Analysis of expression of protein-coding variants in cells

Abstract

Provided herein is an analysis of the expression of a protein-coding variant in a cell. The method can include replacing a protein-coding region of DNA in a cell with a donor vector that includes a variant of the protein-coding region and a first barcode that identifies the variant. The cell can produce an mRNA that includes an expression of the variant and an expression of the first barcode. A second barcode corresponding to the cell can be coupled to the mRNA. The mRNA with the second barcode coupled can be reverse transcribed into a complementary cDNA. The cDNA can be sequenced. Amplicon sequencing can be used to sequence the donor vector or the cDNA. The donor vector sequence and the cDNA sequence can be correlated to identify the variant and its expression by the cell.

Description

[Technical field]

[0001] (CROSS REFERENCE TO RELATED APPLICATIONS) This application claims the benefit of the following applications, the entire contents of each of which are incorporated herein by reference: U.S. Provisional Patent Application No. 63 / 158,492, filed March 9, 2021, entitled “Genomic library preparation and targeted epigenetic assays using Cas-gRNA ribonucleoproteins”; U.S. Provisional Patent Application No. 63 / 162,775, filed on March 18, 2021, entitled “Genomic library preparation and targeted epigenetic assays using Cas-gRNA ribonucleoproteins”; U.S. Provisional Patent Application No. 63 / 163,381, filed March 19, 2021, entitled “Genomic library preparation and targeted epigenetic assays using Cas-gRNA ribonucleoproteins,” and U.S. Provisional Patent Application No. 63 / 226,424, filed July 28, 2021, and entitled “Analyzing Expression of Protein-Coding Variants in Cells.”

[0002] FIELD OF THEINVENTION The present application relates to compositions and methods for analyzing protein-coding variants in cells.

[0003] (Description of sequence listing) The sequence listing associated with this application is provided in text format in lieu of a paper copy and is incorporated herein by reference. The name of the text file containing the sequence listing is 8549103716_SL.txt. The text file is approximately 5.73KB, was created on February 18, 2022, and has been submitted electronically via EFS-Web. [Background technology]

[0004] Specific phenotypic assays have been used to try to determine the function of variants or the effect of genome editing, but they have low throughput.For example, such assays may provide information about the function of only one variant or editing, but not about the function of other variants.Single-cell RNA sequencing (scRNA-seq) is commercially available and can be used to obtain and sequence transcriptomes from cells. Summary of the Invention

[0005] Provided herein is an analysis of the expression of protein-coding variants in cells.

[0006] Some examples herein provide a method of analyzing expression of a protein coding region of DNA in a cell. The method may include replacing the protein coding region of DNA in the cell with a donor vector that includes a variant of the protein coding region and a first barcode that identifies the variant. The cell may generate an mRNA that includes an expression of the variant and an expression of the first barcode. The method may include coupling a second barcode corresponding to the cell to the mRNA. The method may include reverse transcribing the mRNA with the second barcode coupled to it into cDNA. The method may include sequencing the cDNA. The method may include sequencing the donor vector or the cDNA using amplicon sequencing. The method may include correlating the donor vector sequence with the cDNA sequence to identify the variant and the expression of the variant by the cell.

[0007] In some examples, the donor vector comprises a promoter region. In some examples, the barcode is located between the promoter region and the variant. In some examples, the donor vector comprises a right homology arm and a left homology arm, and the variant and the first barcode are between the right homology arm and the left homology arm. In some examples, the promoter region comprises a reverse promoter region. In some examples, the reverse promoter region is located between the first barcode and the variant. In some examples, expression of the variant of the protein coding region is in a forward direction and expression of the first barcode is in a reverse direction.

[0008] Additionally or alternatively, in some examples, the method further comprises using a first polymerase chain reaction (PCR) process to generate a first amplicon of the donor sequence, the first amplicon including the variant, the first barcode, and the right homology arm, and substantially excluding the left homology arm. The method may comprise using a second PCR process to generate a second amplicon of the first amplicon, the first amplicon including the variant and the first barcode, and substantially excluding the right homology arm and the left homology arm. Additionally or alternatively, in some examples, sequencing the donor vector comprises sequencing the second amplicon. Additionally or alternatively, in some examples, the second amplicon has a length of about 1000 bases or less.

[0009] Additionally or alternatively, in some examples, the mRNA comprises a first mRNA molecule comprising an expression of the variant and a second mRNA molecule comprising an expression of the first barcode. In some examples, coupling the second barcode to the mRNA comprises coupling a first molecule of the second barcode to the first mRNA molecule and coupling a second molecule of the second barcode to the second mRNA molecule. Additionally or alternatively, in some examples, the cDNA comprises a first cDNA molecule comprising a reverse transcription of the variant and the second barcode and a second cDNA molecule comprising a reverse transcription of the protein coding region and the second barcode, and sequencing the cDNA comprises sequencing the first and second cDNA molecules.

[0010] Additionally or alternatively, in some examples, replacing the initial protein coding region includes cleaving the DNA of the cell using a CRISPR-associated protein guide RNA ribonucleoprotein (Cas-gRNA RNP) and using homology-directed repair (HDR) to repair the break in the DNA using a donor vector. In some examples, the method further includes inserting a first and a second plasmid into the cell. The donor vector can be located on the first plasmid. The cell can express the Cas-gRNA RNP using the second plasmid.

[0011] Additionally or alternatively, in some instances, the donor vector comprises a lentiviral vector.

[0012] Additionally or alternatively, in some examples, the donor vector further comprises a puromycin resistance gene and the method further comprises contacting the cells with puromycin to enrich for the cells. In some examples, the first barcode is located at a UTR end of the puromycin resistance gene.

[0013] Additionally, or alternatively, in some examples, the method further includes cleaving the first barcode from the variant in the cell.

[0014] Some examples herein provide a method of analyzing expression of a protein coding region of DNA in a population of cells. The method may include replacing an initial protein coding region of DNA in each of the cells with a donor vector that includes a variant of the protein coding region and a first barcode that identifies the variant. The cells may receive variants that differ from each other. The method may include obtaining mRNA from the cells. The mRNA from each cell may include expression of the variant of the protein coding region in the cell and expression of the first barcode. The method may include coupling to the mRNA from each cell a second barcode that corresponds to the cell. The method may include reverse transcribing the mRNA coupled with the second barcode into cDNA. The method may include sequencing the cDNA. The method may include sequencing the donor vector or the cDNA using amplicon sequencing. The method may include correlating the donor vector sequence with the cDNA sequence to identify the variant in each of the cells and expression of the variant by the cell.

[0015] In some instances, the different variants are subjected to saturation mutagenesis.

[0016] Some examples herein provide a collection of cells. The DNA of each cell in the collection can include a variant of a protein coding region and a first barcode that identifies the variant. The cells can have variants that differ from one another.

[0017] In some instances, the different variants are subjected to saturation mutagenesis.

[0018] Some examples herein provide a collection of polynucleotides from a collection of cells. The polynucleotides may include a first and a second mRNA molecule from each of the cells. For each cell, the first mRNA molecule includes a first molecule of a barcode corresponding to the cell and an expression of a variant in the cell, and the second mRNA molecule includes an expression of the barcode corresponding to the cell and the first barcode corresponding to the variant.

[0019] In some instances, the different variants are subjected to saturation mutagenesis.

[0020] Some examples herein provide a method. The method may include providing a barcoded homology donor vector that includes a semi-random barcode at the end of an exogenous transcript. The donor vector may include a homology arm and a mutation. The method may include knocking in the barcoded homology donor vector near the exon to be edited to create a mutation on the exon. The method may include using a CRISPR-associated protein guide RNA ribonucleoprotein (Cas-gRNA RNP) to cleave the mutation.

[0021] In some instances, the barcode is placed at the UTR end of the donor vector such that it can be expressed and detectable by scRNA-seq.

[0022] In some examples, the donor vector contains a puromycin resistance gene.

[0023] In some examples, providing a barcoded homology donor vector may include using a first polymerase chain reaction (PCR) to specifically amplify the knock-in region with the genome edited allele, using a second PCR using the product of the first PCR as a template to link the barcode to the variant in the amplicon, and performing amplicon sequencing using the product from the second PCR.

[0024] In some instances, amplicon sequencing covers both the barcode and the variant.

[0025] Some examples herein provide a method. The method may include adding semi-random mutant barcodes to the UTR region of a saturation mutagenized mutant library. The method may include coupling a cellular barcode to the mutant barcode. The method may include reading the mutant barcode with scRNA-seq. The method may include linking the mutant barcode to the library mutant using a separate sequencing operation.

[0026] In some examples, the semi-random mutant barcodes may be placed downstream of a promoter or upstream of a terminator of a mutant library.

[0027] In some examples, linking mutant barcodes to the variants of the library may include generating tiled polymerase chain reaction (PCR) amplicons by using one set of primers to amplify the barcode on one side and another set of primers to amplify the variant on the other side, such that each amplicon links a respective segment of the variant to the barcode.

[0028] Some examples herein provide lentiviral vectors that contain semi-random barcodes.

[0029] Some examples herein provide compositions comprising a plurality of lentiviral vectors, each of which comprises a different semi-random barcode.

[0030] In some examples, the composition further comprises a mutagenized saturation mutant library in contact with the plurality of lentiviral vectors.

[0031] It should be understood that any respective feature / example of each of the aspects of the present disclosure described herein may be implemented together in any suitable combination, and any feature / example from any one or more of these aspects may be implemented together in any suitable combination with any of the features of the other aspects described herein, in order to achieve the benefits described herein. [Brief description of the drawings]

[0032] [Figure 1A] 1 illustrates generally exemplary compositions and operations in a process flow for analyzing expression of protein-coding variants in cells. [Figure 1B] 1 illustrates generally exemplary compositions and operations in a process flow for analyzing expression of protein-coding variants in cells. [Figure 1C] 1 illustrates generally exemplary compositions and operations in a process flow for analyzing expression of protein-coding variants in cells. [Figure 1D] 1 illustrates generally exemplary compositions and operations in a process flow for analyzing expression of protein-coding variants in cells. [Figure 1E] 1 illustrates generally exemplary compositions and operations in a process flow for analyzing expression of protein-coding variants in cells.

[0033] [Diagram 2] 1 shows an operational flow diagram for an exemplary method for analyzing expression of protein-coding variants in cells.

[0034] [Figure 3A] FIG. 1 illustrates a schematic of exemplary compositions and operations in a process flow for random barcoded saturation genome editing for high-throughput protein-coding variant assays by single-cell RNA-seq (scRNA-seq). [Figure 3B]FIG. 1 illustrates a schematic of exemplary compositions and operations in a process flow for random barcoded saturation genome editing for high-throughput protein-coding variant assays by single-cell RNA-seq (scRNA-seq). [Figure 3C] FIG. 1 illustrates a schematic of exemplary compositions and operations in a process flow for random barcoded saturation genome editing for high-throughput protein-coding variant assays by single-cell RNA-seq (scRNA-seq).

[0035] [Figure 4A] FIG. 1 illustrates schematic diagrams of exemplary compositions and operations in a process flow for high-throughput protein-coding variant assays by single-cell RNA-seq (scRNA-seq) using a saturation mutagenized exogenous mutant library. [Figure 4B] FIG. 1 illustrates schematic diagrams of exemplary compositions and operations in a process flow for high-throughput protein-coding variant assays by single-cell RNA-seq (scRNA-seq) using a saturation mutagenized exogenous mutant library. [Figure 4C] FIG. 1 illustrates schematic diagrams of exemplary compositions and operations in a process flow for high-throughput protein-coding variant assays by single-cell RNA-seq (scRNA-seq) using a saturation mutagenized exogenous mutant library. [Figure 4D] FIG. 1 illustrates schematic diagrams of exemplary compositions and operations in a process flow for high-throughput protein-coding variant assays by single-cell RNA-seq (scRNA-seq) using a saturation mutagenized exogenous mutant library. [Figure 4E] FIG. 1 illustrates schematic diagrams of exemplary compositions and operations in a process flow for high-throughput protein-coding variant assays by single-cell RNA-seq (scRNA-seq) using a saturation mutagenized exogenous mutant library.

[0036] [Diagram 5] Next-generation sequencing results of PCR-amplified amplicons from edited genomes derived from a saturation genomics experiment targeting exon 7 of TP53 are shown.

[0037] [Figure 6] A lentiviral-based library using scRNA-seq as readout is shown. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0038] Provided herein is an analysis of the expression of protein-coding variants in cells.

[0039] Some examples herein relate to libraries of barcoded protein-coding variants. The variants of the library can be introduced into respective cells and single-cell RNA sequencing (scRNA-seq) can be used to analyze the expression of each variant in each cell. In parallel, the variants can be sequenced using DNA sequencing. Using different barcodes, the DNA sequence of each variant can be correlated with the expression of that variant by the corresponding cell as measured by scRNA-seq. In some examples, the barcoded variants in the library can be saturation mutagenized to mutagenize every base in the coding region of the protein to three other alternative bases, thereby generating up to nine different amino acids or stop codons for each codon. Thus, the expression resulting from every possible variant on the coding region of the gene can be analyzed. However, it will be understood that any appropriately genome-edited variant may be introduced and the resulting expression analyzed. Regardless of the particular type of barcoded variant used in the library, scRNA-seq and DNA sequencing can be used synergistically to analyze the expression of those variants by the cells in a scalable, highly multiplexed, high-throughput manner.

[0040] We first provide a brief overview of some of the terms used herein, then describe some exemplary procedures and compositions for generating and assaying libraries of protein-encoding variants.

