Methods and Compounds

JP2025510019A5Pending Publication Date: 2026-03-19ATDBIO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
ATDBIO LTD
Filing Date
2023-03-20
Publication Date
2026-03-19

AI Technical Summary

Technical Problem

The prior art is difficult to ensure high purity when synthesizing polynucleotides in solid phase chemically. Especially in the synthesis of long-chain polynucleotides, insufficient coupling and degradation of nucleotides are prone to occur, resulting in difficulty in completely removing impurities of the product.

Method used

The purity of the polynucleotide is improved by photolytic separable tags during the polynucleotide synthesis process using terminal nucleotide units containing photolytic separable tags. This method increases the hydrophobicity of the polynucleotide by reacting with photolysis separable tags, thereby facilitating purification by high performance liquid chromatography (HPLC) and other technologies.

Benefits of technology

The purity of the polynucleotide is significantly improved, the purification process is simplified, and the risk of degradation of the product is reduced, and this method is suitable for industrial-scale polynucleotide synthesis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

Provided herein is a method for modifying a polynucleotide or an analog or derivative thereof, comprising reacting the polynucleotide or an analog or derivative thereof with a compound of formula (I): [Formula 1] TIFF2025510019000165.tif23114 (In the formula, R H , L 1 , #, R, n, and R P are as defined herein) Also provided are related methods of purifying a polynucleotide or an analog or derivative thereof, uses of the compounds of formula (I), and such compounds themselves.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] FIELD OF THEINVENTION The present invention relates to a method for modifying a polynucleotide or an analogue or derivative thereof. The present invention also relates to compounds for use in said method and modified polynucleotides produced thereby. The present invention also relates to a method for purifying a polynucleotide using the modification method disclosed herein, and to the use of the compounds defined herein for modifying and / or purifying a polynucleotide. The present invention also relates to a polynucleotide or a derivative or analogue thereof obtained by said method. [Background technology]

[0002] 2. Background of the Invention Polynucleotides are biopolymers that contain nucleotide monomer units and have applications in many different fields, including therapeutics, diagnostics, and research. Polynucleotides with customized nucleotide sequences can be synthesized in vitro, for example, using solution phase synthesis or solid phase synthesis.

[0003] Solid-phase chemical synthesis was developed in the 1960s and has many advantages over solution-phase synthesis. For example, reactions can be driven to completion quickly using excess solution-phase reagents, impurities and excess reagents can be thoroughly washed away to facilitate easy isolation of the growing polynucleotide without the need for purification between reaction steps, and the process is amenable to automation on computer-controlled solid-phase synthesizers. In solid-phase polynucleotide synthesis, typically, a polynucleotide or initial nucleoside / nucleotide monomer is bound to a solid support, and a series of reactions are carried out to extend the chain length of the support-bound polynucleotide / initial monomer, such that synthesis is carried out on the solid support. The solid support is typically fixed between filters in a synthesis column. While solution-phase reagents and solvents can flow freely through the column, the solid support and the compounds bound to it are fixed in place. The polynucleotide or initial nucleoside / nucleotide monomer is typically bound to the solid support using a linker.

[0004] While solid phase chemical synthesis of polynucleotides is well established and commercially used, significant problems remain.

[0005] One important problem faced with traditional synthetic routes is ensuring sufficiently pure synthetic polymers: polynucleotide synthetic pathways have many potential sources of impurities that are usually impossible to remove even with careful handling.

[0006] For example, one problem that may be encountered is the inefficient coupling of nucleotide monomers to the growing monomer chain. The inefficiency of the coupling reaction may increase with increasing chain length. It is common to address this capping of unreacted nucleotides at each step of the polymerization cycle (usually using acetic anhydride in N-methylimidazole), which prevents further reaction. Capping techniques mean that failures early in the polymerization reaction will greatly change the mass of the final product, and short oligonucleotides resulting from failures after only a small amount of monomer is incorporated into the chain can be easily separated from longer full-length oligomers. However, the longer the chain, the more difficult it becomes to separate capped truncated oligomers from the full-length desired product. In particular, it becomes increasingly likely that the terminal residue of a long polynucleotide chain is not the intended residue.

[0007] A further problem that can be encountered during polynucleotide synthesis is degradation, which can occur as a result of a variety of mechanisms, including the potential presence of degradative agents (whether chemical reagents or biological agents such as nucleases) in the reaction or product mixture.

[0008] An important source of degradation arises from the need to use protected functional groups in conventional synthesis. Such groups include, for example, DMT (4,4'-dimethoxytrityl). DMT is conventionally used in solid-phase polynucleotide synthesis to protect the 5'-OH group of nucleotide monomers as they are added to the growing polynucleotide chain (usually, though not exclusively, in the 3'→5' direction). However, harsh conditions are usually used to remove the DMT group, and the usual reagent for detritylation is trichloroacetic acid in dichloromethane. These conditions necessarily result in some amount of degradation of the polynucleotide product.

[0009] In an attempt to overcome this problem, two basic approaches have been adopted, both of which have problems.

[0010] One approach involves the removal of the DMT protecting group before the final purification of the synthesized polynucleotide. This means in principle that potential degradation products are removed, but in practice it is very difficult to completely purify the deprotected polynucleotide, especially relatively long oligonucleotides or polynucleotides that may have subtle damage. Even when methods such as reversed-phase or anion-exchange HPLC are used (the most commonly available methods in the commercial environment), the final purity is low.

[0011] An alternative approach has been termed "DMT-on" purification. In this approach, oligonucleotides or polynucleotides are synthesized with a terminal 5'-DMT group that is retained for purification. The presence of the 5'-DMT group increases the hydrophobicity of the full-length oligonucleotide compared to all failure sequences (which, as discussed above, do not have a 5'-DMT group because they are usually capped with acetic anhydride during synthesis). However, while purification can be effective, subsequent removal of the DMT group, which is required for most applications, can lead to further degradation of the desired product. For example, the acidic conditions used can lead to depurination.

[0012] Thus, there is a need for improved methods for purifying polynucleotides. Another challenge in polynucleotide synthesis is to effectively control the chemical nature of the terminal polynucleotides in the synthetic polymer. Depending on the application of the polynucleotide, various terminal modifications are required. In particular, for applications requiring extremely pure products (e.g., therapeutic applications), conventional approaches are insufficient.

[0013] For example, some applications require a terminal (e.g., 5') OH group. While such groups are easily achieved by conventional synthesis as discussed above, the available purity levels may be insufficient. Other applications, such as genome editing, require a terminal phosphate group. While a biological reagent such as a kinase can be used to convert the terminal OH group to a terminal phosphate, the need for such an additional reaction step after completion of the solid-phase synthesis is inefficient and may also lead to purity issues (e.g., if any contaminants are present in the kinase reagent mixture). Further applications also require "unnatural" terminal groups, such as alkyl and alkoxyl groups. For example, a common group used in many technical applications is the "C n spacer" (where n is an integer such as 3, 9, 12 or 18), which has the structure:

[0014] [ka]

[0015] (wherein "DNA" represents the remainder of the polynucleotide chain to which the C3 spacer is attached, e.g., via the 5' phosphate). It is a nucleotide analogue of

[0016] The need for diverse chemistry at the termini of synthesized nucleotides is a technical challenge. In particular, there is a need for methods to control the chemistry of the termini (e.g., -OH, -phosphate, or -other, e.g., -C3 spacer) compatible with extremely high purity synthesis.

[0017] A further approach that has been proposed is the use of photocleavable groups. Photocleavable linkers, or "photolabile" linkers, that undergo cleavage under light excitation are known. Photocleavable linkers have the advantage that the cleavage conditions are relatively mild, do not usually alter the structure of the polynucleotide product, and are orthogonal to the usual reaction conditions used during polynucleotide synthesis.

[0018] Previous attempts have focused on photocleavable linkers that contain carboxyl groups, which have typically focused on the use of ester or carbonate groups.

[0019] Although the above groups are photochemically cleavable, significant problems remain.For example, diester-containing linkers, such as succinate-based linkers, have the disadvantage that photocleavage of linkers usually does not generate free nucleotides in a single reaction step, but rather generates succinyl-functionalized nucleotides.Similarly, carbonate-containing linkers also generate carbonate-functionalized nucleotides.

[0020] Therefore, further reaction steps are then required to obtain the free (poly)nucleotide, adding to the complexity, cost and time required in the synthesis process. Harsh reaction conditions are usually required to remove the succinyl or carbonate group from succinyl- or carbonate-functionalized nucleotides. As a result, carbonate-containing photocleavable linkers have similar disadvantages as succinyl-based linkers, since the use of harsh reaction conditions increases the complexity of the equipment setup required for the synthesis reaction and may also limit the range of polynucleotides that can be synthesized. For example, it may not be possible to generate (poly)nucleotides with protected nucleobases, since the protecting groups of the nucleobases may be at least partially removed during the removal of the succinyl or carbonate group. Some attempts to utilize photocleavable groups in RNA synthesis have also been explored. For example, one approach explored the use of an acetal-bridged photocleavable linker with a nitrobenzene group conjugated with an alkyl diamide linker for selectively linking the terminal 2'-OH group of the RNA polymer with biotin for binding to streptavidin-functionalized beads to ensure successful strand synthesis. However, concerns remain. In particular, biotin-streptavidin capture is not suitable for large-scale oligonucleotide synthesis due to its inability to be scaled up and its prohibitive cost. Thus, there remains a need for methods to improve purification of solid-phase polynucleotide synthesis that are applicable at an industrial level.

[0021] The present invention aims to address some or all of these needs. Summary of the Invention [Problem to be solved by the invention]

[0022] Summary of the Invention The present inventors have recognised that current methods of solid phase polynucleotide synthesis require improvement. The present inventors have found that technical problems such as those outlined above can be addressed by incorporating a photocleavable purification tag into the terminal monomers used in polynucleotide synthesis.

[0023] The inventors have realized that the incorporation of suitable purification tags is a major challenge: to achieve sufficient purity, for example by HPLC, the tags incorporated need to be tightly bound to the polynucleotide and usually need to be quite large so as to have sufficient influence on the physical properties of the modified polynucleotide to allow effective separation of the modified from the unmodified polynucleotides.

[0024] However, even if purification tags can be incorporated, problems remain. Such tags usually cannot be left on the purified polynucleotide without hindering downstream applications, which is usually not commercially or technically acceptable. However, removing said tags by chemical or enzymatic methods is also problematic, since this process usually leads to the degradation of the purified polynucleotide, as outlined above. Thus, the problem of achieving sufficient purification of controllably modified polynucleotides on a commercially relevant scale remains unsolved to date.

[0025] In the course of extensive research, the inventors have recognized that certain photocleavable compounds can be used to modify polynucleotides. The inventors have designed compounds that allow polynucleotides to be efficiently and effectively modified to control the chemical nature of the polynucleotide termini and to reversibly incorporate hydrophobic groups that can be used to improve purification by techniques such as, for example, HPLC. While the invention was made in the context of polynucleotide purification, many other applications exist, as the modifications that can be made to polynucleotides according to the invention are not limited. [Means for solving the problem]

[0026] Thus, as described in more detail below, the present invention provides a method for modifying a polynucleotide or an analogue or derivative thereof, comprising modifying a polynucleotide or an analogue or derivative thereof such that the reactive functional group of said polynucleotide or analogue or derivative is a phosphorus-based group R P under conditions such that a compound of formula (I):

[0027] [ka]

[0028] (In the formula, - R H is a hydrophobic group, - L 1 is a linking group, -

[0029] [ka]

[0030] is a photolabile group, R is a modifying group; - n is an integer selected from 0 and 1; - R P is a phosphorus-based group) By reacting with H to the polynucleotide, or an analog or derivative thereof.

[0031] In some embodiments, the method further comprises converting a free hydroxyl group at the 5′ position of the polynucleotide or analog or derivative thereof to a phosphorus-based group R P In some embodiments, the method comprises reacting a free hydroxyl group at the 3′ position of the polynucleotide or analog or derivative thereof with a phosphorus-based group R P This includes reacting with

[0032] In some embodiments, R H is C1~C 20 Alkyl, C2-C 20 Alkenyl, C2-C 20 Alkynyl, C5-C 10 Carbocyclyl, C6~C 18 aryl, 5-10 membered heteroaryl, and 5-10 membered heterocyclyl; R H In some embodiments, R H is C4~C 16 Alkyl, C4-C 16 Alkenyl, C4-C 16 Alkynyl, C5-C 10 Carbocyclyl and C6-C 10 Aryl, preferably C5-C 12 alkyl; R H may be substituted, and is preferably unsubstituted.

[0033] In some embodiments, L 1 is (i) a chemical bond, and (ii) C1-C 20 Alkylene group, C2-C 20 Alkenylene group and / or C2-C 20 A linker comprising an alkynylene group, wherein the alkylene, alkenylene or alkynylene group is selected from the group consisting of a heteroatom, a phosphite group, a phosphate group, a carbonyl group, a C6-C 10 Aryl groups, C5-C10 In some embodiments, L is selected from the group consisting of a carbocyclyl group, a 5- to 10-membered heteroaryl group, and a 5- to 10-membered saturated or partially unsaturated heterocyclic group, which may be interrupted and / or terminated by one or more groups selected from the group consisting of a carbocyclyl group, a 5- to 10-membered heteroaryl group, and a 5- to 10-membered saturated or partially unsaturated heterocyclic group, which may be further substituted. 1 is a linker comprising (or selected from) a C1-C6 alkylene group, a C2-C6 alkenylene group and / or a C2-C6 alkynylene group, wherein the alkylene, alkenylene or alkynylene group is not limited to a heteroatom (preferably, the heteroatom is -O-, -S-, -SO-, -SO2-, -NR z -, -C(O)NR z (In the formula, R z is H or methyl), a carbonyl group, a phenyl group, a cyclopentyl or cyclohexyl group, a 5- to 6-membered heteroaryl group and a 5- to 6-membered saturated heterocyclic group may be interrupted and / or terminated by one or more groups selected from partially unsaturated heterocyclic groups, and said linkers may be further substituted.

[0034] In some embodiments, R P is a phosphoramidite, a phosphoramidate, an alkylphosphonamidite, or an alkylphosphonamidate. P is a phosphoramidite or an alkylphosphonamidite, preferably a phosphoramidite or a methylphosphonamidite, more preferably 2-cyanoethyl N,N-diisopropylphosphonamidite or N,N-diisopropylmethylphosphonamidite.

[0035] In some embodiments, R is (i) a nucleoside or a derivative or analog thereof, preferably a nucleoside; (ii) C1~C 20 Alkylene group, C2-C 20 Alkenylene group and / or C2-C 20A group containing an alkynylene group, wherein the alkylene, alkenylene or alkynylene group is selected from the group consisting of a heteroatom, a phosphite group, a phosphate group, a carbonyl group, a C6-C 10 Aryl groups, C5-C 10 a group, which may be interrupted and / or terminated by one or more groups selected from a carbocyclyl group, a 5- to 10-membered heteroaryl group, and a 5- to 10-membered heterocyclic group, and R may be further substituted, Preferably, the alkylene, alkenylene or alkynylene group is a group containing a C2-C6 alkylene group, a C2-C6 alkenylene group and / or a C2-C6 alkynylene group, and the alkylene, alkenylene or alkynylene group is not a heteroatom (preferably, the heteroatom is -O-, -S-, -SO-, -SO2-, -NR z -, -C(O)NR z (In the formula, R z is H or methyl), a carbonyl group, a phenyl group, a cyclopentyl or cyclohexyl group, a 5- to 6-membered heteroaryl group, and a 5- to 6-membered saturated or partially unsaturated heterocyclic group, optionally interrupted and / or terminated by one or more groups selected from the group consisting of a carbonyl group, a phenyl group, a cyclopentyl or cyclohexyl group, a 5- to 6-membered heteroaryl group, and a 5- to 6-membered saturated or partially unsaturated heterocyclic group, wherein R is optionally further substituted, and (iii) a second polynucleotide or a derivative or analog thereof, preferably the second polynucleotide is selected from.

[0036] In some embodiments, the compound of formula (I) is a compound of formula (II):

[0037] [ka]

[0038] (In the formula, R H , L 1 and R is as defined herein, -

[0039] [ka]

[0040] is a 2-nitrobenzyl group, and the 2-nitrobenzyl group is selected from halogen, optionally substituted C1-C4 alkyl, -OR a , -SR a , -NR a R a , -C(O)OR a , -C(O)NR a R a , -C(O)R b , -OC(O)R b and -NHC(O)R b and R a are each independently selected from hydrogen, optionally substituted C1-C2 alkyl, and optionally substituted C1-C2 alkoxyl; R b are each independently selected from hydrogen and an optionally substituted C1-C4 alkyl group; - R 3 is methyl, ethyl or C1-C2 haloalkyl; W is a group of the formula (W-2), an oxygen atom and a group of the formula (W-1):

[0041] [ka]

[0042] (In the formula, - R if n is 1 P is a phosphoramidite, phosphoramidate, alkylphosphonamidite, or alkylphosphonamidate; when n is 0, R P forms, together with the oxygen atom to which it is bonded, a phosphoramidite, a phosphoramidate, an alkylphosphonamidite, or an alkylphosphonamidate, The phosphoramidite, phosphoramidate, alkylphosphonamidite or alkylphosphonamidate is preferably a phosphoramidite or a methylphosphonamidite, more preferably 2-cyanoethyl N,N-diisopropylphosphonamidite or N,N-diisopropylmethylphosphonamidite, R P , Q is an oxygen atom or a sulfur atom, - R 2 are each independently selected from hydrogen, methyl, ethyl, C1-C2 haloalkyl, and halogen groups. (selected from As such, the photolabile group

[0043] [ka]

[0044] is the formula

[0045] [ka]

[0046] This is the part. In some embodiments, the compound of formula (II) is a compound of formula (II-3):

[0047] [ka]

[0048] (In the formula, R H , L 1 ,

[0049] [ka]

[0050] , R 2 , R 3 and Q is as defined herein; RP forms, together with the oxygen atom bound thereto, an alkylphosphonamidite, preferably a methylphosphonamidite, more preferably an N,N-diisopropylmethylphosphonamidite. wherein W is a group of formula (W-2) and n is 0.

[0051] In some embodiments, the compound of formula (II) is a compound of formula (II-1):

[0052] [ka]

[0053] (In the formula, R H , L 1 ,

[0054] [ka]

[0055] , and R 3 is as defined herein, and R P forms, together with the oxygen atom bound thereto, a phosphoramidite, a phosphoramidate, an alkylphosphonamidite or an alkylphosphonamidate, preferably a phosphoramidite, more preferably 2-cyanoethyl N,N-diisopropylphosphoramidite. where W is an oxygen atom and n is 0.

[0056] In some embodiments, the compound of formula (II) is a compound of formula (II-2):

[0057] [ka]

[0058] (In the formula, R H , L 1 ,

[0059] [ka]

[0060] , R 2 , R 3 , Q, and R are as defined herein; R P is a phosphoramidite, a phosphoramidate, an alkylphosphonamidite or an alkylphosphonamidate, preferably a phosphoramidite, more preferably 2-cyanoethyl N,N-diisopropylphosphoramidite. wherein W is a group of formula (W-1) and n is 1.

[0061] In some embodiments,

[0062] [ka]

[0063] , L 1 and R H is represented by formula (A-1) or formula (A-2):

[0064] [ka]

[0065] (In the formula, L 1 and R H is as defined herein, where - R 4 , R 5 , R 6 and R 7 each independently represents hydrogen, halogen, an optionally substituted C1-C4 alkyl, -OR a , -SR a , -NR a R a , -C(O)OR a , -C(O)NR a R a , -C(O)R b, -OC(O)R b and -NHC(O)R b Preferably, R 4 , R 5 , R 6 and R 7 each independently represents hydrogen, fluorine, an optionally substituted C1-C4 alkyl, -OR a , -SR a , -NR a R a , -OC(O)R b and -NHC(O)R b More preferably, R 4 , R 5 , R 6 and R 7 are hydrogen or methoxy, and R a and R b are as defined herein) are expressed together as

[0066] Also provided is a method for purifying a polynucleotide or an analog or derivative thereof, comprising the steps of: (i) increasing the hydrophobicity of a polynucleotide or an analogue or derivative thereof in a reaction mixture by modifying said polynucleotide or an analogue or derivative thereof as defined herein; (ii) separating the modified polynucleotide, or an analog or derivative thereof, from other components in the reaction mixture due to the hydrophobicity of the modified polynucleotide, or an analog or derivative thereof; (iii) optionally removing hydrophobic groups from the modified polynucleotide, or analogue or derivative thereof, by irradiating the modified polynucleotide, or analogue or derivative thereof, preferably with UV light of a wavelength of about 300 to about 500 nm. A method is also provided, including:

[0067] In some embodiments, a method for purifying a polynucleotide or its peptide nucleic acid (PNA) analog, glycerol nucleic acid (GNA) analog, threose nucleic acid (TNA) analog, or locked nucleic acid (LNA) analog comprises: (i) increasing the hydrophobicity of a polynucleotide or its peptide nucleic acid (PNA) analog, glycerol nucleic acid (GNA) analog, threose nucleic acid (TNA) analog, or locked nucleic acid (LNA) analog in a reaction mixture by modifying the polynucleotide or its peptide nucleic acid (PNA) analog, glycerol nucleic acid (GNA) analog, threose nucleic acid (TNA) analog, or locked nucleic acid (LNA) analog in accordance with the methods described herein; (ii) separating the modified polynucleotides or their peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA) or locked nucleic acid (LNA) analogs from other components in the reaction mixture according to the hydrophobicity of the modified polynucleotides or their peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA) or locked nucleic acid (LNA) analogs; (iii) optionally removing a hydrophobic group R from the modified polynucleotide or its peptide nucleic acid (PNA), glycerol nucleic acid (GNA) analog, threose nucleic acid (TNA) analog, or locked nucleic acid (LNA) analog by irradiating the modified polynucleotide or its peptide nucleic acid (PNA) analog, glycerol nucleic acid (GNA) analog, threose nucleic acid (TNA) analog, or locked nucleic acid (LNA) analog with light, preferably by irradiating the modified polynucleotide or its peptide nucleic acid (PNA) analog, glycerol nucleic acid (GNA) analog, threose nucleic acid (TNA) analog, or locked nucleic acid (LNA) analog with UV light having a wavelength of about 300 to about 500 nm. H Removal of A method is provided, comprising:

[0068] In some embodiments, step (ii) comprises separating the modified polynucleotide or analog or derivative thereof (preferably the modified polynucleotide or a peptide nucleic acid (PNA) analog, a glycerol nucleic acid (GNA) analog, a threose nucleic acid (TNA) analog, or a locked nucleic acid (LNA) analog) from other components in the reaction mixture using a chromatographic purification technique, preferably using high performance liquid chromatography, more preferably using reverse phase high performance liquid chromatography.

[0069] Furthermore, the compound of formula (I):

[0070] [ka]

[0071] (In the formula, R H , L 1 ,

[0072] [ka]

[0073] , R, n and R P are as defined herein) will also be provided.

[0074] In some embodiments, the compound of formula (II):

[0075] [ka]

[0076] (In the formula, R H , L 1 ,

[0077] [ka]

[0078] , R 3 , W, R, n and R P are as defined elsewhere in this specification) will also be provided.

[0079] In addition, the formula (I * ) group:

[0080] [ka]

[0081] (In the formula, R H , L 1 ,

[0082] [ka]

[0083] , R and n are as defined herein; - R P* is a phosphorus bond, - The wavy line indicates the point of attachment to the polynucleotide or its derivative or analogue. Also provided is a modified polynucleotide comprising:

[0084] In some embodiments, R P* is a phosphodiester bond, a phosphotriester bond, a phosphite-triester bond, a phosphite-diester bond, a phosphorothioate bond, a phosphorodithioate bond, an alkylphosphonate bond, or an alkylphosphonite bond, preferably a phosphite-triester bond or an alkylphosphonite bond, more preferably a phosphite-triester bond or a methylphosphonite bond, and / or a bond represented by the formula (I * ) group is attached to the 3' or 5' position of the polynucleotide or analog or derivative thereof, preferably to the 5' position of the polynucleotide or analog or derivative thereof.

[0085] Also, the group of formula (II):

[0086] [ka]

[0087] (In the formula, R H , L 1 ,

[0088] [ka]

[0089] , R 3 , W, R, and n are as defined elsewhere herein; R P is a phosphodiester bond, a phosphotriester bond, a phosphite-triester bond, a phosphite-diester bond, a phosphorothioate bond, a phosphorodithioate bond, an alkylphosphonate bond, or an alkylphosphonite bond, preferably a phosphite-triester bond or an alkylphosphonite bond, more preferably a phosphite-triester bond, or a methylphosphonite bond, at the 3' or 5' position, preferably at the 5' position, of said polynucleotide or its peptide nucleic acid (PNA) analogue, glycerol nucleic acid (GNA) analogue, threose nucleic acid (TNA) analogue, or locked nucleic acid (LNA) analogue. Also provided are modified polynucleotides comprising or their peptide nucleic acid (PNA) analogues, glycerol nucleic acid (GNA) analogues, threose nucleic acid (TNA) analogues, or locked nucleic acid (LNA) analogues.

[0090] Also provided is the use of a compound of formula (I) as defined herein for (i) modifying a polynucleotide or a derivative or analogue thereof, thereby optionally increasing the hydrophobicity of said polynucleotide or a derivative or analogue thereof, or (ii) purifying a polynucleotide or a derivative or analogue thereof.

[0091] The use may be (i) for optionally increasing the hydrophobicity of a polynucleotide or its peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA) or locked nucleic acid (LNA) analogue by modifying the polynucleotide or its peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA) or locked nucleic acid (LNA) analogue, or (ii) for purifying a polynucleotide or its peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA) or locked nucleic acid (LNA) analogue.

