Compositions and methods for RNA affinity purification

Abstract

The present disclosure provides methods and compositions for RNA affinity purification. In particular, the present disclosure relates to compositions and methods for making and using mRNAs that contain one or more aptamers that specifically bind to an affinity ligand.

Description

[Technical field]

[0001] Related Applications This application claims the benefit of priority to U.S. Provisional Application No. 63 / 240,027, filed September 2, 2021, and EP Priority Application No. 22315159.8, filed July 20, 2022, the contents of each of which are incorporated by reference in their entirety for all purposes. [Background technology]

[0002] Messenger RNA (mRNA) therapeutics are becoming an increasingly important approach in the treatment of various diseases and are an alternative to protein replacement therapy, antibody therapy, traditional vaccine therapy, and / or gene therapy. In mRNA therapy, mRNA encoding a protein or peptide of interest is delivered to the patient or to the patient's target cells. Once the mRNA enters the patient's target cells, the patient's translational machinery produces and subsequently expresses the protein or peptide of interest. Therefore, it is important to ensure the production of a highly pure and safe mRNA product.

[0003] mRNA for therapeutics is often synthesized using an in vitro transcription system with an enzyme such as RNA polymerase that transcribes the mRNA from a template plasmid DNA, followed by or without the addition of a 5'-cap and 3'-polyadenylation. The result of such a reaction is a composition that contains full-length mRNA and a variety of undesirable contaminants, such as proteins, non-RNA nucleic acids, undesirable RNA species, spermidine, DNA, pyrophosphate, endotoxins, detergents, and organic solvents. These contaminants must be purified to provide clean, homogenous mRNA suitable for therapeutic use. Summary of the Invention [Problem to be solved by the invention]

[0004] There remains a need for more effective, reliable and safe methods of purifying RNA from large-scale manufacturing processes for potential therapeutic applications. [Means for solving the problem]

[0005] From the description herein, it will be understood that the present disclosure encompasses multiple aspects and embodiments, including but not limited to the following:

[0006] In one aspect, the present disclosure provides a messenger RNA (mRNA) comprising at least one 5' untranslated region (5'UTR), at least one open reading frame (ORF), at least one 3' untranslated region (3'UTR), and at least one polyadenylation (polyA) sequence, wherein the mRNA comprises at least one RNA aptamer.

[0007] In some embodiments, the RNA aptamer is embedded in an RNA scaffold.

[0008] In some embodiments, the RNA scaffold comprises at least one secondary structure motif. In some embodiments, the secondary structure motif is a tetraloop, a pseudoknot, or a stem loop. In some embodiments, the RNA scaffold comprises at least one tertiary structure. In some embodiments, the secondary structure motif and / or the tertiary structure is nuclease resistant.

[0009] In some embodiments, the RNA scaffold is a transfer RNA (tRNA), a ribosomal RNA (rRNA), or a ribozyme. In some embodiments, the ribozyme is catalytically inactive. In some embodiments, the RNA scaffold comprises a transfer RNA (tRNA). In some embodiments, the RNA aptamer is embedded in a tRNA hairpin loop of the tRNA. In some embodiments, the RNA aptamer is embedded in a tRNA anticodon loop of the tRNA. In some embodiments, the RNA aptamer is embedded in a tRNA D loop of the tRNA. In some embodiments, the RNA aptamer is embedded in a tRNA T loop of the tRNA.

[0010] In some embodiments, the RNA aptamer is located in the 5'UTR. In some embodiments, the RNA aptamer is located between the 3' end of the ORF and the 5' end of the 3'UTR. In some embodiments, the RNA aptamer is located in the 3'UTR. In some embodiments, the RNA aptamer is located between the 3' end of the 3'UTR and the 5' end of the polyA sequence. In some embodiments, the RNA aptamer is located at the 3' end of the polyA sequence.

[0011] In some embodiments, the mRNA comprises one RNA aptamer or consists of one RNA aptamer. In some embodiments, the mRNA comprises 1-4 RNA aptamers. In some embodiments, the RNA aptamers are identical. In some embodiments, the RNA aptamers are distinct.

[0012] In some embodiments, the RNA aptamer is synthetically obtained. In some embodiments, the RNA aptamer is a split aptamer or an X aptamer. In some embodiments, the RNA aptamer is naturally derived. In some embodiments, the RNA aptamer is derived from a hairpin RNA, a tRNA, or a riboswitch.

[0013] In some embodiments, the RNA aptamer is embedded in a bioorthogonal scaffold.

[0014] In some embodiments, the bioorthogonal scaffold is V5, F29, F30, or a variant thereof.

[0015] In some embodiments, the bioorthogonal scaffold comprises the 5' nucleotide sequence of SEQ ID NO:34 and the 3' nucleotide sequence of SEQ ID NO:35, with the aptamer sequence disposed between SEQ ID NO:34 and SEQ ID NO:35.

[0016] In some embodiments, the bioorthogonal scaffold comprises a 5' nucleotide sequence of SEQ ID NO:39, an internal nucleotide sequence of SEQ ID NO:40, and a 3' nucleotide sequence of SEQ ID NO:41, wherein a first aptamer sequence is disposed between SEQ ID NO:39 and SEQ ID NO:40 and a second aptamer sequence is disposed between SEQ ID NO:40 and SEQ ID NO:41, and optionally the first and second aptamers are the same or different.

[0017] In some embodiments, the RNA aptamer-embedded bioorthogonal scaffold comprises the nucleotide sequence of SEQ ID NO:29 or SEQ ID NO:31.

[0018] In some embodiments, the RNA aptamer binds to an affinity ligand. In some embodiments, the affinity ligand comprises protein A, protein G, streptavidin, glutathione, dextran, or a fluorescent molecule. In some embodiments, the affinity ligand comprises streptavidin. In some embodiments, the affinity ligand is immobilized on a chromatography resin.

[0019] In some embodiments, the RNA aptamer is S1m or Sm. In some embodiments, the mRNA comprises 1-4 S1m or sm RNA aptamers. In some embodiments, the S1m or sm RNA aptamer is located: 1) between the 3' end of the ORF and the 5' end of the 3'UTR; 2) within the 3'UTR; 3) between the 3' end of the 3'UTR and the 5' end of the polyA sequence; and / or; 4) at the 3' end of the polyA sequence. In some embodiments, the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 2 or 6. In some embodiments, the tRNA with the embedded RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 7.

[0020] In some embodiments, the mRNA encodes at least one polypeptide. In some embodiments, the polypeptide is a biologically active polypeptide, a therapeutic polypeptide, or an antigenic polypeptide. In some embodiments, the antigenic polypeptide comprises an antibody or a fragment thereof, an enzyme-recruiting polypeptide, or a genome-editing polypeptide. In some embodiments, the therapeutic polypeptide comprises an antibody heavy chain, an antibody light chain, an enzyme, or a cytokine. In some embodiments, the biologically active polypeptide comprises a genome-editing polypeptide.

[0021] In some embodiments, the mRNA comprises a chimeric 5' or 3' UTR.

[0022] In some embodiments, the mRNA comprises at least one chemical modification. In some embodiments, the chemical modification is pseudouridine, N1-methylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methyluridine, 5-methoxyuridine, or 2-O-methyluridine. In some embodiments, the chemical modification is pseudouridine, N1-methylpseudouridine, 5-methylcytosine, 5-methoxyuridine, or a combination thereof, hi some embodiments, the chemical modification is N1-methylpseudouridine.

[0023] In some embodiments, the polyA sequence is at least 10 consecutive adenosine residues. In some embodiments, the polyA sequence is 10-500 consecutive adenosine residues. In some embodiments, the mRNA comprises two polyA sequences, each of which comprises 10-500 consecutive adenosine residues, and at least one RNA aptamer or tRNA with an embedded RNA aptamer is disposed between the two polyA sequences.

[0024] In some embodiments, the mRNA includes a 5' cap.

[0025] In some embodiments, the translation efficiency of the mRNA is substantially the same as compared to an mRNA that does not contain an RNA aptamer.

[0026] In some embodiments, mRNA is synthesized using in vitro transcription (IVT).

[0027] In some embodiments, the mRNA is expressed in vivo or ex vivo.

[0028] In one aspect, the present disclosure provides a vector encoding the above-mentioned mRNA. In some embodiments, the vector comprises at least the following elements a to e in the 5' to 3' direction: a) an RNA polymerase promoter; b) a polynucleotide sequence encoding a 5'UTR; c) a polynucleotide sequence encoding an ORF; d) a polynucleotide sequence encoding a 3'UTR; and e) a polynucleotide sequence encoding at least one RNA aptamer. In some embodiments, the vector further comprises a polynucleotide sequence encoding a polyA sequence and / or a polyadenylation signal.

[0029] In another aspect, the present disclosure provides a host cell comprising the above-described vector.

[0030] In another aspect, the present disclosure provides a pharmaceutical composition comprising the above-mentioned mRNA. In some embodiments, the pharmaceutical composition is administered to a subject in need thereof in a method for treating or preventing a disease or disorder.

[0031] In another aspect, disclosed herein is a method for purifying mRNA, comprising the steps of: (a) contacting a sample containing mRNA with an affinity ligand immobilized on a chromatography resin, wherein the RNA aptamer comprises binding affinity for the affinity ligand; (b) eluting the mRNA from the chromatography resin; and (c) purifying the mRNA from the sample. In some embodiments, the method comprises one or more wash steps between the contacting step (a) and the elution step (b).

[0032] In another aspect, disclosed herein is a method for purifying RNA, comprising the steps of: (a) contacting a sample containing RNA with an affinity ligand immobilized on a chromatography resin; (b) eluting the RNA from the chromatography resin; and (c) isolating the RNA from the sample, wherein the RNA comprises at least one open reading frame (ORF) and at least one RNA aptamer, and the RNA aptamer comprises binding affinity for the affinity ligand.

[0033] In some embodiments, the RNA further comprises at least one 5' untranslated region (5'UTR), at least one 3' untranslated region (3'UTR), and at least one polyadenylation (polyA) sequence.

[0034] In some embodiments, the RNA is at least about 500 nucleotides in length, at least about 750 nucleotides in length, at least about 1,000 nucleotides in length, at least about 1,500 nucleotides in length, at least about 2,000 nucleotides in length, at least about 2,500 nucleotides in length, at least about 3,000 nucleotides in length, at least about 3,500 nucleotides in length, at least about 4,000 nucleotides in length, at least about 4,500 nucleotides in length, or at least about 5,000 nucleotides in length.

[0035] In some embodiments, the RNA comprises a 5' cap. In some embodiments, the RNA is mRNA.

[0036] In some embodiments, the mRNA is greater than 90% pure.

[0037] In another aspect, disclosed herein is a method for purifying mRNA, comprising: (a) contacting a sample containing mRNA with an affinity ligand immobilized on a chromatography resin; (b) eluting the mRNA from the chromatography resin; and (c) isolating the mRNA from the sample, wherein the mRNA comprises at least one 5' untranslated region (5' UTR), at least one open reading frame (ORF), at least one 3' untranslated region (3' UTR), at least one polyadenylation (polyA) sequence, and at least one RNA aptamer, wherein the RNA aptamer comprises a binding affinity for the affinity ligand. In some embodiments, the mRNA is 90% or more pure.

[0038] In another aspect, disclosed herein is a pharmaceutical composition comprising a plurality of mRNA molecules, wherein at least about 90% of the mRNAs comprise at least one 5' untranslated region (5'UTR), at least one open reading frame (ORF), at least one 3' untranslated region (3'UTR), at least one polyadenylation (polyA) sequence, and at least one RNA aptamer.

[0039] In another aspect, disclosed herein is a messenger RNA (mRNA) comprising at least one 5' untranslated region (5'UTR), at least one open reading frame (ORF), at least one 3' untranslated region (3'UTR), and at least one polyadenylation (polyA) sequence, wherein the mRNA comprises at least one tRNA.

[0040] In another aspect, disclosed herein is a messenger RNA (mRNA) comprising at least one 5' untranslated region (5'UTR), at least one open reading frame (ORF), at least one 3' untranslated region (3'UTR), and at least one polyadenylation (polyA) sequence, the mRNA comprising a tRNA having at least one RNA aptamer embedded therein.

[0041] In another aspect, disclosed herein is a messenger RNA (mRNA) comprising at least one 5' untranslated region (5' UTR), at least one open reading frame (ORF), at least one 3' untranslated region (3' UTR), and at least one polyadenylation (polyA) sequence, the mRNA comprising a bioorthogonal scaffold having at least one RNA aptamer embedded therein.

