Enhancement of the safety of T cell-mediated immunotherapy

JP2025521753A5Pending Publication Date: 2026-07-03SELECTIS SOCIETY ANONYM

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
SELECTIS SOCIETY ANONYM
Filing Date
2023-06-30
Publication Date
2026-07-03

AI Technical Summary

Technical Problem

Current immunotherapy approaches for treating solid tumors are limited by the immunosuppressive tumor microenvironment and the lack of tumor-infiltrating lymphocytes, particularly due to the presence of cancer-associated fibroblasts expressing fibroblast activation protein (FAP), leading to restricted efficacy and safety concerns in allogeneic treatments.

Method used

Engineering immune cells, such as T cells, to express a chimeric antigen receptor (CAR) targeting FAP under a constitutive promoter and a tumor antigen under an inducible promoter, which allows for targeted and controlled activation of tumor-specific cytotoxicity, while suppressing endogenous T cell receptors and MHC presentation to enhance therapeutic efficacy and safety.

Benefits of technology

The approach enhances the therapeutic efficacy of CAR-T therapy by selectively targeting FAP in the tumor microenvironment, improving anti-tumor activity and reducing off-target effects, thereby providing a universal treatment option for various patients without allogeneic restrictions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000085_0000
    Figure 00000085_0000
  • Figure 00000085_0001
    Figure 00000085_0001
  • Figure 00000085_0002
    Figure 00000085_0002
Patent Text Reader

Abstract

This document relates to engineered immune cells comprising FAP-CAR and tumor-CAR with different expression, the use of the engineered immune cells in the treatment of tumors expressing FAP, and methods and materials for the preparation of the engineered immune cells.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This document generally relates to cell therapy and immunotherapy for the treatment of solid tumors or blood cancers, particularly characterized by the presence of FAP in the tumor microenvironment of a patient.

Background Art

[0002] Adoptive cell therapy, also known as cellular immunotherapy, is a form of treatment that uses cells of the immune system to eliminate diseased cells such as infected or malignant cells. Some of these techniques involve directly isolating an individual's own immune cells and simply increasing the number of immune cells, while others involve genetically engineering patient-derived immune cells (autologous approach) or donor-derived immune cells (allogeneic approach) to enhance the immune cells and / or redirect the immune cells towards specific target tissues. In the case of cancer, immune cells, particularly cytotoxic T lymphocytes and helper T lymphocytes, natural killers, and macrophages, are particularly potent against cancer because they have the ability to bind to markers known as antigens on the surface of cancer cells. Cell immunotherapy can be deployed by various means such as tumor-infiltrating lymphocyte (TIL) therapy, cell therapy with engineered T cell receptors (TCRs), chimeric antigen receptor (「CAR」) immunotherapy, and natural killer (NK) cell therapy.

[0003] Chimeric antigen receptor-expressing immune cells are cells that have been genetically engineered to express a chimeric antigen receptor (CAR) and are often designed to recognize specific tumor antigens and kill cancer cells expressing said tumor antigen(s). Chimeric antigen receptor-expressing immune cells are generally T cells expressing a CAR (「CAR-T cells」), natural killer cells expressing a CAR (「CAR-NK cells」), or macrophages expressing a CAR.

[0004] A CAR is a synthetic receptor consisting of a targeting moiety associated with one or more signaling domains in a single or multiple fusion molecules. Generally, the binding moiety of a CAR can include the antigen-binding domain of a single-chain antibody (scFv) comprising the variable fragments of the light and heavy chains of a monoclonal antibody linked by a flexible linker. Binding moieties based on receptor or ligand domains have also been successfully used. The signaling domain of first-generation CARs is derived from the cytoplasmic region of the CD3 zeta (i.e., CD3ζ) chain or the Fc receptor gamma chain. First-generation CARs have been shown to successfully redirect T cell cytotoxicity but have not been able to provide long-term expansion and antitumor activity in vivo. By adding the signaling domains of costimulatory molecules including CD28, OX-40 (CD134), ICOS, and 4-1BB (CD137) either alone (second generation) or in combination (third generation), the survival of CAR-modified T cells is enhanced and their proliferation is improved. CARs have been successful in redirecting T cells against antigens expressed on the surface of tumor cells from various malignancies including lymphoma and solid tumors (Jena, Dotti et al., Blood (2010) 116(7):1035-44).

[0005] Adoptive immunotherapy uses the transfer of ex vivo-generated autologous or allogeneic antigen-specific T cells and is a promising strategy for treating viral infections and cancer, as confirmed by the increasing number of clinical trials using CAR-T cells.

[0006] To date, only autologous CAR T cells have been approved by the US Food and Drug Administration (FDA) (e.g., anti-CD19 CAR-T tisagenlecleucel (Kymriah™) by Novartis for the treatment of precursor B-cell acute lymphoblastic leukemia, anti-CD19 CAR-T axicabtagene ciloleucel (Yescarta™) by Kite Pharma for certain types of large B-cell lymphoma in adult patients expressing CD19 as a marker, anti-BCMA CAR-T idecabtagene vicleucel (Abecma™) for the treatment of adult patients with relapsed or refractory multiple myeloma, and anti-CD19 CAR-T lisocabtagene maraleucel (Breyanzi™) for adult patients with relapsed or refractory large B-cell lymphoma, anti-CD19 CAR-T brexucabtagene autoleucel (Tecartus™) for patients with relapsed or refractory mantle cell lymphoma). Allogeneic approaches are more difficult due to the cellular alloreactivity against the patient's own immune cells. State-of-the-art programs involve using specific rare-cutting endonucleases, such as TALE nucleases, to inactivate the endogenous T cell receptor gene to reduce cellular alloreactivity prior to cell administration to the patient, as reported by Poirot et al. (Cancer Res. (2015) 75(18):3853-3864) and Qasim et al. (Science Translational (2017) 9(374)). On the other hand, inactivation of TCR (e.g., TRAC and / or TRBC) in primary T cells can be combined with inactivation of MHC components, such as beta-2-microglobulin (B2M), and / or inactivation of genes encoding checkpoint proteins, such as described in WO 2014 / 184744.

[0007] Anti-tumor cell killing by T cells is a promising immunotherapy strategy for both leukemia and solid tumors. However, due to several factors including a lack of tumor-infiltrating lymphocytes (TILs) and an immunosuppressive tumor microenvironment (TME), the effectiveness of tumor antigen-targeted CAR-T therapy against solid tumors is limited (Stern et al. (2020) Cancer Treat Res. 180:297-326). Most solid tumor microenvironments are characterized by the presence of activated fibroblasts called cancer-associated fibroblasts (CAFs) that express unique surface proteins such as FAP (Kalluri R. Nat Rev Cancer (2016) 16:582-98). CAFs can inhibit TILs and promote immunosuppression (Wang et al. (2014) Cancer Immunol Res. 2:154-66).

[0008] Recently, Sakemura et al. (Blood (2019) 134(Suppl 1)135, Biol. Blood Marrow Transplant (2019) 26(S224)) showed that in multiple myeloma, resistance to CAR-T cell therapy is overcome by dual targeting of both malignant plasma cells and CAFs in the tumor microenvironment.

[0009] The treatment of cancer, particularly cancer characterized by solid tumors, remains a major challenge in medicine. There is a need for new compositions and treatments that are effective against solid tumors and safe in patients. More particularly, there is a need for new "universal" compositions and treatments that are useful for treating solid tumors in all patients without allogeneic restrictions, as generally patients are not the donors of the cells from which the compositions are prepared. There is also a particular need for new compositions and treatments that target tumor tissue but have limited effects on healthy tissue that may also express the target antigen.

[0010] This background information is presented for informational purposes only. The admission that the foregoing information constitutes prior art to the present invention is not necessarily intended and should not be construed as such.

Summary of the Invention

Problems to be Solved by the Invention

[0011] This document provides methods and materials for treating cancer. For example, this document provides cells (e.g., immune cells such as T cells or NK cells) engineered to express a chimeric antigen receptor (CAR) having the ability to bind to fibroblast activation protein (FAP) polypeptides expressed by cancer cells (e.g., cancer cells of solid tumors or blood cancers) and / or FAP polypeptides expressed by cells present in the tumor microenvironment.

Means for Solving the Problems

[0012] It should be understood that both the foregoing general description of the embodiments and the subsequent detailed description are exemplary and thus do not limit the scope of the embodiments.

[0013] The methods and materials provided herein are particularly suitable for the treatment of cancers characterized by the presence of FAP in the tumor microenvironment. The methods and materials provided herein are also particularly suitable for achieving a "general-purpose" treatment where the components of the treatment can be used in many unrelated patients.

[0014] Generally, one aspect of this document is a) an exogenous nucleic acid sequence encoding a chimeric antigen receptor (CAR) that targets fibroblast activation protein (FAP) (a "FAP-CAR") placed under the transcriptional control of an exogenous or endogenous constitutive promoter, and b) an exogenous nucleic acid sequence encoding a chimeric antigen receptor (CAR) that targets a tumor antigen (a "tumor-CAR") placed under the transcriptional control of an exogenous or endogenous inducible promoter comprising an engineered cell, wherein the exogenous nucleic acid sequences a) and b) are integrated into the genome of the cell, characterized by an engineered cell in which the expression of the tumor-CAR is inducible upon activation of the cell.

[0015] The manipulated cells can be immune cells such as T cells, NK cells, or macrophages.

[0016] In some cases, the manipulated cells can be manipulated T cells or manipulated NK cells.

[0017] In some cases, the manipulated cells may be iPSCs that can be intermediates in the production of manipulated immune cells such as T cells, NK cells, or macrophages as described herein. In some cases, the manipulated cells can be manipulated immune cells derived from the manipulated iPSCs after the manipulated iPSCs have been subjected to one or more differentiation steps.

[0018] The various aspects described herein are applicable to situations where the cells are immune cells such as T cells, and these various aspects are equally applicable to NK cells and macrophages and are thus included herein.

[0019] In some cases, the manipulated cells described herein are genetically modified to suppress or abrogate the expression of the T cell receptor (TCR) (e.g., the endogenous TCR) in T cells by inactivation of the genes encoding the components of the TCR (e.g., the TRAC gene and / or the TRBC gene), and optionally, to suppress or abrogate the expression of at least one gene that controls MHC complex surface presentation such as B2M and class II major histocompatibility complex transactivator (CIITA), and optionally, to suppress or abrogate the expression of CD52, and optionally, to suppress or abrogate the expression of at least one immune checkpoint or the receptor of an immune checkpoint, and can be T cells.

[0020] In another aspect, the present document a) an exogenous nucleic acid sequence encoding a chimeric antigen receptor (CAR) that targets fibroblast activation protein (FAP) (the "FAP-CAR") placed under the transcriptional control of an exogenous or endogenous constitutive promoter, and b) An exogenous nucleic acid sequence encoding a chimeric antigen receptor (CAR) that targets a tumor antigen placed under the transcriptional control of an exogenous or endogenous inducible promoter (“tumor-CAR”), and an engineered T cell comprising wherein the exogenous nucleic acid sequences of a) and b) are integrated into the genome of the cell, characterized by an engineered T cell in which the expression of the tumor-CAR is inducible upon activation of the T cell.

[0021] In some cases, the FAP-CAR comprises (a1) an extracellular FAP-binding domain comprising the amino acid sequences of the VH and VL of a monoclonal anti-FAP antibody, and (a2) a hinge selected from the FcγRIII hinge, CD8α hinge, and IgG1 hinge, and (a3) a transmembrane domain comprising the CD8α transmembrane domain or the CD28 transmembrane domain, and (a4) a cytoplasmic domain comprising the CD3 zeta signaling domain and optionally a co-stimulatory domain of 4-1BB or CD28 and may comprise.

[0022] In some cases, the tumor-CAR comprises (b1) an extracellular tumor antigen-binding domain comprising the amino acid sequences of the VH and VL of a monoclonal anti-tumor antigen antibody, and (b2) a hinge selected from the FcγRIII hinge, CD8α hinge, and IgG1 hinge, and (b3) a transmembrane domain comprising the CD8α transmembrane domain or the CD28 transmembrane domain, and (b4) a cytoplasmic domain comprising the CD3 zeta signaling domain and a co-stimulatory domain of 4-1BB or CD28 and may comprise.

[0023] In some cases, the constitutive promoter may be selected from the group consisting of the promoters of EF1A, CD52, GAPDH, CMV, hPGK, UBC, SV40, PGK, CAGG, TRAC, TRBC, TRGC, TRDC, B2M, CD5, CS1, CD45, RPBSA, CD4, and CD8, and / or the inducible promoter may be selected from the group consisting of the NFAT-responsive element and the promoters of PDCD1, CD25, TIM3, TIGIT, CCL1, NR4A3, EGR3, G0S2, IL22, RGS16, FASLG, RDH10, CSF1, GM-CSF, LAG3, CTLA-4, IL10, NUR77, and FOXP3.

[0024] In some cases, the constitutive promoter may be selected from the group consisting of the promoters of EF1A, TRAC, B2M, CD52, CS1, CD45, CD5, and GAPDH. For example, the constitutive promoter may be the EF1A promoter, the TRAC promoter, the CD52 promoter, or the B2M promoter. For example, the constitutive promoter may be the EF1A promoter.

[0025] In some cases, the inducible promoter may be selected from the group consisting of the NFAT-responsive element and the promoters of PDCD1, CD25, GM-CSF, TIM3, and TIGIT. For example, the inducible promoter may be the PDCD1 promoter.

[0026] In some cases, the constitutive promoter may be the endogenous TRAC promoter or the exogenous EF1A promoter, and the inducible promoter may be the endogenous PDCD1 promoter.

[0027] In some cases, the constitutive promoter may be the exogenous EF1A promoter, and the inducible promoter may be the endogenous PDCD1 promoter.

[0028] In some cases, the FAP-CAR may include an extracellular FAP-binding domain comprising the amino acid sequence of SEQ ID NO: 9, SEQ ID NO: 20, SEQ ID NO: 31, or SEQ ID NO: 42, and / or the tumor-CAR may include an extracellular tumor antigen-binding domain comprising the amino acid sequence of SEQ ID NO: 53, SEQ ID NO: 61, or SEQ ID NO: 69.

[0029] In some cases, the FAP-CAR may include an extracellular FAP-binding domain comprising the amino acid sequence of SEQ ID NO: 9, and the tumor-CAR may include an extracellular tumor antigen-binding domain comprising the amino acid sequence of SEQ ID NO: 61 or SEQ ID NO: 69.

[0030] In some cases, the engineered T cells described herein may be T cells that are genetically modified to suppress or abrogate TCR expression by inactivation of genes encoding components of the T cell receptor (TCR) (e.g., endogenous TCR) in the T cell (e.g., TRAC and / or TRBC), and optionally genetically modified to suppress or abrogate the expression of at least one gene that controls MHC complex surface presentation, such as B2M and CIITA, and optionally genetically modified to suppress or abrogate the expression of CD52, and optionally genetically modified to suppress or abrogate the expression of at least one immune checkpoint or the receptor of an immune checkpoint.

[0031] In some cases, the engineered T cells described herein may be T cells that are genetically modified to (i) suppress or abrogate TCR expression by inactivation of genes encoding components of the T cell receptor (TCR) (e.g., TRAC and / or TRBC) in the T cell, (ii) suppress or abrogate the expression of the gene encoding the receptor of PDCD1 or PD1, and optionally (iii) suppress or abrogate the expression of B2M, and optionally (iv) suppress or abrogate the expression of CD52.

[0032] In another aspect, the present document features a method for treating cancer characterized by the presence of FAP in the tumor microenvironment, which comprises administering, in a therapeutically effective amount, engineered immune cells (e.g., engineered T cells) comprising (a) an exogenous nucleic acid sequence encoding FAP-CAR placed under the transcriptional control of an exogenous or endogenous constitutive promoter, and (b) an exogenous nucleic acid sequence encoding tumor-CAR placed under the transcriptional control of an exogenous or endogenous inducible promoter, as described herein.

[0033] In another aspect, the present document features a pharmaceutical composition comprising, in a therapeutically effective amount, the engineered immune cells (e.g., engineered T cells) described herein.

[0034] In another aspect, the present document features a composition comprising, in a therapeutically effective amount, the engineered immune cells (e.g., engineered T cells) described herein for use in the treatment of cancer characterized by the presence of FAP in the tumor microenvironment.

[0035] In some cases, FAP-CAR can be constitutively expressed in engineered immune cells (e.g., engineered T cells) by lentiviral integration or by nuclease-mediated cDNA insertion at one or more constitutively expressed gene loci such as one or more of the TRAC, B2M, or CD52 gene loci.

[0036] In some cases, the TRAC gene locus and / or the B2M gene locus can be disrupted, e.g., by TALE nucleases, to increase the persistence of engineered immune cells (e.g., the persistence of engineered T cells) in an allogeneic environment for inhibiting graft-versus-host disease (GvHD).

[0037] In some cases, the tumor-CAR may be inducible upon activation of engineered immune cells (e.g., engineered T cells) and may be encoded by an exogenous nucleic acid sequence integrated into the cell's genome by lentiviral integration or by an exogenous nucleic acid sequence integrated into the cell's genome by nuclease-mediated cDNA insertion at one or more inducible genetic loci such as one or more of the genetic loci of PDCD1, CD25, GM-CSF, TIM3, and TIGIT, for example, at the PDCD1 inducible locus.

[0038] In some cases, the tumor antigen targeted by the tumor-CAR may be selected from the group consisting of MUC1 (e.g., human MUC1), mesothelin (e.g., human mesothelin), EGFR (e.g., human EGFR), VEGF (e.g., human VEGF), and Trop2 (e.g., human Trop2).

[0039] In some cases, the tumor antigen targeted by the tumor-CAR may be MUC1 (e.g., human MUC1) or mesothelin (e.g., human mesothelin).

[0040] Other embodiments relate to situations where the engineered immune cell(s) is / are NK cells, and thus, for example, a) an exogenous nucleic acid sequence encoding an FAP-CAR placed under the transcriptional control of an exogenous or endogenous constitutive promoter, and b) an exogenous nucleic acid sequence encoding a tumor-CAR placed under the transcriptional control of an exogenous or endogenous inducible promoter comprising engineered NK cells, wherein the exogenous nucleic acid sequences a) and b) are integrated into the cell's genome, and the expression of the tumor-CAR is inducible upon activation of the NK cells, relate to engineered NK cells.

[0041] In some cases, the FAP-CAR is (a1) an extracellular FAP-binding domain comprising the amino acid sequences of the VH and VL of a monoclonal anti-FAP antibody, and (a2) a hinge selected from an FcγRIII hinge, a CD8α hinge, and an IgG1 hinge, and (a3) a transmembrane domain comprising a CD8α transmembrane domain or a CD28 transmembrane domain, and (a4) a cytoplasmic domain comprising a CD3 zeta signaling domain and optionally a co-stimulatory domain of 4-1BB or CD28 may comprise.