[0092] Further provided is a polynucleotide or a derivative or analogue thereof obtainable by the methods defined herein. [Brief description of the drawings]

[0093] [Figure 1] Comparison of oligonucleotide purity by purification using UPLC-MS followed by RP-HPLC. A: Synthesized oligonucleotide with a terminal monomer unit consisting of the compound of Example 2 (5'-PC C3). B: Synthesized oligonucleotide with a terminal monomer unit consisting of a non-photocleavable C3 phosphoramidite. The figure shows that a significantly improved purity was obtained through the use of the compound of Example 2 compared to the control. The results are described in the Examples. [Figure 2-1]Comparison of oligonucleotide purity after purification. A: oligonucleotide of SEQ ID NO: 1. B: oligonucleotide of SEQ ID NO: 2. C: oligonucleotide of SEQ ID NO: 2, corresponding to SEQ ID NO: 1 with a terminal monomer unit consisting of the compound of Example 1 (5'-PCPO3). D: oligonucleotide of SEQ ID NO: 4, corresponding to SEQ ID NO: 2 with a terminal monomer unit consisting of the compound of Example 1 (5'-PCPO3). The figure shows that a significantly improved purity was observed for SEQ ID NO: 3 vs. SEQ ID NO: 1, and SEQ ID NO: 4 vs. SEQ ID NO: 2. Thus, the figure demonstrates the significantly improved purity obtained through the use of the compound of Example 1, compared to the control. The results are described in the examples. [Figure 2-2] Comparison of oligonucleotide purity after purification. A: oligonucleotide of SEQ ID NO: 1. B: oligonucleotide of SEQ ID NO: 2. C: oligonucleotide of SEQ ID NO: 2, corresponding to SEQ ID NO: 1 with a terminal monomer unit consisting of the compound of Example 1 (5'-PCPO3). D: oligonucleotide of SEQ ID NO: 4, corresponding to SEQ ID NO: 2 with a terminal monomer unit consisting of the compound of Example 1 (5'-PCPO3). The figure shows that a significantly improved purity was observed for SEQ ID NO: 3 vs. SEQ ID NO: 1, and SEQ ID NO: 4 vs. SEQ ID NO: 2. Thus, the figure demonstrates the significantly improved purity obtained through the use of the compound of Example 1, compared to the control. The results are described in the examples. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0094] Detailed Description of the Invention definition The term "nucleosides, nucleotides, polynucleotides and derivatives and analogs thereof" includes nucleosides; derivatives of nucleosides; analogs of nucleosides; nucleotides; derivatives of nucleotides; analogs of nucleotides; polynucleotides; derivatives of polynucleotides; and analogs of polynucleotides.

[0095] As used herein, a "derivative" of a nucleoside, nucleotide, or polynucleotide is a modified form of the nucleoside, nucleotide, or polynucleotide that contains one or more chemical modifications to the phosphate backbone, sugar ring, or nucleobase of the DNA or RNA. A derivative of a nucleoside may thus be a chemically modified nucleoside, as described in more detail herein.

[0096] As used herein, a nucleoside, nucleotide, or polynucleotide "analog" is a compound that is structurally similar to a nucleotide, such as DNA and RNA, but contains modifications at one or more positions of the DNA or RNA, such as the phosphate backbone, sugar ring, or nucleobase. Nucleotide analogs include peptide nucleic acids (PNAs), glycerol nucleic acids (GNAs), threose nucleic acids (TNAs), locked nucleic acids (LNAs), and other synthetic polymers with nucleotide side chains.

[0097] Unless otherwise specified, the term "nucleoside" includes protected nucleosides, i.e., nucleosides modified to include protecting groups in their chemical structure. Unless otherwise specified, the term "nucleotide" includes protected nucleotides, i.e., nucleotides modified to include protecting groups in their chemical structure. Unless otherwise specified, the term "polynucleotide" includes protected polynucleotides, i.e., polynucleotides modified to include protecting groups in their chemical structure. The above protecting groups are usually distinguished from modifications that can be made to nucleotide derivatives for functional reasons, e.g., to change the properties of the nucleotide or polynucleotide.

[0098] As used herein and unless otherwise specified, the term "protecting group" refers to any suitable protecting group known in the art. Various protecting groups are suitable for protecting various chemical groups. For example, as used herein and unless otherwise specified, the term "hydroxyl protecting group" refers to any suitable protecting group known in the art for protecting hydroxyl groups. Similarly, as used herein and unless otherwise specified, the term "amine protecting group" refers to any suitable protecting group known in the art for protecting amine groups. Further, as used herein and unless otherwise specified, the terms "phosphate protecting group" and "phosphite protecting group" refer to any suitable protecting group known in the art for protecting phosphate and phosphite groups, respectively.

[0099] Suitable hydroxyl protecting groups include acetyl (Ac), benzoyl (Bz), benzyl (Bn), β-methoxyethoxymethyl ether (MEM), 4,4′-dimethoxytrityl (DMT), methoxymethyl ether (MOM), 4-monomethoxytrityl (MMT), levulinyl, 9-fluorenylmethyloxycarbonyl (Fmoc), p-methoxybenzyl ether (PMB), p-methoxyphenyl ether (PMP), methylthiomethyl ether, pivaloyl (Piv), tetrahydropyranyl (THP), tetrahydrofuran (THF), trityl (Tr), silyl ethers such as trimethylsilyl (TMS), tert-butyldimethylsilyl (TBDMS), tri-iso-propylsilyloxymethyl (TOM) and triisopropylsilyl (TIPS), methyl ether, ethoxyethyl ether, allyl ether and tert-butyl ether.

[0100] Suitable amine protecting groups include carbobenzyloxy (Cbz), p-methoxybenzylcarbonyl (Moz), tert-butyloxycarbonyl (BOC), 9-fluorenylmethyloxycarbonyl (Fmoc), acetyl (Ac), trifluoroacetyl, benzoyl (Bz), benzyl (Bn), benzylidene, trityl (Tr), carbamate, phthalimide, p-methoxybenzyl (PMB), 3,4-dimethoxybenzyl (DMPM), p-methoxyphenyl (PMP), trichloroethyl chloroformate (Troc), tosyl (Ts), nosyl, and 2-nitrophenylsulfenyl (Nps).

[0101] Suitable phosphate and phosphite protecting groups are alkyl groups, e.g. halogens, -OR a , -SR a , -NR a R a , -C(O)OR a , -C(O)NR a R a , -C(O)R b , -OC(O)R b , -NHC(O)R b and -CN, in particular methyl, ethyl and 2-cyanoethyl, preferably 2-cyanoethyl; o-chlorophenyl; and p-chlorophenyl.

[0102] As used herein, an alkyl group may be linear, branched or cyclic, but is preferably linear. 20 The alkyl group is a linear or branched alkyl group containing 1 to 20 carbon atoms. 20 The alkyl group is usually C1-C 10It is an alkyl group, for example a C1-C6 alkyl group, a C1-C5 alkyl group or a C1-C4 alkyl group. Suitable C1-C4 alkyl groups include methyl, ethyl, n-propyl, i-propyl, n-butyl, sec-butyl and tert-butyl. The C1-C4 alkyl group is preferably a C1-C3 alkyl group, more preferably ethyl or methyl. Unless otherwise specified, the alkyl group may be unsubstituted or substituted as described herein. For the avoidance of doubt, when two alkyl groups are present, the alkyl groups may be the same or different.

[0103] As used herein, an alkenyl group may be linear, branched or cyclic, but is preferably linear. An alkenyl group has one or more, for example one or two, usually one double bond. C2-C 20 The alkenyl group is a linear or branched alkenyl group containing 2 to 20 carbon atoms. 20 Alkenyl groups are usually C2-C 10 An alkenyl group, for example a C2-C6 alkenyl group, a C2-C5 alkenyl group or a C2-C4 alkenyl group. The C2-C4 alkenyl group is preferably a C2-C3 alkenyl group. C2-C4 alkenyl groups include ethenyl, propenyl and butenyl. Unless otherwise specified, an alkenyl group may be unsubstituted or substituted as described herein. For the avoidance of doubt, when two alkenyl groups are present, said alkenyl groups may be the same or different.

[0104] As used herein, an alkynyl group may be linear, branched or cyclic, but is preferably linear. An alkenyl group has one or more, for example one or two, usually one triple bond. C2-C 20 The alkynyl group is a linear or branched alkynyl group containing 2 to 20 carbon atoms. 20 Alkynyl groups are usually C2-C 10An alkynyl group, for example a C2-C6 alkynyl group, a C2-C5 alkynyl group or a C2-C4 alkynyl group. The C2-C4 alkynyl group is preferably a C2-C3 alkynyl group. C2-C4 alkynyl groups include ethynyl, propynyl and butynyl. Unless otherwise specified, an alkynyl group may be unsubstituted or substituted as described herein. For the avoidance of doubt, when two alkynyl groups are present, said alkynyl groups may be the same or different.

[0105] As used herein, an alkylene group is an unsubstituted or substituted bidentate moiety obtained by removing two hydrogen atoms from an alkane. The two hydrogen atoms may be removed from the same carbon atom or from different carbon atoms. As used herein, an alkylene group may be linear, branched or cyclic, but is preferably linear. C1-C 20 The alkylene group is a linear or branched alkylene group containing 1 to 20 carbon atoms. A C1-C2 alkylene group is usually a C1-C 10 It is an alkylene group, for example a C1-C6 alkylene group, a C1-C5 alkylene group or a C1-C4 alkylene group. Suitable C1-C4 alkylene groups include methylene, ethylene, n-propylene, i-propylene, n-butylene, sec-butylene and tert-butylene. The C1-C4 alkylene group is preferably a C1-C3 alkylene group, more preferably ethylene or methylene. Unless otherwise specified, an alkylene group may be unsubstituted or substituted as described herein. For the avoidance of doubt, when two alkylene groups are present, the alkylene groups may be the same or different.

[0106] As used herein, an alkenylene group is an unsubstituted or substituted bidentate moiety obtained by removing two hydrogen atoms from an alkene. The two hydrogen atoms may be removed from the same carbon atom or from different carbon atoms. As used herein, an alkenylene group may be linear, branched or cyclic, but is preferably linear. An alkenylene group has one or more, for example one or two, typically one double bond. C2-C 20 The alkenylene group is a linear or branched alkenylene group containing 2 to 20 carbon atoms. 20 The alkenylene group is usually C2-C 10 An alkenylene group, for example a C2-C6 alkenylene group, a C2-C5 alkenylene group or a C2-C4 alkenylene group. The C2-C4 alkenylene group is preferably a C2-C3 alkenylene group. C2-C alkenylene groups include ethenylene, propenylene and butenylene. Unless otherwise specified, an alkenylene group may be unsubstituted or substituted as described herein. For the avoidance of doubt, when two alkenylene groups are present, the alkenylene groups may be the same or different.

[0107] As used herein, an alkynylene group is an unsubstituted or substituted bidentate moiety obtained by removing two hydrogen atoms from an alkyne. As used herein, an alkynylene group may be linear, branched or cyclic, but is preferably linear. An alkynylene group has one or more, for example one or two, usually one triple bond. C2-C 20 The alkynylene group is a linear or branched alkynylene group containing 2 to 20 carbon atoms. 20 The alkynylene group is usually C2-C 10An alkynylene group, for example a C2-C6 alkynylene group, a C2-C5 alkynylene group or a C2-C4 alkynylene group. The C2-C4 alkynylene group is preferably a C2-C3 alkynylene group. C2-C4 alkynylene groups include ethynylene, propynylene and butynylene. Unless otherwise specified, an alkynylene group may be unsubstituted or substituted as described herein. For the avoidance of doubt, when two alkynylene groups are present, said alkynylene groups may be the same or different.

[0108] As used herein, a halogen is typically chlorine, fluorine, bromine or iodine, preferably chlorine, fluorine or bromine, more preferably chlorine or fluorine.

[0109] As used herein, C6-C 10 The aryl group is an aryl group having 6 to 10 carbon atoms, such as phenyl or naphthyl, preferably phenyl. The aryl group or moiety may be substituted or unsubstituted as described herein.

[0110] As used herein, C5-C 10 The carbocyclyl group is C5, C6, C7, C8, C9 or C 10 and preferably cyclopentyl or cyclohexyl. Typically, the cycloalkyl group is substituted with up to three substituents, for example one or two substituents, or unsubstituted.

[0111] As used herein, a 5-10 membered heteroaryl group is a 5-10 membered ring system in which the ring is fully unsaturated and aromatic and contains at least one heteroatom. Typically, the ring contains up to 3 or 4 heteroatoms, for example 1 or 2 heteroatoms, selected from O, N and S. Thus, a 5-10 membered heteroaryl group is typically a 5-10 membered aromatic ring containing 1, 2 or 3 heteroatoms selected from O, N and S. Preferably, the heteroatoms are selected from O and N. Suitable heteroaryl groups include, for example: Monocyclic 5- to 7-membered heteroaryl rings, such as furanyl, oxepinyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridinyl, pyridazinyl, pyrimidinyl, pyrazinyl, triazinyl, azepinyl, thiophenyl, oxepinyl, and thiepinyl; and Bicyclic 8-10 membered heteroaryl rings, such as benzofuranyl, indolyl, isoindolyl, indolizinyl, indazolyl, benzimidazolyl, azaindolyl, azaidazolyl, purinyl, benzoxazolyl, benzoisoxazolyl, benzothiazolyl, benzoisothiazolyl, benzothiadiazolyl, quinolinyl, isoquinolinyl, quinolizinyl, quinoxalinyl, phthalazinyl, quinazolinyl, cinnolinyl, naphthyridinyl, pteridinyl and benzothiophenyl, preferably benzofuranyl, indolyl, isoindolyl, quinolinyl and isoquinolinyl. Examples include:

[0112] Preferably, the 5-10 membered heteroaryl group is a monocyclic 5-7 membered heteroaryl ring selected from furanyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, oxazolyl, isoxazolyl, pyridinyl, pyridazinyl, pyrimidinyl and pyrazinyl.

[0113] As used herein, a 5-10 membered saturated heterocyclic group is a 5-10 membered saturated ring system, the ring containing at least one heteroatom. Typically, the ring contains up to 3 or 4 heteroatoms, such as 1 or 2 heteroatoms, selected from O, S and N. Thus, a 5-10 membered saturated heterocyclic group is a 5-10 membered ring, usually containing 1, 2 or 3 heteroatoms selected from O, S and N. Suitable saturated heterocyclic groups include, for example, monocyclic 5- to 8-membered saturated rings, more preferably 5- to 7-membered rings, such as tetrahydrofuranyl, piperidinyl, oxazolidinyl, morpholinyl, thiomorpholinyl, pyrrolidinyl, dioxolanyl, piperidonyl, azepanyl, oxepanyl, piperazinyl, tetrahydropyranyl, and 1,4-diazepanyl, more preferably pyrrolidinyl, morpholinyl, piperazinyl, tetrahydropyranyl, piperidinyl, azepanyl, and 1,4-diazepanyl.

[0114] As used herein, a 5-10 membered partially unsaturated heterocyclic group is a 5-10 membered ring system in which the ring contains at least one unsaturated bond and at least one heteroatom, but the ring is not fully unsaturated or aromatic. Typically, the ring contains up to 3 or 4 heteroatoms, such as 1 or 2 heteroatoms, selected from O, N and S. Thus, a 5-10 membered partially unsaturated heterocyclic group is typically a 5-10 membered ring containing 1, 2 or 3 heteroatoms selected from O, N and S. Preferably, the heteroatoms are selected from O and N. Suitable partially unsaturated heterocyclic groups include, for example: monocyclic partially unsaturated 5- to 7-membered heterocyclic rings, such as dihydrofuranyl, pyranyl, dihydropyranyl, dioxinyl, dihydrooxepinyl, tetrahydrooxepinyl, pyrrolinyl, pyrazolinyl, imidazolinyl, dihydrooxazolyl, dihydroisoxazolyl, dihydrothiazolyl, dihydroisothiazolyl, dihydropyridinyl, tetrahydropyridinyl, dihydropyridazinyl, tetrahydropyridazinyl, dihydropyrimidinyl, tetrahydropyrimidinyl, dihydropyrazinyl, tetrahydropyrazinyl, oxazinyl, dihydrooxazinyl, thiazinyl, dihydrothiazinyl, dihydroazepinyl, tetrahydroazepinyl, dihydrothiophenyl, thiopyranyl, dihydrothiopyranyl, dihydrothiepinyl, and tetrahydrothiepinyl; and Bicyclic partially unsaturated 8-10 membered heterocyclic rings, such as dihydrobenzofuranyl, dihydroisobenzofuranyl, benzopyranyl, dihydrobenzopyranyl, benzodioxolyl, indolinyl, isoindolinyl, dihydroquinolinyl, tetrahydroquinolinyl, benzoxazinyl, dihydrobenzothiophenyl and benzodithiol; preferably dihydrobenzofuranyl, benzopyranyl, dihydrobenzopyranyl, benzodioxolyl, indolinyl, isoindolinyl, dihydroquinolinyl and tetrahydroquinolinyl. Examples include:

[0115] Preferably, the 5-10 membered partially unsaturated heterocyclic group is a monocyclic partially unsaturated 5-7 membered ring selected from dihydrofuranyl, pyranyl, pyrrolinyl and oxazinyl.

[0116] The heterocyclic and / or heteroaryl groups may be substituted or unsubstituted. Each ring atom may be unsubstituted or may have one or two substituents. The nitrogen atom may be disubstituted to be a positively charged heteroatom. The sulfur atom may be substituted to be a positively charged heteroatom. Typically, a heterocyclic or heteroaryl group has up to three substituents, for example one or two substituents. The heterocyclic or heteroaryl ring may be connected to the rest of the molecule by a bond at any available ring position of the heterocyclic or heteroaryl ring.

[0117] As used herein, an optionally substituted group, unless otherwise specified, includes halogens such as chlorine and / or fluorine, cyano groups, -OR x , -SR x , -NR x R x , -C(O)OR x , -C(O)NR x R x , -C(O)R x and may be substituted with suitable substituents, which may include C1-C4 alkyl groups such as methyl and / or ethyl, the C1-C4 alkyl substituents being themselves either unsubstituted or substituted with 1 to 3 halogen atoms. x are each independently selected from hydrogen and a C1-C4 alkyl group that is unsubstituted or substituted with one, two or three halogen groups. The optional substituents are preferably hydroxyl groups, halogens such as chlorine or fluorine, or C1-C4 alkyl groups such as methyl or ethyl.

[0118] Unless otherwise specified, the above also includes known ionic, salt, solvate, and protected forms of these substituents. For example, a reference to a carboxylic acid, carboxyl group, or carboxyl group (-COOH) also includes its anionic (carboxylate) form (-COO - ), a salt or solvate, as well as conventional protected forms. Similarly, a reference to an amino group includes the protonated form (-N+ HR 1 R 2 ), a salt or solvate of an amino group, such as a hydrochloride salt, as well as conventional protected forms of an amino group. Similarly, a reference to a hydroxy or hydroxyl group (-OH) also includes its anionic form (-O - ), salts or solvates, as well as conventional protected forms. Salts include salts formed with acids and bases. Suitable acids include both inorganic acids, such as hydrochloric acid, sulfuric acid, phosphoric acid, diphosphoric acid, hydrobromic acid or nitric acid, and organic acids, such as oxalic acid, citric acid, fumaric acid, maleic acid, malic acid, ascorbic acid, succinic acid, tartaric acid, benzoic acid, acetic acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid or p-toluenesulfonic acid. Suitable bases include alkali metal (e.g., sodium or potassium) and alkaline earth metal (e.g., calcium or magnesium) hydroxides, as well as organic bases, such as alkylamines, aralkylamines, and heterocyclic amines. Hydrochloride and acetate salts, especially hydrochloride salts, are preferred. When intended for use in pharmaceutical applications, the salts of the compounds provided herein may preferably be pharma- ceutically acceptable salts.

[0119] As used herein, a phosphoramidite group is a group of the structure -OP(NR2)(OR), where each of the R groups can be the same or different, but is typically an optionally substituted hydrocarbyl group. Typically, the R group of the OR moiety is hydrogen, a lone pair of electrons resulting in a negative charge, a phosphate protecting group or a phosphite protecting group. More often, the R group of the OR moiety is hydrogen, a lone pair of electrons resulting in a negative charge, o-chlorophenyl, p-chlorophenyl, or a halogen, -OR a , -SR a , -NR a R a , -C(O)OR a , -C(O)NR a R a , -C(O)R b , -OC(O)R b , -NHC(O)R b and -CN (wherein R a and Rb are independently H or methyl). More preferably, the R group of the OR moiety is hydrogen, a lone pair resulting in a negative charge, o-chlorophenyl, p-chlorophenyl, a methyl group, or a 2-cyanoethyl group. Alternatively, the R group is a C1-C4 alkyl group optionally substituted with one, two, or three groups independently selected from the group consisting of C1, C2, C3, C4, C4, C5, C6, C7, C8, C9, C10, C11, C12, C13, C14, C15, C16, C17, C18, C19, C20, C21, C22, C23, C24, C25, C26, C27, C28, C29, C30, C31, C32, C33, C34, C35, C36, C37, C38, C39, C41, C42, C43, C44, C55, C56, C57, C68, C79, C81, C82, C83, C84, C85, C86, C87, C88, C89, C91, C92, C93, C94, C95, C96, C97, C98, C99, C101, C112, C123, C132, C142, C153, C154, C165, C176, C186, C197, C198, C199, C229, C232, C243, C254, C356, C365, C47, C48, C59, C69, C70, C71, C72, C73, C74, C75, C86, C97, C98, C101, C112, C123, C 1-4 Alkyl, C 2-4 Alkenyl, or C 2-4 Alkynyl groups, typically optionally substituted C 1-3 The group may be an alkyl group, such as methyl, ethyl, or isopropyl, which may be substituted with CN, etc. In most cases, the phosphoramidite group used herein has the structure -OP(N i Pr2)(OCH2CH2CN) is the OCEP group.

[0120] As used herein, a phosphoramidate group is an oxidized phosphoramidite of the structure -OP(O)(NR2)(OR).

[0121] As used herein, a phosphonamidite group is a group of the structure -OP(NR)(R), where each R group may be the same or different and is an optionally substituted hydrocarbyl group, such as an optionally substituted C 1-4 Alkyl, C 2-4 Alkenyl, or C 2-4 Alkynyl groups, typically optionally substituted C 1-3 Alkyl groups, such as methyl, ethyl, or isopropyl, which groups may be substituted with CN, etc. In many cases, the phosphonamidite groups used herein have the structure -OP(N i Pr2)(Me) is a methylphosphonamidite.

[0122] As used herein, a phosphonamidate group is an oxidized phosphonamidite having the structure -OP(O)(NR2)(R).

[0123] A compound may exist in one or more particular geometric, optical, enantiomeric, diastereomeric, epimeric, atropic, stereoisomeric, tautomeric, conformational, or anomeric forms, including, but not limited to, cis and trans forms; E and Z forms; c, t, and r forms; endo and exo forms; R, S, and meso forms; D and L forms; d and l forms; (+) and (-) forms; keto, enol, and enolate forms; syn and anti forms; synclinal and anticlinal forms; α and β forms; axial and equatorial forms; boat, chair, twisted, envelope, and half-chair forms; and combinations thereof, hereinafter collectively referred to as "isomers" (or "isomeric forms"). Unless otherwise specified, a reference to a particular compound includes (wholly or partially) all such isomeric forms, including its racemic and other mixtures. Methods for the preparation (e.g., asymmetric synthesis) and separation (e.g., fractional crystallization and chromatographic methods) of such isomeric forms are either known in the art or readily obtainable by employing known methods in known procedures.

[0124] Unless otherwise specified, a reference to a particular compound or complex also includes ionic, salt, solvated and protected forms.

[0125] Methods for modifying polynucleotides In some embodiments, the present invention provides a method of modifying a polynucleotide or an analog or derivative thereof, the method comprising: modifying a polynucleotide or an analog or derivative thereof such that the reactive functional group of the polynucleotide or analog or derivative is a phosphorus-based group R P under conditions such that a compound of formula (I):

[0126] [ka]

[0127] (In the formula, - R His a hydrophobic group, - L 1 is a linking group, -

[0128] [ka]

[0129] is a photolabile group, R is a modifying group; - n is an integer selected from 0 and 1; - R P is a phosphorus-based group) By reacting with H to the above polynucleotide or its analog or derivative.

[0130] The application of the above method is not limited, but finds particular application in the purification of polynucleotides or their analogs or derivatives. Thus, in some embodiments, the above method is a method for purifying polynucleotides or their analogs or derivatives. For example, the hydrophobic group R H can be used to facilitate purification, for example, by HPLC (e.g., reverse phase HPLC) or other methods, as described in more detail herein.

[0131] As described in more detail below,

[0132] [ka]

[0133] is a photolabile group.

[0134] [ka]

[0135] Photocleavage of results in a modified polynucleotide, or analog or derivative thereof, modified by the presence of R. Photocleavage is described in more detail herein. The polynucleotide, or analog or derivative thereof, may be

[0136] [ka]

[0137] may be modified by the presence of the R moiety of formula (I) that is retained on the polynucleotide or analog or derivative thereof following photocleavage of the nucleotide, as discussed in more detail below.

[0138] The compound of formula (I) used in the method of the present invention is compatible with various well-known polynucleotide synthesis methods, such as phosphoramidite method, H-phosphonate method and phosphotriester method.Thus, the method of the present invention includes the phosphoramidite method of polynucleotide synthesis, the H-phosphonate method of polynucleotide synthesis and the phosphotriester method of polynucleotide synthesis.Preferably, the method of the present invention is the phosphoramidite method of polynucleotide synthesis.

[0139] Also provided is the compound of formula (I) itself. Furthermore, the formula (I * ) group, or an analog or derivative thereof, is provided.

[0140] [ka]

[0141] Formula (I * ) in R H , L 1 ,

[0142] [ka]

[0143] , R and n are as defined herein. P* is a phosphorus-based linkage to a polynucleotide or an analog or derivative thereof.

[0144] Hydrophobic group R H and a linking group L 1 In formula (I), R H is a hydrophobic group. H may be any suitable hydrophobic group. For example, when the compound of formula (I) is attached to a polynucleotide, or an analogue or derivative thereof, such that the modified polynucleotide, or an analogue or derivative thereof, can be separated from the unmodified polynucleotide, or an analogue or derivative thereof, for example by HPLC, R H may be any group that alters the hydrophobicity of the polynucleotide or its analog or derivative.

[0145] R may be any modifying group that increases the hydrophobicity of a polynucleotide or analog or derivative thereof to which R is attached according to the methods of the present disclosure. R may increase the hydrophobicity of a polynucleotide or analog or derivative thereof to which R is attached by at least 1%, at least 2%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 200%, at least 500% or more.

[0146] When a polynucleotide or an analog or derivative thereof is assessed by HPLC, for example by reverse phase HPLC (RPHPCL), R may alter the properties of the polynucleotide or analog or derivative thereof to which R is attached according to the methods of the present disclosure.

[0147] R may increase the strength of the interaction between the polynucleotide or analog or derivative thereof to which R is attached according to the methods and RPHPCL columns disclosed herein. For example, RPHPCL columns may be used with a hydrocarbon chain, also referred to as the stationary phase, such as C 1-20 The column may comprise a porous silica support modified with alkyl, alkenyl and / or alkynyl chains. Elution with hydrophobic molecules (e.g., acetonitrile) in a hydrophilic phase (e.g., ammonium acetate) separates molecules from a mixture applied to the column according to their hydrophobicity. Molecules with higher hydrophobicity elute relatively slower. Thus, R may cause a polynucleotide or analog or derivative thereof to which R is attached according to the disclosed method to separate from a RPHPLC column slower than the corresponding unmodified polynucleotide or analog or derivative. R may improve the separation of the modified polynucleotide or analog or derivative thereof from the unmodified polynucleotide or analog or derivative by at least 1%, at least 2%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 200%, at least 500% or more.

