Method for producing pluripotent stem cells

Abstract

To provide a novel method that enables culture in a suspension state in establishment and proliferation of stem cells.SOLUTION: A method for producing pluripotent stem cells, comprising a step of culturing pluripotent stem cells under feeder-free and suspension culture conditions in a medium containing a scaffold material including atelocollagen and separated from a culture vessel.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to a method for producing stem cells such as pluripotent stem cells, etc. More specifically, the present invention relates to a method for producing stem cells, etc., which comprises a step of suspension culturing cells in a medium containing a scaffold material containing atelocollagen. [Background technology]

[0002] Techniques for culturing pluripotent stem cells, such as induced pluripotent stem cells (iPS cells) and embryonic stem cells (ES cells), by adhering the cells to the bottom of a cell culture dish or the like (plate culture) have been developed (see Non-Patent Documents 1 and 2). On the other hand, pluripotent stem cells, such as ES cells, are derived from the inner cell mass of blastocysts. To cultivate ES cells in a manner similar to their natural growth state, it is necessary to culture them in a suspension or semi-suspension culture, similar to the culture used in the production process for forming three-dimensional (3D) organs (organoids).

[0003] One known method for suspension culture of ES cells and iPS cells is the formation of embryoid bodies (EBs), three-dimensional cell aggregates formed by suspension culture of pluripotent stem cells. The culture that forms embryoid bodies requires manipulation to maintain a uniform size of the embryoid bodies; specifically, this requires physical manipulation, such as crushing the cell aggregates with the shear stress of a propeller in agitation culture. Therefore, controlling the size of embryoid bodies is difficult for cell types such as ES cells and iPS cells, which are prone to cell death due to physical stress (see Non-Patent Document 3).

[0004] In cell culture, microcarriers are sometimes used as scaffolding materials for cells. Microcarriers are tiny particles that allow adherent animal cells to adhere to the microcarriers and then culture them in this state, enabling mass culture in suspension without significantly changing the properties of the adherent animal cells (see Non-Patent Document 4). However, no scaffolding materials, such as microcarriers, suitable for adhering pluripotent stem cells to their surfaces have been discovered.

[0005] It has been reported that the surface of microcarriers used in cell culture must be coated with an adhesive matrix made from biological components, such as Matrigel (Corning) (a solubilized basement membrane preparation extracted from mouse sarcoma). It is also known that in cell culture, small microcarriers with a diameter of 100 μm or less are not suitable for cell growth, and that cells do not adhere if negatively charged residues, such as carboxymethyl groups, are dominant on the microcarrier surface (see Non-Patent Document 5). For example, type I collagen, its hydrolyzed component, gelatin, has a history of being used as a scaffolding material for cell culture dishes for pluripotent stem cells, primarily in the plate culture method known as feeder culture (see Non-Patent Documents 1 and 2). Collagen fibers contain a cell adhesion sequence known as the RGD sequence, and this sequence has been reported to have excellent cell affinity (see Non-Patent Document 6). Gelatin is a collagen molecule or fragment thereof that has lost its triple-stranded helical structure, and the use of gelatin nanofibers for pluripotent stem cell culture has been reported (see Patent Document 1). However, while type I collagen functions as a scaffold for human iPS cells in feeder culture using mouse embryonic fibroblasts (MEFs), it has long been known that in feederless culture, it has poor adhesion and proliferation support for human iPS cells. Therefore, when using commercially available type I collagen, Cytodex-3 (GE Healthcare) (dextran beads with denatured pig skin collagen bound to or coated on the surface), the cell adhesion and proliferation support functions are weak in the feederless culture required for clinical iPS cell production, making it unsuitable for practical use. Furthermore, Patent Document 1 describes that human iPS cells cannot be cultured on 0.1% gelatin, but human iPS cells have been successfully grown by processing gelatin into nanofibers.

[0006] Furthermore, Patent Document 2 discloses a method for attaching pluripotent stem cells to microcarriers coated with an extracellular matrix (e.g., a mixture of laminin, collagen, heparan sulfate proteoglycan, and entactin 1) and then cultured in suspension for three or more passages. Patent Document 3 discloses a method using polymeric compounds (polysaccharides such as hyaluronic acid, deacylated gellan gum, diutan gum, xanthan gum, and carrageenan) as a medium composition for cell or tissue suspension culture. Patent Document 4 discloses a xeno-free, serum-free medium containing bFGF, ascorbic acid, TGFβ-3, and the like, and a method for suspension culture of pluripotent stem cells in the medium. Patent Document 5 discloses a stem cell scaffold material containing a synthetic resin with a specific composition and a culture method using the same. Furthermore, Patent Document 6 discloses an apparatus for culturing pluripotent stem cells, embryoid bodies, and the like by refluxing a solution between a cell culture vessel and a composition-adjusted solution reservoir. However, none of the patent documents discloses a specific method for using atelocollagen as a coating material for microcarriers, nor does it disclose any specific examples of culturing pluripotent stem cells using atelocollagen. [Prior art documents] [Patent documents]

[0007] [Patent Document 1] Patent Publication No. 2013-247943 [Patent Document 2] Special Publication 2011-514169 [Patent Document 3] WO2014 / 017513 [Patent Document 4] Special Publication 2013-510567 [Patent Document 5] WO2019 / 131981 [Patent Document 6] WO2013 / 161885 [Non-patent literature]

[0008] [Non-Patent Document 1] Nature, 1981. 292. 154-156 [Non-patent document 2] Science, 1998. 282. 1145-1147 [Non-patent document 3] Nature Biotechnology, 2007. 25. 681-686 [Non-patent document 4] Nature, 1967. 216. 64-65 [Non-patent document 5] Stem Cell RES, 2011. 7. 97-111 [Non-patent document 6] Biomaterials, 2003, 24. 4385-4415 Summary of the Invention [Problem to be solved by the invention]

[0009] The present invention aims to provide a novel method for establishing and expanding stem cells that enables suspension culture, and also aims to accelerate the industrial use of stem cells, such as pluripotent stem cells, by enabling cell homogenization and automation of culture. [Means for solving the problem]

[0010] Collagen, known as gelatin, has long been used as a scaffold for pluripotent stem cell culture. However, its primary purpose was to serve as a scaffold for feeder-based culture using mouse embryonic fibroblasts (MEFs). In recent years, MEF-based culture methods have become considered classical, and feederless culture methods have become mainstream. Feederless culture methods do not require MEFs or gelatin. Therefore, while type I collagen, a component of gelatin, has historically been used in pluripotent stem cell culture, the recent establishment of feederless culture methods has meant that there has been no motivation to use collagen, or even to replace collagen with atelocollagen, for pluripotent stem cell culture. Despite this background, the present inventors focused on pluripotent stem cell culture using collagen. After extensive research to address the above-mentioned challenges, they came up with the idea that using microcarriers coated with atelocollagen instead of collagen for cell culture could enable efficient establishment and proliferation of pluripotent stem cells. As a result of further research based on this idea, the inventors discovered that pluripotent stem cells could not be established from somatic cells when microcarriers coated with type I collagen were used, whereas pluripotent stem cells could be established from somatic cells when microcarriers coated with atelocollagen were used. Because type I collagen and atelocollagen share a large portion of their structure, the difference in establishment efficiency was surprising. Furthermore, they discovered that culturing pluripotent stem cells using microcarriers coated with atelocollagen enabled efficient proliferation of pluripotent stem cells. Based on these findings, the inventors conducted further research, leading to the completion of the present invention.

[0011] That is, the present invention is as follows. [1] A method for producing pluripotent stem cells, comprising a step of suspension culturing cells in a medium containing a free scaffold material containing atelocollagen. [2] The method according to [1], wherein the cells are somatic cells into which reprogramming factors have been introduced. [3] The method according to [2], wherein the somatic cells are floating cells. [3-1] The method according to [3], wherein the non-adherent cells are blood cells. [4] The method according to [1], wherein the cells are pluripotent stem cells. [4-1] The method according to [4], wherein the pluripotent stem cells are induced pluripotent stem cells or embryonic stem cells. [4-2] The method according to any one of [1] to [4-1], wherein the cells are cells of human origin. [5] The method according to any one of [1] to [4-2], wherein the scaffold material is a microcarrier. [6] The method according to any one of [1] to [5], wherein the mass percent concentration of atelocollagen in the scaffold material is 10% or more. [7-1] The method according to any one of [1] to [6], wherein the scaffold material consists essentially of atelocollagen. [7-2] The method according to any one of [1] to [6], wherein the mass percent concentration of atelocollagen in the scaffold material is 95% or more. [8] The method according to any one of [1] to [7-2], wherein the step of culturing the cells in suspension is carried out using a culture device. [9] Pluripotent stem cells produced by the method according to any one of [1] to [8].

[10] A pluripotent stem cell proliferation promoter comprising a scaffold material that contains atelocollagen and is free in a culture medium. [10-1] An agent for inhibiting cell death of pluripotent stem cells, comprising a scaffold material that contains atelocollagen and is released in a culture medium. [10-2] An agent for maintaining the survival of pluripotent stem cells, comprising a scaffold material that contains atelocollagen and is free in a culture medium.

[11] [1] to [8]. Culturing the prepared cells in a differentiation-inducing medium; and a step of culturing the cultured cells in suspension in a medium containing a free scaffold material containing atelocollagen. A method for producing differentiated cells, comprising:

[12]

[11] Differentiated cells produced by the method described in

[11] .

[13] A pharmaceutical composition comprising the pluripotent stem cell according to [9] or the differentiated cell according to

[12] . [Effects of the Invention]

[0012] The production method of the present invention enables efficient production and proliferation of stem cells. Pluripotent stem cells produced by the production method of the present invention can maintain their pluripotency even after suspension culture on a scaffold containing atelocollagen for at least eight passages. Furthermore, this method includes a step of culturing cells in suspension. Suspension culture not only facilitates automation and mass culture, but also enables the construction of a comprehensive system in which stem cells obtained by the production method of the present invention can be expanded and differentiated into specific cell types while still attached to the scaffold. Furthermore, the scaffold used in the production method of the present invention can be prepared simply by coating a microcarrier or the like with atelocollagen or by molding atelocollagen itself as a scaffold, making it cost-effective. Furthermore, differentiated cells obtained by the method of the present invention can be transplanted into a living body together with the scaffold without removing them from the scaffold. [Brief explanation of the drawings]

[0013] [Figure 1] 1 shows the results of a human iPS cell proliferation test using bead culture in Example 1 (5-6 days after cell seeding). [Figure 2]The structure of a collagen fiber is shown (Source: Journal of Dental Science, Medical University of Hokkaido, 2008. 27. 7-14). Collagen, a major component of living organisms, is a structural protein characterized by its high-order structure with three helices. The basic unit of a collagen fiber is a microfibril, with molecules (arrows) aligned with an offset of 670 Å = D from adjacent molecules, and there is a 0.6D gap (hole zone) between molecules in the same row. Intermolecular cross-links are formed between molecules at the molecular ends (telopeptides). A microfibril is a cylinder (cross section) with five molecules located at each vertex of a regular pentagon. Many microfibrils gather to form fibrils, many fibrils gather to form fibers, and many fibers intertwine to form fiber bundles. [Figure 3] Cell proliferation of hiPSCs in 3D culture using atelocollagen beads. 15M66 cells were counted on days 1, 2, 3, 4, 5, and 6 after seeding at 1 × 105 cells / well on iMatrix 511-coated plates, iMatrix-511-coated Cytodex 1, and iMatrix-511-coated Cytodex 3. Data represent the mean ± SD. **P < 0.01 (A). 15M66 cells were counted on day 6 after seeding at 5 × 104 cells / well on iMatrix 511-coated plates and atelocollagen beads (n = 3). Data represent the mean ± SD (B, left panel). 15M66 cells were seeded on Synthemax II or atelocollagen beads at 1 × 105 cells / bioreactor and cultured for 4 days. Light micrographs are shown after agitation at 60 rpm (C, left panel). The scale bar indicates the indicated length. (D) Side view of the bioreactor during stirred culture. (E) mRNA expression analysis results. Data represent mean ± SD. **P < 0.01 (E), cell count data (F). n = 3. [Figure 4]Proliferation study of hiPSCs using atelocollagen beads of different diameters. (A) Optical micrographs of strain 15M66 cells attached to atelocollagen beads with diameters of ≤105 μm, 105-250 μm, 250-425 μm, and 425-600 μm. (B, left panel) and cell counts (B, right panel) of 15M66 cells 5 days after seeding 5 × 104 cells onto atelocollagen beads with diameters ≤105 μm, 105-250 μm, 250-425 μm, and 425-600 μm. n=6. (C, left panel) and cell counts (C, right panel) of 201B7 cells 5 days after seeding 5 × 104 cells onto atelocollagen beads with diameters ≤105 μm, 105-250 μm, 250-425 μm, and 425-600 μm. Data represent the mean ± SD. *P < 0.05. **P < 0.01. [Figure 5] Characteristics of hiPSCs cultured on atelocollagen-coated plates. Light microscope images of 15M66 cells cultured on iMatrix-511, atelocollagen, or gelatin at 5 × 104 cells / well on day 4. Scale bars indicate the indicated lengths (A). Cell count data. Data represent mean ± SD. **P < 0.01 (B). mRNA expression analysis of 15M66 cells on iMatrix-511 or atelocollagen at 5 × 104 cells / well on day 4. Correlation with stem cell markers (C), expression of undifferentiated cell markers (D), and correlation with pluripotency maintenance markers (E). [Figure 6]Characteristics of hiPSCs cultured on atelocollagen-coated plates. Images were observed by light microscopy 4 days after seeding 201B7 cells at 5 × 104 cells / well on plates coated with iMatrix-511, atelocollagen, or gelatin. Scale bars indicate the indicated lengths (A), and cell count data (B). Data represent mean ± SD. mRNA expression analysis of 201B7 cells seeded at 5 × 104 cells / well on plates coated with iMatrix-511 or atelocollagen 4 days after seeding: correlation with stem cell markers (C), and expression of undifferentiated cell markers (D). Data represent mean ± SD. *P < 0.05. **P < 0.01. [Figure 7] Differentiation and degeneration of hiPSCs cultured on atelocollagen-coated plates. Analysis of mRNA expression of 15M66 cells grown on iMatrix-511 or atelocollagen on day 4 after seeding at 5 × 104 cells / well. Differentiation markers (A). Analysis of mRNA expression of 15M66 cells grown on iMatrix-511 or atelocollagen on day 4 after seeding at 5 × 104 cells / well. Epithelial markers, n = 6. Data represent mean ± SD. *P < 0.05. **p < 0.01 (B). Mesenchymal markers, n = 6. Data represent mean ± SD. *P < 0.05. **p < 0.01 (C). Fluorescence microscopy images of 15M66 cells (5 × 104 cells / well) grown on iMatrix-511 or atelocollagen. Four days after cell seeding, cells were stained with Kyoto Probe 1 (D, upper row) and Tra-1-60 (D, lower row). Scale bar = 200 μm. [Figure 8]iPSCs were established on atelocollagen beads. 1 x 105 human mononuclear cells were reprogrammed with Sendai virus vectors on atelocollagen beads or Cytodex 3. Light microscopy images taken 15 days after initiation of reprogramming. White arrows indicate established hiPSCs (A, left panel) or incompletely established cell clusters (A, right panel). A total of 1 x 105 human mononuclear cells were reprogrammed on iMatrix-511 or atelocollagen beads with five different Sendai virus vectors (SRV™ iPSC-1, 2, 3, 4, CytoTune 2.0). Number of colonies / well 15 days after initiation of reprogramming. **p<0.01 (B). hiPSCs established on atelocollagen beads were passaged eight times on the beads, and then mRNA was collected 11 days after the start of differentiation induction into cardiomyocytes (C), endodermal cells (D), and neural progenitor cells (E). Expression analysis of each differentiation marker in mRNA. Data are shown as mean ± SD. *P < 0.05. **P < 0.01. [Figure 9] The effects of iMatrix-511-coated plates, atelocollagen-coated plates, and atelocollagen beads on inducing differentiation into cardiomyocytes. Cardiomyocytes 8 days after the start of differentiation induction from hiPSCs of the 201B7 strain. Optical microscope images are shown (top). Fluorescent immunostaining using troponin T antibody (second from the top), fluorescent immunostaining using Hoechst (third from the top), and a composite of these images taken under a microscope (bottom). Scale bar = 200 μm. [Figure 10] Degradation of atelocollagen by collagenase. Optical microscope images taken 0-30 minutes after addition of collagenase (1g / 10ml high-concentration solution, 50 μl / well). Scale bar = 400 μm. [Figure 11]Elucidation of the mechanism by which hiPSCs induce filopodia extension in response to atelocollagen. Optical micrographs of hiPSCs (white arrows) extending filopodia and adhering to atelocollagen (A). 15M66 cells were seeded at 2.5 × 104 cells / well onto atelocollagen-coated wells (B) or iMatrix-511-coated wells (C) and then cultured with or without the reagent TC-I 15 at 1 or 10 μg / well. Scale bar = 100 μm. Diagram showing how atelocollagen induces filopodia extension in hiPSCs. Atelocollagen activates integrin α2β1 in hiPSCs, activating their self-renewal potential and filopodia extension. This mechanism functions not only under 2D culture conditions (D, left) but also under 3D culture conditions (D, right). [Figure 12] Effect of atelocollagen on Rho family protein signaling factors. Diagram of the signaling pathway by which Rho family protein signaling factors induce filopodia. Receptors include GPCR, RTK, and integrin, but only integrin is depicted (A). 201B7 cells (B) or 15M66 cells (C) were seeded at 5 x 104 cells / well on wells coated with iMatrix-511 or atelocollagen, and mRNA expression of Rho family protein signaling factors was analyzed after 4 days. n = 6. Data represent mean ± SD. *P < 0.05. **p < 0.01. [Figure 13-1] Examining the mechanism by which hiPSCs induce filopodia extension on atelocollagen. Light microscopy images. 15M66 cells were seeded at 2.5 x 104 cells / well onto iMatrix-511 or atelocollagen-coated wells 3 days after plating with or without reagents (control: DMSO, NF023, NF449, SB 225002, GP Antagonist-2A, or dihydromundretone alone) at 1 or 10 μg / well. Scale bar = 100 μm. [Figure 13-2]Examining the mechanism by which atelocollagen induces filopodia extension in hiPSCs. Light microscopy images. 15M66 cells were seeded at 2.5 x 104 cells / well onto iMatrix-511 or atelocollagen-coated wells 3 days after plating with or without reagents (VU6015929, merestinib, or DDR1-IN-1 alone) at 1 or 10 μg / well. Scale bar = 100 μm. [Figure 14] HiPSCs were cultured in a bioreactor with a PES hollow fiber membrane coated with atelocollagen. Optical microscope images (400x magnification) of 15M66 cells (white arrows) attached to a PES membrane without atelocollagen coating (A, left panel) or with atelocollagen coating (A, right panel). Photograph of an automated cell culture device with a bioreactor using a PES hollow fiber membrane (B). Optical microscope image of cells recovered after detachment with collagenase on day 4 after seeding 15M66 cells at 5 × 105 cells / well into a polyethersulfone (PES) hollow fiber membrane bioreactor (C). mRNA analysis results of cells recovered after detachment with collagenase on day 4 after seeding 15M66 cells at 5 × 105 cells / well into an atelocollagen-coated PES hollow fiber membrane bioreactor (D). Expression of undifferentiated cell markers (D), maintenance of pluripotency markers (E), correlation with stem cell markers (F), and differentiation markers (G). n = 1. [Figure 15] Observation of hiPSCs cultured in a bioreactor using a PES hollow fiber membrane coated with atelocollagen. Hematoxylin and eosin (HE) staining was applied to sections from the inner (IC) and outer (EC) sides of the hollow fiber. hiPSC colonies (black arrows) are shown. The scale bar indicates the indicated length. DETAILED DESCRIPTION OF THE INVENTION