[0042] The above and other features and advantages of the present disclosure will be more fully understood from the following detailed description of illustrative embodiments, taken in conjunction with the accompanying drawings. [Brief description of the drawings]

[0043] [Figure 1] Figure 1 illustrates the steps in the affinity purification process of aptamer-tagged mRNA. [Diagram 2] Figure 2 shows the RNA concentration (ng) measured on the Nanodrop before incubation with streptavidin sepharose beads (input) or after the streptavidin affinity binding purification and elution steps with either random or S1m aptamers (unbound vs. eluted). The percentage of RNA recovered after affinity purification is relative to the input sample that was not affinity purified. [Diagram 3]Figure 3 shows the plasmid maps of pAM14 (2,496 bp) carrying an ARE element tagged with the 4×S1m aptamer or the pAM15 plasmid (2,168 bp) carrying an untagged ARE element. [Figure 4] Figure 4 shows the RNA concentration (ng) measured on the Nanodrop before incubation with streptavidin sepharose beads (input) or after the streptavidin affinity binding purification and elution steps with either TNFα-53 tagged 4xS1m aptamer mRNA or TNFα-53 mRNA negative control (unbound vs eluted). The percentage of purified RNA is relative to the input sample that was not affinity purified. [Diagram 5] Figure 5 shows the plasmid maps containing the following constructs: (1) pAM22, a 2,173-bp control plasmid carrying the tRNAGLN2 scaffold from M. thermautotrophicus (pAM22(tRNA); the plasmid map is annotated with the position of the anticodon arm relative to the Gln2 anticodon loop), (2) pAM20, a 2,134-bp control plasmid carrying the Sm aptamer (pAM20(Sm)), (3) pAM21, a 2,206-bp experimental plasmid carrying the Sm aptamer sequence embedded in a portion of the anticodon loop tRNAGLN2 sequence flanked on either side by tRNA anticodon arm sequences (pAM21(tRNA Sm)), and (4) pAM23, a 2,306-bp experimental plasmid carrying the tandem 2-repeat configuration of the Sm-tRNAGLN2 construct (2× tRNA Each tag was driven by a T7 promoter. [Figure 6]Figure 6 shows the RNA concentration (ng) measured on the Nanodrop before incubation with streptavidin sepharose beads (input) or after the streptavidin affinity binding purification wash steps (washes 1-3) and elution step (elution) using either mRNA containing Sm, tRNA, tRNA-Sm, and 2xtRNA Sm aptamer tags. The percentage of RNA recovery after affinity purification is relative to the input sample that was not affinity purified. [Figure 7] Figure 7 shows the aptamer tagging strategy for optimized binding affinity and translation of mRNA based on aptamer-transcript localization, aptamer copy number, aptamer embedded in tRNA scaffold, and tandem repeat copies of aptamer embedded in tRNA scaffold. [Figure 8] FIG. 8 shows the plasmid maps of pAM11 (3,541 bp) carrying humanized enhanced green fluorescent protein (hEGFP) and pAM8 plasmid (3,213 bp) carrying hEGFP tagged with the 4×S1m aptamer. [Figure 9] FIG. 9 is an image of an agarose gel containing mRNA generated from IVT reactions of PCR product templates for hEGFP (lane 1, from pAM11) and hEGFP tagged with the 4×S1m aptamer (lane 2, from pAM8). [Figure 10] Figure 10 shows the RNA concentration (ng) measured on the Nanodrop before incubation with streptavidin sepharose beads (input) or after the streptavidin affinity binding purification and elution step with either hEGFP or mRNA containing hEGFP tagged with the 4xS1m aptamer (elution). The percentage of purified RNA is relative to the input sample that was not affinity purified. [Figure 11] FIG. 11 shows representative fluorescence microscopy images of HEK293FT cells transfected with hEGFP or hEGFP-4×S1m mRNA after 24 hours. [Figure 12] FIG. 12 shows a panel of representative fluorescence microscopy images taken of HEK293FT cells transfected with hEGFP (left column, top panel), hEGFP-4×S1m (left column, bottom panel), hEGFP with a long polyA tail (right column, top panel), or hEGFP-4×S1m with a long polyA tail (right column, bottom panel) mRNA after 24 hours. [Figure 13] Figures 13A-B test whether the topological order of the S1m aptamer affects downstream mRNA affinity purification. Figure 13A is a schematic of an experimental construct designed to test the location of the S1m aptamer in the mRNA transcript. The S1m aptamer was placed either (1) immediately upstream of the 5'UTR, (2) immediately upstream of the 3'UTR, (3) in the 3'UTR, (4) immediately downstream of the 3'UTR, or (5) at the 3' end of the polyA sequence. Figure 13B shows the percentage of RNA recovered after affinity purification, following the streptavidin binding and elution steps (unbound vs. eluted), relative to the input sample that was not affinity purified. [Figure 14] Testing whether the copy number (valency) of the aptamer in the transcript affects downstream mRNA affinity purification, Figure 14 shows the percentage of RNA recovered after affinity purification, relative to the input sample that was not affinity purified, after a streptavidin binding and elution step (unbound vs. eluted) using mRNA constructs containing 1 to 6 copies of the S1m aptamer. [Figure 15] Figure 15 shows the percentage of RNA recovered after mRNA affinity purification, relative to input samples that were not affinity purified, after streptavidin binding and elution steps (unbound vs. eluted) with mRNA tagged with 2xS1m, 4xS1m, or tRNA S1m aptamers containing different protein coding sequences (Singapore '16 hemagglutinin) and different UTRs. [Figure 16]Figures 16A-C test whether the positioning of aptamers in mRNA transcripts affects translation kinetics in HSKMc cells. Figure 16A is a schematic diagram of an experimental construct designed to test the effect of the position of the S1m aptamer relative to other topologically ordered components of the mRNA. Figure 16B is a bar graph of the total number of GFP-positive cells (expressed as a percentage) calculated by flow cytometry analysis for HSKMc cells transfected with untagged control mRNA or one of the five aptamer-tagged mRNAs shown in Figure 16A. Figure 16C is a bar graph showing the number of GFP-positive high cells (expressed as a percentage) in Figure 16B. [Figure 17] Figures 17A-C test whether the positioning of aptamers in mRNA transcripts affects translation kinetics in Hela cells. Figure 17A is a schematic diagram of an experimental construct designed to test the effect of the position of the S1m aptamer relative to other topologically ordered components of the mRNA. Figure 17B is a bar graph of the total number of GFP-positive cells (expressed as a percentage) calculated by flow cytometry analysis for Hela cells transfected with untagged control mRNA or one of the five aptamer-tagged mRNAs shown in Figure 17A. Figure 17C is a bar graph showing only the GFP-positive high cell numbers (expressed as a percentage) from Figure 17B. [Figure 18] FIG. 18 shows a bar graph of the total number of GFP-positive cells (expressed as a percentage) calculated by flow cytometry analysis for Hela cells transfected with either control or aptamer-tagged mRNAs with increasing polyA tail lengths (labeled "Aptamer, poly(A)2x60_6+A's"). [Figure 19]Figures 19A-B examine whether stabilization of the S1m aptamer by the tRNA scaffold affects mRNA affinity purification and subsequent mRNA translation efficiency. Figure 19A is a bar graph showing the percentage of RNA recovered after mRNA affinity purification relative to the input sample after streptavidin binding and elution steps (unbound vs. eluted) with untagged mRNA control, 2xS1m aptamer, 4xS1m aptamer transcripts, or mRNA tagged with the tRNA S1m aptamer. Figure 19B is a bar graph of the total number of GFP-positive Hela cells (in percentage) calculated by flow cytometry analysis after transfection with untagged mRNA control or mRNA tagged with the tRNA S1m aptamer (labeled "tRNA-stabilized aptamer"). [Figure 20] Figure 20A shows the secondary RNA structures formed by the F30-aptamer. Figure 20B shows the percentage of RNA recovered after mRNA affinity purification relative to the input sample after streptavidin binding and elution steps (unbound vs. eluted) using mRNA tagged with untagged mRNA control, 4xS1m aptamer, 1xS1m aptamer stabilized with F30 scaffold (F30-1xS1m), or 2xS1m aptamer stabilized with F30 scaffold (F30-2xS1m). FIG. 20C shows the RNA concentration (ng) measured on a Nanodrop before incubation with streptavidin sepharose beads (Input) or after the streptavidin affinity binding purification and elution step (Elution) with either untagged mRNA control, 4×S1m aptamer, F30-2×S1m aptamer, or F30-1×S1m tagged mRNA. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0044] The present disclosure is particularly directed to novel mRNA compositions and methods for RNA affinity purification.In particular, the present disclosure relates to mRNA compositions that comprise at least one RNA aptamer.The RNA aptamers associated with the disclosed mRNA compositions allow for the use of effective affinity purification methods, and have minimal impact on translation efficiency and immunogenicity.Also disclosed herein are methods for producing these mRNA tagged aptamer compositions.

[0045] I. Definition Unless otherwise defined herein, scientific and technical terms used in connection with the present invention shall have the meanings commonly understood by those of ordinary skill in the art. Exemplary methods and materials are described below, however, methods and materials similar or equivalent to those described herein may also be used in practicing or testing the present invention. In case of conflict, the present specification, including definitions, shall control. In general, the nomenclature and techniques used in connection with cell and tissue culture, molecular biology, virology, immunology, microbiology, genetics, analytical chemistry, synthetic organic chemistry, medicinal and pharmaceutical chemistry, and protein and nucleic acid chemistry and hybridization described herein are well known and commonly used in the art. Enzymatic reactions and purification techniques are performed according to manufacturer's specifications as commonly accomplished in the art or as described herein. Furthermore, unless otherwise required by context, singular terms shall include the plural and plural terms shall include the singular. Throughout this specification and the embodiments, the terms "have" and "comprise", or variations such as "has", "having", "comprises", or "comprising" are understood to mean the inclusion of a stated integer or group of integers, but not the exclusion of any other integer or group of integers. All publications and other references mentioned herein are incorporated by reference in their entirety. Although a number of documents are cited herein, this citation is not an admission that any of these documents form part of the general knowledge in the art.

[0046] It should be noted that the term "a" or "an" entity refers to one or more of that entity; for example, a "nucleotide sequence" is understood to represent one or more nucleotide sequences. Thus, the terms "a" (or "an"), "one or more," and "at least one" are used interchangeably herein.

[0047] Furthermore, "and / or" as used herein is considered to be a specific disclosure of each of the two specified features or components, whether or not accompanied by the other. Thus, the term "and / or" as used herein in phrases such as "A and / or B" is intended to include "A and B", "A or B", "A (alone)", and "B (alone)". Similarly, the term "and / or" as used in phrases such as "A, B, and / or C" is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0048] Whenever an aspect is described herein with the word "comprising," it is understood that analogous aspects described in terms of "consisting of" and / or "consisting essentially of" are also provided.

[0049] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by ordinary skilled artisans in the art to which this disclosure pertains.For example, Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd Edition, 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd Edition, 1999, Academic Press and Oxford Dictionary Of Biochemistry And Molecular Biology, Revised Edition, 2000, Oxford University Press can provide those skilled in the art with a general dictionary of many of the terms used in this disclosure.

[0050] Units, prefixes, and symbols are expressed in the format accepted by the International System of Units (SI). Numeric ranges are inclusive of the numbers defining the range. Unless otherwise noted, amino acid sequences are written from left to right in the amino to carboxy direction. The headings provided herein are not intended to limit the various aspects of this disclosure. Thus, the terms defined immediately below are more fully defined by reference to the entire specification.

[0051] The terms "approximately" or "about" are used herein to mean approximately, roughly, in the vicinity of, or within the region of. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the stated numerical values. In general, the term "about" may modify a numerical value above and below the stated value by, for example, a variance of 10 percent above and below (high and low). In some embodiments, the term refers to a deviation of ±10%, ±5%, ±4%, ±3%, ±2%, ±1%, ±0.9%, ±0.8%, ±0.7%, ±0.6%, ±0.5%, ±0.4%, ±0.3%, ±0.2%, ±0.1%, ±0.05%, or ±0.01% from the indicated numerical value. In some embodiments, "about" refers to a deviation of ±10% from the indicated numerical value. In some embodiments, "about" refers to a deviation of ±5 percent from the indicated numerical value. In some embodiments, "about" refers to a deviation of ±4 percent from the indicated numerical value. In some embodiments, "about" refers to a deviation of ±3 percent from the indicated numerical value. In some embodiments, "about" refers to a deviation of ±2 percent from the indicated numerical value. In some embodiments, "about" refers to a deviation of ±1 percent from the indicated numerical value. In some embodiments, "about" refers to a deviation of ±0.9 percent from the indicated numerical value. In some embodiments, "about" refers to a deviation of ±0.8 percent from the indicated numerical value. In some embodiments, "about" refers to a deviation of ±0.7 percent from the indicated numerical value. In some embodiments, "about" refers to a deviation of ±0.6 percent from the indicated numerical value. In some embodiments, "about" refers to a deviation of ±0.5 percent from the indicated numerical value. In some embodiments, "about" refers to a deviation of ±0.4 percent from the indicated numerical value. In some embodiments, "about" refers to a deviation of ±0.3 percent from the indicated numerical value. In some embodiments, "about" refers to a deviation of ±0.1 percent from the indicated numerical value. In some embodiments, "about" refers to a deviation of ±0.05 percent from the indicated numerical value.In some embodiments, "about" refers to a deviation of ±0.01 percent from the indicated numerical value.