[0148] R H Typically, R is an organic chemical group having a molecular weight of up to about 5,000 g / mol, more typically up to about 1000 g / mol, such as up to about 500 g / mol, e.g., up to about 300 g / mol. As used herein, those of skill in the art will understand that R H It should be understood that is a chemical group and not a particle such as a bead or nanoparticle.

[0149] Typically, in formula (I), R H is C1~C 20 Alkyl, C2-C 20 Alkenyl, C2-C 20 Alkynyl, C5-C 10 Carbocyclyl, C6~C 18R is selected from aryl, 5-10 membered heteroaryl and 5-10 membered heterocyclyl. H may be optionally substituted or unsubstituted.

[0150] More commonly, R H is C4~C 16 Alkyl, C4-C 16 Alkenyl, C4-C 16 Alkynyl, C5-C 10 Carbocyclyl and C6-C 10 aryl, which may be unsubstituted or substituted, for example as defined herein. More often, R H is C4~C 12 Alkyl, C4-C 12 Alkenyl, C4-C 12 alkynyl, C-C carbocyclyl and C aryl, which may be unsubstituted or substituted, for example as defined herein. Even more typically, R H is C4~C 12 Alkyl, C4-C 12 Alkenyl and C4-C 12 alkynyl, which may be unsubstituted or substituted, for example as defined herein. More often, R H is C5~C 12 alkyl; R H may be substituted or preferably unsubstituted, e.g., R H may be unsubstituted C5 to C9 alkyl.

[0151] Usually, R H is neither a DMT group nor an ODMT group. R H If is substituted, R H is typically substituted with 1, 2, or 3 substituents independently selected from halogen, cyano, C1-C4 alkyl, and phenyl.

[0152] In formula (I), L 1 is the hydrophobic group R H Photolabile group

[0153] [ka]

[0154] L is a linking group that links 1 may be any suitable linking group. In one embodiment, L 1 is a chemical bond, e.g., a covalent bond. 1 In embodiments where R is a chemical bond (e.g., a covalent bond), the hydrophobic group R H is directly attached to the photolabile group. In some embodiments, this can be useful for simplifying synthesis and / or reducing reagent costs.

[0155] In one embodiment, L 1 is a linker. Any suitable linker can be used. For example, L 1 is C1~C 20 Alkylene group, C2-C 20 Alkenylene group and / or C2-C 20 The linker may comprise or consist of an alkynylene group, the alkylene, alkenylene or alkynylene group being selected from the group consisting of heteroatoms, phosphite groups, phosphate groups, carbonyl groups, C6-C 10 Aryl groups, C5-C 10 The linker may be interrupted and / or terminated by one or more groups selected from a carbocyclyl group, a 5-10 membered heteroaryl group, and a 5-10 membered saturated or partially unsaturated heterocyclic group. The linker may be unsubstituted or further substituted. In some embodiments, the use of a chemical linker, such as one of the preceding linkers, may be useful for increasing the hydrophobicity of the hydrophobic group and / or providing a robust scaffold for attaching various hydrophobic groups according to the desired application, without changing the chemical nature of the photolabile group.

[0156] Usually L 1comprises a linker which is or contains a C1-C6 alkylene group, a C2-C6 alkenylene group and / or a C2-C6 alkynylene group, wherein the alkylene, alkenylene or alkynylene group may be interrupted and / or terminated by one or more groups selected from a heteroatom, a carbonyl group, a phenyl group, a cyclopentyl or cyclohexyl group, a 5- to 6-membered heteroaryl group and a 5- to 6-membered saturated or partially unsaturated heterocyclic group, and the linker may be further substituted.

[0157] Preferred heteroatoms and hetero groups are -O-, -S-, -SO-, -SO2-, -NR z -, -C(O)NR z Including R z is H or methyl, preferably H. An example of an alkylene group interrupted and / or terminated with an -O- atom is an alkylene glycol group, so that the linking group may comprise or consist of a polyalkylene glycol, such as polyethylene glycol (PEG). Typically, the linking group is not linked to a biotin or streptavidin moiety. In some cases, L 1 is or comprises a linker comprising a C1-C6 alkylene group, a C2-C6 alkenylene group and / or a C2-C6 alkynylene group, wherein said alkylene, alkenylene or alkynylene group is not interrupted or terminated by one or more oxygen groups.

[0158] When the linker is substituted, it is typically selected from the group consisting of halogen, cyano, -OR x , -SR x , -NR x R x , -C(O)OR x , -C(O)NR x R x , -C(O)R x and C1-C4 alkyl groups, R x is hydrogen or unsubstituted C1-C4 alkyl.

[0159] More commonly, L 1 is a C1-C6 alkylene group, a C2-C6 alkenylene group and / or a C2-C6 alkynylene group, and the alkylene, alkenylene or alkynylene group does not include a heteroatom, such as -O-, -S-, -SO-, -SO2-, -NR z - and -C(O)NR z , (where R z is H or methyl), a carbonyl group, a phenyl group, a cyclopentyl or cyclohexyl group, a 5- to 6-membered heteroaryl group, and a 5- to 6-membered saturated or partially unsaturated heterocyclic group.

[0160] Typically, when the linker comprises a 5-6 membered heteroaryl group, the heteroaryl group is a triazole or imidazole, preferably a triazole.

[0161] More commonly, L 1 is a C1-C3 alkylene group, a C2-C3 alkenylene group and / or a C2-C3 alkynylene group, and the alkylene, alkenylene or alkynylene group is -O-, -NR z - and -C(O)NR z (In the formula, R z is H), may be interrupted and / or terminated by one or more groups selected from a carbonyl group, a phenyl group, a triazole or an imidazole.

[0162] In some embodiments, L 1 is or includes the structural moiety: -AB-, where A is a C1-C5 alkylene group, preferably unsubstituted, where the alkylene group is unsubstituted or substituted as described herein, and B is a cyclic group selected from a C6 aryl group, a C5-C6 carbocyclyl group, a 5-6 membered heteroaryl group, and a 5-6 membered saturated or partially unsaturated heterocyclic group.

[0163] Preferably, when the linking group contains the structural moiety: -AB-, A is an unsubstituted C1-C4 alkylene group, and B is a cyclic group selected from a C6 aryl group, a C5-C6 carbocyclyl group, a 5- to 6-membered heteroaryl group, and a 5- to 6-membered saturated or partially unsaturated heterocyclic group.

[0164] More preferably, when the linking group contains the structural moiety: -AB-, A is an unsubstituted C1-C3 alkylene group and B is a cyclic group selected from triazole, benzene, cyclohexane, piperidine, pyridazine, pyridine, thiazole and imidazole, preferably triazole.

[0165] In some embodiments, the linking group is a moiety of the structure:

[0166] [ka]

[0167] where the wavy line indicates the point of attachment to the rest of the molecule. Includes.

[0168] In some embodiments, the linking group is the structural moiety: -C-, where C is a C2-C5 alkynylene group, preferably an unsubstituted, where the alkynylene group is unsubstituted or substituted as described herein. In some embodiments, C is an unsubstituted C2-C3 alkynylene group. In some embodiments, the linking group is the structural moiety:

[0169] [ka]

[0170] where the wavy line indicates the point of attachment to the rest of the molecule. It is.

[0171] Phosphorus group R P In formula (I), R Pis a phosphorus-based group suitable for reacting with a polynucleotide, or an analogue or derivative thereof, to modify the polynucleotide, or an analogue or derivative thereof, with a compound of formula (I).

[0172] In the methods of the disclosure, the reactive functional group of the polynucleotide or analog or derivative thereof that is modified with a compound of formula (I) is R P The hydrophobic group R of the compound of formula (I) can be reacted with H is linked to the polynucleotide or its analog or derivative, thus modifying the polynucleotide or its analog or derivative.

[0173] The disclosed method comprises attaching a reactive functional group at either the 5' or 3' position of a polynucleotide or an analog or derivative thereof to R P The compound of formula (I) may thus be utilized to modify polynucleotides, or analogs or derivatives thereof, whether synthesized in the 3' to 5' or 5' to 3' direction.

[0174] Generally, the disclosed method comprises converting a reactive functional group at the 5' position of a polynucleotide or an analog or derivative thereof to an R P Typically, the disclosed method involves reacting a free hydroxyl group at the 5' position of a polynucleotide or analog or derivative thereof with a phosphorus-based group R P This is particularly suitable for synthesizing polynucleotide chains in the 3' to 5' direction, which is usually cheaper and more versatile, and therefore usually involves reacting R P This leaves a free hydroxyl group at the 5' position for reaction with the group.

[0175] However, in some embodiments, the disclosed methods involve modifying the reactive functional group at the 3′ position of a polynucleotide or analog or derivative thereof to R P Typically, in such embodiments, the disclosed method involves reacting a free hydroxyl group at the 3′ position of a polynucleotide, or an analog or derivative thereof, with a phosphorus-based group RP This includes reacting with

[0176] Typically, the compounds of formula (I) do not react with functional groups that may be present at positions away from the 5' or 3' positions of a polynucleotide or an analog or derivative thereof. In some embodiments, such functional groups are not present. In some embodiments, such functional groups are protected or masked to prevent such reactions.

[0177] Typically, the terminal monomer unit of the polynucleotide or analog or derivative thereof that is reacted with the compound of formula (I) is represented by formula (N-1) or formula (N-2), preferably formula (N-1):

[0178] [ka]

[0179] (wherein the wavy line indicates the point of attachment to the remainder of the polynucleotide or analog or derivative thereof). It is expressed as:

[0180] In formula (N-1) and formula (N-2), X is an oxygen atom, a nitrogen atom, a sulfur atom, or -C(R a R a )-. Preferably, X is an oxygen atom.

[0181] R 1 and R 1 ' each independently represents hydrogen, OH, halogen, optionally substituted C1-C4 alkyl, -OR a , -SR a , -NR a R a , -C(O)OR a , -C(O)NR a R a and -C(O)R b One R 1 The group is R 1R′ can be joined to form a bridge motif, such as a —CH2-O- bridge, for example between the 2′ and 4′ positions of the ring. 1 are each independently selected from hydrogen, OH, halogen, C1-C2 alkyl, C1-C2 haloalkyl, and C1-C2 alkoxyl. More preferably, R 1 are each selected from hydrogen, fluorine, methyl and methoxy. More preferably, R 1 Each is hydrogen. Preferably, R 1 R′ is hydrogen, OH, halogen, C1-C2 alkyl, C1-C2 haloalkyl, and C1-C2 alkoxyl. More preferably, R 1 More preferably, R ′ is selected from hydrogen, OH, fluorine, methyl and methoxy. 1 ' is H or OH.

[0182] R B is an optionally substituted natural or non-natural nucleobase or a derivative or analogue thereof. Natural nucleobases include adenine, cytosine, guanine, thymine and uracil. Non-natural nucleobases are known in the art and include, for example, analogues of natural nucleobases such as 2-thiothymine, natural nucleobases such as isoguanine, isocyanine and 5-aza-7-deazaguanine, and other isomers of groups used in the art as synthetic nucleobases such as xanthine. For example, unnatural nucleobases include 2-thiothymine, isoguanine, isocytosine, 1-methylcytosine, 5-aza-7-deazaguanine, 6-amino-5-nitropyridin-2-one, 1-methylcytosine, xanthine, hypoxanthine, 7-methylguanine, 5,6-dihydrouracil, 5-methylcytosine, 5-hydroxymethylcytosine, 2,6-diaminopurine, 6,8-diaminopurine, fluorocytosine, fluorouracil, mercaptopurine, thioguanine, 5-hydroxymethyluracil, 5-carboxycytosine, and fluorescent nucleobases such as 2-aminopurine and tricyclic cytosine tC, tCO, and tCnitro. B is a protected natural or non-natural nucleobase. More preferably, R Bis a protected natural nucleobase.

[0183] Y is a reactive functional group of the polynucleotide, R P represents the point of attachment to the R group. Typically, Y is an -OH or -O- group, or an activated derivative thereof, most typically -OH. Typically, Y is an -OH group, or an activated derivative thereof, most typically -OH. P The aryl group, or its activated structure, reacts with the compounds of formula (I) by nucleophilic attack at the phosphorus atom, as described in more detail herein.

[0184] Typically, in formula (I), R P is a phosphoramidite, phosphoramidate, alkylphosphonamidite or alkylphosphonamidate. More usually, R P is a phosphoramidite or an alkylphosphonamidite. For example, R P may be a phosphoramidite or a methylphosphonamidite. Most often, R P is 2-cyanoethyl N,N-diisopropylphosphoramidite or N,N-diisopropylmethylphosphonamidite.

[0185] photolabile group

[0186] [ka]

[0187] As stated above,

[0188] [ka]

[0189] is a photolabile group. Photolabile groups can be cleaved by photolytic excitation, e.g., exposure to UV light. Photolabile groups are typically cleaved under mild conditions that are orthogonal to the reaction conditions typically used in polynucleotide synthesis, as described in more detail herein.

[0190] The photolabile group generally does not contain hydrolyzable motifs, such as ester or carbonate groups. Therefore, it is generally stable under reaction conditions generally used to deprotect synthesized polynucleotides, such as deprotection conditions used to remove hydrolyzable protecting groups from protected nucleobases present in the synthesized polynucleotides. For example, photocleavable linkers are generally stable to concentrated ammonium hydroxide and / or ammonia. This allows various protecting groups to be advantageously removed from the synthesized polynucleotides while retaining the photolabile group in situ. Therefore, it is generally possible to deprotect any protected functional groups on the polynucleotide after modifying the synthesized polynucleotide or its analog or derivative with the compound of formula (I) before purifying the deprotected polynucleotide or its analog or derivative described herein.

[0191] Photolabile groups are advantageously cleaved in a single, generally concerted reaction step to provide modified nucleosides, nucleotides, polynucleotides or derivatives or analogs thereof. This is a particular advantage over some photocleavable groups known in the art (in different contexts), which contain, for example, a diester moiety and can be cleaved to leave behind a potentially undesirable succinyl functional residue, or a carbonate moiety and can be cleaved to leave behind a potentially undesirable carbonate functional residue. Avoidance of such groups is particularly useful, since harsh reaction conditions are usually required to remove succinyl or carbonate groups from succinyl- or carbonate-functionalized polynucleotides, which can lead to degradation. Moreover, the by-products of cleavage are usually volatile and therefore easily removed. Such photolabile groups are usually stable under hydrolysis conditions.

[0192] In some embodiments,

[0193] [ka]

[0194] is the formula

[0195] [ka]

[0196] This is the part. Thus, in such embodiments, the compound of formula (I) may be a compound of formula (II):

[0197] [ka]

[0198] (In the formula, R H , L 1 , R, n and R P are as described herein) It is.

[0199] In formula (II),

[0200] [ka]

[0201] is a 2-nitrobenzyl group, and the 2-nitrobenzyl group is selected from halogen, optionally substituted C1-C4 alkyl, -OR a , -SR a , -NR a R a , -C(O)OR a , -C(O)NR a R a , -C(O)R b , -OC(O)R b and -NHC(O)R b may be substituted with one, two or three groups independently selected from

[0202] R aare each independently selected from hydrogen, optionally substituted C1-C2 alkyl, and optionally substituted C1-C2 alkoxyl. a are each independently selected from hydrogen or methyl, more preferably R a are hydrogen.

[0203] R b are each independently selected from hydrogen and an optionally substituted C1-C4 alkyl group. b are each independently selected from hydrogen or methyl, more preferably R b are hydrogen.

[0204] As used herein, the term "2-nitrobenzyl group" refers to a 2-nitrobenzyl group in which a nitro group is -C(R 3 (L) refers to nitrobenzyl groups attached to adjacent carbon atoms of formula (I) such that they are in the 2-position relative to the -W- moiety. 1 -R H The moiety and any additional substituents are not depicted for clarity.

[0205] [ka]

[0206] That is,

[0207] [ka]

[0208] In the 2-nitrobenzyl group represented by the formula (I), the nitro group is in the ortho position relative to adjacent carbon atoms; i.e., the nitro group is in the -C(R 3 )-carbon atom.

[0209] [ka]

[0210] It should be understood that a 2-nitrobenzyl group represented by the formula: may also be referred to as a 2-nitrophenyl group.

[0211] Thus, in formula (II):

[0212] [ka]

[0213] -L 1 -R H and -CHR 3 W(R) n R P The substituent is a substituent of a benzene ring, i.e., the benzene ring is -CHR 3 W(R) n R P substituted at the 2' position with a nitro group and at the distal position (e.g., at the 3, 4, 5, or 6 position) with a -L 1 -R H and optionally further substituted as described herein, i.e., a 2-nitrobenzyl group:

[0214] [ka]

[0215] It is. Therefore, one skilled in the art should understand that compounds of formula (I) have photocleavable groups, such as 2-nitrobenzyl groups, "in line". This is different from compounds with 2'nitrobenzyl groups pendant from the main chain, such as compounds in which a phosphorus-based group is connected to a hydrophobic group by an alkylene chain, which may be optionally interrupted by one or more heteroatoms, and the alkylene chain may be substituted with an aryl group, which may be further substituted with a nitro group. Such compounds are not examples of compounds of formula (I).

[0216] As explained above, the nitrobenzene group

[0217] [ka]

[0218] is represented by formula (II) -CR 3 -W- and -L 1 -H 1 Apart from the moiety, it may be unsubstituted or further substituted.

[0219] [ka]

[0220] When is further substituted, it may be substituted, for example, with one, two or three substituents independently selected from electron donating groups.

[0221] [ka]

[0222] is halogen, optionally substituted C1-C4 alkyl, -OR a , -SR a , -NR a R a , -C(O)OR a , -C(O)NR a R a , -C(O)R b , -OC(O)R b and -NHC(O)R b and R a and R b is as defined above. Preferably,

[0223] [ka]

[0224] is substituted, C1-C4 alkyl, -OR a , -SR a , -NR a R a , -OC(O)R b and -NHC(O)R b and more preferably substituted with one, two or three groups selected from:

[0225] [ka]

[0226] If is a replacement, OR a , and -OC(O)R b , preferably methoxy. Most preferably,

[0227] [ka]

[0228] Apart from the nitro group of nitrobenzene, the -CR 3 -W- and -L 1 -H 1 Apart from the moiety, it is unsubstituted.

[0229] Typically, in formula (II),

[0230] [ka]

[0231] , L 1 and R H is represented by formula (A-1) or formula (A-2):

[0232] [ka]

[0233] (In the formula, L 1 and R H are as defined herein) These are jointly represented by:

[0234] In formula (A-1) and formula (A-2), R 4 , R 5 , R 6 and R 7 are each independently selected from hydrogen and a substituent which may be an electron donating group. 4 , R 5 , R 6 and R 7 are usually independently hydrogen, halogen, optionally substituted C1-C4 alkyl, -OR a , -SR a , -NR a R a , -C(O)OR a , -C(O)NR a R a , -C(O)R b , -OC(O)R b and -NHC(O)R b Selected from R a and R b is as set out above.

[0235] Preferably, R 4 , R 5 , R 6 and R 7 each independently represents hydrogen, fluorine, an optionally substituted C1-C4 alkyl, -OR a , -SR a , -NR a R a , -OC(O)R b and -NHC(O)R b More preferably, R 4 , R 5 , R 6 and R 7 are each independently hydrogen, -OR a , -SR a, -NR a R a , -OC(O)R b and -NHC(O)R b Even more preferably, R 4 , R 5 , R 6 and R 7 are each independently hydrogen, -OR a , and -OC(O)R b More preferably, R 4 , R 5 , R 6 and R 7 are each independently selected from hydrogen and methoxy. Without being bound by theory, the inventors believe that R 4 , R 5 , R 6 and R 7 It is believed that the linker is more susceptible to cleavage upon photoexcitation when one or more of R 4 , R 5 , R 6 and / or R 7 When is hydrogen, the compounds of formula (I) are easier to synthesise.

[0236] Preferably, R 4 , R 5 , R 6 and / or R 7 At least one of R is hydrogen. For example, 4 , R 5 , R 6 and / or R 7 Preferably, one, two or three of R 4 and R 7 One of the groups is hydrogen, and R 4 and R 7 The other is hydrogen, -OR a , and -OC(O)R b Preferably, R 5 or R 6 is hydrogen. For example, in some embodiments, R 4 and R 7One of the groups is hydrogen, and R 4 and R 7 The other is hydrogen, -OR a , and -OC(O)R b Selected from R 5 or R 6 is hydrogen or methoxy.

[0237] In formula (II), R 3 is methyl, ethyl or C1-C2 haloalkyl. Preferably, R 3 is methyl, ethyl or C1-C2 fluoroalkyl. More preferably, R 3 is methyl or ethyl; or R 3 may be methyl or CF. Most preferably, R 3 is methyl. 3 is one of these groups, the photolabile group may be more easily cleaved using photoexcitation.

[0238] In formula (II), W is selected from the group of formula (W-2), an oxygen atom, and the group of formula (W-1):

[0239] [ka]

[0240] (In the formula, - R if n is 1 P is a phosphoramidite, phosphoramidate, alkylphosphonamidite, or alkylphosphonamidate; when n is 0, R P forms, together with the oxygen atom to which it is bonded, a phosphoramidite, a phosphoramidate, an alkylphosphonamidite, or an alkylphosphonamidate, The phosphoramidite, phosphoramidate, alkylphosphonamidite or alkylphosphonamidate is preferably a phosphoramidite or a methylphosphonamidite, more preferably 2-cyanoethyl N,N-diisopropylphosphonamidite or N,N-diisopropylmethylphosphonamidite; Q is an oxygen atom or a sulfur atom, - R 2 are each independently selected from hydrogen, methyl, ethyl, C1-C2 haloalkyl, and halogen groups. is selected from.

[0241] Typically, in formula (W-2) and formula (W-1), Q is an oxygen atom. Generally, in formula (W-2) and formula (W-1), R 2 are each independently selected from hydrogen, methyl, ethyl, C1-C2 haloalkyl and halogen groups. More usually, R 2 are each independently selected from hydrogen, methyl, and ethyl.

[0242] The Two R's 2 When groups are attached to the same carbon atom, usually one R 2 The group is hydrogen, and one R 2 The groups are selected from hydrogen, methyl, ethyl, C1-C2 haloalkyl and halogen groups, typically selected from hydrogen, methyl, and ethyl.

[0243] Usually, R 2 are each independently hydrogen or methyl. More usually, two R 2 When groups are attached to the same carbon atom, one R 2 group is hydrogen, and the other R 2 The group is hydrogen or methyl.

[0244] Most commonly, R 2 are each hydrogen. This may allow for easier synthesis of compounds of formula (I).

[0245] Typically, W is a group of formula (W-2) or an oxygen atom. Most typically, W is a group of formula (W-2).

[0246] When W is a group of formula (W-2), the compound of formula (II) may be a compound of formula (II-3):

[0247] [ka]

[0248] (In the formula, R H , L 1 ,

[0249] [ka]

[0250] , R 3 , Q, R 2 are as defined herein) So, n is usually 0.

[0251] Typically, in formula (II-3), R P forms an alkylphosphonamidite together with the oxygen atom to which it is attached. P C, together with the oxygen atom attached to it. 1-4 Forming an alkylphosphonamidite. More usually, R P Together with the oxygen atom to which it is attached, it forms a methylphosphonamidite. Most commonly, R P together with the oxygen atom attached thereto, the moiety of formula (II) is as depicted below:

[0252] [ka]

[0253] (In the formula, the wavy line represents

[0254] [ka]

[0255] (Indicating the attachment points of the parts) The N,N-diisopropylmethylphosphonamidite is formed as follows:

[0256] Thus, in some embodiments, the compound of formula (II) is:

[0257] [ka]

[0258] (In the formula, R H , L 1 ,

[0259] [ka]

[0260] , R 3 , and R 2 are as defined herein) It is.

[0261] In some embodiments, the compound of formula (II) is:

[0262] [ka]

[0263] (In the formula, R H and L 1 are as defined herein) It is.

[0264] Usually L 1 -R H teeth,

[0265] [ka]

[0266] where the wavy line indicates the point of attachment to the rest of the molecule. H is C5~C 12 is alkyl, R H may be substituted or preferably unsubstituted, e.g., R H may be unsubstituted C5 to C9 alkyl.

[0267] Solely for purposes of aiding understanding, and without being bound by any theory, the inventors believe that compounds of formula (II-3) may undergo photolytic cleavage as illustrated by one specific example below.

[0268] [ka]

[0269] where pnt is a polynucleotide modified at an oxygen atom with a compound of formula (I) or an analog or derivative thereof, HB is an acid, and B is a base. However, the invention is not limited to this particular compound or to methods of using this particular compound.

[0270] When W is an oxygen atom, the compound of formula (II) may be a compound of formula (II-1):

[0271] [ka]

[0272] (In the formula, R H , L 1 ,

[0273] [ka]

[0274] , and R 3 are as defined herein) So, n is usually 0.

[0275] Typically, in formula (II-1), R P forms a phosphoramidite together with the oxygen atom to which it is attached. P is a substituted C together with the oxygen atom attached to it. 1-4 Form an alkyl phosphoramidite. Most commonly, R P together with the oxygen atom attached thereto, the moiety of formula (II) is as depicted below:

[0276] [ka]

[0277] (In the formula, the wavy line represents

[0278] [ka]

[0279] (Indicating the attachment points of the parts) 2-Cyanoethyl N,N-diisopropyl phosphoramidite is formed as follows:

[0280] Thus, in some embodiments, the compound of formula (II) is:

[0281] [ka]

[0282] (In the formula, R H , L 1 ,

[0283] [ka]

[0284] , R 3 , and R 2 are as defined herein) It is.

[0285] In some embodiments, the compound of formula (II) is:

[0286] [ka]

[0287] (In the formula, R H and L 1 are as defined herein) It is.

[0288] Usually L 1 -R H teeth,

[0289] [ka]

[0290] where the wavy line indicates the point of attachment to the rest of the molecule. H is C5~C 12 is alkyl, R H may be substituted or preferably unsubstituted, e.g., R H may be unsubstituted C5 to C9 alkyl.

[0291] Solely for purposes of aiding understanding, and without being bound by any theory, the inventors believe that compounds of formula (II-1) may undergo photolytic cleavage as illustrated by one specific example below.

[0292] [ka]

[0293] where pnt is a polynucleotide modified with a compound of formula (I) or an analog or derivative thereof, HB is an acid, and B is a base. However, the invention is not limited to this particular compound or to methods of using this particular compound.