[0014] Preferred embodiments for carrying out the present invention will now be described with reference to the drawings. Note that the embodiments described below are examples of typical embodiments of the present invention, and the scope of the present invention should not be construed as being narrow.

[0015] 1.Stem cell proliferation promoter As shown in the examples below, the use of a scaffold material containing atelocollagen enabled efficient production of pluripotent stem cells from somatic cells, and also enabled efficient proliferation of the stem cells. Therefore, a (pluripotent) stem cell proliferation promoter (hereinafter, sometimes referred to as the "agent of the present invention") comprising a scaffold material containing atelocollagen is provided. Without being bound by any theory, it is speculated that the above-mentioned effects of a scaffold material containing atelocollagen are the result of cells, such as stem cells and differentiated cells, adhering to atelocollagen, thereby suppressing cell death due to shear stress in suspension culture. Therefore, a cell death inhibitor or cell survival maintainer comprising a scaffold material containing atelocollagen is also provided.

[0016] The agent of the present invention may be in the form of a culture medium. Accordingly, a culture medium containing a scaffold material containing atelocollagen (hereinafter, sometimes referred to as the "culture medium of the present invention") is also provided. The atelocollagen-containing scaffold material contained in the culture medium of the present invention will be released in the culture medium. Alternatively, the agent of the present invention can be used as a culture medium for culturing somatic cells, a culture medium for culturing stem cells, a differentiation induction medium for inducing stem cell differentiation, a cell preservation solution for stem cells or stem cell-derived differentiated cells, or an organ preservation solution for organs produced from stem cell-derived differentiated cells. In the present invention, the cells to be cultured may be a single cell, but are typically a cell population consisting of multiple cells. Therefore, in this specification, unless otherwise specified, "cells" includes a "cell population." A cell population may be composed of one type of cell, or two or more types of cells.

[0017] Furthermore, the agent of the present invention can be prepared as a composition for preparing a culture medium, using a scaffold material containing atelocollagen as an essential component. That is, all or part of the components of the culture medium of the present invention can be used as constituents, and these can be solidified or made into a concentrated solution, which can be dissolved or diluted, or used as a composition for adding to an existing culture medium (culture medium supplement), or as a set of a liquid culture medium and solid components, to ultimately prepare the culture medium of the present invention.

[0018] [Scaffolding materials] As used herein, the term "scaffold material," also known as a scaffold, refers to a material or substrate that functions as a scaffold for cells in cell culture. The atelocollagen-containing scaffold material used in the present invention is not limited as long as it can be used for cell suspension culture (in other words, it may be released into the medium), but it preferably contains a synthetic resin. Furthermore, the scaffold material may be made of atelocollagen, and specific examples include atelocollagen molded into a shape suitable for use as a scaffold material. Typically, the scaffold material used in the present invention is a material other than nanofibers.

[0019] Synthetic resins refer to materials whose main component is a polymer (hereinafter simply referred to as "polymer") obtained by polymerizing (including polycondensation) polymerizable monomers (hereinafter simply referred to as "monomers"). The polymer also includes copolymers of one or more polymerizable monomers. Alternatively, scaffold materials may be primarily composed of inorganic materials such as glass or silicone.

[0020] Examples of the polymer include polymers composed of one or more polymerizable monomers of (un)saturated hydrocarbons, aromatic hydrocarbons, (un)saturated fatty acids, aromatic carboxylic acids, (un)saturated ketones, aromatic ketones, (un)saturated alcohols, aromatic alcohols, (un)saturated amines, aromatic amines, (un)saturated thiols, aromatic thiols, and organosilicon compounds.

[0021] Specific examples of the polymer include polystyrene, polyolefin, polyether, polyvinyl alcohol, polyvinyl acetal, polyester, poly(meth)acrylic acid ester, epoxy resin, polyamide, polyimide, polyurethane, polycarbonate, cellulose, dextran, polypeptide (e.g., gelatin, etc.). These polymers may be used alone or in combination of two or more. When two or more polymers are combined, the two or more polymers may be mixed and used, or the skeletons of the two or more polymers may be chemically bonded to each other to form a polymer.

[0022] The scaffold material may be produced by a known method, or a commercially available product such as Cytodex-1 (GE Healthcare) may be used.

[0023] Typically, a scaffold material containing atelocollagen can be prepared by coating all or part of the surface of the scaffold material with atelocollagen. As shown in the Examples below, adhesion between pluripotent stem cells and atelocollagen is suggested to be due to the interaction between integrin α2β1 present on the surface of the pluripotent stem cells and atelocollagen, which fixes the pluripotent stem cells to the atelocollagen. Therefore, when coating the surface of a scaffold material with atelocollagen, it is sufficient to cover only a portion of the scaffold surface as long as the above-mentioned interaction occurs. Furthermore, the purity of the atelocollagen used for coating is not particularly limited, but high purity (e.g., 90% or more, more preferably 95% or more, and most preferably 100%) is preferred. To improve cell adhesion to the surface of a free scaffold material such as a microcarrier, the scaffold material may be coated with any cell-supporting substrate, such as an extracellular matrix (ECM), in addition to atelocollagen. As shown in the examples below, native collagen has been found to have an inhibitory effect on cell proliferation, so it is preferable that the matrix contains substantially no native collagen (for example, 10% or less, more preferably 5% or less (e.g., 4%, 3%, 2%, 1%, 0%). The cell support matrix can be any material intended for the attachment of stem cells or feeder cells (if used). Examples of such cell support matrix include collagen, gelatin, poly-L-lysine, poly-D-lysine, laminin (or a partial structure of laminin), and fibronectin. Examples include nectins and mixtures thereof, such as Matrigel and lysed cell membrane preparations (see Lancet, 2005, 365, 9471, 1636-1641). In this specification, unless otherwise specified, "purity" refers to the mass percent concentration (hereinafter, "mass percent concentration" will be simply referred to as "concentration") as an indicator of high quality (low rate of impurity contamination), but it can also refer to the concentration of a specific component (e.g., atelocollagen) in a mixture (e.g., a mixture of atelocollagen and other cell-support substrates).

[0024] The shape of the scaffold material used in the present invention is not particularly limited, but examples include cylindrical, spheroidal, and spherical shapes, with spherical shapes being preferred. Specific examples of such spherical scaffold materials include microcarriers. As shown in the Examples below, pluripotent stem cells can be proliferated using microcarriers with diameters of 105 μm or less, 105 to 250 μm, 250 to 425 μm, or 425 to 600 μm in bioreactor culture. The size of the scaffold material is also not particularly limited, but when using spherical scaffolds such as microcarriers, the particle size (diameter) of the scaffold material is typically 50 to 1000 μm, 70 to 700 μm, and preferably 100 to 400 μm. From the perspective of cell proliferation rate, a preferred embodiment has a particle size of 600 μm. Particle size can be measured using the Coulter counter method described in International Standard ISO 13319, "Measurement of particle size distribution—electrical detection zone method."

[0025] Type I collagen molecules consist of approximately 95% helical (helical) and approximately 5% non-helical (telopeptide) regions (Figure 2). This non-helical region is highly antigenic and is cleaved by proteases (protein-degrading enzymes). Atelocollagen, the natural polymeric material used in scaffold materials, is highly purified after digestion and removal of the highly antigenic telopeptide regions with proteases such as pepsin, resulting in extremely low antigenicity (see Matrix, 1992, 12, 274-281). On the other hand, collagen present in living organisms is an insoluble fibrous protein with a "triple helix structure" in which three polypeptide chains are wound helically, also known as "native collagen." The origin of the atelocollagen used in the present invention is not limited, and examples include those derived from mammals (e.g., humans, mice, rats, monkeys, cows, horses, pigs, dogs, etc.). To prevent contamination with components derived from other animals, it is preferable to use atelocollagen derived from the same source as the cells to be cultured. Such atelocollagen may be produced by known methods, or commercially available products may be used. For example, atelocollagen can be purified by treating collagen extracted from cells or tissues containing atelocollagen or collagen secreted from cultured cells with protease.

[0026] [Stem cells] The "stem cells" referred to in the present invention refer to immature cells that have the ability to self-replicate and differentiate and proliferate, and include pluripotent stem cells, multipotent stem cells, unipotent stem cells, etc., depending on their differentiation potential. "Pluripotent stem cells" are generally defined as undifferentiated cells that have the "self-renewal ability" to proliferate while maintaining an undifferentiated state, and the "pluripotency" to differentiate into all three germ layer lineages.

[0027] Pluripotent stem cells refer to cells that have the ability to differentiate into all tissues and cells that make up the body. Multipotent stem cells refer to cells that have the ability to differentiate into multiple types of tissues or cells, although not all types. Unipotent stem cells refer to cells that have the ability to differentiate into specific tissues or cells.

[0028] The species from which the stem cells are derived is not particularly limited, and may be cells from, for example, rodents such as rats, mice, hamsters, and guinea pigs; lagomorphs such as rabbits; ungulates such as pigs, cows, goats, and sheep; carnivores such as dogs and cats; and primates such as humans, monkeys, rhesus monkeys, marmosets, orangutans, and chimpanzees.

[0029] Specific examples of stem cells include mesenchymal stem cells that differentiate into myoblasts, vascular endothelial cells, osteoblasts, adipocytes, muscle cells, cardiomyocytes, chondrocytes, etc.; neural stem cells that differentiate into neurons and glial cells; hematopoietic stem cells or bone marrow stem cells that differentiate into white blood cells, red blood cells, platelets, mast cells, dendritic cells, etc.; embryonic stem cells (ES cells) and induced pluripotent stem cells (iPS cells), which are known to proceed from a spheroid state through the formation of pseudo-embryos called embryoid bodies (EB bodies) and then proceed to the steps of differentiation and induction into various tissues; embryonic germ (EG) cells derived from primordial germ cells; multipotent germline ES stem (mGS) cells isolated during the establishment and culture process of GS cells from testicular tissue; and multipotent adult progenitor cells (MAPCs) isolated from bone marrow. When the pluripotent stem cells are ES cells or any cells derived from a human embryo, the cells may be produced by destroying an embryo or without destroying an embryo, but from an ethical standpoint, cells produced without destroying an embryo are preferred. Furthermore, the human ES cells used in the present invention are preferably established from a human embryo within 14 days of fertilization.

[0030] Pluripotent stem cells can particularly include the above-mentioned ES cells or iPS cells.Stem cells established by culturing early embryos produced by nuclear transfer of somatic cell nuclei are also preferred as pluripotent stem cells (Nature, 1997.385.810-813; Science, 1998.280.1253-1256; Nature Biotechnology, 1999.17.456-461; Nature, 1998.394.369-374; Nature Genetics, 1999.22.127-128; Proc Natl Acad Sci USA, 1999.96.14984-14989; Nature Genetics, 2000.24.372-376).

[0031] For example, the human ES cell lines WA01 (H1) and WA09 (H9) are available from the WiCell Research Institute, KhES-1, KhES-2, and KhES-3 are available from the Institute for Frontier Medical Sciences, Kyoto University (Kyoto, Japan), and the clinical research human ES cell line KthES11 is available from the Institute for Virus Research and Frontier Medical Sciences, Kyoto University.

