the MOI of the CITWIS-D vector is calculated from the sum of the number of DNA particles and the number of mRNA particles). 5 HEK293T cells were infected in vitro.

[0479] Specifically, HEK293T cells were seeded in 24-well plates approximately 24 hours prior to infection. Then, the RAAV vector was thoroughly mixed with 1 mL DMEM (containing 2% FBS). Then, the cell medium was removed and the cells were incubated with the mixed RAAV vector overnight. Fluorescence photographs were taken 3 and 5 days after infection.

[0480] As a result, the expression of the CITWIS-D vector for tdTomato was faster than that of other vectors, but the expression was also rapidly downregulated (see Figure 7B). Such rapid expression and degradation phenomenon may be due to the short life span of its mRNA genome (Figure 7B).

[0481] Interestingly, CTWS constructs without any ITR sequences are apparently packaged to some extent, although the exact mechanism is not yet clear. With CTWS vectors, at least two possibilities can explain the packaging of mRNA vector genomes: overexpressed cellular mRNAs may be non-specifically packaged into RAAV vectors, or CTWS mRNA may have some RNA structure that interacts with Rep2 or Cap-DJ. In addition, CTWS DNA packaging may be due to the small size of CTWS plasmid, and the increased size of CTWS plasmid may reduce DNA packaging.

[0482] Example 3 Highly efficient packaging of RNA into RAAV particles This example demonstrates that RNA genomes can be packaged highly efficiently into AAV capsids to produce RAAV particles, especially when using modified / recombinant RNAs designed herein for direct packaging into AAV capsids.

[0483] 1. Design The inventors have already designed a strategy to exploit the strong interaction between the MS2 coat protein (MCP) from bacterial phages and its recognition stem-loop MS2 as a novel packaging signal to package heterologous RNA into virions of DNA viruses.

[0484] First, to suppress / reduce the production of conventional AAV particles with packaged ssDNA genome during RAAV production, the conventional AAV packaging signal-ITR was removed. Conversely, one or three copies of the RNA packaging signal (RPS), i.e., MS2 stem-loop (or abbreviated as "MS2", whose RNA sequence is listed in the sequence table below), were inserted into the tdTomato expression cassette, located between the Woodchuck Hepatitis Virus (WHP) posttranscriptional regulatory element (WPRE) and the SV40 polyA signal, ensuring that all transcribed mRNAs have the RPS, which is recognized by the binding protein, i.e., MS2 coat protein (or abbreviated as "MCP", whose amino acid sequence is listed in the table below) (corresponding to MS2) from bacterial phage (Figure 8A).

[0485] Because AAV Rep proteins are nonstructural proteins and they normally function as a bridge between the ITRs of the ssDNA genome and the AAV capsid during AAV packaging, MCP was fused to the N-terminus of the Rep78 and Rep68 proteins from AAV2 (Rep 68 is a C-terminal truncation of Rep 78; the amino acid sequences of the two fusions are listed in the sequence listing below). The interaction of these MCP-Rep78 / 68 fusions with the MS2 sequence in the RNA genome and their ability to promote packaging of the RNA genome into the AAV capsid were examined.

[0486] The conventional AAV vectors pssAAV-tdTomato (having two wild-type functional ITRs) and CTWS ("CTWS" representing the sequence elements CAG promoter, tdTomato transgene, WPRE sequence, and SV40 polyA signal sequence) without functional wild-type ITRs were used as controls (Figure 8A). In this example, the use of AAV serotype DJ ("AAV-DJ" or "DJ") was chosen because it has excellent transduction efficiency in the cultured HEK293T cells used in this example. AAV-DJ is a synthetic serotype and has a chimeric capsid of AAV-2, 8, and 9.

[0487] 2. RAAV Packaging and Production Herein, a conventional avian plasmid transfection system was used, with the necessary modifications, to co-transfect the relevant transgene plasmids, packaging plasmids and helper plasmids in a 1:1:2 mass ratio into HEK293T cells to produce RAAV and control AAV particles.

[0488] In particular, HEK293T cells were cultured in competent DMEM medium, and the cells were seeded 24 hours before transfection. Just before transfection, the medium was replaced with fresh DMEM containing 2% FBS. PEI-MAX was used as the transfection reagent. After transfection into infected cells, the transgene plasmid carrying the RPS was transcribed to generate the RNA genome to be packaged. Then, the supernatant was collected on days 2 and 5 after transfection, and the transfected cells were harvested on day 5. RAAV and control AAV particles were purified by iodixanol density gradient ultracentrifugation.

[0489] 3. Detection of packaged genomes First, purified RAAV and control AAV particles were processed with nucleases (including DNA enzyme I and RNA enzyme I) at 37° C. for 2 hours to remove any possible nucleic acids other than viral particles. Next, nucleases and RAAV or control AAV particles were denatured by protease K / SDS digestion at 65° C. for approximately 3 hours to rupture the viral particles and release the genomes packaged therein. Nuclease-resistant polynucleotides containing the released viral genomes were then extracted and purified by phenol / chloroform extraction.

[0490] To detect DNA genome titers of control AAV and RAAV particles, nuclease-resistant polynucleotides were directly analyzed using Q-PCR. In Q-PCR, a WPRE primer pair (shown in the sequences below) specific for the WPRE sequence in the viral genome pair was used to detect and quantitate any DNA genomes encapsidated into control AAV or RAAV particles.

[0491] To detect the RNA genome titers of control AAV and RAAV particles, prior to reverse transcription of the encapsidated RNA genome, DNA was removed by DNA Enzyme I digestion to remove any control AAV- or RAAV-encapsidated DNA genomes, and the resulting cDNA was used as a Q-PCR template to detect and quantify the WPRE sequence with the same WPRE primer pair described above. To detect and quantify any potential residual DNA that may be present due to incomplete removal of DNA, after the DNA removal step, the samples were directly amplified using Q-PCR (without reverse transcription) to detect the WPRE (DNA) sequence with the same WPRE primer pair described above, which were also used in all other PCR reactions specific for the WPRE sequence.