[0041] term Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. The use of the term "including" and other forms such as "include", "includes" and "included" is not limiting. The use of the term "having" and other forms such as "have", "has" and "had" is not limiting. As used herein, whether in a transitional phrase or in the body of a claim, the terms "comprise" and "comprising" should be interpreted as having an open-ended meaning. That is, the above terms should be interpreted as synonymous with the phrase "having at least" or "comprising at least". For example, when used in the context of a process, the term "comprising" means that the process includes at least the recited steps, but may include additional steps. When used in the context of a compound, composition, or device, the term "comprising" means that the compound, composition, or device includes at least the recited features or components, but may include additional features or components.

[0042] As used herein, the singular forms "a," "an," and "the" include plural referents unless the content clearly dictates otherwise.

[0043] As used throughout this specification, the terms "substantially," "approximately," and "about" are used to describe and take into account small variations due to processing variations, etc. For example, they can refer to ±10% or less, such as ±5% or less, such as ±2% or less, such as ±1% or less, such as ±0.5% or less, such as ±0.2% or less, such as ±0.1% or less, such as ±0.05% or less.

[0044] As used herein, terms such as "hybridize" and "hybridization" are intended to mean non-covalent association of polynucleotides with each other along the length of the polynucleotides to form a duplex "duplex", a triplex "triple strand", or a higher order structure. For example, two DNA polynucleotide strands can associate through complementary base pairing to form a duplex. Primary interactions between polynucleotide strands are typically nucleotide base specific, e.g., A:T, A:U, and G:C, with Watson-Crick and Hoogsteen type hydrogen bonds. Base stacking and hydrophobic interactions can also contribute to duplex stability. Hybridization conditions can include salt concentrations of less than about 1 M, more typically less than about 500 mM, or less than about 200 mM. Hybridization buffers can include buffered salt solutions such as 5% SSPE, or other suitable buffers known in the art. Hybridization temperatures can be as low as 5° C., but are typically greater than 22° C., more typically greater than about 30° C., and typically greater than 37° C. The strength of association between a first and second polynucleotide increases with the complementarity between the nucleotide sequences within those polynucleotides. The strength of hybridization between polynucleotides can be characterized by the melting temperature (Tm) at which 50% of the polynucleotide strands of a duplex separate.

[0045] As used herein, the term "nucleotide" is intended to mean a molecule that includes a sugar and at least one phosphate group, and in some instances also includes a nucleobase. A nucleotide that lacks a nucleobase may be referred to as "abasic." Nucleotides include deoxyribonucleotides, modified deoxyribonucleotides, ribonucleotides, modified ribonucleotides, peptide nucleotides, modified peptide nucleotides, modified phosphate sugar backbone nucleotides, and mixtures thereof. Examples of nucleotides include adenosine monophosphate (AMP), adenosine diphosphate (ADP), adenosine triphosphate (ATP), thymidine monophosphate (TMP), thymidine diphosphate (TDP), thymidine triphosphate (TTP), cytidine monophosphate (CMP), cytidine diphosphate (CDP), cytidine triphosphate (CTP), guanosine monophosphate (GMP), guanosine diphosphate (GDP), guanosine triphosphate (GTP), uridine monophosphate (UMP), uridine diphosphate (UDP), uridine triphosphate (GT ... deoxyadenosine monophosphate (UTP), deoxyadenosine monophosphate (dAMP), deoxyadenosine diphosphate (dADP), deoxyadenosine triphosphate (dATP), and deoxythymidine monophosphate (DTMP).These include deoxythymidine diphosphate (dTMP), deoxythymidine diphosphate (dTDP), deoxythymidine triphosphate (dTTP), deoxycytidine diphosphate (dCDP), deoxycytidine triphosphate (dCTP), deoxyguanosine monophosphate (dGMP), deoxyguanosine diphosphate (dGDP), deoxyguanosine triphosphate (dGTP), deoxyuridine monophosphate (dUMP), deoxyuridine diphosphate (dUDP), and deoxyuridine triphosphate (dUTP).

[0046] As used herein, the term "nucleotide" is also intended to encompass any nucleotide analog, which is a type of nucleotide that contains a modified nucleobase, sugar, backbone and / or phosphate moiety compared to naturally occurring nucleotides. Nucleotide analogs may also be referred to as "modified nucleic acids." Exemplary modified nucleobases include inosine, xanthate, hypoxanthate, isocytosine, isoguanine, 2-aminopurine, 5-methylcytosine, 5-hydroxymethylcytosine, 2-aminoadenine, 6-methyladenine, 6-methylguanine, 2-propylguanine, 2-propyladenine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 15-halouracil, 15-halocytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil ... These include cytosine, 6-azothymine, 5-uracil, 4-thiouracil, 8-halo adenine or guanine, 8-amino adenine or guanine, 8-thiol adenine or guanine, 8-thioalkyl adenine or guanine, 8-hydroxyl adenine or guanine, 5-halo substituted uracil or cytosine, 7-methylguanine, 7-methyladenine, 8-azaguanine, 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, and the like. As is known in the art, certain nucleotide analogs cannot become incorporated into polynucleotides, such as nucleotide analogs such as adenosine 5'-phosphosulfate. A nucleotide can include any suitable number of phosphates, such as 3, 4, 5, 6, or more than 6 phosphates. Nucleotide analogs also include locked nucleic acids (LNA), peptide nucleic acids (PNA), and 5-hydroxybutynyl-2'-deoxyuridine ("Super T").

[0047] As used herein, the term "polynucleotide" refers to a molecule that comprises a sequence of nucleotides that are linked together. A polynucleotide is a non-limiting example of a polymer. Examples of polynucleotides include deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and their analogs, such as locked nucleic acid (LNA) and peptide nucleic acid (PNA). A polynucleotide can be a single-stranded sequence of nucleotides, such as RNA or single-stranded DNA, a double-stranded sequence of nucleotides, such as double-stranded DNA, or can comprise a mixture of single-stranded and double-stranded sequences of nucleotides. Double-stranded DNA (dsDNA) includes genomic DNA, and PCR and amplification products. Single-stranded DNA (ssDNA) can be converted to dsDNA and vice versa. A polynucleotide can include non-naturally occurring DNA, such as enantiomeric DNA, LNA, or PNA. The exact sequence of nucleotides in a polynucleotide can be known or unknown. The following are examples of polynucleotides: a gene or gene fragment (e.g., a probe, primer, expressed sequence tag (EST), or serial analysis of gene expression (SAGE) tag), genomic DNA, genomic DNA fragment, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, synthetic polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, primers, or amplified copies of any of the foregoing.

[0048] As used herein, "polymerase" is intended to mean an enzyme having an active site that assembles polynucleotides by polymerizing nucleotides into polynucleotides. A polymerase can bind to a primed single-stranded target polynucleotide and grow it by successively adding nucleotides to the primer to form a "complementary copy" polynucleotide with a sequence complementary to that of the target polynucleotide. Another polymerase, or the same polymerase, can then form a copy of the target nucleotide by forming a complementary copy of the complementary copy polynucleotide. A DNA polymerase can bind to a target polynucleotide and then move the target polynucleotide downstream while growing it by successively adding nucleotides to the free hydroxyl group at the 3' end of the polynucleotide chain (amplicon growth). A DNA polymerase can synthesize a complementary DNA molecule from a DNA template, and an RNA polymerase can synthesize an RNA molecule from a DNA template (transcription). A polymerase can use a short RNA or DNA strand (primer) to initiate strand growth. Some polymerases can displace the strand upstream of the site where they add a base to the strand. Such polymerases can also be said to be strand displacing, that is, have the activity of removing the complementary strand from the template strand that is read by the polymerase.

[0049] Examples of polymerases include Bst DNA polymerase, 9°Nm DNA polymerase, Phi29 DNA polymerase, DNA polymerase I (E. coli), DNA polymerase I (large), (Klenow) fragment, Klenow fragment (3'-5' exo-), T4 DNA polymerase, T7 DNA polymerase, Deep VentR™ (exo-) DNA polymerase, Deep VentR™ DNA polymerase, DyNAzyme™ EXT DNA, DyNAzyme™ II Hot Start DNA polymerase, Phusion™ High-Fidelity DNA polymerase, Therminator™ DNA polymerase, Therminator™ II DNA polymerase, VentR™ DNA polymerase, VentR™ (exo-) DNA polymerase, RepliPHI™ Phi29 DNA polymerase, rBst DNA polymerase, rBst Examples include DNA polymerase (large), fragment (IsoTherm™ DNA polymerase), MasterAmp™ AmpliTherm™ DNA polymerase, Taq DNA polymerase, Tth DNA polymerase, Tfl DNA polymerase, Tgo DNA polymerase, SP6 DNA polymerase, Tbr DNA polymerase, DNA polymerase beta, and ThermoPhi DNA polymerase. In specific, non-limiting examples, the polymerase is selected from the group consisting of Bst, Bsu, and Phi29. Since the polymerase extends the hybridized strand, it may be beneficial to include a single-stranded binding protein (SSB). The SSB may stabilize the displaced (non-template) strand. Exemplary polymerases with strand displacement activity include, but are not limited to, Bst (Bacillus stearothermophilus) polymerase, Exo-Klenow polymerase, or a large fragment of sequencing grade T7 exo-polymerase. Some polymerases cleave their preceding strand and effectively replace it with the growing strand (5' exonuclease activity).Some polymerases have activity that degrades their trailing strand (3' exonuclease activity). Some useful polymerases have been mutated or otherwise modified to reduce or eliminate 3' and / or 5' exonuclease activity.

[0050] As used herein, the term "primer" is defined as a polynucleotide to which nucleotides can be added via a free 3'OH group. A primer may contain a 3' block that inhibits polymerization until the block is removed. A primer may contain a modification at the 5' end to allow for a coupling reaction or to allow the primer to be coupled to another moiety. A primer may contain one or more moieties, such as, for example, 8-oxo-G, that can be cleaved under appropriate conditions, such as UV light, chemicals, enzymes, etc. The length of a primer may be any suitable number of bases long and may contain a suitable combination of natural and / or non-natural nucleotides. A target polynucleotide may contain an "amplification adaptor" or more simply an "adaptor" that hybridizes to the primer (having a sequence complementary to the primer) and can be amplified to generate a complementary copy polynucleotide by adding a nucleotide to the free 3'OH group of the primer.

[0051] As used herein, the term "plurality" is intended to mean a population of two or more distinct members. A plurality can range in size from small, medium, large, to very large. A small size plurality can range, for example, from a few members to tens of members. A medium size plurality can range, for example, from tens of members to about 100 members or hundreds of members. A large plurality can range, for example, from about hundreds of members to about 1000 members, thousands of members, and tens of thousands of members. A very large plurality can range, for example, from tens of thousands of members to about hundreds of thousands, millions, tens of millions, or hundreds of millions or more members. Thus, a plurality can range in size from 2 to well over 100 million members, as well as between all sizes measured by number of members and larger than the exemplary ranges listed above. Exemplary polynucleotides include, for example, about 1×10 5 That's it, 5 x 10 5 or more or 1×10 6 The term includes a population of more than one different polynucleotides. Thus, the definition of this term is intended to include all integer values ​​greater than 2. The upper limit of the plurality of values ​​can be set, for example, by the theoretical diversity of polynucleotide sequences in a sample.

[0052] As used herein, the term "duplex" when used in reference to a polynucleotide is intended to mean that all or substantially all of the nucleotides in a polynucleotide are hydrogen bonded to their respective nucleotides in a complementary polynucleotide. A duplex polynucleotide may also be referred to as "double stranded." As used herein, the term "single strand" when used in reference to a polynucleotide means that none of the nucleotides in a polynucleotide are hydrogen bonded to their respective nucleotides in a complementary polynucleotide.

[0053] As used herein, the term "target polynucleotide" is intended to mean a polynucleotide that is the subject of an analysis or action. The analysis or action may include subjecting the polynucleotide to capture, amplification, sequencing, and / or other procedures. The target polynucleotide may include additional nucleotide sequences to the target sequence being analyzed. For example, the target polynucleotide may include one or more adapters, including an amplification adapter that serves as a primer binding site that flanks the target polynucleotide sequence to be analyzed. The target polynucleotide hybridized to the primer may include nucleotides that extend beyond the 5' or 3' end of the oligonucleotide such that not all of the target polynucleotide becomes suitable for extension. In certain examples, the multiple target polynucleotides may have first and second adapters that are the same as each other, but may have different sequences from each other. The two adapters that may flank a particular target polynucleotide sequence may have the same sequence as each other, or complementary sequences to each other, or the two adapters may have different sequences. Thus, a species in the multiple target polynucleotides may include a region of known sequence flanked by a region of unknown sequence that is evaluated, for example, by sequencing (e.g., SBS). In some instances, the target polynucleotide carries an amplification adapter at a single end, and such adapter may be located at either the 3' or 5' end of the target polynucleotide. The target polynucleotide may be used without an adapter, in which case the primer binding sequence may directly use the sequence present in the target polynucleotide.

[0054] The terms "polynucleotide" and "oligonucleotide" are used interchangeably herein. The difference in the terminology is not intended to indicate any particular difference in size, sequence, or other properties, unless otherwise specified. For clarity of explanation, when describing a particular method or composition that includes several polynucleotide species, different terms may be used to distinguish one species of polynucleotide from another species.

[0055] The terms "sequence" and "subsequence" may in some cases be used interchangeably herein. For example, a sequence may include one or more subsequences therein. Each such subsequence may also be referred to as a sequence.