[0032] iPS cells include cells that have acquired pluripotency similar to that of ES cells and are obtained by introducing multiple genes or proteins (reprogramming factors) into somatic cells such as skin cells. Examples of iPS cells include iPS cells obtained by introducing the Oct3 / 4 gene, Klf4 gene, c-Myc gene, and Sox2 gene, and iPS cells obtained by introducing the Oct3 / 4 gene, Klf4 gene, and Sox2 gene (Nature Biotechnology, 2008.26.101-106). Examples of reprogramming factors include Oct3 / 4, Sox2, Sox1, Sox3, Sox15, Sox17, Klf4, Klf2, c-Myc, N-Myc, L-Myc, Nanog, Lin28, Fbx15, ERas, ECAT15-2, Tcl1, beta-catenin, Lin28b, Sall1, Sall4, ESrrb, Nr5a2, Tbx3, and Glis1. These reprogramming factors may be used alone or in combination.Combinations of reprogramming factors include WO2007 / 069666, WO2008 / 118820, WO2009 / 007852, WO2009 / 032194, WO2009 / 058413, WO2009 / 057831, WO2009 / 075119, WO2009 / 079007, WO2009 / 091659, WO2009 / 101084, WO2009 / 101407, WO2009 / 102983, WO2009 / 114949, WO2009 / 117439, WO2009 / 126250, WO2009 / 126251, WO2009 / 126655, WO2009 / 157593, WO2010 / 009015, WO2010 / 033906, WO2010 / 033920, WO2010 / 042800, WO2010 / 050626, WO2010 / 056831, WO2010 / 0 68955, WO2010 / 098419, WO2010 / 102267, WO2010 / 111409, WO2010 / 111422, WO2010 / 115050, WO2010 / 124290, WO2010 / 147395, WO2010 / 147612, Nat Biotechnol,2008.26.795-797, Cell Stem Cell,2008.2.525-528, Stem Cells,2008.26.2467-2474, Nat Biotechnol,2008.26.1269-1275, Cell Stem Cell,2008.3.568-574, Cell Stem Cell,2008.3.475-479, Cell Stem Cell,2008.3.132-135, Nat Cell Biol,2009.11.197-203, Nat Biotechnol,2009.27.459-461, Proc Natl Acad Sci Examples of combinations include those described in USA, 2009.106.8912-8917, Nature, 2009.461.643-649, Cell Stem Cell, 2009.5.491-503, Cell Stem Cell, 2010.6.167-74, Nature, 2010.463.1096-1100, Stem Cells, 2010.28.713-720, and Nature, 2011.474.225-229.

[0033] iPS cells are available from designated institutions (RIKEN BioResource Center, Kyoto University). Clinical-grade iPS cells are also being established in Japan (Kyoto University Hospital, Center for iPS Cell Research and Application, Kyoto University https: / / www.cira.kyoto-u.ac.jp / j / rESearch / stock.html), the Kyoto University iPS Cell Research Foundation https: / / www.cira-foundation.or.jp / j / , and in the United States (ClinicalTrials.gov Identifier: NCT03434808, ClinicalTrials.gov Identifier: NCT02056613), as well as by FUJIFILM Cellular Dynamics, Inc. (FCDI), a U.S. subsidiary of Fujifilm Corporation. The technology of the present invention can also be used to establish and maintain such iPS cells.

[0034] More specifically, examples of human iPS cells include the 253G1 strain (RIKEN Cell Bank No. HPS0002), the 201B7 strain (RIKEN Cell Bank No. HPS0063), the 409B2 strain (RIKEN Cell Bank No. HPS0076), the 454E2 strain (RIKEN Cell Bank No. HPS0077), the HiPS-RIKEN-1A strain (RIKEN Cell Bank No. HPS0003), the HiPS-RIKEN-2A strain (RIKEN Cell Bank No. HPS0009), the HiPS-RIKEN-12A strain (RIKEN Cell Bank No. HPS0029), and the NiPS-B2 strain (RIKEN Cell Bank No. HPS0223), as well as clinical iPS cells, medical iPS cells, regenerative medicine iPS cells, and myiPS (Kyoto University iPS Cell Research Foundation).

[0035] Multipotent stem cells include somatic stem cells such as mesenchymal stem cells, hematopoietic stem cells, neural stem cells, bone marrow stem cells, and germline stem cells. Multipotent stem cells are preferably mesenchymal stem cells, more preferably bone marrow mesenchymal stem cells. Mesenchymal stem cells broadly refer to stem cells that can differentiate into all or some of the mesenchymal cells, such as osteoblasts, chondroblasts, and adipblasts, or a population of their precursor cells.

[0036] [Culture medium] As used herein, "suspension culture" refers to culture performed under conditions that maintain cells or cell aggregates suspended in the culture medium, i.e., culture under conditions that do not allow the formation of strong cell-substratum junctions or cell-cell junctions between the cells or cell aggregates and the culture vessel and feeder cells (if used). When cells adhere to a scaffold material that has become free in the culture medium, the cells themselves become free in the culture medium. "Freed" or "free to be freed" also includes a state in which the scaffold material or cells or cell aggregates attached to the scaffold material float in the culture medium upon gentle shaking of the culture vessel. The medium of the present invention can be prepared by adding free scaffold materials, such as atelocollagen-containing microcarriers, either alone or in combination, to a medium (basal medium) conventionally used for culturing somatic cells, culturing stem cells produced from somatic cells, and inducing differentiated cells from stem cells. Examples of such media include the following:

[0037] Examples of the basal medium include RPMI-1640 medium, Eagle's MEM medium, Dulbecco's modified MEM medium, Glasgow's MEM medium, α-MEM medium, 199 medium, IMDM medium, DMEM medium, Hybridoma Serum-free medium, Chemically Defined Hybridoma Serum-Free medium, Ham's Medium F-12, Ham's Medium F-10, Ham's Medium F12K, ATCC-CRCM30, DM-160, DM-201, BME, Fischer, McCoy's 5A, Leibovitz's L-15, RITC80-7, MCDB105, MCDB107, MCDB131, MCDB153, MCDB201, NCTC109, NCTC135, Waymouth's MB752 / 1, CMRL-1066, Williams' medium E, and Brinster's BMOC-3. Examples of suitable medium include, but are not limited to, ReproFF2, Primate ES Cell Medium, ReproStem (ReproCELL Inc.), ProculAD (Rohto Pharmaceutical Co., Ltd.), MSCBM-CD, MSCGM-CD (Lonza), EX-CELL302 Medium (SAFC) or EX-CELL-CD-CHO (SAFC), ReproMed™ iPSC Medium (ReproCELL Inc.), Cellartis MSC Xeno-Free Culture Medium (Takara Bio Inc.), TESR-E8 (Veritas Inc.), StemFit® AK02N, AK03N (Ajinomoto Co., Inc.), and mixtures thereof.

[0038] The concentration of atelocollagen in a scaffold material ((mass of atelocollagen / mass of scaffold material containing atelocollagen) × 100) is not particularly limited, as long as it is a concentration that exhibits a cell death inhibitory effect on cells. Such a concentration can be appropriately determined by those skilled in the art using the methods described in the Examples or conventionally known methods. The concentration of atelocollagen in a scaffold material is, for example, 0.1% or more (e.g., 0.1%, 1%, 3%, 5%, 10%, 20%, 25%, 30% or more) and 100% or less. When a scaffold material is coated with a cell-support matrix containing atelocollagen, the concentration of atelocollagen in the cell-support matrix is ​​90% or more (e.g., 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 97%, 98%, 99%, or 100%). In one embodiment of the present invention, the scaffold material is substantially composed of atelocollagen, and "substantially composed of atelocollagen" does not mean that the atelocollagen concentration is 100%, but rather that it is close to 100% (e.g., 95% or more, preferably 95.5% or more (e.g., 96%, 97%, 98%, 99% or 100%)).

[0039] The concentration of atelocollagen in the medium is not particularly limited, and by appropriately adjusting the atelocollagen concentration, it is possible to control the cell proliferation rate. The atelocollagen concentration in the medium is, for example, 0.01 to 20%, preferably 0.05 to 5%, and more preferably 0.1 to 2%. The atelocollagen concentration in the medium is also preferably 0.5% to 20%, 1% to 15%, or 5% to 10%.

[0040] Furthermore, physiologically active substances and nutritional factors necessary for cell survival or proliferation can be added to the medium as needed. These additives may be added to the medium in advance or during cell culture. The method of adding additives during culture may be in any form, such as a single solution or a mixed solution of two or more types, and may be added continuously or intermittently.

[0041] Physiologically active substances include insulin, IGF-1, transferrin, albumin, coenzyme Q10, various cytokines (interleukins (IL-2, IL-7, IL-15, etc.), stem cell factor (SCF), activin, etc.), various hormones, and various growth factors (leukemia inhibitory factor (LIF), basic fibroblast growth factor (bFGF), TGF-β, etc.). Nutritional factors include sugars, amino acids, vitamins, hydrolysates, lipids, and the like. Examples of sugars include glucose, mannose, and fructose, and one or more of these may be used in combination. Examples of amino acids include L-alanine, L-arginine, L-asparagine, L-aspartic acid, L-cysteine, L-glutamic acid, L-glutamine, glycine, L-histidine, L-isoleucine, L-leucine, L-lysine, L-methionine, L-phenylalanine, L-proline, L-serine, L-threonine, L-tryptophan, L-tyrosine, and L-valine, and these may be used alone or in combination of two or more. Examples of vitamins include d-biotin, D-pantothenic acid, choline, folic acid, myo-inositol, niacinamide, pyrodoxal, riboflavin, thiamine, cyanocobalamin, and DL-α-tocopherol, and these may be used alone or in combination of two or more. Hydrolysates include those obtained by hydrolyzing soybeans, wheat, rice, peas, corn, cottonseed, yeast extract, and the like. The lipids include cholesterol, linoleic acid, and linolenic acid.

[0042] Furthermore, antibiotics such as kanamycin, streptomycin, penicillin, or hygromycin may be added to the medium as needed. When an acidic substance such as sialic acid is added to the medium, it is desirable to adjust the pH of the medium to a neutral range suitable for cell growth, between pH 5 and 9, preferably between pH 6 and 8.

[0043] The medium of the present invention may be a serum-containing medium (e.g., fetal bovine serum (FBS), human serum, or horse serum) or a serum-free medium. From the viewpoint of preventing contamination with components derived from different animal species, it is preferable that the medium does not contain serum, or that serum derived from the same animal species as the cells to be cultured is used. Here, serum-free medium refers to a medium that does not contain unconditioned or unpurified serum. The serum-free medium may contain purified blood-derived components or animal tissue-derived components (e.g., growth factors).

[0044] The medium of the present invention may or may not contain a serum substitute, similar to serum. Examples of serum substitutes include albumin, lipid-rich albumin, recombinant albumin, and other albumin substitutes, plant starch, dextran, protein hydrolysates, transferrin or other iron transporters, fatty acids, insulin, collagen precursors, trace elements, 2-mercaptoethanol, 3'-thioglycerol, and their equivalents. Specific examples of serum substitutes include those prepared by the method described in International Publication No. 98 / 30679, as well as commercially available products such as knockout serum replacement [KSR] (Life Technologies), chemically-defined lipid concentrated (Life Technologies), and Glutamax (Life Technologies). Examples of biological factors include platelet-rich plasma (PRP) and components of the culture supernatant of human mesenchymal stem cells.

[0045] [Cell and organ preservation solutions] Cell and organ preservation solutions that have been widely used in clinical practice include University of Wisconsin organ preservation solution (UW solution), HBSS (Hank's Balanced Salt Solution), histidine-tryptophan-ketoglutarate (HTK) solution, Euro-Collins solution, Celsior solution, ET-Kyoto solution, IGL-1 solution, and EP-TU solution.

[0046] 2. Stem cell production method In another aspect, the present invention provides a method for producing stem cells (hereinafter, sometimes referred to as the "stem cell production method of the present invention"), which comprises the step of suspension culturing cells in the medium of the present invention. By culturing stem cells in the medium of the present invention, the stem cells proliferate (i.e., stem cells are produced) due to the self-renewal ability of the stem cells. Therefore, a method for proliferating stem cells (or a maintenance culture method) which comprises the step of suspension culturing stem cells in the medium of the present invention is also provided. As shown in the examples below, pluripotent stem cells produced by the production method of the present invention can maintain their pluripotency (in other words, the ability to differentiate into all three germ layer lineages) even when suspension cultured in the medium of the present invention for at least eight passages or more, and are therefore suitable for maintenance culture.

[0047] Furthermore, in the method for producing stem cells of the present invention, when the stem cells are pluripotent stem cells, pluripotent stem cells can be established by culturing and initializing cells that serve as the source of the pluripotent stem cells (starting cells). Thus, in another aspect of the present invention, there is provided a method for producing pluripotent stem cells (hereinafter sometimes referred to as the "method for producing pluripotent stem cells of the present invention") or a method for establishing pluripotent stem cells, which comprises the step of suspension culturing cells in the medium of the present invention. In this specification, the term "method for producing pluripotent stem cells of the present invention" may be used to encompass both the method for producing stem cells of the present invention and the method for producing pluripotent stem cells of the present invention.

[0048] In yet another aspect, stem cells produced by the method of the present invention are also provided.

[0049] [cell] In the method for producing pluripotent stem cells of the present invention, the cells to be cultured in the medium of the present invention are not limited as long as they are cells (starting cells) that serve as the source of pluripotent stem cells. For example, when the pluripotent stem cells to be produced are iPS cells, the starting cells can be somatic cells into which the above-mentioned reprogramming factors have been introduced. Alternatively, the starting cells can be somatic cells in the process of reprogramming (e.g., cells that express at least Oct4). The somatic cells used in the method for producing pluripotent stem cells of the present invention can be either floating cells (e.g., blood cells) or adherent cells, but floating cells are preferred. Somatic cells used in the production method of the present invention include, but are not limited to, mesenchymal stem cells derived from fibroblasts such as skin cells, skin cells, visual cells, brain cells, hair cells, oral mucosa, lung cells, liver cells, gastric mucosa cells, intestinal cells, spleen cells, pancreatic cells, kidney cells, neural stem cells, wisdom teeth, etc., tissue stem cells, tissue progenitor cells, blood cells (e.g., hematopoietic stem cells, peripheral blood mononuclear cells (including T cells and non-T cells), umbilical cord blood cells, etc.), epithelial cells, endothelial cells (e.g., vascular endothelial cells), muscle cells, etc.

[0050] Methods for introducing reprogramming factors into somatic cells include, when the reprogramming factors are in the form of DNA, for example, vectors such as viruses, plasmids, and artificial chromosomes, lipofection, liposomes, microinjection, etc.; when the reprogramming factors are in the form of RNA, for example, lipofection, microinjection, etc.; when the reprogramming factors are in the form of protein, for example, lipofection, fusion with cell membrane-permeable peptides (e.g., HIV-derived TAT and polyarginine), microinjection, etc. Methods using viral vectors include, but are not limited to, methods using retroviral vectors, methods using episomal vectors, methods using Sendai virus vectors such as ID Pharma's reprogramming kit "CytoTune®-iPS 2.0," methods using lentiviral vectors, and methods using adenoviral vectors. Furthermore, the method for producing pluripotent stem cells of the present invention may include a step of introducing reprogramming factors into somatic cells.