[0492] 4. Packaging Efficiency Comparison When control AAV particles are produced using a conventional transgene plasmid containing the pssAAV-tdTomato construct (both ends with wild-type ITRs) and a conventional packaging plasmid for AAV-DJ, the majority of particles contain DNA genomes with WPRE sequences. Very rarely, RNA genomes are also packaged into the particles (see the bar labeled "RNA", approximately 5 orders of magnitude lower than the bar labeled "DNA"). The presence of residual DNA is comparable to the presence of RNA, which may be due to the low efficiency of digestion of the packaged DNA genome by DNA enzyme I prior to reverse transcription.

[0493] Interestingly, when the recombinant packaging plasmid DJ-MCP (MCP fused to the N-terminus of Rep78 and 68 proteins) was used instead of DJ, the packaging of DNA genome was slightly decreased (about 0.5 orders of magnitude), but the distribution pattern of viral genome was almost the same, where DNA packaging was about 5 orders of magnitude higher than RNA packaging. This result suggests that fusing MCP to the N-terminus of Rep78 / 68 proteins does not significantly impair their native functions (Figure 8B).

[0494] Together, removing the ITRs from both ends of the pssAAV-tdTomato construct resulted in the production of a CTWS construct, which significantly abolished DNA packaging: the CTWS construct (without ITRs) produced approximately four orders of magnitude less packaged DNA, or less packaged RNA, regardless of the packaging plasmid (DJ or DJ-MCP) used.

[0495] Also, RAAV transgene plasmids, CTWMS and CTWM3S, were obtained by adding one or three copies of RPS (MS2) between 3' of WPRE and 5' of SV40 polyA signal in the ITR-less viral genome. In the absence of MCP, the CTWMS and CTWM3S constructs were hardly encapsidated as DNA or RNA genomes, like the genome distribution pattern of CTWS. Surprisingly, by using DJ-MCP instead of DJ as packaging plasmid, the difference in packaging efficiency between DNA and RNA genomes was significantly reversed, and the majority of packaged genomes were RNA.

[0496] Compared with CTWS / DJ-MCP, the number of RNA genomes packaged by CTWMS / DJ-MCP and CTWM3S / DJ-MCP was 100-fold and 400-fold higher, respectively, with no obvious difference in the DNA packaging numbers of the three. This result suggests that the MCP-Rep78 / 68 fusion can specifically recognize the RPS, MS2, embedded in the RNA transcripts of the CTWMS and CTWM3S plasmids and promote the packaging of those RNAs into RAAV particles, and that three copies of the RPS in the CTWM3S construct provided better RNA packaging efficiency than one copy (Figure 8B).

[0497] In summary, by introducing the MS2 / MCP pair into the conventional AAV packaging system, RAAV particles can be generated by packaging the MS2-bearing RNA genome into AAV particles in the presence of the MCP-Rep78 / 68 fusion. Unwanted DNA packaging accounts for only about 10% of the total viral particle population produced with CTWM3S / DJ-MCP.

[0498] In other words, an artificial / heterologous RNA packaging signal (RPS) - the MS2 sequence - together with its cognate binding protein MCP can be used to replace a natural DNA virus packaging signal pair (i.e., ITR and Rep) to significantly enhance the efficiency of packaging RNA into another DNA virus while suppressing its native packaging of DNA into the same DNA virus.

[0499] Example 4 Expanded Plasmid Backbone Reduced Unwanted DNA Packaging in RAAV This example demonstrates that increasing the backbone size of an AAV transgene plasmid by inserting a stuffer sequence into the plasmid backbone can reduce packaging of unwanted DNA into AAV particles.

[0500] Although there are no ITRs in the CTWMS and CTWM3S constructs for RAAV particles in Example 3 and there is no reverse packaging in RAAV production, it was speculated that the small size (5-6 kb) of the RAAV transgene plasmid may still result in undesired DNA packaging.

[0501] Therefore, a 3266 bp non-coding sequence (stuffer sequence, see sequence listing below) was inserted upstream of the tdTomato expression cassette of CTWM3S to increase the backbone length of the CTWM3S transgene plasmid, and the resulting construct was named L-CTWM3S. A schematic diagram of the plasmid is shown in Figure 9A.

[0502] The conventional AAV genome construct pssAAV-tdTomato and the RAAV genome construct CTWM3S used in Example 3 were used as controls herein. As in Example 3, RAAV particles were produced by co-transfecting the CTWM3S or L-CTWM3S transgene plasmid with the packaging plasmid DJ-MCP and the helper plasmid into HEK293T cells, and the resulting RAAV particles were purified and the viral genome was quantified. The same WPRE primer pair was used to detect and quantify any DNA and RNA genomes encapsidated in AAV and RAAV particles, and another CAG primer pair specific to the CAG promoter sequence in the viral genome was used in Q-PCR to detect and quantify any functional DNA (i.e., DNA that contains a CAG promoter sequence and can express a functional transgene protein).

[0503] Note that the packaged RNA genome cannot be detected with the CAG primer because it does not contain a CAG promoter, and the RNA column in the figure with the CAG primer represents background RNA signal (see Figure 9B).

[0504] Surprisingly, no matter which primer pair was used in Q-PCR, the DNA genome titer of the L-CTWM3S group was about 2-fold lower than that of the CTWM3S group (see Figures 9B and 9C). The RNA genome titers of the CTWM3S and L-CTWM3S groups were essentially equivalent (see Figure 9C). Because the transcribed RNA from the CTWM3S and L-CTWM3S transgene plasmids lacked the CAG promoter sequence, the packaged RNA genome could be detected with only one pair of WPRE primers (Figure 9C).