[0056] As used herein, the term "amplicon" when used in reference to a nucleic acid refers to a product of the replication of a nucleic acid, which product has a nucleotide sequence that is substantially the same as or complementary to at least a portion of the nucleotide sequence of the nucleic acid. "Amplification" and "amplifying" refer to the process of creating an amplicon of a polynucleotide. A first amplicon of a target polynucleotide can typically be a complementary copy. Additional amplicons are copies made from the target polynucleotide or the first amplicon after the generation of the first amplicon. Subsequent amplicons can have a sequence that is substantially complementary to or substantially identical to the target polynucleotide. It will be understood that a small number of mutations of a polynucleotide (e.g., due to amplification artifacts) may occur when generating an amplicon of that polynucleotide.

[0057] As used herein, terms such as "CRISPR-Cas system", "Cas-gRNA ribonucleoprotein", and Cas-gRNA RNP refer to an enzymatic system that includes a guide RNA (gRNA) sequence that includes an oligonucleotide sequence that is complementary or substantially complementary to a sequence in a target polynucleotide, and a Cas protein. CRISPR-Cas systems can generally be classified into three main types based on core element content and sequence, which are further subdivided into 10 subtypes; see, for example, Makarova et al., "Evolution and classification of the CRISPR-Cas systems," Nat Rev Microbiol. 9(6):467-477 (2011). Cas proteins can have various activities, such as nuclease activity. Thus, CRISPR-Cas systems provide a mechanism for targeting specific sequences (e.g., via gRNA) as well as certain enzymatic activities against the sequences (e.g., via Cas proteins).

[0058] Type I CRISPR-Cas systems can contain a Cas3 protein that has separate helicase and DNase activities. For example, in type 1-E systems, the crRNA is incorporated into a multisubunit effector complex called Cascade (CRISPR-associated complex for antiviral defense), which binds to target DNA and triggers its degradation by the Cas3 protein; see, e.g., Brouns et al., "Small CRISPR RNAs guide antiviral defense in prokaryotes", Science 321(5891):960-964(2008); Sinkunas et al., "Cas3 is a single-stranded DNA nuclease and ATP-dependent helicase in the CRISPR-Cas immune system", EMBO J 30:1335-1342(2011); and Beloglazova et al., "Structure and activity of the Cas3 HD nuclease MJ0384, an effector enzyme of the CRISPR interference, EMBO J 30:4616-4627 (2011). Type II CRISPR-Cas systems contain a signature Cas9 protein, a single protein (approximately 160 kDa) that can generate crRNA and cleave target DNA. Cas9 proteins typically contain two nuclease domains, a RuvC-like nuclease domain near the amino terminus and an HNH (or McrA-like) nuclease domain near the middle of the protein. Each nuclease domain of the Cas9 protein is specialized to cleave one strand of the double helix; see, e.g., Jinek et al., "A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity," Science 337(6096):816-821 (2012). Type III CRISPR-Cas systems contain a polymerase and a RAMP module.Type III systems can be further divided into subtypes III-A and III-B. Type III-A CRISPR-Cas systems have been shown to target plasmids, and the polymerase-like protein of the type III-A system is responsible for cleaving the target DNA; see, e.g., Marraffini et al., "CRISPR interference limits horizontal gene transfer in Staphylococci by targeting DNA," Science 322(5909):1843-1845(2008). Type III-B CRISPR-Cas systems have also been shown to target RNA; see, e.g., Hale et al., "RNA-guided RNA cleavage by a CRISPR-RNA-Cas protein complex," Cell 139(5):945-956(2009). CRISPR-Cas systems include engineered and / or programmed nuclease systems derived from naturally occurring CRISPR-Cas systems. The CRISPR-Cas system may include engineered and / or mutated Cas proteins. The CRISPR-Cas system may include engineered and / or programmed guide RNAs.

[0059] In some specific examples, the Cas protein in one of the Cas-gRNA RNPs of the invention can include Cas9, or other suitable Cas capable of cleaving a target polynucleotide at a sequence to which the gRNA is complementary, in a manner as described in the following references, the entire contents of each of which are incorporated herein by reference: Nachmanson et al., "Targeted genome fragmentation with CRISPR / Cas9 enables fast and efficient enrichment of small genomic regions and ultra-accurate sequencing with low DNA input (CRISPR-DS)", Genome Res. 28(10):1589-1599 (2018); Vakulskas et al., "A high-fidelity Cas9 mutant delivered as a ribonucleoprotein complex enables efficient gene editing in human hematopoietic stem and progenitor cells", Nature Medicine 24:1216-1224 (2018); Chatterjee et al., "Minimal PAM specificity of a highly similar SpCas9 ortholog”, Science Advances 4(10):eaau0766,1-10(2018); Lee et al., “CRISPR-Cap: multiplexed double-stranded DNA enrichment based on the CRISPR system”, Nucleic Acids Research 47(1):1-13(2019). The Cas9-crRNA complex isolated from the S. thermophilus CRISPR-Cas system, as well as a complex assembled in vitro from separate elements, demonstrate that it binds to both synthetic oligodeoxynucleotides and plasmid DNA bearing nucleotide sequences complementary to the crRNA.Cas9 has two nuclease domains, RuvC and HNH active site / nuclease domain, which have been shown to be involved in cleaving opposite DNA strands. In some instances, the Cas9 protein is derived from the Cas9 protein of the S. thermophilus CRISPR-Cas system. In some instances, the Cas9 protein is a multi-domain protein with approximately 1,409 amino acid residues.

[0060] In other examples, the Cas may be engineered to not cleave the target polynucleotide at a sequence to which the gRNA is complementary, e.g., in a manner as described in the following references, the entire contents of each of which are incorporated herein by reference: Guilinger et al., "Fusion of catalytically inactive Cas9 to Fokl nuclease improves the specificity of genome modification," Nature Biotechnology 32:577-582 (2014); Bhatt et al., "Targeted DNA transposition using a dCas9-transposase fusion protein," https: / / doi.org / 10.1101 / 571653, pages 1-89 (2019); Xu et al., "CRISPR-assisted targeted enrichment-sequencing (CATE-seq)," available at URL www.biorxiv.org / content / 10.1101 / 672816v1, 1-30 (2019); and Tijan et al. al., "dCas9-targeted locus-specific protein isolation method identifies histone gene regulators," PNAS 115(12):E2734-E2741 (2018). A Cas lacking nuclease activity may be referred to as an inactivated Cas (dCas). In some examples, dCas may include a nuclease-deficient mutant of a Cas9 protein in which both the RuvC and HNH active site / nuclease domains are mutated. A nuclease-deficient mutant of a Cas9 protein (dCas9) binds to double-stranded DNA but does not cleave the DNA. Another mutant of a Cas9 protein has two inactivated nuclease domains, with a first mutation in the domain that cleaves the strand complementary to the crRNA and a second mutation in the domain that cleaves the strand non-complementary to the crRNA. In some examples, the Cas9 protein has a first mutation D10A and a second mutation H840A.

[0061] In yet another example, the Cas protein comprises a Cascade protein. The Cascade complex of E. coli recognizes double-stranded DNA (dsDNA) targets in a sequence-specific manner. The Cascade complex of E. coli is a 405 kDa complex that contains five functionally essential CRISPR-associated (Cas) proteins (CasA1B2C6D1E1, also called Cascade proteins) and a 61-nucleotide crRNA. The crRNA guides the Cascade complex to the dsDNA target sequence by forming base pairs with the complementary DNA strand while displacing the non-complementary strand to form an R-loop. Cascade recognizes target DNA without consuming ATP, suggesting that continuous invader DNA surveillance occurs without energy investment; see, e.g., Matthijs et al., "Structural basis for CRISPR RNA-guided DNA recognition by Cascade," Nature Structural & Molecular Biology 18(5):529-536 (2011). In yet another example, the Cas protein includes a Cas3 protein. In one example, E. coli Cas3 can catalyze ATP-independent annealing of RNA and DNA to form R-loops and RNA base-pair hybrids to double-stranded DNA. Cas3 proteins can use longer gRNAs than Cas9; see, e.g., Howard et al., "Helicase disassociation and annealing of RNA-DNA hybrids by Escherichia coli Cas3 protein," Biochem J. 439(1):85-95 (2011). Such longer gRNAs may allow other elements to more easily access the target DNA, such as the primer that is extended by the polymerase. Another feature provided by the Cas3 protein is that it does not require a PAM sequence like Cas9, thus providing more flexibility to target the desired sequence.R-loop formation by Cas3 can utilize magnesium as a cofactor; see, e.g., Howard et al., "Helicase disassociation and annealing of RNA-DNA hybrids by Escherichia coli Cas3 protein," Biochem J. 439(1):85-95 (2011). It will be understood that any suitable cofactor, such as a cation, can be used with the Cas proteins used in the compositions and methods of the invention.

[0062] It should also be understood that any CRISPR-Cas system capable of disrupting a double-stranded polynucleotide and creating a loop structure may be used. For example, Cas proteins can include, but are not limited to, Cas proteins as described in the following references, the entire contents of each of which are incorporated herein by reference: Haft et al., "A guild of 45 CRISPR-associated (Cas) protein families and multiple CRISPR / Cas subtypes exist in prokaryotic genomes", PLoS Comput Biol. 1(6):e60,1-10 (2005); Zhang et al., "Expanding the catalog of cas genes with metagenomes", Nucl. Acids Res. 42(4):2448-2459 (2013); and Strecker et al., "RNA-guided DNA insertion with CRISPR-associated transposases", Science 365(6448):48-53 (2019) (Cas proteins can include CasK12). Some of these CRISPR-Cas systems may utilize specific sequences to recognize and bind to target sequences, for example, Cas9 may utilize the presence of a 5'-NGG protospacer adjacent motif (PAM).

[0063] The CRISPR-Cas system may also include an engineered and / or programmed guide RNA (gRNA). As used herein, the terms "guide RNA" and "gRNA" (sometimes referred to in the art as single guide RNA or sgRNA) are intended to mean an RNA that includes a sequence that is complementary or substantially complementary to a region of a target DNA sequence and that guides a Cas protein to that region. A guide RNA may include nucleotide sequences in addition to the nucleotide sequence that is complementary or substantially complementary to a region of a target DNA sequence.Methods for designing gRNAs are well known in the art, and non-limiting examples are provided in the following references, the entire contents of each of which are incorporated herein by reference: Stevens et al., "A novel CRISPR / Cas9 associated technology for sequence-specific nucleic acid enrichment," PLoS ONE 14(4):e0215441, pages 1-7 (2019); Fu et al., "Improving CRISPR-Cas nuclease specificity using truncated guide RNAs, Nature Biotechnology 32(3):279-284 (2014); Kocak et al., "Increasing the specificity of CRISPR systems with engineered RNA secondary structures," Nature Biotechnology 37:657-666 (2019); Lee et al., "CRISPR-Cap: multiplexed double-stranded DNA enrichment based on the CRISPR system," Nucleic Acids Research 47(1):e1,1-13(2019); Quan et al., “FLASH: a next-generation CRISPR diagnostic for multiplexed detection of antimicrobial resistance sequences”, Nucleic Acids Research 47(14):e83,1-9(2019); and Xu et al., “CRISPR-assisted targeted "enrichment-sequencing(CATE-seq)", https: / / doi.org / 10.1101 / 672816,1-30(2019).

[0064] In some examples, the gRNA comprises a chimera, e.g., a CRISPR RNA (crRNA) fused to a transactivating CRISPR RNA (tracrRNA). Such chimeric single guide RNAs (sgRNAs) are described in Jinek et al., "A programmable dual-RNA-guided endonuclease in adaptive bacterial immunity," Science 337(6096):816-821 (2012). The Cas protein can be directed by the chimeric sgRNA to any genomic locus followed by a 5'-NGG protospacer adjacent motif (PAM). In one non-limiting example, the crRNA and tracrRNA can be synthesized by in vitro transcription using a synthetic double-stranded DNA template containing a T7 promoter. The tracrRNA may have a fixed sequence, but the target sequence may determine part of the sequence of the crRNA. Equimolar concentrations of the crRNA and tracrRNA may be mixed and heated at 55°C for 30 seconds. Cas9 can be added at the same molar concentration and incubated with the RNA mix for 10 min at 37 °C. A 10-20 fold molar excess of the resulting Cas9-gRNA RNP may then be added to the target DNA. The binding reaction can occur within 15 min. Other suitable reaction conditions can easily be used.

[0065] As used herein, the term "nuclease" is intended to mean an enzyme that can cleave the phosphodiester bond between the nucleotide subunits of a polynucleotide. The term "endonuclease" refers to an enzyme that can cleave the phosphodiester bond in a polynucleotide chain, and the term "nickase" refers to an endonuclease that cleaves only one strand of a DNA duplex. The term "Cas9 nickase" refers to a nickase that is typically derived from a Cas9 protein by inactivating one nuclease domain of the Cas9 protein.

[0066] In the context of polynucleotides, the terms "variant" and "derivative" as used herein refer to a polypeptide, including a polypeptide or a fragment of a polypeptide, that has been altered by the introduction of substitutions, deletions, or additions of amino acid residues. A variant or derivative of a polypeptide may be a fusion protein that includes a portion of the amino acid sequence of the polypeptide. In the context of a polypeptide, the terms "variant" or "derivative" as used herein also refer to a polypeptide or a fragment of a polypeptide that has been chemically modified, for example, by the covalent attachment of any type of molecule to the polypeptide. For example, but not limited to, a polypeptide or a fragment of a polypeptide can be chemically modified, for example, by glycosylation, acetylation, pegylation, phosphorylation, amidation, derivatization with known protecting / blocking groups, proteolytic cleavage, attachment to cellular ligands or other proteins, etc. A variant or derivative is modified in a manner that differs from the starting peptide or polypeptide, either in the type or location of the attached molecule, which is naturally occurring or different from the starting peptide or polypeptide. A variant or derivative further includes the deletion of one or more chemical groups that are naturally occurring on the peptide or polypeptide. A variant or derivative of a polypeptide or a fragment of a polypeptide can be chemically modified by chemical modification using techniques known to those skilled in the art, including, but not limited to, specific chemical cleavage, acetylation, formulation, metabolic synthesis of tunicamycin, etc. Additionally, a variant or derivative of a polypeptide or a fragment of a polypeptide can contain one or more non-classical amino acids. A variant or derivative of a polypeptide can have a similar or identical function as a polypeptide or a fragment of a polypeptide described herein. A variant or derivative of a polypeptide can have additional or different functions compared to a polypeptide or a fragment of a polypeptide described herein.