[0051] The cells to be cultured may be dispersed or non-dispersed. Dispersed cells are cells that have been treated to promote cell dispersion. Dispersed cells include single cells or cells that form small cell clusters consisting of a few cells (typically 2-50, 2-20, or 2-10). Dispersed cells may be floating (suspended) cells or cells attached to a free scaffold material such as a microcarrier.

[0052] [Culture method] The step of culturing cells in suspension in the medium of the present invention may involve adding a scaffold material containing atelocollagen to the medium in advance and then culturing the cells in suspension in the medium, or may involve adding a scaffold material containing atelocollagen during cell culture and then culturing the cells in suspension. Furthermore, cells may be cultured in suspension in the medium of the present invention throughout the entire cell culture period in the production method of the present invention, or only for a portion of the period. For example, when establishing pluripotent stem cells, cells may be cultured in suspension in the medium of the present invention only at the stage when pluripotent stem cells or adherent cells in the process of reprogramming appear. Alternatively, cells may be cultured in the medium of the present invention from the early stage of pluripotent stem cell establishment (e.g., the stage when starting the culture of somatic cells transfected with reprogramming factors). Furthermore, in the production method of the present invention, the scaffold material containing atelocollagen may be removed when it is no longer needed, or the scaffold material and cells may be separated. Specifically, it is known that atelocollagen can be dissolved by adding collagenase at a concentration of 0.1% and treating the medium at 37°C for 1 hour or more. Therefore, in the production method of the present invention, collagenase may be added to the medium at any timing, or the medium may be replaced with a medium containing collagenase.

[0053] The culture vessel used for suspension culture is not particularly limited as long as it is capable of "suspension culture," and those skilled in the art can appropriately determine the appropriate vessel. Examples of such culture vessels include flasks, tissue culture flasks, dishes, Petri dishes, tissue culture dishes, multi-dishes, microplates, microwell plates, micropores, multi-plates, multi-well plates, chamber slides, Petri dishes, tubes, trays, culture bags, and roller bottles. Another example of a vessel for suspension culture is a bioreactor. These culture vessels are preferably non-cell-adhesive to enable suspension culture. Examples of non-cell-adhesive culture vessels that can be used include those whose surfaces have not been artificially treated (e.g., coated with an extracellular matrix) to improve cell adhesion.

[0054] Suspension culture can be performed, for example, by seeding cells in the various vessels described above and rocking or shaking the vessel in an appropriate manner, or by stirring the medium in the vessel. Alternatively, suspension culture can be performed using culture devices such as bioreactors and automated culture systems. Specifically, cell culture can be performed in a closed environment under mechanical control, automatically performing cell seeding, medium exchange, cell image acquisition, and cultured cell recovery, and by controlling pH, temperature, oxygen concentration, and other parameters, enabling high-density culture. These devices can be used to replenish fresh medium during culture and provide cells with the required substances in the correct amounts, including fed-batch culture, continuous culture, and perfusion culture. All of these methods can be used in the production method of the present invention. Furthermore, culture vessels used in bioreactors and automated culture systems include open-system culture vessels (e.g., culture vessels with lids) that are easy to open and close and have a large contact area with the outside world, and closed-system culture vessels (e.g., cartridge-type culture vessels) that are difficult to open and close and have a small contact area with the outside world. Both types of culture vessels can be used in the production method of the present invention.

[0055] When a bioreactor equipped with a stirrer is used as a vessel for suspension culture, the rotation speed can be appropriately set. Although not particularly limited, examples of the rotation speed of a bioreactor include 10 to 100 rpm, a 5 mL bioreactor includes 80 to 100 rpm, a 100 mL bioreactor includes 30 to 50 rpm, and a 500 mL bioreactor includes 10 to 30 rpm.

[0056] The cell culture density is not particularly limited as long as the cells can grow. Preferably, the cell culture density is 1.0 × 10 1 ~1.0×10 9 cells / ml, more preferably 1.0 x 10 2 ~1.0×10 9 cells / ml, even more preferably 1.0 x 10 3 ~1.0×10 9 cells / ml, most preferably 3.0 x 10 4 ~1.0×10 9 cells / ml.

[0057] When stem cells are cultured in an adherent manner on a free scaffold material such as a microcarrier, they may be cultured in the presence of feeder cells. Stromal cells such as fetal fibroblasts can be used as feeder cells (see, for example, *Manipulating the Mouse Embryo: A Laboratory Manual, Fourth Edition* (Cold Spring Harbor Laboratory PrESs, 2014), *Gene Targeting: A Practical Approach* (Oxford University PrESs, 1993), *Proc Natl Acad Sci USA*, 1981.78.12.7634-7638, *Nature*, 1981.292.5819.154-156, *J. Virol*, 1969.4.5.549-553, *Science*, 1996.272.5262.722-724, *J Cell Physiol*, 1982.112.1.89-95, *International Publication No. WO2001 / 088100, *International Publication No. WO2005 / 080554).

[0058] In the production method of the present invention, some cells may be free from a free scaffold material such as a microcarrier, and examples of the suspension culture of stem cells include suspension culture on a carrier (J Biotechnol, 2007.132.2.227-236) or suspension culture using a high molecular weight polymer such as methylcellulose (Stem Cell Reports, 2014.2.5.734-745).

[0059] Stem cell suspension cultures include dissociated stem cell cultures and aggregated suspension cultures. Dissociated stem cell cultures refer to the cultivation of suspended stem cells, and include the dissociated culture of single cells or small cell clusters consisting of several stem cells (e.g., 2-20 cells). Continuing the dissociated culture allows the cultured dispersed cells to form larger stem cell clusters, after which aggregated suspension culture can be performed. Examples of such aggregated suspension cultures include the embryoid body culture method (see Curr Opin Cell Biol, 1995.7.6.862-869), the SFEB method (Nature Neuroscience, 2005.8.3.288-296, International Publication WO2005 / 123902), and the sphere culture method, in which cell lines are passaged by mechanical processing using a mesh filter (Stem Cell Reports, 2014.2.5.734-745).

[0060] Culture conditions such as temperature, dissolved CO2 concentration, dissolved oxygen concentration, and pH can be appropriately set based on techniques conventionally used in culturing cells derived from animal tissues. For example, the culture temperature is not particularly limited but can be 30 to 40°C, preferably 37°C. The temperature at which the organ preservation solution or cell preservation solution is used can be 0°C to room temperature, preferably 0°C to 4°C. The dissolved CO2 concentration can be 1 to 10%, preferably 2 to 5%. The oxygen partial pressure can be 1 to 10%. The number of days for culture is also not particularly limited as long as stem cells are produced, but is usually 2 days or more, preferably 3 days or more, and more preferably 4 days or more. The upper limit of the culture period is also not particularly limited but is usually 30 days or less, preferably 25 days or less.

[0061] The contents of the basal medium, physiologically active substances, nutritional factors, etc. are all incorporated by reference in "1. Stem cell proliferation promoters."

[0062] 3. Method for producing differentiated cells As described above, scaffold materials containing atelocollagen can have a cell death-inhibiting effect on cells such as stem cells and differentiated cells. Therefore, the agent or medium of the present invention can also be used when producing differentiated cells from stem somatic cells. Therefore, a method for producing differentiated cells (hereinafter, sometimes referred to as the "method for producing differentiated cells of the present invention") is also provided, which includes a step of suspension-culturing cells in the medium of the present invention. In the method for producing differentiated cells of the present invention, the cells cultured in the medium of the present invention may be stem cells (including stem cells produced by the method of the present invention), cells after differentiation induction (e.g., cells in the process of differentiation, such as precursor cells of differentiated cells), or even differentiated cells.

[0063] In one embodiment of the method for producing differentiated cells of the present invention, (1) a step of preparing stem cells produced by the method of the present invention or a step of producing stem cells by the method of the present invention; (2) culturing the prepared cells in a differentiation-inducing medium; and (3) A step of culturing the cultured cells in a fine suspension culture in the medium of the present invention. A method for producing differentiated cells, comprising: is provided.

[0064] In yet another aspect, there is also provided a differentiated cell produced by the method for producing a differentiated cell of the present invention.

[0065] The step of culturing cells in suspension in the medium of the present invention may involve adding a scaffold material containing atelocollagen to the medium in advance and then culturing the cells in suspension in the medium, or may involve adding the scaffold material containing atelocollagen during cell culture. Furthermore, in the differentiated cell production method of the present invention, cells may be cultured in suspension in the medium of the present invention throughout the entire cell culture period, or only for a portion of the period. For example, in the differentiated cell production method of the present invention, the scaffold material containing atelocollagen may be removed when it is no longer needed, or the scaffold material and cells may be separated. Specifically, it is known that atelocollagen can be dissolved by adding 0.1% collagenase and treating the cells at 37°C for at least one hour. Therefore, in the production method of the present invention, collagenase may be added to the medium at any time, or the medium may be replaced with a medium containing collagenase.

[0066] The differentiated cells produced by the method for producing differentiated cells of the present invention are not particularly limited, and examples include osteoblasts, nerve cells, hepatocytes, smooth muscle cells, adipocytes, cardiac muscle cells, epithelial cells, retinal pigment epithelial cells, immune cells such as dendritic cells, and the like.

[0067] In one embodiment, the step of culturing cells in suspension in a medium of the present invention involves culturing stem cells in suspension in a differentiation-inducing medium containing a scaffold material containing atelocollagen. For example, in the process of inducing differentiation of stem cells into cardiomyocytes, 0.5 ng / ml BMP-4 is added to a medium (e.g., STEMdiff APEL Medium, STEMCELL) and, after one day, the medium is replaced with one containing 10 ng / ml BMP-4, 10 ng / ml Activin A, and 5 ng / ml bFGF. After four days, the medium is replaced with one containing 10 ng / ml VEGF and 150 ng / ml Dkk1. After eight days, the medium is replaced with one containing 10 ng / ml VEGF, 150 ng / ml Dkk1, and 10 ng / ml bFGF, allowing for the identification of autonomously beating cardiomyocytes. In clinical trials, for example, sheets of cardiac progenitor cells (CD15+, Isl-1+ progenitors) derived from human ES cells encapsulated in a fibrin patch have been reported (ClinicalTrials.gov Identifier: NCT02057900). Furthermore, a group led by Professor Yoshiki Sawa of Osaka University is developing and clinically applying a "myocardial sheet," in which iPS cell-derived cardiac cells are cultured in the form of a sheet and applied to the hearts of patients with heart failure to promote functional regeneration (http: / / www2.med.osaka-u.ac.jp / surg1 / technology / regenerative-medicine / ). Cells cultured using the present invention could also be used for this technique. Furthermore, examples of activities aimed at elucidating pathological conditions have been reported, such as the risk assessment of heart disease (ClinicalTrials.gov Identifier: NCT01517425, ClinicalTrials.gov Identifier: NCT01865981) using patient-derived heart disease model iPS cells (ClinicalTrials.gov Identifier: NCT02413450), and cells cultured using the present invention can also be used for this method.

[0068] For example, the differentiation induction process for chondrocytes can be carried out by culturing mesenchymal stem cells in a medium (90% α-MEM medium, 10% fetal bovine serum (FBS), 2 mM L-glutamine, and 0.1 μM dexamethasone). Furthermore, adding a differentiation inducer, such as retinoic acid, to the medium can differentiate stem cells into neural cells and other cells. Differentiation inducers such as BMP inhibitors, Wnt inhibitors, Nodal inhibitors, and retinoic acid can also be used. Megakaryocyte formation, required for the platelet differentiation induction process, can be achieved using factors such as thrombopoietin (TPO), interleukin 3 (IL3), interleukin 6 (IL6), and stem cell factor (SCF) via embryoid bodies induced in a serum-containing medium (20% FCS).

[0069] The contents of "1. Stem Cell Proliferation Promoting Agent and 2. Method for Producing Stem Cells" are all incorporated by reference for the contents of the culture vessel, starting stem cells, cell culture density, culture conditions, culture vessels and culture equipment, and suspension culture mode. In this case, "the production method of the present invention" should be read as "the production method of the present invention for differentiated cells," "stem cells" cultured in the medium of the present invention should be read as "stem cells, cells after differentiation induction, or cells in the process of differentiation," and "stem cells" produced should be read as "differentiated cells."

[0070] The differentiated cells may also be produced using a one-step system. For example, stem cells produced by the method of the present invention may be expanded in suspension culture while attached to a scaffold material, and then further cultured in suspension in a differentiation-inducing medium while maintaining the adherent state, thereby allowing the cells to proliferate and differentiate continuously on the scaffold material.

[0071] 4. Cellular medicine composition The present invention also provides a cell pharmaceutical composition (hereinafter, sometimes referred to as the "pharmaceutical composition of the present invention") containing stem cells or differentiated cells (hereinafter, sometimes referred to as the "cells of the present invention") produced by the production method of the present invention or the method for producing differentiated cells of the present invention. The cells of the present invention can be dispersed cells, cell populations that have formed cell clusters of a predetermined shape, or differentiated cell populations that have formed tissue structures or organelles (e.g., tissue construction using a bio-3D printer). Since cell pharmaceutical compositions can be used as a cell source for regenerative medicine, the pharmaceutical composition of the present invention can be used, for example, in cell transplantation therapy. The present invention also encompasses methods for treating or preventing disease, in which an effective amount of the cells of the present invention is administered or transplanted into a mammal (e.g., human, mouse, rat, monkey, cow, horse, pig, dog, etc.) that is the target of treatment or prevention. The cells of the present invention may be isolated from a scaffold material. Furthermore, if the scaffold material does not have a serious effect on the living body upon transplantation (e.g., one that is degraded in vivo, such as high-purity atelocollagen), the cells can be used in transplantation therapy while still attached to the scaffold material.

[0072] When using the cells of the present invention in cell transplantation therapy, it is desirable to use cells derived from iPS cells established from somatic cells with the same or substantially the same HLA genotype as the recipient individual, in order to avoid rejection. Here, "substantially the same" refers to HLA genotype matching to the extent that the immune response to the transplanted cells can be suppressed with immunosuppressants, e.g., somatic cells with an HLA type matching the three loci HLA-A, HLA-B, and HLA-DR, or four loci including HLA-C. When the cells are derived from a patient with a disease, it is preferable to repair the disease-causing genetic mutation in advance using techniques such as genome editing (e.g., CRISPR system, TALEN, ZFN, etc.). If sufficient cells cannot be obtained due to age or constitution, they can be transplanted in a state where they are embedded in capsules or porous containers made of polyethylene glycol or silicone to avoid rejection.

[0073] The cells of the present invention are prepared as parenteral preparations such as injections, suspensions, and infusions by mixing with a pharmaceutically acceptable carrier according to conventional methods. Therefore, in one embodiment, a method for producing a cell pharmaceutical composition is also provided, which includes a step of formulating the cells of the present invention. Such a method may include (1) a step of preparing stem cells produced by the method of the present invention or a step of producing stem cells by the method of the present invention, and / or (2) a step of preparing differentiated cells produced by the method of the present invention or a step of producing differentiated cells by the method of the present invention. The method may further include a step of preserving the stem cells or differentiated cells.