[0042] In some cases, the tumor-CAR is (b1) an extracellular tumor antigen-binding domain comprising the amino acid sequences of the VH and VL of a monoclonal anti-tumor antigen antibody, and (b2) a hinge selected from an FcγRIII hinge, a CD8α hinge, and an IgG1 hinge, and (b3) a transmembrane domain comprising a CD8α transmembrane domain or a CD28 transmembrane domain, and (b4) a cytoplasmic domain comprising a CD3 zeta signaling domain and a co-stimulatory domain of 4-1BB or CD28 may comprise.

[0043] In another aspect, the present document is a method for producing a cell population comprising engineered immune cells (e.g., engineered T cells) described herein, comprising (i) preparing immune cells from a donor, and (ii) when the cells are T cells, inactivating the expression of the T cell receptor (TCR) (e.g., endogenous TCR) in the cells or the presentation of TCR on the cell surface, and (iii) integrating into the genome of the cells an exogenous nucleic acid sequence encoding a FAP-CAR placed under the transcriptional control of an exogenous or endogenous constitutive promoter, and (iv) integrating into the genome of the cells an exogenous nucleic acid sequence encoding a tumor-CAR placed under the transcriptional control of an exogenous or endogenous inducible promoter, and (v) optionally, isolating engineered cells that do not express TCR (e.g., endogenous TCR) on the cell surface comprising, Featured is a method in which the expression of tumor-CAR can be induced upon activation of immune cells (e.g., T cells).

[0044] In another aspect, this document is a method for producing a cell population comprising engineered NK cells described herein, comprising: (i) preparing donor-derived immune cells; (ii) integrating into the genome of the cells an exogenous nucleic acid sequence encoding FAP-CAR placed under the transcriptional control of an exogenous or endogenous constitutive promoter; (iii) integrating into the genome of the cells an exogenous nucleic acid sequence encoding tumor-CAR placed under the transcriptional control of an exogenous or endogenous inducible promoter and featured is a method in which the expression of tumor-CAR can be induced upon activation of NK cells.

[0045] Other objects, features, and advantages of the present invention will become apparent from the following detailed description. However, it should be understood that various changes and modifications within the spirit and scope of the present invention will be apparent to those skilled in the art from this detailed description, and that the detailed description and specific examples are given by way of illustration only and not by way of limitation of the specific embodiments of the present invention.

[0046] Those skilled in the art will understand that the drawings described below are for illustrative purposes only. The drawings are not intended to limit the scope of the teachings herein.

Brief Description of the Drawings

[0047]

Figure 1

Figure 2

Figure 3

Figure 4-1

Figure 4-2

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9-1

Figure 9-2

[0048] This document provides methods and materials that can be used to locally amplify the anti-tumor activity of immunotherapy by exploiting the spatial features of the tumor microenvironment (the "TME"). For example, in some cases, this document provides a fibroblast activation protein (the "FAP")-targeted CAR that can be used as an inducer of targeted cellular immunotherapy, thereby enabling the enhancement of CAR-T anti-tumor activity when and where CAR-T anti-tumor activity is needed, thereby enhancing both the therapeutic efficacy and safety of targeted cellular immunotherapy in patients.

[0049] In the interpretation of this specification, the following definitions shall apply, and whenever appropriate, terms used in the singular shall include the plural, and vice versa. If any of the definitions described below conflict with the usage of such terms in other documents, including documents incorporated herein by reference, the definitions described below shall always prevail in the interpretation of this specification and the claims related hereto, unless a contrary meaning is clearly intended (e.g., in the document in which the term was first used). Unless otherwise specified, the use of "or" means "and / or". When used in this specification and the claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. For example, the term "a cell" includes a plurality of cells and a mixture of cells. The use of "comprise", "comprises", "comprising", "include", "includes", and "including" is interchangeable and not intended to be limiting. Further, when the term "comprising" is used in the description of one or more embodiments, those skilled in the art will understand that in some specific instances, one or more embodiments may alternatively be described using the phrases "consisting essentially of" and / or "consisting of".

[0050] As used herein, the term "about" means ±10% of the numerical value of the number used with the term "about".

[0051] In practicing or testing the present invention, all methods and materials similar or equivalent to those described herein can be used, and suitable methods and materials are described herein. All published documents, patent applications, patents, and other references mentioned in this specification are hereby incorporated by reference in their entirety. In case of conflict, this specification, including definitions, will control. Further, unless otherwise specified, the materials, methods, and examples are illustrative only and not intended to be limiting.

[0052] In the practice of the present invention, unless otherwise stated, techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, gene editing, and immunology that are within the knowledge of those skilled in the art are used. Such techniques are well described in the literature. For example, Current Protocols in Molecular Biology (Frederick M. AUSUBEL, 2000, Wiley and son Inc, Library of Congress, USA), Molecular Cloning: A Laboratory Manual, 3rd Edition, (Sambrook et al., 2001, Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press), Oligonucleotide Synthesis (M.J. Gait ed., 1984), Mullis et al., U.S. Patent No. 4,683,195, Nucleic Acid Hybridization (B.D. Harries & S.J. Higgins eds., 1984), Transcription And Translation (B.D. Hames & S.J. Higgins eds., 1984), Culture Of Animal Cells (R.I. Freshney, Alan R. Liss, Inc., 1987), Immobilized Cells And Enzymes (IRL Press, 1986), B. Perbal, A Practical Guide To Molecular Cloning (1984), the series Methods In ENZYMOLOGY (J. Abelson and M. Simon, editors-in-chief, Academic Press, Inc., New York), particularly Volumes 154 and 155 (eds. Wu et al.) and Volume 185, "Gene Expression Technology" (D. Goeddel ed.), Gene Transfer Vectors For Mammalian Cells (J.H. Miller and M.P.See Calos, ed., 1987, Cold Spring Harbor Laboratory; Immunochemical Methods In Cell And Molecular Biology, Mayer and Walker, eds., Academic Press, London, 1987; Handbook Of Experimental Immunology, vols. I-IV, D.M. Weir and C.C. Blackwell, eds., 1986; and Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986.

[0053] Unless otherwise defined herein, all technical and scientific terms used have the same meaning as commonly understood by one of ordinary skill in the art in the fields of gene therapy, biochemistry, genetics, immunology, cancer, molecular biology, and gene editing. Definitions of common terms in molecular biology can be found, for example, in Benjamin Lewin, Genes VII, published by Oxford University Press, 2000 (ISBN 019879276X); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Publishers, 1994 (ISBN 0632021829); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by Wiley, John & Sons, Inc., 1995 (ISBN 0471186341).

[0054] As used herein, "recipient" refers to a patient who receives a graft, such as a graft containing a population of engineered immune cells, e.g., T cells. The transplanted cells administered to the recipient can be, for example, autologous cells, syngeneic cells, or allogeneic cells.

[0055] As used herein, "donor" means a mammal (e.g., human) from which one or more cells are isolated prior to administration of the cells or progeny of the cells to a recipient. The one or more cells can be, for example, a population of immune cells or hematopoietic stem cells that are manipulated, expanded, enriched, or maintained according to the methods described herein prior to administration of the cells or progeny of the cells to a recipient. In an allogeneic context contemplated herein, the "donor" is not the patient being treated.

[0056] "Expansion" in the context of cells refers to an increase in the number of a particular cell type or cell types from an initial cell population of cells that may or may not be identical. The initial cells used for expansion need not be the same as the cells generated from the expansion.

[0057] "Cell population" includes eukaryotic cells such as mammalian cells, e.g., human cells, isolated from a biological source, e.g., a blood preparation or tissue. A cell population can be derived from more than one cell.

[0058] As used herein, the term "pharmaceutical composition" refers to an active ingredient combined with a pharmaceutically acceptable carrier and / or excipient such as carriers and / or excipients commonly used in the pharmaceutical industry. The phrase "pharmaceutically acceptable" is used herein to refer to compounds, materials, compositions, and / or dosage forms that are suitable for use in contact with mammalian tissue such as human tissue within the scope of sound medical judgment, and that do not have excessive toxicity, irritation, allergic response, or other problems or complications, and provide a reasonable benefit / risk ratio.

[0059] As used herein, the term "administering" refers to introducing a compound, cell, or cell population disclosed herein to a subject by a method or route that results in at least partial delivery of an agent to a desired site. A pharmaceutical composition comprising a compound or cell disclosed herein can be administered by any suitable route that results in effective treatment of a patient. A patient that can be treated by the materials and methods disclosed herein can be a mammal, including humans and non-human primates.

[0060] As used herein, the term "nucleic acid" or "polynucleotide" refers to nucleotides and / or polynucleotides, such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), oligonucleotides, fragments generated by polymerase chain reaction (PCR), and fragments generated by any of ligation, fragmentation, endonuclease action, and exonuclease action. Nucleic acid molecules can be composed of monomers that are naturally occurring nucleotides (e.g., DNA and RNA), or analogs of naturally occurring nucleotides (e.g., enantiomeric forms of naturally occurring nucleotides), or combinations of both. Modified nucleotides can have modifications in the sugar portion and / or the pyrimidine or purine base portion. Sugar modifications can include, for example, replacement of one or more hydroxyl groups by halogen, alkyl groups, amines, and azide groups, or the sugar can be functionalized as an ether or ester. Further, the entire sugar portion can be replaced with stereochemically and electronically similar structures, such as azasugars and carbocyclic sugar analogs. Examples of modifications in the base portion include alkylated purines and pyrimidines, acylated purines or pyrimidines, or other well-known heterocyclic substitutions. Nucleic acid monomers can be linked by phosphodiester bonds or analogs of phosphodiester bonds. Nucleic acids can be either single-stranded or double-stranded.

[0061] The terms "polypeptide", "peptide", and "protein" are used interchangeably to refer to a polymer of amino acid residues. This term also applies to amino acid polymers in which one or more amino acids are chemical analogs or modified derivatives of the corresponding naturally occurring amino acids.

[0062] As used herein, the terms "treating", "treatment", "to treat", etc. refer to obtaining a desired pharmacological and / or physiological effect. This effect may be prophylactic in terms of completely or partially preventing a disease or symptom of a disease, and / or therapeutic in terms of partial or complete cure of a disease and / or adverse effect attributable to the disease. "Treatment" as used herein includes any treatment of a disease in a mammal (e.g., a human), including (a) preventing the occurrence of a disease in a subject who may be predisposed to the disease but has not yet been diagnosed as having the disease, (b) inhibiting the disease, i.e., arresting its development, and (c) relieving the disease, e.g., causing regression of the disease, e.g., completely or partially eliminating the symptoms of the disease.

[0063] As used herein, the term "subject" or "patient" includes mammals including non-human primates and humans.

[0064] "Effective amount" or "therapeutically effective amount" refers to an amount of a composition described herein that is sufficient to be useful in treating a disease when administered to a subject (e.g., a human). The amount of the composition that constitutes a "therapeutically effective amount" will vary depending on the cell preparation, the condition and severity of the condition, the mode of administration, and the age of the subject being treated, but can be determined by conventional methods by those of ordinary skill in the art considering their knowledge and the present disclosure. When referring to an individual active ingredient or composition administered alone, a therapeutically effective dose refers only to that individual active ingredient or composition. When referring to a combination, a therapeutically effective dose refers to the total amount of the active ingredient, composition, or both that produces a therapeutic effect, whether administered concomitantly, simultaneously, or sequentially.

[0065] "Vector" means a nucleic acid molecule capable of transporting another linked nucleic acid. "Vector" can include, but is not limited to, viral vectors, plasmids, oligonucleotides, RNA vectors, or linear or circular DNA or RNA molecules that can consist of chromosomal nucleic acids, non-chromosomal nucleic acids, semi-synthetic nucleic acids, or synthetic nucleic acids. Preferred vectors are vectors capable of autonomous replication (episomal vectors) and / or vectors capable of expressing the linked nucleic acid (expression vectors). A number of suitable vectors are known to those skilled in the art and are commercially available. Viral vectors include retroviruses, adenoviruses, parvoviruses (e.g., adeno-associated virus (AAV)), coronaviruses, orthomyxoviruses (e.g., influenza virus), rhabdoviruses (e.g., rabies virus and vesicular stomatitis virus), paramyxoviruses (e.g., measles and Sendai) and other negative-strand RNA viruses, picornaviruses and alphaviruses and other positive-strand RNA viruses, and double-stranded DNA viruses including adenoviruses, herpesviruses (e.g., herpes simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and poxviruses (e.g., vaccinia, fowlpox and canarypox). Other viruses include, for example, Norwalk virus, togavirus, flavivirus, reovirus, papovavirus, hepadnavirus, and hepatitis virus. Examples of retroviruses include avian leukosis-sarcoma virus, mammalian C-type virus, B-type virus, D-type virus, HTLV-BLV group, lentivirus, spumavirus (Coffin, J.M., Retroviridae: The viruses and their replication, In Fundamental Virology, 3rd ed., B.N. Fields et al. eds., Lippincott-Raven Publishers, Philadelphia, 1996).

[0066] As used herein, the term "locus" is the specific physical location of a DNA sequence (e.g., a gene) in the genome. The term "locus" can refer to the specific physical location of a rare cleavage endonuclease target sequence on a chromosome. Such a locus can include a target sequence that is recognized and / or cleaved by a sequence-specific endonuclease described herein. The locus of interest can identify not only a nucleic acid sequence present in the bulk of the cell's genetic material (i.e., the chromosome), but also a portion of genetic material that can exist independently of the bulk of the genetic material, such as a plasmid, episome, virus, transposon, etc., or a portion of genetic material that can exist in an organelle such as mitochondria, by way of non-limiting example.

[0067] As used herein, a nucleic acid sequence is said to be "under the transcriptional control of a promoter" when the nucleic acid sequence is operably linked to the promoter and the nucleic acid sequence follows the promoter or is at the 3' end of the promoter such that transcription of the nucleic acid sequence is controlled by the promoter.

[0068] The term "cleavage" as used with respect to a nucleic acid refers to the breakage of the covalent backbone of a polynucleotide. Cleavage can be initiated by a variety of methods including, but not limited to, enzymatic or chemical hydrolysis of phosphodiester bonds. Both single-strand cleavage and double-strand cleavage are possible, and double-strand cleavage can occur as a result of two different single-strand cleavage events. Cleavage of double-stranded DNA, RNA, or DNA-RNA hybrids can result in the production of either blunt ends or sticky ends.

[0069] "Sequence identity" refers to the identity between two nucleic acid molecules or polypeptides. Sequence identity refers to residues that are the same in two sequences when the two sequences are aligned to maximize their correspondence. If the positions in the sequences being compared are occupied by the same base (or amino acid), the molecules are identical at that position. The degree of identity between nucleic acid sequences (or amino acid sequences) depends on the number of nucleotides (or amino acids) that are identical or match at positions common to the aligned nucleic acid sequences (or amino acid sequences). Various alignment algorithms and / or alignment programs, including FASTA or BLAST, which are available as part of the GCG sequence analysis package (University of Wisconsin, Madison, Wis.), can be used to calculate the identity between two sequences, for example, using default settings. For example, polypeptides having at least 70%, 85%, 90%, 95%, 98% or 99% identity with a specific polypeptide described herein and exhibiting substantially the same function, and polynucleotides encoding such polypeptides are contemplated.

[0070] "Fibroblast activation protein" ("FAP") is generally also referred to as prolyl endopeptidase FAP, or fibroblast activation protein alpha (NCBI Gene ID: 2191). In some cases, the FAP polypeptide can be a human FAP polypeptide. Examples of FAP polypeptides that can be targeted by the FAP-CAR described herein include, but are not limited to, human FAP polypeptides having the amino acid sequence set forth in NCBI Reference Sequence: NP_004451.2.

[0071] In one aspect, the present document a) an exogenous nucleic acid sequence encoding a chimeric antigen receptor (CAR) that targets fibroblast activation protein (FAP) ("FAP-CAR") placed under the transcriptional control of an exogenous or endogenous constitutive promoter, and b) an exogenous nucleic acid sequence encoding a chimeric antigen receptor (CAR) that targets a tumor antigen under the transcriptional control of an exogenous or endogenous inducible promoter ("tumor-CAR"), and an engineered cell comprising: providing an engineered cell, wherein the exogenous nucleic acid sequences a) and b) are integrated into the genome of the cell, and the expression of the tumor-CAR is inducible upon activation of the cell.

[0072] The engineered cell can be any suitable cell. For example, the cell comprising the exogenous nucleic acid sequences a) and b) can be an immune cell such as a T cell, NK cell, or macrophage. In some cases, the cell comprising the exogenous nucleic acid sequences a) and b) can be an iPSC that is an intermediate in the production of an engineered immune cell such as a T cell, NK cell, or macrophage as described herein.

[0073] In some cases, the engineered cell provided herein is genetically modified to suppress or abrogate the expression of a T cell receptor (TCR), e.g., an endogenous TCR, on the surface of the T cell, and optionally, genetically modified to suppress or abrogate the expression of at least one gene that controls MHC complex surface presentation, such as the B2M gene encoding the β2m polypeptide and / or the CIITA gene encoding the CIITA polypeptide, and optionally, genetically modified to suppress or abrogate the expression of the gene encoding the CD52 polypeptide on the surface of the T cell, and can be a T cell.

[0074] In some cases, the β2m polypeptide can be a human β2m polypeptide. Examples of the B2M gene encoding a β2m polypeptide whose expression can be suppressed or abrogated as described herein include, but are not limited to, the human B2M gene encoding a β2m polypeptide having the amino acid sequence set forth in GeneBank accession number AAA51811 (e.g., NCBI gene ID 567).

[0075] In some cases, the CIITA polypeptide can be a human CIITA polypeptide. Examples of CIITA genes encoding CIITA polypeptides whose expression can be suppressed or inhibited as described herein include, but are not limited to, the human CIITA gene (e.g., NCBI Gene ID 4261) encoding a CIITA polypeptide having the amino acid sequence described in GeneBank accession number P33076.3 or AAU06586.

[0076] In some cases, the CD52 polypeptide can be a human CD52 polypeptide. Examples of CD52 genes encoding CD52 polypeptides whose expression can be suppressed or inhibited as described herein (e.g., NCBI Gene ID 1043) include, but are not limited to, the human CD52 polypeptide having the amino acid sequence described in GeneBank accession number AJC19276.

[0077] In some cases, the engineered T cells described herein can be designed such that the CD52 gene, the B2M gene, or both the CD52 gene and the B2M gene are inactivated.