[0067] As used herein, the term "sequencing" is intended to mean determining the sequence of a polynucleotide. Sequencing may include one or more of sequencing by synthesis (SBS), bridge PCR, chain termination sequencing, sequencing by hybridization, nanopore sequencing, and sequencing by ligation.

[0068] As used herein, the term "species-specific repetitive element" is intended to mean a repetitive sequence that is present in a polynucleotide of a given species and may not be present in a polynucleotide of another species. A species with multiple chromosomes (e.g., mammals, e.g., humans) may contain different species-specific elements on each chromosome, or may contain the same species-specific elements on each chromosome, or a mixture of the same and different species-specific elements on each chromosome. An example of a species-specific repetitive element is a photospacer adjacent motif or PAM sequence (e.g., NGG). The gRNA of the Cas-gRNA RNP may have a sequence that hybridizes to the species-specific repetitive element.

[0069] As used herein, the terms "molecular barcode" and "UMI" are intended to mean an oligonucleotide that can be coupled to a polynucleotide and through which the polynucleotide can be identified. For example, a set of different UMIs can be coupled to multiple different polynucleotides, each of which can be identified with a particular UMI coupled to the polynucleotide.

[0070] As used herein, "selective" for an element is intended to mean that it couples to its target and does not couple to a different element. For example, a Cas-gRNA RNP that is selective for a species-specific repeat element may couple to that species-specific repeat element and not to a different species-specific repeat element. When used in reference to guide RNAs or other polynucleotides, terms such as "target-specific" and "selective" are intended to mean a polynucleotide that contains a sequence that is specific (substantially complementary and capable of hybridizing) to a sequence in another polynucleotide.

[0071] As used herein, the terms "complementary" and "substantially complementary," when used in reference to a polynucleotide, are intended to mean that the polynucleotide comprises a sequence that is capable of selectively hybridizing to a sequence in another polynucleotide under specified conditions.

[0072] As used herein, terms such as "amplification" and "amplifying" refer to the use of any suitable amplification method to generate polynucleotide amplicons. Polymerase chain reaction (PCR) is one non-limiting amplification method. Other suitable amplification methods known in the art include, but are not limited to, rolling circle amplification, riboprimer amplification (e.g., as described in U.S. Patent Application No. 7,413,857), ICAN, UCAN, ribospia, end tagging (e.g., as described in U.S. Patent Application Publication No. 2005 / 0153333), and Eberwine-type aRNA amplification or strand displacement amplification. Further non-limiting examples of amplification methods are described in WO 02 / 16639, WO 00 / 56877, Australian Patent Application Publication No. 00 / 29742, U.S. Patent No. 5,523,204, U.S. Patent No. 5,536,649, U.S. Patent No. 5,624,825, U.S. Patent No. 5,631,147, U.S. Patent No. 5,648,211, U.S. Patent No. 5,733,752, U.S. Patent No. 5,744,311, U.S. Patent No. 5,756,702, U.S. Patent No. 5,916,779, U.S. Patent No. 6,238,868, U.S. Patent No. 6,309,833, U.S. Patent No. 6,326,173, U.S. Patent No. 5,847,41 ...916,779, U.S. Patent No. 6,238,868, U.S. Patent No. 6,309,833, U.S. Patent No. 6 Nos. 9,547, 5,874,260, 6,218,151, 5,786,183, 6,087,133, 6,214,587, 6,063,604, 6,251,639, 6,410,278, WO 00 / 28082, 5,591,609, 5,614,389, 5,773,733, 5,834,202, 6,448,017, 6,124,120 and 6,280,949.

[0073] The terms "polymerase chain reaction" and "PCR" as used herein refer to a procedure in which small amounts of polynucleotides, such as RNA and / or DNA, are amplified. Generally, amplification primers are coupled to polynucleotides for use during PCR. See, for example, the following references, the entire contents of which are incorporated herein by reference: Mullis, U.S. Pat. No. 4,683,195; Mullis et al., Cold Spring Harbor Symp. Quant. Biol., 51:263 (1987); and Erlich, ed., PCR Technology, (Stockton Press, NY, 1989). As known to those skilled in the art, a wide variety of enzymes and kits are available for performing PCR. For example, in some instances, PCR amplification is performed using either the FAILSAFE™ PCR System or the MASTERAMP™ Extra-Long PCR System from EPICENTRE Biotechnologies, Inc., Madison, Wisconsin, USA, as described by the manufacturer.

[0074] As used herein, terms such as "ligation" and "ligating" are intended to mean forming a covalent bond or linkage between the ends of two or more polynucleotides. The nature of the bond or linkage can vary widely, and ligation can be performed enzymatically or chemically. Ligation may be performed enzymatically to form a phosphodiester bond between the 5' carbon terminal nucleotide of one oligonucleotide and the 3' carbon of another nucleotide. Template-driven ligation reactions are described in the following references, the contents of each of which are incorporated herein by reference in their entirety: U.S. Pat. No. 4,883,750, U.S. Pat. No. 5,476,930, U.S. Pat. No. 5,593,826, and U.S. Pat. No. 5,871,921. Ligation may also be performed using non-enzymatic formation of phosphodiester bonds or formation of non-phosphodiester covalent bonds between the ends of polynucleotides, such as phosphorothioate bonds, disulfide bonds, etc.

[0075] The term "variant," in the context of polynucleotides, is intended to mean that a given polynucleotide has a sequence that differs by at least one base from the sequence of another polynucleotide, such as the original genomic sequence.

[0076] As used herein, the term "saturation mutagenized" is intended to mean that every base in a gene has been replaced with three other bases.

[0077] As used herein, the term "library" is intended to mean a collection of polynucleotides or a plurality of polynucleotides that share a common sequence at the 5' end and a common sequence at the 3' end, and have different sequences between these common sequences. As an example, a library of saturation mutagenized polynucleotides refers to a collection of polynucleotides that share a common sequence at the 5' end and a common sequence at the 3' end, and all bases in a given gene in these polynucleotides are replaced with three other bases. As another example, a library of genome-edited polynucleotides refers to a collection of polynucleotides that share a common sequence at the 5' end and a common sequence at the 3' end, and different polynucleotides among these polynucleotides are genome-edited in different ways.

[0078] Analysis of expression of protein-coding variants in cells Currently available mutant assays can be low throughput. For example, currently available approaches to assay mutants with unknown functions are limited by specific phenotypic assays. Such approaches may provide limited information about mutants, and may be difficult to scale up to many genes in a high throughput manner, since each gene requires a different assay. We are not aware of any studies that use scRNA-seq as a readout for saturation edited mutants.

[0079] In comparison, some examples herein may provide high-throughput mutant assays using scRNA-seq with saturation edited genes. These examples use scRNA-seq as a readout for genome editing that provides rich information from many genes and / or pathways on molecular, cellular and organismal phenotypes, is generalizable to all genes, and provides significantly finer information on mutant function. As provided herein, scRNA-seq can be used as a readout for mutant function in a general workflow for any exonic mutation in a gene. For example, the inventors recognized that a challenge of using scRNA-seq for high-throughput mutant assays is how to link (associate) cellular barcodes to mutants for large sets of mutants, especially exons far from the transcription end. As provided herein, knock-in mutagenesis can be used to link cellular barcodes to edited mutants at the same time as creating edited mutant alleles.

[0080] Some examples herein show that a barcoded saturation mutagenized mutant library can be introduced into cells and the mutant effect can be assayed using scRNA-seq as a readout. In this approach, every base in the coding region of a protein can be mutagenized to three other alternative bases, generating up to nine different amino acids or stop codons for each codon. Thus, the functional impact of every possible mutant on the coding region of any gene can be assayed. For example, the inventors recognized that a challenge of using scRNA-seq for high-throughput mutant assays is how to link the cellular barcode to the mutants in the case of a large set of mutants. As provided herein, a randomly barcoded vector can be used to barcode each mutant on the UTR region and the mutant barcode can be read out with scRNA-seq. Separate sequencing (amplicon sequencing or long-read sequencing) can be used to link the mutant barcode to the mutant.

[0081] 1A-1E are schematic diagrams illustrating exemplary compositions and operations in a process flow for analyzing expression of protein-coding variants in cells. The composition 101 shown in FIG. 1A includes cells 111 and 112 in which it is desired to analyze expression of different protein-coding variants. For example, the cells 111 and 112 may initially include the same protein-coding region 130, in one example, the same DNA sequence S1, which includes a naturally occurring protein-coding region. Expression of the region 130 in the cells may be characterized, and it may be desirable to determine the effect, if any, of changes in the DNA sequence of the protein-coding region on expression of the protein-coding region by the cells. As provided herein, the protein-coding region 130 in the cells 111, 112 may be replaced using donor vectors 121, 122 that include a variant of the protein-coding region and a first barcode that identifies the variant. In one example, the composition 101 may include the vectors 121, 122 that are contacted with the cells 111, 112. Although FIG. 1A shows the use of two cells and two vectors for simplicity, it will be understood that the procedures and compositions as described with reference to FIGS. 1A-1E may be used with any suitable number of cells and any suitable number of vectors, e.g., any suitable combination of 1 cell, or more than 1 cell, or more than 10 cells, or more than 100 cells, or more than 1,000 cells, or more than 10,000 cells, or more than 100,000 cells, and 1 vector, or more than 1 vector, or more than 10 vectors, or more than 100 vectors, or more than 1,000 vectors, or more than 10,000 vectors, or more than 100,000 vectors.

[0082] As shown in the composition 102 of FIG. 1B, the vectors 121, 122 of FIG. 1A can be used to replace the protein coding region 130 in each of the cells 111, 112 of FIG. 1A with respective variants 131, 132 that include a sequence that differs from the protein coding region 130 by at least one base, as shown in the composition 102 of FIG. 1B. Additionally, the vectors 121, 122 can be used to insert respective first barcodes 141, 142 into the DNA of the cells 111, 112 that correspond to the variants. If desired, further portions 150 of the vector (e.g., one or more further bases on either side of the variants 131, 132, on either side of the first barcodes 141, 142, and / or between the variant and its respective barcode) can also be inserted into the DNA of the cells 111, 112. As a result of replacing the protein coding region 130 with the respective variants and inserting the respective barcodes into the DNA sequence S1, the cells 111, 112 can have sequences that differ from each other. For example, cell 111 may include a DNA sequence S1' that includes variant 131 and first barcode 141, and cell 112 may include a DNA sequence S1'' that includes variant 132 and first barcode 142. Variant 131 may have a different sequence than variant 132, and first barcode 141 may have a different sequence than first barcode 142. Non-limiting examples of vectors and procedures for replacing coding regions with respective variants coupled to barcodes are described elsewhere herein, for example with reference to Figures 3A-C and 4A-E.

[0083] As shown in composition 103 of FIG. 1C, cells 111, 112 may express DNA sequences S1′, S1″ to produce mRNAs that include an expression of variants 131, 132 and a corresponding expression of first barcodes 141, 142, respectively. In one example, cell 111 may express sequence S1′ as an mRNA molecule M1 that includes an expression 131′ of variant 131, and as an mRNA molecule M2 that includes an expression 141′ of first barcode 141. Similarly, cell 112 may express sequence S1″ as an mRNA molecule M3 that includes an expression 132′ of variant 132, and as an mRNA molecule M4 that includes an expression 142′ of first barcode 142. It will be appreciated that since variants 131 and 132 have different sequences from each other, cells 111 and 112 may express those sequences differently from each other. For example, sequence differences between variants 131 and 132 may have different effects on regulating gene expression in the respective cells, and it may be desirable to analyze such effects and compare such effects with each other. Because some or all of the variants may have initially unknown functions, such information can be used to understand the function of the variants, to increase the feasibility of genomics for disease diagnosis and treatment, and / or to speed up the drug discovery process.

[0084] The respective sequences of the variants and the mRNAs generated by the expression of the variants by the cells can be correlated. In some examples, the sequence of the mRNA is determined using single cell RNA sequencing (scRNA-seq). scRNA-seq can include coupling a second barcode corresponding to the cell to the mRNA. For example, as shown in FIG. 1D, a barcode molecule 161 corresponding to the cell 111 can be coupled to an mRNA molecule M1 to form a molecule M1' that includes the expressed variant 131', and another barcode molecule 161 corresponding to the cell 111 can be coupled to an mRNA molecule M2 to form a molecule M2' that includes the expressed first barcode 141'. Further, a barcode molecule 162 corresponding to the cell 112 can be coupled to an mRNA molecule M3 to form a molecule M3' that includes the expressed variant 132', and another barcode molecule 162 corresponding to the cell 112 can be coupled to an mRNA molecule M4 to form a molecule M4' that includes the expressed first barcode 142'. Note that barcodes 141', 142' are internal to the respective transcripts M2', M4', and barcodes 161, 162 are coupled to the ends of the respective transcripts M1', M2', M3', M4'. Optionally, barcodes can be coupled to the mRNA molecules as part of the process to release the mRNA from the respective cells. The mRNA molecules can then be pooled together, such as composition 104 shown in FIG. 1D.