[0074] Pharmaceutically acceptable carriers that can be contained in such parenteral formulations include aqueous solutions for injection, such as physiological saline, isotonic solutions containing glucose or other adjuvants (e.g., D-sorbitol, D-mannitol, sodium chloride, etc.). The pharmaceutical composition of the present invention may be formulated with, for example, a buffer (e.g., phosphate buffer, sodium acetate buffer), a soothing agent (e.g., benzalkonium chloride, procaine hydrochloride, etc.), a stabilizer (e.g., human serum albumin, polyethylene glycol, etc.), a preservative, an antioxidant, etc. When the pharmaceutical composition of the present invention is formulated as an aqueous suspension, for example, about 1 × 10 6 ~Approx. 1×10 8 The cells can be suspended to a concentration of 1000 cells / mL. The amount of cells or pharmaceutical compositions of the present invention administered or transplanted and the number of administrations or transplants can be determined appropriately depending on the age, body weight, symptoms, etc. of the mammal to be administered.

[0075] The pharmaceutical composition of the present invention is provided in a frozen state stored under conditions typically used for cryopreserving cells, and can be thawed immediately before use. In this case, it may further contain serum or a serum substitute, an organic solvent (e.g., DMSO), etc. In this case, the concentration of the serum or serum substitute is not particularly limited, but may be about 1 to about 30% (v / v), preferably about 5 to about 20% (v / v). The concentration of the organic solvent is not particularly limited, but may be 0 to about 50% (v / v), preferably about 5 to about 20% (v / v).

[0076] The present invention will be described below with reference to examples, although the present invention is not limited to these examples. [Example]

[0077] (material and method) In the following examples, the following materials were used or the experiments were carried out according to the following methods, except where the methods are described in the examples.

[0078] <Reagents> StemFit AK03N was obtained from Ajinomoto Healthy Supply Co., Ltd. (Tokyo, Japan). iMatrix-511 was obtained from Matrixome Co., Ltd. (Osaka, Japan). CHIR 99021 (CT 99021) was obtained from Axon Medchem LLC (Reston, Virginia, USA). 10-mmol / L Y-27632 solution, D-PBS(-), and 0.5 mol / L EDTA solution (pH 8.0) were obtained from Nacalai Tesque (Kyoto, Japan). RPMI 1640 medium, B-27 without insulin, was used. TM , TrypL TM Select Enzyme (1X), GlutaMAX TMSupplements, troponin T, Cardiac Isoform Ab-1 (Clone 13-11), PSC cardiomyocyte differentiation kit, and PSC neuron induction medium were obtained from Thermo Fisher Scientific Co., Ltd. (Kanagawa, Japan). 100x non-essential amino acids (NEAA) were obtained from MP Biomedicals, LLC (Irvine, CA, USA). Recombinant human activin A was obtained from BioLegend, Inc. (San Diego, CA, USA). Recombinant human BMP-4 was obtained from PeproTech (Cranberry, NJ, USA). Kyoto Probe 1 (KP-1) was obtained from Goryo Chemical Co., Ltd. (Sapporo, Japan). Human GloLIVE TRA-1-60® NorthernLights TMThe antibody conjugated with NL557 was obtained from R&D Systems, Inc. (Minneapolis, Minnesota, USA). The peptide-GFOGER bioink was obtained from Sigma-Aldrich Co. LLC (St. Louis, Missouri, USA). The atelocollagen acidic solution (5 mg / mL, pH 3.0) and collagen (atelocollagen) microspheres were obtained from Takasaki Co., Ltd. (Tokyo, Japan). The low concentration Synthemax® II microcarrier, 10 g vial was obtained from Corning (Corning, New York, USA). The GLS250 gelatin solution (1.0 mg / g) was purchased from Nitta Gelatin Inc. (Osaka, Japan). Cytodex® 1 gamma and Cytodex® 3 gamma were obtained from GE Healthcare Bio-Sciences AB (Uppsala, Sweden). CultureSure® DMSO was obtained from Fujifilm Wako Pure Chemical Corporation (Tokyo, Japan). The PES membrane was obtained from Terumo Blood and Cell Technologies (Lakewood, Colorado, USA). TC-I 15 was obtained from Tocris Bioscience (Bristol, England). The GP antagonist-2A, NF023, NF449, and SB 225002 were obtained from Calbiochem (San Diego, California, USA). Dihydromunduletone was obtained from MedChemExpress LLC (Monmouth Junction, New Jersey, USA). VU6015929, Melesitnib (LY2801653) and DDR1-IN-1 were obtained from Selleck Chemicals LLC (Houston, Texas, USA).

[0079] <Maintenance culture of hiPSCs> The hiPSC lines 201B7 and 15M66 were established by Shinya Yamanaka (Kyoto University iPS Cell Research Foundation) and obtained from the Kyoto University iPS Cell Research Foundation (Kyoto, Japan). iPSCs were cultured using a published method (CiRA_Ff-iPSC_protocol_Eng_v140310) (https: / / www.cira.kyoto-u.ac.jp / j / research / img / protocol / Ff-iPSC-culture_protocol_E_v140311.pdf). The ABLE 5 mL Disposable Bioreactor and ABLE Bioreactor Magnetic Stir System Base 5 mL were obtained from ABLE (Tokyo, Japan). The Quantum (Terumo Biotechnology) operating procedure was performed according to the manufacturer's instructions and standard protocol. The coating material for the bioreactor was 100 mL of an acidic atelocollagen solution (5 mg / mL, pH 3.0) (Koken Co., Ltd., Tokyo, Japan). HE staining was performed at Biopathology Research Institute Co., Ltd. (Oita, Japan).

[0080] <Cell differentiation assay> Cardiomyocyte differentiation To induce differentiation into cardiomyocytes, hiPSCs were cultured in StemFit AK03N medium in 6-well plates and cultured on carriers until confluent using a PSC cardiomyocyte differentiation kit according to the manufacturer's instructions (Thermo Fisher Scientific Inc.). -Definitive endoderm differentiation To induce differentiation into definitive endoderm, hiPSCs were cultured in StemFit AK03N medium in 6-well plates until confluent, according to a previously published protocol (Si-Tayeb, K. et al., Hepatology 51, 297-305 (2010)). -Differentiation into neural progenitor cells To induce differentiation into neural progenitor cells, hiPSCs were cultured in StemFit AK03N medium in a 6-well plate according to the manufacturer's instructions (Thermo Fisher Scientific K.K.), and cultured on a carrier using PSC Neural Cell Induction Medium until confluent.

[0081] <Cell Proliferation Assay> Cell proliferation was measured using a Countess (Thermo Fisher Scientific K.K.).

[0082] <Maintenance Culture of Human Mononuclear Cells> Purified and characterized normal human PBMCs (10M cells / vial) from Japanese donors were obtained from FUJIFILM Wako Pure Chemical Corporation. To prepare the medium for human mononuclear cells, stem cell factor / c-Kit ligand (SCF; final concentration 50 ng / mL), thrombopoietin (TPO; final concentration 10 ng / mL), Flt3L (final concentration 20 ng / mL), IL-6 (final concentration 50 ng / mL), IL-3 (20 ng / mL), and G-CSF (10 ng / mL) were added to the mixed solution of Solution A and Solution B of StemFit AK03N (Ajinomoto Health Supply Co., Ltd., Tokyo, Japan). The following protocol is a method for culturing human peripheral blood mononuclear cells (PBMCs) and is a brief description of the procedure commonly performed in our laboratory. (1) Thaw a cryovial of normal human PBMCs in a 37 °C water bath for 1 minute. (2) Dissolve PBMCs in 5 mL of the mixed solution of Solution A and Solution B of StemFit AK03N and centrifuge the sample (5 minutes at 22 °C, 440 g). (3) After removing the supernatant, add 1 mL of the medium for human mononuclear cells, mix, and count the number of cells. In the case of this example, a total of 3 x 10 6 cells / mL were added to the medium for human mononuclear cells. (4) Seed the cells in a 24-well plate at a volume of 1 mL / well. (5) Incubate the cells at 37 °C, 5% CO2 for 5 days.

[0083] <hiPSC Establishment Protocol> hiPSCs were established using the TOKIWA-Bio SRV iPS-1 Vector, TOKIWA-Bio SRV iPS-2 Vector, TOKIWA-Bio SRV iPS-3 Vector, and TOKIWA-Bio SRV iPS-4 Vector according to the manufacturer's instructions (Tokiwa Bio Co., Ltd.). Briefly, 1 × 10 5 Cells were dispensed into microtubes and centrifuged (300 g x 5 min). After removing the supernatant, 10 μL of the vector included in the kit was added. Another 10 μL of human mononuclear cell culture medium was then added, and the solution was incubated at 37°C for 2 hours. Centrifugation was repeated (300 g x 5 min), followed by washing three times with human mononuclear cell culture medium. Culture was then initiated using human mononuclear cell medium, and 2 / 3 of the volume of StemFit AK03N medium was added on days 1, 3, 5, and 7 of culture. The medium was replaced with StemFit AK03N medium on days 9, 11, and 13 after the start of culture. Cell passage and colony picking were performed from day 15 of culture.

[0084] hiPSCs were established using CytoTune®-iPS 2.0 vector according to the manufacturer's instructions (ID Pharma Co., Ltd., Tokyo, Japan). Briefly, 1 × 10 5 The cells were dispensed into a microtube and centrifuged (300 g × 5 minutes). According to the data sheet provided with the kit, 7.14 μL of Tube KOS (orange cap), 6.66 μL of Tube KLF4 (red cap), and 10.00 μL of Tube C-MYC (white cap) were added to 2 mL of human mononuclear cell medium. A total of 1 × 10 cells were then cultured. 5 Cells were seeded onto a 6-well plate. Culture was initiated in human mononuclear cell medium supplemented with various vectors (MOI = 5). Next, 2 / 3 the volume of StemFit AK03N medium was added on days 1, 3, 5, and 7 of culture. On days 9, 11, and 13 of culture, the medium was replaced with StemFit AK03N medium. Cell passage and colony picking were performed from day 15 of culture.

[0085] Real-time polymerase chain reaction (PCR) and quantitative PCR (qPCR) arrays RNA was prepared using the SuperPREP II Cell Lysis & RT Kit for quantitative PCR (Toyobo Co., Ltd., Osaka, Japan) according to the manufacturer's instructions. Real-time PCR was performed using the StepOnePlus system (Life Technologies, Carlsbad, CA, USA). Luna Universal qPCR Master Mix (New England Biolabs Inc., Ipswich, MA, USA) was used according to the manufacturer's instructions. For mRNA expression analysis, TaqMan Array 96-Well FAST Plate (Human Stem Cell Pluripotency, Applied Biosystems) was used. TaqMan TM Fast Advanced Master Mix (Thermo Fisher Scientific) was used according to the manufacturer's instructions. Expression was calculated using the ΔΔCt method. Target gene expression was normalized by the expression of housekeeping genes. Primers were designed for human β-actin, OCT3 / 4, NANOG, SOX2, Brachyury (T), NKX2.5, troponin T (cTnT), SOX17, FOXA2, HNF4A, PAX6, MAP2, SOX1, CDH1, CDH2, integrin α5, and integrin β1. Gene names were obtained from the US National Library of Medicine NIH website (https: / / www.ncbi.nlm.nih.gov / pubmed / ). Human β-actin, OCT3 / 4, NANOG, SOX2, Brachyury (T), NKX2.5, troponin T (cTnT), SOX17, FOXA2, HNF4A, PAX6, MAP2, SOX1, CDH1, CDH2, integrin α5, and integrin β1 were designed using the Primer 3 Plus application (http: / / www.bioinformatics.nl / cgi-bin / primer3plus / primer3plus.cgi). Other primers were purchased from Takara Bio Inc. (Shiga, Japan).

[0086] The primers used for PCR are as follows: <Undifferentiated ES cells> Human OCT3 / 4 (NM_002701.4) 144 bp (Forward) GACAGGGGGAGGGGAGGAGCTAGG (SEQ ID NO: 1) (reverse) CTTCCCTCCAACCAGTTGCCCCAAAC (SEQ ID NO: 2) Human NANOG (NM_024865.2) 391 bp (Forward) CAGCCCCGATTCTTCCACCAGTCCC (SEQ ID NO: 3) (reverse) CGGAAGATTCCCAGTCGGGTTCACC (SEQ ID NO: 4) Human SOX2 (NM_003106.2) 151 bp (Forward) GGGAAATGGGAGGGGTGCAAAAGAGG (SEQ ID NO: 5) (reverse) TTGCGTGAGTGTGGATGGGATTGGTG (SEQ ID NO: 6)

[0087] <Mesoderm> Human Brachyury (T) (NM_001270484.1) 211 bp (Forward) GCTGAACTCCTTGCATAAGTATGAG (SEQ ID NO: 7) (reverse) CATCTCTTTGTGATCACTTCTTTCC (SEQ ID NO: 8) Human NKX2.5 (NM_001166175.1) 221 bp (Forward) GAAATTTTAAGTCACCGTCTGTCTC (SEQ ID NO: 9) (reverse) AGTAATGGTAAGGGATCCTCGTG (SEQ ID NO: 10) Human troponin T (cTnT) (NM_001001432.1) 238 bp (Forward) ATGAGCGGGAGAAGGAGCGGCAGAAC (SEQ ID NO: 11) (reverse) TCAATGGCCAGCACCTTCCTCCTCTC (SEQ ID NO: 12)

[0088] <Endoderm> Human SOX17 (NM_022454.3) 608 bp (Forward) CGCTTTCATGGTGTGGGCTAAGGACG (SEQ ID NO: 13) (reverse) TAGTTGGGGTGGTCCTGCATGTGCTG (SEQ ID NO: 14) Human FOXA2 (NM_153675.2) 216 bp (Forward) TGGGAGCGGTGAAGATGGAAGGGCAC (SEQ ID NO: 15) (reverse) TCATGCCAGCGCCCACGTACGACGAC (SEQ ID NO: 16) Human HNF4A (NM_000457.4) 239 bp (Forward) GAACAGGAGCTCTTAACTACAGTGG (SEQ ID NO: 17) (reverse) CTGTCAAGAGTCATGAATTCTCCTT (SEQ ID NO: 18)

[0089] <Ectoderm> Human PAX6 (NM_001604.4) 317 bp (Forward) ACCCATTATCCAGATGTGTTTGCCCGAG (SEQ ID NO: 19) (reverse) ATGGTGAAGCTGGGCATAGGCGGCAG (SEQ ID NO: 20) Human MAP2 (NM_001039538.1) 212 bp (Forward) CAGGTGGCGGACGTGTGAAAATTGAGAGTG (SEQ ID NO: 21) (reverse) CACGCTGGATCTGCCTGGGGACTGTG (SEQ ID NO: 22) Human SOX1 (NM_005986.3) 158 bp (Forward) ACTCTCTCTGAGGTTCTTTGACTGA (SEQ ID NO: 23) (reverse) AGCTTTTCATAGTCTGTGCCTCTAA (SEQ ID NO: 24)

[0090] <Epithelial marker genes> Human cadherin 1 (CDH1) (NM_004360.4) 191 bp (Forward) GCCACATCTTGACTAGGTATTGTCT (SEQ ID NO: 25) (reverse) GCAGCACTTTAGGCACTATTCTAAG (SEQ ID NO: 26) HA324529 (TJP1) (Forward) GCACGGGCATTGTTTAATGTC (SEQ ID NO: 27) (reverse) GGATTCAGTCCACAAAGGTGTTTAC (SEQ ID NO: 28) HA380619 (MUC1) (Forward) GAACTACGGGCAGCTGGACA (SEQ ID NO: 29) (reverse) CTGCCACCATTACCTGCAGAA (SEQ ID NO: 30) HA265338 (COL4A1) (Forward) CCAGGATTTATAGGCGAAATTGGA (SEQ ID NO: 31) (reverse) CATCTCTGCCAGGCAAACCTC (SEQ ID NO: 32) HA346490 (SDC1) (Forward) GGATCAGAGATGCACCACCM (SEQ ID NO: 33) (reverse) CCAGCAGATGAGCATGGTCAG (SEQ ID NO: 34)