[0078] In some cases, the engineered T cells described herein can be designed (e.g., gene-modified) to suppress or inhibit the expression of at least one gene encoding an immune checkpoint protein or a receptor for an immune checkpoint protein. For example, the engineered T cells described herein can be designed such that the programmed cell death 1 (PDCD1) gene, the CTLA4 gene, or both the PDCD1 gene and the cytotoxic T lymphocyte-associated protein 4 (CTLA4) gene are inactivated.

[0079] In some cases, the PD1 polypeptide can be a human PD1 polypeptide. Examples of the PDCD1 gene encoding a PD1 polypeptide whose expression can be suppressed or inhibited as described herein include, but are not limited to, the human PDCD1 gene encoding a polypeptide having the amino acid sequence described in GeneBank accession number UMM61402.1 (e.g., NCBI gene ID 5133 or ENSG00000188389).

[0080] In some cases, the CTLA4 polypeptide can be a human CTLA4 polypeptide. Examples of the CTLA4 gene encoding a CTLA4 polypeptide whose expression can be suppressed or inhibited as described herein include, but are not limited to, the human CTLA4 gene encoding a CTLA4 polypeptide having the amino acid sequence of GeneBank accession number AAL07473 (e.g., NCBI gene ID 1493).

[0081] In some cases, the engineered T cells described herein can be designed such that at least one gene encoding a TCR component and the PDCD1 gene are inactivated.

[0082] In another aspect, the present document provides a pharmaceutical composition comprising an engineered immune cell (e.g., an engineered T cell) comprising: a) an exogenous nucleic acid sequence encoding a FAP-CAR under the transcriptional control of an exogenous or endogenous constitutive promoter; and b) an exogenous nucleic acid sequence encoding a tumor-CAR under the transcriptional control of an exogenous or endogenous inducible promoter, wherein the exogenous nucleic acid sequences a) and b) are integrated into the genome of the cell and the expression of the tumor-CAR is inducible upon activation of the immune cell.

[0083] In some cases, the pharmaceutical compositions described herein can be for use in the treatment of cancer characterized by the presence of FAP in the tumor microenvironment.

[0084] In another aspect, the present document provides a method of treating cancer characterized by the presence of FAP in the tumor microenvironment, the method comprising administering, to a patient in need thereof, a therapeutically effective amount of engineered immune cells (e.g., engineered T cells) comprising: a) an exogenous nucleic acid sequence encoding an FAP-CAR under the transcriptional control of an exogenous or endogenous constitutive promoter; and b) an exogenous nucleic acid sequence encoding a tumor-CAR under the transcriptional control of an exogenous or endogenous inducible promoter, wherein the exogenous nucleic acid sequences a) and b) are integrated into the genome of the cell and the expression of the tumor-CAR is inducible upon activation of the immune cell.

[0085] The engineered cells and methods described herein can be part of autologous treatment or part of allogeneic treatment. Autologous means that the cells used to treat the patient are derived from the patient. Allogeneic means that the cells or cell population used to treat the patient are not derived from the patient but from a donor or cell line.

[0086] In some cases, the engineered cells described herein can be administered to a patient (e.g., a human) undergoing immunosuppressive treatment. In some cases, the administered cells can be cells made resistant to at least one immunosuppressive agent. In some cases, immunosuppressive treatment can aid in the selection and expansion of engineered immune cells (e.g., engineered T cells) in the patient.

[0087] Any suitable route of administration can be used to administer the cells described herein to a patient, including aerosol inhalation, injection, ingestion, infusion, implantation, and / or transplantation. The compositions described herein can be administered subcutaneously, intradermally, intratumorally, intra-articularly, intrathecally, intramuscularly, by intravenous or lymphatic injection, or intraperitoneally to a patient. In some cases, the cell compositions described herein can be administered to a patient by intravenous injection as long as the cells can migrate to the desired site of action.

[0088] Individual needs vary, but determining the optimal range of the effective amount of a particular cell type for a particular disease or condition is within the skill set of one of ordinary skill in the art. An effective amount means an amount that provides a therapeutic or prophylactic benefit. The dosage administered will be determined by the recipient's age, health, and weight, the type if concurrent treatment is present, the frequency of treatment, and the nature of the desired effect. In some cases, administration of the cells or cell population may include from about 10 4 to 10 9 cells per administration. In some cases, from about 10 5 to 10 6 cells / kg body weight, or from about 10 5 to 5×10 6 cells / kg body weight may be administered. All integer values of the number of cells within these ranges are contemplated.

[0089] The cells may be administered in one or more doses. In some cases, an effective amount of the cells may be administered as a single dose. In some cases, an effective amount of the cells may be administered as multiple doses over a period of time. The timing of administration is within the discretion of the attending physician and is determined by the clinical condition of the patient.

[0090] In some cases, administering engineered immune cells (e.g., T cells) can involve treating the patient with a myeloablative regimen and / or an immunosuppressive regimen to deplete host bone marrow stem cells and prevent rejection. In some cases, the patient can be administered chemotherapy and / or radiation therapy. In some cases, the patient can be administered a reduced-dose chemotherapy regimen. In some cases, a reduced-dose chemotherapy regimen using busulfan at 25% of the standard dose may be sufficient to achieve significant engraftment of the modified cells while reducing conditioning-related toxicities (Aiuti A. et al. (2013), Science 23;341(6148)). More intensive chemotherapy regimens can be based on the administration of both busulfan and fludarabine as endogenous HSC-depleting agents. In some cases, the doses of busulfan and fludarabine can be approximately 50% and 30% of the doses used in standard allogeneic transplantation. In some cases, the cells can be administered after B cell depletion therapy with an agent that reacts with CD20, such as Rituxan. In some cases, the patient can be administered chemotherapy such as fludarabine, external beam radiation therapy (XRT), cyclophosphamide, or an antibody such as OKT3 against CD3 or alemtuzumab against CD52 (Campath® (registered trademark), Lemtrada® (registered trademark)). In some cases, the patient can be administered fludarabine and cyclophosphamide, and optionally alemtuzumab.

[0091] In certain cases, the engineered immune cells (e.g., T cells) can be administered to a subject as part of a combination therapy that includes an immunosuppressive agent. Exemplary immunosuppressive agents include sirolimus, tacrolimus, cyclosporine, mycophenolic acid, antithymocyte globulin, corticosteroids, calcineurin inhibitors, antimetabolites such as methotrexate, post-transplant cyclophosphamide, or any combination thereof. In some cases, the subject can be pre-treated with only sirolimus or tacrolimus for prevention of GVHD. In some cases, the cells can be administered to the subject before the immunosuppressive agent. In some cases, the cells can be administered to the subject after the immunosuppressive agent. In some cases, the cells can be administered to the subject concurrently with the immunosuppressive agent. In some cases, the cells can be administered to the subject without an immunosuppressive agent. In some cases, a patient receiving the genetically modified cells can receive the immunosuppressive agent for less than 6 months, less than 5 months, less than 4 months, less than 3 months, less than 2 months, less than 1 month, less than 3 weeks, less than 2 weeks, or less than 1 week.

[0092] 1. Engineered immune cells comprising FAP-CAR and tumor-CAR Engineered cells that express (i) a chimeric antigen receptor against fibroblast activation protein ( "FAP-CAR") whose expression is constitutive, and (ii) a chimeric antigen receptor against a tumor antigen ( "tumor-CAR") whose expression is inducible upon activation of said cells are not particularly limited.

[0093] 1.1. Cell types The engineered cells described herein can be immune cells including T cells, NK cells, and macrophages.

[0094] The engineered cells described herein can also be induced pluripotent stem cells ( "iPSCs") and can be subsequently differentiated into the immune cells described herein. The engineered iPSCs described herein are thus intermediates in the production of engineered immune cells according to the present disclosure.

[0095] In some cases, the engineered cells described in this book may be any differentiated cells, may be later dedifferentiated into iPSCs, or may be later differentiated from iPSCs into the immune cells described in this book. The engineered differentiated cells described in this book are thus intermediates in the production of engineered immune cells according to the present disclosure. The genetic manipulations described in this book can be performed on differentiated cells, dedifferentiated cells, or iPSCs.

[0096] Methods for producing iPSCs from differentiated cells are well known to those skilled in the art and include methods based on nuclear transfer, the use of cell extracts and synthetic molecules, the forced expression of defined genes, and modifications at the cytoplasmic level (Telpaló-Carpio et al. (2013) J Stem Cells Regen Med. 9(1):2-8). Methods for producing immune cells from iPSCs are also well known to those skilled in the art and include, for example, the serum-free and feeder-free in vitro differentiation protocol for T cells disclosed by Themeli et al. (Nature Biotechnology (2013) 31:928-933), and the use of the differentiation protocol for NK cells under fully chemically defined conditions described by Matsubara et al. (Biochem Biophys Res Commun. (2019) 515(1):1-8).

[0097] Thus, one aspect is a) an exogenous nucleic acid sequence encoding a chimeric antigen receptor (CAR) that targets fibroblast activation protein (FAP) (「FAP-CAR」) under the transcriptional control of an exogenous or endogenous constitutive promoter, and b) an exogenous nucleic acid sequence encoding a chimeric antigen receptor (CAR) that targets a tumor antigen (「tumor-CAR」) under the transcriptional control of an exogenous or endogenous inducible promoter comprising an engineered immune cell, wherein the exogenous nucleic acid sequences a) and b) are integrated into the genome of the cell, and the expression of the tumor-CAR is inducible upon activation of the immune cell, relating to an engineered immune cell.

[0098] In some cases, the immune cells can be T cells.

[0099] In some cases, the immune cells can be NK cells.

[0100] In some cases, the immune cells can be macrophages.

[0101] Another aspect is a) an exogenous nucleic acid sequence encoding a chimeric antigen receptor (CAR) that targets fibroblast activation protein (FAP) ( "FAP-CAR") under the transcriptional control of an exogenous or endogenous constitutive promoter, and b) an exogenous nucleic acid sequence encoding a chimeric antigen receptor (CAR) that targets a tumor antigen ( "tumor-CAR") under the transcriptional control of an exogenous or endogenous inducible promoter in engineered iPSCs, wherein the exogenous nucleic acid sequences a) and b) are integrated into the genome of the cell, and the expression of the tumor-CAR is inducible upon activation of the iPSC or upon activation of immune cells into which the engineered iPSC can further differentiate.

[0102] In some cases, the engineered iPSCs described herein can be intermediates in the production of engineered immune cells comprising the FAP-CAR and the tumor-CAR.

[0103] 1.2. FAP-CAR and tumor-CAR The term "chimeric antigen receptor" or "CAR" generally refers to a synthetic receptor that includes a targeting moiety associated with one or more signaling domains as a single fusion molecule. In the definition in this document, the term "chimeric antigen receptor" includes single-chain CARs and multi-chain CARs. In some cases, the binding portion of a CAR can include the antigen-binding domain of a single-chain antibody (scFv) that includes the variable fragments of the light and heavy chains of a monoclonal antibody linked by a flexible linker. Binding portions based on receptor or ligand domains have also been successfully used. The signaling domain of first-generation CARs is derived from the cytoplasmic region of the CD3 zeta chain or the Fc receptor gamma chain. First-generation CARs have been shown to successfully redirect T cell cytotoxicity. However, first-generation CARs were unable to provide long-term expansion and antitumor activity in vivo. By adding the signaling domains of co-stimulatory molecules including CD28, OX-40 (CD134), and 4-1BB (CD137) alone (second generation) or in combination (third generation), the survival of CAR-modified T cells is enhanced and their proliferation is improved. Since multi-chain CARs are also possible, CARs are not necessarily limited to single-chain polypeptides only. According to the structure of a multi-chain CAR as described, for example, in International Publication No. WO 2014 / 039523, the signaling domain and the co-stimulatory domain are located on different polypeptide chains. Such a multi-chain CAR can be derived from FcεRI by replacing the high-affinity IgE-binding domain of the FcεRI alpha chain with an extracellular ligand-binding domain such as an scFv, while the N-terminal tail and / or C-terminal tail of the beta chain and / or gamma chain of FcεRI are fused to the signaling domain and the co-stimulatory domain, respectively. The extracellular ligand-binding domain serves to redirect the specificity of immune cells (e.g., T cells) towards a cellular target, and the signaling domain activates the immune cell response. CARs are generally expressed in effector immune cells to redirect the immune activity of effector immune cells against antigens expressed on the surface of tumor cells from various malignant diseases including lymphoma and solid tumors.The components of a CAR are any functional subunits of the CAR encoded by an exogenous polynucleotide sequence introduced into a cell. For example, this component can serve to interact with a target antigen, stabilize the CAR, or localize the CAR within the cell.

[0104] The CARs of the present disclosure that are useful in the methods of this book are not limited to a particular CAR structure, but the nucleic acids that can be used to engineer immune cells generally encode a CAR comprising an extracellular antigen-binding domain that binds to a tumor antigen or FAP (depending on the target of the CAR), a hinge, a transmembrane domain, and an intracellular domain comprising a co-stimulatory domain and / or a primary signaling domain. Generally, the extracellular antigen-binding domain is a scFv comprising a variable heavy chain (VH) and a variable light chain (VL) of an antibody that binds to a specific antigen (e.g., a tumor antigen or FAP) connected via a linker. The transmembrane domain can be, for example, the CD8α transmembrane domain, the CD28 transmembrane domain, or the 4-1BB transmembrane domain. The co-stimulatory domain can be, for example, the 4-1BB co-stimulatory domain or the CD28 co-stimulatory domain. The primary signaling domain can be, for example, the CD3ζ signaling domain.

[0105] The CARs described in this book generally also include a signal peptide that directs the nascent protein to the endoplasmic reticulum and induces its subsequent expression on the surface of the engineered cell. The signal peptide is cleaved after directing the CAR to the cell surface. The signal peptides included in the CARs described in this book are those having an amino acid sequence having at least 80%, at least 90%, at least 95%, at least 99% identity with SEQ ID NO: 84, or an alternative signal peptide of SEQ ID NO: 85 and having an amino acid sequence having at least 80%, at least 90%, at least 95%, at least 99% identity, and can be, for example, a CD8α signal peptide. [Table 1]

[0106] The FAP-CAR comprises an extracellular ligand-binding domain (or extracellular antigen-binding domain) that recognizes FAP. Thus, the FAP-CAR described herein comprises an extracellular FAP-binding domain.

[0107] The tumor-CAR comprises an extracellular ligand-binding domain (or extracellular antigen-binding domain) that recognizes a tumor antigen. Thus, the tumor-CAR described herein comprises a tumor antigen-binding domain.

[0108] As used herein, the terms "extracellular antigen-binding domain" or "extracellular ligand-binding domain" generally refer to an oligopeptide or polypeptide that can bind to a specific antigen such as FAP or a tumor antigen. In some cases, this domain can interact with cell surface molecules such as ligands. For example, in some cases, the extracellular antigen-binding domain can be selected to recognize an antigen that acts as a cell surface marker on target cells associated with a particular disease state. In some cases, the extracellular antigen-binding domain can comprise a single-chain antibody fragment (scFv) comprising fragments of the variable heavy chain (VH) and variable light chain (VL) of a target antigen-specific monoclonal antibody linked by a flexible linker. The antigen-binding domain of the CAR expressed on the cell surface of the engineered cells described herein can bind to the target antigen and can be any domain derived from, for example, a monoclonal antibody, a recombinant antibody, a human antibody, a humanized antibody, and functional fragments thereof. [Table 2] TIFF2025521753000003.tif59149

[0109] In some cases, the FAP-CAR a) An extracellular FAP-binding domain comprising the H-CDRs of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, and the L-CDRs of SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, and optionally an amino acid sequence having at least 80%, at least 90%, at least 95%, or at least 99% identity to the amino acid sequence of SEQ ID NO: 9. b) An extracellular FAP-binding domain comprising the H-CDRs of SEQ ID NO: 12, SEQ ID NO: 13, and SEQ ID NO: 14, and the L-CDRs of SEQ ID NO: 15, SEQ ID NO: 16, and SEQ ID NO: 17, and optionally an amino acid sequence having at least 80%, at least 90%, at least 95%, or at least 99% identity to the amino acid sequence of SEQ ID NO: 20. c) An extracellular FAP-binding domain comprising the H-CDRs of SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, and the L-CDRs of SEQ ID NO: 26, SEQ ID NO: 27, and SEQ ID NO: 28, and optionally an amino acid sequence having at least 80%, at least 90%, at least 95%, or at least 99% identity to the amino acid sequence of SEQ ID NO: 31, or d) An extracellular FAP-binding domain comprising the H-CDRs of SEQ ID NO: 34, SEQ ID NO: 35, and SEQ ID NO: 36, and the L-CDRs of SEQ ID NO: 37, SEQ ID NO: 38, and SEQ ID NO: 39, and optionally an amino acid sequence having at least 80%, at least 90%, at least 95%, or at least 99% identity to the amino acid sequence of SEQ ID NO: 42.