[0505] In conclusion, by increasing the backbone length of the transgene plasmid, undesired DNA packaging in RAAV particles can be reduced without interfering with its RNA packaging, suggesting that the deconstruction of the DNA packaging system and the establishment of the RNA packaging system in AAV particles are two independent lines, and the long stuffer sequence was used in the RAAV transgene plasmid in the subsequent examples.

[0506] Example 5 Use of the RAAV-MS2 / MCP system for additional transgenes To verify the general applicability of the RAAV-MS2 / MCP system to additional transgenes and to verify that the observed RNA packaging was not solely an artifact related to the reporter gene used, a series of AAV and RAAV transgene plasmids containing a Cre recombinase expression cassette were generated.

[0507] The conventional pssAAV-Cre (replacing the tdTomate coding sequence in the pssAAV-tdTomato construct in FIG. 8A with the Cre coding sequence) and the corresponding L-CCWS construct (replacing the tdTomate coding sequence in CTWS in FIG. 8A with the Cre coding sequence and inserting the stuffer sequence in Example 4) were used as controls, where the second C represents the Cre recombinase transgene. After replacing the tdTomate coding sequence with the Cre coding sequence, the L-CTWM3S construct in Example 4 was also redesigned as the L-CCWM3S construct.

[0508] The Cre transgene plasmid was co-transfected with the packaging plasmids DJ or DJ-MCP and helper plasmids into HEK293T cells to produce AAV and RAAV particles, respectively. The resulting viral particles were purified and the viral genomes were quantified as described in Example 3.

[0509] In the case of AAV-Cre and RAAV-Cre, the same viral genome distribution results as AAV-tdTomato and RAAV-tdTomato were obtained. In the case of pssAAV-Cre, the majority of viral particles contained DNA genomes, and the DNA genome titer was about 4 to 5 orders of magnitude higher than the RNA genome titer. In the case of L-CCWS, due to the lack of both DNA and RNA packaging signals, DNA and RNA genomes were hardly encapsidated. In the case of L-CCWM3S, RNA packaging in the case of DJ-MCP was significantly improved by about 200 times compared to L-CCWS / DJ-MCP, and undesired viral particles carrying DNA accounted for only about 1% of the total viral particle population (Figures 10A and 10B).

[0510] Since the DJ-MCP fusion not only serves RNA packaging but also retains DNA packaging ability, its performance was evaluated in a construct containing both DNA packaging signal (ITR) and RNA packaging signal (three copies of MS2), which was constructed by inserting three copies of MS2 between WPRE and SV40 polyA of pssAAV-Cre construct and named pssAAV-Cre-MS2X3. The results suggest that in the absence of MCP, the majority of virus particles contain packaged DNA genomes, and only negligible amounts of RNA genomes are packaged with or without RNA packaging signal. When DJ-MCP is combined with RNA binding signal instead of DJ as packaging plasmid, RNA packaging is significantly improved, and surprisingly, the increased RNA packaging does not significantly prevent DNA packaging of pssAAV-Cre-MS2X3 construct (Figure 11B). From another perspective, introduction of the MS2 / MCP pair can also significantly increase RNA packaging without removing the DNA packaging signal-ITR, suggesting that the deconstruction of the DNA packaging system and the establishment of the RNA packaging system are two independent lines in AAV particles, and that removal of the ITR is not an essential basis for the increase in RNA packaging by the introduction of the RPS / RBP pair.

[0511] In summary, the tested RAAV-MS2 / MCP system can generally be applied to any transgene, such as the Cre recombinase shown above. Interestingly, the RAAV-Cre construct gave better yields than the RAAV-tdTomato construct. Without wishing to be bound by any theory, this is due to the simpler secondary structure of the Cre mRNA compared to the tdTomato mRNA, based on online RNA secondary structure predictions such as those found at rna.tbi.univie.ac.at / cgi-bin / RNAWebSuite / RNAfold.cgi.

[0512] Example 6 Optimization of the RAAV production system and identification of the properties of the optimized RAAV particles The endonuclease activity of the Rep68 and Rep78 proteins (Rep68 / 78) is crucial for DNA genome replication during the conventional DNA packaging process of AAV particles. Without a functional trs-endonuclease, newly synthesized viral ssDNA cannot be released for packaging. In this example, we investigated whether it would be possible to further reduce undesired DNA packaging in AAV particles by disrupting the activity of the trs-endonuclease.

[0513] To examine this, three trs-endonuclease negative mutants were constructed, namely DJ-MCP(Y156F, where the Y156F mutation is located in the consensus sequence of the Rep68 and Rep78 proteins, i.e. Rep68-Y156F and Rep78-Y156F), DJ-MCP(KDE-mu) and DJ-MCP(EKE-mu) (see sequence listing below).

[0514] First, the DNA and RNA packaging efficiency of DJ-MCP(Y156F) was evaluated using the transgene plasmid pssAAV-Cre-MS2X3 (described in Example 5), which contains both DNA and RNA packaging signals. DJ and DJ-MCP were set as packaging plasmid controls. Viral particles were produced, purified and titrated as described in Example 3.

[0515] The results suggest that the Y156F mutation in DJ-MCP significantly reduced ITR-mediated DNA packaging of pssAAV-Cre-MS2X3 without preventing RNA packaging.

[0516] Therefore, apart from removing the DNA packaging signal ITR as shown in the above examples, functional proteins involved in the DNA packaging process (e.g., Rep78 / 68 proteins) can also be modified, e.g., mutated, to weaken or remove their functions related to DNA packaging, which may be another strategy to reduce or suppress conventional DNA packaging of AAV particles (Figure 13A).