[0294] When W is a group of formula (W-1), the compound of formula (II) may be a compound of formula (II-2):

[0295] [ka]

[0296] (In the formula, R H , L 1 ,

[0297] [ka]

[0298] , R 3 , Q, and R 2 are as defined herein) So n is usually 1.

[0299] Typically, in formula (II-2), R P is a phosphoramidite. Usually, R P is the replaced C 1-4 Most commonly, the moiety of formula (II) is as depicted below:

[0300] [ka]

[0301] (In the formula, the wavy line represents

[0302] [ka]

[0303] (Indicating the attachment points of the parts) So that R P is 2-cyanoethyl N,N-diisopropyl phosphoramidite.

[0304] Thus, in some embodiments, the compound of formula (II) is:

[0305] [ka]

[0306] (In the formula, R H , L 1 ,

[0307] [ka]

[0308] , R 3 , R 2 and R is as defined herein. It is.

[0309] In some embodiments, the compound of formula (II) is:

[0310] [ka]

[0311] (In the formula, R, R H and L 1 are as defined herein) It is.

[0312] Usually L 1 -R H teeth,

[0313] [ka]

[0314] where the wavy line indicates the point of attachment to the rest of the molecule. H is C5~C 12 is alkyl, R H may be substituted or preferably unsubstituted, e.g., RH may be unsubstituted C5 to C9 alkyl.

[0315] Solely for purposes of aiding understanding, and without being bound by any theory, the inventors believe that compounds of formula (II-2) may undergo photolytic cleavage as illustrated by one specific example below.

[0316] [ka]

[0317] where pnt is a polynucleotide modified with a compound of formula (I) or an analog or derivative thereof, HB is an acid, and B is a base. However, the invention is not limited to this particular compound or to methods of using this particular compound.

[0318] Modifying group R In formula (I), R is a modifying group and n is 0 or 1. Thus, R is optionally present. For example, R can be, among others,

[0319] [ka]

[0320] is of the formula defined herein

[0321] [ka]

[0322] which may be present when W is a group of formula (W-1) as defined herein (i.e. n may be 1).

[0323] In formula (I), R may be any suitable modifying group. Suitable modifying groups are, for example, groups that can be incorporated at the termini, such as the 5' termini, of a synthesized polynucleotide.

[0324] For example, R is (i) a nucleoside or a derivative or analog thereof; (ii) C1~C 20 Alkylene group, C2-C 20 Alkenylene group and / or C2-C 20 A group comprising or consisting of an alkynylene group, wherein the alkylene, alkenylene or alkynylene group is not further comprised of a heteroatom, a phosphite group, a phosphate group, a carbonyl group, a C6-C 10 Aryl groups, C5-C 10 a group in which R is optionally further substituted, and which is optionally interrupted and / or terminated by one or more groups selected from a carbocyclyl group, a 5- to 10-membered heteroaryl group, and a 5- to 10-membered heterocyclic group; (iii) a second polynucleotide or a derivative or analog thereof. You may choose from.

[0325] When R is a nucleoside or derivative or analog, R is typically a ribose or deoxyribose nucleoside. R may be a nucleoside having a purine or pyrimidine base. R may be an abasic nucleoside.

[0326] In some embodiments, R may be selected from adenosine, guanosine, thymidine, uridine, 5-methylcytidine, 5-hydroxymethylcytidine, cytidine, cyclic adenosine, cyclic guanosine, deoxyadenosine, deoxyguanosine, deoxythymidine, deoxyuridine, deoxycytidine, and deoxymethylcytidine.

[0327] In some embodiments, R may comprise or consist of nitroindole, inosine, acridine, 2-aminopurine, 2-6-diaminopurine, 5-bromo-deoxyuridine, inverted thymidine (inverted dT), inverted dideoxy-thymidine (ddT), dideoxy-cytidine (ddC), 5-hydroxymethylcytidine, 2'-O-methyl RNA bases, isodeoxycytidine (iso-dC), isodeoxyguanosine (iso-dG).

[0328] In some embodiments, R is a nucleoside analog such as a peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA), or locked nucleic acid (LNA) analog of an abasic nucleoside, or a nucleoside analog such as a peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA), or locked nucleic acid (LNA) analog of adenosine, guanosine, thymidine, uridine, 5-methylcytidine, 5-hydroxymethylcytidine, cytidine, cyclic adenosine, cyclic guanosine, deoxyadenosine, deoxyguanosine, deoxythymidine, deoxyuridine, deoxycytidine, and deoxymethylcytidine.

[0329] An example of the synthesis and use of a compound of formula (I) to effect deoxythymidine (dT) modifications is provided in Example 3 and Example 8.

[0330] In some embodiments, R is C1-C 20 Alkylene group, C2-C 20 Alkenylene group and / or C2-C 20 The alkylene, alkenylene or alkynylene group may contain or consist of a heteroatom, a phosphite group, a phosphate group, a carbonyl group, a C6-C 10 Aryl groups, C5-C 10 R may be interrupted and / or terminated by one or more groups selected from a carbocyclyl group, a 5- to 10-membered heteroaryl group, and a 5- to 10-membered heterocyclic group, and R may be further substituted.

[0331] In some embodiments, R comprises or consists of a C2-C6 alkylene group, a C2-C6 alkenylene group, and / or a C2-C6 alkynylene group, wherein the alkylene, alkenylene, or alkynylene group is optionally interrupted and / or terminated by one or more groups selected from heteroatoms, carbonyl groups, phenyl groups, cyclopentyl or cyclohexyl groups, 5- to 6-membered heteroaryl groups, and 5- to 6-membered saturated or partially unsaturated heterocyclic groups, and R is optionally further substituted.

[0332] In some embodiments, R comprises or consists of an unsubstituted C2-C6 alkylene group. For example, in some embodiments, R comprises or consists of a C3 alkylene group. Thus, R is a substituted or unsubstituted C2-C6 alkylene group. P An example of the synthesis and use of a compound of formula (I) that results in a C3 spacer modification is provided in Example 2 and Example 6.

[0333] In some embodiments, R comprises or consists of one or more PEG(CH2CH2O) moieties. For example, in some embodiments, R is (OCH2CH2) n R comprises or consists of the moiety (wherein n is an integer between 1 and 10, e.g., between 3 and 6). Thus, R can be any moiety that is compatible with the R P Together with the group, it may comprise an iSp9 spacer (spacer 9) or an iSp18 spacer (spacer 18).

[0334] In some embodiments, R is a second polynucleotide or a derivative or analog thereof. In some embodiments, R is a polynucleotide comprising between 2 and 100 nucleotide monomers, such as between 2 and 10 monomers, such as 2, 3, 4, 5, 6, 7, 8, 9, or 10 monomers.

[0335] Preferred Aspects In some preferred embodiments of the methods and compounds of the present disclosure, the methods include a method of modifying a polynucleotide or a peptide nucleic acid (PNA) analog, a glycerol nucleic acid (GNA) analog, a threose nucleic acid (TNA) analog, or a locked nucleic acid (LNA) analog thereof, comprising reacting the polynucleotide or the peptide nucleic acid (PNA) analog, the glycerol nucleic acid (GNA) analog, the threose nucleic acid (TNA) analog, or the locked nucleic acid (LNA) analog thereof with a compound of formula (II):

[0336] [ka]

[0337] (In the formula, -

[0338] [ka]

[0339] is a 2-nitrobenzyl group, and the 2-nitrobenzyl group is selected from halogen, optionally substituted C1-C4 alkyl, -OR a , -SR a , -NR a R a , -C(O)OR a , -C(O)NR a R a , -C(O)R b , -OC(O)R b and -NHC(O)R b and R a are each independently selected from hydrogen, optionally substituted C1-C2 alkyl, and optionally substituted C1-C2 alkoxyl; R b are each independently selected from hydrogen and an optionally substituted C1-C4 alkyl group; - R 3 is methyl, ethyl or C1-C2 haloalkyl; W is a group of the formula (W-2), an oxygen atom and a group of the formula (W-1):

[0340] [ka]

[0341] is selected from - n is an integer selected from 0 and 1; - R if n is 1 P is a phosphoramidite, phosphoramidate, alkylphosphonamidite or alkylphosphonamidate, - If n is 0, R P forms, together with the oxygen atom to which it is attached, a phosphoramidite, phosphoramidate, alkylphosphonamidite or alkylphosphonamidate; Q is an oxygen atom or a sulfur atom, - R 2 are each independently selected from hydrogen, methyl, ethyl, C1-C2 haloalkyl, and halogen groups; - R (i) a nucleoside or its peptide nucleic acid (PNA) analogue, glycerol nucleic acid (GNA) analogue, threose nucleic acid (TNA) analogue, or locked nucleic acid (LNA) analogue; (ii) C1~C 20 Alkylene group, C2-C 20 Alkenylene group and / or C2-C 20 A group containing an alkynylene group, wherein the alkylene, alkenylene or alkynylene group is -O-, -S-, -SO-, -SO2-, -NR z -, -C(O)NR z (In the formula, R z is H or methyl), phosphite group, phosphate group, carbonyl group, C6-C 10 Aryl groups, C5-C 10a group in which R is optionally further substituted, and which is optionally interrupted and / or terminated by one or more groups selected from a carbocyclyl group, a 5- to 10-membered heteroaryl group, and a 5- to 10-membered heterocyclic group; (iii) a second polynucleotide or its peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA), or locked nucleic acid (LNA) analogue. is selected from - R H is C1~C 20 Alkyl, C2-C 20 Alkenyl, C2-C 20 Alkynyl, C5-C 10 Carbocyclyl, C6~C 18 aryl, 5-10 membered heteroaryl, and 5-10 membered heterocyclyl; R H is optionally substituted, - L 1 is (i) a chemical bond, and (ii) C1-C 20 Alkylene group, C2-C 20 Alkenylene group and / or C2-C 20 A linker comprising an alkynylene group, wherein the alkylene, alkenylene or alkynylene group is -O-, -S-, -SO-, -SO2-, -NR z - and -C(O)NR z (In the formula, R z is H or methyl), phosphite group, phosphate group, carbonyl group, C6-C 10 Aryl groups, C5-C 10 a carbocyclyl group, a 5- to 10-membered heteroaryl group, and a 5- to 10-membered saturated or partially unsaturated heterocyclic group, the linker being optionally further substituted; and a free hydroxyl group at the 5' or 3' position of the polynucleotide or its peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA), or locked nucleic acid (LNA) analog is R P By reacting with R Hunder conditions such that the polynucleotide or its peptide nucleic acid (PNA) analog, glycerol nucleic acid (GNA) analog, threose nucleic acid (TNA) analog, or locked nucleic acid (LNA) analog is ligated to the polynucleotide.

[0342] As discussed above, one of skill in the art would be able to:

[0343] [ka]

[0344] It should be understood that the 2-nitrobenzyl group represented by the formula: may also be referred to as a 2-nitrophenyl group. Thus, in some preferred embodiments of the methods and compounds of the present disclosure, the method is a method of modifying a polynucleotide or its peptide nucleic acid (PNA) analog, glycerol nucleic acid (GNA) analog, threose nucleic acid (TNA) analog, or locked nucleic acid (LNA) analog, comprising reacting the polynucleotide or its peptide nucleic acid (PNA) analog, glycerol nucleic acid (GNA) analog, threose nucleic acid (TNA) analog, or locked nucleic acid (LNA) analog with a compound of formula (II):

[0345] [ka]

[0346] (In the formula, -

[0347] [ka]

[0348] is a 2-nitrophenyl group, and the 2-nitrophenyl group is selected from halogen, optionally substituted C1-C4 alkyl, -OR a , -SR a , -NR a R a , -C(O)OR a , -C(O)NRa R a , -C(O)R b , -OC(O)R b and -NHC(O)R b and R a are each independently selected from hydrogen, optionally substituted C1-C2 alkyl, and optionally substituted C1-C2 alkoxyl; R b are each independently selected from hydrogen and an optionally substituted C1-C4 alkyl group; - R 3 is methyl, ethyl or C1-C2 haloalkyl; W is a group of the formula (W-2), an oxygen atom and a group of the formula (W-1):

[0349] [ka]

[0350] is selected from - n is an integer selected from 0 and 1; - R if n is 1 P is a phosphoramidite, phosphoramidate, alkylphosphonamidite or alkylphosphonamidate, - If n is 0, R P forms, together with the oxygen atom to which it is attached, a phosphoramidite, phosphoramidate, alkylphosphonamidite or alkylphosphonamidate; Q is an oxygen atom or a sulfur atom, - R 2 are each independently selected from hydrogen, methyl, ethyl, C1-C2 haloalkyl, and halogen groups; - R (iii) a nucleoside or its peptide nucleic acid (PNA) analogue, glycerol nucleic acid (GNA) analogue, threose nucleic acid (TNA) analogue, or locked nucleic acid (LNA) analogue; (iv) C1~C 20Alkylene group, C2-C 20 Alkenylene group and / or C2-C 20 A group containing an alkynylene group, wherein the alkylene, alkenylene or alkynylene group is -O-, -S-, -SO-, -SO2-, -NR z -, -C(O)NR z (In the formula, R z is H or methyl), phosphite group, phosphate group, carbonyl group, C6-C 10 Aryl groups, C5-C 10 a group in which R is optionally further substituted, and which is optionally interrupted and / or terminated by one or more groups selected from a carbocyclyl group, a 5- to 10-membered heteroaryl group, and a 5- to 10-membered heterocyclic group; (iii) a second polynucleotide or its peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA), or locked nucleic acid (LNA) analogue. is selected from - R H is C1~C 20 Alkyl, C2-C 20 Alkenyl, C2-C 20 Alkynyl, C5-C 10 Carbocyclyl, C6~C 18 aryl, 5-10 membered heteroaryl, and 5-10 membered heterocyclyl; R H is optionally substituted, - L 1 is (i) a chemical bond, and (ii) C1-C 20 Alkylene group, C2-C 20 Alkenylene group and / or C2-C 20 A linker comprising an alkynylene group, wherein the alkylene, alkenylene or alkynylene group is -O-, -S-, -SO-, -SO2-, -NR z - and -C(O)NR z (In the formula, R z is H or methyl), phosphite group, phosphate group, carbonyl group, C6-C 10 Aryl groups, C5-C 10a carbocyclyl group, a 5- to 10-membered heteroaryl group, and a 5- to 10-membered saturated or partially unsaturated heterocyclic group, the linker being optionally further substituted; and a free hydroxyl group at the 5' or 3' position of the polynucleotide or its peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA), or locked nucleic acid (LNA) analog is R P By reacting with R H under conditions such that the polynucleotide or its peptide nucleic acid (PNA) analog, glycerol nucleic acid (GNA) analog, threose nucleic acid (TNA) analog, or locked nucleic acid (LNA) analog is ligated to the polynucleotide.

[0351] Preferably, in the method of the present disclosure, said method is a method for modifying a polynucleotide.

[0352] In some preferred embodiments of the methods or compounds of the disclosure, R is (i) a nucleoside, (ii) C1~C 20 Alkylene group, C2-C 20 Alkenylene group or C2-C 20 An alkynylene group, wherein the alkylene, alkenylene or alkynylene group is -O-, -S-, -SO-, -SO2-, -NR z - and -C(O)NR z (In the formula, R z is H or methyl), phosphite group, phosphate group, carbonyl group, C6-C 10 Aryl groups, C5-C 10 R may be interrupted and / or terminated by one or more groups selected from a carbocyclyl group, a 5- to 10-membered heteroaryl group, and a 5- to 10-membered heterocyclic group, and R may further optionally be a halogen group, a cyano group, -OR x , -SR x , -NR x R x , -C(O)OR x, -C(O)NR x R x , -C(O)R x or a C1-C4 alkyl group, the C1-C4 alkyl group being unsubstituted or substituted with 1 to 3 halogen atoms; R x are each independently selected from hydrogen and a C1-C4 alkyl group that is unsubstituted or substituted with 1, 2 or 3 halogen groups; 20 Alkylene group, C2-C 20 Alkenylene group or C2-C 20 Alkynylene groups, and (iii) a second polynucleotide is selected from.

[0353] In some preferred embodiments of the methods or compounds of the present disclosure, i) R H and ii) L. 1 (In the formula, L 1 is a linker), are each independently substituted, they are each independently a halogen group, a cyano group, -OR x , -SR x , -NR x R x , -C(O)OR x , -C(O)NR x R x , -C(O)R x or a C1-C4 alkyl group, the C1-C4 alkyl group being unsubstituted or substituted with 1 to 3 halogen atoms; R x are each independently selected from hydrogen and a C1-C4 alkyl group that is unsubstituted or substituted with 1, 2 or 3 halogen groups.

[0354] In some preferred embodiments of the methods or compounds of the present disclosure,

[0355] [ka]

[0356] is a 2-nitrobenzyl group (also known as a 2-nitrophenyl group), which is selected from the group consisting of halogen, C1-C4 alkyl, -OR a , -SR a , -NR a R a , -C(O)OR a , -C(O)NR a R a , -C(O)R b , -OC(O)R b and -NHC(O)R b and R a are each independently selected from hydrogen, C1-C2 alkyl, and C1-C2 alkoxyl; R b are each independently selected from hydrogen and a C1 to C4 alkyl group.

[0357] Preferably, in the methods and compounds of the present disclosure: a compound of formula (I)

[0358] [ka]

[0359] and -

[0360] [ka]

[0361] , L 1 and R H is expressed by the formula (A-1):

[0362] [ka]

[0363] Represented together by - R 4 , R 5 , R6 and R 7 are each independently hydrogen, -OR a , -SR a , -NR a R a , -OC(O)R b and -NHC(O)R b is selected from - L 1 is a C1-C3 alkylene group, a C2-C3 alkenylene group and / or a C2-C3 alkynylene group, or a structural moiety: -AB- (wherein A is an unsubstituted C1-C4 alkylene group, and B is a cyclic group selected from a C6 aryl group, a C5-C6 carbocyclyl group, a 5-6 membered heteroaryl group, and a 5-6 membered saturated heterocyclic group or a partially unsaturated heterocyclic group), - R H is C4~C 16 Alkyl, C4-C 16 Alkenyl, C4-C 16 Alkynyl, C5-C 10 Carbocyclyl and C6-C 10 aryl; - R 3 is methyl, ethyl or C1-C2 haloalkyl; W is a radical of formula (W-2), an oxygen atom and a radical of formula (W-1):

[0364] [ka]

[0365] is selected from - R if n is 1 P is a phosphoramidite or an alkylphosphonamidite; when n is 0, R P forms, together with the oxygen atom to which it is bonded, a phosphoramidite or an alkylphosphonamidite, Q is an oxygen atom or a sulfur atom, - R 2 are each independently selected from hydrogen, methyl, ethyl, C1-C2 haloalkyl, and halogen groups; R is a nucleoside or a derivative or analogue thereof, or a C2-C6 alkylene group, a C2-C6 alkenylene group and / or a C2-C6 alkynylene group, said alkylene, alkenylene or alkynylene group optionally interrupted and / or terminated by one or more groups selected from heteroatoms, carbonyl groups, phenyl groups, cyclopentyl or cyclohexyl groups, 5- to 6-membered heteroaryl groups and 5- to 6-membered saturated or partially unsaturated heterocyclic groups.

[0366] In a first preferred embodiment, The compound of formula (I) has the formula:

[0367] [ka]

[0368] is a compound of -

[0369] [ka]

[0370] , L 1 and R H is expressed by the formula (A-1):

[0371] [ka]

[0372] and are jointly represented by - R 4 , R 5 , R 6 and R 7 are each independently hydrogen, -OR a , -SR a , -NR a R a , -OC(O)R b and -NHC(O)R b is selected from, preferably hydrogen; - L 1 is a C1-C3 alkylene group, a C2-C3 alkenylene group or a C2-C3 alkynylene group, or the structural moiety: -AB- (wherein A is an unsubstituted C1-C3 alkylene group and B is a cyclic group selected from triazole, benzene, cyclohexane, piperidine, pyridazine, pyridine, thiazole and imidazole), - R H is C4~C 12 Alkyl, C4-C 12 Alkenyl and C4-C 12 alkynyl, - R 3 is methyl, - R 2 are each independently hydrogen or methyl.

[0373] In a second preferred embodiment, The compound of formula (I) has the formula:

[0374] [ka]

[0375] is a compound of -

[0376] [ka]

[0377] , L 1 and R H is expressed by the formula (A-1):

[0378] [ka]

[0379] and are jointly represented by - R 4 , R 5 , R 6 and R 7are each independently hydrogen, -OR a , -SR a , -NR a R a , -OC(O)R b and -NHC(O)R b is selected from, preferably hydrogen; - L 1 is a C1-C3 alkylene group, a C2-C3 alkenylene group or a C2-C3 alkynylene group, or the structural moiety: -AB- (wherein A is an unsubstituted C1-C3 alkylene group and B is a cyclic group selected from triazole, benzene, cyclohexane, piperidine, pyridazine, pyridine, thiazole and imidazole), - R H is C4~C 12 Alkyl, C4-C 12 Alkenyl and C4-C 12 alkynyl, - R 3 is methyl.

[0380] In a third preferred embodiment, The compound of formula (I) has the formula:

[0381] [ka]

[0382] is a compound of -

[0383] [ka]

[0384] , L 1 and R H is expressed by the formula (A-1):

[0385] [ka]

[0386] and are jointly represented by - R 4 , R 5 , R 6 and R 7 are each independently hydrogen, -OR a , -SR a , -NR a R a , -OC(O)R b and -NHC(O)R b is selected from, preferably hydrogen; - L 1 is a C1-C3 alkylene group, a C2-C3 alkenylene group or a C2-C3 alkynylene group, or the structural moiety: -AB- (wherein A is an unsubstituted C1-C3 alkylene group and B is a cyclic group selected from triazole, benzene, cyclohexane, piperidine, pyridazine, pyridine, thiazole and imidazole), - R H is C4~C 12 Alkyl, C4-C 12 Alkenyl and C4-C 12 alkynyl, - R 3 is methyl, - R 2 are each independently hydrogen or methyl; R is a nucleoside or a derivative or analogue thereof, or a C2-C6 alkylene group, a C2-C6 alkenylene group and / or a C2-C6 alkynylene group, said alkylene, alkenylene or alkynylene group optionally interrupted and / or terminated by one or more groups selected from heteroatoms, carbonyl groups, phenyl groups, cyclopentyl or cyclohexyl groups, 5- to 6-membered heteroaryl groups and 5- to 6-membered saturated or partially unsaturated heterocyclic groups.

[0387] Polynucleotides or their analogs or derivatives As described herein, the methods provided include modifying a polynucleotide, or an analog or derivative thereof, by reaction with a compound of formula (I).

[0388] The polynucleotides or their analogs or derivatives may be selected from any suitable natural, non-natural, functionalized, and / or modified polynucleotides. Derivatives and analogs of the above polynucleotides are known in the art.

[0389] Polynucleotides and their analogs may be modified with protecting groups at any of these groups. In particular, it is common for polynucleotides to have protecting groups at their saccharide rings, nucleobases and / or phosphorus-based bonds. Commonly used protecting groups are known in the art.

[0390] For example, amino groups present in nucleobases (e.g., adenine, guanine, cytosine and their derivatives and analogs) may be protected with amine protecting groups known in the art, including acyl groups, such as acetyl, oxyacetyl (including phenoxyacetyl and t-butylphenoxyacetyl), propionyl, isobutyryl, benzoyl and benzylidene. Formamidine groups, such as dimethylformamidine and di-N-butylformamidine groups, may also be used.

[0391] The phosphate linkages may be protected with a phosphate protecting group, e.g., ethyl or 2-cyanoethyl, and the phosphite linkages may be protected with a phosphite protecting group, e.g., ethyl or 2-cyanoethyl. For example, a protected phosphodiester backbone linkage may be present as a phosphotriester, e.g., 2-cyanoethyl phosphotriester.

[0392] The compounds of formula (I) may be reacted with derivatives of polynucleotides in which the saccharide ring is a non-natural saccharide, such as arabinose or a "locked ribose," or contains one or more monomers in which the oxygen atoms normally present in the saccharide ring are replaced with nitrogen atoms, sulfur atoms, or methylene motifs, respectively. A "locked ribose" is a modified ribose moiety having an additional bridge connecting the 2' oxygen and the 4' carbon. An example of a locked ribose moiety is shown below:

[0393] [ka]

[0394] Nucleic acids containing a "locked ribose" saccharide ring are known as "locked nucleic acids" or LNA. LNA has high stability against enzymatic degradation and is a commercially important nucleic acid analogue of RNA and DNA.

[0395] The polynucleotide or its analog or derivative modified by the method of the present disclosure preferably comprises a monomer unit in which the saccharide ring is a ribose or deoxyribose ring. Thus, the polynucleotide or its analog or derivative is preferably a polyribonucleotide or a polydeoxyribonucleotide. Preferably, the polynucleotide or its analog or derivative is a polydeoxyribonucleotide or a derivative or analog thereof.

[0396] A polynucleotide or analog or derivative thereof modified by the method of the present disclosure may contain one or more phosphorus-based linkages between adjacent nucleoside monomer units selected from phosphodiester linkages, phosphotriester linkages such as alkyl phosphotriester linkages, phosphorous acid-triester linkages such as alkyl phosphotriester linkages, phosphorothioate linkages, phosphorodithioate linkages and / or alkyl phosphonate linkages such as methyl phosphonate linkages. In particular, the phosphoramidite method is a common method of polynucleotide synthesis, which first produces a polynucleotide in which the phosphorous-based linkage is a phosphorous acid-triester linkage. The phosphorous acid-triester linkage may also be oxidized to produce a phosphotriester linkage, which may be deprotected to produce a phosphodiester linkage.

[0397] photolabile group

[0398] [ka]

[0399] Disconnection Photolabile Groups of Compounds of Formula (I)

[0400] [ka]

[0401] can be cleaved by photolysis. Usually a photolabile group

[0402] [ka]

[0403] can be cleaved by photoirradiating the compound of formula (I) using UV light.

[0404] [ka]

[0405] can be cleaved by irradiating the photolabile group of the compound of formula (I) using UV light.

[0406] Typically, the wavelength of the UV light used to cleave the photolabile group is about 300 to about 500 nm, preferably about 325 to about 475 nm, more preferably about 350 to about 450 nm. For example, a UV lamp that produces UV light having a wavelength of about 365 nm may be used.