[0110] In some cases, the FAP-CAR comprises an extracellular FAP-binding domain comprising a VH region comprising SEQ ID NO: 7 and a VL region comprising SEQ ID NO: 8. In some cases, the FAP-CAR comprises an extracellular FAP-binding domain comprising a VH region comprising SEQ ID NO: 7 and an amino acid sequence having at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, and a VL region comprising SEQ ID NO: 8 and an amino acid sequence having at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. In some cases, the extracellular FAP-binding domain comprises an amino acid sequence comprising the complementarity-determining regions (CDRs) contained in SEQ ID NO: 7 and SEQ ID NO: 8. In some cases, the H-CDRs contained in SEQ ID NO: 7 comprise the amino acid sequences of SEQ ID NOs: 1-3. In some cases, the L-CDRs contained in SEQ ID NO: 8 comprise the amino acid sequences of SEQ ID NOs: 4-6. In some cases, the FAP-CAR comprises an extracellular FAP-binding domain comprising (i) the CDRs contained in SEQ ID NOs: 7 and 8, (ii) a VH region comprising SEQ ID NO: 7 and an amino acid sequence having at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, and (iii) a VL region comprising SEQ ID NO: 8 and an amino acid sequence having at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0111] In some cases, the FAP-CAR comprises an extracellular FAP-binding domain that includes a VH region comprising SEQ ID NO: 18 and a VL region comprising SEQ ID NO: 19. In some cases, the FAP-CAR comprises an extracellular FAP-binding domain that includes a VH region comprising SEQ ID NO: 18, an amino acid sequence having at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, a VL region comprising SEQ ID NO: 19, and an amino acid sequence having at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. In some cases, the extracellular FAP-binding domain comprises an amino acid sequence that includes the complementarity-determining regions (CDRs) contained in SEQ ID NO: 18 and SEQ ID NO: 19. In some cases, the H-CDRs contained in SEQ ID NO: 18 include the amino acid sequences of SEQ ID NOs: 12-14. In some cases, the L-CDRs contained in SEQ ID NO: 19 include the amino acid sequences of SEQ ID NOs: 15-17. In some cases, the FAP-CAR comprises an extracellular FAP-binding domain that includes (i) the CDRs contained in SEQ ID NOs: 18 and 19, (ii) a VH region comprising SEQ ID NO: 18, an amino acid sequence having at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, (iii) a VL region comprising SEQ ID NO: 19, and an amino acid sequence having at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0112] In some cases, the FAP-CAR comprises an extracellular FAP-binding domain comprising a VH region comprising SEQ ID NO: 29 and a VL comprising SEQ ID NO: 30. In some cases, the FAP-CAR comprises an extracellular FAP-binding domain comprising a VH region comprising SEQ ID NO: 29, an amino acid sequence having at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, a VL region comprising SEQ ID NO: 30, and an amino acid sequence having at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. In some cases, the extracellular FAP-binding domain comprises an amino acid sequence comprising the complementarity determining regions (CDRs) contained in SEQ ID NO: 29 and SEQ ID NO: 30. In some cases, the CDRs contained in SEQ ID NO: 29 comprise the amino acid sequences of SEQ ID NOs: 23-25. In some cases, the CDRs contained in SEQ ID NO: 30 comprise the amino acid sequences of SEQ ID NOs: 26-28. In some cases, the FAP-CAR comprises an extracellular FAP-binding domain comprising (i) the CDRs contained in SEQ ID NOs: 29 and 30, (ii) a VH region comprising SEQ ID NO: 29, an amino acid sequence having at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, (iii) a VL region comprising SEQ ID NO: 30, and an amino acid sequence having at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0113] In some cases, the FAP-CAR comprises an extracellular FAP-binding domain comprising a VH region comprising SEQ ID NO: 40 and a VL comprising SEQ ID NO: 41. In some cases, the FAP-CAR comprises an extracellular FAP-binding domain comprising a VH region comprising SEQ ID NO: 40 and an amino acid sequence having at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, and a VL region comprising SEQ ID NO: 41 and an amino acid sequence having at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. In some cases, the extracellular FAP-binding domain comprises an amino acid sequence comprising the complementarity determining regions (CDRs) contained in SEQ ID NO: 40 and SEQ ID NO: 41. In some cases, the CDRs contained in SEQ ID NO: 40 comprise the amino acid sequences of SEQ ID NOs: 34-36. In some cases, the CDRs contained in SEQ ID NO: 41 comprise the amino acid sequences of SEQ ID NOs: 37-39. In some cases, the FAP-CAR comprises an extracellular FAP-binding domain comprising (i) the CDRs contained in SEQ ID NOs: 40 and 41, (ii) a VH region comprising SEQ ID NO: 40 and an amino acid sequence having at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, and (iii) a VL region comprising SEQ ID NO: 41 and an amino acid sequence having at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

Table 3

[0114] In some cases, the amino acid sequence containing the VH region and the amino acid sequence containing the VL region are separated by one or more linker amino acid residues. The number of amino acids constituting the linker is not necessarily limited, but in some cases, the linker is at least about 5 amino acids in length, for example, at least about 10 amino acids in length. In some cases, the linker is about 10 to 25 amino acids in length. In some cases, the linker sequence is selected from any one of SEQ ID NOs: 45 to 46.

[0115] In some cases, the extracellular FAP-binding domain containing the VH and VL regions of the monoclonal anti-FAP antibody may contain a sequence selected from any one of SEQ ID NO: 9, SEQ ID NO: 20, SEQ ID NO: 31, and SEQ ID NO: 42. In some cases, the extracellular FAP-binding domain may contain any one of SEQ ID NO: 9, SEQ ID NO: 20, SEQ ID NO: 31, and SEQ ID NO: 42 and an amino acid sequence having at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, and optionally may contain the CDRs of SEQ ID NOs: 1 to 6, SEQ ID NOs: 12 to 17, SEQ ID NOs: 23 to 28, and SEQ ID NOs: 34 to 39, respectively.

[0116] In some cases, the FAP-CAR contains an extracellular ligand-binding domain that recognizes FAP, a transmembrane domain, and one or more intracellular signaling domains. In some cases, the FAP-CAR contains a hinge region that separates the extracellular ligand-binding domain and the transmembrane domain.

[0117] In some cases, the FAP-CAR is (a) an extracellular FAP-binding domain containing the VH and VL of a monoclonal anti-FAP antibody, and (b) a hinge selected from FcγRIII hinge, CD8α hinge, and IgG1 hinge, and (c) a transmembrane domain selected from CD8α transmembrane domain and CD28 transmembrane domain, and (d) a cytoplasmic domain comprising a CD3 zeta signaling domain and optionally a costimulatory domain of 4-1BB or CD28, and comprises.

[0118] In some cases, the FAP-CAR comprises a CD8α hinge.

[0119] In some cases, the FAP-CAR comprises a CD8α hinge, a CD8α transmembrane domain, and optionally a costimulatory domain of 4-1BB.

[0120] In some cases, the FAP-CAR comprises a CD8α hinge, a CD28 transmembrane domain, and optionally a costimulatory domain of CD28.

[0121] In some cases, the engineered cells described herein comprise an FAP-CAR that does not contain a costimulatory domain (e.g., does not contain a costimulatory domain of 4-1BB or CD28) and a tumor-CAR that contains a costimulatory domain (e.g., a costimulatory domain of 4-1BB or CD28).

[0122] In some cases, the FAP-CAR contains a costimulatory domain of CD28 and the tumor-CAR contains a costimulatory domain of 4-1BB.

[0123] In some cases, the FAP-CAR can have an amino acid sequence selected from any one of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 43, SEQ ID NO: 44. In some cases, the FAP-CAR can comprise any one of SEQ ID NO: 10, SEQ ID NO: 21, SEQ ID NO: 32, SEQ ID NO: 43 and an amino acid sequence having at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, and optionally can comprise the CDRs of SEQ ID NO: 1-6, SEQ ID NO: 12-17, SEQ ID NO: 23-28, SEQ ID NO: 34-39, respectively.

[0124] In some cases, the nucleic acid sequence encoding the FAP-CAR described in this document includes a nucleic acid sequence selected from any one of SEQ ID NO: 107, SEQ ID NO: 108, SEQ ID NO: 109, and SEQ ID NO: 110. In some cases, the nucleic acid sequence encoding the FAP-CAR described in this document includes any one of SEQ ID NO: 107, SEQ ID NO: 108, SEQ ID NO: 109, or SEQ ID NO: 110 and a nucleic acid sequence having at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, respectively encoding an FAP-CAR that includes an amino acid sequence selected from any one of SEQ ID NO: 10, SEQ ID NO: 21, SEQ ID NO: 32, and SEQ ID NO: 43.

[0125] In some cases, the engineered immune cells (e.g., engineered T cells) described in this document for use in an allogeneic setting comprise the FAP-CAR and tumor-CAR described in this document that include a co-stimulatory domain of CD28 to cause more rapid activation of said immune cells.

[0126] In some cases, the FAP-CAR may include an amino acid sequence having at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with any one of SEQ ID NO: 11, SEQ ID NO: 22, SEQ ID NO: 33, SEQ ID NO: 44, respectively, including the CDRs of SEQ ID NO: 1-6, SEQ ID NO: 12-17, SEQ ID NO: 23-28, SEQ ID NO: 34-39.

[0127] As described above, the engineered immune cells of the present disclosure also include an exogenous nucleic acid sequence encoding a chimeric antigen receptor (CAR) that targets a tumor antigen (a "tumor-CAR") placed under the transcriptional control of an exogenous or endogenous inducible promoter.

[0128] As used herein, the term "tumor antigen" is intended to include "tumor-specific antigens" and "tumor-associated antigens". Tumor-specific antigens (TSAs) generally exist only in tumor cells and not in other cells, while tumor-associated antigens (TAAs) exist in some tumor cells and also in some normal cells. The "tumor antigens" intended herein also refer to mutant forms of proteins that are observed in non-mutant forms in non-tumor tissues but appear only in mutant forms in tumors.

[0129] Tumor antigens can be antigens specific to solid tumors or antigens associated with solid tumors. Tumor antigens are not limited. In some cases, tumor antigens are selected from the group consisting of CEA, ERBB2, EGFR, GD2, mesothelin, MUC1, PSMA, GD2, PSMA1, LAP3, ANXA3, tumor-associated glycoprotein 72 (TAG72), MUC16, 5T4, FRα, MUC28z, NKG2D, HRG1β, prostate stem cell antigen (PSCA), prostate-specific membrane antigen (PSMA), carbonic anhydrase-IX (CA-IX), Trop2, claudin 18.2, folate receptor 1 (FOLR1), CXCR2, B7-H3, CD133, CD24, receptor tyrosine kinase-like orphan receptor 1 specific (ROR1), EGFR, EGFRvIII, VEGF, erythropoietin-producing hepatocellular carcinoma A2 (EphA2), DLL3, glypican-3, epithelial cell adhesion molecule (EpCAM), GUCY2C (guanylate cyclase 2C), doublecortin-like kinase 1 (DCLK1), HER receptors HER1, HER2, HER3, HER4, PEM, A33, G250, carbohydrate antigen Le y 、Le x 、Le b 、STEAP1, CD166, CD24, CD44, E-cadherin, SPARC, and ERBB3. See, for example, Marofi et al., Stem Cell Res Ther (2021) 12, 81, which is incorporated herein by reference.

[0130] In some cases, the tumor antigen is selected from the group consisting of mesothelin, Trop2, MUC1, EGFR, and VEGF. In some cases, the antigen is selected from the group consisting of mesothelin, MUC1, and Trop2.

[0131] The tumor antigen may also be an antigen specific for a blood cancer characterized by the presence of FAP in the tumor microenvironment such as myelofibrosis, myelodysplastic syndrome, acute myeloid leukemia, non-Hodgkin lymphoma, multiple myeloma, or an antigen associated with such blood cancer.

[0132] In some cases, the tumor antigen associated with blood cancer is selected from the group consisting of BCMA, CD19, CD20, CD22, CD30, CD123, CD70, CD33, CD135, CD44, CD276, CD2, CD3, CD4, CD5, CD7, CD8, CD10, CD37, CD79, CD79a, CD80, CD138, CD47, CRLF2, CD38, CLL-1, NKG2D, CALR, IL1RAP, ILT3, TIM3, CD96, VISTA, CS1, TACI, APRIL, GPRC5D, and CD44v6.

[0133] In some cases, the tumor antigen associated with blood cancer is selected from the group consisting of BCMA, CD19, CD123, CD20, CD22, CS1, CD138, CD80, CD2, CD3, CD4, CD5, CD7, and CD8.

[0134] In some cases, the tumor antigen associated with blood cancer is selected from the group consisting of BCMA, CD19, CD123, CD20, CD22, and CS1.

Table 4

[0135]

Table 5

[0136] Similar to the FAP-CAR described in this book, the tumor-CAR described in this book (a2) an extracellular ligand-binding domain comprising the amino acid sequences of VH and VL of a monoclonal antibody, (b2) a hinge selected from FcγRIII hinge, CD8α hinge, and IgG1 hinge, (c2) a transmembrane domain comprising a CD8α transmembrane domain or a CD28 transmembrane domain, (d2) a cytoplasmic domain comprising a CD3 zeta signaling domain and a co-stimulatory domain of 4-1BB or CD28 may include.

[0137] However, the extracellular ligand-binding domain of FAP-CAR may contain the amino acid sequences of VH and VL of a monoclonal anti-FAP antibody, while the extracellular ligand-binding domain of tumor-CAR may contain the amino acid sequences of VH and VL of a monoclonal anti-tumor antigen antibody. Therefore, tumor-CAR is different from FAP-CAR at least in the extracellular ligand-binding domain.

[0138] In some cases, the tumor-CAR a) an extracellular binding domain comprising the H-CDRs of SEQ ID NO: 47, SEQ ID NO: 48, and SEQ ID NO: 49, and the L-CDRs of SEQ ID NO: 50, SEQ ID NO: 51, and SEQ ID NO: 52, and optionally, an amino acid sequence having at least 80%, at least 90%, at least 95%, or at least 99% identity with the amino acid sequence SEQ ID NO: 53, b) an extracellular binding domain comprising the H-CDRs of SEQ ID NO: 55, SEQ ID NO: 56, and SEQ ID NO: 57, and the L-CDRs of SEQ ID NO: 58, SEQ ID NO: 59, and SEQ ID NO: 60, and optionally, an amino acid sequence having at least 80%, at least 90%, at least 95%, or at least 99% identity with the amino acid sequence SEQ ID NO: 61, c) An extracellular binding domain comprising the H-CDRs of SEQ ID NO: 63, SEQ ID NO: 64, and SEQ ID NO: 65, and the L-CDRs of SEQ ID NO: 66, SEQ ID NO: 67, and SEQ ID NO: 68, and optionally, an amino acid sequence having at least 80%, at least 90%, at least 95%, or at least 99% identity to SEQ ID NO: 69, or d) An extracellular binding domain comprising the H-CDR and L-CDR contained in the amino acid sequence of SEQ ID NO: 71, and optionally, an amino acid sequence having at least 80%, at least 90%, at least 95%, or at least 99% identity to SEQ ID NO: 71 may be included.

[0139] In some cases, the tumor-CAR can be specific for mesothelin (MESO-CAR) and can have the amino acid sequence of SEQ ID NO: 70. In some cases, MESO-CAR can include an amino acid sequence having at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 70, and optionally, can include the CDRs of SEQ ID NOs: 63-68.

[0140] In some cases, the nucleic acid sequence encoding MESO-CAR described herein can include the nucleic acid sequence of SEQ ID NO: 104. In some cases, the nucleic acid sequence encoding MESO-CAR described herein can include a nucleic acid sequence having at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 104 and can encode a MESO-CAR comprising the amino acid sequence of SEQ ID NO: 70.

[0141] In some cases, the tumor-CAR can be specific for Trop2 (Trop2-CAR) and can have the amino acid sequence of SEQ ID NO: 54. In some cases, the Trop2-CAR can include the amino acid sequence of SEQ ID NO: 54 and an amino acid sequence having at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto, and can optionally include the CDRs of SEQ ID NOs: 47-52.

[0142] In some cases, the nucleic acid sequence encoding the Trop2-CAR described herein can include the nucleic acid sequence of SEQ ID NO: 106. In some cases, the nucleic acid sequence encoding the Trop2-CAR described herein can include the nucleic acid sequence of SEQ ID NO: 106 and a nucleic acid sequence having at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto, and can encode a Trop2-CAR comprising the amino acid sequence of SEQ ID NO: 54.

[0143] In some cases, the tumor-CAR can be specific for mucin 1 (MUC1-CAR) and can have the amino acid sequence of SEQ ID NO: 62. In some cases, the MUC1-CAR can include the amino acid sequence of SEQ ID NO: 62 and an amino acid sequence having at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto, and can optionally include the CDRs of SEQ ID NOs: 55-60.

[0144] In some cases, the nucleic acid sequence encoding the MUC1-CAR described herein can include the nucleic acid sequence of SEQ ID NO: 105. In some cases, the nucleic acid sequence encoding the MUC1-CAR described herein can include the nucleic acid sequence of SEQ ID NO: 105 and a nucleic acid sequence having at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto, and can encode a MUC1-CAR comprising the amino acid sequence of SEQ ID NO: 62.

[0145] In some cases, the tumor-CAR can be specific for CS1 (CS1-CAR) and can have the amino acid sequence of SEQ ID NO: 96. In some cases, the CS1-CAR can include the amino acid sequence of SEQ ID NO: 96 and an amino acid sequence having at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto, and can optionally include the CDRs contained in SEQ ID NO: 96.

[0146] In some cases, the tumor-CAR and the FAP-CAR differ not only in the extracellular ligand-binding domain but also in one or more of the hinge, transmembrane domain, and co-stimulatory domain.

[0147] In some cases, the FAP-CAR includes the co-stimulatory domain of CD28, while the tumor-CAR includes the co-stimulatory domain of 4-1BB.

[0148] In some cases, the co-stimulatory domain is dispensable in the FAP-CAR.

[0149] In some cases, the FAP-CAR does not include a co-stimulatory domain, while the tumor-CAR includes a co-stimulatory domain such as the co-stimulatory domain of 4-1BB or CD28.

[0150] As described above, the FAP-CAR and the tumor-CAR expressed by the engineered immune cells described herein differ in expression as a result of having an exogenous nucleic acid sequence encoding the FAP-CAR under the transcriptional control of a constitutive promoter and an exogenous nucleic acid sequence encoding the tumor-CAR under the transcriptional control of an inducible promoter.

[0151] The term "constitutive promoter" generally means a promoter that is active in all circumstances in a particular cell or cell type that contains the promoter. A constitutive promoter continuously transcribes the associated gene in the cell. The level of transcription of the gene associated with the constitutive promoter can vary, but the transcript and thus the gene product (if present) are still detectable. Examples of constitutive promoters include the human elongation factor 1α (EF1A) promoter, the cluster of differentiation 52 (CD52) promoter, the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter, the human cytomegalovirus (CMV) promoter, the human phosphoglycerate kinase (hPGK) promoter, the RPBSA promoter, the human ubiquitin C (UBC) promoter, the simian virus 40 (SV40) early promoter, the mouse phosphoglycerate kinase 1 (PGK) promoter, and the chicken β-actin promoter (CAGG) combined with the CMV early enhancer, the T cell receptor alpha constant region (TRAC or TCRA) promoter, the T cell receptor beta constant 1 region (TRBC or TCRB) promoter, the T cell receptor gamma constant region 1 or 2 (TRGC1 or TCRG1, TRGC2 or TCRG2) promoter, the T cell receptor delta constant region (TRDC or TCRD) promoter, the beta-2-microglobulin (B2M) promoter, the cluster of differentiation 5 (CD5) promoter, the CS1 (also known as CD319, CRACC, and SLAMF7) promoter, the cluster of differentiation 45 (CD45) promoter, the cluster of differentiation 4 (CD4) promoter, and the cluster of differentiation 8 (CD8) promoter. A constitutive promoter useful in this document can be identical to a promoter that already exists in the genome of the cell (i.e., without the genetic manipulation as described in this document). This is the case, for example, for the EF1A promoter, the CD52 promoter, the GAPDH promoter, the TRAC promoter, the TRBC promoter, the TRGC promoter, the TRDC promoter, the B2M promoter, and the CD5 promoter.Useful constitutive promoters in this book, such as the synthetic RPBSA promoter (i.e., a synthetic promoter composed of a fragment of the RPL13a promoter fused to a region of the RPL41 gene), CMV promoter, mouse PGK promoter, SV40 promoter, and CAGG promoter, do not have to be present in the cell genome prior to introduction into cells by genetic manipulation. The constitutive promoter may be added as an exogenous polynucleotide to the cell genome and may be an endogenous polynucleotide already present in the cell genome, independent of the genetic manipulation of the cell as described in this book, i.e., without adding an exogenous polynucleotide corresponding to the constitutive promoter to the cell.

