miRNA DETECTION METHOD

Abstract

To provide an in situ hybridization method for miRNA.SOLUTION: The present invention provides a method for detecting miRNA by an in situ hybridization process using a probe labeled with a fluorescent dye that emits fluorescence when irradiated with excitation light of 640 nm or more.SELECTED DRAWING: Figure 2

Description

[Technical field]

[0001] The present invention relates to a FISH method, and more particularly to a method for fluorescent detection of miRNA. [Background technology]

[0002] The genomic DNA FISH (Fluorescent in situ hybridization) method targets nuclear DNA, so even in formalin-fixed tissue specimens, the cytoplasm (proteins) around the nucleus can be dissolved to expose the nuclear DNA. This prevents formalin from cross-linking to proteins and emitting strong autofluorescence, and also makes it easier for the FISH probe to penetrate into the nucleus, allowing a fluorescent signal to be obtained.

[0003] However, because microRNA (miRNA) exists in the cytoplasm, when cytoplasm fixed with formalin is dissolved, the miRNA is also lost at the same time, so there was a problem that the signal could not be detected by the FISH method. There is also a method in which the miRNA probe is labeled with DIG, hybridized, and then detected with a DIG antibody, but this method is complicated and time-consuming.

[0004] Therefore, there was a need for a method to detect miRNA more quickly and easily, as well as a method to detect miRNA by FISH without interference from background fluorescence. [Prior art documents] [Patent documents]

[0005] [Patent Document 1] JP 2007-245150 A Summary of the Invention [Problem to be solved by the invention]

[0006] A method for in situ hybridization of miRNA is provided. [Means for solving the problem]

[0007] (1) A method of detecting miRNA by in situ hybridization using a probe labeled with a fluorescent dye that emits fluorescence when exposed to excitation light of 640 nm or more. (2) The method for detecting miRNA according to (1), wherein the fluorescent dye is any one selected from the group consisting of Cy5, Cy5.5, Cy7, Cy7.5, indocyanine green, iFLUOR790, Alexa Fluor790, and IRDye800. (3) The miRNA in situ hybridization method according to (1), which uses a fluorescent substance whose target fluorescence intensity / background fluorescence intensity ratio is 1.5 or more. (4) The formalin-fixed tissue specimens are A step of deparaffinizing; Dehydration process and A process of air drying; A process of treating with Paraffin Pretreatment Solution at 95 to 100°C for 30 minutes. Wash twice with 2XSSC for 5 minutes; A dehydration step; Dropping a microRNA FISH Probe onto a tissue specimen; A hybridization step; A cleaning step; A step of dropping DAPI; Observing under a fluorescent microscope; having (1) miRNA in situ hybridization method. Effect of the Invention

[0008] According to the present invention, there is an advantage that miRNA can be detected without background fluorescence becoming a problem. [Brief description of the drawings]

[0009] [Figure 1]FIG. 1 shows background fluorescence. [Diagram 2] FIG. 2 shows the detection of miRNA by the method of the present invention. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0010] The present invention relates to a method and a kit for detecting miRNA by in situ hybridization. Although an in situ hybridization method for detecting nuclear DNA in formalin-fixed tissue sections has been established, the same method cannot be applied to the detection of miRNA. Because DNA is in the nucleus, even if the cytoplasm is washed away, the nucleus remains, making in situ hybridization of DNA possible. In contrast, miRNA is present in the cytoplasm, so it is not possible to detect miRNA by washing away the cytoplasm. In addition, since the cytoplasm has autofluorescence, it is difficult to excite a fluorescently stained probe and observe the fluorescence. This is because the emission of the fluorescent probe is masked by the autofluorescence.

[0011] Figure 1 shows the autofluorescence observed when excitation light of various wavelengths was irradiated. At 420 nm, the autofluorescence was so strong that the cell nuclei and other components were barely visible. Even when excitation light of 500, 550, or 600 nm was irradiated, the cell nuclei were visible to some extent, but the autofluorescence of the cytoplasm was so strong that it was not suitable for observing the cytoplasm. However, when excitation light of a wavelength longer than 640 nm was irradiated, there was almost no autofluorescence and the cell nuclei were clearly visible. Therefore, it is believed that if a fluorescent dye that emits fluorescence at wavelengths of 640 nm or longer is used, miRNA present in the cytoplasm can be detected by in situ hybridization.