[0091] <Mesenchymal marker genes> Human cadherin 2 (CDH2) (NM_001792.4) 219 bp (Forward) AGTGTTCCCAAGACAATTCAGTAAG (SEQ ID NO: 35) (reverse) GGGTTGATAATGAAGATACCAGTTG (SEQ ID NO: 36) HA283325 (VIM) (Forward) AACCTGGCCGAGGACATCA (SEQ ID NO: 37) (reverse) TCAAGGTCAAGACGTGCCAGA (SEQ ID NO: 38) HA333211 (FN1) (Forward) GGCCAGATGATGAGCTGCAC (SEQ ID NO: 39) (reverse) GGAGCAAATGGCACCGAGATA (SEQ ID NO: 40) Human integrin α5 (NM_002205.4) 229 bp (Forward) CTGCTACCTCTCCACAGATAACTTC (SEQ ID NO: 41) (reverse) GATCAGGTACTCGGGGTAATAAGAT (SEQ ID NO: 42) Human integrin β1 (NM_002211.3) 179 bp (Forward) CTGAAGACTATCCCATTGACCTCTA (SEQ ID NO: 43) (Reverse) GCTAATGTAAGGCATCACAGTCTTT (SEQ ID NO: 44) HA328103 (SNAI1) (Forward) CCAGTGCCTCGACCACTATG (SEQ ID NO: 45) (Reverse) TTAGAGTCCTGCAGCTCGCTGTA (SEQ ID NO: 46)

[0092] <Rho family protein signaling factor> HA311735 (CDC42) (Forward) TTGACTTCTGGGTCTTAAACTGCTG (SEQ ID NO: 47) (Reverse) CCATGGTGGGTCTGGAACTC (SEQ ID NO: 48) HA339862 (WASL) (Forward) GGAGTTCAGTCCAGGCATGAAG (SEQ ID NO: 49) (Reverse) TGCTCACAGTGCAGGATGGTAG (SEQ ID NO: 50) HA356749 (RAC1) (Forward) CCTGTAGTCGCTTTGCCTATTGA (SEQ ID NO: 51) (Reverse) AGGGTCCCACGCTGTATTCTC (SEQ ID NO: 52) HA342384 (CYFIP1) (Forward) TCCTGACGGACCACATCCTG (SEQ ID NO: 53) (Reverse) TCGGCCTCAATTTCGTCGTA (SEQ ID NO: 54) HA349400 (DIAPH1) (Forward) CCAGCTTCTGCCACGCTTTA (SEQ ID NO: 55) (Reverse) CCCATAGTCCAGATGAGATGCAC (SEQ ID NO: 56) HA390884 (RHOA) (Forward) CAGCTGCMGGTACTCTGGTGA (SEQ ID NO: 57) (reverse) CTCTGCCACAGCTGCATGAA (SEQ ID NO: 58) HA355736 (ROCK1) (Forward) TGCAACTGGAACTCAACCAAGAA (SEQ ID NO: 59) (reverse) GCTGGCCAACTGCATCTGAA (SEQ ID NO: 60) HA359025 (ROCK2) (Forward) GCAAGTCACTGCCGAGCTTC (SEQ ID NO: 61) (reverse) GCTGTCACACAGTGCTTATGTTCA (SEQ ID NO: 62) HA271276 (ROCK1P1) (Forward) ACAAATATCACAGGCTTCAGGGTTA (SEQ ID NO: 63) (reverse) TGTAGGCAAACCCGCGATA (SEQ ID NO: 64) HA102338 (DIAPH3) (Forward) CTCAGAGGCCTGTTCTGAAAGTTTG (SEQ ID NO: 65) (reverse) GGCGACTGGAGTCCTTGTTGA (SEQ ID NO: 66) HA368551 (PFN1) (Forward) CCATCGTGGGCTACAAGGA (SEQ ID NO: 67) (reverse) CAAGTGTCAGCCCATTCACGTAA (SEQ ID NO: 68) HA260170 (PFN2) (Forward) GTGTCCACGGAGGCACACTTA (SEQ ID NO: 69) (reverse) GGGTTGTTGATGAAGACAGTTGCTA (SEQ ID NO: 70) HA118642 (PFN4) (Forward) TGTGTGTAGCATCACCAGGTTTCA (SEQ ID NO: 71) (reverse) GGCAAA TCCATTCACCAGTGTTC (SEQ ID NO: 72) HA347617 (PFN5P) (Forward) ACCATGTACCTGCGCACCAA (SEQ ID NO: 73) (reverse) CTGTCCAATCACCACAAGCCTTA (SEQ ID NO: 74)

[0093] <Adhesion GPCR genes> HA339122 (GPRC5A) (Forward) AATTGGAGGTGGCAGCTTCAG (SEQ ID NO: 75) (reverse) GGGCCACAGMTTTCCMAGA (SEQ ID NO: 76) HA372963 (ADGRG1) (Forward) AGCTGCCTGGTGTCTGCTGTA (SEQ ID NO: 77) (reverse) AGCAAGGGCAATGCAGCTC (SEQ ID NO: 78) HA251255 (ADGRG2) (Forward) ATGAGGTACATACACTGCCGCTTC (SEQ ID NO: 79) (reverse) TGGGCCAGAGTGTACCAGTCATA (SEQ ID NO: 80) HA362862 (ADGRL2) (Forward) ATAAATGAGCCGGGCAGCTT (SEQ ID NO: 81) (reverse) CCATCAGTCTGCATCATTGATCTT (SEQ ID NO: 82) HA352953 (ADGRG6) (Forward) TGGCTCCAGCAGATGATGAGA (SEQ ID NO: 83) (reverse) CGTGAAAGCCAAGCTGGGTAA (SEQ ID NO: 84) HA161540 (ADGRF4) (Forward) GAGATGCTTTGAGGATGAGGATGTC (SEQ ID NO: 85) (reverse) TCCATTGGTTGGGCCTAGTGA (SEQ ID NO: 86)

[0094] <Housekeeping genes> Human β-actin (NM_001101.5) 223 bp (Forward) TGACATTAAGGAGAAGCTGTGCTAC (SEQ ID NO: 87) (reverse) CTTCATGATGGAGTTGAAGGTAGTT (SEQ ID NO: 88)

[0095] <Staining analysis> Live staining was performed using KP-1 (Goryo Chemical, Hokkaido, Japan) and AntiTRA-1-60, Mouse-Mono (TRA-1-60), NL557, and GloLIVE (R&D Systems, Inc., Minneapolis, MN, USA). Images were recorded using a BZ-X800 fluorescence microscope (Keyence Corporation, Osaka, Japan).

[0096] <Statistical analysis> Statistical analysis was performed using Student's t-test to compare the means of two samples. Comparisons between multiple groups (three or more groups) were performed using one-way analysis of variance using the StatPlus software program (AnalystSoft, Walnut, CA, USA). Statistical significance was set at *P < 0.05 or **P < 0.01 for all tests.

[0097] [Example 1: Establishment of iPS cells] The efficiency of human iPS cell establishment was compared using atelocollagen microcarriers and collagen microcarriers.

[0098] (method) Human mononuclear cells used for the establishment of human iPS cells were purchased from PRECISION (Human PBMC 93219, Lot 2010114001). Human mononuclear cells were cultured according to the "Research iPS Cell Establishment Protocol ver. 1.1" (available from the Kyoto University iPS Cell Research Foundation website: https: / / www.cira-foundation.or.jp / j / research / img / protocol / 20210507new_protocol_ver1_1.pdf). The protocol for establishing iPS cells using Sendai virus vectors is "SRV TM Protocol for inducing iPS cells from human peripheral blood mononuclear cells and monocytes using iPSC-2 Vector (TKB_P-003-02) (available from the Tokiwa Bio website: https: / / tokiwa-bio.com / jp / wp / wp-content / uploads / 2020 / 12 / 3_iPSC-2-Protocol-for-inducing-iPS-cells-from-human-peripheral-blood-monocytes-and-monocytes-using-iPSC-2-Vector) The study was carried out in accordance with the following procedure: Specifically, the following procedure was performed. (1) Prepare a medium for granulocytic cells by adding IL-6 (50 ng / mL), SCF (50 ng / mL), TPO (10 ng / mL), Flt3L (20 ng / mL), IL-3 (20 ng / mL), and G-CSF (10 ng / mL) to a mixture of solutions A and B of StemFit AK03 (Ajinomoto) medium. (2) Human mononuclear cells are 1.5 × 10 6 The cells were seeded into one well of a 24-well plate (Sumitomo Bakelite MS-80240) at a concentration of 1000 cells / mL and cultured in a medium for granulocytic cells. (3) Three days after seeding, the cells were harvested and diluted to 1.0 × 10 5 Dispense into cell / tubes (1.5 mL tubes) and centrifuge (300g x 5 min x 4°C). (4) Add 10 μL of SRV iPSC-2 vector (Tokiwa Bio S1011694A, Lot T002) to the cell pellet obtained after centrifugation. (5) Add 10 μL of granulocyte cell medium. (6) Leave the container in a CO2 incubator (37°C) for 2 hours. (7) Wash with granulocyte cell medium and centrifuge (repeat three times). (8) Culture in a medium for granulocyte cells, adding the microcarriers shown in the experimental conditions below. (9) After culturing in the granulocyte cell medium, on the 1st, 3rd, 5th, and 7th days, add a mixture of solutions A, B, and C of StemFit AK03 (Ajinomoto) medium (2 / 3 volume). (10) After culturing in the granulocytic cell medium, on the 9th, 11th, and 13th days, replace the medium with a mixture of solutions A, B, and C of StemFit AK03 (Ajinomoto) medium.

[0099] The experimental conditions for the microcarriers are as follows: Experimental conditions [1] Collagen microcarrier: Cytodex-3 (GE Healthcare) (dextran beads coated with denatured pig skin collagen on the surface) was added to 6 wells at a concentration of 300 μg (equivalent to 100,000 beads) / well. Experimental condition [2] Atelocollagen microcarrier: Atelocollagen-beads (MIC-00) (microcarrier for cell culture) (purity 95.5% or higher) were added to 6 wells at a concentration of 300 μg (equivalent to 100,000 beads) / well (approximately 1%).

[0100] (result) The results are shown in Table 1. Under experimental condition [1], the number of iPS cell colonies confirmed within five fields of view within the well 10 days after infection with the Sendai virus vector was 0,0,0,0,0 (average: 0 colonies / field of view). Under experimental condition [2], the number of iPS cell colonies confirmed within five fields of view within the well 10 days after infection with the Sendai virus vector was 1,1,3,1,1 (average: 1.4 colonies / field of view). Furthermore, under experimental condition [2], 15 days after infection with the Sendai virus vector, the colonies were confirmed to have produced pseudopodia using an optical microscope (×400), confirming that they were live iPS cell colonies (Figure 1). The cells were passaged once, and the results of cell counting on the 12th day are shown below. When the surface of the cell culture microcarrier was collagen, the total cell number was 1.76 × 10 4 cells / ml, number of living cells: 0.00×10 0 When the surface was atelocollagen, the total number of cells was 6.39 × 10 5 cells / ml, number of viable cells: 4.22×10 5 cells / ml (viable cell rate: 66%), confirming viability. To confirm that these cells were iPS cells, mRNA was extracted from a cell suspension containing 1 / 10 the amount of cells used for passage, and real-time PCR was performed to analyze the mRNA expression of iPS cell markers. The results confirmed the expression of iPS cell marker mRNA, including OCT3 / 4 (CT value: 20.94), NANOG (CT value: 20.93), SOX2 (CT value: 21.56), and β-actin (CT value: 17.37). Since there is a possibility that cell reprogramming may be strongly induced immediately after iPS cell establishment due to residual vectors that induce cell reprogramming, the cells were passaged six times after establishment, and the cells at passage 6 were then immunofluorescently stained with the iPS cell marker Tra-1-60 (Human GloLIVE TRA-1-60® NorthernLights). TM As a result, the cells established on atelocollagen were Tra-1-60 positive and were determined to be iPS cells.

[0101] [Table 1]

[0102] These results demonstrate that iPS cells cannot be established in a three-dimensional environment when the surface of the cell culture microcarrier is collagen, but that iPS cells can be established in a three-dimensional environment when the surface is atelocollagen.

[0103] Example 2: Proliferation of human iPS cells The proliferation of established iPS cells was tested using atelocollagen microcarriers. On the other hand, proliferation tests were not performed using collagen microcarriers: Cytodex-3 (GE Healthcare) because iPS cells could not be established. On the other hand, a culture experiment was performed using established human iPS cells using collagen microcarriers: Cytodex-3 (GE Healthcare), but the cells did not proliferate. (Human iPS cells and culture methods) Human iPS cells were cultured according to the "Protocol for Feeder-Free Establishment and Maintenance of Human iPS Cells (CiRA, Kyoto University)" (https: / / www.cira.kyoto-u.ac.jp / j / rESearch / img / protocol / hiPSprotocolFf_140311.pdf).

[0104] Experimental condition [3]: 5 mL of StemFit AK03 (Ajinomoto) containing 10 μM Y-27632 (Fujifilm Wako) was added to each well of a 6-well plate (FALCON 353046) at a concentration of 1.0 × 10 5 Atelocollagen beads (MIC-00) (microcarriers for cell culture) were mixed with the cells at a concentration of 300 μg (equivalent to 100,000 beads) / well together with a human iPS cell line (15M66) at a concentration of 15 cells / mL / well. The medium was not changed until day 6 after seeding. On day 6 after seeding, the cells were detached with trypsin-EDTA and counted.

[0105] (result) The results are shown in Table 2. The cell proliferation capacity in three-dimensional culture using cell culture microcarriers with atelocollagen as a scaffold was significantly higher than that in three-dimensional culture using a cell seeding amount (1.0 × 10 5 cells), the average number of cells on day 6 of culture was 2.4 × 10 6 These results indicate that atelocollagen microcarriers are a suitable scaffold material for 3D culture. It has been reported that when mouse iPS cells were cultured using Cytodex-3, the iPS cells only proliferated four-fold in seven days (Cytotechnology, 2016. 68. 45-59) (and it appears that proliferation occurred in the gaps between the beads, not on the surface of the beads), so the effect of atelocollagen microcarriers was more pronounced than that of conventional technologies.

[0106] [Table 2]

[0107] Example 3: Effects of gelatin, collagen, laminin, and atelocollagen coat concentrations and blend ratios on human iPS cell culture (evaluation of cell proliferation) (method) Human iPS cells were cultured using 201B7 according to the following method (CiRA, Kyoto University protocol: https: / / www.cira.kyoto-u.ac.jp / j / research / img / protocol / hipsprotocolFf_140311.pdf). The following three types of coating materials were used: (1) Gelatin (GLS250, Nitta Gelatin, 0.1% gelatin solution) (2) Native collagen (AteloCell® IAC-50, Koken, 5 mg / mL (=0.5%) native collagen acidic solution) (3) Atelocollagen (AteloCell® IPC-50, Koken, 5 mg / mL (=0.5%) atelocollagen acidic solution) A total of 200 μL of coating material was applied to a 6-well plate (Sumitomo Bakelite: MS-80060) using a cell scraper, and then the plate was left in a 37°C, 5% CO2 incubator for 24 hours. The coated wells were washed twice with 2 mL of PBS for 5 minutes before use. 5 × 10 4 Human induced pluripotent stem cells (201B7) at a concentration of 10 ...