[0152] The term "inducible promoter" generally means a promoter that becomes active in cells containing the promoter only when responding to a specific stimulus. Thus, an inducible promoter has activity only under certain specific circumstances. The inducible promoter remains in an inactive state unless stimulated and the gene associated with the inducible promoter in the "off" state is generally not transcribed or is transcribed only weakly. When a specific stimulus is present and an activator protein binds to the inducible promoter, activating the inducible promoter to initiate transcription, the inducible promoter becomes "on". Transcription of the gene associated with the inducible promoter increases when the inducible promoter shifts to the "on" state in response to a specific stimulus. The expression of the gene controlled by the inducible promoter is tightly regulated and its expression rapidly decreases when the activating signal is removed. In the present disclosure, the inducible promoter responds to cell activation as defined in this book (e.g., activation of immune cells such as T cells). For example, a promoter that is inducible during CAR-T cell activation in vitro (e.g., as described in Example 6) meets the criterion that the fold change between the average expression at 0 hours and the average expression at 24 hours is greater than 3, e.g., greater than 5.

[0153] "Cell activation" generally means a process in which changes occur in a cell in response to an "activation signal". An "activation signal" refers to a signal or stimulus that can directly or indirectly activate a cell. In the present disclosure, "cell activation" refers mainly to the changes that occur in an engineered cell containing a CAR described herein when, upon binding or recognition of an epitope of FAP by FAP-CAR expressed by the engineered cell and / or upon binding or recognition of an epitope of a tumor antigen by tumor-CAR expressed by the engineered cell, an activation signal is generated in the cell.

[0154] At the molecular level, cell activation also corresponds to the activation of an inducible promoter. Indeed, an inducible promoter contains one or more regulatory elements that respond to one or more signaling pathways in a cell, such as NFAT-regulated signaling.

[0155] In some cases, the inducible promoter can respond to CD3 zeta signaling. Examples of inducible promoters useful herein include the programmed cell death protein 1 (PDCD1) gene, the cluster of differentiation 25 (CD25) gene, the T cell immunoglobulin and mucin domain-containing 3 (TIM3) gene, the T cell immunoreceptor with Ig and ITIM domains (TIGIT) gene, the C-C motif chemokine ligand 1 (CCL1) gene, the nuclear receptor subfamily 4 group A member 3 (NR4A3) gene, the early growth response 3 (EGR3) gene, the G0 / G1 switch 2 (G0S2) gene, the interleukin 22 (IL22) gene, the regulator of G protein signaling 16 (RGS16) gene, the Fas ligand (FASLG) gene, the retinol dehydrogenase 10 (RDH10) gene, the colony-stimulating factor 1 (CSF1) gene, the colony-stimulating factor 2 (CSF2, also known as GM-CSF) gene, the lymphocyte activation 3 (LAG3) gene, the cytotoxic T lymphocyte-associated protein 4 (CTLA-4 or CD152) gene, the interleukin-10 (IL10) gene, the nuclear receptor subfamily 4 group A member 1 (NR4A1 or NUR77) gene, the forkhead box P3 (FOXP3) gene, and a promoter containing at least one NFAT-responsive element. The inducible promoter useful herein can be identical to a promoter already present in the genome of the cell (i.e., without genetic manipulation as described herein). This is the case, for example, for the promoter of PDCD1 or the promoter of GM-CSF. The inducible promoter useful herein need not be present in the genome of the cell prior to introduction into the cell by genetic manipulation. The inducible promoter may be added as an exogenous polynucleotide to the genome of the cell, or may be an endogenous polynucleotide already present in the genome of the cell, independent of the genetic manipulation of the cell as described herein, i.e., without adding an exogenous polynucleotide corresponding to the inducible promoter to the cell.As used herein, the term "NFAT promoter" includes a polynucleotide sequence that acts as a promoter and contains at least one NFAT-responsive element such as those described by Hooijberg et al. (Blood (2000) 96:459-466), Zhang et al. (Mol. Ther. (2011) 19, 751-759), or Takeuchi et al. (J. Immunol. (1998) 160(1):209-218). The NFAT promoter or NFAT-responsive element may include, for example, the nucleotide sequences GGAGGAAAAACTGTTTCATACAGAAGGCGT (SEQ ID NO: 114) or GGAGGAAAAACTGTTTCATACACAGAAGGCCT (SEQ ID NO: 115). The NFAT-responsive element may be repeated, for example, 3 times, 6 times, 9 times, or more.

[0156] In some cases, after an activation signal in the engineered cells described herein, the percentage of cells expressing tumor-CAR in the cell population containing the engineered immune cells is at least about 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, or 95%.

[0157] In some cases, the expression of tumor-CAR induced by an activation signal in the engineered cells returns to the initial basal level or is undetectable after removal, disappearance, or reduction of the activation signal in the engineered immune cells.

[0158] 1.3. Further characteristics of the engineered cells In some cases, engineered immune cells, such as T cells, that are modified to express a CAR against FAP and a CAR against a tumor antigen may have one or more additional modifications.

[0159] Additional genetic traits can be conferred by gene editing the immune cells to improve their therapeutic efficacy.

[0160] In some cases, the engineered cells can be further modified to improve persistence or lifespan in a patient, for example, by inactivating genes encoding MHC-I components such as HLA or B2M as described by International Publication No. WO 2015 / 136001 or Liu et al. (2017, Cell Res 27:154-157).

[0161] Beta-2 microglobulin, also known as β2m, is the light chain of MHC class I molecules and is thus an essential part of the major histocompatibility complex. In humans, β2m is encoded by the B2M gene located on chromosome 15, rather than by the other MHC genes located on chromosome 6 as a gene cluster. The human protein consists of 119 amino acids and has a molecular weight of 11,800 daltons.

[0162] In some cases, inhibition of B2M expression is achieved by genome modification, such as by expression in cells of a rare-cutting endonuclease that can selectively inactivate genes encoding β2m, such as the human B2M gene (NCBI reference sequence: NG_012920.1), by DNA cleavage. Such rare-cutting endonucleases can be TALE nucleases, meganucleases, zinc finger nucleases (ZFNs), or RNA-guided endonucleases (e.g., Cas9).

[0163] In some cases, inhibition of B2M expression can be achieved by inhibiting gene transcription and / or translation by using nucleic acid molecules that specifically hybridize (e.g., bind) under cellular conditions to cellular mRNA and / or genomic DNA encoding β2m (e.g., introducing them into T cells). In some cases, inhibition of B2M expression is achieved by using antisense oligonucleotide molecules, ribozyme molecules, or interfering RNA (RNAi) molecules (e.g., introducing them into T cells). In some cases, such nucleic acid molecules can comprise at least 10 consecutive nucleotides complementary to mRNA encoding human β2m.

[0164] In some cases, immune cells (e.g., T cells) or progenitor cells are provided that express a rare cleavage endonuclease capable of selectively inactivating the gene encoding β2m by DNA cleavage. For example, such cells may include an exogenous nucleic acid molecule comprising a nucleotide sequence encoding the rare cleavage endonuclease, which can be a TALE nuclease, a meganuclease, a zinc finger nuclease (ZFN), or an RNA-guided endonuclease. Thus, in order to provide immune cells (e.g., T cells) with reduced alloreactivity, the methods described herein may further include the step of inactivating or mutating the B2M gene.

[0165] In some cases, the engineered immune cells, such as T cells, are modified to suppress or inhibit the expression of HLA in said cells. The human class I HLA gene cluster contains three major loci, B, C, and A, as well as several minor loci. The class II HLA cluster also contains three major loci, DP, DQ, and DR, and both the class I gene cluster and the class II gene cluster are polymorphic in that several different alleles of both class I and class II genes exist within the population. There are also several accessory proteins involved in HLA function. The subunits of Tap1 and Tap2 are part of the TAP transporter complex that is essential for loading peptide antigens onto the class I HLA complex, and the proteasome subunits LMP2 and LMP7 are involved in proteolytically degrading antigens into peptides for presentation by HLA. Reduction of LMP7 has been shown to reduce the amount of MHC class I on the cell surface, presumably due to lack of stabilization (Fehling et al. (1999) Science 265:1234-1237). In addition to TAP and LMP, there is the tapasin gene, and the product of the tapasin gene forms a bridge between the TAP complex and the HLA class I chain, enhancing peptide loading. Reduction of tapasin results in cells in which the assembly of MHC class I is impaired, cell surface expression of MHC class I is reduced, and the immune response is impaired (Grandea et al. (2000) Immunity 13:213-222 and Garbi et al. (2000) Nat. Immunol. 1:234-238). Any of the above genes can be inactivated as part of this document, as disclosed, for example, in International Publication No. WO 2012 / 012667.

[0166] In some cases, the engineered immune cells, such as T cells, are modified to suppress or inhibit the expression of CIITA in said cells. CIITA is a gene encoding the class II major histocompatibility complex transactivator protein.

[0167] In some cases, the engineered immune cells, such as T cells, are inactivated in at least one gene selected from the group consisting of RFXANK, RFX5, RFXAP, TAP1, TAP2, ZXDA, ZXDB, and ZXDC. The inactivation can be achieved, for example, by using genome editing, such as the expression of a rare cutting endonuclease in cells that can selectively inactivate genes selected from the group consisting of RFXANK, RFX5, RFXAP, TAP1, TAP2, ZXDA, ZXDB, and ZXDC by DNA cleavage. Such modifications can make it possible to reduce the alloreactivity of the engineered immune cells when injected into a patient.

[0168] Accordingly, in one aspect, the engineered cells described herein may be genetically modified to suppress or inhibit the expression of at least one gene that controls MHC complex surface presentation. Genes that control MHC complex surface presentation as defined herein include B2M, CIITA, HLA, RFXANK, RFX5, RFXAP, TAP1, TAP2, ZXDA, ZXDB, and ZXDC. In some cases, the engineered immune cells, such as T cells or NK cells, are genetically modified to suppress or inhibit the expression in said cells of genes encoding immune checkpoint proteins and / or receptors for immune checkpoint proteins, such as PDCD1 or CTLA4 described in WO 2014 / 184744.

[0169] As will be understood by those skilled in the art, the term "immune checkpoint" refers to a group of molecules expressed by T cells, NK cells, and antigen-presenting cells. These molecules function effectively as "brakes" to downregulate or inhibit the immune response. Immune checkpoint molecules directly inhibit immune cells, such as programmed cell death 1 (PD-1, also known as PDCD1 or CD279, e.g., human PD-1: accession number NM_005018), cytotoxic T lymphocyte antigen 4 (CTLA-4, also known as CD152, e.g., human CTLA-4: GenBank accession number AF414120.1), LAG3 (also known as CD223, e.g., human LAG3: accession number NM_002286.5), Tim3 (also known as HAVCR2, e.g., human Tim3: GenBank accession number JX049979.1), BTLA (also known as CD272, e.g., human BTLA: accession number NM_181780.3), BY55 (also known as CD160, e.g., human BY55: GenBank accession number CR541888.1), TIGIT (also known as IVSTM3, e.g., human TIGIT: accession number NM_173799), LAIR1 (also known as CD305, e.g., human LAIR1: GenBank accession number CR542051.1), SIGLEC10 (e.g., human SIGLEC10: GeneBank accession number AY358337.1), 2B4 (also known as CD244, e.g., human 2B4: accession number NM_001166664.1), PPP2CA (also known as: NEDLBA, PP2Ac, PP2C alpha, RP-C, e.g., human PPP2CA: NCBI gene ID 5515), PPP2CB (also known as: also known as PP2A beta, e.g., human PPP2CB: NCBI gene ID 5516), PTPN6 (also known as: HCP, HCPH, HPTP1C, PTP-1C, SH-PTP1, SHP-1, SHP-1L, SHP1, e.g., human PTPN6: NCBI gene ID 5777), PTPN22 (NCBI gene ID 26191), CD96 (NCBI gene ID 10225), CRTAM (NCBI gene ID 56253), SIGLEC7 (NCBI gene ID 27036), SIGLEC9 (NCBI gene ID27180), TNFRSF10B (NCBI Gene ID 8795), TNFRSF10A (NCBI Gene ID 8797), CASP8 (NCBI Gene ID 841), CASP10 (NCBI Gene ID 843), CASP3 (NCBI Gene ID 836), CASP6 (NCBI Gene ID 839), CASP7 (NCBI Gene ID 840), FADD (NCBI Gene ID 8772), FAS (NCBI Gene ID 355), TGFBRII (NCBI Gene ID 7048), TGFRBRI (NCBI Gene ID 7046), SMAD2 (NCBI Gene ID 4087), SMAD3 (NCBI Gene ID 4088), SMAD4 (NCBI Gene ID 4089), SMAD10, SKI (NCBI Gene ID 6497), SKIL (NCBI Gene ID 6498), TGIF1 (NCBI Gene ID 7050), IL10RA (NCBI Gene ID 3587), IL10RB (NCBI Gene ID 3588), HMOX2 (NCBI Gene ID 3163), IL6R (NCBI Gene ID 3570), IL6ST (NCBI Gene ID 3572), EIF2AK4 (NCBI Gene ID 440275), CSK (NCBI Gene ID 1445), PAG1 (NCBI Gene ID 55824), SIT1 (NCBI Gene ID 27240), FOXP3 (NCBI Gene ID 50943), PRDM1 (NCBI Gene ID 639), BATF (NCBI Gene ID 10538), GUCY1A2 (NCBI Gene ID 2977), GUCY1A3 (NCBI Gene ID 2977), and GUCY1B2 (NCBI Gene ID 2974), including but not limited to. For example, CTLA-4 is a cell surface protein expressed in certain CD4 T cells and CD8 T cells, and when associated by its ligands (B7-1 and B7-2) in antigen-presenting cells, T cell activation and effector functions are inhibited. In some cases, the engineered T cells are further genetically modified by inactivating at least one gene encoding a protein involved in immune checkpoints such as PD1 and / or CTLA-4 or any of the immune checkpoint proteins mentioned in this document.

[0170] In some cases, at least two genes encoding immune checkpoint proteins selected from the group consisting of CTLA4, PPP2CA, PPP2CB, PTPN6, PTPN22, PDCD1, LAG3, HAVCR2, BTLA, CD160, TIGIT, CD96, CRTAM, LAIR1, SIGLEC7, SIGLEC9, CD244, TNFRSF10B, TNFRSF10A, CASP8, CASP10, CASP3, CASP6, CASP7, FADD, FAS, TGFBRII, TGFRBRI, SMAD2, SMAD3, SMAD4, SMAD10, SKI, SKIL, TGIF1, IL10RA, IL10RB, HMOX2, IL6R, IL6ST, EIF2AK4, CSK, PAG1, SIT1, FOXP3, PRDM1, BATF, GUCY1A2, GUCY1A3, GUCY1B2, and GUCY1B3 are inactivated.

[0171] In some cases, the engineered immune cells, such as T cells, may be modified to confer resistance to at least one immunosuppressive or chemotherapeutic agent and, optionally, may be modified to contain a suicide gene.

[0172] In some cases, the engineered immune cells, such as T cells, may be further modified to confer resistance to at least one immunosuppressive agent, such as by inactivating CD52, which is a target of an anti-CD52 antibody (such as alemtuzumab) as described, for example, in International Publication No. WO 2013 / 176915.

[0173] To improve cancer therapy and the selective engraftment of allogeneic immune cells, drug resistance can be conferred to the engineered immune cells to protect the engineered immune cells from the toxic side effects of chemotherapeutic or immunosuppressive agents. In some cases, the engineered immune cells can be further modified to confer resistance to chemotherapeutic agents, such as purine analog drugs, by inactivating DCK, as described, for example, in International Publication No. WO 2015 / 75195.

[0174] Immune cells that express drug-resistant genes survive and proliferate compared to drug-sensitive cells. Thus, the drug resistance of immune cells also enables the enrichment of immune cells in vivo or ex vivo. In some cases, the present method is a method of manipulating allogeneic drug-resistant immune cells for immunotherapy, comprising: (a) providing immune cells, such as T cells; (b) selecting at least one drug; (c) modifying the cells to confer drug resistance on the cells; and (d) expanding the manipulated cells in the presence of the drug. When the immune cells are T cells, the method may further comprise modifying the T cells by inactivating at least one gene encoding a T cell receptor (TCR) component, and then selecting the transformed T cells that do not express the TCR on the cell surface, and combining the foregoing steps.

[0175] Accordingly, the manipulated immune cells can be further modified to confer resistance to drugs such as chemotherapeutic agents. Drug resistance can be conferred on immune cells by expressing drug-resistant genes. Variant alleles of some genes, such as dihydrofolate reductase (DHFR), inosine monophosphate dehydrogenase 2 (IMPDH2), calcineurin, or methylguanine transferase (MGMT), have been confirmed to confer drug resistance on cells. In some cases, drug-resistant genes can be expressed in cells by introducing into the cells a transgene encoding the gene, or integrating the drug-resistant gene into the genome of the cells by homologous recombination.

[0176] Drug resistance can be conferred on immune cells by inactivating one or more genes (plural possible) (drug-sensitizing gene(s)) responsible for cell sensitivity to the drug, such as the hypoxanthine-guanine phosphoribosyltransferase (HPRT) gene (Genbank: M26434.1). For example, inactivation of HPRT in engineered immune cells can confer resistance to 6-thioguanine (6TG), a cell growth inhibitory metabolite. 6TG is converted by HPRT into cytotoxic thioguanine nucleotides and is currently used to treat patients with cancer, particularly leukemia (Hacke et al. (2013) Transplantation Proceedings, 45(5):2040-2044). Another example is the inactivation of CD3, which is normally expressed on the surface of T cells, which can confer resistance to anti-CD3 antibodies such as teprilizumab.

[0177] Alternatively, drug resistance can be conferred on immune cells (e.g., T cells) by the expression of at least one drug resistance gene. A drug resistance gene refers to a nucleic acid sequence that encodes "resistance" to an agent such as a chemotherapeutic agent (e.g., methotrexate). In other words, the expression of a drug resistance gene in a cell enables the growth of the cell in the presence of the agent to a higher degree than the growth of the corresponding cell without the drug resistance gene. Drug resistance genes can encode resistance to antimetabolites, methotrexate, vinblastine, cisplatin, alkylating agents, anthracyclines, cytotoxic antibiotics, immunosuppressants, their analogs or derivatives, and the like.