[0517] And, instead of pssAAV-Cre-MS2X3, L-CCWM3S in Example 5 was used as the RAAV transgene plasmid, thereby providing the viral genome. trs-endonuclease positive DJ-MCP was used as a control for DJ-MCP(Y156F). Viral particles were produced, purified and titrated as described in Example 3. Here, two pairs of primers were used to titrate the viral genome, one pair to target the WPRE sequence above, and another pair (see sequence listing below) to target the 5' end of the Cre coding sequence.

[0518] The results suggest that the Y156F mutation in the Rep78 / 68 protein not only reduced undesired DNA packaging by about 10-fold, but also increased desired RNA packaging by about 50%. For the two pairs of primers used in Q-PCR (i.e., the WPRE primer pair and the Cre primer pair), the patterns of the difference in packaging efficiency between packaged DNA and RNA genomes are virtually the same (Figures 12A-12B).

[0519] Two other trs-endonuclease mutants, DJ-MCP(KDE-mu) and DJ-MCP(EKE-mu), were further tested and demonstrated the same ability to reduce unwanted DNA packaging as DJ-MCP(Y156F), although only DJ-MCP(Y156F) showed improved RNA packaging (Figure 13B).

[0520] It was further demonstrated that fusing two copies of MCP to the N-terminus of the Rep 78 / 68 protein (MCPx2-Rep78 and MCPx2-Rep68) could also achieve the result of reducing undesired DNA packaging (Figure 13B).

[0521] The composition of AAV and RAAV particles was analyzed by silver-stained SDS-PAGE, and RAAV capsids were also composed of three VP proteins (VP1, VP2, and VP3), where the VP1 / 2 / 3 ratio was similar to that of conventional AAV particles (Figure 12C).

[0522] To analyze the morphology of RAAV particles, 10 μL of purified AAV and RAAV particles were placed on a copper mesh coated with 300 μm carbon-coated polyvinyl acetal (Pioloform) and incubated at room temperature for 2 min. Excess sample was aspirated with filter paper and immediately replaced with 10 μL of stain (3% phosphotungstic acid), left for 2 min, and aspirated again. Samples were visualized using a Talos L120C transmission electron microscope. RAAV particles are morphologically similar to conventional AAV vectors, where complete viral particles enveloping the genome are seen as 25-nm solid spheres and empty viral particles without enveloping the genome are 25-nm donut-like structures (Figure 12D).

[0523] In summary, mutation of functional proteins involved in the DNA packaging process during AAV production (including Rep proteins) to weaken or eliminate their DNA packaging-related functions and remove the DNA packaging signal ITRs is an optimal strategy to reduce or suppress undesired DNA packaging in RAAV particles. The produced RAAV particles have a composition and morphology similar to conventional AAV particles.

[0524] Example 7 RAAV Vectors Expressing Functional Proteins This example demonstrates that the tested RAAV vector is infectious and can function as a gene delivery vector.

[0525] The Cre-loxP system is a highly sensitive system for studying the infectivity of the RAAV vector of the present invention. Mouse embryonic fibroblasts (MEFs) isolated from homo-Ai9 (carrying loxP-tdTomato-reporter gene system) mice and AAV (pssAAV-Cre / DJ) or RAAV (L-CCWM3S / DJ-MCP(Y156F)) vectors purified in Example 5 were incubated overnight to set the multiplicity of infection (MOI) (the number of virus particles added per cell during infection), including 7 MOI for conventional AAV vectors and 3 MOI for RAAV vectors. The predominant genome titer, quantified by detecting the Cre coding sequence with the 5'-end Cre primer described above, was used as the infectious titer. In other words, the DNA genome titer was used for conventional AAV vectors, while the RNA genome titer was used for RAAV vectors.

[0526] Specifically, approximately 24 h prior to infection, Ai9-MEF cells were cultured at approximately 5 × 10 4 Cells / well were seeded into 48-well plates. AAV or RAAV vectors were then thoroughly mixed with 0.5 mL of DMEM containing 2% FBS. The medium of the seeded cells was removed, and the cells were incubated with the mixed AAV or RAAV vectors at 37°C overnight. The infected cells were harvested at different time points and subjected to RNA and DNA analysis. As described above, the primer pair targeting the 5' end of the Cre coding sequence was used to detect specific Cre coding DNA and mRNA derived from the vector. Fluorescence photographs were taken every day after infection (pi), and fluorescence-positive cells were quantified by flow cytometry on the 5th day after infection.

[0527] The mRNA analysis results suggest that specific mRNA was detected from cells infected with RAAV at 2 hours after infection, peaked at 6 hours after infection, and then declined. In cells infected with conventional AAV vectors, no obvious transcription was detected at 2 hours after infection, but a rapid increase in transcribed mRNA was observed at 6 to 20 hours after infection, reaching a plateau phase at 30 hours. Contrary to the results of RAAV vectors, the mRNA level in cells infected with conventional AAV vectors did not decline after reaching a plateau phase. In all samples, the copy number of Cre mRNA was positively correlated with the MOI (Figures 14A-14B and Figure 15A). In addition, mGAPDH mRNA was tested as a reference transcript (housekeeping gene), and as expected, there was no difference in mGAPDH mRNA levels in all samples (Figure 15C).

[0528] The DNA and mRNA results are quite different. Conventional AAV and RAAV vectors have virtually the same DNA copy number pattern, with most of the DNA genome detected from infected cells at 2 hours after infection, and then increasing slightly from 2 hours to 20 hours after infection, which was very similar to the trend of mRNA levels in RAAV-infected cells. After that, the DNA level reached a plateau phase or slowly decreased. Cre DNA copy number also exhibited a positive correlation with MOI in all samples, but the Cre DNA number detected from RAAV-infected cells was much lower (the DNA copy number of RAAV-CCWM3S MOI=100 or 300 pairs was smaller than that of AAV-Cre MOI=1 pair, and the DNA copy number of RAAV-CCWM3S MOI=1000 pair was smaller than that of AAV-Cre MOI=3 pair) (Figure 14C and Figure 15B). Similarly, the DNA levels of another housekeeping gene, 36B4, were quantified as a reference gene, and as expected, no obvious differences in DNA levels were observed among all samples (FIG. 15D).