[0407] Irradiation can be carried out for any suitable time scale, depending on the power of the light source used. For example, a power of about 1 W to about 5000 W, such as about 2 W to about 1000 W, for example about 2 W to about 25 W, can be applied. Usually, the higher the power of the light source, the shorter the exposure time required. For example, a light source generating about 2 W to about 10 W, for example about 3 W to about 6 W, for example about 4 or 5 W, can be used to expose the sample in deionized water for about 0.5 hours to about 2 hours, for example about 40 to about 60 minutes, and can result in nearly quantitative cleavage. Alternatively, a light source with a higher power can be used to irradiate the sample, for example about 1 minute to about 30 minutes. In general, the sample can be irradiated for any suitable time, for example about 1 minute to about 10, for example about 10 minutes to about 1 hour, for example about 30 minutes. Such a light source can provide approximately 15 W to about 100 W, for example about 15 W to 25 W. A mercury (Hg) lamp can be used to provide UV irradiation.

[0408] Thus, in some embodiments of the invention, the modified polynucleotide or analog or derivative thereof comprises a photolabile group that can be cleaved by UV irradiation at a power of about 2 W to about 25 W and a frequency of about 300 nm to about 500 nm for about 1 minute to about 2 hours.

[0409] The selection of suitable irradiation conditions is a matter of routine for those skilled in the art.The suitable irradiation conditions can be determined by monitoring the degree of cleavage and by selecting the conditions that allow for substantial or complete cleavage in the shortest time without damaging the synthesized polynucleotide according to the device used.The product of polynucleotide synthesis can be evaluated using techniques such as NMR and mass spectrometry (e.g. UPLC-MS) to monitor the reaction.

[0410] Purification of modified polynucleotides As will be apparent from the discussion herein, the modified polynucleotides or analogs or derivatives thereof produced using the compounds of formula (I) according to the present disclosure can be readily purified by separating the modified polynucleotides or analogs or derivatives thereof from other contaminants based on their hydrophobicity.

[0411] Accordingly, provided herein is a method for purifying a polynucleotide or an analog or derivative thereof, comprising: (i) increasing the hydrophobicity of a polynucleotide, or an analog or derivative thereof, in a reaction mixture by modifying the polynucleotide, or an analog or derivative thereof, as described herein; (ii) separating the modified polynucleotide, or its analog or derivative, from other components in the reaction mixture due to the hydrophobicity of the modified polynucleotide, or its analog or derivative; A method is provided, comprising:

[0412] A preferred purification method is chromatography, which is a method for separating components in a mixture by differential adsorption onto an adsorbent surface (the stationary phase). The components are then eluted with a solvent or mixture of solvents (the mobile phase).

[0413] One convenient chromatographic method is gel filtration. The main way that gel filtration can separate components in a mixture is based on molecular size. Modification of a polynucleotide or its analog or derivative with a compound of formula (I) can increase the size of the polynucleotide or its analog or derivative, so that the modified polynucleotide or its analog or derivative can have different migration characteristics through a gel matrix compared to unmodified contaminants such as truncated sequences. Thus, gel filtration can be used to purify the modified polynucleotide or its analog or derivative from contaminants.

[0414] More commonly, however, high performance liquid chromatography (HPLC) is used to separate the modified polynucleotides from unmodified contaminants and other components in the reaction mixture. An HPLC system typically consists of the following components: an injector, a pump to transport the solvent through the column, an exchangeable HPLC column, a column oven, a solvent mixing system, and a detector (usually UV / visible), all controlled by a PC.

[0415] Typically, purification of modified polynucleotides or analogs or derivatives thereof according to the present disclosure may involve reversed-phase HPLC (RPHPLC). Reverse-phase HPLC separates oligonucleotides from contaminants based on differences in hydrophobicity. Typically, in RPHPLC, a mixture containing the desired modified polynucleotides or analogs or derivatives thereof and other components, such as unmodified truncated sequences and other impurities, is applied to a column. The column typically has a porous silica support with pores of about 10 Å to about 1000 Å, such as about 100 Å to about 500 Å, such as about 200 to about 400 Å, such as about 300 Å. The support typically has a hydrophobic group, such as a carboxyl ... 1-30 Alkyl, alkenyl and / or alkynyl chains, e.g. C 5-20 Modified with alkyl, alkenyl and / or alkynyl chains. Often C8 and C 18Alkyl, alkenyl and / or alkynyl chains may be used. The support is often referred to as the stationary phase.

[0416] The modified polynucleotide or its analog or derivative can be eluted with a hydrophilic (usually aqueous) mobile phase. Usually, ammonium acetate (e.g. triethylammonium acetate, TEAA) can be used. The aqueous phase allows the modified oligonucleotide to strongly interact with the reversed-phase column. Further elution with a gradient of acetonitrile in aqueous ammonium acetate causes the individual components in the mixture to enter the mobile phase, with the increasing percentage of acetonitrile becoming more hydrophobic. Molecules with higher hydrophobicity elute relatively slowly, which leads to the separation of the components in the mixture.

[0417] To optimize the purification achieved, the operating temperature can be controlled by the user according to the identity and structure of the polynucleotide or its analog or derivative. For example, secondary structures such as (e.g., hairpin loops) can cause the oligonucleotide to elute as a broad peak or even a continuous peak. In some embodiments, to overcome this, the HPLC column can be heated (e.g., at about 30 to about 100°C, e.g., about 40 to about 80°C, e.g., about 50°C to about 70°C, e.g., at about 60°C) for a time period of about 1 minute to about 1 hour.

[0418] The operating pH and salt concentration can be adjusted by the user. For example, a pH of about pH 4 to about pH 10, such as about pH 6 to about pH 8, such as about pH 7, can be used. A salt concentration of about 0.01M to about 1M, such as about 0.05M to about 0.5M, such as about 0.1M salt (e.g., about 0.01M to about 1M, such as about 0.05M to about 0.5M, such as about 0.1M TEAA) can be used.

[0419] Other purification techniques that can be used to separate a modified polynucleotide according to the present disclosure or an analog or derivative thereof from other components in the reaction mixture include anion exchange HPLC, fluorous affinity chromatography, and polyacrylamide gel electrophoresis (PAGE).

[0420] It is common for those skilled in the art to select suitable purification or separation techniques.The suitable conditions can be determined by monitoring the purification profile and selecting the conditions that bring about substantial or complete purification in the shortest possible time without causing damage to the synthesized polynucleotide according to the device used.The product of polynucleotide synthesis can be evaluated using techniques such as NMR and mass spectrometry (e.g. UPLC-MS) to monitor the reaction.

[0421] Optionally, the purification method further comprises removing hydrophobic groups from the modified polynucleotide or analog or derivative thereof after purification.

[0422] Accordingly, provided herein is a method for purifying a polynucleotide or an analog or derivative thereof, comprising: (i) increasing the hydrophobicity of a polynucleotide, or an analog or derivative thereof, in a reaction mixture by modifying the polynucleotide, or an analog or derivative thereof, as described herein; (ii) separating the modified polynucleotide, or its analog or derivative, from other components in the reaction mixture due to the hydrophobicity of the modified polynucleotide, or its analog or derivative; (iii) optionally removing hydrophobic groups from the modified polynucleotide, or analogue or derivative thereof, by irradiating the modified polynucleotide, or analogue or derivative thereof, preferably with UV light of a wavelength of about 300 to about 500 nm. A method is provided that includes:

[0423] Method for Producing Polynucleotides or Their Analogs or Derivatives Also provided is a method for producing a polynucleotide or an analog or derivative thereof, comprising the steps of: (i) providing a support-bound polynucleotide or a derivative or analog thereof; (ii) optionally extending the length of the support-bound nucleoside, nucleotide, polynucleotide, or derivative or analog thereof, by introducing one or more additional nucleoside units, nucleotide units, and / or analogs or derivatives thereof; (x) modifying a polynucleotide, or an analog or derivative thereof, by reacting a reactive functional group of the polynucleotide, or an analog or derivative thereof, with a compound of formula (I) as described herein; (iii) cleaving the polynucleotide or analog or derivative thereof from the solid support; and (iv) purifying the modified polynucleotide or an analog or derivative thereof; and (v) optionally cleaving the photolabile group of the compound of formula (I) by irradiating the modified polynucleotide, analog or derivative thereof with light; A first variant of the method is provided, comprising:

[0424] Further provided is a method for producing a polynucleotide, or an analog or derivative thereof, comprising: (i) providing a support-bound polynucleotide, or a derivative or analog thereof; (ii) optionally extending the length of the support-bound nucleoside, nucleotide, polynucleotide, or derivative or analog thereof, by introducing one or more additional nucleoside units, nucleotide units, and / or analogs or derivatives thereof; (iii) cleaving the polynucleotide or analog or derivative thereof from the solid support; and (x) modifying a polynucleotide, or an analog or derivative thereof, by reacting a reactive functional group of the polynucleotide, or an analog or derivative thereof, with a compound of formula (I) as described herein; (iv) purifying the modified polynucleotide or an analog or derivative thereof; and (v) optionally cleaving the photolabile group of the compound of formula (I) by irradiating the modified polynucleotide, analog or derivative thereof with light; A second variation of the method is provided, which comprises:

[0425] Step (i) of the above method may comprise providing a pre-prepared support-bound polynucleotide or analogue or derivative thereof, or alternatively, step (i) may comprise binding the polynucleotide or analogue or derivative thereof to a solid support.

[0426] Any suitable solid support can be used. Preferably, the solid support comprises glass, silica, ceramic, or polymer resin. More preferably, the solid support comprises controlled pore glass (CPG) or polystyrene. The CPG may be treated with a suitable surface treatment to introduce one or more functional groups. A suitable surface treatment comprises silanes, such as (3-aminopropyl)triethoxysilane, to give aminopropyl CPG. The functionalized CPG can be derivatized by reacting the amino moiety of the aminopropyl group with a suitable moiety, such as an ester group. A suitable polystyrene material is usually low-swelling and / or crosslinked. For example, polystyrene can be obtained by polymerizing divinylbenzene, styrene, and 4-chloromethylstyrene in the presence of a porosity agent. The resulting macroporous chloromethyl MPPS can be converted to aminomethyl MPPS. Usually, the solid support is not functionalized with a protein, such as streptavidin.

[0427] Preferably, the solid support comprises particles having a diameter of about 1 μm to about 10,000 μm, more preferably about 5 μm to about 1,000 μm, even more preferably about 10 μm to about 500 μm, for example, about 50 to about 250 μm. Preferably, the solid support material particles are porous. Preferably, when the solid support material is porous, the pore size is about 1 to about 1,000 nm, for example, about 10 to about 100 nm, for example, about 50 nm.

[0428] Preferably, the support material is or comprises beads. The beads may be magnetic, e.g. comprise a magnetic material. The beads may be ferromagnetic or paramagnetic. The beads may have an iron oxide core.

[0429] Preferably, the support material is contained within a column. The total volume of the column may be about 100 μL to about 100 L, for example, about 1 mL to about 1 L. Any suitable total volume can be used depending on the envisaged synthesis scale.

[0430] Step (ii) of the above method typically involves contacting the support-bound polynucleotide, or an analogue or derivative thereof, with a nucleoside, or a derivative thereof, to form a phosphorus-based bond, one or more times.

[0431] The nucleoside or its derivative may be a nucleoside phosphoramidite, a nucleoside H-phosphonate or a nucleoside phosphotriester, preferably an activated nucleoside phosphoramidite, an activated nucleoside H-phosphonate or an activated nucleoside phosphotriester. The nucleoside phosphoramidite may be activated by reacting with tetrazole or its derivative as an activating agent, for example, the group of the phosphoramidite (e.g., the diisopropylamino group of the phosphoramidate) may be protonated by acidic tetrazole or its derivative. The nucleoside H-phosphonate may be activated by reacting with a chlorinating agent such as pivaloyl chloride. The nucleoside nucleoside phosphotriester may be activated by reacting with a coupling agent such as 1-(mesitylsulfonyl)-3-nitro-1H-1,2,4-triazole.

[0432] Preferably, in step (ii), the nucleoside or derivative thereof is an activated nucleoside phosphoramidite. Preferably, the activated nucleoside phosphoramidite has an activated phosphoramidite group at the 3' or 5' position. More preferably, the activated nucleoside phosphoramidite has an activated phosphoramidite group at the 3' position. In many cases, the activated nucleoside phosphoramidite having an activated phosphoramidite group at the 3' position has a hydroxyl protecting group at the 5' position. In many cases, the activated phosphoramidite group has the formula (PH-A):

[0433] [ka]

[0434] (In the formula, R PP is hydrogen, a lone pair of electrons resulting in a negative charge, o-chlorophenyl, p-chlorophenyl, a methyl group, or a 2-cyanoethyl group, preferably a 2-cyanoethyl group. It is expressed as:

[0435] The phosphorus-based bond may be a phosphodiester bond, a phosphotriester bond such as an alkyl phosphotriester bond, a phosphorous-triester bond such as an alkyl phosphorous-triester bond, a phosphorothioate bond, a phosphorodithioate bond, or an alkyl phosphonate bond such as a methyl phosphonate bond. Preferably, the phosphorous-based bond is a phosphorous-triester bond. More preferably, the phosphorous-based bond is a 2-cyanoethyl phosphorous-triester bond.

[0436] Preferably, step (ii) comprises performing one or more of the steps of providing a nucleoside phosphoramidite, activating the nucleoside phosphoramidite, and contacting a support-bound nucleoside, nucleotide, polynucleotide, or derivative or analogue thereof with the activated nucleoside phosphoramidite to form a phosphite triester bond.

[0437] The nucleoside phosphoramidite preferably has a phosphoramidite group at the 3' or 5' position. More preferably, the nucleoside phosphoramidite has a phosphoramidite group at the 3' position. Preferably, the nucleoside phosphoramidite having a phosphoramidite group at the 3' position has a hydroxyl protecting group at the 5' position. Preferably, the phosphoramidite group has the formula (PH):

[0438] [ka]

[0439] (In the formula, R PP is hydrogen, a lone pair resulting in a negative charge, an o-chlorophenyl, a p-chlorophenyl, a methyl group, or a 2-cyanoethyl group, preferably a 2-cyanoethyl group; R a are H or C 1-3 (It is alkyl) It is expressed as:

[0440] Step (ii) may optionally further comprise oxidizing the phosphite triester bond to form a phosphotriester bond.

[0441] Step (ii) may optionally further comprise removing the hydroxyl protecting group.

[0442] More preferably, step (ii) comprises (a)(i) providing a nucleoside having a phosphoramidite group at the 3' position and a hydroxyl protecting group at the 5' position; (b) activating the nucleoside phosphoramidite of step (a); (c) contacting the support-bound polynucleotide, or an analog or derivative thereof, with an activated nucleoside phosphoramidite to form a phosphite triester bond; (d) oxidizing the phosphite triester bond to form a phosphotriester bond; (e) removing the hydroxyl protecting group from the terminal nucleoside of the resulting support-bound polynucleotide; The method includes carrying out the above steps (a) to (e) one or more times.

[0443] Step (b) typically involves contacting the nucleoside phosphoramidite with a suitable activating agent. Any suitable activating agent can be used. Typically, the activating agent is tetrazole or a derivative thereof. Typically, the activating agent and the nucleoside phosphoramidite are contacted in an organic solvent such as acetonitrile.

[0444] Step (c) may be carried out by flowing the activated nucleoside phosphoramidite of step (b) through a column containing a support-bound nucleoside, nucleotide, polynucleotide, or derivative or analog thereof.

[0445] Step (d) typically involves oxidizing the phosphite triester using a suitable oxidizing agent. Any suitable oxidizing agent can be used. Typically, the oxidizing agent is iodine. Iodine may be used in the reaction together with a suitable solvent, for example, water and pyridine (for example, water / pyridine / THF 2 / 20 / 78, with iodine at a concentration of about 0.01-0.02M).

[0446] Step (e) may be carried out by contacting the support-bound polynucleotide obtained in step (d) with a suitable reagent. Typically, deprotection involves contacting the support-bound polynucleotide with a concentrated aqueous base, such as aqueous ammonia. The aqueous solution may be removed by evaporation.

[0447] Step (ii) may include repeating the reacting step at least once, at least twice, at least five times, at least 10 times, at least 20 times, at least 30 times, at least 40 times, at least 50 times, at least 100 times, at least 150 times, at least 200 times, at least 500 times, at least 1000 times, or more. Thus, step (ii) may include forming a polynucleotide that is at least 2 monomer units, at least 5 monomer units, at least 10 monomer units, at least 20 monomer units, at least 30 monomer units, at least 40 monomer units, at least 50 monomer units, at least 100 monomer units, at least 150 monomer units, at least 200 monomer units, at least 500 monomer units, at least 1000 monomer units, or more in length. One skilled in the art will appreciate that the nucleoside or derivative thereof bound to the support-bound nucleoside provided in step (i) may be the same or different in each repetition. Thus, the sequence of a polynucleotide synthesized by the method can be determined by a user of the method, for example, an operator of an instrument configured for synthesizing polynucleotides.

[0448] Step (x) involves modifying the polynucleotide or its analogue or derivative (see below), either when bound to the support or after cleavage from the support, by reacting the polynucleotide or its analogue or derivative with a compound of formula (I). The reaction of the polynucleotide or its analogue or derivative with a compound of formula (I) typically proceeds as described, or substantially as described, in step (ii) above.

[0449] Preferably, the disclosed method includes one or more steps of deprotecting the polynucleotide or its analog or derivative. Preferably, deprotecting the polynucleotide or its analog or derivative includes removing protecting groups from one or more nucleobases and / or one or more phosphorus-based bonds present in the support-bound polynucleotide. Deprotection can be achieved by treating the polynucleotide or its analog or derivative with a suitable reagent depending on the protecting group used. For example, benzoyl, isobutyryl and dimethylformamidyl protecting groups that are typically used to protect nucleobases can be removed using concentrated ammonium hydroxide. Ultra-mild protecting groups that are used to protect nucleobases, such as phenoxyacetyl, acetyl and isopropylphenoxyacetyl groups, can typically be removed using a methanolic solution of potassium carbonate or a mixture of aqueous ammonia and aqueous methylamine. Cyanoethyl phosphotriester groups can be used to protect phosphodiester backbones and can be removed using concentrated ammonium hydroxide. Phosphate groups can be protected as methyl triesters and removed using thiophenol.

[0450] In step (iii), the polynucleotide or its analog or derivative is cleaved from the solid support. Typically, the polynucleotide or its analog or derivative is attached to the solid support using a succinyl linker that can be readily cleaved by treatment with concentrated ammonium hydroxide at room temperature for 1 hour.

[0451] In step (iv), the modified polynucleotide or its analog or derivative is purified. Typically, the modified polynucleotide or its analog or derivative is purified by separating it from other components in the reaction mixture, such as truncated polynucleotide, unreacted monomers, and removed protecting groups. Typically, the modified polynucleotide or its analog or derivative is separated from said groups according to the hydrophobicity of the modified polynucleotide or its analog or derivative. Typically, the modified polynucleotide or its analog or derivative is separated from other components of the reaction mixture by chromatography, for example by high performance liquid chromatography (HPLC). The modified polynucleotide or its analog or derivative can be purified by reverse phase (RP) HPLC, as described in more detail herein.

[0452] In optional step (v), the modified polynucleotide or analog or derivative thereof is subjected to photolysis to form the hydrophobic modification R H is cleaved from the purified polynucleotide or analog or derivative thereof. Photocleavage typically involves irradiating the modified polynucleotide or analog or derivative thereof. Thus, photolytic cleavage typically involves irradiating the photolabile group of the compound of formula (I). Typically, the modified polynucleotide or analog or derivative thereof is irradiated with ultraviolet light as described herein.

[0453] The methods disclosed herein can be carried out at any suitable temperature and under conventional solvent conditions readily available to one of skill in the art. Typically, the reaction is carried out at about 10° C. to about 100° C., such as about 20° C. to about 50° C., for example, about 25° C. to about 30° C. In many cases, the reaction can be carried out at room temperature.

[0454] Products of the disclosed methods The methods of the present disclosure can be used to generate modified polynucleotides or analogs or derivatives thereof. Accordingly, also provided herein are polynucleotides or derivatives or analogs thereof obtainable or obtainable by the methods provided herein.

[0455] The term "polynucleotide", when referring to a polynucleotide that has been modified or modified according to the present disclosure, refers to a single-stranded or double-stranded covalently linked sequence of nucleotides, where the 3' and 5' ends of each nucleotide are joined by a phosphorus-based bond, depending on the context. The phosphorus-based bond present in the product of the method of the present disclosure may be a phosphodiester bond, as in natural polynucleotides, or a non-natural phosphorus-based bond, such as a phosphotriester bond, for example, an alkylphosphotriester bond, such as a methylphosphotriester bond and an ethylphosphotriester bond; a phosphorothioate bond; a phosphorodithioate bond; and an alkylphosphonate bond, such as a methylphosphonate bond.

[0456] A polynucleotide may be composed of deoxyribonucleotide or ribonucleotide bases. A nucleic acid may further include modified DNA or RNA, such as methylated DNA or RNA, or RNA that has been subjected to post-translational modifications, such as 5'-capping with 7-methylguanosine, 3'-processing such as cleavage and polyadenylation, and splicing. A nucleic acid may also include synthetic nucleic acids (XNA), such as hexitol nucleic acid (HNA), cyclohexene nucleic acid (CeNA), threose nucleic acid (TNA), glycerol nucleic acid (GNA), locked nucleic acid (LNA), and peptide nucleic acid (PNA). The size of a nucleic acid, also referred to herein as a "polynucleotide", is usually expressed in terms of the number of base pairs (bp) for double-stranded polynucleotides, or as the number of nucleotides (nt) for single-stranded polynucleotides. 1000 bp or 1000 nt is equal to 1 kilobase (kb). Polynucleotides less than about 40 nucleotides in length are commonly referred to as "oligonucleotides" and may include primers for use in DNA manipulation, for example, via the polymerase chain reaction (PCR).

[0457] A polynucleotide may have any combination of any nucleotides. The nucleotides may be naturally occurring or artificial. One or more nucleotides of the polynucleotide may be oxidized or methylated. One or more nucleotides of the polynucleotide may be damaged. For example, the polynucleotide may include pyrimidine dimers. The dimers are usually associated with ultraviolet light damage and are the main cause of skin melanoma. One or more nucleotides of the polynucleotide may be modified, for example with a label or tag, suitable examples of which are known by those skilled in the art. The polynucleotide may include one or more spacers. A nucleotide typically contains a nucleobase, a sugar and at least one phosphate group, as described in more detail herein. The nucleobase and the sugar form a nucleoside. The nucleobase is usually heterocyclic. The nucleobase includes, but is not limited to, purines and pyrimidines, more specifically adenine (A), guanine (G), thymine (T), uracil (U), and cytosine (C). The sugar is usually a pentose sugar. Nucleotide sugars include, but are not limited to, ribose and deoxyribose. The sugar is preferably deoxyribose. The polynucleotide preferably includes the following nucleosides: deoxyadenosine (dA), deoxyuridine (dU) and / or thymidine (dT), deoxyguanosine (dG), and deoxycytidine (dC). The nucleotides are typically ribonucleotides or deoxyribonucleotides. The nucleotides typically contain monophosphates, diphosphates, or triphosphates. The nucleotides may contain more than three phosphates, for example, four or five phosphates. The phosphates may be attached to the 5' or 3' positions of the nucleotide. The nucleotides of the polynucleotide may be attached to each other in any manner. The nucleotides are typically attached by their sugar and phosphate groups, similar to nucleic acids. The nucleotides may be linked via their nucleobases, such as in pyrimidine dimers.

[0458] The nucleotides contained in the polynucleotide include, but are not limited to, adenosine monophosphate (AMP), guanosine monophosphate (GMP), thymidine monophosphate (TMP), uridine monophosphate (UMP), 5-methylcytidine monophosphate, 5-hydroxymethylcytidine monophosphate, cytidine monophosphate (CMP), cyclic adenosine monophosphate (cAMP), cyclic guanosine monophosphate (cGMP), deoxyadenosine monophosphate (dAMP), deoxyguanosine monophosphate (dGMP), deoxythymidine monophosphate (dTMP), deoxyuridine monophosphate (dUMP), deoxycytidine monophosphate (dCMP) and deoxymethylcytidine monophosphate.The nucleotide is preferably selected from AMP, TMP, GMP, CMP, UMP, dAMP, dTMP, dGMP, dCMP and dUMP.The nucleotide may be abasic (i.e., lacking a nucleobase). A nucleotide may also lack a nucleobase and a sugar (ie, a C3 spacer).

[0459] Typically, a polynucleotide consists of or contains DNA and / or RNA, preferably DNA.

[0460] A polynucleotide may be at least 10, at least 50, at least 100, at least 150, at least 200, at least 250, at least 300, at least 400 or at least 500 nucleotides or nucleotide pairs in length. Thus, for example, a polynucleotide may be from about 10 to about 1000 or more nucleotides or nucleotide pairs in length, such as from about 10 to about 500, such as from about 20 to about 500, such as from about 30 to about 250, such as from about 50 to about 150 nucleotides or nucleotide pairs in length.

[0461] A population of polynucleotides Also provided is a population of purified polynucleotides or analogs or derivatives thereof, said population having improved properties compared to populations of polynucleotides produced by the prior art. The advantages arise when the polynucleotides are used in high-tech applications, including pharmaceuticals (e.g. for gene therapy) and other applications of gene synthesis. In particular, it is important to remove as far as possible any possible contamination resulting from the introduction of impurities into the genetic construct, e.g. truncation impurities. However, current methods for purifying polynucleotides are not able to provide the very high purity levels required for these applications. This is particularly the case when the desired polynucleotide is modified with a modifying group, such as an R group as defined herein. In such cases, there are essentially two options. If the modification is performed prior to purification, the limitations of the purification method often mean that a homogenous population cannot be generated. If the purification is performed prior to modification, the inefficiencies of the modification chemistry often mean that a homogenous population cannot be generated in this case either.

[0462] Thus, the present disclosure provides a homogenous population comprising a plurality of polynucleotides or analogs or derivatives thereof, such as a homogenous population comprising a plurality of modified polynucleotides or analogs or derivatives thereof, which may be at least 90% pure, such as at least 91%, for example at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.9%, or at least 99.99% or more.

[0463] The present disclosure also provides a homogeneous population comprising a plurality of modified polynucleotides or analogs or derivatives thereof, wherein at least 90% of the monomers in the population are chemically modified with an R group as defined herein. In some embodiments, at least 90%, such as at least 91%, such as at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.9% or at least 99.99% or more of the monomers in the population are modified with a modifying group. In some embodiments, 100% of the monomers in the population are modified with a modifying group. As explained above, known methods are usually unable to provide the homogeneous population, since modification chemistries are usually not 100% effective, and modified monomers usually cannot be easily separated or purified from impurities.

[0464] Uses of polynucleotides produced by the methods of the present disclosure Polynucleotides modified and / or purified according to the present disclosure have many potential uses, and the uses are not particularly limited, and the polynucleotides provided herein and by the methods disclosed herein can be used in any application where a polynucleotide is required.