[0178] Several drug resistance genes have been identified that may be used to confer drug resistance on target cells (Takebe et al. (2001) Mol. Ther. 3(1):88-96), Sugimoto et al. (2003) Mol Cancer Ther. 2:105-112, Zielske et al. (2003) J. Clin. Invest. 112(10):1561-70, Nivens et al. (2004) Cancer Chemother Pharmacol 53(2):107-15, Bardenheuer et al. (2005) Leukemia 19(12):2281-8, Kushman et al. (2007) Carcinogenesis 28(1):207-14).

[0179] Also, an example of a drug resistance gene can be a mutant or modified form of dihydrofolate reductase (DHFR). DHFR is an enzyme involved in regulating the amount of tetrahydrofolate in cells and is essential for DNA synthesis. Folic acid analogs such as methotrexate (MTX) inhibit DHFR and are thus used clinically as anti-neoplastic agents. Various mutant forms of DHFR with increased resistance to inhibition by folic acid antagonists used in therapy have been described. In some cases, the drug resistance gene can be a nucleic acid sequence encoding a mutant form of human wild-type DHFR (GenBank: AAH71996.1) containing at least one mutation conferring resistance to treatment with folic acid antagonists such as methotrexate. In some cases, the mutant form of DHFR contains at least one mutant amino acid at position G15, L22, F31, or F34, for example at position L22 or F31 (Schweitzer, Dicker et al., 1990), WO 94 / 24277, US Patent No. 6,642,043).

[0180] As used herein, the term "folic acid antagonist" or "folic acid analogue" refers to a molecule that is intended to interfere with the folic acid metabolic pathway at some level. Examples of folic acid antagonists include, for example, methotrexate (MTX), aminopterin, trimethoprim (Neutrexin (trademark)), edatrexate, N10-propargyl-5,8-dideazafolic acid (CB3717), ZD1694 (Tumodex), 5,8-dideazaisofolic acid (IAHQ), 5,10-dideazatetrahydrofolic acid (DDATHF), 5-deazafolic acid, PT523 (N alpha-(4-amino-4-deoxypteroyl)-N delta-hemi-phthaloyl-L-ornithine), 10-ethyl-10-deazaaminopterin (DDATHF, iomatrexol), pirimethamine, 10-EDAM, ZD1694, GW1843, pemetrexed, and PDX (10-propargyl-10-deazaaminopterin).

[0181] Another example of a drug resistance gene can be a mutant or modified form of inosine-5'-monophosphate dehydrogenase II (IMPDH2), which is a rate-limiting enzyme in the de novo synthesis of guanosine nucleotides. The mutant or modified form of IMPDH2 is an IMPDH inhibitor resistance gene. The IMPDH inhibitor can be mycophenolic acid (MPA) or its prodrug mycophenolate mofetil (MMF). The mutant IMPDH2 can contain at least one, for example, two mutations in the MAP binding site of wild-type human IMPDH2 (NP_000875.2) that confer significantly increased resistance to the IMPDH inhibitor. This mutation can be at position T333 and / or position S351 (Yam et al. (2006) Mol. Ther. 14(2):236-44, Jonnalagadda et al. (2013) PLoS One 8(6):e65519). In some cases, the threonine residue at position 333 may be replaced with an isoleucine residue, and the serine residue at position 351 may be replaced with a tyrosine residue.

[0182] Another drug resistance gene is a mutant form of calcineurin. Calcineurin (PP2B) is a ubiquitously expressed serine / threonine protein phosphatase that is involved in many biological processes and is central to T cell activation. Calcineurin is a heterodimer composed of a catalytic subunit (CnA, 3 isoforms) and a regulatory subunit (CnB, 2 isoforms). After associating with the T cell receptor, calcineurin dephosphorylates the transcription factor NFAT and translocates NFAT to the nucleus and to active major target genes such as IL-2. FK506 complexed with FKBP12, or cyclosporin A (CsA) complexed with CyPA, blocks access of NFAT to the active site of calcineurin, prevents dephosphorylation of its active site, and thereby inhibits T cell activation (Brewin et al. (2009) Blood 114(23):4792-803). The drug resistance gene can be a nucleic acid sequence encoding a mutant form of calcineurin that is resistant to calcineurin inhibitors such as FK506 and / or CsA. In some cases, the mutant form may contain at least one mutant amino acid of the wild-type calcineurin heterodimer at positions V314, Y341, M347, T351, W352, L354, K360, for example, double mutations at positions T351 and L354 or at positions V314 and Y341. The amino acid position correspondences described herein are often presented from the perspective of the positions of the amino acids in the form of the wild-type human calcineurin heterodimer (GenBank: ACX34092.1).

[0183] In some cases, the mutant form may contain at least one mutant amino acid of the wild-type calcineurin heterodimer b at positions V120, N123, L124 or K125, for example, double mutations at positions L124 and K125. The amino acid position correspondences described herein are often presented from the perspective of the positions of the amino acids in the form of the wild-type human calcineurin heterodimer b polypeptide (GenBank: ACX34095.1).

[0184] Another drug resistance gene is O that encodes human alkylguanine transferase (hAGT). 6 -methylguanine methyltransferase (MGMT). AGT is a DNA repair protein that confers resistance to the cytotoxic effects of alkylating agents such as nitrosoureas and temozolomide (TMZ). 6-benzylguanine (6-BG) is an inhibitor of AGT that enhances the toxicity of nitrosoureas and is co-administered with TMZ to enhance the cytotoxic effect of TMZ. Some variants of MGMT that encode variants of AGT have high resistance to inactivation by 6-BG but retain the ability to repair DNA damage (Maze, Kurpad et al., 1999). In some cases, the AGT variant may contain a mutant amino acid at position P140 (UniProtKB:P16455) of wild-type AGT.

[0185] Another drug resistance gene may be the multi-drug resistance protein 1 (MDR1) gene. The MDR1 gene encodes a membrane glycoprotein known as P-glycoprotein (P-GP) that is involved in the transport of metabolic by-products across the cell membrane. The P-Gp protein exhibits broad specificity for a plurality of structurally unrelated chemotherapeutic agents. Thus, expression of the nucleic acid sequence encoding MDR-1 (NP_000918) can confer drug resistance on cells.

[0186] Drug resistance genes can also be cytotoxic antibiotics such as the ble gene or the mcrA gene. Ectopic expression of the ble gene or mcrA in immune cells confers a selective advantage upon exposure to the chemotherapeutic agents bleomycin or mitomycin C, respectively.

[0187] Regarding immunosuppressants, this document describes steps that are feasible and optional, namely: (a) preparing immune cells such as T cells derived from, for example, cell cultures or blood samples, or induced pluripotent stem cells (iPSCs); (b) selecting a gene in said cells that expresses a target of the immunosuppressant; (c) introducing into said cells an endonuclease that can selectively inactivate the gene encoding the target of the immunosuppressant by DNA cleavage, for example, by double-strand cleavage; (d) optionally expanding said cells in the presence of the immunosuppressant. In some cases, the method includes a further step of inactivating components of the T cell receptor (TCR).

[0188] An immunosuppressant is a drug that suppresses immune function by one of several mechanisms of action. In other words, an immunosuppressant is a compound that can reduce the degree and / or voracity of the immune response. By way of non-limiting example, an immunosuppressant can be a calcineurin inhibitor, a target of rapamycin, an interleukin-2α-chain blocker, an inhibitor of inosine monophosphate dehydrogenase, an inhibitor of dihydrofolate reductase, a corticosteroid, or an immunosuppressive antimetabolite. Conventional cytotoxic immunosuppressive drugs act by inhibiting DNA synthesis. Others can act by inactivating T cells or inhibiting the activation of helper cells. The methods described herein make it possible to confer immunosuppressive resistance to cells for immunotherapy by inactivating the target of the immunosuppressant in immune cells (e.g., T cells). By way of non-limiting example, the target of the immunosuppressant can be a receptor for the immunosuppressant, such as CD52, the glucocorticoid receptor (GR), a member of the FKBP family of genes, and a member of the cyclophilin family of genes.

[0189] In immunocompetent hosts, allogeneic cells are usually rapidly rejected by the host immune system. Allogeneic white blood cells present in non-irradiated blood products have been shown not to persist for more than 5 - 6 days (Boni et al. (2008) Blood 112(12):4746 - 54). Therefore, in order to prevent the rejection reaction of allogeneic cells, it is necessary to effectively suppress the host immune system. Glucocorticoid steroids are widely used therapeutically for immunosuppression (Coutinho and Chapman (2011) Mol. Cell Endocrinol. 335(1):2 - 13). This class of steroid hormones binds to glucocorticoid receptors (GR) present in the cytosol of T cells, leading to translocation into the nucleus and binding to specific DNA motifs that regulate the expression of multiple genes involved in immunological processes. Treatment of T cells with glucocorticoid steroids results in a decrease in cytokine production levels, leading to T cell anergy and interference with T cell activation. Alemtuzumab, also known as Campath 1-H, is a humanized monoclonal antibody that targets CD52, a 12 - amino acid glycosylphosphatidyl-inositol-(GPI)-linked glycoprotein (Waldmann and Hale (2005) Philos. Trans. R. Soc. Lond. B. Biol Sci. 360:1701 - 11). CD52 is expressed at high levels on T and B lymphocytes and at lower levels on monocytes, but is not present on granulocytes and bone marrow precursors. Treatment with alemtuzumab, a humanized monoclonal antibody against CD52, has been shown to induce rapid depletion of circulating lymphocytes and monocytes. Alemtuzumab is frequently used in the treatment of T cell lymphoma and, in certain cases, as part of a conditioning regimen for transplantation. However, in the case of adoptive immunotherapy, the use of immunosuppressive drugs also causes harmful effects on the introduced therapeutic immune cells (e.g., T cells). Therefore, in order to effectively use adoptive immunotherapy techniques under these conditions, the introduced cells need to have resistance to immunosuppressive treatment.

[0190] In some cases, the gene that is specific to the immunosuppressive treatment is CD52, and the immunosuppressive treatment includes a humanized antibody that targets the CD52 antigen. In some cases, the gene that is specific to the immunosuppressive treatment is the glucocorticoid receptor (GR), and the immunosuppressive treatment includes a corticosteroid such as dexamethasone. In some cases, the gene that is specific to the immunosuppressive treatment is an FKBP family gene member or a variant thereof, and the immunosuppressive treatment includes FK506, also known as tacrolimus or Fujimycin. In some cases, the gene that is specific to the immunosuppressive treatment is an FKBP family gene member such as FKBP12 or a variant thereof. In some cases, the gene that is specific to the immunosuppressive treatment is a cyclophilin family gene member or a variant thereof, and the immunosuppressive treatment includes cyclosporine.

[0191] Cytokine release syndrome (CRS) is the most commonly recognized adverse event in CAR-T cell therapy. CRS is defined as a clinical syndrome that can occur after cell therapy due to the release of cytokines (substances secreted by immune cells) into the bloodstream of the body. Inactivation of granulocyte macrophage colony-stimulating factor (GM-CSF) has been shown to prevent monocyte-dependent release of a major mediator of cytokine release syndrome (Sachdeva et al. (2019) J. Biol. Chem. 294(14) 5430-5437). Thus, in a further aspect, the engineered immune cells described herein are genetically modified to suppress the expression or cell surface presentation of GM-CSF.

[0192] In some cases, the engineered immune cells described herein are one or more of TCR negative, B2M negative, CIITA negative, PDCD1 negative, GM-CSF negative, CD52 negative, for example, at least TCR negative, or at least TCR negative, B2M negative, and CD52 negative.

[0193] In some cases, to reduce the fratricide effect, the engineered immune cells described herein do not present on their cell surface the antigen targeted by the tumor-CAR. For example, the engineered immune cells described herein may have the CD4 gene or the CD8 gene inactivated or their expression inhibited, respectively, when the tumor-CAR targets CD4 or CD8.

[0194] 2. Method for producing the engineered cells described herein Another aspect is a method for producing a cell population comprising the engineered immune cells described herein, (i) providing donor-derived immune cells or providing induced pluripotent stem cells (iPSCs); (ii) optionally, inactivating the potential expression of the T cell receptor (TCR) in the cells or the presentation of the TCR on the cell surface; (iii) integrating into the genome of the cells an exogenous nucleic acid sequence encoding a chimeric antigen receptor (CAR) that targets fibroblast activation protein (FAP) ( "FAP-CAR") under the transcriptional control of an exogenous or endogenous constitutive promoter; (iv) integrating into the genome of the cells an exogenous nucleic acid sequence encoding a chimeric antigen receptor (CAR) that targets a tumor antigen ( "tumor-CAR") under the transcriptional control of an exogenous or endogenous inducible promoter; (v) optionally, differentiating the engineered iPSCs into immune cells; (vi) optionally, isolating the engineered cells that do not express the TCR on their cell surface comprising and providing a method wherein the expression of the tumor-CAR is inducible upon activation of the immune cells.

[0195] The origin of the cells prepared, i.e., to be manipulated, in step (i) is not particularly limited. In some cases, the cells in step (i) can be immune cells resulting from donor-derived immune cells or the differentiation of iPSCs into immune cells. The cells in step (i) can also be iPSCs that can differentiate into immune cells after any one of steps (ii) to (iv) of the gene manipulation disclosed above.

[0196] "Immune cells" typically refer to hematopoietic-derived cells that are functionally involved in the initiation and / or execution of innate and / or adaptive immune responses, such as CD45-positive cells, CD3-positive cells, CD8-positive cells, or CD4-positive cells. Immune cells include dendritic cells, killer dendritic cells, mast cells, macrophages, natural killer cells (NK cells), cytokine-induced killer cells (CIK cells), B cells, or T cells selected from the group consisting of inflammatory T lymphocytes, cytotoxic T lymphocytes, or helper T lymphocytes, gamma delta T cells, and natural killer T cells ("NKT cells").

[0197] In some cases, the origin of the immune cells (such as T cells) to be manipulated is primary cells. "Primary cells (plural)" are intended to mean cells directly collected from a biological tissue (e.g., a biopsy specimen) and established to grow in vitro for a limited time, i.e., primary cells can undergo a limited number of population doublings. Primary cells are different from tumorigenic continuous cell lines or artificially immortalized cell lines. Non-limiting examples of such cell lines are CHO-K1 cells, HEK293 cells, Caco2 cells, U2-OS cells, NIH 3T3 cells, NSO cells, SP2 cells, CHO-S cells, DG44 cells, K-562 cells, U-937 cells, MRC5 cells, IMR90 cells, Jurkat cells, HepG2 cells, HeLa cells, HT-1080 cells, HCT-116 cells, Hu-h7 cells, Huvec cells, and Molt 4 cells.

[0198] Primary immune cells can be obtained from multiple non-limiting sources, including peripheral blood mononuclear cells (PBMCs), bone marrow, lymph node tissue, cord blood, thymus tissue, tissue at the site of infection, ascites, pleural effusion, spleen tissue, and tumors (e.g., tumor-infiltrating lymphocytes). In some cases, the immune cells can be derived from healthy donors, patients diagnosed with cancer, or patients diagnosed with an infectious disease. In some cases, the cells are part of a mixed population of immune cells that exhibit different phenotypic characteristics, such as including CD4-positive cells, CD8-positive cells, and CD56-positive cells. Primary immune cells are prepared from donors or patients via various methods known in the art, such as leukapheresis techniques outlined by Schwartz J. et al. (Guidelines on the use of therapeutic apheresis in clinical practice-evidence-based approach from the Writing Committee of the American Society for Apheresis: Special Issue 6 (2013) J Clin Apher. 28(3):145-284).

[0199] In this document, immune cells derived from induced pluripotent stem cells (iPSCs) (Yamanaka, K. et al. (2008) Science. 322(5903):949-53), etc., and immune cells derived from stem cells are also considered primary immune cells. Expression of reprogramming factors by lentivirus has been used to induce pluripotent cells from human peripheral blood cells (Staerk et al. (2010) Cell stem cell. 7(1):20-4, Loh et al. (2010) Cell stem cell. 7(1):15-9).

[0200] In some cases, immune cells can be derived from human embryonic stem cells by techniques well-known in the art that do not involve the destruction of human embryos (Chung et al. (2008) Cell Stem Cell 2(2):113-117).

[0201] In some cases, the engineered T cells can be derived from inflammatory T lymphocytes, cytotoxic T lymphocytes, or helper T lymphocytes.

[0202] In some cases, immune cells, such as T cells or NK cells, can be derived from stem cells. The stem cells can be adult stem cells, embryonic stem cells, such as non-human stem cells, umbilical cord blood stem cells, progenitor cells, bone marrow stem cells, induced pluripotent stem cells, totipotent stem cells, or hematopoietic stem cells. Representative human cells are CD34+ cells.

[0203] In some cases, the engineered cells can be derived from the group consisting of CD4+ T lymphocytes and CD8+ T lymphocytes. Prior to cell expansion and genetic modification, cells can be obtained from a subject by various non-limiting methods. T cells can be obtained from multiple non-limiting sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue at the site of infection, ascites, pleural effusion, spleen tissue, and tumors. In certain cases, any number of T cell lines that are available and known to those of skill in the art can be used. In some cases, the cells can be derived from a healthy donor or a patient diagnosed with cancer. In some cases, the cells are part of a mixed population of cells that exhibit different phenotypic characteristics. The scope of the present disclosure also encompasses cell lines obtained from transformed T cells according to the foregoing methods. Modified cells that are resistant to immunosuppressive treatment and can be obtained by the foregoing methods are also disclosed herein.

[0204] In some cases, the immune cells to be manipulated (e.g., T cells or NK cells) are allogeneic. "Allogeneic" means that the cells are donor-derived, cell line-derived, or generated and / or differentiated from stem cells, taking into account that the cells are infused into patients with different haplotypes. Such immune cells are generally engineered to have low alloreactivity and / or high persistence against the patient host. More specifically, the method of engineering allogeneic cells may include the step of reducing or suppressing TCR expression in T cells or TCR expression in stem cells that are derived into T cells. This can be achieved by various sequence-specific reagents, such as gene silencing techniques or gene editing techniques using, for example, nucleases, base editing techniques, shRNA, and RNAi, as non-limiting examples.

[0205] In some cases, when the human is the donor and not the patient, the immune cells to be manipulated, e.g., T cells or NK cells, may be human-derived.