[0529] Since successful infection with AAV-Cre or RAAV-CCWM3S vectors leads to the expression of functional Cre recombinase and rescues tdTomato expression in Ai9-MEF cells, fluorescent photographs of infected cells were taken and analyzed to assess the infectivity of viral vectors by counting cells emitting tdTomato red fluorescence. The results show that the number of fluorescent positive cells generated by RAAV-CCWM3S is comparable to that generated by AAV-Cre with a 10-fold lower MOI (Figure 14D). The low fluorescence intensity of tdTomato in RAAV-infected cells may be due to the short life span of the Cre mRNA delivered therein and the limited amount of translated Cre recombinase cannot rescue the two copies of the tdTomato expression cassette in homo-Ai9-MEF cells (Figure 16).

[0530] Comparison of DNA titer and cell counting data suggests that the majority of tdTomato red fluorescent signal in RAAV-CCWM3S-infected cells was generated by RAAV particles carrying Cre mRNA.

[0531] In summary, the RAAV vectors of the present invention are capable of delivering functional Cre mRNA to cells and expressing functional Cre recombinase.

[0532] Example 8 Rapid transfer of functional genes into cells in vitro by RAAV particles To determine the exact life span of the Cre protein produced by AAV-Cre or RAAV-CCWM3S delivery in Example 7, 5 × 10 4 Ai9-MEF cells were seeded at cell confluence of 100 cells / well and incubated overnight with AAV-Cre (MOI=300) or RAAV-CCWM3S (MOI=10,000) vectors as described above. Cells were harvested at several time points post-infection and fluorescent photographs were taken before cell harvest.

[0533] In the case of AAV-Cre, Cre expression increased during the first 4 days, but then decreased. In contrast, a small amount of Cre was detected about 24 hours after RAAV-CCWM3S transfection and disappeared after 2 days. Such rapid expression and degradation may be due to the immediate appearance and short life span of the delivered functional Cre mRNA (Figures 17A and 17B).

[0534] Example 9 Rapid in vivo transfer of functional genes into Ai9 mice by RAAV particles This example demonstrates that RAAV particles are a tool for in vivo gene transfer and transiently express functional Cre recombinase.

[0535] To study the infectivity of RAAV particles in vivo, Ai9-mice (2.5-4 months old) were anesthetized and injected in vivo into the right hippocampus (coordinates are as follows: anterior-posterior (A / P) = -1.7 mm, mediolateral (M / L) = -1.0 mm, dorsoventral (D / V) = -2.1 mm) with 1 μL of AAV-Cre (pssAAV-Cre / DJ) (high dose: 1E9 vg / mouse, low dose: 3E6 vg / mouse) or 1 μL of RAAV-Cre (L-CCWM3S / DJ-MCP(Y156F)) (1E9 vg / mouse). AAV capsid-DJ was also used as a control in this assay.

[0536] Six weeks after AAV or RAAV injection, mice were anesthetized and perfused transcardially with PBS, pH 7.4, at room temperature, and then perfused with freshly prepared, cold 4% paraformaldehyde (PFA) in phosphate buffer (PB). Brains were post-fixed overnight in 4% PFA. Fixed brains were dehydrated, embedded in OCT, and cryosectioned. Brains were cut at a thickness of 20 μm using a freezing microtome (Leica CM1950), and sections were placed directly on glass slides. Slides were baked at 60°C for 1-2 h and then mounted with 5% BSA serum in PBS for 1 h. Slides were then incubated overnight at room temperature with anti-Cre primary antibody (10536, Cell Signaling Technology, diluted 1:800) in 5% BSA in PBS (0.1% Triton-X). After five washes with PBS, slides were incubated in 1% BSA in PBS containing the primary antibody and a secondary antibody against DAPI (D3571, Invitrogen). The secondary antibody used was Alexa Fluor 488 donkey anti-rabbit IgG (711-545-152, Jackson ImmunoResearch) (diluted 1:1000). Images were acquired with a Nikon C2si+ confocal microscope.

[0537] The images showing the fluorescence from the obtained tdTomato expression system suggest that RAAV-Cre infected cells in the Ai9-mouse hippocampus and rescued the expression of tdTomato. Under the same dosage, the number of infected cells in the RAAV-Cre group was less than that of the AAV-Cre group. However, compared to the low-dose group of AAV-Cre infection (30-fold lower dosage), RAAV-Cre infection generated more tdTomato-positive cells.

[0538] Interestingly, while Cre expression was readily detectable in both the high- and low-dose AAV-Cre infected groups, we did not detect any obvious Cre expression in RAAV-Cre infected cells, even though the presence of Cre was evidenced by the detected tdTomato fluorescence.

[0539] Overall, as shown in both fluorescent photographs (positive cell counts) at the same high dose of 1E9 vg / mouse (Figure 21A vs. Figure 21C), RAAV-Cre had lower transduction efficiency than conventional AAV-Cre because RAAV-Cre can transcribe multiple mRNAs for protein translation from the successfully transduced AAV DNA genome. To further evaluate the Cre expression level, we reduced the high dose AAV-Cre of 1E9 vg / mouse to a low dose of 3E6 vg / mouse and normalized the transduction efficiency of AAV-Cre to that of RAAV-Cre (Figure 21B), and the result showed that the transduction efficiency of RAAV-Cre was superior to that of the low dose AAV-Cre group as shown in the fluorescent photographs (positive cell counts), but no Cre expression was detected from RAAV-Cre infected cells compared to the AAV-Cre group, suggesting that Cre expression in the RAAV-Cre group was instantaneous but functional.