[0085] The mRNAs coupled with each second barcode can be reverse transcribed into complementary cDNAs, for example, as another scRNA-seq operation. For example, as shown in FIG. 1E, the mRNA molecule M1' can be reverse transcribed into a cDNA molecule M1'' containing the cDNA 131'' of the expressed variant 131' of FIG. 1D, and the mRNA molecule M2' can be reverse transcribed into a cDNA molecule M2'' containing the cDNA 141'' of the expressed first barcode 141' of FIG. 1D. Similarly, the mRNA molecule M3' can be reverse transcribed into a cDNA molecule M3'' containing the cDNA 132'' of the expressed variant 132' of FIG. 1D, and the mRNA molecule M4' can be reverse transcribed into a cDNA molecule M4'' containing the cDNA 142'' of the expressed first barcode 142' of FIG. 1D.

[0086] The resulting cDNA can then be sequenced, for example, as another scRNA-seq operation. In this regard, it is noted that the scRNA-seq operation as described with reference to Figures 1D-1E may be performed using known techniques, and indeed may optionally be performed using commercially available technologies such as CHROMIUM Single Cell 3'Solution available from 10x Genomics (Pleasanton, Calif., USA). Furthermore, the donor vectors 121, 122, the mutation library DNAs S1', S1'', and / or the cDNAs M1'', M2'', M3'', M4'' may be sequenced using known techniques such as amplicon sequencing, which utilizes sequencing by synthesis (SBS) of amplicons to link the variants 131, 132 to their respective variant barcodes 141, 142. Such amplicon sequencing may be performed in a manner as described with reference to Figure 4C, and SBS may, if desired, be performed using commercially available technology (e.g., the MISEQ System available from Illumina, Inc. (San Diego, Calif., USA)).

[0087] The donor vector sequence and the cDNA sequence can be correlated to identify variants and their expression by the cell. For example, referring to FIG. 1E, although cDNA molecules M1'', M2'', M3'', M4'' are pooled, the same barcode 161' is present in the sequence of both cDNA molecules M1'' and M2'', and the barcodes can be correlated to determine that the molecules originate from the same cell as one another. Similarly, the same barcode 162' is present in the sequence of both cDNA molecules M3'' and M4'', and the barcodes can be correlated to determine that the molecules originate from the same cell as one another. Further, referring to FIG. 1A, although which particular donor vector is used to add the corresponding variant 131 or 132 to which cell may not necessarily be known or controlled, the sequences of each of the donor vectors may be correlated to determine that barcode 141 corresponds to protein coding region 131 since they are in the same molecule as one another, and that barcode 142 corresponds to protein coding region 132 since they are in the same molecule as one another. Thus, referring again to FIG. 1E, based on the correlation between the scRNA-seq sequence and the donor vector sequence, it may be determined that cDNA barcode 141' corresponds to variant 131'', which was in cell 111, and that cDNA barcode 142' corresponds to variant 132'', which was in cell 112. Such a correlation may be referred to as "linking" the cellular barcode to the variant.

[0088] In some examples, a nested polymerase chain reaction (PCR) operation can be used to sequence the donor vector, which may be relatively long. For example, a first process can be used to generate a first amplicon of the donor sequence, including the variant, the first barcode, and the right homology arm, and substantially excluding the left homology arm, in a manner as described with reference to FIG. 3C. A second PCR process can then be used to generate a second amplicon of the first amplicon, including the variant and the first barcode, and substantially excluding the right homology arm and the left homology arm. Sequencing the donor vector can include sequencing the second amplicon, which in some examples can have a length of about 1000 bases or less. Another exemplary process for sequencing the donor vector is described with reference to FIG. 4C.

[0089] It will be appreciated that any suitable donor vector can be used to replace a protein coding region in a cell with any suitable variant and add a first barcode corresponding to such variant. In some examples, the donor vector may include a promoter region that the cell can use to initiate expression of, for example, the barcode, the variant, or both the barcode and the variant. In one example, the barcode may be located between the promoter region and the variant, in which case the cell may use the promoter region to initiate expression of both the barcode and the variant, in a manner as described in more detail with reference to Figures 4A-4E. In other examples, the promoter region may include a reverse promoter region, optionally disposed between the first barcode and the variant, in which case the cell may use the reverse promoter region to initiate expression of either the barcode or the variant, in a manner as described with reference to Figures 3A-3C. For example, expression of the variant of the protein coding region may be in the forward direction and expression of the first barcode may be in the reverse direction, in a manner as described with reference to Figures 3A-3C. Additionally or alternatively, the donor vector may comprise a right homology arm and a left homology arm, and the variant and the first barcode may be between the right homology arm and the left homology arm, in a manner as described with reference to Figures 3A to 3C.

[0090] 3A-3C, exemplary compositions and operations in a process for random barcoded saturation genome editing for high-throughput protein-coding variant assays by single-cell RNA-seq (scRNA-seq) are shown in schematic form. As shown in FIG. 3A, a randomly barcoded homology donor vector 321 can be constructed by placing semi-random barcodes 341 within or on the UTR ends of an exogenous transcript 371, which in the illustrated example links to a promoter and a puromycin resistance gene. Mutations 331 in the protein-coding region can be located adjacent to the exogenous transcript 371. On the one hand, this donor vector 321 contains the desired mutations on the homology arms 351, 352 and donor repair template (e.g., in the mutant 331 of the protein coding region) to create a mutant on the exon, which may then be cleaved by Cas-gRNA RNP to generate a double-strand break (DSB) in or near the protein coding region 330 on the normal allele, causing the cell to initiate a homology-directed repair (HDR) process in which the mutant 331 is used to replace the normal protein coding region 330. On the other hand, this foreign gene 371 with a semi-random barcode 341 may be knocked in near the exon and edited in the reverse direction. The semi-random barcode is placed at the UTR end of the foreign gene 371 so that it can be expressed and detectable by scRNA-seq. A non-limiting example of knock-in mutagenesis using a puromycin resistance gene is shown in Figure 3A. In Figure 3A, it can be seen that the foreign gene 371 may contain an inverted promoter 372 in an intron. Thus, the foreign gene 371 driven by the reverse promoter 372 can splice out and does not affect normal protein translation. The cell expresses the semi-random barcode 341 driven by the reverse promoter linked to the mutant 331, expressing the semi-random barcode 341 and the puromycin resistance gene 361 in the reverse direction into a first mRNA molecule and expressing the mutant 331 in the forward direction into a second mRNA molecule.For example, a barcode 341 may be placed at the UTR end of a puromycin resistance gene, and the cells may then be contacted with puromycin to enrich for the cells. A donor vector may be inserted into a cell by inserting a plasmid into which a homology donor vector 231 is placed. Additionally, a second plasmid may be inserted into the cell that causes the cell to express a Cas-gRNA RNP for use in the HDR process.

[0091] Figure 3B contains preliminary data demonstrating that a barcoded puromycin resistance gene can be successfully knocked in and that the exon can also be successfully edited. The top panel 3110 of Figure 3B shows the location and size of the knock-in portion where the mutation should be. In panel 3120, the band on the gel for PCR verification in the red box shows the band generated after successful knock-in mutagenesis. In panel 3130, sequencing verification shows that the introduction of the barcode and mutation was successful. This shows that this "knock-in mutagenesis" approach works and can be used to barcode mutations.

[0092] To link the barcode to the edited variant, two-step PCR and amplicon sequencing can be performed in the manner shown in Figure 3C. The first PCR can specifically amplify the knock-in region with the genome-edited allele. The second PCR can use the PCR product from the first PCR as a template and link the barcode to the variant in the amplicon up to 1 kb. Amplicon sequencing is performed using the product from the second PCR. Amplicon sequencing can be performed using a commercially available sequencer, such as the MISEQ sequencer available from Illumina, Inc. (San Diego, CA, USA).

[0093] To link the cellular barcode to the mutant barcode, the scRNA-seq library may be sequenced, for example, for 150 bps, to cover both the cellular and mutant barcode regions. In this way, reads from foreign transcripts knocked into the adjacent intronic regions can be used to link the cellular barcode to the mutant barcode.

[0094] These two data sets (amplicon sequencing and scRNA-seq) may be linked using a computational decoding pipeline that can decode which cells are linked to which variants. Another computational pipeline and deep learning algorithms may be used to analyze the effect of each variant on gene expression in each cell based on the decoded cell barcode-variant relationships and the scRNA-seq data.

[0095] In another example, Figures 4A-4E show schematics of exemplary compositions and operations in a process flow for high-throughput protein-coding variant assays by single-cell RNA-seq (scRNA-seq) using saturation mutagenized exogenous variant libraries. These two data sets can be linked using a computational decoding pipeline that decodes which cells are linked to variants in a manner as shown in Figure 4A and described in more detail with reference to Figures 1A-1E. In the barcoding vector, a semi-random barcode can be placed downstream of the promoter or upstream of the terminator for the pool of mutant libraries to be cloned such that after the pool of mutant libraries is cloned, this barcode will be within the UTR region of the variant transcript. In this way, every variant can have a unique barcode expressed within the UTR region. The variants can be linked to the variant barcodes using amplicon sequencing as described above with reference to Figure 1E, or long-read sequencing. The expressed variants and the expressed variant barcodes can be linked to the cellular barcodes using scRNA-seq in a manner as described with reference to Figure 1E. The mutant barcode may be linked to the expressed mutant barcode by correlating the vector sequence to the expressed sequence in a manner as described with reference to FIG. 1E.

[0096] FIG. 4B shows an exemplary vector that can be used to insert a first barcode into a cell's DNA and replace a protein coding region in the cell with a variant in a manner as described with reference to FIG. 1A-1B or FIG. 3A. The vector 4100 shown in FIG. 4B can include a lentiviral vector constructed for 5' barcoding, such as the pLenti 5' barcode vector. Using molecular cloning, the variant and the first barcode can be inserted into any suitable region of the vector, for example, between the WPRE and EFs sequences. Exemplary mRNA and protein sequences that can result from cellular expression of the vector are also shown in FIG. 4B.

[0097] As described above with reference to FIG. 1E, in some examples, tiled PCR amplicons can be generated by using one set of primers to amplify the barcode on one side and another set of primers to amplify the variant on the other side to link the barcode to the variant. Each amplicon can be used to link a segment of the variant to the barcode. Amplicon sequencing can be performed using a modified recipe on a sequencer such as a MISEQ sequencer commercially available from Illumina, Inc. (San Diego, Calif., USA). In this way, variant barcodes can be linked to variants using a computational pipeline with this data set in a manner as shown in FIG. 4C, along with the exemplary data shown in FIG. 4D. More specifically, FIG. 4C shows an amplicon assay performed on vector DNA, mutagenized library DNA, and / or cDNA, where one PCR primer (tiled across the entire region) is used to amplify the variant and the other PCR primer is used to amplify the variant barcode. In some instances, commercial SBS can be used to only sequence regions of about 150 base pairs or less, and tiled amplicons can be used that individually cover each region of about 150 base pairs or less, but collectively cover the entire sequence. Figure 4D shows that amplicon sequencing works well and has the desired coverage of the barcode and variant regions for use in linking the barcode and variant.

[0098] To link the cellular barcode to the mutant barcode, the scDNA-seq library can be sequenced, for example, for about 150 base pairs, to cover both the cellular and mutant barcode regions. In this way, the cellular barcode can be linked to the mutant barcode. Exemplary data is shown in Figure 4E, which shows information for both the cellular barcode and the mutant barcode in the same read (read 1 of scRNA-seq).

[0099] A computational pipeline and deep learning algorithms can be developed and used to analyze the effect of each variant on gene expression in each cell based on the decoded cell barcode-variant relationship and scRNA-seq data.

[0100] It will be appreciated that any suitable combination of process flows as described with reference to Figures 1A-1E, 3A-3C, 4A-4E can be used to analyze expression of a protein coding region of DNA in a population of cells. For example, the initial protein coding region of DNA in each of the cells may be replaced with a donor vector that includes a variant of the protein coding region and a first barcode that identifies the variant, where the cells receive different variants from each other. mRNA can be obtained from the cells, and the mRNA from each cell can include expression of the variant of the protein coding region in that cell and expression of the first barcode. The mRNA from each cell can be coupled to a second barcode that corresponds to that cell. The mRNA with the second barcode coupled can be reverse transcribed into a complementary cDNA. The cDNA can be sequenced, and the donor vector can also be sequenced. The donor vector sequence and the cDNA sequence can be correlated to identify the variant in each of the cells and the expression of that variant by that cell. If desired, in some examples as described with reference to Figures 3A-3C or 4A-4E, the different variants can be saturation mutagenized.

[0101] It will be further appreciated that as part of the process flow of the present invention, a population of cells can be generated in which the DNA of each cell in the population can include a variant in the protein coding region and a first barcode identifying the variant. The cells can have different variants from each other. If desired, in some examples such as those described with reference to Figures 3A-3C or 4A-4E, the different variants can be saturation mutagenized.

[0102] It will be further appreciated that as part of the process flow of the present invention, a collection of polynucleotides from a collection of cells can be generated that includes a first and a second mRNA molecule from each of the cells. For each cell, the first mRNA molecule can include a first molecule of a barcode corresponding to that cell and an expression of a variant in that cell, and the second mRNA molecule can include an expression of a barcode corresponding to that cell and a first barcode corresponding to that variant. If desired, in some examples such as those described with reference to Figures 3A-3C or 4A-4E, the different variants can be saturation mutagenized.