[0206] In some cases, the engineered T cells can contain an inactivated T cell receptor (TCR), and may be modified, for example, by using a sequence-specific endonuclease such as an RNA-guided endonuclease associated with a specific guide RNA, or by using other gene editing techniques such as TALE nucleases, to inactivate at least one component of the TCR. The T cell receptor (TCR) is a cell surface receptor involved in the activation of T cells in response to antigen presentation. The TCR generally consists of two chains, alpha and beta, which assemble to form a heterodimer and associate with CD3 signaling subunits to form a T cell receptor complex present on the cell surface. Each of the alpha and beta chains of the TCR consists of an immunoglobulin-like variable (V) region and a constant (C) region at the N-terminus, a hydrophobic transmembrane domain, and a short cytoplasmic region. For immunoglobulin molecules, the variable regions of the alpha and beta chains are generated by V(D)J recombination, which gives rise to a great diversity of antigen specificities in the T cell population. However, unlike intact immunoglobulins that recognize antigens, T cells are activated by processed peptide fragments associated with MHC molecules, and an additional property known as MHC restriction is introduced into antigen recognition by T cells. Recognition of MHC differences between donor and recipient by the T cell receptor can lead to T cell proliferation and the potential for the development of GvHD. Normal surface expression of the TCR has been shown to depend on the coordinated synthesis and assembly of all seven components of the complex (Ashwell and Klusner (1990) Annu. Rev. Immunol. 8:139-67). Inactivation of TRAC (encoding the TCR alpha constant domain) or TRBC (encoding the TCR beta constant domain) can eliminate the TCR from the surface of T cells, preventing recognition of allogeneic antigens and thus preventing GVHD. However, disruption of the TCR generally results in the loss of CD3 signaling components and alters the means of further T cell expansion.

[0207] In some cases, at least 50%, at least 70%, at least 90%, or at least 95% of the engineered T cells in the population are mutated at the TRAC allele, the TRBC allele, and / or the CD3 allele.

[0208] In some cases, the TCR is inactivated by using a specific TALE nuclease, better known under the trademark TALEN (registered trademark) (Cellectis, 8, rue de la Croix Jarry, 75013 PARIS). This method uses RNA transfection as part of a platform enabling the large-scale production of allogeneic T cells and has been demonstrated to be highly efficient in primary cells. See, for example, International Publication No. WO 2013 / 176915, which is incorporated herein by reference in its entirety.

[0209] In some cases, the TCR is inactivated using an RNA-guided endonuclease associated with a specific guide RNA. U.S. Patent No. 10,870,864 describes methods for inactivating the TCR in a cell using such methods, which are incorporated herein by reference. Engraftment of allogeneic T cells is possible by inactivating at least one gene encoding a TCR component. In some cases, the TCR is rendered non-functional intracellularly by inactivating the TRAC gene and / or the TCRB gene. TCR inactivation in allogeneic T cells is targeted at preventing or reducing GvHD.

[0210] In some cases, the TCR gene is inactivated by inserting into the TRAC locus of the cell's genome at least one exogenous polynucleotide encoding a FAP-CAR that includes (a) an extracellular FAP-binding domain comprising the variable heavy chain (VH) and variable light chain (VL) of a monoclonal anti-FAP antibody, (b) a hinge selected from an FcγRIII hinge, a CD8α hinge, and an IgG1 hinge, (c) a CD8α transmembrane domain or a CD28 transmembrane domain, and (d) a cytoplasmic domain comprising a CD3 zeta signaling domain and optionally a co-stimulatory domain of 4-1BB or CD28.

[0211] Inactivating a gene is intended to result in the target gene not being expressed in the form of a functional protein. In some cases, genetic modification of a cell relies on expressing an endonuclease in the cell prepared for manipulation, which catalyzes the cleavage of one target gene by the endonuclease, thereby inactivating the target gene. The nucleic acid strand breaks caused by the endonuclease are usually repaired by different mechanisms such as homologous recombination or non-homologous end joining (NHEJ). However, NHEJ is an imperfect repair process that often results in changes in the DNA sequence at the site of cleavage. The mechanism involves rejoining the remaining portions of the two DNA ends either by direct religation (Critchlow and Jackson (1998) Trends Biochem Sci. 23(10):394-8) or via so-called microhomology-mediated end joining (Betts et al. (2003) J. Immunol. Methods 281(1-2):65-78, Ma et al. (2003) Mol Cell Biol 23(23):8820-8). Repair via non-homologous end joining (NHEJ) often results in small insertions or deletions and can be used to create specific gene knockouts. The modification can be a substitution, deletion, or addition of at least one nucleotide. Cells in which a cleavage-induced mutagenesis event, i.e., a mutagenesis event that occurs subsequent to an NHEJ event, has occurred can be identified and / or selected by methods well known in the art.

[0212] The engineered immune cells described in this book can be derived from the differentiation of the engineered iPSCs described in this book into said immune cells. Thus, another aspect described in this application is a method of producing a cell population comprising the engineered iPSCs described in this book, comprising: (i) preparing induced pluripotent stem cells (iPSCs); (ii) optionally, inactivating the potential expression of the T cell receptor (TCR) in the cells or the presentation of the TCR on the cell surface; (iii) integrating into the genome of the cells an exogenous nucleic acid sequence encoding a chimeric antigen receptor (CAR) that targets fibroblast activation protein (FAP) placed under the transcriptional control of an exogenous or endogenous constitutive promoter (the "FAP-CAR"); (iv) integrating into the genome of the cells an exogenous nucleic acid sequence encoding a chimeric antigen receptor (CAR) that targets a tumor antigen placed under the transcriptional control of an exogenous or endogenous inducible promoter (the "tumor-CAR") and relates to a method wherein the expression of the tumor-CAR is inducible upon activation of immune cells into which the engineered iPSCs can further differentiate.

[0213] Accordingly, another aspect includes a method of producing a cell population comprising the engineered immune cells described in this book, comprising: (i) producing a cell population comprising the iPSCs engineered as described above; and (ii) differentiating the engineered iPSCs into immune cells. Manipulation and Gene Editing The methods that can be used in this book to manipulate cells or perform gene editing are not particularly limited. In some cases, cells can be modified (e.g., manipulated or gene edited) by contacting the cells with sequence-specific reagents.

[0214] The "array-specific reagent" generally refers to an active molecule having the ability to specifically recognize a selected polynucleotide sequence at the genomic locus, namely a "target sequence" that is generally at least 12 bp, at least 15 bp, or at least 30 bp or 35 bp in length, considering the modification of the expression of the genomic locus. The expression can be modified by mutations, deletions, or insertions into the coding polynucleotide sequence or regulatory polynucleotide sequence, by epigenetic changes such as methylation or histone modification, or by interference at the transcriptional level by interacting with transcription factors or polymerases.

[0215] Examples of array-specific reagents are endonucleases, RNA guides, RNAi, methylases, exonucleases, histone deacetylases, terminal processing enzymes, such as exonucleases, and more specifically, cytidine deaminases such as those combined with the CRISPR / cas9 system to perform base editing (i.e., nucleotide substitution) without necessarily relying on nuclease cleavage, as described by, for example, Hess et al. (Mol Cell. (2017) 68(1):26 - 43) and Rees et al. (Nat.Rev.Genet. (2018) 19, 770 - 788).

[0216] According to one aspect, at least 50%, at least 70%, at least 90%, or at least 95% of the cell population expresses short hairpin RNA (shRNA) or small interfering (siRNA) against the polynucleotide sequence encoding the components of the TCR.

[0217] According to one aspect, at least 50%, at least 70%, at least 90%, or at least 95% of the cell population expresses short hairpin RNA (shRNA) or small interfering (siRNA) against the polynucleotide sequence encoding β2M.

[0218] According to one aspect, at least 50%, at least 70%, at least 90%, or at least 95% of the cell population expresses a short hairpin RNA (shRNA) or small interfering (siRNA) against the polynucleotide sequence encoding CD52.

[0219] According to one aspect, at least 50%, at least 70%, at least 90%, or at least 95% of the cell population expresses a short hairpin RNA (shRNA) or small interfering (siRNA) against the polynucleotide sequence encoding PDCD1. According to one aspect, at least 50%, at least 70%, at least 90%, or at least 95% of the cell population expresses a short hairpin RNA (shRNA) or small interfering (siRNA) against the polynucleotide sequence encoding LAG3.

[0220] According to one aspect, at least 50%, at least 70%, at least 90%, or at least 95% of the cell population expresses a short hairpin RNA (shRNA) or small interfering (siRNA) against the polynucleotide sequence encoding TIM3.

[0221] According to one aspect, at least 50%, at least 70%, at least 90%, or at least 95% of the cell population expresses a short hairpin RNA (shRNA) or small interfering (siRNA) against the polynucleotide sequence encoding GM-CSF.

[0222] According to another aspect, at least 50%, at least 70%, at least 90%, or at least 95% of the cell population encodes a short hairpin RNA (shRNA) or small interfering (siRNA) against the polynucleotide sequence encoding a component of the TCR, and a short hairpin RNA (shRNA) or small interfering (siRNA) against the polynucleotide sequence encoding β2M and / or a short hairpin RNA (shRNA) or small interfering (siRNA) against the polynucleotide sequence encoding CD3.

[0223] In some cases, the sequence-specific reagent can be a sequence-specific nuclease reagent, such as a sequence-specific endonuclease like a rare-cutting endonuclease such as a TALE nuclease, or an RNA guide associated with a guide endonuclease such as CRISPR.

[0224] The term "sequence-specific nuclease reagent" includes reagents having nickase activity or endonuclease activity. The sequence-specific nuclease reagent can be a chimeric polypeptide comprising a DNA-binding domain and another domain exhibiting catalytic activity. Such catalytic activity can be, for example, a nuclease for gene inactivation, or a nickase or double-nickase for preferentially performing gene insertion by creating sticky ends to facilitate gene integration by homologous recombination.

[0225] The term "endonuclease" generally refers to a wild-type enzyme or a variant enzyme capable of catalyzing the hydrolysis (cleavage) of the bond between nucleic acids in a DNA molecule or an RNA molecule. An endonuclease (and thus a sequence-specific endonuclease) does not cleave a DNA molecule or an RNA molecule regardless of the sequence of the DNA molecule or RNA molecule, but recognizes and cleaves a DNA molecule or an RNA molecule at a specific polynucleotide sequence hereinafter referred to as the "target sequence" or "target site". An endonuclease can be classified as a rare-cutting endonuclease when it has a polynucleotide recognition site typically longer than 10 base pairs (bp) or 14 - 55 bp. A rare-cutting endonuclease significantly increases homologous recombination by inducing a DNA double-strand break (DSB) at a defined locus, thereby enabling gene repair therapy or gene insertion therapy (Pingoud and Silva (2007) Nat. Biotechnol. 25(7):743 - 4).

[0226] In some cases, the array-specific reagent can be a base editor capable of performing base editing as described, for example, by Komor et al. (Nature (2019) 533(7603), 420-424) and Mok et al. (Nature (2020) 583:631-637).

[0227] As used herein, the term "base editor" refers to a catalytic domain capable of modifying a base (e.g., A, T, C, G, or U) within a nucleic acid sequence by converting one base to another (e.g., A to G, A to C, A to T, C to T, C to G, C to A, G to A, G to C, G to T, T to A, T to C, T to G). Base editors can include cytidine deaminases that convert target C / G to T / A, and adenine base editors that convert target A / T to G / C. The adenosine deaminase can be, for example, TadA or its variant TadA7.10 as described by Jeong et al. (Nat Biotechnol (2021) 39, 1426-1433). Cytidine can be converted to thymidine using various members of the apolipoprotein B mRNA editing enzyme (APOBEC) family, such as mouse rAPOBEC1 and human APOBEC3G developed by Lee et al. (Science Advances (2020) 6(29)).

[0228] In some cases, the base editor catalytic domain can convert C to T (cytidine deaminase) and catalyze the chemical reaction "cytosine + H2O → uracil + NH3" or "5-methyl-cytosine + H2O → thymine + NH3". As may be apparent from the reaction scheme, such chemical reactions result in a nucleic acid base change from C to U / T. In the context of a gene, such nucleotide changes or mutations can ultimately lead to amino acid changes in a protein, such as loss of function or gain of function, which can affect the function of the protein.

[0229] The array-specific reagents defined in this book include TALE-base editors (BEs) that can be generated by fusing transcription activator-like effector array proteins (TALEs) with base editor catalytic domains. The base editor catalytic domain can be a double-stranded DNA deaminase (``DddA'') that does not break DNA by double-strand breaks (DSBs), but rather performs the accurate generation of nucleotide changes and / or the correction of pathogenic mutations. For example, Mok et al. (Nature (2020) 583:631-637) recently developed a TALE base editor by splitting the bacterial cytidine deaminase toxin DddAtox from Burkohlderia cenocepacia into non-toxic halves and fusing them to the C-terminus of a pair of (left and right) TALE binding domains to form a heterodimeric TALE base editor. In such a situation, the deaminase DddAtox becomes active when the two halves linked to their respective TALE binding domains co-localize at a predetermined genomic locus. The split ``DddA-N half'' and ``DddA-C half'' can be obtained by cleaving the complete DddAtox protein (SEQ ID NO: 95) at position 1333 or 1397.

[0230] In some cases, such TALE-base editors can also include a domain that inhibits uracil glycosylase, termed ``UGI'', and / or a nuclear localization signal. The term ``uracil glycosylase inhibitor'' or ``UGI'' as used in this book refers to a protein that can inhibit the uracil-DNA glycosylase base excision repair enzyme. In some cases, the UGI domain can include wild-type UGI or standard UGI. In some cases, the UGI protein can include fragments of UGI and proteins homologous to UGI or UGI fragments that are useful for improving the specificity of base editing performed at a predetermined locus.

[0231] The methods and materials provided in this book aim to improve the therapeutic potential of immune cells through gene editing techniques, particularly through gene targeting integration.

[0232] In some cases, an exogenous nucleic acid sequence encoding a chimeric antigen receptor (CAR) that targets fibroblast activation protein (FAP) (a "FAP-CAR") under the transcriptional control of an exogenous or endogenous constitutive promoter, and an exogenous nucleic acid sequence encoding a chimeric antigen receptor (CAR) that targets a tumor antigen (a "tumor-CAR") under the transcriptional control of an exogenous or endogenous inducible promoter, can be integrated into the genome of a cell.

[0233] Each of the exogenous nucleic acid sequences encoding the FAP-CAR and the exogenous nucleic acid sequence encoding the tumor-CAR described in this book can be independently integrated into the genome of a cell by random integration (e.g., by integration of a lentiviral vector) or by gene targeting integration (e.g., by sequence-specific endonuclease-mediated cDNA insertion at a targeted gene locus in the genome of the cell).

[0234] In one example, the exogenous nucleic acid sequence encoding the FAP-CAR and the exogenous nucleic acid sequence encoding the tumor-CAR described in this book are integrated into the genome of a cell by random integration (e.g., by integration of a lentiviral vector).

[0235] In another example, the exogenous nucleic acid sequence encoding the FAP-CAR described in this book is integrated into the genome of a cell by random integration (e.g., by integration of a lentiviral vector), and the exogenous nucleic acid sequence encoding the tumor-CAR described in this book is integrated into the genome of a cell by gene targeting integration (e.g., by sequence-specific endonuclease-mediated cDNA insertion at a targeted gene locus in the genome of the cell).

[0236] In yet another example, the exogenous nucleic acid sequence encoding the FAP-CAR described herein is integrated into the genome of a cell by gene targeting integration (e.g., by sequence-specific endonuclease-mediated cDNA insertion at a targeted gene locus in the genome of the cell), and the exogenous nucleic acid sequence encoding the tumor-CAR described herein is integrated into the genome of the cell by random integration (e.g., by integration of a lentiviral vector).

[0237] In a further example, the exogenous nucleic acid sequence encoding the FAP-CAR described herein and the exogenous nucleic acid sequence encoding the tumor-CAR are integrated into the genome of a cell by gene targeting integration (e.g., by sequence-specific endonuclease-mediated cDNA insertion at a targeted gene locus in the genome of the cell).

[0238] "Gene targeting integration" means any known site-specific method that enables the insertion, replacement, or modification of genomic coding sequences in living cells.

[0239] In some cases, gene targeting integration involves inserting a target gene or replacing a target gene with at least one exogenous nucleotide sequence, such as a coding sequence, of several nucleotides (i.e., polynucleotides), as a result of homologous recombination at the locus of the target gene.

[0240] "DNA target", "DNA target sequence", "target DNA sequence", "nucleic acid target sequence", "target sequence", or "processing site" is intended to mean a polynucleotide sequence that can be targeted and processed by the sequence-specific nuclease reagents described herein. These terms refer to the position of specific DNA, such as the position within the genome of a cell, but also refer to a portion of genetic material that can exist independently of the main body of genetic material, such as a plasmid, episome, virus, transposon, etc., or a portion of genetic material that can exist in an organelle such as mitochondria, as a non-limiting example. Non-limiting examples of RNA-guided target sequences include genomic sequences to which a guide RNA that directs an RNA-guided endonuclease to a desired locus can hybridize.

[0241] "Rare-cutting endonuclease" is an optionally sequence-specific endonuclease reagent as long as the recognition sequence is in the range of 10 to 50 consecutive base pairs in total, for example, in the range of 12 to 30 bp or 14 to 20 bp.

[0242] In some cases, the sequence-specific endonuclease reagent may be a nucleic acid encoding a "engineered" rare-cutting endonuclease or "programmable" rare-cutting endonuclease, such as a homing endonuclease described by, for example, Arnould et al. (International Publication No. WO 2004 / 067736), a zinc finger nuclease (ZFN) described by, for example, Urnov et al. (Nature (2005) 435: 646-651), a TALE nuclease described by, for example, Mussolino et al. (Nucl. Acids Res. (2011) 39(21): 9283-9293), or a megaTAL nuclease described by, for example, Boissel et al. (Nucleic Acids Research (2013) 42(4): 2591-2601).

[0243] In some cases, the endonuclease reagent can be an RNA guide, such as Cas9 or Cpf1, that is used in combination with an RNA-guided endonuclease, as taught, for example, by Doudna and Charpentier (Science (2014) 346(6213):1077), which is incorporated herein by reference.

[0244] In some cases, the endonuclease reagent can be transiently expressed in cells, i.e., the reagent is not expected to integrate into the genome or persist over a long period of time, such as in the case of RNA, such as mRNA, protein, or a complex of protein and nucleic acid (e.g., ribonucleoprotein).

[0245] The endonuclease in mRNA form can be synthesized using a cap to enhance its stability according to techniques well known in the art, such as those described by Kore et al. (J Am Chem Soc. (2009) 131(18):6364-5).

[0246] The nucleases described herein, polynucleotides encoding these nucleases, donor polynucleotides, and compositions comprising proteins and / or polynucleotides for gene modifying cells can be delivered in vivo or ex vivo by any suitable means.

[0247] In some cases, the polypeptide can be synthesized in situ within the cell as a result of introducing into the cell a polynucleotide encoding the polypeptide. In some cases, the polypeptide can be produced extracellularly and then introduced into the cell. Methods for introducing a polynucleotide construct into a cell are known in the art and include, by way of non-limiting example, stable transformation methods that integrate the polynucleotide construct into the genome of the cell, transient transformation methods that do not integrate the polynucleotide construct into the genome of the cell, and virus-mediated methods. In some cases, the polynucleotide can be introduced into the cell by a recombinant viral vector (e.g., retrovirus, adenovirus), liposome, or the like. For example, transient transformation methods include, for example, microinjection, electroporation, or particle bombardment. The polynucleotide can be included in a vector such as a plasmid or virus in view of being expressed intracellularly.