[0108] (Coating conditions: volume %) (1) Gelatin 100.0% + Atelocollagen 0.0% (2) Gelatin 97.4% + Atelocollagen 2.6% (3) Gelatin 95.0% + Atelocollagen 5.0% (4) Gelatin 90.0% + Atelocollagen 10.0% (5) Gelatin 70.0% + Atelocollagen 30.0% (6) Gelatin 50.0% + Atelocollagen 50.0% (7) Gelatin 30.0% + Atelocollagen 70.0% (8) Gelatin 10.0% + Atelocollagen 90.0% (9) Gelatin 5.0% + Atelocollagen 95.0% (10) Gelatin 0.0% + Atelocollagen 100.0% (11) Native collagen 100.0% + atelocollagen 0.0% (12) Native collagen 97.4% + atelocollagen 2.6% (13) Native collagen 95.0% + atelocollagen 5.0% (14) Native collagen 90.0% + atelocollagen 10.0% (15) Native collagen 70.0% + atelocollagen 30.0% (16) Native collagen 50.0% + atelocollagen 50.0% (17) Native collagen 30.0% + atelocollagen 70.0% (18) Native collagen 10.0% + atelocollagen 90.0% (19) Native collagen 5.0% + atelocollagen 95.0% (20) Native collagen 0.0% + atelocollagen 100.0%

[0109] (result) The mass (mg) of each coating material contained in 100 mL of coating solution and the viable cell count on the fifth day after the start of cell culture [× 10 4 ]: Mean value ± standard deviation is shown in the table below.

[0110] [Table 3-1]

[0111] [Table 3-2]

[0112] These results showed that 100% atelocollagen produced the best cell proliferation. When the atelocollagen content was less than 98% in combination with gelatin, the number of viable cells was equal to or decreased compared to the number of seeded cells. It was revealed that the presence of atelocollagen on the scaffold surface provides an excellent cell proliferation-promoting effect on iPSCs, but this effect is impaired when other coating materials are present. Specifically, it was suggested that the effect is largely maintained when the proportion of other coating materials is less than 2%.

[0113] Example 4: Cultivation of hiPSCs using atelocollagen beads Currently, the production of clinical iPS cells is mainly achieved through 2D culture, in which the culture substrate is coated with a scaffold material from establishment to subsequent culture, but there are challenges in industrializing the production of clinical iPS cells for the purposes of mechanization and mass production. We investigated whether it is possible to establish and expand iPS cells using microcarriers that take advantage of the characteristics of both 2D and 3D culture.

[0114] iMatrix-511 (a recombinant peptide of the cell adhesion active site of laminin 511) is the most versatile culture scaffold material used for clinical human iPS cell (hiPSC) culture. In this study, we used iMatrix-511 coated (27.6 μl / 10 ml PBS) onto cell culture microcarriers Cytodex 1 (protein-adsorbing surface treated) and Cytodex 3 (collagen coated). Human mononuclear cell line 15M66 (a research line for clinical hiPSCs) was cultured at a cell concentration of 1 × 10 5Cell counts were obtained at 1, 2, 3, 4, 5, and 6 days after seeding at 100 cells / well (6-well plate). The results showed that the number of hiPSCs proliferated on the two types of iMatrix-511-coated beads was significantly lower than on the control plate (iMatrix-511-coated plate), indicating almost no cell proliferation (Figure 3A). The iMatrix-511 coating method was repeatedly tested through trial and error. We also evaluated the usefulness of various materials other than iMatrix-511 as scaffold materials. However, we were unable to culture hiPSCs while they remained attached to the beads. Therefore, we sought new biomaterials to which hiPSCs could attach. We found that atelocollagen, extracted by acid treatment from collagen, the source of gelatin used in feeder culture (Ludwig, TE et al., Nat Methods 3, 637-646 (2006); Takahashi, K. et al., Cell 131, 861-872 (2007)), induced extremely long filopodia of hiPSCs (Figure 11A, upper and lower panels). The long filopodia were strong enough to anchor atelocollagen and hiPSCs like a tent rope.

[0115] A plate coated with iMatrix-511 (9.2 μl / 1.5 ml PBS / well [6-well plate]) and atelocollagen beads (500 μl / well [6-well plate]) were prepared. The cell concentration was 1 × 10 5 The 15M66 cell line was seeded at 15 cells / well (6-well plate). Six days after seeding, the cells were detached and counted (Figure 3B, left). (Light microscope images from days 1 and 6 are shown in Figure 3B, right). The total cell number, live cell count, and dead cell count were comparable between cells cultured on iMatrix-511-coated plates and cells cultured on atelocollagen beads. Cells adhered to the iMatrix-511-coated plates and atelocollagen beads from the day after seeding and subsequently proliferated.

[0116] Next, we performed rotational culture (60 rpm) using a bioreactor, the most versatile 3D culture method (Figure 3D). 15M66 cells were cultured at a total concentration of 1 × 10 in Synthemax II (Corning; 500 μl / reactor; Singleuse bioreactor [IABLE]) and atelocollagen beads (500 μl / reactor). 5 Figure 3C shows optical micrographs of cells seeded 4 days after seeding. Under rotational culture conditions (60 rpm) in a bioreactor, cells attached to both Synthemax II and atelocollagen beads. Cell counts are shown in Figure 3F. The number of live and dead cells was comparable between cells cultured on Synthemax II and atelocollagen beads. Furthermore, mRNA expression analysis of cells cultured on a rotational culture (60 rpm) in a bioreactor confirmed that expression of the undifferentiated markers OCT3 / 4 and SOX2 was comparable between Synthemax II and atelocollagen beads. NANOG expression in cells cultured on atelocollagen beads was significantly lower than that in cells cultured on Synthemax II (Figure 3E). Atelocollagen beads with a bead concentration of approximately 3 million beads / 15 ml were mixed with beads with diameters of 100–400 μm. Next, we examined whether bead size affected cell adhesion and proliferation of hiPSCs. Four types of beads with diameters of 105 μm or less, 105-250 μm, 250-425 μm, and 425-600 μm were prepared, and cell adhesion of the 15M66 strain was shown in optical microscopy images (Figure 4A).

[0117] In this experiment, 105 μm diameter beads were thought to exert a constant compressive force on the cell cluster due to the small interbead spacing. The 15M66 and 201B7 strains were used with four different bead diameters: 105 μm or less, 105-250 μm, 250-425 μm, and 425-600 μm. Cell adhesion was observed with beads of all sizes. Cells were seeded into wells containing atelocollagen beads (500 μl / well [6-well plate]). Optical microscope images taken 5 days after cell seeding are shown (15M66 strain: left panel in Figure 4B; 201B7 strain: left panel in Figure 4C). Total cells, live cells, and dead cells were counted (15M66 strain: right panel in Figure 4B; 201B7 strain: right panel in Figure 4C). Both strains 15M66 and 201B7 grew better on larger diameter atelocollagen beads than on smaller beads. For strain 201B7, the total number of cells and viable cells cultured on 600 μm diameter atelocollagen beads was significantly higher than that cultured on 105 μm diameter atelocollagen beads. This result may be influenced by the amount of space between beads, the curvature angle of the bead surface, or the amount of medium flowing between the beads.

[0118] [Example 5: Verification of the undifferentiated potential of hiPSCs cultured on atelocollagen] 5×10 415M66 cells were seeded at a concentration of 15M66 cells / well (12-well plates) and cultured on iMatrix-511-coated plates (9.2 μl / well), atelocollagen-coated plates (atelocollagen with a purity of 95.5% or higher was applied to the plates; the same applies below) (200 μl / well), and gelatin-coated plates. Cells adhered to iMatrix-511- and atelocollagen-coated plates but not to gelatin-coated plates (Figure 5A). Cells on iMatrix-511- and atelocollagen-coated plates exhibited filopodia, with significantly more filopodia observed on atelocollagen-coated plates (Figure 5A, bottom center) than on iMatrix-511-coated plates (Figure 5A, bottom left). Cell counts were performed 4 days after cell seeding. 15M66 cells exhibited strong filopodia on atelocollagen-coated plates (Figure 5A). The cell count of hiPSCs cultured on iMatrix-511-coated plates was used as a control. The results showed that the total and viable cell counts of cells cultured on atelocollagen- and gelatin-coated plates were significantly lower than those on control plates. However, the levels of cell adhesion and proliferation of cells cultured on atelocollagen-coated plates were approximately half of those of cells cultured on iMatrix-511-coated plates (Figure 5B). This result indicates that iMatrix-511 is more active than atelocollagen in signaling pathways that promote cell proliferation.

[0119] 5 × 10 201B7 cells 4When cells were seeded at a concentration of 1000 cells / well, they adhered well to iMatrix-511- and atelocollagen-coated plates but hardly adhered to gelatin-coated plates (Figure 6A). Cells that adhered to atelocollagen-coated plates did not exhibit filopodia (Figure 6A, bottom middle panel). These results indicate that filopodia formation in response to atelocollagen varies depending on the cell's properties. Cells cultured on iMatrix-511-coated plates were counted 4 days after seeding as a control. The total number and viable cell counts of cells cultured on atelocollagen-coated plates were similar to those of cells cultured on iMatrix-511-coated plates, whereas the total number and viable cell counts of cells cultured on gelatin-coated plates were lower than those of cells cultured on iMatrix-511 (Figure 6B). This suggests that the 201B7 cell line suppresses filopodia formation on atelocollagen without inducing cell death (Figure 6B).

[0120] 5 × 10 15M66 cells were cultured on iMatrix-511-coated plates (9.2 μl / well) and atelocollagen-coated plates (1 ml (1 mg / ml) / well). 4Cells were seeded at a density of 1000 cells / well, and on day 5, cells were sampled and mRNA was extracted for mRNA expression analysis. mRNA expression levels were measured using TaqMan Human Stem Cell Pluripotency Arrays (Applied Biosystems, Waltham, MA, USA) (Avilion, AA et al., Genes Dev 17, 126-140 (2003); Chambers, I. et al., Cell 113, 643-655 (2003); International Stem Cell et al., Nat Biotechnol 25, 803-816 (2007); Matin, MM et al., Stem Cells 22, 659-668 (2004); Mitsui, K. et al., Cell 113, 631-642 (2003)). The types of mRNA were selected from the mRNA expression profiles of "Expression in undifferentiated cells," "Maintenance of pluripotency," "Correlation with stemness," "Differentiation markers," and "Control." First, to analyze the undifferentiated state, we analyzed "Correlation with stem cells (Figure 5C)," "Expression in undifferentiated cells (Figure 5D)," and "Maintenance of pluripotency (Figure 5E)." Cells cultured on iMatrix-511-coated plates were used as a control, and mRNA expression was color-coded. The results showed that cells cultured on atelocollagen-coated plates had higher expression of OCT3 / 4 (POU5F1) compared to the control (Figures 5D and 5E), indicating an overall undifferentiated state.

[0121] [Example 6: Verification of differentiation induction, epithelial-mesenchymal transition (EMT), and mesenchymal-epithelial transition (MET) in hiPSCs cultured on atelocollagen] To analyze the differentiation induction status, a heat map was created from the list of "differentiation markers" (Figure 7A). Cells cultured on iMatrix-511-coated plates were used as a control, and mRNA expression levels were color-coded. Cells cultured on atelocollagen-coated plates were confirmed to have increased expression of the endodermal markers AFP, SOX17, and Collagen Type I Alpha 1 Chain (COL1A1). Furthermore, expression of HBB, which is known to be expressed not only in hematopoietic stem cells but also in peripheral blood mononuclear cells (PBMCs) and has been reported to be upregulated in human blood-derived iPSCs (Joehanes, R. et al., Physiol Genomics 44, 59-75 (2012)), was also increased, as was expression of the ectodermal marker KRT1 (Figure 7A).

[0122] 5 x 10 15M66 cells 4 Cells were seeded at a concentration of 1000 cells / well onto iMatrix-511-coated plates (9.2 μl / well) and atelocollagen-coated plates (250 μl / well) and cultured. On day 4, samples were collected for mRNA extraction and analysis. mRNA expression of MET markers was examined. Cells cultured on atelocollagen showed a significant increase in E-cadherin expression compared with cells cultured on iMatrix-511. COL4A1 expression was significantly decreased, with no significant differences observed for other factors (Figure 7B). These results do not suggest that MET is induced in cells cultured on atelocollagen. The mRNA expression pattern of MET-related factors was similar in 201B7 cells (Figure 6C). The mRNA expression of EMT markers, including vimentin, fibronectin, α5 integrin, and β1 integrin, was significantly decreased (Figure 7C). These results suggest that EMT is not only not induced in cells cultured on atelocollagen, but is also difficult to induce under such culture conditions.

[0123] It is known that hiPSCs are unable to maintain an undifferentiated state due to environmental deterioration of culture conditions, and as they dedifferentiate, EMT-induced cells with high vimentin expression tend to appear around the colony. Therefore, it is speculated that culture materials that are less susceptible to EMT are better able to maintain undifferentiated cells. However, in the 201B7 line, only N-cadherin expression was significantly increased in cells cultured on atelocollagen, while the expression of fibronectin, β1 integrin, and Snail was significantly decreased (Figure 6D). These results also suggest that EMT was not induced in cells cultured on atelocollagen.

[0124] Recently, a fluorescent immunostaining method called Kyoto Probe 1 (KP-1) was reported to stain iPSC-like cells or tissue-specific progenitor cells generated by iPSC generation methods (Noguchi, H. et al., Mol Ther Methods Clin Dev 13, 243-252 (2019)) (Miyagi-Shiohira et al., Sci Rep 10, 18084 (2020)). 15M66 cells were cultured at 5 × 10 in iMatrix-511-coated (9.2 μl / well) or atelocollagen-coated (250 μl / well) plates. 4 Cells were seeded at a concentration of 1000 cells / well (12-well plate). Four days after cell seeding, the cells were fixed. Cells on iMatrix-511-coated and atelocollagen-coated plates were positive for both KP-1 (the most representative staining marker for iPSCs) (Figure 7D, top) and Tra-1-60 (the most representative specific antibody for iPSCs) (Figure 7D, bottom). These results indicated that the cells cultured on atelocollagen were iPSCs.

[0125] [Example 7: Establishment of hiPSCs on atelocollagen beads] SRV TMiPSC-1, 2, 3, and 4 (Tokiwa Bio Co., Ltd., Tsukuba, Japan) and CytoTune 2.0 (ID Pharma, Tokyo, Japan) are commercially available cell reprogramming Sendai virus vectors intended for use in establishing clinical iPSCs. However, these cell reprogramming Sendai virus vectors were developed for cells grown on cell culture plates and are optimized for establishing hiPSCs under 2D conditions. The spherical surface of atelocollagen beads provides a 3D environment, so we tested whether the above Sendai virus vectors could be used to establish hiPSCs in a 3D environment.

[0126] Mononuclear cells (1 × 10) isolated from human blood 5 pcs) to vector (SRV TM iPSC-2) were infected at a multiplicity of infection (MOI) of 3 and seeded into 6-well plates containing atelocollagen beads (spherical atelocollagen of 95.5% purity or higher; the same applies below) (500 μl / well) or Cytodex 3 (500 μl / well). On day 15 of culture, established hiPSC colonies were observed under an optical microscope. hiPSCs extended filopodia and attached to the atelocollagen beads (white arrows) (Figure 8A, left). In contrast, no colonies were formed on the surface of Cytodex 3 beads, and only cell clusters were observed detached from the microcarriers (white arrows) (Figure 8A, right). These results demonstrate the feasibility of establishing hiPSCs on atelocollagen beads.