[0103] It will be further understood that as part of the process flow of the invention, some examples provide a plurality of lentiviral vectors, each of which comprises a different semi-random barcode. A mutagenesis saturation mutant library may be provided in contact with the plurality of lentiviral vectors.

[0104] The particular vectors, compositions, and procedures described herein may be adapted for use in any suitable method for analyzing the expression of protein-coding variants in cells. For example, Figure 2 shows a flow diagram of an exemplary method 2000 for analyzing the expression of protein-coding variants in cells.

[0105] Method 2000 may include replacing a protein coding region of DNA in a cell with a donor vector comprising a variant of the protein coding region and a first barcode identifying the variant, and the cell produces an mRNA comprising an expression of the variant and an expression of the first barcode (operation 2001). For example, donor vectors 121, 122 may be used to replace a protein coding region 130 of DNA sequence S1 in each cell 111, 112 with variant 131 coupled to barcode 141 or variant 132 coupled to barcode 142 in a manner as described with reference to Figures 1A-1B. Non-limiting examples of vectors and insertion methods are described with reference to Figures 3A and 4B. The mRNA may be produced in a manner as described with reference to Figure 1C.

[0106] Method 2000 may also include coupling a second barcode corresponding to the cell to the mRNA (operation 2002). For example, the second barcode may be coupled to any mRNA molecule produced by the cell in response to the insertion of the variant and barcode, in a manner as described with reference to FIG. 1D. Method 2000 may also include reverse transcribing the mRNA with the second barcode coupled to cDNA (operation 2003). For example, the mRNA with the second barcode may be transcribed to cDNA, in a manner as described with reference to FIG. 1E. Method 2000 may also include sequencing the cDNA (operation 2004). In some examples, operations 2002, 2003, 2004 are performed in a scRNA-seq process, optionally using commercially available equipment as described elsewhere herein. Method 2000 may also include sequencing the donor vector and / or the cDNA (operation 2005). In some examples, operation 2005 may be performed with amplicon sequencing as described with reference to FIG. 4C, optionally using a commercially available SBS device as described elsewhere herein. Optionally, sequencing may be performed using long reads, which may be generated in a nested PCR process as described with reference to FIG. 1E, FIG. 3C, or FIG. 4C, or using shortened amplicons. Method 2000 may also include correlating the donor vector sequence with the cDNA sequence to identify variants and their expression by the cells (operation 2006). Non-limiting examples of the manner in which such correlation may be performed are described with reference to FIG. 1E, FIG. 3B, and FIG. 4A. EXAMPLES

[0107] The following protocols are intended to be purely illustrative and not limiting of the invention, and in particular, it should be understood that the specific sizes, times, temperatures, and amounts provided are purely illustrative.

[0108] Example 1 Next, we describe a non-limiting, purely illustrative example of Saturation Genome Editing (SGE) using CRISPR-Cas9 and homology-directed repair (HDR) to study Variants of Uncertain Significance (VUS) function.

[0109] (A) Example protocol for approach I: Co-transfection of sgRNA-Cas9 plasmid and barcoded mutant HDR plasmid library

[0110] Introduction Exemplary approach I uses two sets of exon-specific plasmids to perform saturation genome editing (SGE) in human cells. The first set of plasmids, e.g., sgRNA-Cas9 plasmids, contain expression cassettes to drive efficient expression of sgRNAs and Cas9 nuclease in human cells. sgRNAs are designed specifically for each exon of interest. The second set of plasmids, e.g., barcoded mutant HDR plasmids, contain barcoded mutants and puromycin resistance (Puro R The two plasmids carry homology arms to the cleavage site and insertion region, comprising or consisting essentially of the .) gene. This set of plasmids is used to induce homology-directed repair (HDR) at the cleavage site while inserting the barcoded variants using puromycin as a selection marker for subsequent screening and enrichment. Together, these two sets of plasmids are used together to introduce double-stranded breaks at target sites in human cells, and then perform SGE with the barcoded variants using amplicon sequencing and scRNA-Seq as readout methods.

[0111] Exemplary Procedure Construction of sgRNA-Cas9 plasmid. The vector backbone of the sgNRA-Cas9 plasmid is linearized into two fragments (e.g., approximately 4-5 kb each) using PCR, followed by E-gel purification. The sgRNA is designed by IDT online tool, and the gBlocks gene fragment, which includes or essentially consists of the sgRNA and the overlapping region with the backbone, is ordered through IDT. The sgRNA-Cas9 plasmid is then constructed using the NEBuilder HiFi DNA Assembly kit and transformed into Endura electrocompetent cells. After colonies form, random colonies are picked from the plate and inoculated into LB broth containing ampicillin to grow overnight. The plasmid is then extracted from the cell pallet using a Qiagen Mini-Prep kit. The constructed plasmid is then subjected to full plasmid Sanger sequencing for sequence verification.

[0112] Construction of a barcoded mutant HDR plasmid library. The vector backbone of the HDR template plasmid is linearized (e.g., about 5.3 kb) using PCR and then E-gel purified. The homology arms are amplified from genomic DNA of the HAP1 Lig4 knockout (KO) cell line using PCR. Puro R The gene and random barcode region were amplified from a random barcoded vector ordered from GenScript. An initial HDR template plasmid was then constructed using the NEBuilder HiFi DNA Assembly kit with these four fragments and subsequently transformed into Endura electrocompetent cells. 10 ng / ml of the plasmid grown on an agar plate was electrocompetent using the Qiagen Maxi-Prep kit. 5Plasmids are extracted from more than 10 colonies. A Nextera Flex Library is constructed and sequenced to verify the overall structure of the plasmid and to ensure barcode diversity using amplicon sequencing targeting the random barcode region. The HDR template plasmid backbone is then linearized into two fragments using PCR (e.g., approximately 4-5 kb each) followed by E-gel purification. Oligo pools containing oligos that each introduce SNPs at every nucleotide along the exon of interest are designed and ordered from IDT. The oligo pools are then amplified to dsDNA using PCR. Finally, the HDR template plasmid backbone and PCR products are assembled using the NEBuilder HiFi DNA Assembly kit followed by transformation into Endura electrocompetent cells. The Qiagen Maxi-Prep kit is used to linearize the HDR template plasmid backbone into two fragments (e.g., approximately 4-5 kb each) grown on agar plates. 5 Use another round of plasmid extraction from more than 10 colonies to obtain a plasmid pool containing random barcoded mutants that are ready for transfection.

[0113] Transfection and enrichment of cell populations with successful genome editing. The constructed sgRNA-Cas9 plasmid and barcoded mutant HDR plasmid library are co-transfected into a cell line, e.g., the HAP1 Lig4 KO cell line, using Lipofectamine 3000 according to the user guide. Briefly, cells (e.g., approximately 5 × 10 5100 μg of sgRNA-Cas9 plasmid and barcoded mutant HDR plasmid library (e.g., about 1.25 μg each) are also diluted in, for example, about 125 μL of Opti-MEM medium along with, for example, 5 μL of P3000 reagent. The diluted components are then combined and added to each well of the multi-well plate. After incubation for about 2 days, the cells are trypsinized and transferred to a cell culture flask containing, for example, about 10 mL of fresh medium. Puromycin is added to each flask to a final concentration of, for example, about 1 μg / mL. Cultures are split again at about 5 days and about 7 days after transfection under constant Puro selection. On day 7, for example, about 2 mL of culture is used to extract lysates using Lucigen QuickExtract DNA extraction solution. The lysates are then used as DNA templates for PCR to verify the knock-in region.

[0114] Amplicon sequencing to link barcodes and variants. One of the day 7 (post-transfection) lysate PCRs produces an amplicon (e.g., about 3 kb) covering the barcode, variant and right homology arm regions, which is used as a DNA template for a second PCR to amplify a region (e.g., about 1 kb region) covering the barcode and variant regions. Adapters and sequencing indexes are added to the amplicons by PCR. The amplicons are sequenced using MiSeq for 151 bases in both read 1 and read 2. Both indexes are 10 bases each. The sequencing data is then analyzed using an appropriate bioinformatics pipeline to establish correlations between variant barcodes and variants.

[0115] 10X Genomics scRNA-Seq to Study Mutant Phenotypes. On the same day as lysate extraction and amplicon sequencing (e.g., about 7 days after transfection), cells can also be used to perform 10X Genomics scRNA-Seq to characterize single-cell transcriptomes to study mutants. Cells are prepared according to the cell preparation protocol. Briefly, e.g., about 10 7 10 cells are used for each sample and subsequently washed, for example, with 1× PBS containing about 0.04% BSA. The washed cells are filtered through a cell strainer to remove cell debris and large clumps, for example, about 10 6 Resuspend to a concentration of 10000 cells / mL. After cell preparation, start 10X Genomics scRNA-Seq according to the Chromium Next GEM Single Cell 5' Reagent Kits v2 (Dual Index) user guide. For example, about 10,000 cells are used as input for GEM generation and barcoding. After GEM post-RT cleanup and cDNA amplification, a 5' gene expression (GEX) library is constructed. The library is then sequenced on a NovaSeq using a SP flow cell with 210 cycles for read 1 and 90 cycles for read 2 with 10x10 indexed reads. The generated sequencing data is analyzed using an appropriate bioinformatics pipeline.

[0116] (B) Example protocol for approach II: Co-transfection of barcoded mutant linear HDR library and ribonucleoproteins (RNPs)

[0117] Introduction An exemplary approach II utilizes a barcoded variant linear HDR library (e.g., dsDNA of about 3 kb) and RNPs to perform SGE. The linear HDR library contains barcoded variants and Puro RThe barcoded mutant HDR plasmid library constructed from approach I, which includes or essentially consists of the gene, is amplified using PCR, and the homology arms for the cleavage site and insertion region are formed in vitro using purified Cas9 nuclease and sgRNA. The linear HDR library and RNP complex are then electroporated into a suitable cell line, for example, HAP1 Lig4 KO cell line, to perform SGE, followed by amplicon sequencing and scRNA-Seq as readout methods.

[0118] Exemplary Procedure 1. Construction of a barcoded mutant linear HDR library. The barcoded mutant HDR plasmid library constructed from approach I was used as a DNA template for PCR to generate linear HDR libraries with homology arms to the cleavage site, random barcodes, and Puro R Generate a linear HDR library that includes or consists essentially of the gene and mutant region. Purify and concentrate the PCR products using the Zymo DNA Clean & Concentrator kit according to the user guide.

[0119] 2. Formation of RNP complex. Alt-R CRISPR-Cas9 sgRNA and Alt-R SpHiFi Cas9 nuclease V3 are purchased from IDT. To form RNP complex, 5.3 μL of sgRNA (100 μM stock solution), 7.3 μL of Cas9 nuclease (62 μM stock solution), and 9.4 μL of DPBS are mixed per reaction in a 0.5 mL centrifuge tube and incubated at room temperature for 20 minutes for RNP complex formation.

[0120] 3. Cell preparation and electroporation. The following protocol is modified from the Electroporation of RNP User Guide from IDT. Briefly, refresh the cell culture medium about one day before electroporation. On the day of electroporation, trypsinize cells into a flask (e.g., about a 30 mL flask), then add medium, e.g., to about 10 mL, and quantitate the cells. (For about 10 reactions) e.g., about 1 x 10 7 Dilute the cells with DPBS, e.g., to about 40 mL, and centrifuge, e.g., at about 200 x g, e.g., at room temperature, for about 5 minutes. Remove the supernatant without disturbing the pellet, and wash the cells in 5 mL of DPBS. Centrifuge, e.g., at about 200 x g, e.g., at room temperature, for about 5 minutes. Remove the supernatant, and resuspend the cells, e.g., in about 600 uL of DPBS, e.g., at about 1 x 10 cells per 60 uL. 6 For each electroporation, aliquot, for example, about 60 μL of resuspended cells into, for example, a 1.5 mL microcentrifuge tube. Keep cells on ice for at least about 5 minutes prior to electroporation.

[0121] For electroporation, prepare a multi-well plate (e.g., about 6-well plate) filled with, for example, about 2 mL of culture medium per well in an incubator at about 37°C. Mix the following components, for example, in a about 0.5 mL centrifuge tube: about 20 μL of Alt-R RNP complex from step 2, about 5 μL of Alt-R electroporation enhancer (about 96 μM), about 15 μL of double-stranded linear HDR template from step 1 (e.g., about 100 ng / μL stock), and about 60 μL of aliquot cell suspension. Transfer the mixture immediately to a chilled cuvette (Bio-Rad #1652082 with 0.2 cm gap) and perform electroporation at about 150 V, 2 ms pulse width, 1 pulse, unipolar polarity. After electroporation, transfer the cells to the multi-well plate (e.g., use a 20 μL pipette tip to remove all cells from the cuvette). After about 2 days of incubation, trypsinize the cells and transfer them to, for example, a cell culture flask containing about 10 mL of fresh medium. Add puromycin to each flask to, for example, a final concentration of about 1 μg / mL. Split the cultures again, for example, about 5 and 7 days after transfection, with constant Puro selection. On day 7, use about 2 mL of culture and extract lysate using Lucigen QuickExtract DNA extraction solution. The lysate is then used as a DNA template for PCR to verify the knock-in region.

[0122] 4. Amplicon sequencing to link barcodes and variants. One of the lysate PCRs at about day 7 (post-transfection) produces an amplicon (e.g., about 3 kb) covering the barcode, variant and right homology arm region, which is used as a DNA template for a second PCR to amplify a region of about 1 kb just covering the barcode and variant region. Adapters and sequencing indexes are added to the amplicon by PCR. The amplicon is sequenced using MiSeq for about 151 bases in both read 1 and read 2. Both indexes are, for example, about 10 bases each. The sequencing data is then analyzed using an appropriate bioinformatics pipeline to establish the correlation between variant barcodes and variants.