[0540] Example 10: Additional RPS / RBP Pairs for RAAV Systems In addition to the MS2 / MCP pair used in Examples 3-8, two additional RNA aptamer / aptamer-binding protein (or RNA packaging signal / RNA binding protein, herein "RPS / RBP") pairs were tested for RAAV packaging: (1) PP7 binding site / PP7 bacterial phage coat protein ("PP7 / PCP" or "PCP" or "P", or L-CCW P 3S) and (2) the Com binding site / phage COM protein ("com / COM" or "COM", or L-CCW CUnlike the natural viral packaging systems MS2 / MCP and PP7 / PCP, com / COM is not a natural viral packaging system but a transcriptional regulator known to function in the transcription initiation of the bacterial phage Mu mom gene.

[0541] A transgene plasmid carrying three copies of RPS (L-CCW P 3S and L-CCW C 3S) and its corresponding packaging plasmids [DJ-PCP(Y156F) with the PP7 bacterial phage coat protein (PCP) fused to the N-terminus of Rep78-Y156F and Rep68-Y156F, and DJ-COM(Y156F) with the phage COM protein (COM) fused to the N-terminus of Rep78-Y156F and Rep68-Y156F] were constructed. Viral particles were produced, purified, and titered as described in Example 3.

[0542] The results suggest that similar to the MS2 / MCP pair well-documented in each embodiment in Examples 3 to 8, the two pairs PP7 / PCP and com / COM also expand the scope of the various RAAV packaging systems by inducing significant RNA packaging in RAAV particles (Figure 18).

[0543] Example 11 Application of various AAV serotypes with the RAAV system To investigate the application of various AAV serotypes other than AAV-DJ tested in Examples 3-9 with the RAAV packaging system of the present invention, two pairs of RPS / RBP (MS2 / MCP and com / COM) in AAV-DJ and three other different AAV serotypes (AAV5, AAV8, and AAV9) were tested. Viral particles were produced, purified, and titrated as described in Example 3.

[0544] The RAAV-MS2 / MCP and RAAV-com / COM systems worked well in all four serotypes, suggesting the general applicability of the RAAV packaging system to different AAV serotypes (i.e., not limited to AAV-DJ). In the presence of RBP, the Cre RNA genome containing the corresponding RPS was efficiently encapsidated into the corresponding RAAV particle. The yield of RNA-packaged RAAV particles differed depending on the serotype, but RAAV5, RAAV8, and RAAV9 particles all had higher yields than RAAV-DJ (Figure 19).

[0545] Example 12. Improvement of RAAV yields with AAP and MCP fusion proteins Normally, AAV encodes a unique assembly activating protein (AAP) in its native viral genome, which is crucial for capsid assembly. In particular, AAP has been shown to be crucial for capsid protein stabilization and the generation of functional AAV particles.

[0546] AAP-MCP (with MCP fused to the C-terminus of AAP) or MCP-AAP (with MCP fused to the N-terminus of AAP) fusion protein expression cassettes were reverse-inserted into the backbone of the packaging plasmid DJ-MCP(Y156F) used in Examples 6-10, and the resulting constructs were designated DJ-MCP(Y156F)-AM and DJ-MCP(Y156F)-MA, respectively. These constructs then expressed both the MCP-Rep78 / 68(Y156F) fusion and the AAP-MCP or MCP-AAP fusion, and showed increased amounts of RNA-binding proteins (RBPs) that cooperated in RNA packaging compared to the MCP-Rep78 / 68 fusion alone. Viral particles were produced, purified, and titrated as described in Example 3.

[0547] As a result, the yield of RNA-packaged RAAV particles was increased by approximately 65% ​​and approximately 35% in DJ-MCP(Y156F)-MA and DJ-MCP(Y156F)-AM, respectively, compared to the MCP-Rep78 / 68 fusion alone (Figures 20A and 20B), suggesting that RBPs can be additionally fused to or associated with any other proteins that affect AAV particle packaging or assembly to enhance RNA packaging in RAAV particles.

[0548] It is also within the scope of the present invention to use AAP-MCP or MCP-AAP alone, without MCP-Rep78 / 68.

[0549] array Several sequences are provided below, including those sequences referenced in the Examples above.

[0550] [Table 4]

[0551] [Table 5]

[0552] [Table 6-1]

[0553] [Table 6-2]

[0554] [Table 6-3]

[0555] [Table 6-4]

[0556]

Table 6-5

[0557]

Table 6-6

[0558]

Table 6-7

[0559]

Table 6-8

[0560]

Table 6-9

[0561]

Table 6-10

[0562]

Table 7-1

[0563]

Table 7-2

[0564]

Table 8

[0565]

Table 9-1

[0566] [Table 9-2]

[0567] Incorporated by reference The entire disclosures of each patent document, including patent applications, scientific literature, government reports, websites, and other references cited herein, are hereby incorporated by reference in their entirety for all purposes. In the event of a conflict of terminology, the present specification controls. All sequence listings or SEQ ID NOs disclosed herein are hereby incorporated by reference in their entirety.

[0568] The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are expressly incorporated herein by reference:

[0569] Although illustrative embodiments of the present invention have been described herein, it should be understood that the invention is not limited to what has been described and that those skilled in the art could make various other changes and modifications without departing from the scope or spirit of the invention.