[0052] Depending on the context, the term "polynucleotide" or "nucleotide" can encompass a single nucleic acid as well as multiple nucleic acids. In some embodiments, a polynucleotide is an isolated nucleic acid molecule or construct, such as messenger RNA (mRNA) or plasmid DNA (pDNA). In some embodiments, a polynucleotide comprises a conventional phosphodiester bond. In some embodiments, a polynucleotide comprises a non-conventional bond (e.g., an amide bond as found in peptide nucleic acid (PNA)). The term "nucleic acid" can refer to one or more nucleic acid segments present in a polynucleotide, such as DNA or RNA fragments. By "isolated" nucleic acid or polynucleotide is intended a nucleic acid molecule, DNA or RNA, that has been removed from its native environment. For example, a recombinant polynucleotide encoding a Factor VIII polypeptide contained in a vector is considered isolated for the purposes of this disclosure. Further examples of isolated polynucleotides include recombinant polynucleotides maintained in a heterologous host cell or purified (partially or substantially) from other polynucleotides in solution. Isolated RNA molecules include in vivo or in vitro RNA transcription products of the polynucleotides of the present disclosure. Isolated polynucleotides or nucleic acids in accordance with the present disclosure further include such molecules produced synthetically. In addition, a polynucleotide or nucleic acid may contain regulatory elements, such as a promoter, enhancer, ribosomal binding site, or transcription termination signals.

[0053] As used herein, the term "polypeptide" is intended to encompass the singular "polypeptide" and the plural "polypeptides" and refers to a molecule composed of monomers (amino acids) linked in a linear chain by amide bonds (also known as peptide bonds). The term "polypeptide" refers to any chain or chains of two or more amino acids and does not refer to a specific length of the product. Thus, peptide, dipeptide, tripeptide, oligopeptide, "protein," "amino acid chain," or any other term used to refer to a chain or chains of two or more amino acids are included within the definition of "polypeptide," and the term "polypeptide" is used in place of or interchangeably with any of these terms. The term "polypeptide" is also intended to refer to the products of post-expression modifications of the polypeptide, including, but not limited to, glycosylation, acetylation, phosphorylation, amidation, derivatization with known protecting / blocking groups, proteolytic cleavage, or modification with non-naturally occurring amino acids. A polypeptide may be derived from a natural biological source or produced by recombinant technology, but need not necessarily be translated from a specified nucleic acid sequence. It may be produced by any method, including chemical synthesis.

[0054] An "isolated" polypeptide, or a fragment, variant, or derivative thereof, refers to a polypeptide that is not in its natural environment. No particular level of purification is required. For example, an isolated polypeptide is simply removed from its native or natural environment. Recombinantly produced polypeptides and proteins expressed in host cells are considered isolated for the purposes of this disclosure, as are native or recombinant polypeptides that have been separated, fractionated, or partially or substantially purified by any suitable technique.

[0055] As used herein, "administer" or "administering" refers to delivering a composition, e.g., a chimeric protein, described herein, to a subject. The composition, e.g., a chimeric protein, is administered to a subject using methods known in the art. In particular, the composition is administered intravenously, subcutaneously, intramuscularly, intradermally, or via any mucosal surface, e.g., via oral, sublingual, buccal, nasal, rectal, vaginal, or pulmonary routes. In some embodiments, the administration is intravenous. In some embodiments, the administration is subcutaneous. In some embodiments, the administration is self-administered. In some embodiments, a parent administers the chimeric protein to a child. In some embodiments, the chimeric protein is administered to a subject by a medical professional, such as a doctor, a hygienist, or a nurse.

[0056] II. Messenger RNA (mRNA) Disclosed herein is an mRNA composition comprising an RNA aptamer. mRNA is typically considered to be a type of RNA that transfers information from DNA to ribosomes. The existence of an mRNA is typically very short and involves processing and translation followed by degradation. Typically, in eukaryotes, processing of the mRNA involves adding a "cap" to the N-terminus (5') and a "tail" to the C-terminus (3').

[0057] A typical cap is a 7-methylguanosine cap of guanosine that is linked to the first transcribed nucleotide via a 5'-5'-triphosphate bond. The presence of the cap is important in conferring resistance to nucleases found in most eukaryotic cells. The 5' cap is typically added as follows: first, an RNA terminal phosphatase removes one of the terminal phosphate groups from the 5' nucleotide, leaving two terminal phosphates; then, guanosine triphosphate (GTP) is added to the terminal phosphate via guanylyltransferase, generating a 5'5'5 triphosphate linkage; and then, the 7-nitrogen of guanine is methylated by a methyltransferase.

[0058] A tail is typically a polyadenylation event, whereby a polyadenylyl moiety is added to the 3' end of an mRNA molecule. The presence of this "tail" serves to protect the mRNA from degradation by exonucleases. Messenger RNA is translated by ribosomes into a series of amino acids that make up proteins.

[0059] In some embodiments, the mRNA comprises a 5' and / or 3' untranslated region (UTR). In some embodiments, the mRNA disclosed herein comprises a 5' UTR that comprises one or more elements that affect the stability or translation of the mRNA. In some embodiments, the 5' UTR can be about 50 to 500 nucleotides in length. In some embodiments, the mRNA disclosed herein comprises a 3' UTR that comprises one or more of a polyadenylation signal, a binding site for a protein that affects the stability of the location of the mRNA in the cell, or one or more binding sites for an miRNA. In some embodiments, the 3' UTR can be 50 to 500 nucleotides in length or more. In some embodiments, the mRNA disclosed herein comprises a 5' or 3' UTR that is derived from a gene that is different from the gene encoded by the mRNA transcript. In some embodiments, the mRNA disclosed herein comprises a 5' or 3' UTR that is chimeric.

[0060] The mRNA disclosed herein may be synthesized according to any of a variety of known methods. For example, the mRNA according to the present invention may be synthesized via in vitro transcription (IVT). Methods of in vitro transcription are known in the art. See, for example, Geall et al. (2013) Semin. Immunol. 25(2):152-159; Brunelle et al. (2013) Methods Enzymol. 530:101-14. Briefly, IVT is typically performed using a linear or circular DNA template containing a promoter, a pool of ribonucleotide triphosphates, a buffer system that may contain DTT and magnesium ions, and a suitable RNA polymerase (e.g., T3, T7 or SP6 RNA polymerase), DNAse I, pyrophosphatase, and / or RNAse inhibitors. The exact conditions will vary depending on the specific application. The presence of these reagents is undesirable in the final mRNA product and is considered an impurity or contaminant that must be purified to provide a clean, homogenous mRNA suitable for therapeutic use. In some embodiments, mRNA provided from an in vivo transcription reaction may be desirable, although other sources of mRNA may be used in accordance with the present disclosure, including wild-type mRNA produced from bacteria, fungi, plants, and / or animals.

[0061] The methods disclosed herein can be used to purify mRNAs of various nucleotide lengths. In some embodiments, the disclosed methods can be used to purify mRNAs of lengths greater than about 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 11 kb, 12 kb, 13 kb, 14 kb, or 15 kb. The mRNAs disclosed herein can be modified or unmodified. In some embodiments, the mRNAs disclosed herein typically include one or more modifications that enhance the stability of the RNA. Exemplary modifications include backbone modifications, sugar modifications, or base modifications.In some embodiments, the mRNA of the disclosure may contain purines (adenine (A), guanine (G)) or pyrimidines (thymine (T), cytosine (C), uracil (U)), as well as modified nucleotide analogs or derivatives of purines and pyrimidines, such as 1-methyladenine, 2-methyladenine, 2-methylthio-N-6-isopentenyladenine, N6-methyladenine, N6-isopentenyladenine, 2-thio Cytosine, 3-methylcytosine, 4-acetyl-cytosine, 5-methylcytosine, 2,6-diaminopurine, 1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine, 7-methyl-guanine, inosine, 1-methyl-inosine, pseudouracil (5-uracil), dihydrouracil, 2-thio-uracil, 4-thio-uracil, 5-carboxymethylaminomethyl-2-thio-uracil, 5-(carboxy hydroxymethyl)-uracil, 5-fluorouracil, 5-bromo-uracil, 5-carboxymethylaminomethyl-uracil, 5-methyl-2-thio-uracil, 5-methyl-uracil, N-uracil-5-oxyacetic acid methyl ester, 5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil, 5'-methoxycarbonylmethyl-uracil, 5-methoxy-uracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 1-methyl-pseudouracil, queosine, β-D-mannosyl-queosine, phosphoramidate, phosphorothioate, peptide nucleotides, methylphosphonates, 7-deazaguanosine, 5-methylcytosine, and inosine.In some embodiments, the mRNA of the present disclosure comprises at least one chemical modification consisting of, but not limited to, pseudouridine, N1-methylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methyluridine, 5-methoxyuridine, and 2-O-methyluridine. In some embodiments, the modified nucleotide comprises N1-methylpseudouridine. The preparation of such analogs is known to those skilled in the art, for example from U.S. Pat. No. 4,373,071, U.S. Pat. No. 4,401,796, U.S. Pat. No. 4,415,732, U.S. Pat. No. 4,458,066, U.S. Pat. No. 4,500,707, U.S. Pat. No. 4,668,777, U.S. Pat. No. 4,973,679, U.S. Pat. No. 5,047,524, U.S. Pat. No. 5,132,418, U.S. Pat. No. 5,153,319, U.S. Pat. No. 5,262,530, and U.S. Pat. No. 5,700,642.

[0062] In some embodiments, the mRNA disclosed herein comprises mRNA from a single gene or a single synthetic or expression construct, however, in some embodiments, the mRNA compositions disclosed herein comprise multiple mRNA transcripts, each of which may, or collectively, encode one or more proteins.

[0063] In some embodiments, the mRNA comprising the RNA aptamer disclosed herein encodes a therapeutic polypeptide, hi some embodiments, the therapeutic polypeptide comprises an antibody heavy chain, an antibody light chain, an enzyme, or a cytokine.

[0064] In some embodiments, the mRNA encodes a cytokine, non-limiting examples of which include IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, INF-α, INF-γ, GM-CFS, M-CSF, LT-β, ​​TNF-α, growth factors, and hGH.

[0065] In one embodiment, the mRNA comprising the RNA aptamer encodes a genome editing polypeptide.In some embodiments, the genome editing polypeptide is a CRISPR protein, a restriction nuclease, a meganuclease, a transcription activator-like effector protein (TALE nuclease, including TALEN), or a zinc finger protein (ZF nuclease, including ZFN).See, for example, International Publication No. WO2020139783.

[0066] In some embodiments, the mRNA encodes an enzyme utilized in enzyme replacement therapy. Examples of enzyme replacement therapy include lysosomal storage diseases such as Gaucher disease, Fabry disease, MPS I, MPS II (Hunter syndrome), MPS VI, and glycogen storage disease type II.

[0067] In some embodiments, the mRNA comprising the RNA aptamer encodes an antigen of interest. The antigen can be a polypeptide derived from a virus, such as influenza virus, coronavirus (e.g., SARS-CoV-1, SARS-CoV-2, or MERS-related virus), Ebola virus, Dengue virus, human immunodeficiency virus (HIV), hepatitis A virus (HAV), hepatitis B virus (HBV), hepatitis C virus (HCV), herpes simplex virus (HSV), respiratory syncytial virus (RSV), rhinovirus, cytomegalovirus (CMV), Zika virus, human papillomavirus (HPV), human metapneumovirus (hMPV), human parainfluenza virus type 3 (PIV3), Epstein-Barr virus (EBV), or chikungunya virus.

[0068] Antigens can be derived from bacteria, such as Staphylococcus aureus, Moraxella (e.g., Moraxella catarrhalis; causing otitis, respiratory infections, and / or sinusitis), Chlamydia trachomatis (causing chlamydia), Borrelia (e.g., Borrelia burgdorferi, causing Lyme disease), Bacillus anthracis (causing anthrax), Salmonella typhi (causing typhoid fever), Mycobacterium tuberculosis (causing tuberculosis), Mycobacterium acnes (causing acne), or atypical Haemophilus influenzae.

[0069] If desired, the mRNA comprising the RNA aptamer may code for multiple antigens. In some embodiments, the mRNA disclosed herein codes for 2, 3, 4, 5, 6, 7, 8, 9, 10 or more antigens. These antigens can be from the same pathogen or from different pathogens. For example, polycistronic mRNA that can be translated into multiple antigens (e.g., each antigen coding sequence is separated by a nucleotide linker that codes for a self-cleaving peptide, such as 2A peptide) is further fused to the aptamer.