[0123] 5. 10X Genomics scRNA-Seq to study mutant phenotypes. On the same day as lysate extraction and amplicon sequencing (e.g., about 7 days after transfection), cells are used to perform 10X Genomics scRNA-Seq to characterize the transcriptome of a single cell to study mutants. Cells are prepared according to the cell preparation protocol. Briefly, e.g., about 10 7 10 cells are used for each sample, followed by washing with 1X PBS containing 0.04% BSA. The washed cells are filtered through a cell strainer to remove cell debris and large clumps, e.g., approximately 10 6Resuspend to a concentration of 10000 cells / mL. After cell preparation, initiate 10X Genomics scRNA-Seq according to the Chromium Next GEM Single Cell 5' Reagent Kits v2 (Dual Index) user guide. For example, use approximately 10,000 cells as input for GEM generation and barcoding. After GEM post-RT cleanup and cDNA amplification, construct a 5' gene expression (GEX) library. The library is then sequenced on a NovaSeq using an SP flow cell with 210 cycles for read 1 and 90 cycles for read 2 with 10x10 indexed reads. Analyze the generated sequencing data using an appropriate bioinformatics pipeline.

[0124] Results of Example 1 Figure 3B and Figure 5 show results from a CRISPR-HDR approach for saturation genome editing (SGE) experiments targeting exon 7 of TP53. Example 1 provides an illustrative example of a method of SGE using CRISPR-Cas9 and homology-directed repair (HDR). It will be understood that other suitable methods may be used.

[0125] Panel 3110 of Figure 3B shows the gene that contains the knock-in sequence (the puromycin gene with the barcode and mutation). Panel 3130 of Figure 3B also shows where the primers bind. The primers were designed to bind to sequences outside of the homology arms of the chromosome.

[0126] Cells were transfected with a vector containing the knock-in sequence. Non-transfected cells were used as a control. PCR-generated amplicons were generated from transfected and non-transfected cells using the primers shown in panel 3130 of Figure 3B.

[0127] Panel 3120 of Figure 3B shows an agarose gel in which the PCR-generated amplicons from the experimental and control cells of Example 1 were separated. As shown in panel 3120 of Figure 3B, the PCR-generated amplicons from the transfected cells yielded a band approximately 1.7 kb larger than the native chromosome (approximately 3 kb), which is the expected size of the puromycin gene with the barcode and mutation. In the non-transfected control sample, this large 1.7 kb band was absent.

[0128] FIG. 5 shows next-generation sequencing of PCR-amplified amplicons from a saturation genome editing experiment targeting exon 7 of TP53. In the region of the knock-in sequence, mutant barcodes and protospacer adjacent motifs (PAMs) were consistently present in each of the edited genomes. Element 10 of FIG. 5 shows the location of the PAM. The PAM site prevents re-cutting of the edited DNA by single guide RNA. Element 20 of FIG. 5 shows an example of a mutant barcode. These data from FIG. 3B and FIG. 5 together show that virtually all bases on exon 7 of TP53 can be edited and identified using amplicon sequencing data and scRNA-seq data.

[0129] Example 2 Here, we provide a non-limiting, purely illustrative example of cloning library DNA into a 5'UTR-barcoded lentiviral vector (part I).

[0130] [Table 1]

[0131] The PCR tubes are sealed and the digestion is carried out in a thermal cycler, for example at about 37° C. for about 90 minutes.

[0132] 2. Gel Extraction of Digestion Products

[0133] a. Run the digestion reaction on 1% E-Gel® EX Agarose Gels (ThermoFisher G402001) according to the manufacturer's instructions.

[0134] b. Open the cassette and cut out the desired band.

[0135] c. Purify the gel pieces containing the desired digested DNA using Zymoclean Gel DNA Recovery Kit (Zymo D4002). Extract the DNA according to the manufacturer's protocol. Gel pieces from up to four lanes can be combined into a single extraction. Elute the DNA in, for example, approximately 10-20 μl.

[0136] d. Quantify DNA using Qubit.

[0137] 3. Ligation

[0138] For ligation, use, for example, approximately 20 ng of digested vector DNA and an appropriate amount of digested Twist library (insert:vector = approximately 7:1 molar ratio). Use http: / / nebiocalculator.neb.com / #! / ligation for calculations.

[0139] Set up the following ligation reaction, for example about 20 μl. [Table 2]

[0140] Mix the reaction gently by pipetting up and down and vortex briefly.

[0141] Seal the PCR tubes and perform the ligation in a thermal cycler using the following program: Approximately 90 minutes at room temperature Approximately 10 minutes at approximately 65℃ Maintain at approximately 4°C Chill on ice or store at approximately -20°C before transformation.

[0142] 4. E. coli Transformation

[0143] Example of competent cells used: Lucigen Endura electrocompetent cells (Lucigen 60242-2)

[0144] Follow the manufacturer's instructions. For each transformation reaction, use, for example, approximately 1 μl of the ligation reaction.

[0145] For example, about 500 μl of the transformation is spread onto each of, for example, about 15 cm LB-ampicillin agar plates (Teknova: L5004) for DNA extraction.

[0146] Also, for example, about 1 to 2 μl of the transformant (e.g., added to about 100 μl medium) is plated onto another, for example, about 10 cm plate (Teknova: L1004), and the colonies are counted and a single colony is picked for Sanger sequencing.

[0147] For DNA extraction, sufficient transformations are performed to reach a total colony number of, for example, greater than about 100,000 colonies.

[0148] 5. DNA Extraction

[0149] DNA is extracted directly from, for example, about 15 cm plates bearing transformants. Enough plates are extracted to reach a total colony count of, for example, greater than about 100,000 colonies.

[0150] a. Harvest all the cells from the agar plate.

[0151] b. Pipette, for example, about 5 mL of fresh LB broth, place, for example, about 5-10 Rattler Plating Beads (Zymo: S1001-5) onto a plate, and shake them gently (5-10 min) using an orbital shaker.

[0152] c. After, for example, about 5-10 minutes, immediately collect the cells, for example, into a about 50 mL tube, and wash the plate several times using LB broth to recover substantially all of the cells.

[0153] d. Extract DNA from the Qiagen Maxi kit (Qiagen 12162) following the manufacturer's protocol, details of which are as follows:

[0154] i) For example, centrifugation at about 6000 g for about 15 minutes at about 4° C.

[0155] ii) Decant all the supernatant and resuspend the pellet (e.g., about 300-500 mg for each extraction) in, e.g., about 10 mL of buffer.

[0156] iii) For example, add about 10 mL of Buffer P2, mix thoroughly by vigorously inverting about 4-6 times, and incubate at about room temperature (e.g., about 15-25 °C) for about 5 min.

[0157] iv) For example, add approximately 10 mL of pre-chilled Buffer P3 and mix thoroughly by vigorously inverting approximately 4-6 times. Incubate on ice for approximately 20 min.

[0158] v) For example, centrifugation at about 20,000 x g or more at about 4°C for about 30 minutes.

[0159] vi) Equilibrate the QIAGEN tip 500, for example by applying about 10 mL of Buffer QBT and empty the column by gravity flow.

[0160] vii) The supernatant from step v) is applied to a QIAGEN tip and allowed to enter the resin by gravity flow.

[0161] viii) Wash the QIAGEN tip with, for example, about 2×30 mL of Buffer QC. Allow Buffer QC to move through the QIAGEN tip by gravity flow.

[0162] ix) Elute the DNA into a clean 50 mL vessel using, for example, approximately 15 mL of Buffer QF.

[0163] x) Precipitate the DNA, e.g., by adding about 10.5 mL (about 0.7 volumes) of RT isopropanol to the eluted DNA and mix. Centrifuge, e.g., at about 15,000 x g or greater for about 30 minutes at about 4 °C. Carefully decant the supernatant.

[0164] xi) Wash the DNA pellet with, e.g., about 5 mL of RT 70% ethanol and centrifuge, e.g., at about 15,000 x g or greater for about 10 minutes. Carefully decant the supernatant.

[0165] xii) The pellet is air-dried, for example for about 5-10 minutes, and the DNA is redissolved, for example, in about 150 μl of TE buffer.

[0166] 6. QC by Sanger Sequencing (Optional)

[0167] Pick one or more colonies (e.g., about 16 colonies) for Sanger sequencing using primer 4997F EFs (e.g., sequence tgatgtcgtgtactggctc (SEQ ID NO: 17)). This primer is expected to read the barcode region and about 00 nt in the cloned gene with good quality. If the gene is, for example, greater than about 500 bp in length, additional gene-specific sequencing primers can be used.

[0168] 7. QC by whole genome sequencing

[0169] Use the extracted DNA and sequence on a Miseq of 2 x 200 bp to prepare Nextera DNA prep libraries. Check the alignment to the genome and use overlapping regions to identify variants (an appropriate data analysis pipeline can be used for this).

[0170] Here, a non-limiting, purely illustrative example of lentiviral packaging and titering (part II) is provided.

[0171] 1. Lentiviral Packaging

[0172] Example of cell line used: 293FT cell line (ThermoFisher R70007)

[0173] An example of a packaging plasmid to use is ViraPower™ Lentiviral Packaging Mix (ThermoFisher K497500).

[0174] Transfection can be performed using standard protocols with Lipofectamine 3000 reagent (ThermoFisher Scientific, Waltham, MA, USA) (see, for example, Figure 2 of the following protocol, the entire contents of which are incorporated herein by reference: https: / / www.thermofisher.com / content / dam / LifeTech / global / life-sciences / CellCultureandTransfection / pdfs / Lipofectamine3000-LentiVirus-AppNote-Global-FHR.pdf). For best results, use a 10 cm plate column for lentivirus packaging and collect the viral supernatant only once.

[0175] 2. Virus Concentration with PEG-it (Optional)

[0176] a) After collecting the viral supernatant, transfer the supernatant to a sterile container and add, for example, about 1 volume of cold PEG-it viral precipitation solution (System Bioscience LV810A-1) for every about 4 volumes of lentivector-containing supernatant. (e.g., 3 ml of PEG-it with 12 ml of viral supernatant). Refrigerate at about 4°C for about 3 days.

[0177] b) The supernatant / PEG-it mixture is centrifuged, for example, at about 1500×g for about 30 minutes at about 4° C. After centrifugation, the lentivector particles may appear as a beige or white pellet at the bottom of the container.

[0178] c) Transfer the supernatant to a new tube. Spin down the remaining PEG-it solution, for example by centrifugation at about 1500×g for about 5 minutes. Remove substantially all traces of fluid by aspiration, taking great care not to disturb the precipitated lentiviral particles in the pellet.

[0179] d) Resuspend / mix the lentiviral pellet using cold sterile phosphate buffered saline (PBS), for example in approximately 1 / 100-1 / 200 of the original volume.

[0180] 3. Lentivirus Titer Measurement by Counting Zeocin-resistant Colonies

[0181] To determine the titer of a lentiviral stock, perform the following steps: (1) prepare serial dilutions of the lentiviral stock; (2) transduce the lentiviral dilutions into mammalian cell lines; (3) select for stably transduced cells using standard methods; (4) count colonies of stably transduced cells (see, e.g., pages 15-21 of the following protocol, the entire contents of which are incorporated herein by reference: https: / / www.thermofisher.com / document-connect / document-connect.html?url=https%3A%2F%2Fassets.thermofisher.com%2FTFS-Assets%2FLSG%2Fmanuals%2Fvirapower_lentiviral_system_man.pdf&title=VmlyYVBvd2VyIExlbnRpdmlyYWwgRXhwcmVzc2lvbiBTeXN0ZW0=).

[0182] Perform titration using the cell line selected for the 10X experiment. In one example, use 250ug / mL Zeocin (ThermoFisher R25001) for selection in HEK293 and A549 cell lines (for other cell lines, a death curve can be performed to determine the appropriate amount of Zeocin to use). Count colonies approximately 14 days after crystal violet staining.

[0183] Here, we provide a non-limiting, purely illustrative example of lentiviral transduction and 10X (part III).

[0184] 1) Day 1 afternoon: Seed approximately 3 million ATCC HEK 293 cells (ATCC CRL-1573) into approximately 10 cm plates each for approximately 4 million cells the next day. Seed approximately 3 plates, one for lentiviral transduction, one for a non-transduced control, and the third to be used to count the cells the next day.

[0185] 2) Day 2: On the day of transduction, count the number of cells using an extra 3rd plate. This will be used to calculate how much virus to add. Thaw the lentiviral stock and dilute the appropriate amount of virus into fresh complete medium (e.g., ~10 mL) to obtain an MOI of ~0.05. Do not vortex. For example, add ~10 µL of ~6 mg / mL polybrene (final concentration = ~6 µg / mL). Also plate a non-transduced control.

[0186] 3) Incubate overnight at approximately 37°C in a humidified approximately 5% CO2 incubator.

[0187] 4) Day 3: Replace with approximately 10 ml of medium.

[0188] 5) Day 4: Remove the medium, wash the cells once with PBS, trypsinize the cells with, for example, about 0.25% (w / v) Trypsin-about 0.53 mM EDTA solution. Transfer all samples from about 10 cm plates to about 15 cm plates, and add, for example, about 250 μg / mL Zeocin for selection.

[0189] 6) Replace the medium with fresh antibiotics approximately every 3-4 days.

[0190] 7) Observe the time point at which the non-transduced control becomes completely dead.

[0191] 8) After the cells on the non-transduced cell plate have completely died, the cells can be harvested for 10X library preparation.