Claims

1. A ribonucleotide (RNA) capable of being packaged into a viral particle of a DNA virus, said RNA comprising: (1) an RNA sequence of interest (RSI); and (2) an RNA packaging signal (RPS) capable of interacting, directly or indirectly, with an RPS-interacting molecule that promotes packaging of the RNA into viral particles of the DNA virus; Including, Optionally, the RSI may be an RNA coding sequence of a gene of interest (GOI), an RNA encoding a protein, or a non-coding functional RNA, or a precursor thereof; Optionally, the GOI may encode a protein, an enzyme, a structural protein, an mRNA, a non-coding RNA (ncRNA), an siRNA, a piRNA, a small hairpin RNA or shRNA, a microRNA (miRNA) or a precursor thereof, a ribosomal RNA (rRNA), an antisense sequence or oligonucleotide (ASO), an RNA component of the CRISPR-Cas system, an rRNA, a tRNA, a snoRNA, a snRNA, an exRNA, a scaRNA, an lncRNA, an X-inactive specific transcript (Xist), or a HOT transcript antisense RNA (HOTAIR); Optionally, the protein may be a fluorescent protein, a therapeutic protein, an antigenic protein, or a gene-editing protein; Optionally, the enzyme may be a Cas protein or a CRISPR / Cas effector enzyme; Optionally, the RNA component of the CRISPR-Cas system may include a guide RNA (gRNA), a CRISPR RNA (crRNA), and / or a tracr RNA; Optionally, the protein-coding RNA may encode a therapeutic protein, an antigenic protein, or a gene-editing protein; Optionally, the gene-editing protein may be a CRISPR / Cas effector enzyme, a ZFN protein, or a TALEN protein; Optionally, the protein-coding RNA may be mRNA; Optionally, the non-coding functional RNA may be transfer RNA (tRNA), ribosomal RNA (rRNA), small interfering RNA (siRNA), small hairpin RNA (shRNA), antisense RNA, antisense oligonucleotide (ASO), microRNA (miRNA), or an RNA component of a CRISPR-Cas system; Optionally, the CRISPR-Cas system may include Cas9, Cas12, or Cas13; Optionally, the RPS may be capable of binding, directly or indirectly, to the RPS-interacting molecule; and / or Optionally, the DNA encoding the RNA or the reverse complement of the DNA has a reduced, attenuated, or substantially no ability to be packaged into viral particles of the DNA virus; Optionally, the DNA or its reverse complement lacks a DNA packaging signal; and / or Optionally, the RNA does not include a transcribed DNA packaging signal. The RNA.

2. The RNA of claim 1, wherein the DNA virus particle is an AAV virus particle or an oncolytic virus particle.

3. The RNA of claim 1 or 2, wherein the RPS is located at or near the 5' end of the RSI, at or near the 3' end of the RSI, or within the RSI.

4. the RNA comprises more than one, same or different, RPS; Two or more of the one or more RPSs are (1) adjacent to or tandemly linked to each other via the same or different linkers; or (2) are not adjacent to each other; The RNA according to any one of claims 1 to 3.

5. the DNA virus particle is an AAV virus particle; and The RPS comprises a transcribed modified AAV inverted terminal repeat (ITR), wherein the transcribed modified AAV ITR comprises: (a) contains a transcribed functional Rep binding element (RBE); (b) lacking a transcribed terminal release site (TRS) or a transcribed reverse complement TRS (rcTRS), or both; and (c) Transcribed D region sequence Including; Optionally, the transcribed modified AAV ITRs may be modified from the transcribed wild-type Flip or Flop ITRs; Optionally, the wild-type Flip or Flop ITR may be from AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAVrh74, AAV8, AAV9, AAV10, AAV11, AAV12, or AAV13; Optionally, the wild-type Flop ITR may have the nucleotide sequence of SEQ ID NO: 1; and / or Optionally, the transcribed modified AAV ITRs may have the nucleotide sequence of SEQ ID NO:

3. The RNA according to any one of claims 1 to 4.

6. the RPS comprises an MS2 sequence, a PP7 binding site, or a com binding site; and The RPS-interacting molecule comprises an RPS-interacting protein (RPSIP) capable of interacting directly or indirectly with the RPS; and Optionally, (a) the RPS may comprise an MS2 sequence and the RPSIP may comprise an MS2 coat protein (MCP) from a bacteriophage; (b) the RPS may comprise a PP7 binding site and the RPSIP may comprise a PP7 bacteriophage coat protein (PCP); or (c) the RPS may comprise a com binding site and the RPSIP may comprise a phage COM protein (COM); The RNA according to any one of claims 1 to 4.

7. said RPSIP is directly or indirectly associated with, and optionally fused to, a protein component of a viral packaging system of a viral particle of said DNA virus; Optionally, the protein components of the viral packaging system of the DNA virus viral particle may include Rep78 and / or Rep68 of adeno-associated virus 2 (AAV2), or assembly activating protein (AAP); The RNA according to any one of claims 1 to 6.

8. 2. The RNA of claim 1, wherein the RPS interacting molecule is or comprises Rep78, Rep68, Rep52, and / or Rep40; optionally, Rep78 and / or Rep68 may comprise a Y156F mutation.

9. (1) a transcribed transcriptional enhancer; (2) transcribed intron or exon sequences; (3) a 5′ UTR sequence; (4) a 3′ UTR sequence; (5) a polyA sequence, or a polyadenylation (polyA) signal sequence, and optionally a GU-rich region downstream of the polyA signal sequence; (6) post-transcriptional regulatory elements or sequences, and / or (7) Transcription termination sequence Further comprising: Optionally, the RNA may comprise an RPS located 3' of the post-transcriptional regulatory element or sequence, and 5' of the polyA sequence or polyA signal sequence. Naranibi / or Optionally, the RNA may include, in a 5' to 3' direction, the RSI, the optional transcribed Woodchuck Hepatitis Virus post-transcriptional regulatory element (WPRE) sequence; the RPS; and the polyA sequence or the polyA signal sequence. The RNA according to any one of claims 1 to 8.