[0070] In some embodiments, the mRNA compositions disclosed herein are used in vaccines. mRNA vaccines offer a promising alternative to traditional subunit vaccines that contain antigenic proteins derived from pathogens. mRNA-based vaccines allow de novo expression of complex antigens in vaccinated subjects, resulting in proper post-translational modification and presentation of the antigen in its native conformation. Furthermore, the manufacturing process for mRNA vaccines, once established, can be used for a variety of antigens, allowing for rapid development and deployment of mRNA vaccines. A detailed discussion of mRNA vaccines can be found in Pardi et al. (2018) Nat Rev Drug Discov 17, 261-279.

[0071] III. Aptamers The widespread use of affinity purification of RNA has been limited due to the lack of efficient RNA fusion tags. Unless the RNA to be purified naturally contains a sequence with a strong affinity for a target that can be immobilized on a stationary phase (i.e., a chromatography resin), the RNA may require tagging with a specific sequence to do so, similar to the polyhistidine tags used in protein science.

[0072] Disclosed herein is an mRNA composition that comprises at least one aptamer.The aptamer associated with these mRNA compositions allows the use of affinity purification and has minimal impact on translation efficiency and immunogenicity.Also disclosed herein is the method for producing such mRNA tagged aptamer composition.

[0073] The term "aptamer" as used herein refers to any nucleic acid sequence that has a non-covalent binding site for a specific target. Exemplary aptamer targets include nucleic acid sequences, proteins, peptides, antibodies, small molecules, minerals, antibiotics, etc. Aptamer binding sites can arise due to the secondary structure, tertiary structure, or conformational structure of the aptamer.

[0074] The term "RNA aptamer" as used herein refers to an aptamer that is composed of RNA. In some embodiments, the RNA aptamer is included in the nucleotide sequence of the mRNA transcript. In other embodiments, the RNA aptamer is separated from the nucleotide sequence of the mRNA transcript.

[0075] Aptamers are typically capable of binding to a particular target with high affinity and specificity. Aptamers have several advantages over other binding proteins (e.g., antibodies). For example, aptamers can be engineered entirely in vitro (e.g., via the SELEX aptamer selection method), can be produced by chemical synthesis, have desirable storage properties, and induce little or no immunogenicity in therapeutic applications. See generally, Proske et al. (2005) Appl. Microbiol. Biotechnol 69:367-374.

[0076] Aptamers have historically been used to regulate gene expression by directly binding to ligands: these aptamers act similarly to regulatory proteins, forming highly specific binding pockets for their targets and subsequently undergoing conformational changes.

[0077] In some embodiments, the RNA aptamer is synthetically derived. In some embodiments, the RNA aptamer is naturally derived from prokaryotes and / or eukaryotes. In some embodiments, the RNA aptamer is derived from a hairpin RNA, a tRNA, or a riboswitch.

[0078] In some embodiments, the RNA aptamer is derived from a riboswitch. A riboswitch is a regulatory RNA element that functions as a small molecule sensor to control gene transcription and translation. Several classes of riboswitches are known in the art. Exemplary riboswitches include the B 12 riboswitch, TPP riboswitch, SAM riboswitch, guanine riboswitch, FMN riboswitch, lysine riboswitch, and PreQ1 riboswitch.

[0079] In some embodiments, the RNA aptamer is a split aptamer. Split aptamers are similar to split-protein systems (such as β-galactosidase) and rely on two or more short nucleic acid strands that assemble into a higher order structure in the presence of a specific target. Debais et al. (2020) Nucleic Acids Res 48(7):3400-3422. An exemplary split aptamer is the ATP-aptamer. Sassanfar and Szostak (1993) Nature 364(6437)-550-553. The ATP aptamer is an RNA aptamer that has been split into two RNA fragments by removing the loop that closes the stem and extending each fragment with additional nucleotides to compensate for loss of stability. Neither of the two RNA fragments binds ATP alone, but the binding ability is reactivated in the presence of ATP. Debiais et al. (2020) Nucleic Acids Res 48(7):3400~3422.

[0080] In some embodiments, the RNA aptamer is an X-aptamer. The X-aptamer is modified by combining natural and chemically modified nucleotides to improve binding affinity, specificity, and versatility. An exemplary embodiment of the X-aptamer is the PS2-aptamer. The PS2-aptamer is an RNA aptamer that contains phosphorodithioate (i.e., PS2) substitutions at one nucleotide of the RNA aptamer, increasing the binding affinity of the aptamer from the nanomolar to picomolar range. Abeydeera et al. (2016) Nucleic Acids Res. 44(17):8052-8064.

[0081] In some embodiments, the RNA aptamer binds to a ligand. In some embodiments, the ligand is utilized in an affinity purification system. In some embodiments, the affinity ligand comprises protein A, protein G, streptavidin, glutathione (GSH), dextran (Sephadex), cellulose (e.g., diethylaminoethylcellulose) or a fluorescent molecule. In some embodiments, the affinity ligand is immobilized on a chromatography resin.

[0082] In some embodiments, the affinity ligand comprises Protein A. DNA aptamers have previously been shown to target Protein A. See, e.g., Stoltenburg et al. (2016) Sci Rep. 6:33812.

[0083] In some embodiments, the RNA aptamers of the present disclosure bind to streptavidin. Streptavidin-binding aptamers are described, for example, in Srisawat and Engelke (2001) RNA 7(4):632-641.

[0084] Also disclosed herein are RNA aptamers that bind to Sephadex. Sephadex-binding aptamers are described, for example, in Srisawat et al. (2001) Nucleic Acid Res 29(2):e4.

[0085] Also disclosed herein is the RNA aptamer that binds to glutathione (GSH).Glutathione-binding aptamers are described, for example, in Bala et al. (2011), RNA Biology 8(1):101-111.In some embodiments, the RNA aptamer is GSHapt 8.17 or GSHapt 5.39.

[0086] Also disclosed herein are RNA aptamers that bind to fluorescent molecules. Examples of such aptamers are described, for example, in Paige et al. (2011) Science 333(6042):642-646.

[0087] In some embodiments, the RNA aptamer comprises an S1m aptamer. In some embodiments, the S1m aptamer used according to the present disclosure is an aptamer described in Bachler et al. (1999) RNA 5(11):1509-1516, Srisawat and Engelke (2001) RNA 7(4):632-641, or Li and Altman (2002) Nuc.Acids Res.30(17):3706-3711. In some embodiments, the RNA adapter comprises the nucleotide sequence of SEQ ID NO:2.

[0088] In some embodiments, the RNA aptamer comprises an Sm aptamer. In some embodiments, the RNA adapter comprises the nucleotide sequence of SEQ ID NO:6.

[0089] A. Location of Aptamer The introduction of aptamers into mRNA has been reported to affect translation. The location of the aptamer on the mRNA may determine in part the magnitude of the effect on translation. For example, it is generally believed that inserting structured RNA into the 5'-UTR of a transcript reduces the level of protein translation. Babendure et al., (2006), RNA 12:851-861; Kotter et al., (2009) Nuc Acids Res 37(18):e120. Inserting an aptamer into the 5'UTR of an mRNA molecule results in the formation of a hairpin loop, which alters the structure of the mRNA and inhibits access to the ribosome, thus preventing translation. See, for example, US Patent Application Publication No. 2007 / 0136827.

[0090] Disclosed herein are RNA aptamers that include aptamers at various positions relative to the ORF of the mRNA. The selection of the position of the RNA aptamer on the mRNA is evaluated with respect to both the magnitude of translational control and basal expression levels. For example, reporter constructs can be constructed that include aptamers at various positions within the 5'-UTR between 0 and 100 bases from the cap or start codon. In some embodiments, the downstream region after the aptamer can be maintained to preserve the peptide leader sequence, thereby limiting modification of the upstream sequence relative to the aptamer.

[0091] In some embodiments, the RNA aptamer is located in the 5'UTR. In some embodiments, the RNA aptamer is placed following the 5'UTR and immediately preceding the ORF encoding the protein. In some embodiments, the RNA aptamer is placed following the open reading frame (ORF) encoding the protein and immediately preceding the 3'UTR. In some embodiments, the RNA aptamer is placed between the 3' end of the ORF and the 5' end of the 3'UTR. In some embodiments, the RNA aptamer is placed in the 3'UTR. In some embodiments, the RNA aptamer is placed downstream of the 3'UTR, immediately preceding the polyA tail. In some embodiments, the RNA aptamer is placed between the 3' end of the 3'UTR and the 5' end of the polyA sequence. In some embodiments, the RNA aptamer is placed immediately following the polyA tail (i.e., at the end of the transcript). In some embodiments, the RNA aptamer is placed at the 3' end of the polyA sequence.

[0092] In some embodiments, the RNA aptamer may not be directly bound to mRNA. In some embodiments, the RNA aptamer is bound to a linker. For example, see Elenko et al. (2009) J Am Chem Soc. 131(29):9866-9867.

[0093] In some embodiments, the RNA aptamer is removed from the mRNA after affinity purification. This can be accomplished, for example, by using a DNA oligonucleotide that hybridizes to the RNA aptamer or the RNA scaffold. The resulting duplex is then cleaved with an enzyme such as RNase H. See, for example, Batey RT, (2014), Curr Opin Struct Biol.26:1-8.

[0094] B. Aptamer copy number Increasing the copy number of an aptamer may allow the aptamer to form a larger three-dimensional structure (i.e., increasing the number of available affinity ligand binding sites or forming unique ligand binding sites). Strategic placement of aptamer copies may allow for increased avidity with the cognate affinity ligand.

[0095] In some embodiments, the mRNA used in the disclosed methods and compositions contains multiple copies of aptamers. Previously, it was reported that the use of one small molecule binding aptamer in the 5'-UTR can suppress translation 8-fold upon addition of ligand, whereas the use of three aptamers suppresses translation 37-fold. Kotter et al. (2009), Nucleic Acids Res.37(18):e120. In some embodiments, the number of copies of aptamers introduced into mRNA is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more.

[0096] In some embodiments, the RNA aptamer comprises multiple copies of the aptamer sequence. In some embodiments, the RNA aptamer comprises the nucleotide sequence of SEQ ID NO:5.

[0097] In some embodiments, the copies of the aptamer are in a repeat tandem configuration. The 4xS1m aptamer disclosed herein is an example of a multi-copy aptamer in a repeat tandem configuration.

[0098] IV. RNA Scaffolds In some embodiments, the mRNA compositions disclosed herein include RNA aptamers embedded in an RNA scaffold. As used herein, the term "RNA scaffold" refers to a non-coding RNA molecule that can assemble to have a predefined structure that forms a spatial architecture to organize, protect, or enhance the properties of a functional module of interest. Exemplary functional modules can be nucleic acids (e.g., aptamers) or proteins. In some embodiments, RNA scaffolds suitable for use in accordance with the present disclosure can associate with RNA without disrupting the RNA structure. Furthermore, suitable RNA scaffolds allow for the embedding of RNA aptamers without disrupting the RNA structure. In some embodiments, the RNA scaffolds used in accordance with the present disclosure can be any RNA scaffold that does not significantly adversely affect the expression or translation of the RNA.

[0099] The predefined structure of the RNA scaffold includes RNA-specific sequence motifs for self-assembly, such as base pairing between hairpin stems (kissing loops), and / or chemical modifications. Myhrvold and Silver (2015) Nat Struct Mol Bio 22(1):8-10. The RNA-specific sequence motifs can form secondary (i.e., two-dimensional) and / or tertiary (i.e., three-dimensional) structures. In some embodiments, the RNA scaffold includes at least one secondary structure motif. In some embodiments, the RNA scaffold includes at least one tertiary structure motif. Common secondary and / or tertiary RNA structural motifs include open and stacked three-way junctions, four-way junctions, four-way junctions similar to Holliday structures, stem loops (i.e., hairpin loops), internal loops (i.e., internal loops), bulges, tetraloops, multibranched loops, pseudoknots and knots, 90° kinks, and pseudotorsion angles. Shanna et al. (2021) Molecules 26(5):1422.

[0100] RNA scaffolds can be either naturally occurring (e.g., attenuators, tRNAs, riboswitches, terminators) or artificially modified to form secondary or tertiary RNA structures. Delebecque et al., (2012) Nat Protoc 7(10):1797-1807. Typically, to maintain a predetermined structure of the RNA scaffold, the RNA loops (e.g., hairpin loops) of the RNA scaffold are the target regions for embedding the functional modules of interest. See, for example, US Patent Application Publication No. 20050282190A1. However, the predetermined structure of the RNA scaffold can be modified to have further desirable properties. For example, the predetermined RNA scaffold structure can be modified to be resistant to either or both exonuclease digestion and endonuclease digestion.