[0192] 9) Prepare a 10X library using the 10X Chromium Next Gem Single Cell 5' Reagent Kit V2 targeting, for example, approximately 10,000 cells, following the manufacturer's protocol (10X Genomics, Pleasanton, CA, USA). (The entire contents of which are incorporated herein by reference, https: / / assets.ctfassets.net / an68im79xiti / 4oB71TeT0kDoIHhfq9dPxd / 05ce9121d027715321d2a9765b1e9b70 / CG000331_ChromiumNextGEMSingleCell5_v2_UserGuide_RevA.pdf).

[0193] Here we provide a non-limiting example of amplicon sequencing to link mutant barcodes to mutants (Part IV).

[0194] This part can use either the cloned plasmid DNA or the amplified cDNA from the 10X kit as the substrate for PCR to link the mutant barcode to the mutant. The PCR cycles for these two inputs are different.

[0195] The forward PCR primer on the barcode side uses a staggered primer mix and has the following exemplary sequence: [Table 3]

[0196] A reverse primer covering the entire gene has the following exemplary sequence with the gene specific sequence following the stop codon: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGccagaggttgattgtcgaca (SEQ ID NO: 5)

[0197] Other reverse primers for tiling the ORF region may be designed for each gene, for example the following A14-ME adapter sequence: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG (SEQ ID NO: 6) may be added before the gene-specific sequence. Primers are designed every 100 to 150 bp to tile the entire gene.

[0198] Example steps:

[0199] 1. Gene-specific PCR:

[0200] Set up the following reaction: [Table 4]

[0201] Run the following PCR program Approximately 95℃ for approximately 3 minutes Approximately 10 cycles (for cloned plasmid DNA) or approximately 16 cycles (for 10X cDNA) Approximately 95℃ for approximately 30 seconds About 55℃ or about 60℃ for about 30 seconds Approximately 72℃ for approximately 30 seconds Approximately 72℃ for approximately 5 minutes Keep at approximately 4°C.

[0202] 2. Gene-specific PCR cleanup:

[0203] a. Vortex the AMPure XP beads for approximately 30 seconds to ensure the beads are evenly distributed.

[0204] b. Add approximately 20 μl of AMPure XP beads (approximately 0.8X) to each well and gently pipette the entire volume up and down approximately 10 times.

[0205] c. Incubate at room temperature without shaking for approximately 5 minutes.

[0206] d. Place on magnetic stand and wait until liquid is clear (approximately 2 minutes). Remove and discard all supernatant.

[0207] e. Wash the beads with, for example, about 200 μl of fresh 80% ethanol. Remove and discard all the supernatant.

[0208] f. Centrifuge briefly and remove excess ethanol using a P20 multichannel pipette with a fine pipette tip. Allow the beads to air dry for approximately 10 minutes.

[0209] g. Add, for example, about 52.5 μl of 10 mM Tris pH 8.5 to the beads.

[0210] h. Gently pipette the entire volume up and down approximately 10 times. Incubate at room temperature for approximately 2 minutes. Place on the magnetic stand and wait until the liquid is clear (approximately 2 minutes).

[0211] i. Carefully transfer, for example, about 50 μl of the supernatant into new PCR tubes and label them appropriately.

[0212] 3. Index PCR

[0213] Set up the following reaction: [Table 5]

[0214] Run the following PCR program Approximately 95℃ for approximately 3 minutes Approximately 8 cycles (for cloned plasmid DNA) or approximately 9 cycles (for 10X cDNA) Approximately 95℃ for approximately 30 seconds About 55℃ or about 60℃ for about 30 seconds Approximately 72℃ for approximately 30 seconds Approximately 72℃ for approximately 5 minutes Hold at 4°C

[0215] 4. Index PCR Cleanup

[0216] a. Vortex the AMPure XP beads for approximately 30 seconds to ensure the beads are evenly distributed.

[0217] b. Add, for example, about 50 μl of AMPure XP beads (1×) to each well and gently pipette the entire volume up and down about 10 times.

[0218] c. Incubate at room temperature without shaking for approximately 5 minutes.

[0219] d. Place on magnetic stand and wait until liquid is clear (approximately 2 minutes). Remove and discard substantially all of the supernatant.

[0220] e. Wash the beads with, for example, about 200 μl of fresh 80% ethanol. Remove and discard all the supernatant.

[0221] f. Centrifuge briefly and remove excess ethanol using a P20 multichannel pipette with a fine pipette tip. Allow the beads to air dry for approximately 10 minutes.

[0222] g. Add, for example, about 27.5 μl of 10 mM Tris pH 8.5 to the beads.

[0223] Gently pipette the entire volume up and down approximately 10 times. Incubate at room temperature for approximately 2 minutes, place on the magnetic stand, and wait until the liquid is clear (approximately 2 minutes).

[0224] i. Carefully transfer, for example, about 25 μl of the supernatant into new PCR tubes and label them appropriately.

[0225] 5. Quantitative Library

[0226] For example, run about 1 μl of a 1:20 dilution of the final library on a Bioanalyzer DNA High Sensitivity Chip to obtain the final concentration of the library. A single peak is expected to be seen for each PCR. Select the peak to quantitate.

[0227] 6. Sequencing

[0228] The library is mixed with at least about 5% phiX (FC-110-3001) and sequenced on Miseq or Novaseq.

[0229] Results of Example 2 FIG. 6 shows the distribution of mutants in the saturation mutagenesis TP53 library introduced into HEK293 cells using a barcoded vector in Example 2. The library contained approximately 3,546 mutants. A 10X scRNA-seq library was prepared using HEK293 cells. Each of the mutants was linked to a mutant barcode by amplicon sequencing of cDNA derived from HEK293 cells. Mutants were linked to cell barcodes by interrogating the amplicon data with the scRNA-seq data. Example 2 provides an illustrative, non-limiting example of how to clone a library of DNA into a 5'UTR barcoded lentiviral vector. It will be understood that other suitable methods may be used.

[0230] Further comments The practice of the present disclosure may employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are within the skill of the art. Such techniques may be implemented in any manner suitable for use in the art, including, but not limited to, Molecular Cloning: A Laboratory Manual, 2 nded.(Sambrook et al.,1989);Oligonucleotide Synthesis(MJGait,ed.,1984);Animal Cell Culture(RIFreshney,ed.,1987);Methods in Enzymology(Academic Press,Inc.);Current Protocols in Molecular Biology(FMAusubel et al.,eds.,1987,and periodic updates);PCR:The Polymerase Chain Reaction (Mullis et al., eds., 1994); Remington, The Science and Practice of Pharmacy, 20 th ed., (Lippincott, Williams & Wilkins 2003), and Remington, The Science and Practice of Pharmacy, 22. th ed., (Pharmaceutical Press and Philadelphia College of Pharmacy at University of the Sciences 2012).

[0231] All patents and publications mentioned in this specification are herein incorporated by reference to the same extent as if each individual patent and publication was specifically and individually indicated to be incorporated by reference.

[0232] While various illustrative examples have been described above, it will be apparent to one skilled in the art that various changes and modifications can be made herein without departing from the present invention. It is intended that the appended claims cover all such changes and modifications that fall within the true spirit and scope of the present invention.

[0233] It should be understood that any respective feature / example of each of the aspects of the present disclosure described herein may be implemented together in any suitable combination, and any feature / example from any one or more of these aspects may be implemented together in any suitable combination with any of the features of the other aspects described herein, in order to achieve the benefits described herein.

Claims

1. 1. A method for analyzing expression of a protein coding region of DNA in a cell, comprising: replacing a protein coding region of the DNA in the cell with a donor vector comprising a variant of the protein coding region and a first barcode that identifies the variant; wherein the cell produces an mRNA comprising an expression of the variant and an expression of the first barcode; coupling a second barcode corresponding to the cell to the mRNA; reverse transcribing the mRNA coupled with the second barcode into cDNA; sequencing the cDNA; sequencing the donor vector or cDNA using amplicon sequencing; correlating the donor vector sequence with the cDNA sequence to identify the variant and its expression by the cell; The method comprising:

2. The method of claim 1 , wherein the donor vector comprises a promoter region.

3. The method of claim 2 , wherein the barcode is located between the promoter region and the variant.

4. 3. The method of claim 2, wherein the donor vector comprises a right homology arm and a left homology arm, and the mutant and the first barcode are between the right homology arm and the left homology arm.

5. The method of claim 2 or claim 4, wherein the promoter region comprises an inverted promoter region.

6. 6. The method of claim 5, wherein the inverted promoter region is located between the first barcode and the variant.

7. 6. The method of claim 5, wherein expression of the variant of the protein coding region is in a forward orientation and expression of the first barcode is in a reverse orientation.

8. generating a first amplicon of the donor sequence using a first polymerase chain reaction (PCR) process, the first amplicon including the variant, the first barcode, and the right homology arm, and substantially excluding the left homology arm; generating a second amplicon of the first amplicon using a second PCR process, the second amplicon including the variant and the first barcode, and substantially excluding the right homology arm and the left homology arm; The method of claim 4 further comprising:

9. 9. The method of claim 8, wherein sequencing the donor vector comprises sequencing the second amplicon.

10. 9. The method of claim 8, wherein the second amplicon has a length of about 1000 bases or less.

11. The mRNA is a first mRNA molecule comprising an expression of said variant; a second mRNA molecule comprising an expression of the first barcode; and The method of claim 1 , comprising:

12. Coupling the second barcode to the mRNA comprises: coupling a first molecule of the second barcode to the first mRNA molecule; coupling a second molecule of the second barcode to the second mRNA molecule; The method of claim 11 , comprising:

13. 13. The method of claim 12, wherein the cDNA comprises a first cDNA molecule comprising a reverse transcription of the variant and the second barcode and a second cDNA molecule comprising a reverse transcription of the protein coding region and the second barcode, and sequencing the cDNA comprises sequencing the first and second cDNA molecules.

14. Replacing the initial protein coding region cleaving the DNA of the cell using a CRISPR associated protein guide RNA ribonucleoprotein (Cas-gRNA RNP); using homology directed repair (HDR) to repair the break in the DNA using the donor vector; The method of claim 1 , comprising:

15. further comprising inserting the first and second plasmids into the cell; the donor vector is located on the first plasmid; and The cell expresses the Cas-gRNA RNP using the second plasmid. The method of claim 14.

16. The method of claim 1 , wherein the donor vector comprises a lentiviral vector.

17. 2. The method of claim 1, wherein the donor vector further comprises a puromycin resistance gene, and the method further comprises contacting the cells with puromycin to concentrate the cells.

18. 18. The method of claim 17, wherein the first barcode is located at a UTR end of the puromycin resistance gene.

19. 2. The method of claim 1, further comprising cleaving the first barcode from the variant in the cell.

20. 1. A method for analyzing expression of a protein coding region of DNA in a population of cells, comprising: replacing an initial protein coding region of the DNA in each of the cells with a donor vector comprising a variant of the protein coding region and a first barcode identifying the variant, wherein the cells receive variants that differ from one another; obtaining mRNA from the cells, the mRNA from each cell comprising expression of the variant of the protein coding region in that cell and expression of the first barcode; coupling to the mRNA from each cell a second barcode corresponding to that cell; reverse transcribing the mRNA coupled with the second barcode into cDNA; sequencing the cDNA; sequencing the donor vector; correlating the donor vector sequence with the cDNA sequence to identify the variant in each of the cells and its expression by the cell; The method comprising:

21. 21. The method of claim 20, wherein the different variants are saturation mutagenized.

22. a collection of polynucleotides from a collection of cells, the polynucleotides comprising a first and a second mRNA molecule from each of the cells; For each cell, the first mRNA molecule comprises a first molecule of a barcode corresponding to the cell and expression of a variant in the cell; the second mRNA molecule comprises a barcode corresponding to the cell and an expression of a first barcode corresponding to the variant; A collection of said polynucleotides.

23. 23. The collection of polynucleotides of claim 22, wherein the different variants have been saturation mutagenized.

24. providing a barcoded homology donor vector comprising a semi-random barcode at an end of an exogenous transcript, the donor vector comprising a homology arm and a mutation; Knocking in the barcoded homology donor vector adjacent to the exon to be edited to generate a mutation in the exon; cleaving said mutant using a CRISPR-associated protein guide RNA ribonucleoprotein (Cas-gRNA RNP); A method comprising:

25. 25. The method of claim 24, wherein the barcode is positioned at a UTR end of the donor vector such that it can be expressed and detectable by scRNA-seq.

26. The method of claim 24 or claim 25, wherein the donor vector comprises a puromycin resistance gene.

27. Providing the barcoded homology donor vector comprises: using a first polymerase chain reaction (PCR) to specifically amplify the knock-in region carrying the genome-edited allele; linking the barcode to a variant in an amplicon using a second PCR using the product of the first PCR as a template; performing amplicon sequencing using the products from the second PCR; 25. The method of claim 24, comprising:

28. 26. The method of claim 25, wherein the amplicon sequencing covers both the barcode and the variant.

29. adding semi-random mutant barcodes to the UTR regions of the saturation mutagenized mutant library; coupling a cellular barcode to the mutant barcode; reading the mutant barcodes by scRNA-seq; linking said variant barcodes to said variants in said library using a separate sequencing operation; A method comprising:

30. 30. The method of claim 29, wherein the semi-random mutant barcodes may be positioned downstream of a promoter or upstream of a terminator of the mutant library.

31. 31. The method of claim 29 or claim 30, wherein linking the variant barcodes to the variants of the library comprises generating tiled polymerase chain reaction (PCR) amplicons by using one set of primers to amplify the barcode on one side and another set of primers to amplify the variants on the other side, such that each amplicon links a respective segment of the variant to the barcode.

Images