[0012] In fact, in Figure 2, after in situ hybridization using a Cy7-labeled miR122 probe, excitation with 750 nm infrared light was performed, and the fluorescence was observed. A strong signal was observed in the cytoplasm. With DAPI, the nucleus was detected, and when the Cy7-labeled miR122 probe and DAPI were added simultaneously, a slight cytoplasmic background was observed, but this was not a problem because the fluorescence emitted when excited at 750 nm was much stronger.

[0013] These results demonstrated that miRNAs can be detected by in situ hybridization using infrared light with wavelengths longer than 640 nm.

[0014] In this example, Cy7 was used as the fluorescent dye, but theoretically any dye that emits fluorescence at an excitation light wavelength where autofluorescence is not a problem can be used.

[0015] The excitation light for detecting the fluorescent probe hybridized to miRNA is preferably 640 nm or more, more preferably 650 nm or more, even more preferably 660 nm or more, even more preferably 670 nm or more, or 680 nm or more, 690 nm or more, 700 nm or more, 710 nm or more, 720 nm or more, 730 nm or more, 740 nm or more, or 750 nm or more. In short, any excitation light having a wavelength that is low in autofluorescence and can be used to observe fluorescence that can be sufficiently distinguished from autofluorescence by the excitation light can be used. In addition, the upper limit of the wavelength of the excitation light may be, for example, 3000 nm or less, 2500 nm or less, 2000 nm or less, 1500 nm or less, 1000 nm or less, 900 nm or less, 800 nm or less, or 750 nm or less. In short, any excitation light within the range of wavelengths that is not hindered by background fluorescence and emits fluorescence of sufficient intensity for measurement can be used in the present invention.

[0016] Examples of such fluorescent dyes excited by wavelengths longer than 640 nm include, but are not limited to, Cy5, Cy5.5, Cy7, Cy7.5, indocyanine green (ICG), iFLUOR790, Alexa Fluor790, and IRDye800. In short, any fluorescent dye that does not interfere with the measurement due to its own fluorescence and can measure fluorescence with a detectable sensitivity can be used. Not only currently reported fluorescent dyes, but also fluorescent dyes to be developed in the future can be used as long as they are suitable for the purpose of the present invention.

[0017] In the present invention, the S / N ratio of measured fluorescence intensity / autofluorescence intensity is preferably 1.3 or more, and more preferably 1.4 or more, 1.5 or more, 1.6 or more, 1.7 or more, 1.8 or more, 1.9 or more, 2.0 or more, 3.0 or more, 5.0 or more, 7.0 or more, or 10.0 or more, and the higher the S / N ratio, the more preferable.

[0018] As an embodiment of the present invention, a method for increasing the efficiency of in situ hybridization, a promoter, and a kit containing the promoter may be used. In the present invention, the time required for hybridization can be shortened by adding one or more selected from the group consisting of betaine, carnitine, and trimethylglycine to a hybridization solution used for in situ hybridization.

[0019] In this case, the amount of betaine, carnitine, or trimethylglycine added to the hybridization solution is not particularly limited as long as it promotes hybridization, but the preferred lower limit concentration is 10 μM or more, 100 μM or more, 1 mM or more, 10 mM or more, 50 mM or more, or 100 mM or more, and the preferred upper limit concentration is 1000 mM or less, 500 mM or less, or 300 mM or less.

[0020] The hybridization rate can be further improved by further adding polyethylene glycol to the hybridization solution. The polyethylene glycol is not particularly limited as long as it promotes hybridization, but for example, polyethylene glycol 200, polyethylene glycol 4000, polyethylene glycol 6000, polyethylene glycol 8000, etc. are preferably used. In this case, the lower limit of the preferred concentration of the polyethylene glycol to be added is 0.01% or more, 0.1% or more, or 1% or more, expressed by weight %, and the upper limit of the preferred concentration is 10% or less, 5% or less, or 2% or less. When polyethylene glycol is added to the hybridization solution together with betaine, it is preferable to add both at the same concentration (weight %).