[0101] In some embodiments, the mRNA compositions disclosed herein include an RNA aptamer embedded in a transfer RNA (tRNA). Transfer RNA (tRNA) scaffolds are attractive tagging candidates in affinity purification systems because tRNA folds into a standard stable cloverleaf structure, is resistant to unfolding, and can protect RNA fusions from nuclease degradation. Embedding an aptamer into the anticodon loop of a tRNA scaffold has been demonstrated to promote proper folding. See generally Ponchon and Dardel (2007) Nat. Methods 4(7):571-576; Ponchon et al. (2013) Nucleic Acids Res. 41:e150. It has been demonstrated that RNA aptamers embedded in tRNA scaffolds can be used to successfully pull down transcript-specific RNA-binding proteins from cell lysates. Iioka H et al. (2011) Nuc. Acids Res. 39(8):e53.

[0102] In some embodiments, the mRNA compositions disclosed herein comprise an RNA aptamer embedded in a tRNA comprising the nucleotide sequence of SEQ ID NO:7.

[0103] In some embodiments, the RNA aptamer is embedded in the tRNA hairpin loop of tRNA. In some embodiments, the RNA aptamer is embedded in the tRNA anticodon loop. In some embodiments, the RNA aptamer is embedded in the tRNA D loop. In some embodiments, the RNA aptamer is embedded in the tRNA T loop.

[0104] In some embodiments, the mRNA compositions disclosed herein comprise an RNA aptamer embedded in a bioorthogonal scaffold. A prominent feature of a bioorthogonal scaffold is that it is not recognized by intracellular nucleases and is not targeted for degradation. Filonov et al., (2015) Chem Biol. 22(5):649-660. Examples of bioorthogonal scaffolds include V5, F29, F30, or variants thereof. Ibid. F29 and F30 share the same three-way junction motif found in naturally occurring riboswitch and viral RNAs. Shu et al., (2014) Nucleic Acids Res. 42, e10. F30 is a modified version of F29 that has been mutated to remove the internal terminator sequence. Filonov et al., (2015) Chem Biol. 22(5):649-660.

[0105] In some embodiments, the mRNA composition disclosed herein comprises an RNA aptamer embedded in a bioorthogonal scaffold. In some embodiments, the bioorthogonal scaffold is V5, F29, F30, or a variant thereof.

[0106] In some embodiments, the bioorthogonal scaffold comprises the 5' nucleotide sequence of SEQ ID NO:34 and the 3' nucleotide sequence of SEQ ID NO:35, with the aptamer sequence disposed between SEQ ID NO:34 and SEQ ID NO:35.

[0107] In some embodiments, the bioorthogonal scaffold comprises a 5' nucleotide sequence of SEQ ID NO:39, an internal nucleotide sequence of SEQ ID NO:40, and a 3' nucleotide sequence of SEQ ID NO:41, wherein a first aptamer sequence is disposed between SEQ ID NO:39 and SEQ ID NO:40 and a second aptamer sequence is disposed between SEQ ID NO:40 and SEQ ID NO:41, and optionally the first and second aptamers are the same or different.

[0108] In some embodiments, the RNA aptamer-embedded bioorthogonal scaffold comprises the nucleotide sequence of SEQ ID NO:29 or SEQ ID NO:31.

[0109] Other exemplary RNA scaffolds include ribosomal RNA (rRNA) and ribozymes. In some embodiments, the RNA aptamer is embedded in the ribosomal RNA. In some embodiments, the ribosomal RNA is 5S rRNA or a derivative thereof. Exemplary 5S rRNA scaffolds and their derivatives are described in more detail in Stepanov et al., (Methods Mol Biol. 2323:75-97, 2021), the contents of which are incorporated herein by reference.

[0110] In some embodiments, the RNA aptamer is embedded in a ribozyme. In some embodiments, the ribozyme is catalytically inactive.

[0111] In some embodiments, the RNA aptamer is embedded in a T-cassette. In some embodiments, the T-cassette RNA scaffold comprises the following sequence: [ka] (SEQ ID NO:43, where bold underlined text corresponds to the aptamer insertion site. Aptamers can be inserted into one, two, or all three aptamer insertion sites. In some embodiments, the T-cassette RNA scaffold has one, two, or three aptamers embedded in it. In some embodiments, the aptamers are the same. In other embodiments, the aptamers are different. In yet other embodiments, two of the three aptamers are different. In yet other embodiments, two or three aptamers are the same.

[0112] In some embodiments, the T-cassette RNA scaffold is encoded by the polynucleotide sequence of GAACGAAACTCTGGGAGCTGCGATTGGCAGAATTCCGTTAGCAAGGCCGCAGGACTTGCATGCTTATCCTGCGGCGCGGGCGCGTTTCCCGGGTTACGCGCCCGCCTTAAGTGTTTCTCGAGTTGGCACTTAAGCTTGCTAACGGAATTCCCCCCATATCCAACTTCCAATTTAATCTTTCTTTTTTAATTTTCACTTATTTGCG (SEQ ID NO: 44).

[0113] The T-cassette scaffold is described in further detail in Wurster et al., (Nucleic Acids Research, 37(18):6214-6224, 2009), the contents of which are incorporated herein by reference.

[0114] V. Affinity Purification of RNA In one aspect, disclosed herein is a method for purifying mRNA sample.In some embodiments, the mRNA purified according to the disclosed method is substantially free of impurities from mRNA synthesis.Such impurities include, for example, prematurely terminated RNA sequence, DNA template, and / or enzyme reagent used in in vitro synthesis.

[0115] In some embodiments, the disclosed method for purifying mRNA comprises the steps of: (a) contacting a sample containing mRNA comprising at least one aptamer with an affinity ligand immobilized on a chromatography resin, wherein the RNA aptamer comprises binding affinity for the affinity ligand; (b) eluting the mRNA from the chromatography resin; and (c) purifying the mRNA from the sample.

[0116] Affinity chromatography is one purification method that can be used with the mRNA compositions and methods disclosed herein. The RNA aptamers disclosed herein comprise a binding affinity for a selected affinity ligand. The selected affinity ligand is immobilized (e.g., cross-linked) to a chromatography resin. Thus, the mRNA that comprises the RNA aptamer binds to the resin that comprises the affinity ligand. The chromatography resin material is preferably present in a column, and the sample that comprises the RNA is loaded at the top of the column, and the eluate is collected at the bottom of the column. For a general diagram of the affinity purification method disclosed herein, see, for example, FIG. 1.

[0117] The chromatography resin can be any material known to be used as a stationary phase in chromatography methods. The type of molecule used as an affinity ligand to interact with the RNA aptamer disclosed herein can be of various types. Non-exhaustive examples of affinity ligands are antibodies, proteins, oligonucleotides, dyes, boronic acid groups, or chelated metal ions. The stationary phase can be composed of organic and / or inorganic materials.

[0118] The most widely used stationary phase materials are hydrophilic carbohydrates such as cross-linked agarose and synthetic copolymer materials. These materials may include derivatives of cellulose, polystyrene, synthetic polyamino acids, synthetic polyacrylamide gels, or glass surfaces. Further examples of materials that can be used as chromatography resins are polystyrene divinylbenzene, silica gel, silica gel modified with non-polar residues, or other materials suitable for gel chromatography or other chromatographic methods, such as dextran, Sephadex, agarose, dextran / agarose mixtures, and others known in the art.

[0119] The chromatography resin is functionalized with the affinity ligand that the RNA aptamer has binding affinity for. In some embodiments, the resin can be agarose medium, or a membrane functionalized with phenyl groups (e.g., Phenyl Sepharose™ from GE Healthcare or Phenyl Membrane from Sartorius), Tosoh Hexyl, CaptoPhenyl, low or high substituted Phenyl Sepharose™ 6 Fast Flow, Phenyl Sepharose™ High Performance, Octyl Sepharose™ High Performance (GE Healthcare); Fractogel™ EMD Propyl or Fractogel™ EMD Phenyl (E. Merck, Germany); Macro-Prep™ Methyl or Macro-Prep™ t-Butyl columns (Bio-Rad, California); WP HI-Propyl(C3)™ (JTBaker, New Jersey) or Toyopearl™ ether, phenyl, or butyl (TosoHaas, PA). ToyoScreen PPG, ToyoScreen Phenyl, ToyoScreen Butyl, and ToyoScreen Hexyl are based on rigid methacrylic polymer beads. GE HiScreen Butyl FF and HiScreen Octyl FF are based on high-flow agarose-based beads. Preferred are methacrylate-based monolithic columns such as Toyopearl Ether-650M, Toyopearl Phenyl-650M, Toyopearl Butyl-650M, Toyopearl Hexyl-650C (TosoHaas, PA), POROS-OH (ThermoFisher), or CIM-OH, CIM-SO3, CIM-C4 A, and CIM C4 HDL, which contain OH, sulfate, or butyl ligands, respectively (BIA Separations).

[0120] In some embodiments, the chromatography resin comprises Protein A as an affinity ligand. Exemplary Protein A resins include Byzen Pro Protein A resin (MilliporeSigma; 18887), Dynabeads Protein A magnetic beads (ThermoFisher; 10001D), Pierce Protein A Agarose (ThermoFisher; 20334), Pierce Protein A / G Plus Agarose (ThermoFisher; 20423), Pierce Protein A Plus UltraLink (ThermoFisher; 53142), Pierce Recombinant Protein A Agarose (ThermoFisher), POROS MabCapture A Select (ThermoFisher).

[0121] In some embodiments, the chromatography resin comprises streptavidin as an affinity ligand. Exemplary streptavidin resins include Streptavidin-Agarose from Streptomyces avidinii (MilliporeSigma; S1638), Pierce Streptavidin Plus UltaLink Resin (ThermoFisher; 53117), Pierce High Capacity Streptavidin Agarose (ThermoFisher; 20357), Streptavidin 6HC Agarose Resin (ABT; STV6HC-5), Streptavidin Resin-Amintra (Abcam; ab270530).

[0122] In some embodiments, the chromatography resin comprises glutathione (GSH) as an affinity ligand. Exemplary GSH resins include Glutathione Resin (GenScript; L00206), Pierce Glutathione Agarose (ThermoFisher; 16102BID), Glutathione Sepharose 4B GST-tagged Protein Resin 9Cytiva; 17075605); Glutathione Affinity Resin-Amintra (Abcam; ab270237).

[0123] In certain embodiments, the purification process disclosed herein may be performed during or after mRNA synthesis. For example, the mRNA may be purified as described herein before a cap and / or tail is added to the mRNA. In some embodiments, the mRNA is purified after a cap and / or tail is added to the mRNA. In some embodiments, the mRNA is purified after the cap is added. In some embodiments, the mRNA is purified both before and after a cap and / or tail is added to the mRNA. In general, the purification steps described herein may be performed after each step of mRNA synthesis, optionally together with other purification processes such as dialysis and / or filtration. For example, the mRNA may be dialyzed after the initial synthesis to remove short strands (e.g., with or without a tail) and then subjected to purification as described herein. The purification methods disclosed herein may be applied multiple times to an mRNA sample.

[0124] VI. Vector In one aspect, disclosed herein is a vector comprising the mRNA composition disclosed herein.The nucleic acid sequence encoding the protein of interest (e.g., mRNA encoding therapeutic polypeptide) is cloned into many types of vectors.For example, nucleic acid is cloned into vectors including, but not limited to, plasmid, phagemid, phage derivative, animal virus, and cosmid.Vectors of particular interest include expression vectors, replication vectors, probe generation vectors, sequencing vectors, and vectors optimized for in vitro transcription.

[0125] In one embodiment, the vector is used to express mRNA in a host cell. In another embodiment, the vector is used as a template for IVT. The construction of optimally translated IVT mRNA suitable for therapeutic use is disclosed in detail in Sahin et al. (2014), Nat.Rev.Drug Discov.13, 759-780; Weissman (2015), Expert Rev.Vaccines 14, 265-281.

[0126] In some embodiments, the vectors disclosed herein comprise, in the 5' to 3' orientation, at least the following: an RNA polymerase promoter; a polynucleotide sequence encoding a 5' UTR; a polynucleotide sequence encoding an ORF; a polynucleotide sequence encoding a 3' UTR; and a polynucleotide sequence encoding at least one RNA aptamer. In some embodiments, the vectors disclosed herein also comprise a polynucleotide sequence encoding a polyA sequence and / or a polyadenylation signal.

[0127] A variety of RNA polymerase promoters are known in the art. In one embodiment, the promoter is a T7 RNA polymerase promoter. Other useful promoters include, but are not limited to, T3 and SP6 RNA polymerase promoters. The consensus nucleotide sequences of T7, T3 and SP6 promoters are known in the art.