[0465] In some embodiments, the methods provided herein allow for the preparation of polynucleotides with very high purity.Therefore, the polynucleotides provided herein are particularly useful for applications that require high purity.Preferably, the purity of the polynucleotides obtained by the methods disclosed herein is at least 99%, such as at least 99.9%, such as at least 99.99%, more preferably at least 99.999% or more.

[0466] One application of the polynucleotides provided herein is in PCR (polymerase chain reaction). Methods for carrying out PCR are well known to those skilled in the art. For example, one embodiment of carrying out PCR includes contacting a primer that is complementary to the target polynucleotide under conditions that allow polymerase to catalyze chain extension with the target polynucleotide, thereby amplifying the target polynucleotide. The polynucleotides provided herein are particularly useful as primers for PCR due to their high purity.

[0467] Another use of the polynucleotides provided herein is in the preparation of therapeutic polynucleotides, which are being investigated for use in the treatment of a variety of disease states and have particular use as anti-cancer and anti-viral drugs.

[0468] Further applications of the polynucleotides provided herein include applications in next-generation sequencing technology.For example, the polynucleotides provided herein can be used as barcodes in single-cell sequencing technology, such as drop sequence sequencing.

[0469] In standard drop sequencing techniques, a microfluidic device is used to generate an emulsion of water droplets in oil, where each droplet contains a maximum of a single biological cell (e.g., a mammalian cell, such as a human cell, or a bacterial cell) and a barcoded solid support, e.g., a barcoded bead, bound to a polynucleotide sequence that defines a polynucleotide "barcode." The polynucleotides provided herein can be used in this approach.

[0470] More specifically, support-bound polynucleotides for use in drop sequence sequencing typically include a molecular beacon for identifying cellular target polynucleotides, a polynucleotide "barcode" and a universal sequence. Support-bound polynucleotides typically include a 3'-polyT end, i.e., there are several consecutive, e.g., about 5 to about 50, e.g., about 10 to about 40, e.g., about 30, nucleotide units having thymine as their nucleobase at the 3' end of the polynucleotide. The molecular beacon may include about 5 to about 15 nucleotides. The barcode may have about 4 to about 50, e.g., about 5 to about 30, e.g., about 6 to about 20, e.g., about 8 to about 15 monomer units. The universal sequence may be of any desired length.

[0471] Cells usually contain mRNA with a 5'-polyA region. That is, there are several consecutive nucleotides at the 5' end of the mRNA with adenine as the nucleobase. Typically, in drop sequencing technology, cells are lysed and their mRNAs are released into their respective droplets. The 5'-polyA region of the mRNA strand hybridizes to the 3'-polyT end of the support-bound polynucleotide, thereby capturing the mRNA strand from a single cell onto a single solid support. The resulting support-bound polynucleotide-mRNA ensemble is often referred to as "STAMPs" - Single cell Transcriptomes Attached to MicroParticles. The emulsion may then be broken, releasing the STAMPS, which can be used to create a transcriptome library. The STAMPS can be identified by the barcode on the solid support and can undergo reverse transcription, PCR and sequencing to determine the mRNA strand sequence.

[0472] The support-bound polynucleotides with 3'-polyT ends used in conventional drop sequencing technology can be synthesized directly on the solid support, for example, using solid-phase polynucleotide synthesis in the 3' to 5' direction, and the chemical nature of the 5' end can be modified by the modifications herein. Alternatively, the polynucleotides can be synthesized as described herein and then coupled to a solid support for use in drop sequencing technology. As a further alternative, the polynucleotides can be synthesized in the 5' to 3' direction to obtain a free 3' end that can be hybridized to an mRNA strand. The chemical nature of the 3' end can be modified by the modifications herein. Alternatively, the polynucleotides can be synthesized as described herein and then coupled to a solid support for use in drop sequencing technology. Subsequent reverse transcription and PCR steps can then be performed "in droplets" to sequence the mRNA strands present in each individual droplet.

[0473] Thus, provided herein is a method of sequencing a polynucleotide expressed by a cell, comprising providing a support-bound polynucleotide, the polynucleotide being modified as described herein; contacting the support-bound polynucleotide with a target polynucleotide under conditions in which the support-bound polynucleotide hybridizes to the target polynucleotide; enzymatically synthesizing a complementary polynucleotide strand complementary to the target polynucleotide; and determining a sequence of the target polynucleotide by sequencing the synthesized complementary polynucleotide strand or the complementary polynucleotide strand.

[0474] Further aspects of the invention As discussed in more detail herein, the present invention provides methods that involve the use of compounds of formula (I). The present invention also provides compounds of formula (I) themselves.

[0475] Thus, as used herein, a compound of formula (I):

[0476] [ka]

[0477] (In the formula, R H , L 1 ,

[0478] [ka]

[0479] , R, n and R P are as defined herein) is provided.

[0480] As will become apparent below, this compound is useful in the methods provided herein. In addition, the formula (I * ) group:

[0481] [ka]

[0482] (In the formula, R H , L 1 ,

[0483] [ka]

[0484] , R and n are as defined herein; - R P* is a phosphorus bond, - The wavy line indicates the point of attachment to the polynucleotide or its derivative or analogue. Also provided is a modified polynucleotide comprising:

[0485] Usually, R P*is a phosphodiester bond, a phosphotriester bond, a phosphite-triester bond, a phosphite-diester bond, a phosphorothioate bond, a phosphorodithioate bond, an alkylphosphonate bond or an alkylphosphonite bond. More usually, R P* is a phosphorous acid-triester bond or an alkylphosphonite bond or a phosphodiester bond or an alkylphosphonate bond. More usually, R P* is a phosphorous acid-triester bond or an alkylphosphonite bond. Even more commonly, R P* is a phosphite-triester bond or a methylphosphonite bond.

[0486] Usually, the formula (I * ) is attached to the 3' or 5' position of the polynucleotide or its analog or derivative modified with said group. Most often, (I * The group of formula (I) is attached to the 5' position of the polynucleotide or its analog or derivative. * ) group is attached via a bond to the 5' oxygen atom of the polynucleotide or its analog or derivative.

[0487] Also provided herein is a compound of formula (I) for modifying a polynucleotide or a derivative or analogue thereof.

[0488] [ka]

[0489] (In the formula, R H , L 1 ,

[0490] [ka]

[0491] , R, n and R Pis as defined herein), typically for increasing the hydrophobicity of a polynucleotide or a derivative or analogue thereof.

[0492] There is also provided the use of a compound of formula (I) as defined herein for purifying a polynucleotide or a derivative or analogue thereof, typically for chromatographic purification of a polynucleotide or a derivative or analogue thereof based on the hydrophobicity of the modified polynucleotide or analogue or derivative thereof, for example by HPLC, for example via RPHPLC as described in more detail herein.

[0493] Further embodiments of the present invention Further provided is an apparatus for performing polynucleotide synthesis, comprising: - a solid support bound to a polynucleotide, said polynucleotide being modified with a compound of formula (I) as defined herein; a light source for irradiating the solid support and thereby cleaving the photolabile group of the compound of formula (I); An apparatus is provided that includes:

[0494] Preferably, the solid support, the light source and the photocleavable linker are as defined herein.

[0495] moreover, - a solid support bound to a polynucleotide having a reactive functional group for reaction with a compound of formula (I); a compound of formula (I) for reaction with a polynucleotide, a light source for irradiating the solid support and thereby cleaving the photolabile group of the compound of formula (I); A system is provided that includes:

[0496] Preferably, the solid support, the light source and the photocleavable linker are as defined herein.

[0497] method The compounds of the present invention can be prepared by any suitable method.Details of the general synthetic route of the representative compounds of the present invention are described below and in the examples.Those skilled in the art should be able to apply the synthesis details provided herein to easily prepare other compounds disclosed herein.However, by way of overview, the compounds provided herein can generally be prepared by reaction according to one of the following schemes.

[0498] Exemplary compounds of formula (I) of the compound of formula (II-3) can generally be prepared according to the following reaction scheme.

[0499] [ka]

[0500] The starting material SM is readily available. A: SM, e.g., L 1 -R H (For example, compounds such as 1-octyne are used to 1 is C2 alkynylene and R H can provide compounds in which R is a C6 alkyl. An ethylene glycol derivative can provide a cycloadduct in step B using hydride donation, for example with sodium borohydride, leading to a decyclized compound in step C. P Reaction of (e.g. bis(diisopropylamino)(methyl)phosphine) with the phosphorus center gives the final compound.

[0501] The exemplified compound of formula (I), which is a compound of formula (II-1), can generally be prepared according to the following reaction scheme.

[0502] [ka]

[0503] SOCl2 may be added, for example, to R 3A: Activation of the carboxylic acid for reaction with the Grignard derivative of L. Other functionalization chemistries are readily available. B: Reduction of the carboxylic acid can be achieved, for example, with NaBH4 to give the alcohol. C: Reduction of L via standard nucleophilic substitution, for example 1 -R H to L by a reaction using, for example, NaN3 to convert the bromine to the azide. 1 -R H In step D, the reaction of the terminal hydroxy group R P Reaction of the aryl amine (e.g. 2-cyanoethoxy-N,N-diisopropylaminochlorophosphine) with the phosphorus center gives the final compound.

[0504] The exemplified compound of formula (I), which is the compound of formula (II-2), can generally be prepared according to the following reaction scheme.

[0505] [ka]

[0506] SOCl2 may be added, for example, to R 3 Activates the carboxylic acid for reaction with Grignard derivatives of . Other functionalization chemistries are readily available. B: Reduction of the carboxylic acid can be achieved, for example, with NaBH4 to give the alcohol (when Q is O). When Q is other than O, standard transformations can be used to convert the alcohol to other functional groups. C: Reduction of L via, for example, standard nucleophilic substitution 1 -R H to L by a reaction using, for example, NaN3 to convert the bromine to the azide. 1 -R H In step D, the reaction with the sulfur-containing CR 2 Reaction with the 2- derivative introduces a reactive group for reaction with the R derivative (E), such as the HO-R-OH moiety. F: R of the terminal hydroxy groupP Reaction of the aryl amine (e.g. 2-cyanoethoxy-N,N-diisopropylaminochlorophosphine) with the phosphorus center gives the final compound.

[0507] Detailed synthetic routes for exemplary compounds of the invention are set forth below. Although specific embodiments, specific configurations, and materials and / or molecules have been discussed herein for the method according to the present invention, it should be understood that various changes or modifications in form and details can be made without departing from the scope and spirit of the present invention. The following examples are provided to better illustrate specific embodiments, and should not be considered as limiting this application. This application is limited only by the claims. EXAMPLES

[0508] Experimental Procedure All reagents were purchased from Sigma-Aldrich, Alfa Aesar, Fisher Scientific, Fluorochem, Carbosynth, TCI or Link Technologies and used without further purification. Anhydrous pyridine, triethylamine, diisopropylethylamine and dichloromethane were freshly distilled over calcium hydride. All air / moisture sensitive reactions were carried out under argon in oven-dried glassware. Aluminum-backed Merck Silica Gel 60 F 254Reactions were monitored by thin-layer chromatography using plates. The compounds were visualized by UV irradiation at 254 / 260 nm and by staining with the appropriate solutions (p-anisaldehyde, potassium permanganate, ninhydrin, Mary's reagent). Flash chromatography was performed using a Biotage Isolera with KP-Sil or Sfa Duo cartridges or manually using Merck silica gel 60 (40-63 μm). NMR spectra were measured using a Bruker AVII400 FT-NMR spectrometer or a Bruker AVIIIHD400 FT-NMR spectrometer. Chemical shifts are given in ppm and were internally referenced to the appropriate solvent signals. Coupling constants (J) are given in Hertz (Hz) and identification is by COSY, 13 C, HMBC, and DEPT experiments were assisted. Chemical names were generated using ChemDraw (Perkin Elmer).

[0509] Example 1: 5'-PCPO 3 Synthesis of This example describes the synthesis of a compound of formula (I), which is a compound of formula (II-1). 1-(5-methyl-2-nitrophenyl)ethan-1-one

[0510] [ka]

[0511] To a solution of 5-methyl-2-nitrobenzoic acid (5 g, 27.6 mmol) in anhydrous toluene (30 mL) was added thionyl chloride (6 mL, 82.8 mmol) and the mixture was refluxed under argon at 80° C. for 3 h. The mixture was concentrated to give 5-methyl-2-nitrobenzoyl chloride as a yellow oil (5.5 g) which was carried on without further purification.

[0512] To a suspension of anhydrous magnesium chloride (2.36 g, 24.8 mmol) and diethyl malonate (5 mL, 33 mmol) in anhydrous ethyl acetate (80 mL) was added anhydrous triethylamine (16 mL) slowly at 0 °C. After stirring for 45 min, a solution of 5-methyl-2-nitrobenzoyl chloride (5.5 g) in anhydrous ethyl acetate (10 mL) was added. The mixture was heated to 60 °C and stirred for 30 min. Once complete, the reaction was extracted with ethyl acetate, washed with dilute hydrochloric acid (1 M), water, dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. A solution of glacial acetic acid (30 mL) and concentrated sulfuric acid (6 mL) was added and the mixture was refluxed for 12 h. The reaction mixture was cooled in an ice bath, made alkaline with sodium hydroxide and the product was extracted with dichloromethane before purification by flash chromatography (0-50% ethyl acetate in hexane) to give the title compound (3.79 g, 21.2 mmol, 77%).

[0513] 1 H NMR (400 MHz, CDCl3) δ ppm 8.03 (d, 1H, J = 8.4 Hz, C H Ar), 7.38 (m, 1H, C H Ar), 7.18 (m, 1H, C H Ar), 2.54 (s, 1H, C H 3CO), 2.48 (s, 1H, C H 3). 1-(5-(bromomethyl)-2-nitrophenyl)ethan-1-one

[0514] [ka]

[0515] To a solution of 1-(5-methyl-2-nitrophenyl)ethan-1-one (3.79 g, 21.2 mmol) in anhydrous acetonitrile (25 mL) were added N-bromosuccinimide (4.14 g, 23.3 mmol) and 1,1'-azobis(cyclohexanecarbonitrile) (0.52 g, 2.12 mmol), and the mixture was refluxed for 12 h. After cooling to room temperature, the solvent was removed and the residue was dissolved in toluene (25 mL) and filtered. The filtrate was concentrated and purified by flash chromatography (0-50% ethyl acetate in hexane) to give the title compound (3.74 g, 14.5 mmol, 68%).

[0516] 1 H NMR (400 MHz, CDCl3) δ ppm 8.09 (d, 1H, J = 8.4 Hz, C H Ar), 7.62 (dd, 1H, J = 8.5, 2.0 Hz, C H Ar), 7.43 (d, 1H, J = 2.0 Hz, C H Ar), 4.50 (s, 2H, C H 2Br), 2.57 (s, 1H, C H 3CO). 1-(5-(bromomethyl)-2-nitrophenyl)ethan-1-ol

[0517] [ka]

[0518] 1-(5-(bromomethyl)-2-nitrophenyl)ethan-1-one (3.74 g, 14.5 mmol) was dissolved in a mixture of anhydrous methanol (38 mL) and anhydrous dioxane (25 mL) whereupon sodium borohydride (0.822 g, 21.7 mmol) was added slowly at 0° C. before it was allowed to warm to room temperature over 12 h. Water (60 mL) and 1 M hydrochloric acid (15 mL) were added and the suspension was extracted with ethyl acetate, dried over anhydrous sodium sulfate, filtered, concentrated and then purified by flash chromatography (0-50% ethyl acetate in hexanes) to give the title compound (3.38 g, 13.0 mmol, 90%).

[0519] 1 H NMR (400 MHz, CDCl3) δ ppm 7.91 (d, 1H, J = 8.4 Hz, C H Ar), 7.87 ppm (d, 1H, J = 2.0 Hz, C H Ar), 7.45 (m, 1H, C H Ar), 5.46 (q, 1H, J = 6.4 Hz, CH3C H ), 4.51 (s, 1H, C H 2Br), 2.27 (br. s, 1H, O H ), 1.58 (d, 3H, J = 6.4 Hz, C H 3CH). 1-(5-(azidomethyl)-2-nitrophenyl)ethan-1-ol

[0520] [ka]

[0521] To a solution of 1-(5-(bromomethyl)-2-nitrophenyl)ethan-1-ol (2.49 g, 9.57 mmol) in anhydrous dimethylformamide (30 mL) was added sodium azide (0.93 g, 14.4 mmol) and the mixture was stirred at room temperature for 3 h. The mixture was concentrated and then extracted from ethyl acetate with water, dried over anhydrous sodium sulfate, filtered, and concentrated before purification by flash chromatography (0-50% ethyl acetate in hexanes) to give the title compound (1.95 g, 8.77 mmol, 92%).

[0522] 1 H NMR (400 MHz, CDCl3) δ ppm 7.95 (d, 1H, J = 8.4 Hz, C H Ar), 7.81 (d, 1H, J = 2.0 Hz, C H Ar), 7.39 (dd, 1H, J = 8.4, 2.0 Hz, C H Ar), 5.48 (q, 1H, J = 6.4 Hz, CH3C H ), 4.49 (s, 2H, C H 2N3), 2.17 (br. s, 1H, O H ), 1.59 (d, 3H, J = 6.4 Hz, C H 3CH). 1-(5-(4-(hexyl)-1h-1,2,3-triazol-1-ylmethyl)-2-nitrophenyl)ethan-1-ol

[0523] [ka]

[0524] 1-(5-(azidomethyl)-2-nitrophenyl)ethan-1-ol (0.95 g, 4.3 mmol) and 1-octyne (0.96 mL, 6.5 mmol) were added to a 3:1:1 mixture of tetrahydrofuran / tert-butanol / water (54 mL / 18 mL / 18 mL). 7.5% aqueous copper(II) sulfate (8.8 mL) and (+)-sodium L-ascorbic acid 1 M aqueous solution (9.7 mL) were added and the reaction was stirred at room temperature for 2 h. The mixture was diluted with ethyl acetate and the organic phase was washed with saturated sodium bicarbonate and brine (diluted to 10% with water), dried over anhydrous sodium sulfate, filtered and concentrated. The crude material was purified by flash chromatography (0-100% ethyl acetate in hexanes) to give the title compound (1 g, 3 mmol, 70%).

[0525] 1 H NMR (400 MHz, CDCl3) δ ppm 7.9 (d, 1H, J = 8.3 Hz, C H Ar), 7.78 (d, 1H, J = 2.0 Hz, C H Ar), 7.29 (br s, 1H, C H Triazole), 7.2 (dd, 1H, J = 8.3 Hz, 2.0 Hz, C H Ar), 5.59 (s, 2H, C H 2N), 5.46 (q, 1H, J = 6.4 Hz, C H CH3), 2.7 (t, 2H, J = 7.7 Hz, triazole C H 2CH2), 1.71-1.62 (m, 2H, triazole CH2C H 2), 1.56 (d, 3H, J = 6.4 Hz, CHC H 3), 1.40-1.25 (m, 6H, C H 2C H 2C H 2CH3), 0.91-0.84 (m, 3H, CH2CH2CH2C H 3) 2-Cyanoethyl(1-(5-((4-hexyl-1H-1,2,3-triazol-1-yl)methyl)-2-nitrophenyl)ethyl)diisopropylphosphoramidite

[0526] [ka]

[0527] A solution of 1-(5-(4-(hexyl)-1h-1,2,3-triazol-1-ylmethyl)-2-nitrophenyl)ethan-1-ol (0.43 g, 1.3 mmol) in anhydrous dichloromethane (10 mL) was degassed under argon for 5 min, followed by the addition of anhydrous diisopropylethylamine (0.68 mL, 3.9 mmol). 2-Cyanoethoxy-N,N-diisopropylaminochlorophosphine (0.35 mL, 1.55 mmol) was added dropwise and the reaction was stirred at room temperature for 1 h. The reaction mixture was diluted with anhydrous dichloromethane (2×20 mL), washed with degassed saturated potassium chloride (30 mL), passed through anhydrous sodium sulfate, concentrated, and dried under high vacuum. The crude product was purified by flash chromatography under argon (80% ethyl acetate (0.2% pyridine in hexanes) to give the title compound (0.6 g, 1.13 mmol, 87%) as a colorless oil, which was dissolved in degassed anhydrous acetonitrile and filtered through a 0.45 μm syringe filter before concentration and aliquoting.

[0528] 1 H NMR (400 MHz, CD3CN) δ ppm 7.89 (t, 1H, J = 8.5 Hz, C H Ar), 7.72 (d, 0.5H, J = 2.0 Hz, C H Ar), 7.67 (d, 0.5H, J = 2.1 Hz, C H Ar), 7.57 (s, 0.5H, C H Triazole), 7.55 (s, 0.5H, C H Triazole), 7.33 (dd, 1H, J = 8.4Hz, 2.0 Hz, C HAr), 5.62-5.58 (m, 2H, C H 2N), 5.48-5.36 (m, 1H, C H CH3), 3.85-3.40 (m, 4H, C H 2CH2CN, 2 x C H (CH3)2), 2.69-2.63 (m, 3H, CH2C H 2CN, Triazole C H 2CH2), 2.53 (t, 1H, J = 5.8 Hz, triazole C H 2CH2), 1.67-1.58 (m, triazole CH2C H 2), 1.52 (t, 3H, J = 6.4 Hz, CHC H 3), 1.37-1.26 (m, 6H C H 2C H 2C H 2CH3), 1.17-1.09 (m, 9H, 2 x CH(C H 3)2), 0.9-0.85 (m, 3H, CH2CH2CH2C H 3), 0.83 (d, 3H, J = 6.7 Hz, 2 x CH(C H 3)2). 31 P { 1 H} NMR (162 MHz, CD3CN) δ ppm 148.5, 148.3 Example 2: Synthesis of 5'-PC C3 This example describes the synthesis of a compound of formula (I), which is a compound of formula (II-2). ((1-(5-(4-(hexyl)-1h-1,2,3-triazol-1-ylmethyl)-2-nitrophenyl)ethoxy)methyl)(methyl)sulfane

[0529] [ka]

[0530] Acetic anhydride (12 mL) and glacial acetic acid (8 mL) were added to a solution of 1-(5-(4-(hexyl)-1h-1,2,3-triazol-1-ylmethyl)-2-nitrophenyl)ethan-1-ol (0.5 g, 1.5 mmol) in dimethyl sulfoxide (8 mL), and the reaction mixture was stirred at room temperature for 20 hours. The reaction mixture was poured into ice-cold saturated aqueous sodium carbonate solution, stirred for an additional 30 minutes, and then extracted with ethyl acetate. The combined organic layer was washed with saturated aqueous sodium carbonate, water, and brine, then dried over anhydrous sodium sulfate, and concentrated. The crude product was purified by flash chromatography (hexane containing 0-30% ethyl acetate) to give the title compound (0.36 g, 0.92 mmol, 61%).

[0531] 1 H NMR (400 MHz, CDCl3) 7.92 (d, 1H, J = 8.3 Hz, C H Ar), 7.65 (d, 1H, J = 2.1 Hz, C H Ar), 7.27 (br. s, 1H, C H Triazole), 7.23 (dd, 1H, J = 8.4 Hz, 2.1 Hz , C H Ar), 5.65-5.55 (m, 2H, C H 2N), 5.41 (q, 1H, J = 6.3 Hz, C H CH3), 4.6 (d, 1H, J = 11.5 Hz, C H 2SCH3), 4.3 (d, 1H, J = 11.5 Hz, C H 2SCH3), 2.75-2.7 (m, 2H, triazole C H 2CH2), 2.1 (s, 3H, CH2SC H 3), 1.72-1.62 (m, 2H, triazole CH2C H 2), 1.52 (d, 3H, J = 6.4 Hz, CHC H 3), 1.40-1.27 (m, 6H, C H 2C H 2C H2CH3), 0.91-0.85 (m, 3H, CH2CH2CH2C H 3) ((1-(5-(4-(hexyl)-1h-1,2,3-triazol-1-ylmethyl)-2-nitrophenyl)ethoxy)methoxy)propan-1-ol

[0532] [ka]

[0533] To a solution of ((1-(5-(4-(hexyl)-1h-1,2,3-triazol-1-ylmethyl)-2-nitrophenyl)ethoxy)methyl)(methyl)sulfane (0.16 g, 0.4 mmol) and 1,3-propanediol (0.57 mL, 8 mmol) in anhydrous tetrahydrofuran (2 mL) at -40 °C, N-iodosuccinimide (0.09 g, 0.4 mmol) and 4 Å molecular sieves were added, followed by triflic acid (0.035 mL, 0.4 mmol), and the mixture was stirred for 30 min. The reaction was quenched with triethylamine, filtered through Celite, and then concentrated in vacuo. The residue was dissolved in ethyl acetate and washed with saturated aqueous sodium thiosulfate. The combined organic layers were washed with saturated aqueous sodium carbonate, water and brine, then dried over anhydrous sodium sulfate, filtered, concentrated in vacuo and purified by flash chromatography (0-100% ethyl acetate in hexanes) to give the title compound (0.08 g, 0.19 mmol, 48%).

[0534] 1 H NMR (400 MHz, CDCl3) 7.92 (d, 1H, J = 8.4 Hz, C H Ar), 7.67 (d, 1H, J = 1.8 Hz, C H Ar), 7.34 (br. s, 1H, C H Triazole), 7.22 (dd, 1H, J = 8.4 Hz, 2.0 Hz, C H Ar), 5.65-5.57 (m, 2H, C H2N), 5.33-5.27 (m, 1H, C H CH3), 4.67 (d, 1H, J = 6.7 Hz, C H 2OCH2), 4.55 (d, 1H, J = 6.7 Hz, C H 2OCH2), 3.71-3.64 (m, 3H, C H 2CH2C H 2OH), 3.55-3.47 (m, 1H, C H 2CH2CH2OH), 2.77-2.70 (m, 2H, triazole C H 2CH2), 1.75-1.62 (m, 4H, CH2C H 2CH2OH, Triazole CH2C H 2), 1.52 (d, 3H, J = 6.4 Hz, CHC H 3), 1.39-1.24 (m, 6H, C H 2C H 2C H 2CH3), 0.91-0.86 (m, 3H, CH2CH2CH2C H 3) 2-Cyanoethyl(((1-(5-(4-(hexyl)-1h-1,2,3-triazol-1-ylmethyl)-2-nitrophenyl)ethoxy)methoxy)propyl)diisopropylphosphoramidite

[0535] [ka]

[0536] A solution of ((1-(5-(4-(hexyl)-1h-1,2,3-triazol-1-ylmethyl)-2-nitrophenyl)ethoxy)methoxy)propan-1-ol (0.16 g, 0.38 mmol) in anhydrous dichloromethane (2 mL) was degassed under argon for 5 min, followed by the addition of anhydrous diisopropylethylamine (0.199 mL, 1.14 mmol). 2-Cyanoethoxy-N,N-diisopropylaminochlorophosphine (0.12 mL, 0.49 mmol) was added dropwise and the reaction was stirred at room temperature for 1 h. The reaction mixture was diluted with anhydrous dichloromethane (2×10 mL), washed with degassed saturated potassium chloride (30 mL), passed through anhydrous sodium sulfate, concentrated, and dried under high vacuum. The crude product was purified by flash chromatography under argon (100% pyridine in ethyl acetate containing 0.2% ethyl acetate) to give the title compound (0.16 g, 0.26 mmol, 68%) as a colorless oil, which was dissolved in degassed anhydrous acetonitrile and filtered through a 0.45 μm syringe filter before concentration and aliquoting.