[0021] The hybridization solution used in the present invention can be any hybridization solution that can be used for in situ hybridization without any particular limitations. For example, in standard hybridization, a 50% formamide solution is often used, but in the present invention, one or more selected from the group consisting of betaine, carnitine, and trimethylglycine may be added to the standard hybridization solution, and polyethylene glycol may also be added.

[0022] In the present invention, when formamide is added, it is preferable to use a concentration of 10% to 50%. The optimal concentration of formamide for improving the hybridization rate can be determined by in situ hybridization experiments depending on other factors, i.e., the concentrations of added betaine, carnitine, and / or trimethylglycine, polyethylene glycol, etc.

[0023] When betaine, carnitine, and / or trimethylglycine is added, and when polyethylene glycol is further added, the preferred concentration of formamide is not particularly limited as long as in situ hybridization is performed appropriately, but the preferred upper limit of the concentration is 50% or less, 40% or less, 35% or less, or 30% or less, and the lower limit is 10% or more, or 15% or more. EXAMPLES

[0024] Example 1 MicroRNA FISH Procedure Formalin-fixed tissue specimens were used 1. Deparaffinization Hemo-De (Pharma Co., Ltd.) x3 2. Dehydration 100% ethanol x2 3. Air dry 4. Paraffin Pretreatment Solution (GSP Laboratory Co., Ltd. K008) 95~100℃ 30 minutes 5. Cleaning 2xSSC 5 minutesx2 6. Dehydration 70% ethanol 1 min 100% ethanol 1 min 6. Air dry 7. Add 10 μL of microRNA FISH Probe to the tissue specimen and place a cover glass on it. The microRNA FISH probe used here was anti-miR122 (CAAACACCATTGTCACACTCCA) labeled with Cy7 at both ends and adjusted to 40 nM in the hybridization solution of Patent Application No. 2016-216799 (betaine 300 mM, carnitine 300 mM, polyethylene glycol 4000 0.1%, dextran sulfate 20%, formamide 30%, sodium chloride 600 mM, trisodium citrate dihydrate 60 mM, 0.1% Tween-20, 0.1% SDS). 8. Leave at 60℃ for 60 minutes or at 45℃ for 18 hours. 9. Cleaning 2xSSC 5 minutes, 0.2xSSC / 0.3% NP40 60℃ 3 minutes, 2xSSC 5 minutes 10. Add 10 μL of DAPI Counterstain (GSP Research Institute, K004) and place a cover glass on the plate. 12. Observation with a fluorescent microscope [Industrial Applicability]

[0025] The present invention can be used in the medical industry, the testing industry, and the like. [Explanation of symbols]

[0026] 1. DAPI fluorescence (nuclei) 2. miRNA-derived fluorescence

Claims

1. A method for detecting miRNA by in situ hybridization using a probe labeled with a fluorescent dye that emits fluorescence when irradiated with excitation light of 640 nm or more.

2. The method for detecting miRNA according to claim 1, wherein the fluorescent dye is any one selected from the group consisting of Cy5, Cy5.5, Cy7, Cy7.5, indocyanine green, iFLUOR790, Alexa Fluor790, and IRDye800.

3. The method for in situ hybridization of miRNA according to claim 1, wherein a fluorescent substance having a target fluorescence intensity / background fluorescence intensity ratio of 1.5 or more is used.

4. Formalin-fixed tissue specimens were A step of deparaffinizing; Dehydration process and A process of air drying; A process of treating with Paraffin Pretreatment Solution at 95-100℃ for 30 minutes, Wash twice with 2XSSC for 5 minutes; A dehydration step; Dropping a microRNA FISH Probe onto a tissue specimen; A hybridization step; A cleaning step; A step of dropping DAPI; Observing under a fluorescent microscope; having The method for in situ hybridization of miRNA according to claim 1.

Images