[0128] Also disclosed herein are host cells (eg, mammalian cells, eg, human cells) that contain the vectors or RNA compositions disclosed herein.

[0129] Polynucleotides are introduced into target cells using any of a number of different methods, such as, but not limited to, electroporation (Amaxa Nucleofector-II (Amaxa Biosystems, Cologne, Germany)), (ECM 830(BTX) (Harvard Instruments, Boston, Massachusetts) or Gene Pulser II (BioRad, Denver, Colorado), Multiporator (Eppendort, Hamburg, Germany), cationic liposome-mediated transfection using lipofection, polymer encapsulation, peptide-mediated transfection, biolistic delivery systems such as "gene guns" (see, e.g., Nishikawa et al., (2001), Hum Gene Ther. 12(8):861-70), or the TransIT-RNA transfection Kit (Mirus, Madison, Wisconsin).

[0130] Chemical means for introducing polynucleotides into host cells include colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle).

[0131] Regardless of the method used to introduce exogenous nucleic acid into a host cell or to expose the cell to an inhibitor of the invention, a variety of assays can be performed to confirm the presence of the mRNA sequence in the host cell. Such assays are well known to those of skill in the art.

[0132] VII. Pharmaceutical Compositions RNA purified according to the present invention is useful as a component of pharmaceutical compositions, for example for use as a vaccine. These compositions typically include RNA and a pharma- ceutically acceptable carrier. The pharmaceutical compositions of the present invention may also include one or more additional components, such as a small molecule immune enhancer (e.g., a TLR agonist). The pharmaceutical compositions of the present invention may also include a delivery system for the RNA, such as a liposome, an oil-in-water emulsion, or a microparticle. In some embodiments, the pharmaceutical composition includes a lipid nanoparticle (LNP). In one embodiment, the composition includes a nucleic acid molecule encoding an antigen encapsulated within the LNP. In some embodiments, the LNP includes at least one cationic lipid. In some embodiments, the LNP includes a cationic lipid, a polyethylene glycol (PEG)-conjugated (PEGylated) lipid, a cholesterol-based lipid, and a helper lipid.

[0133] In order that the invention may be better understood, the following examples are presented, which are for illustrative purposes only and are not to be construed as limiting the scope of the invention.

[0134] Working Example The above description of the specific embodiments sufficiently reveals the general nature of the present disclosure, so that those skilled in the art can easily modify and / or adapt such specific embodiments for various applications by applying knowledge within the scope of their skill, without undue experimentation, and without departing from the general concept of the present disclosure. Therefore, such adaptations and modifications are intended to be within the meaning and range of equivalents of the disclosed embodiments, based on the teaching and guidance presented herein. It should be understood that the phraseology or terminology used herein is for the purpose of description, not limitation, and should be interpreted by those skilled in the art in light of the teaching and guidance. EXAMPLES

[0135] Aptamer synthesis Two RNA aptamer sequences were chemically synthesized. The first RNA aptamer nucleotide sequence was a random sequence aptamer (SEQ ID NO:1) which served as a negative control. The second sequence is an S1m aptamer (SEQ ID NO:2) which has previously been reported to bind to streptavidin. Bachler et al., (1999), RNA 5(11):1509-1516; Srisawat, C. and Engelke, DR, (2001), RNA 7(4):632-641; Li, Y. and Altman, S., Nucleic Acids Res. (2002), 30(17):3706-3711. The nucleotide sequences of the random aptamer (SEQ ID NO:1) and the S1m aptamer (SEQ ID NO:2) are shown below.

[0136] [Table 1] EXAMPLES

[0137] Streptavidin Sepharose bead affinity purification and RNA quantification Aptamer binding was analyzed using a Sepharose bead affinity purification strategy followed by quantification of RNA recovery.

[0138] The method for preparing streptavidin beads for binding with RNA aptamers includes the following steps: (1) Preparation of streptavidin sepharose beads. To remove the bead storage solution, 20 μL of streptavidin sepharose beads (per sample) were spun at 600×g for 1 min at 4° C. and washed twice with binding buffer (500 μL per sample). The beads were then resuspended in 20 μL of binding buffer containing RNasin Ribonuclease Inhibitor (3 μL / 100 units) and then incubated on ice for 15 min. (2) Preparation of RNA aptamers. 2.5 μg of RNA aptamers were resuspended in 10 μL of binding buffer. The RNA aptamers were refolded by heating at 56° C. for 5 min and 37° C. for 10 min, followed by incubation at room temperature for 5 min to refold the structure of the aptamer. At the end of the RNA aptamer preparation procedure, 2 μL of random aptamer and S1m aptamer mixed 1:2 with binding buffer were collected as a control for total RNA aptamer yield (input control). (3) Incubation conditions. 10 μL of refolded aptamer containing mRNA (2.5 μg) aptamer was added to the beads and incubated for 2 h at 4 °C on a rotator. The beads were then washed three times with 100 μL of binding buffer and kept on ice for the remaining procedure to maintain the secondary structure of the aptamer. (4) Elution of RNA aptamer from beads. Elution was performed using 250 μL of phenol-based reagent as follows: 50 μL of cold chloroform was added to the beads, shaken vigorously for 10 s, and then spun at 12,000 × g for 15 min (4 °C). The aqueous upper phase of each sample containing RNA (approximately 125 μL per sample) was added directly to a Monarch cleanup column according to the manufacturer's instructions (Monarch RNA Cleanup Kit; NEB). RNA was eluted from each Monarch column in 50 μL of DEPC-treated water. RNA concentrations after streptavidin affinity purification were quantified on a Nanodrop using parameters set by the manufacturer's specifications.

[0139] The aptamers prepared in Example 1 were affinity purified with streptavidin sepharose beads, eluted, and the RNA recovery in the eluate was quantified using the method described above. The random aptamer sequence sample did not result in RNA recovery (detection limit of Nanodrop is 2.5ng / μL). In contrast, the S1m aptamer sample showed about 13% RNA recovery (1,250ng / μL) compared to the S1m aptamer RNA sample (about 9,600ng / μL) recovered before incubation with streptavidin beads (Figure 2). This result indicates that the S1m aptamer designed in Example 1 can be affinity purified with streptavidin and therefore may be suitable as a functional tag in a streptavidin affinity-based purification system. EXAMPLES

[0140] Synthesis and affinity purification of multicopy (4×) aptamer-tagged mRNA To analyze the effect of aptamer copy number on binding affinity, multiple copy aptamers were introduced into mRNA and compared with mRNA without aptamer.

[0141] Arrangement of the S1m aptamer in a tandem 4-repeat configuration (4xS1m; SEQ ID NO:5) has previously been shown to have higher affinity for Sepharose beads. Leppek and Stoecklin, (2014) Nuc. Acids Res. 42(2):e13. To examine the effect of RNA aptamer copy number on binding affinity, 4xS1m aptamers tagged to mRNA were generated by constructing DNA plasmids to generate cDNA templates for in vitro transcription (IVT). Ibid.

[0142] DNA plasmids pAM14 and pAM15 were modified to contain a 53 bp nucleotide sequence encoding an AU-rich element (ARE) RNA from the 3'UTR of mouse TNFα driven by a T7 promoter as previously described (Stoecklin G et al., (2004) EMBO J 23(6):1212-1324; Leppek and Stoecklin, (2014) Nuc. Acids Res. 42(2):e13). pAM14 (2,496 bp) is derived from the same vector backbone as pAM15 (2,168 bp) but contains the 4xS1m aptamer flanked in the 5' to 3' direction by a 30-mer polyA tail.

[0143] To obtain the cDNA template for IVT (SEQ ID NO:5), the nucleotide sequence of TNFα-53-4xS1m was amplified with the AM5 / 6 primer pair from the pAM14 plasmid. A negative control cDNA template was amplified with the same AM5 / 6 primer pair from the plasmid pAM15 to generate a sequence containing the 5'UTR and 3'UTR flanks (SEQ ID NOs:3 and 4, respectively). The locations of the AM5 / 6 primer binding sites are annotated on the plasmid maps of pAM14 and pAM15 as shown in Figure 3.

[0144] Then, IVT reactions for the experimental, TNFα-53-4×S1m mRNA, and control groups were performed using commercially available RNA reagents and procedures (HiScribe T7 ARCA mRNA synthesis Kit with tailing, NEB). After capping and tailing reactions, the filtered mRNA was stored at -20°C until use.

[0145] The nucleotide sequences of the 5'UTR, 3'UTR, and 4xS1m aptamer are shown below.

[0146] [Table 2]

[0147] To analyze the affinity binding of TNFα-53-4×S1m aptamer mRNA, the aptamer mRNA was affinity purified with streptavidin sepharose beads, eluted, and the RNA recovery in the eluate was quantified using the method described above. The binding affinity of streptavidin sepharose beads to TNFα-53 tagged 4×S1m mRNA or TNFα-53 mRNA negative control samples was evaluated and compared. Affinity purified TNFα-53 tagged 4×S1m mRNA showed 54% RNA recovery (1,500 ng / μl) versus 4×S1m mRNA sample (~2,800 ng / μL) recovered prior to incubation with streptavidin beads (Figure 4). In contrast, the affinity purified TNFα-53 negative control showed only 2% RNA recovery. This result indicates that the efficiency of affinity purification of mRNA may be improved by introducing multiple aptamer copies (e.g., 4 × S1m). EXAMPLES

[0148] Synthesis and affinity purification of distinct mRNAs tagged with aptamers embedded in RNA scaffolds To test the efficiency of RNA aptamers embedded in tRNA scaffolds in the downstream mRNA affinity purification process, four vectors were constructed.

[0149] The Sm aptamer was selected for analysis. The nucleotide sequences of the Sm aptamer (SEQ ID NO:6) and the tRNA-Sm aptamer (SEQ ID NO:7) are shown below.

[0150] [Table 3]

[0151] Maps of the plasmids of interest are shown in Figure 5. Briefly, they are: (1) pAM22, a tRNA-binding domain of Methanothermobacter thermautotrophicus; GLN2 (1) pAM20, a control construct carrying the scaffold (pAM22(tRNA(Sm)); the plasmid map is annotated with the position of the anticodon arm relative to the Gln2 anticodon loop), (2) pAM20, a control construct carrying the Sm aptamer (pAM20(Sm)), and (3) pAM21, an anticodon loop tRNA flanked on both sides by tRNA anticodon arm sequences. GLN2 Experimental constructs carrying the Sm aptamer sequence embedded in part of the sequence (pAM21, tRNA Sm, and (4) pAM23, Sm-tRNA GLN2 The experimental construct (2x tRNA Sm) retained the tandem 2 repeat configuration of the construct. Each tag was driven by a T7 promoter.

[0152] To obtain cDNA templates for IVT, the nucleotide sequence of the aptamer tag was amplified by flanking primers as described in Example 3. Then, IVT reactions of the experimental group, tRNA Sm, 2x tRNA Sm mRNA, and control group were carried out using commercially available RNA reagents and procedures (HiScribe T7 ARCA mRNA Kit with tailing, NEB). After the capping and tailing reaction, the filtered mRNA was stored at -20°C until use.

[0153] The affinity binding of Sm, tRNA, tRNA-Sm, and 2xtRNA Sm aptamer tags was analyzed. The same binding and elution methods as in Example 2 were applied.

[0154] As shown in Figure 6, similar RNA recovery rates were obtained using either the tRNA (pAM22) tag or the Sm aptamer (pAM20) tag, indicating nonspecific binding under the experimental conditions tested. In contrast, the use of one copy (pAM21) or two copies (pAM23) of Sm aptamer embedded in the tRNA scaffold resulted in 60% RNA recovery relative to the input RNA, indicating a significant improvement in purification efficiency. This result indicates that the binding efficiency of the aptamer tag can be improved by using an RNA scaffold structure such as tRNA. EXAMPLES

[0155] Synthesis and affinity purification of mRNA encoding hEGFP tagged with a multicopy aptamer (eHGFP-4×S1m) This example studies the effect of including an RNA aptamer tag on mRNA expression and protein translation. Because the aptamer is designed to become part of the mRNA, the aptamer tag may adversely affect translation.

[0156] To test the potential effect of RNA aptamers on translation efficiency, a plasmid was constructed (pAM11) containing the ORF of humanized enhanced green fluorescent protein (hEGFP; SEQ ID NO: 8 shown below) flanked by 5' and 3' UTR sequences, driven by a T7 promoter, and terminated in a 30-mer polyA tail in the 5' to 3' direction. The experimental plasmid pAM8 was generated by introducing the 4xS1m aptamer sequence (SEQ ID NO: 5) downstream of the 3' UTR, just before the polyA tail. Figure 8 shows the plasmid maps of pAM11 and pAM8.