[0537] 1 H NMR (400 MHz, CD3CN) δ ppm 7.92-7.88 (m, 1H, C H Ar), 7.64-7.57 (m, 2H, C H Ar, C H triazole), 7.34-7.28 (m, 1H, C H Ar), 5.67-5.57 (m, 2H, C H 2N), 5.23 (q, 1H, J = 6.4 Hz, C H CH3), 4.65-4.59 (m, 1H, C H 2OCH2), 4.48-4.44 (m, 1H, C H 2OCH2), 3.85-3.70 (m, 2H, 2 x C H (CH3)2), 3.69-3.50 (m, 5H, C H 2CH2CN, C H 2CH2C H 2OH), 3.41-3.32 (m, 1H,C H2CH2CH2OH), 2.72-2.63 (m, 4H, CH2C H 2CN, Triazole C H 2CH2), 1.74-1.59 (m, 4H, triazole CH2C H 2, CH2C H 2CH2OH), 1.48 (d, 3H, J = 6.5Hz, CHC H 3), 1.38-1.27 (m, 6H, C H 2C H 2C H 2CH3), 1.22-1.13 (m, 12H, 2 x CH(C H 3)2), 0.94-0.86 (m, 3H, CH2CH2CH2C H 3) 31 P { 1 H} NMR (162 MHz, CD3CN) δ ppm 148.6, 148.5 Example 3: Synthesis of 5'-PCdT This example describes the synthesis of a compound of formula (I), which is a compound of formula (II-2). 5'-O-(4,4'-dimethoxytrityl)-3'-O-(tert-butyldimethylsilyl)thymidine

[0538] [ka]

[0539] To a solution of 5'-O-(4,4'-dimethoxytrityl)thymidine (3.5 g, 6.43 mmol) and imidiazole (1.9 g, 28.2 mmol) in anhydrous dichloromethane (10 mL) was added tert-butyldimethylsilyl chloride (4.2 g, 27.87 mmol). The reaction mixture was stirred at room temperature for 20 h and then quenched with methanol (2 mL). The solution was diluted with ethyl acetate and washed with 5% aqueous sodium bicarbonate, water and brine, then dried over anhydrous sodium sulfate, filtered and concentrated. The product (3.8 g, 5.8 mmol, 90%) was used without further purification. 3'-O-(tert-butyldimethylsilyl)thymidine

[0540] [ka]

[0541] A solution of 5'-O-(4,4'-dimethoxytrityl)-3'-O-(tert-butyldimethylsilyl)thymidine (3.8 g, 5.8 mmol) in 80% acetic acid (45 mL) was stirred at 50° C. for 30 min. The reaction mixture was then diluted with dichloromethane, washed with water and saturated sodium bicarbonate, dried over anhydrous sodium sulfate, filtered, and concentrated. The crude material was purified by flash chromatography (dichloromethane containing 0-4% methanol) to give the title compound (1.96 g, 5.51 mmol, 95%).

[0542] 1H NMR (400 MHz, CDCl3) 8.59 (s, 1H, NH), 7.36 (s, 1H, C H 6 ), 6.16-6.12 (m, 1H, C H 1’ ), 4.52-4.48 (m, 1H, C H 4’ ), 3.96-3.91 (m, 2H, C H 3’ , C H 5’ ), 3.79-3.74 (m, 1H, C H 5’ ), 2.41-2.32 (m, 1H, C H 2’ ), 2.26-2.19 (m, 1H, C H 2’ ), 1.92 (d, 3H, J = 1.22 Hz, C H 3), 0.9 (s, 9H, (C H 3)3CSi), 0.09 (s, 6H, (C H 3)2Si) ((1-(5-(azidomethyl)-2-nitrophenyl)ethoxy)methyl)(methyl)sulfane

[0543] [ka]

[0544] To a solution of 1-(5-(azidomethyl)-2-nitrophenyl)ethan-1-ol (1.65 g, 7.4 mmol) in dimethyl sulfoxide (38 mL) were added acetic anhydride (57 mL) and glacial acetic acid (38 mL) and the reaction mixture was stirred at room temperature for 20 h. The reaction mixture was poured into ice-cold saturated aqueous sodium carbonate solution and stirred for a further 30 min before being extracted with ethyl acetate. The combined organic layers were washed with saturated aqueous sodium carbonate, water and brine before being dried over anhydrous sodium sulfate and concentrated. The crude material was purified by flash chromatography (0-30% ethyl acetate in hexanes) to give the title compound (1.7 g, 6 mmol, 81%).

[0545] 1 H NMR (400 MHz, CDCl3) δ ppm 7.96 (d, 1H, J = 8.4 Hz, C H Ar), 7.72 (d, 1H, J = 2.0 Hz, C H Ar), 7.39 (dd, 1H, J = 8.4, 2.0 Hz, C H Ar), 5.45 (q, 1H, J = 6.4 Hz, CH3C H ), 4.64 (d, 1H, J = 11.5 Hz, C H 2SCH3), 4.49 (s, 2H, C H 2N3), 4.35 (d, 1H, J = 11.5 Hz, C H 2SCH3), 2.13 (s, 3H, CH2SC H 3), 1.56 (d, 3H, J = 6.5 Hz, C H 3CH). 5'-O-((1-(5-(azidomethyl)-2-nitrophenyl)ethoxy)methyl)thymidine

[0546] [ka]

[0547] To a solution of ((1-(5-(azidomethyl)-2-nitrophenyl)ethoxy)methyl)(methyl)sulfane (0.45 g, 1.6 mmol) and 3'-O-(tert-butyldimethylsilyl)thymidine (0.54 g, 1.5 mmol) in anhydrous tetrahydrofuran (5 mL) at -40°C, N-iodosuccinimide (0.36 g, 1.6 mmol) and 4 Å molecular sieves were added followed by triflic acid (0.14 mL, 1.6 mmol) and the mixture was stirred for 30 min. The reaction was quenched with triethylamine, filtered through Celite, and concentrated in vacuo. The residue was dissolved in ethyl acetate and washed with saturated aqueous sodium thiosulfate. The combined organic layers were washed with saturated sodium carbonate, water, and brine, then dried over anhydrous sodium sulfate, filtered, and concentrated in vacuo. The residue was dissolved in anhydrous methanol (15 mL), ammonium fluoride (0.56 g, 15.2 mmol) was added, and the mixture was refluxed for 2 h and then cooled to room temperature for 12 h. The reaction mixture was concentrated in vacuo and purified by flash chromatography (0-100% ethyl acetate in hexanes) to give the title compound (0.35 g, 0.74 mmol, 46%, mixture of diastereomeric forms).

[0548] 1 H NMR (400 MHz, CDCl3) δ ppm 8.60 (s, 1H, N H ), 7.96-7.91 (m, 1H, C H Ar), 7.76-7.70 (m, 1H, C H Ar), 7.43-7.37 (m, 2H, C H Ar, C H 6 ), 6.35-6.26 (m, 1H, C H 1’ ), 5.41-5.30 (m, 1H, C HCH3), 4.86-4.81 (m, 0.5H, C H 2OCH2), 4.76-4.65 (m, 1H, C H 2OCH2), 4.62-4.58 (m, 0.5H, C H 2OCH2), 4.53-4.49 (m, 2H, C H 2N3), 4.47-4.42 (m, 0.5H, C H 3’ ), 4.17-4.12 (m, 0.5H, C H 3’ ), 4.04 (q, 1H, J = 3.3 Hz, C H 4’ ), 3.96-3.88 (m, 1H, C H 4’ , C H 5’ ), 3.78-3.60 (m, 1.5H, C H 5’ ), 2.39-2.27 (m, 1H, C H 2’ ), 2.19-2.05 (m, 1H, C H 2’ ), 1.93-1.91 (m, 1.5H, C H 3), 1.85-1.83 (m, 1.5H, C H 3), 1.60-1.56 (m, 3H, CHC H 3). 5'-O-((1-(5-((4-(4-hexyl)-1H-1,2,3-triazol-1-yl)methyl)-2-nitrophenyl)ethoxy)methyl)thymidine

[0549] [ka]

[0550] 5'-O-((1-(5-(azidomethyl)-2-nitrophenyl)ethoxy)methyl)thymidine (0.35 g, 0.74 mmol) and 1-octyne (0.16 mL, 1.1 mmol) were added to a 3:1:1 mixture of tetrahydrofuran / tert-butanol / water (10 mL / 3.5 mL / 3.5 mL). 7.5% aqueous copper(II) sulfate (1.63 mL) and 1 M aqueous (+)-sodium L-ascorbic acid (1.85 mL) were added and the reaction was stirred at room temperature for 2 h. The mixture was diluted with ethyl acetate and the organic phase was washed with saturated sodium bicarbonate and brine (10% diluted with water), dried over anhydrous sodium sulfate, filtered and concentrated. The crude product was purified by flash chromatography (dichloromethane containing 0-3% methanol (0.1% triethylamine)) to give the title compound (0.27 g, 0.46 mmol, 62%, mixture of diastereomers).

[0551] 1 H NMR (400 MHz, CDCl3) δ ppm 9.47-9.35 (m, 1H, N H ), 7.90-7.85 (m, 1H, C H Ar), 7.65-7.61 (m, 1H, C H Ar), 7.43 (s, 0.5H, C H 6 ), 7.39-7.33 (m, 1.5H, C H 6 , C H triazole), 7.29-7.22 (m, 1H, C H Ar), 6.30-6.23 (m, 1H, C H 1’ ), 5.64-5.55 (m, 2H, C H 2N), 5.27 (q, 0.5H, J = 6.4 Hz, C H CH3), 5.21 (q, 0.5H, J = 6.3 Hz, C H CH3), 4.79-4.76 (m, 0.5H, C H 2OCH2), 4.70-4.66 (m, 1H, C H<h2 style=";text-align:left;direction:ltr">2OCH2), 4.65-4.61 (m, 0.5H, C<h2 style=";text-align:left;direction:ltr"> H <h2 style=";text-align:left;direction:ltr"> 2OCH2), 4.42-4.31 (m, 1H, C<h2 style=";text-align:left;direction:ltr"> H <h2 style=";text-align:left;direction:ltr"> 3’ <h2 style=";text-align:left;direction:ltr"> , O<h2 style=";text-align:left;direction:ltr"> H <h2 style=";text-align:left;direction:ltr"> ), 4.16-4.11 (m, 0.5H, O<h2 style=";text-align:left;direction:ltr"> H <h2 style=";text-align:left;direction:ltr"> ), 3.95 (q, 0.5H, J = 3.1 Hz, C<h2 style=";text-align:left;direction:ltr"> H <h2 style=";text-align:left;direction:ltr"> 4’ <h2 style=";text-align:left;direction:ltr"> ), 3.91 (q, 0.5H, J = 3.9 Hz, C<h2 style=";text-align:left;direction:ltr"> H <h2 style=";text-align:left;direction:ltr"> 4’ <h2 style=";text-align:left;direction:ltr"> ), 3.84-3.78 (m, 0.5H, C<h2 style=";text-align:left;direction:ltr"> H <h2 style=";text-align:left;direction:ltr"> 3’ <h2 style=";text-align:left;direction:ltr"> ), 3.75-3.69 (m, 0.5H, C<h2 style=";text-align:left;direction:ltr"> H <h2 style=";text-align:left;direction:ltr"> 5’ <h2 style=";text-align:left;direction:ltr"> ), 3.67-3.59 (m, 1H, C<h2 style=";text-align:left;direction:ltr"> H <h2 style=";text-align:left;direction:ltr"> 5’ <h2 style=";text-align:left;direction:ltr"> ), 3.53-3.47 (m, 0.5H, C<h2 style=";text-align:left;direction:ltr"> H <h2 style=";text-align:left;direction:ltr"> 5’ <h2 style=";text-align:left;direction:ltr"> ), 2.70 (t, 2H, トリアゾール C<h2 style=";text-align:left;direction:ltr"> H <h2 style=";text-align:left;direction:ltr"> 2CH2), 2.39-2.31 (m, 0.5H, C<h2 style=";text-align:left;direction:ltr"> H <h2 style=";text-align:left;direction:ltr"> 2’ <h2 style=";text-align:left;direction:ltr"> ), 2.28-2.20 (m, 0.5H, C<h2 style=";text-align:left;direction:ltr"> H <h2 style=";text-align:left;direction:ltr"> 2’ <h2 style=";text-align:left;direction:ltr"> ), 2.18-2.10 (m, 0.5H, C<h2 style=";text-align:left;direction:ltr"> H <h2 style=";text-align:left;direction:ltr"> 2’ <h2 style=";text-align:left;direction:ltr"> ), 1.99-1.91 (m, 0.5H, C<h2 style=";text-align:left;direction:ltr"> H <h2 style=";text-align:left;direction:ltr"> 2’ <h2 style=";text-align:left;direction:ltr"> ), 1.87-1.82 (m, 3H, C<h2 style=";text-align:left;direction:ltr"> H <h2 style=";text-align:left;direction:ltr"> 3), 1.69-1.59 (m, 2H, トリアゾール CH2C<h2 style=";text-align:left;direction:ltr"> H <h2 style=";text-align:left;direction:ltr"> 2), 1.52-1.47 (m, 3H, CHC<h2 style=";text-align:left;direction:ltr"> H <h2 style=";text-align:left;direction:ltr"> 3), 1.38-1.23 (m, 6H, C<h2 style=";text-align:left;direction:ltr"> H <h2 style=";text-align:left;direction:ltr"> 2C<h2 style=";text-align:left;direction:ltr"> H <h2 style=";text-align:left;direction:ltr"> 2C<h2 style=";text-align:left;direction:ltr"> H <h2 style=";text-align:left;direction:ltr"> 2CH3), 0.90-0.82 (m, 3H, CH2CH2CH2C<h2 style=";text-align:left;direction:ltr"> H <h2 style=";text-align:left;direction:ltr"> 3)<h2 style=";text-align:left;direction:ltr"> 5'-O-((1-(5-((4-(hexyl)-1H-1,2,3-triazol-1-yl)methyl)-2-nitrophenyl)ethoxy)methyl)thymidine-3'-O-(2-cyanoethyl diisopropyl phosphoramidite)

[0552] [ka]

[0553] A solution of 5'-O-((1-(5-((4-(4-hexyl)-1H-1,2,3-triazol-1-yl)methyl)-2-nitrophenyl)ethoxy)methyl)thymidine (0.27 g, 0.46 mmol) in anhydrous dichloromethane (3 mL) was degassed under argon for 5 min before adding anhydrous diisopropylethylamine (0.24 mL, 1.38 mmol). 2-Cyanoethoxy-N,N-diisopropylaminochlorophosphine (0.123 mL, 0.552 mmol) was added dropwise and the reaction was stirred at room temperature for 1 h. The reaction mixture was diluted with anhydrous dichloromethane (2 x 10 mL), washed with degassed saturated potassium chloride (30 mL), passed through anhydrous sodium sulfate, concentrated and dried under high vacuum. The crude product was purified by flash chromatography under argon (100% pyridine in ethyl acetate containing 0.2% ethyl acetate) to give the title compound (0.25 g, 0.32 mmol, 70%, mixture of diastereomers) as a colorless oil, which was concentrated and aliquoted before being dissolved in degassed anhydrous acetonitrile and filtered through a 0.45 μm syringe filter.

[0554] 1 H NMR (400 MHz, CDCl3) δ ppm 8.89 (br. s, 1H, N H ), 7.91-7.86 (m, 1H, C H Ar), 7.62-7.56 (m, 2H, C H Ar, C H triazole), 7.40-7.36 (s, 1H, C H 6 ), 7.32-7.27 (m, 1H, CH Ar), 6.21-6.16 (m, 1H, C H 1’ ), 5.62-5.59 (m, 2H, C H 2N), 5.30-5.22 (m, 1H, C H CH3), 4.76-4.72 (m, 0.5H, C H 2OCH2), 4.68-4.64 (m, 0.5H, C H 2OCH2), 4.60-4.52 (m, 1H, C H 2OCH2), 4.48-4.40 (m, 0.5H, C H 3’ ),4.31-4.22 (m, 0.5H, C H 3’ ), 4.1-3.93 (m, 1H, C H 4’ ), 3.86-3.42 (m, 6H, 2 x C H (CH3)2, C H 2CH2CN, C H 5’ ), 2.68-2.61 (m, 4H, CH2C H 2CN, トリアゾール C H 2CH2), 2.35-2.09 (m, 2H, C H 2’), 1.81-1.78 (m, 1.5H, C H 3), 1.81-1.78 (m, 1.5H, C H 3), 1.76-1.74 (m, 1.5H, C H 3), 1.66-1.57 (m, 2H, トリアゾール CH2C H 2), 1.50-1.44 (m, 3H, CHC H 3), 1.37-1.25 (m, 6H, C H 2C H 2C H 2CH3), 1.21-1.11 (2 x CH(C H 3)2), 0.91-0.84 (m, 3H, CH2CH2CH2C H 3) 31 P { 1H} NMR (162 MHz, CD3CN) δ ppm 149.9, 149.8, 149.7, 149.6 Example 4: Synthesis of 5'-PCMePhos This example describes the synthesis of a compound of formula (I), which is a compound of formula (II-3). 1-(5-oct-1-ynyl-2-nitrophenyl)ethan-1-one

[0555] [ka]

[0556] 1-(5-Bromo-2-nitro-phenyl)ethenone (2.5 g, 10.25 mmol) was added to a solution of 1-octyne (3.025 mL, 20.5 mmol), anhydrous triethylamine (30 mL, 41 mmol) in anhydrous dimethylformamide (75 mL) and the mixture was degassed under argon for 5 min. Tetrakis(triphenylphosphine)palladium(0) (1.21 g, 1.05 mmol) and copper(I) iodide (0.4 g, 2.05 mmol) were then added and the reaction was heated at 80 °C for 1 h. The reaction mixture was concentrated in vacuo and purified by flash chromatography (hexanes with 0-20% ethyl acetate) to give the title compound as a colorless oil (1.2 g, 4.4 mmol, 43%).

[0557] 1 H NMR (400 MHz, CDCl3) δ ppm 8.04 (d, 1H, J = 8.6 Hz, C H Ar), 7.54 (dd, 1H, J = 8.6 Hz, 1.8 Hz, C H Ar), 7.37 (d, 1H, J = 1.7 Hz, C H Ar), 2.55 (s, 3H, C H 3), 2.45 (t, 2H, J = 7.15 Hz, CC H 2CH2), 1.67-1.58 (m, 2H, CCH2C H 2), 1.50-1.27 (m, 6H, C H2C H 2C H 2CH3), 0.94-0.89 (m, 3H, CH2CH2CH2C H 3), 2-Methyl(5-oct-1-ynyl-2-nitrophenyl)-1,3-dioxolane

[0558] [ka]

[0559] A mixture of 1-(5-oct-1-ynyl-2-nitrophenyl)ethan-1-one (1.2 g, 4.6 mmol), anhydrous ethylene glycol (3.9 mL, 23 mmol) and p-toluenesulfonic acid (0.045 g, 0.23 mmol) in anhydrous toluene (40 mL) was refluxed in a Dean-Stark apparatus for 48 h. The reaction mixture was washed with saturated sodium bicarbonate, brine, dried over anhydrous sodium sulfate and concentrated. The crude material was purified by flash chromatography (hexanes with 0-11% ethyl acetate) to give the title compound as a colorless oil (1.45 g, 4.6 mmol, 100%).

[0560] 1 H NMR (400 MHz, CDCl3) δ ppm 7.66 (d, 1H, J = 1.6 Hz, C H Ar), 7.41-7.33 (m, 2H, 2 x C H Ar), 4.06-3.97 (m, 2H, OC H 2C H 2O), 3.71-3.62 (m, 2H, OC H 2C H 2O), 2.55 (s, 3H, C H 3), 2.43 (t, 2H, J = 7.15 Hz, CC H 2CH2), 1.86 (s, 3H, C H 3), 1.67-1.58 (m, 2H, CCH2C H 2), 1.51-1.26 (m, 6H, C H 2CH 2C H 2CH3), 0.95-0.88 (m, 3H, CH2CH2CH2C H 3), 2-(1-(5-oct-1-ynyl-2-nitrophenyl)ethoxy)ethan-1-ol

[0561] [ka]

[0562] To a solution of 2-methyl(5-oct-1-ynyl-2-nitrophenyl)-1,3-dioxolane (0.85 g, 2.7 mmol) in anhydrous acetonitrile (20 mL) at 0° C. was added titanium tetrachloride (0.4 mL, 3.5 mmol), followed by sodium cyanoborohydride (0.2 g, 3.24 mmol). The resulting yellow suspension was stirred at room temperature for 2 h, then neutralized with saturated sodium bicarbonate, extracted with dichloromethane, dried over anhydrous sodium sulfate, filtered, and concentrated. The crude material was purified by flash chromatography (0-43% ethyl acetate in hexanes) to give the title compound as a colorless oil (0.56 g, 1.75 mmol, 65%).

[0563] 1 H NMR (400 MHz, CDCl3) δ ppm 7.87 (d, 1H, J = 8.4 Hz, C H Ar), 7.74 (d, 1H, J = 1.8 Hz, C H Ar), 7.39 (dd, 1H, J = 8.5 Hz, 1.9 Hz, C H Ar), 5.07 (q, 1H, J = 6.3 Hz, C H CH3), 3.78-3.71 (m, 2H, CH2C H 2OH), 3.49-3.39 (m, 2H, C H 2CH2OH), 2.45 (t, 2H, J = 7.1 Hz, CC H 2CH2), 1.97-1.90 (m, 1H, CH2CH2O H), 1.67-1.56 (m, 2H, CCH2C H 2), 1.56-1.53 ​​(m, 3H, CHC H 3), 1.51-1.26 (m, 6H, C H 2C H 2C H 2CH3), 0.95-0.89 (m, 3H, CH2CH2CH2C H 3) Bis(diisopropylamino)(methyl)phosphine

[0564] [ka]

[0565] To a solution of bis(diisopropylamino)chlorophosphine (22 g, 82.5 mmol) in anhydrous diethyl ether (350 mL) at 0 °C was added dropwise 3 molar methylmagnesium bromide in diethyl ether (33 mL) and the mixture was stirred for 1 h. The reaction mixture was warmed to room temperature and filtered under argon before being concentrated. The crude material was distilled under reduced pressure (70-75 °C at 0.07 mmHg) to give a colorless oil (19 g, 77 mmol, 93%).

[0566] 1 H NMR (400 MHz, CDCl3) δ ppm 3.46-3.33 (m, 4H, 4 x C H (CH3)2), 1.22 (s, 1.5H, PC H 3), 1.21.1.16 (m, 13.5H, PC H 3, 2 x CH(C H 3)2), 1.09 (d, 12H, J = 6.7 Hz, 2 x CH(C H 3)2) 31 P { 1 H} NMR (162 MHz, CD3CN) δ ppm 39.7 2-(1-(5-oct-1-ynyl-2-nitrophenyl)ethoxy)ethoxy[(diisopropylamino)(methyl)phosphine]

[0567] [ka]

[0568] To a solution of 2-(1-(5-oct-1-ynyl-2-nitrophenyl)ethoxy)ethan-1-ol (0.12 g, 0.38 mmol) and 4,5-dicyanoimidazole (0.04 g, 0.34 mmol) in degassed anhydrous dichloromethane (5 mL) was added dropwise a mixture of bis(diisopropylamino)(methyl)phosphine (0.128 g, 0.38 mmol) in degassed anhydrous dichloromethane (2 mL) and the mixture was stirred for 40 min. The reaction was neutralized with a small amount of anhydrous triethylamine and the entire mixture was purified by flash chromatography under argon (25% ethyl acetate (0.2% triethylamine in hexane) to give the title compound (0.13 g, 0.28 mmol, 74%) as a colorless oil.

[0569] 1 H NMR (400 MHz, CDCl3) δ ppm 7.91-7.86 (m, 1H, C H Ar), 7.80-7.77 (m, 1H, C H Ar), 7.42 (dd, 1H, C H Ar), 5.04-4.97 (m, 1H, C H CH3), 3.71-3.41 (m, 5H, C H 2C H 2OP, C H (CH3)2), 3.36-3.24 (m, 1H, C H (CH3)2), 2.45 (t, 2H, J = 7.1 Hz, CC H 2CH2), 1.64-1.56 (m, 2H, CCH2C H 2), 1.50-1.30 (m, 9H, PC H 3. C H 2C H 2C H 2CH3), 1.20-1.06 (m, 12H, 2 x CH (CH3)2), 0.93-0.88 (m, 3H, CH2CH2CH2C H 3) 31 P { 1 H} NMR (162 MHz, CD3CN) δ ppm 122.9, 122.2 Example 5: Oligonucleotide synthesis and purification methods Standard DNA phosphoramidites, solid supports and reagents were purchased from Link Technologies and Applied Biosystems. Small-scale automated solid-phase synthesis of oligonucleotides was performed on a K&A H-8 SE DNA / RNA synthesizer. Synthesis was performed on a 0.2 or 1.0 micromole scale with cycles of acid-catalyzed detritylation, coupling, capping and iodine oxidation. 60 units of standard DNA phosphoramidites were coupled. Coupling efficiencies and overall synthesis yields were measured by a built-in automated trityl cation conductivity monitoring facility and were ≥98.0% in all cases. Oligonucleotides were treated with 20% diethylamine, then cleaved from the solid support with concentrated ammonium hydroxide at room temperature for 60 min, followed by heating at 55° C. for 5 h in sealed tubes to remove protecting groups from the nucleobases and backbone.

[0570] Large-scale automated solid-phase synthesis of oligonucleotides was performed on an Akta oligopilot synthesizer. Syntheses were performed on a 15- or 30-μmole scale, including cycles of acid-catalyzed detritylation, coupling, capping, and iodine oxidation. 60 units of standard DNA phosphoramidites were coupled. Coupling efficiencies and overall synthesis yields were determined by a built-in automated trityl cation conductivity monitoring facility and were ≥98.0% in all cases. Oligonucleotides were treated with 20% diethylamine for 10 min, followed by manual cleavage from the solid support by heating at 55°C for 5 h in sealed tubes using concentrated ammonium hydroxide.