[0127] Next, we compared the efficiency of hiPSC establishment on standard iMatrix-511-coated plates and on atelocollagen beads using five different hiPSC establishment vectors. TM Five vectors, iPSC-1, 2, 3, 4, and CytoTune 2.0, were used to compare the efficiency of hiPSC establishment on atelocollagen. The efficiency of hiPSC establishment was recorded by counting the number of colonies observed in the wells using light and fluorescence microscopes on day 14 after Sendai virus infection. Four of the five vectors (SRV TMFor all strains (except for iPSC-2), no significant difference in hiPSC establishment efficiency was observed between iMatrix-511-coated plates and atelocollagen beads (Figure 8B). The improved hiPSC establishment efficiency on iMatrix-511-coated plates was the reason for the significant difference in the relative efficiency of hiPSC establishment on atelocollagen beads. Consequently, we concluded that there was no significant difference in the establishment efficiency of hiPSCs on iMatrix-511-coated plates and atelocollagen beads.

[0128] Following standard hiPSC culture protocols, hiPSCs established on atelocollagen beads were detached with trypsin and then transferred to plates containing new atelocollagen beads (500 μl / well). To assess pluripotency after eight cell passages, mRNA was extracted from cardiomyocytes (Figure 8C), endodermal cells (Figure 8D), and neural progenitor cells (Figure 8E) on day 11 after differentiation induction, and their differentiation potential into three germ layers was assessed. Furthermore, cardiomyocyte maturation on atelocollagen beads was examined using the 201B7 cell line on day 8 after cardiomyocyte differentiation induction (Figure 9). As controls, iMatrix-511-coated plates (Figure 9, left panel) and atelocollagen-coated plates (Figure 9, center panel) were used. As a result, the 201B7 cell line was induced to differentiate into mature cardiomyocytes expressing troponin T on atelocollagen beads (Figure 9, right panel).

[0129] When producing clinical cells such as cardiomyocytes using conventional microcarriers, detachment of therapeutic cells from the microcarriers is a major problem. For some types of therapeutic cells (e.g., pancreatic islets), trypsin treatment is undesirable because it can disrupt cell-to-cell adhesion. Therefore, dissolving atelocollagen beads using collagenase is appropriate for securing differentiated cells as tissue. After adding collagenase (50 μl of a 1 g / 10 ml high-concentration solution per well [6-well plate]), atelocollagen beads completely disappeared within 30 minutes at temperatures ranging from room temperature to 37°C, without damaging intercellular adhesion (Figure 10).

[0130] [Example 8: Mechanism of cell adhesion of hiPSCs to atelocollagen via filopodia extension] Light microscopic observation of hiPSC cell adhesion to atelocollagen revealed that hiPSCs extended extremely long filopodia (white arrows) (Figure 11A). We investigated the behavior of proteins involved in signal transduction of the Rho family proteins, which are strongly involved in filopodia formation (Bar-Sagi, D., and Hall, A. Cell 103, 227-238 (2000); Heasman, SJ, and Ridley, AJ Nat Rev Mol Cell Biol 9, 690-701. (2008)) (Figure 12A). The key factors in filopodia formation are CDC42 and WASL. CDC42 is a key factor in inducing cytoskeletal reorganization, and WASL encodes the Wiskott-Aldrich syndrome protein (WASP). WASP acts downstream of CDC42 to form cellular filopodia (Thrasher, AJ, and Burns, SO Nat Rev Immunol 10, 182-192 (2010)). Thus, increased expression of CDC42 and WASL indicates activation of signaling pathways that lead to cytoskeletal reorganization and filopodia formation.

[0131] 5 × 10 201B7 cells 4Cells were seeded at a concentration of 1000 cells / well (12-well plates) and allowed to adhere to iMatrix-511-coated and atelocollagen-coated plates (Figure 12B). mRNA was extracted from the cells, and the expression of factors related to Rho family protein signaling was analyzed. The results showed that the expression of CDC42 and DIAPH3 was significantly increased in cells cultured on atelocollagen compared to cells cultured on iMatrix-511. Furthermore, the expression of Rac1, DIAPH1, ROCK2, ROCK1P1, Profilin (PFN)1, PFN2, and PFN5 was significantly decreased. These results suggest that in 201B7 cells cultured on atelocollagen, the signaling pathway for filopodia induction, including CDC42-DIAPH3, is activated, resulting in actin filament reorganization. However, expression of PFN43 and PFN44, which are required for filopodia formation from the plasma membrane upon adhesion to actin filaments, was low (Lee, CW et al., Curr Biol 23, 1046-1056 (2013); Romero, S. et al., Cell 119, 419-429 (2004)). Conversely, low expression of DIAPH1 may prevent activation of the signaling pathway for iPS cell-specific ROCK-mediated cell death induction. These findings suggest that 201B7 cells suppress filopodia formation on atelocollagen without inducing cell death (Figures 6A and 6B).

[0132] 5 x 10 15M66 cells 4Cells were seeded at a density of 1000 cells / well in 12-well plates and allowed to adhere to iMatrix-511-coated and atelocollagen-coated plates (Figure 12C). mRNA was extracted from the cells and the expression of factors involved in Rho family protein signaling was analyzed. CDC42-induced WASL expression was significantly increased in cells cultured on atelocollagen compared to cells cultured on iMatrix-511. PFN1 expression was also significantly decreased. These results suggest that the signaling pathway for filopodia formation in 15M66 cells cultured on atelocollagen is in a late or terminal phase of signaling activation for filopodia formation, since CDC42 activation has already converged while WASL activation remains. These results also suggest that atelocollagen promotes activation of the CDC42-WASP pathway in hiPSCs, inducing filopodia formation. Because CDC42 is also a protein strongly involved in cell polarity (Iden, S., and Collard, JG Nat Rev Mol Cell Biol 9, 846-859 (2008)), it is possible that cell polarity-related signals influenced the mechanism by which hiPSCs on atelocollagen beads were attached and cultured under 3D conditions.

[0133] To investigate the mechanism by which iPSC filopodia extend on atelocollagen, we first examined integrin α2β1, a receptor for collagen I, the main component of atelocollagen. TC-I 15, an integrin α2β1 inhibitor, was prepared as an additive reagent at 1 μg (dissolved in 0.1 μl of DMSO) or 10 μg (dissolved in 1 μl of DMSO). DMSO alone (0.1 μl, 1 μl) was prepared as a control. 2.5 × 10 415M66 cells (6-well plates) were seeded onto iMatrix-511-coated and atelocollagen-coated plates at a concentration of 15 cells / well with the reagent (Figures 11B and 11C). In wells treated with 1 μg or 10 μg of TC-I 15, cells on atelocollagen were observed as EB-like cell clusters on the surface of the atelocollagen by day 3 of culture (Figure 11B, bottom). In control wells treated with DMSO at the same volume as the diluted reagent, partial cell death occurred, but filopodia formation was observed (white arrows) (Figure 11B, top). This result indicates that the induction of filopodia formation by hiPSCs on atelocollagen is solely activated by signals from integrin α2β1. In contrast, in all wells treated with 0, 1, or 10 μg of TC-I 15, cells on iMatrix-511 adhered and formed short filopodia on day 3 (Figure 11C, bottom). This result indicates that the induction of filopodia formation by hiPSCs on iMatrix-511 is not activated solely by signals from integrin α2β1.

[0134] As mentioned above, hiPSCs cultured in atelocollagen did not induce EMT or MET (Figures 6C and 6D, 7B and 7C). It has been reported that type I collagen induces EMT through activation by two receptors: integrin α2β1 and Discoid in domain receptor family members (DDR) 1 and 2. This mechanism is explained by the fact that DDR receptors strongly enhance integrin α2β1 signaling, thereby causing cell invasion (Xu, H. et al., PLoS One 7, e52209 (2012)). Three DDR receptor inhibitors (VU6015929, merestinib, and DDR1-IN-1) were used. 2.5 × 10 415M66 cells were seeded at a concentration of 100 cells / well (6-well plates) onto iMatrix-511-coated and atelocollagen-coated plates along with DDR receptor inhibitors (VU6015929, merestinib, or DDR1-IN-1) (Figure 13). All DDR receptor inhibitors weakly inhibited cell proliferation at a reagent concentration of 1 μg / well, and strongly inhibited proliferation at 10 μg / well on both iMatrix-511-coated and atelocollagen-coated plates. However, none of the DDR receptor inhibitors suppressed the expression of filopodia on iMatrix-511-coated and atelocollagen-coated plates, nor did they inhibit cell morphology or cell adhesion (Figure 13). These results indicate that the mechanisms underlying DDR receptor signaling and atelocollagen-induced filopodia formation in hiPSCs are unrelated. However, even when cultured on plates coated with iMatrix-511 or atelocollagen, hiPSCs clearly expressed DDR receptors, and their inhibition suppressed cell proliferation.

[0135] These results demonstrate that atelocollagen-induced filopodia formation in hiPSCs is independent of DDR receptors and thus is a mechanism independent of EMT induction. Furthermore, we found that atelocollagen-induced filopodia formation in hiPSCs is driven by the signaling activity of integrin α2β1 alone. Type I collagen has been reported to activate self-renewal in mouse ES cells via integrin α2β1 and the DDR1-dependent Bmi-1 signaling. The results of this experiment, in which a DDR receptor inhibitor also inhibited hiPSC proliferation, suggest that not only iMatrix-511 but also atelocollagen may affect DDR receptor activity. The effect of atelocollagen on hiPSCs is shown in Figure 11. Integrin α2β1 extended filopodia, anchoring hiPSCs to atelocollagen like a tent rope, both under 2D conditions (Figure 11, left) and under 3D conditions (Figure 11, right). This promotes self-renewal of hiPSCs attached to atelocollagen.

[0136] The Rho family of GTPases is a family of small (approximately 21 kDa) signaling G proteins (El Masri, R., and Delon, J. Nat Rev Immunol 21, 499-513 (2021)). 15M66 cells were cultured at 2.5 × 10 4 Cells were seeded onto iMatrix-511-coated and atelocollagen-coated plates at a concentration of 1000 cells / well (6-well plates) along with a G protein inhibitor (NF023) (Figure 12A). Counting of viable cells attached to the plates revealed that NF023 did not alter cell adhesion, proliferation, or morphology of cells cultured on iMatrix-511- or atelocollagen-coated plates (light microscope images shown in Figure 13). This result indicates that G proteins play a relatively influential role in the filopodia extension of hiPSCs on atelocollagen.

[0137] [Example 9: Applicability to automatic culture equipment] Currently, automated clinical cell culture systems have evolved from traditional swivel bioreactors to hollow fiber membrane bioreactors, which are becoming the mainstream for clinical mesenchymal stem cell culture (Figure 14B). The advantage of hollow fiber membrane bioreactors over previous modalities is that they utilize the properties of hollow fiber membranes to provide both an inner (intracapillary; IC) space for cell culture and an outer (extracapillary; EC) space for oxygen supply and removal of cellular metabolic products such as lactate. This allows for advanced control of culture conditions.

[0138] However, the hollow fiber membranes used in cell bioreactors are primarily made of polyethersulfone (PES), which makes cell adhesion difficult with existing hiPSC biomaterials. The inventors discovered that the surface of PES has a liquid-permeable texture similar to a hybrid layer like tooth dentin. Atelocollagen is a highly fluid liquid at an acidic pH of 3, but solidifies into a jelly-like consistency when the pH is neutralized. Therefore, by injecting atelocollagen at pH 3 as a liquid into the textured areas of the PES membrane and neutralizing the PES membrane surface with phosphate-buffered saline (PBS) or culture medium, it is possible to create an atelocollagen hybrid layer on the PES membrane. In fact, when PES membranes were coated with atelocollagen using this method, the 15M66 cell line did not adhere to the PES membrane (Figure 14A, left), but did adhere to the atelocollagen-coated PES membrane (Figure 14A, right). The hollow fiber membranes of the bioreactor were coated with atelocollagen. 5 × 10 515M66 cells were seeded at a density of 1 / 4 and detached with collagenase after 4 days. Optical micrographs of harvested cells are shown (Figure 14C). IC and EC sections on day 7 of culture were stained with hematoxylin-eosin (HE). hiPSC colonies were identified (black arrows) (Figure 15). On day 7 of culture, the hollow fiber membranes in the bioreactor were removed and embedded in paraffin to prepare tissue sections for microscopic examination. Collagenase-assisted cell detachment maintained cell adhesion, allowing for sampling as cell clusters (cell viability: 80%).

[0139] mRNA was extracted for mRNA expression analysis. The types of mRNA measured using TaqMan Human Stem Cell Pluripotency Arrays (Applied Biosystems) were selected from the mRNA expression profiles of "expression in undifferentiated cells," "maintenance of pluripotency," "correlation with stemness," "differentiation markers," and "control." To analyze the undifferentiated state, we analyzed "correlation with stemness (Figure 14F)," "expression in undifferentiated cells (Figure 14D)," "maintenance of pluripotency (Figure 14E)," and "differentiation markers (Figure 14G)." Cells cultured on iMatrix-511-coated plates were used as a control, and mRNA expression was color-coded. The results revealed that cells cultured on atelocollagen-coated PES hollow fiber membrane bioreactors showed higher expression of OCT3 / 4 (POU5F1) (Figures 14D and 14E), indicating a tendency toward a more undifferentiated state overall. The 15M66 cell line cultured in atelocollagen-coated PES hollow fiber membrane bioreactors showed increased expression of LEFTY2 (Figure 14F), which is involved in left-right asymmetry of developing organs, and HBB (Figure 14G), which is highly expressed in hematopoietic stem cells. The mRNA expression patterns of cells cultured in these atelocollagen-coated PES hollow fiber membrane bioreactors were similar in many respects to those of cells cultured on atelocollagen-coated plates (Figures 5C, 5D, 5E, and 7A). [Industrial Applicability]

[0140] According to the present invention, stem cells can be efficiently produced and proliferated. This method includes a step of culturing cells in suspension, which facilitates automation and mass culture. Therefore, the present invention is extremely useful as a stem cell-based research tool or for producing safe stem cell-derived transplant cells that can be used in regenerative medicine.

Claims

1. A method for producing pluripotent stem cells, comprising the step of suspension culture of pluripotent stem cells in a culture medium containing atelocollagen and microcarriers released from a culture vessel.

2. The method according to claim 1, wherein the pluripotent stem cells are induced pluripotent stem cells.

3. The method according to claim 2, wherein the induced pluripotent stem cells are obtained by reprogramming floating cells.

4. The method according to claim 3, wherein the floating cells are hematopoietic cells.

5. The method according to claim 1, wherein the mass percentage concentration of atelocollagen in the microcarrier is 10% or more.

6. The method according to claim 1, wherein the mass percentage concentration of atelocollagen in the microcarrier is 95% or more.

7. The method according to claim 1, wherein the step of suspension culture of the pluripotent stem cells is performed using a culture apparatus.

8. A pluripotent stem cell proliferation promoter containing atelocollagen and microcarriers that are released from the culture vessel in the culture medium.

9. A step of preparing pluripotent stem cells produced by the method of any one of Claims 1 to 7, The steps include culturing the prepared cells in a culture medium for differentiation induction, and The process involves culturing the cultured cells in suspension culture in a culture medium containing atelocollagen and microcarriers released from the culture vessel. A method for producing differentiated cells, including

Images