[0157] [Table 4]

[0158] To obtain IVT cDNA templates, nucleotide sequences tagged with hEGFP or hEGFP-4xS1m aptamers were amplified with AM5 / 6 primer pair. The design and orientation of primer pair was similar to the strategy disclosed in Example 3. IVT reaction was carried out using HiScribe™ T7 ARCA mRNA Kit according to the manufacturer's instructions. To avoid an additional polyadenylation step, a 30-mer adenosine tail was generated in the template DNA for IVT.

[0159] As shown in the agarose gel in FIG. 9, the resulting mRNA had the expected size (lane 1 hEGFP and lane 2 hEGFP-4×S1m) and was of good quality.

[0160] To test the effect of the 4xS1m aptamer on affinity binding, mRNA containing hEGFP or hEGFP-4xS1m was affinity purified with streptavidin sepharose beads, respectively. The same binding and elution methods as outlined in Example 2 were applied.

[0161] hEGFP tagged with the 4xS1m aptamer resulted in 63% RNA recovery compared to the input control sample, which was significantly higher than the RNA recovery of hEGFP without the aptamer (Figure 10). EXAMPLES

[0162] Analysis of protein translation and function of mRNA tagged with multicopy aptamer (eHGFP-4×S1m) The effect of the RNA aptamer tag on protein translation and function was assessed by directly visualizing GFP expression in cells. To test this effect, hEGFP mRNA generated from pAM8 and pAM11 was isolated after affinity purification and transfected into HEK293FT cells. 0.5 μg of RNA was transfected into HEK293FT cells in 24-well plates using Mirus TransIT Transfection reagent according to the manufacturer's instructions. After 24 hours, cells were examined by fluorescence microscopy.

[0163] As shown in Figure 11, mRNA containing the 4xS1m aptamer produces a lower intensity signal (right panel) than mRNA without the aptamer (left panel). Therefore, it appears that the introduction of four copies of the streptavidin aptamer tag (4xS1m) may lead to a decrease in the translation efficiency of hEGFP expression. This result indicates that the introduction of certain aptamers into mRNA may have a negative effect on protein translation. EXAMPLES

[0164] Analysis of protein translation and function of multicopy aptamer-tagged mRNAs containing extended poly(A) tails It was hypothesized that the short polyA tail (30mer adenosine) might affect the translation efficiency due to the aptamer sequence. To examine the effect of the polyA tail on the translation efficiency, hEGFP-4×S1m aptamer-tagged mRNA was subjected to an additional polyadenylation reaction with poly(A) polymerase (NEB, M0276S).

[0165] Polyadenylation was confirmed by a shift of the mRNA product on an agarose gel (data not shown). The mRNA was affinity purified as described above, and the mRNA with the longer polyA was transfected into HEK293 cells. As shown in Figure 12, hEGFP-4xS1m aptamer-tagged mRNA with a longer polyA tail showed significantly higher EGFP expression than mRNA with a shorter (30mer) polyA tail. This result suggests that the length of the polyA tail can affect the translation efficiency of mRNAs containing specific aptamer sequences. EXAMPLES

[0166] Analysis of aptamer location in RNA recovery Aptamer sequences are designed to be part of mRNA, and potential aptamer structures or their placement may adversely affect expression. To understand such effects, we designed aptamer-tagged mRNA constructs to test (1) the position of the aptamer relative to other topologically ordered mRNA components, (2) the number of aptamer copies (i.e., aptamer valency), and (3) the surrounding scaffolding (i.e., stabilizing tRNA scaffolds), or combinations of configurations as shown in Figure 7.

[0167] Specifically, in this example, we investigate whether altering the position of the 4xS1m aptamer sequence, relative to other topologically ordered portions of the mRNA, affects RNA recovery following mRNA affinity purification. A panel of designed mRNA constructs is shown in Figure 13A.

[0168] Specifically, the 4xS1m aptamer was localized either (1) immediately upstream of the 5'UTR, (2) immediately upstream of the 3'UTR, (3) in the 3'UTR, (4) immediately downstream of the 3'UTR, or (5) embedded at the 3' end of the polyA sequence.

[0169] cDNA templates were generated and IVT was used to generate mRNA with specific aptamer configurations. The mRNA was affinity purified using streptavidin sepharose beads and quantified as described in Example 2.

[0170] The affinity purified RNA yields (relative to the input sample that was not affinity purified, after the streptavidin binding and elution steps) for mRNA tagged with each aptamer tested (unbound vs. eluted) are shown in Figure 13B, and the mean and standard deviation values ​​for each sample (unbound and eluted) are shown in Table 1 below.

[0171] [Table 5]

[0172] As shown in Figure 13B and Table 1, mRNA containing the 4xS1m aptamer resulted in specific binding compared to control mRNA lacking the aptamer, regardless of the position of the aptamer, indicating that introducing the 4xS1m aptamer into one of multiple positions in the mRNA does not affect affinity purification yields. EXAMPLES

[0173] Analysis of aptamer valency in RNA recovery Aptamer valency (i.e., aptamer copy number) is another variable that can affect RNA recovery, as is aptamer position within the mRNA transcript. To further expand on the analysis performed in Example 3, a panel of aptamer-tagged mRNA constructs was designed to contain one to six tandem repeat copies of the S1m aptamer (denoted 1xS1m to 6xS1m). In this study, the aptamer tag was placed after the 3'UTR.

[0174] cDNA templates were generated and IVT was used to generate mRNA with specific aptamer valencies, which were affinity purified using streptavidin sepharose beads and quantified as described in Example 2.

[0175] The affinity purified RNA yields (unbound vs. eluted) of the mRNA constructs of each aptamer valency tested are shown in FIG. 14, and the mean and standard deviation values ​​for each sample (unbound and eluted) are shown in Table 2 below.

[0176] [Table 6]

[0177] As shown in Figure 14, the purification efficiency increased up to three copies of the aptamer (3 × S1m), after which the addition of subsequent copies (4 × S1m–6 × S1m) did not improve the RNA affinity purification yield. This result indicates that increasing the valency of the aptamer improves the binding affinity. EXAMPLES

[0178] Analysis of aptamer binding in alternative mRNA contexts during RNA recovery To demonstrate that the aptamers that provide efficient binding in affinity purification are functional in alternative RNA contexts, a panel of mRNAs encoding different protein coding regions (Singapore '16 hemagglutinin) and different UTRs than those shown in Example 3 was designed.

[0179] The RNA yield (unbound vs. eluted) following the streptavidin affinity binding purification process for each construct tested is shown in Figure 15. The mean and standard deviation values ​​for each sample (unbound and eluted) are shown in Table 3 below.

[0180] [Table 7]

[0181] As shown in Figure 15, the aptamer provides specific binding to streptavidin sepharose beads despite variations in the flanking sequences, demonstrating that the streptavidin aptamer mRNA design disclosed herein is robust in alternative RNA contexts. EXAMPLES

[0182] Analysis of aptamer location in protein translation To understand whether mRNA translation kinetics is affected by the positioning of the aptamer within the mRNA transcript, mRNAs from the panel of constructs designed in Example 8 were evaluated in an mRNA translation efficiency assay to detect GFP expression.

[0183] Briefly, mRNA encoding humanized EGFP (hEGFP) was generated by in vitro transcription (IVT) and then mixed with transfection reagent. The mixture was then applied to HeLa cells or human skeletal muscle (HSKMc) cells. After 24 h of incubation, GFP fluorescence in the transfected cells was quantified by flow cytometry analysis. The intracellular GFP fluorescence intensity is directly proportional to the translation efficiency of the hEGFP-encoding mRNA transcript.

[0184] The following steps describe the transfection procedure for the mRNA translation efficiency assay: (1) Preparation of cell lines. Hela or HSKMc cell lines were seeded in complete growth medium in 12-well plates and grown to 80-90% confluence. The media conditions for Hela 229 cells were DMEM and 10% FBS, and the media conditions for HSK Mc cells were 199 medium, 20% FBS, and 1% PenStrep. (2a) Preparation of mRNA using Mirus TransIT transfection reagent for HskMc cell line. TransIT-mRNA transfection reagent and mRNA Boost reagent were warmed to room temperature and vortexed gently before use. For mRNA transfection, the manufacturer's protocol was followed and each tube of mRNA to be tested contained 5 μg of mRNA (10 μL of 500 ng / μL mRNA) per 400 μL of Opti-MEM. For negative controls, medium was added instead of mRNA. Then, 8 μL of mRNA Boost Reagent was added and the tube was mixed well by pipetting. Next, 8 μL of Transit mRNA Reagent was added and mixed well, then incubated at room temperature for 2–5 min to allow enough time for complexes to form. (3a) Transfection of HskMc cell line. 106.5 μL of mRNA mix was added dropwise to each well of a 12-well plate (approximately 1.25 μg mRNA / well; triplicate wells were set up for each construct) and gently rocked to evenly distribute the TransIT-mRNA Reagent:mRNA Boost:RNA complex. The plate was then incubated for 24 hours. (2b) Preparation of mRNA using Lipofectamine MessengerMax transfection reagent for Hela cell line. Following the manufacturer's protocol for the mRNA transfection tube, each mRNA to be tested was prepared by adding 4 μg of mRNA (8 μL of 500 ng / μL mRNA) to 312 μL of Opti-MEM and mixed well. For the negative control, medium was added instead of mRNA. In a separate tube, 8 μL of MessengerMax transfection reagent was added to 312 μL of Opti-MEM and mixed well. The volume of the mRNA tube was then added to the transfection mix tube and incubated at room temperature for 15 min to allow enough time for complexes to form. (3b) Transfection of Hela cell line. 160 μL / well of the mRNA mix described in 2b was added dropwise to each well of a 12-well plate (approximately 1 μg mRNA / well; triplicate wells were set up for each construct). The plate was then incubated for 24 h.

[0185] The following steps describe the cell staining and sorting procedures for the flow cytometry analysis used in the mRNA translation efficiency assay: (1) Cell harvesting. The medium was aspirated from the cell monolayer and washed with 1 ml of PBS, followed by dissociation with 250 μL of 1× Accutase per well and incubation at room temperature for 5 min. 250 μL of PBS was added to each well and the cells were harvested in a 1.5 ml microcentrifuge tube. (2) Cell staining. Live / Dead staining was performed on all samples according to the manufacturer's instructions (Live / Dead Fixable Far Red Dead Cell Stain Kit). Fixing the cells was optional but not a required step. Subsequently, excess stain was removed by washing the cells with 1 ml of PBS, and the cells were pelleted at 300 rcf for 5 min at 20°C, the old supernatant was removed, and the samples were resuspended in 400 μL of staining buffer (BD Biosciences). (3) Compensation beads. Compensation control samples were generated by preparing live / dead reactive ArC compensation beads or using GFP BrightComp eBeads according to the manufacturer's instructions. (4) FACS analysis. For HskMc and Hela cell lines, a 130 μm sorting tip was used. Unstained beads and stained compensation beads were run first to adjust the FSC / SSC voltage settings and set the gate window.

[0186] The mRNA translation efficiency of aptamer-tagged mRNAs with different aptamer placement within the mRNA was assessed in either HskMc or Hela cell lines, respectively, as shown in Figures 16A-C and 17A-B. Expression was quantified as the total number of cells with GFP signal above background (%GFP+Cells) and the number of cells above a certain signal intensity threshold (%high GFP+Cells).

[0187] The position of the aptamer tag within the full-length mRNA sequence significantly affected translation efficiency. Placing the aptamer at the 5' end of the mRNA eliminated translation, whereas other positions allowed varying levels of translation. Placing the aptamer after the 3'UTR resulted in the highest translation efficiency, as indicated by increased GFP intensity. This trend was reproducible in both HskMc and Hela cell lines. EXAMPLES

[0188] Analysis of the effect of extended poly(A) tail length on translation efficiency In Example 7, it was demonstrated that increasing the length of the polyA tail increases the translation efficiency of aptamer-tagged mRNA.

[0189] To quantitate the amount of translational enhancement, extended polyA tails were added to S1m aptamer-tagged mRNAs and tested in the mRNA translation efficiency assay described in Example 11. The vectors used for IVT contained an encoded polyA tail, specifically a segmented polyA tail with 60 As, an NsiI restriction site, and an additional 60 As. All mRNAs generated from the above vectors contained segmented polyA tails and were ARCA-capped. The two conditions on the right side of Figure 18 included an additional polyadenylation step of incubating 1 μl of E. coli poly(A) polymerase (NEB, M0276) with buffer and additional ATP for 45 min, which typically results in approximately 200 A added to the end of each RNA shown in Figure 18, yet the total number of GFP-positive Hela cells (expressed as a percentage) was significantly higher for aptamer-tagged mRNAs with extended polyA tails compared to the control. This result confirms that increasing the polyA tail length of aptamer-tagged mRNAs can improve downstream mRNA translation kinetics in cells. EXAMPLES

[0190] Analysis of RNA recovery and translation efficiency of aptamer-tagged mRNA embedded in RNA scaffolds To confirm and extend the findings of Example 5, the S1m aptamer embedded in a tRNA scaffold tag (see Example 5) was compared to mRNA tagged with 2xS1m and 4xS1m aptamers with respect to RNA recovery after streptavidin affinity purification and mRNA translation efficiency.