[0571] Methylphosphonamidites were coupled for 10 min. Oligonucleotides containing methylphosphonates were cleaved and deprotected by treatment with a solution of 45:45:10 acetonitrile / ethanol / concentrated ammonium hydroxide at room temperature for 30 min, followed by the addition of an equal volume of ethylenediamine for 6 h.

[0572] RPHPLC purification of oligonucleotides was performed using a Gilson HPLC system with a Luna 10 μm C8(2) 100 Å LC column in pH 7.5 0.1 M triethylammonium acetate (TEAA) buffer and desalted using a prepacked sephadex G-25 column.

[0573] ES - Mass spectra of oligonucleotides were recorded using a XEVO G2-QTOF MS instrument in NMR mode. UV absorbance was performed on an Agilent Technologies Cary 60 UV-Vis at 260 nm in water.

[0574] UV cleavage was performed using a handheld Analytik Jena UVP UVGL-25 4W UV lamp positioned approximately 2 cm from the sample. Irradiation of samples in milli-Q water for 50 min at 365 nm resulted in nearly quantitative cleavage. Low molecular weight cleavage products were separated from the oligonucleotides using prepacked sephadex G-25 columns or by organic extraction methods. Methylphosphonates were further treated with concentrated ammonium hydroxide for 2 h at room temperature.

[0575] Ultra-performance liquid chromatography-mass spectrometry (UPLC-MS) analysis of oligonucleotides was performed on a Waters Acquity H Class system coupled to a Waters Xevo G2-XS QToF mass spectrometer. Chromatography was performed on a Waters Acquity Premier BEH C18 oligonucleotide column 2.1 x 100 mm (1.7 μm particle size, 130 Å) at 60 °C with a flow rate of 0.25 mL / min using a gradient of Buffer A and B: Buffer A, 400 mM 1,1,1,3,3,3-hexafluoroisopropanol, 15 mM triethylamine), Buffer B, 50% 400 mM 1,1,1,3,3,3-hexafluoroisopropanol, 15 mM triethylamine 50% methanol. The eluent was directly infused into the mass spectrometer and data were acquired in negative ion mode. The data was analyzed and deconvoluted using the MaxEnt1 algorithm (UNIFI, Waters).

[0576] Capillary electrophoresis (CE) analysis of oligonucleotides was performed on a Sciex P / ACE MDQ Plus using the ssDNA 100-R Kit.

[0577] Example 6: Modification and purification of oligonucleotides using the compounds of Example 2 A 92mer oligonucleotide mixed sequence was synthesized under standard conditions on a 15 μmol scale, replacing the terminal 5' addition of the spacer C3 phosphoramidite with 5'-PC C3 (2-cyanoethyl(((1-(5-(4-(hexyl)-1h-1,2,3-triazol-1-ylmethyl)-2-nitrophenyl)ethoxy)methoxy)propyl)diisopropyl phosphoramidite). After cleavage and deprotection, the crude oligonucleotide was analyzed by mass spectrometry. The calculated mass was 26846.3. The found mass was 26848.1.

[0578] One micromol of crude oligonucleotide was purified by RPHPLC on a Luna 10 μm C8(2) 100 Å LC column using a 20-60% gradient in 30 min with 0.1 M TEAA, pH 7.5. A prepacked sephadex G-25 column was used to desalt the recovered oligonucleotide. The sample was analyzed by mass spectrometry. The calculated mass was 26846.3. The found mass was 26847.6.

[0579] The purified oligonucleotide was drawn up into 1 mL of milli-Q water and irradiated at 365 nm for 50 min before being passed through a pre-packed sephadex G-25 column. The sample was analyzed by mass spectrometry. The calculated mass was 26501.9. The found mass was 26503.1. Photocleavage proceeded quantitatively.

[0580] The oligonucleotides were repurified by RPHPLC on a Luna 10 μm C8(2) 100 Å LC column using a 20 min 5-45% gradient with 0.1 M TEAA, pH 7.5. A prepacked sephadex G-25 column was used to desalt the recovered oligonucleotides. Samples were analyzed by mass spectrometry. The calculated mass was 26501.9. The found mass was 26502.9.

[0581] The purity of the sample was analyzed by UPLC-MS (Figure 1A) and was found to be 90.05%.

[0582] For comparison, an identical 92-mer oligonucleotide in which the terminal 5' addition was replaced with a standard spacer C3 phosphoramidite was synthesized under standard conditions on a 1 μmol scale.

[0583] Crude oligonucleotides were purified by RPHPLC on a Luna 10 μm C8(2) 100 Å LC column using a 20-60% gradient in 30 min at pH 7.5 0.1 M TEAA. Recovered oligonucleotides were desalted using a prepacked sephadex G-25 column.

[0584] The oligonucleotides were repurified by RPHPLC on a Luna 10 μm C8(2) 100 Å LC column using a 20 min 5-45% gradient of TEAA, pH 7.5. A prepacked sephadex G-25 column was used to desalt the recovered oligonucleotides.

[0585] The purity of the sample was analyzed by UPLC-MS (Figure 1B) and was found to be 62.31%.

[0586] This example shows that compounds of formula (I) can be incorporated into polynucleotides, used to improve purification, for example by HPLC, and can be successfully photocleaved to give the desired product.

[0587] Example 7: Modification and purification of oligonucleotides using the compounds of Example 1 Two oligonucleotides were synthesized under standard conditions on a 1 μmol scale with and without a terminal 5′-PC PO3 (compound of Example 1, i.e., 2-cyanoethyl(1-(5-((4-hexyl-1H-1,2,3-triazol-1-yl)methyl)-2-nitrophenyl)ethyl)diisopropylphosphoramidite) modification. The sequences are shown below. SEQ ID NO:3 corresponds to SEQ ID NO:1 with an additional 5′PC PO3. SEQ ID NO:4 corresponds to SEQ ID NO:2 with an additional 5′PC PO3. SEQ ID NO: 1: TTGCAGCTCCTTCTCTTGTTCCGTGGAGCAAGCCTTCTTAA SEQ ID NO: 2: GCCTATTGTAGTGCGGAAGAGAATCGGTCTAAGCTTCCTAATTC SEQ ID NO: 3: XTTGCAGCTCCTTCTCTTGTTCCGTGGAGCAAGCCTTCTTAA SEQ ID NO: 4: XGCCTATTGTAGTGCGGAAGAGAATCGGTCTAAGCTTCCTAATTC [X=5'-PCPO3] After cleavage and deprotection, the oligonucleotides were purified by RPHPLC on a Luna 10 μm C8(2) 100 Å LC column using 0.1 M TEAA, pH 7.5, with a 20 min 10-40% gradient for Seq.1 and Seq.2, and a 20 min 15-60% gradient for Seq.3 and Seq.4. Recovered oligonucleotides were desalted using a prepacked Sephadex G-25 column. Samples were analyzed by mass spectrometry.

[0588] SEQ ID NO:1: calculated mass 12484.1, found mass 12484.4 SEQ ID NO:2: calculated mass 13561.8, found mass 13562.1 SEQ ID NO:3: calculated mass 12878.5, found mass 12878.7 SEQ ID NO: 4: calculated mass 13956.2, mass factor 13956.7 The purified oligonucleotides SEQ ID NO:3 and SEQ ID NO:4 were drawn up into 1 mL of milli-Q water and irradiated at 365 nm for 50 min before being passed through a pre-packed sephadex G-25 column. Samples were analyzed by mass spectrometry. Photocleavage proceeded quantitatively.

[0589] SEQ ID NO:3: calculated mass 12562.1, found mass 12564.5 SEQ ID NO:4: calculated mass 13639.8, found mass 13642.4 The purity of the oligonucleotides was analyzed by CE, the results are shown in Figure 2 (A: SEQ ID NO: 1, B: SEQ ID NO: 2, C: SEQ ID NO: 3, D: SEQ ID NO: 4) and the calculated purity levels are summarized in the table below.

[0590] [Table 1]

[0591] As summarized above and seen in Figure 2, the synthesized oligonucleotides with 5'-PCPO3 showed significantly higher purity and less truncated sequences than those synthesized conventionally. Figure 3 compares the expanded regions of the electropherograms of Figure 2 for SEQ ID NO:2 (A) versus SEQ ID NO:4 (B). As can be clearly seen, the trace for SEQ ID NO:4 is much cleaner than the trace for SEQ ID NO:2 indicating less impurities.

[0592] This example shows that compounds of formula (I) can be incorporated into polynucleotides and used to improve purification, for example by HPLC, and can be successfully photocleaved to give the desired product, and that the purity of the resulting polynucleotide is higher than can be achieved using conventional methods.

[0593] Example 8: Modification and purification of oligonucleotides using the compounds of Example 3 Oligonucleotides with terminal 5'-PCdT (compound of Example 3, i.e., 5'-O-((1-(5-((4-(hexyl)-1H-1,2,3-triazol-1-yl)methyl)-2-nitrophenyl)ethoxy)methyl)thymidine-3'-O-(2-cyanoethyldiisopropylphosphoramidite)) modifications were synthesized under standard conditions on a 1 μmol scale. SEQ ID NO: 5: XTAATACGACTCACTATAG X=5'-PCdT] After cleavage and deprotection, the oligonucleotides were purified by RPHPLC using a 20 min 5-45% gradient with 0.1M TEAA, pH 7.5 on a Luna 10 μm C8(2) 100 Å LC column. Recovered oligonucleotides were desalted using a prepacked sephadex G-25 column. Samples were analyzed by mass spectrometry. The calculated mass was 6115.2, the found mass was 6116.0.

[0594] The purified oligonucleotide was drawn up into 1 mL of milli-Q water and irradiated at 365 nm for 50 min before being passed through a pre-packed sephadex G-25 column. The sample was analyzed by mass spectrometry. The calculated mass was 5770.8. The found mass was 5770.3. Photocleavage proceeded quantitatively.

[0595] This example demonstrates that compounds of formula (I) can be incorporated into polynucleotides and successfully photocleaved to give the desired products.

[0596] Example 9: Modification and purification of oligonucleotides using the compounds of Example 4 Oligonucleotides bearing terminal 5'-PCMePhos (compound of Example 4, i.e., 2-(1-(5-oct-1-ynyl-2-nitrophenyl)ethoxy)ethoxy[(diisopropylamino)(methyl)phosphine]) modifications were synthesized under standard conditions on a 1 μmol scale. SEQ ID NO: 6: XTTTTTTTTTT X=5'-PCMePhos] After cleavage and deprotection, the oligonucleotides were purified by RPHPLC using a Luna 10 μm C8(2) 100 Å LC column with a 20 min 5-45% gradient using pH 7.5 0.1 M TEAA. Recovered oligonucleotides were desalted using a pre-packed sephadex G-25 column. Samples were analyzed by mass spectrometry. The calculated mass was 3360.14 and the found mass was 3363.3.

[0597] The purified oligonucleotide was drawn up into 1 mL of milli-Q water and irradiated at 365 nm for 50 min before being passed through a pre-packed Sephadex G-25 column. The sample was analyzed by mass spectrometry. The calculated mass was 3103.0. The found mass was 3102.2. Photocleavage proceeded quantitatively to give the 5'-hydroxyethyl methylphosphonate oligonucleotide.

[0598] The oligonucleotide was hydrolyzed with concentrated ammonium hydroxide for 2 hours at room temperature, concentrated and desalted using a prepacked Sephadex G-25 column. The sample was analyzed by mass spectrometry. The calculated mass was 2979.98 and the found mass was 2980.3. The hydrolysis proceeded quantitatively.

[0599] This example demonstrates that compounds of formula (I) can be incorporated into polynucleotides and successfully photocleaved to give the desired products.

[0600] Example 10: Faster deprotection of oligonucleotides using higher UV wattage This example describes the deprotection of a synthesized oligonucleotide (as synthesized in Example 3) having a 5'-PCdT modification.

[0601] Rapid UV cleavage was performed using an EvoluChem PhotoRed Ox Box (HepatoChem) equipped with an EvoluChem PhotoRed Ox Box LED light source-wavelength 365 nm, electrical power 18 W, 220 V, with samples held in a mirror-finished chamber. Irradiation of samples in milli-Q water for 2 min at 365 nm resulted in nearly quantitative cleavage. Low molecular weight cleavage products were separated from the oligonucleotides using prepacked sephadex G-25 columns or by organic extraction methods.

[0602] A 92mer oligonucleotide mixed sequence was synthesized under standard conditions on a 1 μmol scale, replacing the terminal 5' addition of dT phosphoramidite with 5'-PCdT (product of Example 3). After cleavage and deprotection, 1 μmol of crude oligonucleotide was purified by RPHPLC on a Luna 10 μm C8(2) 100 Å LC column with pH 7.5 0.1 M TEAA, 20-60% gradient in 30 min. A pre-packed sephadex G-25 column was used to desalt the recovered oligonucleotide. The product was analyzed by mass spectrometry. The calculated mass was 27012.45. The found mass was 27012.40.

[0603] The purified oligonucleotide was drawn up into 1 mL of milli-Q water and subjected to fast UV cleavage by irradiation at 365 nm for 2 min before passing through a pre-packed sephadex G-25 column. The product was analyzed by mass spectrometry. The calculated mass was 26668.04. The found mass was 26668.20. Photocleavage proceeded quantitatively.

[0604] This example demonstrates that the photocleavable groups described herein can be cleaved from purified oligonucleotides in a very short time (i.e., 2 minutes) using high wattage UV irradiation.

[0605] Example 11: Rapid deprotection of complex and sensitive oligonucleotides using high wattage UV for deprotection This example describes the rapid deprotection of sensitive oligonucleotides and demonstrates that the above modifications are stable under high wattage irradiation deprotection conditions.

[0606] Example 11 was carried out using a UV cutter as described in Example 10, except the samples were irradiated for 15 minutes.

[0607] A pure 91mer mixed sequence containing potentially sensitive modifications (DBCO, FAM, BHQ1) was drawn up into 1 mL of milli-Q water and irradiated at 365 nm for 15 min before being passed through a pre-packed sephadex G-25 column. The product was analyzed by mass spectrometry. The calculated mass was 29658.93. The found mass was 29659.00. Photocleavage proceeded quantitatively and no degradation products were detected.

[0608] Thus, this example demonstrates that the methods of the present invention can be employed to perform rapid deprotection of sensitive oligonucleotides without sacrificing the stability of the oligonucleotide.

[0609] Example 12: Purification of oligomers with complex modifications To verify the suitability of the method of the present invention with various modifications, the following experiments were carried out.

[0610] Two complex 21mer oligonucleotides (compound 1 and compound 2) with 5'-PCPO3 modifications were synthesized (as described in Example 1). The synthesis was carried out under standard conditions on a 1 μmol scale. The oligonucleotide sequences each contained multiple modifications including multiple phosphorothioate linkages, 2'-fluoro bases, 2'-OMe bases, 2'-MOE bases, and multiple GalNac additions.

[0611] After cleavage and deprotection, the oligonucleotides were purified by RPHPLC using a Luna 10 μm C8(2) 100 Å LC column with a 20 min 30-70% gradient using pH 7.5 0.1 M TEAA. Recovered oligonucleotides were desalted using a pre-packed sephadex G-25 column. Products were analyzed by mass spectrometry and the results are shown in the table below.

[0612] [Table 2]

[0613] The purified oligonucleotides Compound 1 and Compound 2 were drawn up into 1 mL of milli-Q water and irradiated at 365 nm for 50 minutes before being passed through a pre-packed Sephadex G-25 column. The products were analyzed by mass spectrometry as shown in the table below. Photocleavage proceeded quantitatively with no degradation products.

[0614] [Table 3]

[0615] Thus, this example shows that the method of the invention can be successfully applied to highly complex, multiply modified oligonucleotides.

Claims

1. A method for modifying a polynucleotide or its analog or derivative, wherein the reactive functional group of the polynucleotide or its analog or derivative is a phosphorus group R P Under conditions that cause a reaction, the compound of formula (I): 【Chemistry 1】 (In the formula, - R H It is a hydrophobic group, - L 1 is a linking group, - 【Chemistry 2】 It is a photodissociable group, - R is a modifying group, - n is an integer selected from 0 and 1, - R P (This is a phosphorus group.) By reacting with the hydrophobic group R H A method comprising linking the polynucleotide or its analogues or derivatives.

2. (i) The free hydroxyl group at the 5' position of the polynucleotide or its analog or derivative is the phosphorus group R P To cause a reaction, or (ii) The free hydroxyl group at the 3' position of the polynucleotide or its analog or derivative is the phosphorus group R P To make it react The method according to claim 1, including the method described in claim 1.

3. -R H is C 1 to C 20 alkyl, C 2 to C 20 alkenyl, C 2 to C 20 alkynyl, C 5 to C 10 carbocyclic, C 6 to C 18 aryl, 5- to 10-membered heteroaryl and 5- to 10-membered heterocyclic, selected, and R H may be substituted, and / or - L 1 However, (i) chemical bond, and (ii) C 1 ~C 20 Alkylene group, C 2 ~C 20 Alkenylene group and / or C 2 ~C 20 A linker containing an alkylene group, wherein the alkylene, alkenylene, or alkylene group is a heteroatom, a phosphite group, a phosphate group, a carbonyl group, or C 6 ~C 10 Aryl group, C 5 ~C 10 The linker may be interrupted and / or terminated by one or more groups selected from a carbocykyl group, a 5-10 membered heteroaryl group, and a 5-10 membered saturated heterocyclic or partially unsaturated heterocyclic group, and the linker may be further substituted, selected from and / or - R P but is a phosphoramidite, phosphoramidate, alkylphosphonamidite or alkylphosphonamidate, and / or - R, (i) Nucleosides or their derivatives or analogues, (ii) C 1 ~C 20 Alkylene group, C 2 ~C 20 Alkenylene group and / or C 2 ~C 20 A group comprising an alkylene group, wherein the alkylene, alkenylene, or alkylene group is a heteroatom, a phosphite group, a phosphate group, a carbonyl group, or C 6 ~C 10 Aryl group, C 5 ~C 10 A group which may be interrupted and / or terminated by one or more groups selected from a carbocykyl group, a 5-10 membered heteroaryl group, and a 5-10 membered heterocyclic group, and which may have R further substituted, and (iii) A second polynucleotide or its derivative or analogue The method according to claim 1, selected from the following.

4. - R H However, C 4 ~C 16 Alkyl, C 4 ~C 16 Alkenil, C 4 ~C 16 Alkinyl, C 5 ~C 10 Carbocyclyl and C 6 ~C 10 Aryl, preferably C 5 ~C 12 Selected from alkyl groups, R H It may be substituted, preferably unsubstituted, and / or - L 1 However, C 1 ~C 6 Alkylene group, C 2 ~C 6 Alkenylene group and / or C 2 ~C 6 A linker containing an alkylene group, wherein the alkylene, alkenylene, or alkylene group may be interrupted and / or terminated by one or more groups selected from heteroatoms, carbonyl groups, phenyl groups, cyclopentyl or cyclohexyl groups, 5-6 membered heteroaryl groups, and 5-6 membered saturated heterocyclic or partially unsaturated heterocyclic groups, and the linker may be further substituted, and / or - R P The phosphoramidite or alkylphosphonamidite, preferably phosphoramidite or methylphosphonamidite, more preferably 2-cyanoethyl N,N-diisopropylphosphonamidite or N,N-diisopropylmethylphosphonamidite, and / or - R, (i) Nucleosides or their derivatives or analogues, (ii) C 2 ~C 6 Alkylene group, C 2 ~C 6 Alkenylene group and / or C 2 ~C 6 A group comprising an alkylene group, wherein the alkylene, alkenylene, or alkylene group may be interrupted and / or terminated by one or more groups selected from a heteroatom, a carbonyl group, a phenyl group, a cyclopentyl or cyclohexyl group, a 5-6 membered heteroaryl group, and a 5-6 membered saturated heterocyclic or partially unsaturated heterocyclic group, and R may be further substituted, and (iii) A second polynucleotide or its derivative or analogue The method according to claim 1, selected from the following.

5. The compound of formula (I) is the compound of formula (II): 【Transformation 3】 (In the formula, R H , L 1 , and R are as described in claim 1, where - 【Chemistry 4】 is a 2-nitrobenzyl group, and the 2-nitrobenzyl group is halogen, optionally substituted C 1 -C 4 -C alkyl, -OR a -SR a -NR a R a -C(O)OR a -C(O)NR a R a -C(O)R b -OC(O)R b and -NHC(O)R b and may be substituted with one, two or three groups independently selected from R a each independently is hydrogen, optionally substituted C 1 -C 2 alkyl and optionally substituted C 1 -C 2 alkoxyl, R b each independently is hydrogen and optionally substituted C 1 -C 4 alkyl group, - R 3 is methyl, ethyl, or C 1 ~C 2 It is a haloalkyl, - W is the group of formula (W-2), the oxygen atom, and the group of formula (W-1): 【Transformation 5】 (In the formula, - If n is 1, R P is a phosphoramidite, phosphoramidate, alkylphosphonamidite, or alkylphosphonamidate, and when n is 0, R P Together with the oxygen atom bonded to it, it forms a phosphoramidite, phosphoramidate, alkylphosphonamidite, or alkylphosphonamidate. The phosphoramidite, phosphoramidate, alkylphosphonamidite, or alkylphosphonamidate is preferably phosphoramidite or methylphosphonamidite, more preferably 2-cyanoethyl N,N-diisopropylphosphonamidite or N,N-diisopropylmethylphosphonamidite. - Q is either an oxygen atom or a sulfur atom, -R 2 are each independently hydrogen, methyl, ethyl, C 1 to C 2 haloalkyl and a halogen group, respectively). (Selected from) Thus, the photodissociable group 【Transformation 6】 is the formula 【Transformation 7】 The method according to claim 1, which is the part of the claim.

6. The compound of formula (II) is the compound of formula (II-3): 【Transformation 8】 (where R) H L 1 , 【Chemistry 9】 , R 2 , R 3 And Q is as described in claim 5, and R P (Together with the oxygen atom bonded to it, it forms an alkylphosphonamidite, preferably a methylphosphonamidite, more preferably an N,N-diisopropylmethylphosphonamidite.) The method according to claim 5, wherein W is the base of formula (W-2) and n is 0.

7. The compound of formula (II) is the same as the compound of formula (II-1): 【Chemistry 10】 (where R) H L 1 , 【Chemistry 11】 , and R 3 The following is described in claim 5, R P The method according to claim 5, wherein W is an oxygen atom and n is 0, so that together with the oxygen atom bonded thereto, W forms a phosphoramidite, phosphoramidate, alkylphosphonamidite, or alkylphosphonamidate, preferably a phosphoramidite, more preferably 2-cyanoethyl N,N-diisopropylphosphoramidite.

8. The compound of formula (II) is the compound of formula (II-2): 【Chemistry 12】 (where R) H L 1 , 【Chemistry 13】 , R 2 , R 3 Q and R are as described in claim 5, and R P (The phosphoramidite is a phosphoramidite, phosphoramidate, alkylphosphonamidite, or alkylphosphonamidate, preferably a phosphoramidite, and more preferably 2-cyanoethyl N,N-diisopropylphosphoramidite.) The method according to claim 5, wherein W is the base of formula (W-1) and n is 1. 【Request Item 9】 【Chemistry 14】 , L 1 and R H However, equation (A-1) or equation (A-2): 【Chemistry 15】 (In the formula, L 1 and R H The above is as described in claim 1, where - R 4 , R 5 , R 6 and R 7 Each of these can be independently hydrogen, halogen, or a substituted C 1 ~C 4 Alkyl, -OR a ,-SR a , -NR a R a , -C(O)OR a , -C(O)NR a R a , -C(O)R b , -OC(O)R b and -NHC(O)R b Selected from, preferably R 4 , R 5 , R 6 and R 7 Each of these can be independently hydrogen, fluorine, or a substituted C. 1 ~C 4 Alkyl, -OR a ,-SR a , -NR a R a , -OC(O)R b and -NHC(O)R b Selected from, more preferably R 4 , R 5 , R 6 and R 7 Each of these is either hydrogen or methoxy, and R a and R b (This is as described in claim 5.) The method according to claim 5, as expressed together by the same.

10. A method for purifying polynucleotides or their analogs or derivatives, (i) To increase the hydrophobicity of a polynucleotide or its analog or derivative in a reaction mixture by modifying the polynucleotide or its analog or derivative according to the method described in any one of claims 1 to 9, (ii) Separating the modified polynucleotide or its analog or derivative from the other components in the reaction mixture by the hydrophobicity of the modified polynucleotide or its analog or derivative, (iii) By irradiating the modified polynucleotide, its analogues or derivatives with light, preferably using UV light with a wavelength of about 300 to about 500 nm, hydrophobic groups can be optionally removed from the modified polynucleotide or its analogues or derivatives. Methods that include...

11. The method according to claim 10, wherein step (ii) comprises separating the modified polynucleotide or its analogues or derivatives from other components in the reaction mixture using chromatographic purification techniques, preferably using high-performance liquid chromatography, more preferably using reversed-phase high-performance liquid chromatography.

12. Compound of formula (I): 【Chemistry 16】 (where R) H L 1 , 【Chemistry 17】 , R, n and R P (This is as described in any one of claims 1 to 9).

13. Equation (I * ) is based on: [Chemistry 18] (where R) H L 1 , 【Chemistry 19】 , R and n are as described in any one of claims 1 to 9, - R P* This is a phosphorus bond, Modified polynucleotides or their derivatives or analogs (the wavy lines indicate binding sites with polynucleotides or their derivatives or analogs).

14. - R P* is a phosphodiester bond, phosphotriester bond, phosphite-triester bond, phosphite-diester bond, phosphorothioate bond, phosphorodithioate bond, alkylphosphonate bond, or alkylphosphonite bond, preferably phosphite-triester bond or alkylphosphonite bond, more preferably phosphite-triester bond or methylphosphonite bond, and / or - Equation (I * The group of ) is bonded to the 3' or 5' position of the polynucleotide or its analog or derivative, preferably to the 5' position of the polynucleotide or its analog or derivative. The modified polynucleotide or its derivative or analogue according to claim 13.

15. (i) Use of a compound of formula (I) according to any one of claims 1 to 9 for optionally increasing the hydrophobicity of a polynucleotide or its derivative or analog by modifying the polynucleotide or its derivative or analog, or (ii) for purifying a polynucleotide or its derivative or analog.

16. A polynucleotide or a derivative or analog thereof obtained by the method described in any one of claims 1 to 9.