10. the RNA is a single stranded RNA that is less than about 8,900 nucleotides in length, less than about 8,000 nucleotides in length, less than about 7,000 nucleotides in length, less than about 6,000 nucleotides in length, less than about 5,200 nucleotides in length, less than about 4,000 nucleotides in length, less than about 3,000 nucleotides in length, less than about 2,000 nucleotides in length, between about 4,700 and 5,200 nucleotides in length, between about 4,700 and 5,000 nucleotides in length, between about 4,700 and 4,800 nucleotides in length, or about 4,700 nucleotides in length; The RNA according to any one of claims 1 to 9.

11. A polynucleotide comprising a cassette encoding the RNA according to any one of claims 1 to 10, Optionally, the polynucleotide may be DNA; optionally, the DNA may be a DNA plasmid; optionally, the DNA plasmid may include a stuffer sequence in the backbone of the DNA plasmid; optionally, the functional DNA packaging signal may not be included; and / or, optionally, the functional DNA packaging signal may be AAV ITRs. The polynucleotide.

12. A recombinant DNA virus virus particle comprising an RNA transcribed from the polynucleotide of claim 1 or claim 12 packaged in a protein shell of the DNA virus; Optionally, the DNA virus particle may be AAV, and the recombinant DNA virus particle may be a recombinant RNA adeno-associated virus (rRAAV) particle, the recombinant RNA adeno-associated virus particle comprising: (1) an AAV capsid; and (2) The RNA packaged in the AAV capsid. may include; and / or Optionally, the AAV capsid may comprise a capsid from an AAV of serotype AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-DJ, AAV PHP.eB, Anc80L65, Anc80L65AAP, AAVrh74, or 7m8. A virus particle of the recombinant DNA virus.

13. A population of recombinant DNA virus particles comprising a plurality of recombinant DNA virus particles of claim 12, A population of recombinant DNA virus particles, wherein at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or more of the recombinant DNA virus particles in the population have the RNA packaged therein.

14. A host cell comprising an RNA according to any one of claims 1 to 10, a polynucleotide according to claim 11, an RNA transcribed from the polynucleotide according to claim 11, a virus particle of the recombinant DNA virus according to claim 12, and / or a population of virus particles of the recombinant DNA virus according to claim 13, Optionally, the cell may be a mammalian cell or an insect cell. The host cell.

15. 1. A method for producing ribonucleotides (RNA) capable of being packaged into viral particles of a DNA virus, the method comprising: (1) an RNA sequence of interest (RSI); and (2) an RNA packaging signal (RPS) capable of interacting, directly or indirectly, with an RPS-interacting molecule that promotes packaging of the RNA into viral particles of the DNA virus; and operably linking the RNA to the nucleic acid sequence of ... The method comprising:

16. 1. A method for producing recombinant DNA virus particles comprising ribonucleotides (RNA) packaged within a protein shell of the DNA virus particle, comprising: the RNA is capable of being packaged into a viral particle of the DNA virus; The RNA is (1) an RNA sequence of interest (RSI); and (2) an RNA packaging signal (RPS) capable of interacting, directly or indirectly, with an RPS-interacting molecule that promotes packaging of the RNA into viral particles of the DNA virus; Including, The method comprises contacting the RPS-interacting molecule with the RNA to promote packaging of the RNA into a protein shell of a viral particle of the DNA virus, thereby producing a recombinant DNA viral particle. The method.

17. 1. A system for packaging RNA into viral particles of a DNA virus, comprising: The system is (1) one or more proteins, or one or more coding sequences thereof, for assembling the protein shell of a viral particle of said DNA virus for packaging said RNA; (2) one or more proteins, or one or more coding sequences thereof, for promoting assembly of the protein shell and / or packaging of the RNA into the protein shell of a viral particle of the DNA virus; (3) an RPS-interacting molecule or its coding sequence; and (4) RNA according to any one of claims 1 to 10, RNA transcribed from the polynucleotide according to claim 11, or the polynucleotide according to claim 11; Including, Optionally, the ability of the viral packaging system to package DNA into viral particles of the DNA virus may be reduced, attenuated, or substantially eliminated, for example, by: (1) Removing part or all of a DNA packaging signal, e.g., an AAV ITR, in a polynucleotide encoding the RNA of any one of claims 1 to 10 or in a polynucleotide of claim 11; (2) modifying, e.g., mutating, one or more coding sequences of the AAV rep gene, the AAV cap gene, and / or one or more proteins required for AAV packaging to reduce, attenuate, or substantially eliminate the ability of the corresponding translated protein to promote packaging of the DNA sequence into viral particles of the DNA virus; and / or (3) Enlarging the size of a polynucleotide encoding the RNA according to any one of claims 1 to 10 or the polynucleotide according to claim 11; The system.

18. 1. A method for producing recombinant DNA virus particles or a population thereof, the method comprising: a) contacting a host cell with the system of claim 17 for a sufficient period of time; b) harvesting the produced viral particles or populations of the DNA virus; Including, Optionally, the method may further comprise isolating or purifying the recombinant DNA virus virus particles or population thereof. The method.

19. 1. A method for delivering a gene of interest (GOI) or an RNA sequence of interest (RSI) to a cell, plant, or animal, comprising: The method comprises contacting the cell, the plant or the animal with a recombinant DNA virus particle according to claim 12, a population of recombinant DNA virus particles according to claim 13, or a recombinant DNA virus particle or a population of recombinant DNA virus particles produced by the method of claim 16 or 18, The GOI is encoded by an RNA contained in the viral particle of the recombinant DNA virus, and the RSI is contained in an RNA contained in the viral particle of the recombinant DNA virus. However, the animal does not include humans. The method.

20. 19. A composition for use in the diagnosis, prevention or treatment of a disease, comprising a therapeutically effective amount or dosage of a recombinant DNA virus particle of claim 12, a population of recombinant DNA virus particles of claim 13, or a recombinant DNA virus particle or a population of recombinant DNA virus particles produced by the method of claim 16 or 18.

Images