[0191] As shown in Figure 19A, the addition of stabilizing sequences surrounding the S1m aptamer resulted in RNA purification yields comparable to the binding efficiency of 4xS1m aptamer-tagged mRNA, demonstrating that the RNA scaffold significantly increases affinity purification yields. Stabilization of the S1m aptamer by the tRNA scaffold did not affect the translation efficiency of the mRNA, as shown in Figure 19B. The results are summarized in Table 4 below.

[0192] [Table 8] EXAMPLES

[0193] Synthesis and affinity purification of aptamer-tagged mRNA stabilized in a bioorthogonal RNA scaffold Aptamers scaffolded with tRNA often suffer from reduced RNA stability due to endonuclease cleavage in bacterial and mammalian cells. Filonov et al. (2015) Chem Biol. 22(5):649-660. An alternative to tRNA scaffolds are bioorthogonal scaffolds, which are less likely to be recognized by intracellular nucleases and targeted for degradation, such as the V5, F29, or F30 scaffolds. Ibid.

[0194] To test whether a bioorthogonal scaffold could stabilize the S1m aptamer and improve the efficiency of the downstream mRNA affinity purification process, two vectors were constructed containing either the F30 scaffold that stabilizes the 1×S1m aptamer (F30-1×S1m aptamer) or the F30 scaffold that stabilizes the 2×S1m aptamer (F30-2×S1m aptamer). The sequences of the F30-1×S1m aptamer and F30-2×S1m aptamer are shown below.

[0195] DNA sequence encoding the F30-1×S1m aptamer (F30 segment in bold underlined): [ka]

[0196] F30-1×S1m aptamer (F30 segment is underlined and in bold): [ka]

[0197] DNA sequence encoding the F30-2×S1m aptamer (F30 segment in bold underlined): [ka]

[0198] F30-2×S1m aptamer (F30 segment is underlined and in bold): [ka]

[0199] Other aptamers of interest can be easily inserted into the F30 scaffold. In the 1× aptamer configuration, the left F30 sequence and the "1× right" F30 sequence flank one aptamer. In the 2× aptamer configuration, the left F30 sequence and the center F30 sequence flank the first aptamer, and the center F30 sequence and the "2× right" F30 sequence flank the second aptamer. The sequences of the F30-1× aptamer and F30-2× aptamer are shown below.

[0200] DNA sequence encoding the F30-1× aptamer: TTGCCATGTGTATGTGGG (left F30 sequence, SEQ ID NO: 32) - aptamer sequence - CCCACATACTCTGATGATCCTTCGGGATCATTCATGGCAA ("1x right" F30 sequence, SEQ ID NO: 33)

[0201] F30-1×Aptamer: UUGCCAUGUGUAUGUGGG (left F30 sequence, SEQ ID NO: 34) - aptamer sequence - CCCACAUACUCUGAUGAUCCUUCGGGAUCAUUCAUGGCAA ("1x right" F30 sequence, SEQ ID NO: 35)

[0202] DNA sequence encoding the F30-2× aptamer: TTGCCATGTGTATGTGGG (left F30 sequence, SEQ ID NO: 36)-aptamer sequence-CCCACATACTCTGATGATCC (center F30 sequence, SEQ ID NO: 37)-aptamer sequence-GGATCATTCATGGCAA ("2x right" F30 sequence, SEQ ID NO: 38)

[0203] F30-2×S1m aptamer (F30 segment is underlined and in bold): UUGCCAUGUGUAUGUGGG (left F30 sequence, SEQ ID NO: 39)-aptamer sequence-CCCACAUACUCUGAUGAUCC (center F30 sequence, SEQ ID NO: 40)-aptamer sequence-GGAUCAUUCAUGGCAA ("2x right" F30 sequence, SEQ ID NO: 41)

[0204] To analyze the affinity binding of F30-1xS1m and F30-2xS1m aptamer mRNA, the aptamer mRNA was affinity purified with streptavidin sepharose beads, eluted, and the amount of RNA recovered in the eluate was quantified using the method described above. The binding affinity of streptavidin sepharose beads to either untagged mRNA (no aptamer control), 4xS1m aptamer, F30-1xS1m aptamer, or F30-2xS1m aptamer-tagged mRNA was assessed and compared.

[0205] As also shown in Table 5 below, affinity purified F30-1xS1m and F30-2xS1m mRNA resulted in approximately 30-40% RNA recovery relative to the input sample collected prior to incubation with streptavidin beads (Figure 20B).

[0206] [Table 9]

[0207] Total RNA recovery from eluted F30-2xS1m and F30-1xS1m tagged mRNA was approximately 900ng / μL and 800ng / μL, respectively (Figure 20C). In contrast, the affinity purified elution negative control yielded RNA recovery of only 200ng / μL.

[0208] This result indicates that the introduction of a bioorthogonal scaffold (i.e., F30) to stabilize aptamers (e.g., S1m aptamer) could be used to improve the affinity purification efficiency of mRNA.

[0209] Other embodiments of the present disclosure will be apparent to those skilled in the art from consideration of the specification and practice of the disclosure disclosed herein. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the present disclosure being indicated by the following claims.

[0210] All patents and publications cited herein are hereby incorporated by reference in their entirety.

[0211] array

[0212] [Table 10-1] [Table 10-2] [Table 10-3] [Table 10-4] [Table 10-5] [Table 10-6] [Table 10-7] [Table 10-8] [Table 10-9] [Table 10-10] [Table 10-11] [Table 10-12]

Table 10-13

Table 10-14

Table 10-15

Table 10-16

Table 10-17

Table 10-18

Table 10-19

Table 10-20

Table 10-21

Table 10-22

Table 10-23

Table 10-24

Table 10-25

Table 10-26

Claims

1. A messenger RNA (mRNA) comprising at least one 5' untranslated region (5'UTR), at least one open reading frame (ORF), at least one 3' untranslated region (3'UTR), and at least one polyadenylation (polyA) sequence, wherein the mRNA comprises at least one RNA aptamer.

2. The mRNA of claim 1 , wherein the RNA aptamer binds to an affinity ligand.

3. The mRNA of claim 1 , wherein the RNA aptamer is embedded in an RNA scaffold.

4. The mRNA of claim 3 , wherein the RNA scaffold is transfer RNA (tRNA), ribosomal RNA (rRNA), or a ribozyme.

5. The mRNA of claim 1 , wherein the RNA aptamer is embedded in a bioorthogonal scaffold.

6. The mRNA of claim 1, wherein the ribozyme is catalytically inactive.

7. The RNA aptamer is embedded in the tRNA hairpin loop of the tRNA; The RNA aptamer is embedded in the tRNA anticodon loop of the tRNA; the RNA aptamer is embedded in the tRNA D-loop of the tRNA; or The mRNA of claim 1 , wherein the RNA aptamer is embedded in the tRNA T loop of the tRNA.

8. The RNA aptamer is located in the 5′UTR; The RNA aptamer is placed between the 3′ end of the ORF and the 5′ end of the 3′UTR; the RNA aptamer is located in the 3'UTR; or The RNA aptamer is placed between the 3' end of the 3'UTR and the 5' end of the polyA sequence. The mRNA of claim 1 .

9. The mRNA of claim 1 , wherein the RNA aptamer is located at the 3′ end of the polyA sequence.

10. the mRNA comprises or consists of one RNA aptamer; The mRNA contains 1 to 4 RNA aptamers; The RNA aptamers are identical or the RNA aptamers are distinct; RNA aptamers can be synthetically derived or naturally occurring; the RNA aptamer is a split aptamer or an X aptamer; or The mRNA of claim 1 , wherein the RNA aptamer is derived from a hairpin RNA, a tRNA, or a riboswitch.

11. The bioorthogonal scaffold is V5, F29, F30, or a variant thereof, and optionally the bioorthogonal scaffold comprises the 5' nucleotide sequence of SEQ ID NO:34 and the 3' nucleotide sequence of SEQ ID NO:35, with the aptamer sequence located between SEQ ID NO:34 and SEQ ID NO:35; or the bioorthogonal scaffold comprises the 5' nucleotide sequence of SEQ ID NO:39, an internal nucleotide sequence of SEQ ID NO:40, and a 3' nucleotide sequence of SEQ ID NO:41, wherein a first aptamer sequence is disposed between SEQ ID NO:39 and SEQ ID NO:40 and a second aptamer sequence is disposed between SEQ ID NO:40 and SEQ ID NO:41, and optionally the first and second aptamers are the same or different; or The mRNA of claim 1, wherein the bioorthogonal scaffold having the RNA aptamer embedded therein comprises the nucleotide sequence of SEQ ID NO: 29 or SEQ ID NO:

31.

12. Affinity ligands include protein A, protein G, streptavidin, glutathione, dextran, or fluorescent molecules; the affinity ligand comprises streptavidin; and / or The mRNA of claim 1 , wherein the affinity ligand is immobilized on a chromatography resin.

13. the RNA aptamer is S1m or Sm, and optionally the RNA aptamer comprises one to four S1m or sm RNA aptamers; The S1m or sm RNA aptamer is 1) between the 3' end of the ORF and the 5' end of the 3' UTR; 2) Within 3'UTR; 3) between the 3' end of the 3'UTR and the 5' end of the polyA sequence; and / or 4) 3' end of poly A sequence and / or The mRNA of claim 1, wherein the RNA aptamer-embedded RNA comprises the nucleotide sequence of SEQ ID NO:

7.

14. The mRNA encodes at least one polypeptide and optionally the polypeptide is a biologically active polypeptide, a therapeutic polypeptide, or an antigenic polypeptide; The polypeptide comprises an antibody or fragment thereof, an enzyme-recruiting polypeptide, or a genome-editing polypeptide; The therapeutic polypeptide comprises an antibody heavy chain, an antibody light chain, an enzyme, or a cytokine; and / or The biologically active polypeptide comprises a genome editing polypeptide. RNA.

15. the mRNA comprises at least one chemical modification, optionally the chemical modification is pseudouridine, N1-methylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methyluridine, 5-methoxyuridine, or 2-O-methyluridine; the mRNA comprises two polyA sequences, each comprising 10 to 500 consecutive adenosine residues, and at least one RNA aptamer or RNA aptamer-embedded tRNA is located between the two polyA sequences; and / or The mRNA of claim 1, wherein the translation efficiency of the mRNA is substantially the same as that of an mRNA that does not contain an RNA aptamer.

16. A vector encoding the mRNA of any one of claims 1 to 15, optionally comprising in the 5' to 3' direction at least the following elements a to e: a. RNA polymerase promoter; b. a polynucleotide sequence encoding the 5'UTR; c. a polynucleotide sequence encoding an ORF; d. a polynucleotide sequence encoding the 3'UTR; and e. a polynucleotide sequence encoding at least one RNA aptamer; and optionally f. Polynucleotide sequences encoding polyA sequences and / or polyadenylation signals A vector comprising:

17. A host cell comprising the vector of claim 16.

18. A pharmaceutical composition comprising the mRNA according to any one of claims 1 to 11.

19. A method for purifying mRNA, comprising the steps of: (a) contacting a sample containing the mRNA of any one of claims 1 to 15 with an affinity ligand immobilized on a chromatography resin, wherein the RNA aptamer has binding affinity for the affinity ligand; (b) eluting the mRNA from the chromatography resin; and (c) purifying mRNA from the sample Including, in some cases The method includes one or more washing steps between the contacting step (a) and the eluting step (b); the RNA is at least about 500 nucleotides in length, at least about 750 nucleotides in length, at least about 1,000 nucleotides in length, at least about 1,500 nucleotides in length, at least about 2,000 nucleotides in length, at least about 2,500 nucleotides in length, at least about 3,000 nucleotides in length, at least about 3,500 nucleotides in length, at least about 4,000 nucleotides in length, at least about 4,500 nucleotides in length, or at least about 5,000 nucleotides in length; and / or The method wherein the mRNA is greater than 90% pure.

20. A pharmaceutical composition comprising a plurality of mRNA molecules, wherein at least about 90% of the mRNAs comprise at least one 5' untranslated region (5' UTR), at least one open reading frame (ORF), at least one 3' untranslated region (3' UTR), at least one polyadenylation (polyA) sequence, and at least one RNA aptamer.

21. A messenger RNA (mRNA) comprising at least one 5' untranslated region (5'UTR), at least one open reading frame (ORF), at least one 3' untranslated region (3'UTR), and at least one polyadenylation (polyA) sequence, wherein the mRNA comprises a bioorthogonal scaffold in which at least one RNA aptamer is embedded.

Images