[0248] In some cases, a nucleic acid encoding an endonuclease reagent can be transfected into a cell. In some cases, 80% of the endonuclease reagent is degraded by 30 hours after transfection, for example, by 24 hours or 20 hours after transfection.

[0249] In some cases, the nuclease and / or donor construct described herein may be delivered using a vector comprising a sequence encoding one or more of the CRISPR / Cas system(s), zinc finger, or TALEN protein(s).

[0250] Any vector system may be used, including but not limited to plasmid vectors, retroviral vectors, lentiviral vectors, adenoviral vectors, poxviral vectors, herpes viral vectors, and adeno-associated viral vectors. See also U.S. Patent Nos. 6,534,261, 6,607,882, 6,824,978, 6,933,113, 6,979,539, 7,013,219, and 7,163,824, which are hereby incorporated by reference in their entirety. Further, it will be apparent that any of these vectors may contain one or more of the sequences required for treatment. Thus, when one or more nucleases and donor constructs are introduced into a cell, the nuclease and / or donor polynucleotide may be carried on the same vector or a different vector. When multiple vectors are used, each vector may contain sequences encoding one or more nucleases and / or donor constructs.

[0251] The nucleic acids encoding the nuclease and donor construct can be introduced into cells (e.g., mammalian cells) and target tissues using any suitable viral and non-viral gene transfer method.

[0252] Viral vector delivery systems include DNA and RNA viruses that have either an episomal genome or an integrated genome after delivery to cells. For reviews of gene therapy approaches, see Anderson, Science 256:808-813 (1992), Nabel & Feigner, TIBTECH 11:211-217 (1993), Mitani & Caskey, TIBTECH 11:162-166 (1993), Dillon, TIBTECH 11:167-175 (1993), Miller, Nature 357:455-460 (1992), Van Brunt, Biotechnology 6(10):1149-1154 (1988), Vigne, Restorative Neurology and Neuroscience 8:35-36 (1995), Kremer & Perricaudet, British Medical Bulletin 51(1):31-44 (1995), Haddada et al., Current Topics in Microbiology and Immunology, Doerfler and Bohm (eds.) (1995), and Yu et al., Gene Therapy 1:13-26 (1994).

[0253] In some cases, methods of non-viral delivery of nucleic acids include electroporation, lipofection, microinjection, biolistic methods, virosomes, liposomes, immunoliposomes, polycation:nucleic acid conjugates or lipid:nucleic acid conjugates, naked DNA, naked RNA, capped RNA, artificial virions, and enhancement by agents for DNA uptake. For example, sonoporation using the Sonitron 2000 system (Rich-Mar) can also be used for delivery of nucleic acids.

[0254] Generally, the electroporation step used to transfect primary immune cells such as PBMCs is typically carried out in a closed chamber equipped with the parallel plate electrodes that generate a pulsed electric field greater than 100 volts / cm and less than 5,000 volts / cm, which is substantially uniform throughout the throughput, as described in particular on pages 23, line 25 to page 29, line 11 of International Publication No. WO 2004 / 083379, which is incorporated herein by reference. One such electroporation chamber may have a form factor (cm 3 ) defined by the quotient of the square of the electrode gap (cm2) divided by the chamber volume (cm -1 ), and this form factor is 0.1 cm -1 or less, and the suspension of cells and sequence-specific reagents is carried out in a medium adjusted so that the medium has a conductivity in the range of 0.01 to 1.0 millisiemens. Generally, the cell suspension is subjected to one or more pulsed electric fields. In this method, the throughput of the suspension is scalable and the processing time of the cells in the chamber is substantially uniform.

[0255] In some cases, different transgenes or multiple copies of a transgene may be included in one vector. The vector may include a nucleic acid sequence encoding a ribosome skip sequence such as a sequence encoding a 2A peptide. The 2A peptide identified in the aphthovirus subgroup of picornaviruses causes ribosome "skipping" from one codon to the next without forming a peptide bond between the two amino acids encoded by these codons (see Donnelly et al., J. of General Virology 82:1013 - 1025 (2001), Donnelly et al., J. of Gen. Virology 78:13 - 21 (1997), Doronina et al., Mol. And. Cell. Biology 28(13):4227 - 4239 (2008), Atkins et al., RNA 13:803 - 810 (2007)).

[0256] A "codon" refers to three nucleotides of mRNA (or the sense strand of a DNA molecule) that are translated by a ribosome into one amino acid residue. Thus, if two polypeptides are separated by a 2A oligopeptide sequence that is in-frame, the two polypeptides can be synthesized from a single continuous open reading frame in the mRNA. Such a ribosome skipping mechanism is well known in the art and is known to be used by several vectors for the expression of several proteins encoded by a single messenger RNA.

[0257] In some cases, the polynucleotide encoding the sequence-specific reagent can be mRNA that is introduced directly into cells, for example, by electroporation. In some cases, cells can be electroporated using cytoPulse technology, which uses the application of a pulsed electric field to transiently permeabilize live cells to allow delivery of substances into the cells. This technology, based on the use of the electroporation waveform of PulseAgile (BTX Havard Apparatus, 84 October Hill Road, Holliston, Mass. 01746, USA), allows precise control of the pulse duration, intensity, and the interval between pulses (see U.S. Patent No. 6,010,613 and International Publication No. WO 2004 / 083379 of the International Publication of the International Application). All of these parameters can be modified to reach the best conditions for high transfection efficiency with minimal mortality. The first high electric field pulse allows pore formation, and subsequent low electric field pulses allow the movement of the polynucleotide into the cell.

[0258] Additional exemplary nucleic acid delivery systems include those provided by Amaxa Biosystems (Cologne, Germany), Maxcyte, Inc. (Rockville, Md.), BTX Molecular Delivery Systems (Holliston, Mass.), and Copernicus Therapeutics Inc. (see, e.g., U.S. Patent No. 6,008,336). Lipofection is described, for example, in U.S. Patent Nos. 5,049,386, 4,946,787, and 4,897,355, and lipofection reagents are commercially available (e.g., Transfectam and Lipofectin). Cationic and neutral lipids suitable for efficient receptor recognition lipofection of polynucleotides include those of Felgner, WO 91 / 17424, and WO 91 / 16024.

[0259] The preparation of lipid:nucleic acid complexes, including targeted liposomes such as immunolipid complexes, is well known to those of skill in the art (see, e.g., Crystal, Science 270:404-410 (1995), Blaese et al., Cancer Gene Ther. 2:291-297 (1995), Behr et al., Bioconjugate Chem. 5:382-389 (1994), Remy et al., Bioconjugate Chem. 5:647-654 (1994), Gao et al., Gene Therapy 2:710-722 (1995), Ahmad et al., Cancer Res. 52:4817-4820 (1992), U.S. Patent Nos. 4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028, and 4,946,787).

[0260] In some cases, the donor array and / or array-specific reagents can be encoded by a viral vector. In some cases, an adenovirus-based system can be used. Adenovirus-based vectors allow for very high transduction efficiency in many cell types and do not require cell division. High titers and high levels of expression have been obtained with such vectors. This vector can be produced in large quantities in a relatively simple system. Adeno-associated virus (「AAV」) vectors are also used to transduce target nucleic acids into cells, for example, in the in vitro production of nucleic acids and peptides, and for in vivo and ex vivo gene therapy procedures (see, for example, West et al., Virology 160:38-47 (1987), U.S. Patent No. 4,797,368, International Publication No. 93 / 24641, Kotin, Human Gene Therapy 5:793-801 (1994), Muzyczka, J. Clin. Invest. 94:1351 (1994)). The construction of recombinant AAV vectors is described in a number of published documents, including U.S. Patent No. 5,173,414, Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985), Tratschin et al., Mol. Cell. Biol. 4:2072-2081 (1984), Hermonat & Muzyczka, PNAS 81:6466-6470 (1984), and Samulski et al., J. Virol. 63:03822-3828 (1989).

[0261] Recombinant adeno-associated virus vector (rAAV) is a promising alternative gene delivery system based on adeno-associated virus type 2, a defective and non-pathogenic parvovirus. All vectors are derived from plasmids that retain only the AAV 145 bp inverted terminal repeats flanking the transgene expression cassette. Efficient gene transfer and stable transgene delivery by integration into the genome of transduced cells are the main features of this vector system (Wagner et al., Lancet 351:9117 1702-3 (1998), Kearns et al., Gene Ther. 9:748-55 (1996)). Other AAV serotypes, including, but not limited to, AAV1, AAV3, AAV4, AAV5, AAV6, AAV8, AAV8.2, AAV9, and AAV rh10, as well as pseudotyped AAV such as AAV2 / 8, AAV2 / 5, and AAV2 / 6, may also be used according to the present disclosure.

[0262] In some cases, the cells can be administered with an effective amount of one or more caspase inhibitors in combination with the AAV vector.

[0263] In some cases, the donor sequence and / or sequence-specific reagent can be encoded by a recombinant lentiviral vector (rLV).

[0264] The nuclease coding sequence and the donor construct can be delivered using the same system or different systems. For example, the donor polynucleotide may be carried on a viral vector, and one or more nucleases may be delivered as an mRNA composition.

[0265] In some cases, one or more reagents can be delivered to cells using nanoparticles. In some cases, the nanoparticles are coated with a ligand such as an antibody that has a specific affinity for an HSC surface protein such as CD105 (Uniprot number P17813). In some cases, the nanoparticles are biodegradable polymer nanoparticles in which a sequence-specific reagent in polynucleotide form is complexed with a polymer of poly-beta amino ester and coated with polyglutamic acid (PGA).

[0266] TALE nucleases are particularly suitable sequence-specific nuclease reagents for therapeutic use because of their high specificity, especially in heterodimeric form, i.e., in a form that functions as a pair of a "right" monomer (also referred to as "5'" or "forward") and a "left" monomer (also referred to as "3'" or "reverse") as reported, for example, by Mussolino et al. (Nucl. Acids Res. (2014) 42(10):6762-6773).

[0267] As described above, sequence-specific reagents can be in the form of nucleic acids such as DNA or RNA encoding a rare-cutting endonuclease or a subunit of a rare-cutting endonuclease, but can also be part of a conjugate comprising polynucleotide(s) and polypeptide(s) such as a so-called "ribonucleoprotein". Such conjugates can be formed with reagents as Cas9 or Cpf1 (RNA-guided endonucleases) respectively described by Zetsche et al. (Cell (2015) 163(3):759-771), which include an RNA guide or a DNA guide that can be complexed with each nuclease.

[0268] "Exogenous sequence" refers to a nucleotide sequence or nucleic acid sequence that was not initially present at a selected locus. The exogenous sequence can be homologous to a genomic sequence, or can be a copy of a genomic sequence, or can be a foreign sequence introduced into the cell. In contrast, "endogenous sequence" means the cellular genomic sequence that was present at the locus from the beginning.

[0269] As used herein, "donor construct" or "donor polynucleotide" includes an exogenous nucleotide sequence that is randomly inserted into the genome of a cell at any locus, or an exogenous nucleotide sequence that is inserted into or replaces a targeted gene locus. A donor construct can include a nucleotide sequence encoding a CAR described herein, and optionally can include a promoter that controls the transcription of said CAR.

[0270] In some cases, the donor construct can be a vector that includes a constitutive exogenous promoter and an exogenous nucleic acid sequence encoding FAP-CAR operably linked to said promoter, as described herein. In this case, the donor construct can be randomly integrated into the genome of the cell at any locus, and the transcription of FAP-CAR is controlled by said constitutive exogenous promoter.

[0271] In some cases, the donor construct can be a vector comprising an exogenous nucleic acid sequence encoding a FAP-CAR flanked by left and right homology arms (or “left and right homology regions”) having homology to a targeted gene locus, such that expression is constitutive as described herein (also referred to as “5’ and 3’ homology arms (or 5’ and 3’ homology regions)”, respectively). In some cases, the vector does not include a promoter sequence, and the donor construct can be integrated into the genome of the cell by homologous recombination at the targeted constitutively expressed gene locus such that transcription of the FAP-CAR is controlled by the constitutive (endogenous) promoter of the targeted gene locus. In some cases, the vector further includes a constitutive exogenous promoter sequence, and a “cassette” comprising the promoter sequence and the exogenous nucleic acid sequence encoding the FAP-CAR is flanked by left and right homology arms having homology to the targeted gene locus. In these latter cases, the donor construct can be integrated into the genome of the cell by homologous recombination at the targeted gene locus, but transcription of the FAP-CAR is controlled by the constitutive exogenous promoter provided by the vector.

[0272] In some cases, the donor construct can be a vector comprising an exogenous inducible promoter and an exogenous nucleic acid sequence encoding a tumor-CAR. In this case, the donor construct can be randomly integrated into the genome of the cell at any locus, and transcription of the tumor-CAR is controlled by the exogenous inducible promoter.

[0273] In some cases, the donor construct can be a vector comprising an exogenous nucleic acid sequence encoding a tumor-CAR flanked by left and right homology arms having homology to the targeted gene locus. In some cases, the vector does not contain a promoter sequence, and the donor construct can be integrated into the cell's genome by homologous recombination at the targeted inducible gene locus such that transcription of the tumor-CAR is controlled by an inducible (endogenous) promoter of the targeted gene locus. In some cases, the vector further comprises an inducible exogenous promoter sequence, and a "cassette" comprising the promoter sequence and the exogenous nucleic acid sequence encoding the tumor-CAR is flanked by left and right homology arms having homology to the targeted gene locus. In some of these latter cases, the donor construct can be integrated into the cell's genome by homologous recombination at the targeted gene locus, but transcription of the tumor-CAR is controlled by the inducible exogenous promoter provided by the vector.

[0274] When the donor construct does not contain a promoter, the donor construct can include, in addition to the CAR coding sequence, an internal ribosome entry site (IRES), or a "self-cleaving" 2A peptide such as T2A, P2A, E2A or F2A, to enable production of a functional CAR protein.

[0275] Stable expression of CARs, particularly the FAP-CAR and tumor-CAR described herein, in immune cells such as T cells can be achieved, for example, using viral vectors (e.g., lentiviral vectors, retroviral vectors, adeno-associated virus (AAV) vectors), or transposon / transposase systems, or integration of plasmids or PCR products. Other approaches include direct mRNA electroporation.

[0276] In some cases, the tumor-CAR and the FAP-CAR have the same hinge, transmembrane domain, and / or cytoplasmic domain. In these cases, in order to avoid recombination events in constructs containing polynucleotides encoding two CARs that contain the same domain, the nucleotide sequences used to encode the same amino acid sequence (e.g., the same hinge, transmembrane domain, or the same stimulatory domain) that is present twice in the construct are optimized using codon usage frequency and codon degeneracy so that the nucleotide sequences are different.

[0277] Non-limiting examples of TALE nucleases that target endogenous genes expressing PDCD1, TRAC, CD52, and B2M are shown in Table 6. The present invention can be practiced as described herein using such polynucleotides or polypeptides having at least 70%, such as at least 80%, at least 90% or at least 95% or 99% identity to the sequences recited in Table 6.

Table 6

[0278] In some cases, integration of the donor construct by homologous recombination at the targeted gene locus results in a reduction or suppression of the production of the product of the gene being targeted.

[0279] Thus, in some cases, any of the donor constructs described herein can be integrated at loci encoding TCR components, HLA, B2M, PDCD1, CTLA4, TIM3, LAG3, CD69, IL2Ra, GM-CSF, and / or CD52. As a result, in these cases, the expression of the targeted gene is reduced or suppressed.

[0280] For example, in some cases, the polynucleotide encoding the FAP-CAR described herein is integrated into the endogenous TRAC locus, B2M locus, or CD52 locus in the genome of the engineered immune cells, such as T cells. In some cases, the polynucleotide encoding the tumor-CAR described herein is integrated into the endogenous PDCD1 locus, CD25 locus, GM-CSF locus, TIM3 locus, or TIGIT locus in the genome of the engineered immune cells, such as T cells.

[0281] In some cases, the vector can comprise an exogenous sequence encoding FAP-CAR and / or tumor-CAR that is optionally co-expressed with a cytokine such as IL-12, IL-15, IL-7, or IL-2.

[0282] Gene-targeted insertion of the sequence encoding CAR and / or other exogenous gene sequences can be performed using an AAV vector, particularly a vector derived from the AAV6 family, or the chimeric vector AAV2 / 6 previously described by Sharma et al. (Brain Research Bulletin. (2010) 81(2-3):273-278).

[0283] Thus, one aspect relates to transducing human primary immune cells, such as primary T cells, with such an AAV vector encoding the FAP-CAR or tumor-CAR described herein in combination with the expression of a sequence-specific endonuclease reagent such as a TALE endonuclease to increase gene integration at the aforementioned loci.

[0284] Another aspect relates to the inactivation of the aforementioned genes (e.g., TRAC, TRBC, CD3, HLA, B2M, PDCD1, CTLA4, TIM3, LAG3, CD69, IL2Ra, GM-CSF, and / or CD52) by transduction of a recombinant lentiviral vector (rLV) encoding a CAR such as FAP-CAR or tumor-CAR described herein into human primary immune cells, particularly primary T cells, which can be performed before or after the introduction of an array-specific endonuclease reagent such as a TALE endonuclease.

[0285] In some cases, the array-specific endonuclease reagent can be introduced into the cell by transfection such as electroporation of the mRNA encoding the array-specific endonuclease reagent.

[0286] Accordingly, provided is a method for inserting an exogenous nucleic acid sequence encoding FAP-CAR or tumor-CAR described herein into the genome of a cell at one of the aforementioned loci, the method comprising: transducing the cell with an AAV vector comprising an exogenous nucleic acid sequence encoding FAP-CAR or tumor-CAR and a sequence homologous to the endogenous DNA sequence to be targeted, and optionally, inducing the expression of an array-specific endonuclease reagent to cleave the endogenous sequence at the insertion locus. at least one of.

[0287] The insertion of the exogenous nucleic acid sequence achieved can result in the introduction of genetic material and the replacement of the endogenous sequence, and thus in the inactivation of the endogenous locus.

[0288] Another object relates to an AAV vector used in the present method, which may contain an exogenous coding sequence that is "promoterless", and this coding sequence is any of those mentioned herein.

[0289] Many other vectors known in the art, such as plasmids, episomal vectors, linear DNA substrates, etc., can also be used to insert genes at these loci by following the teachings of the present case.

[0290] As described above, the DNA vectors used for gene targeting integration described in this document may include (1) an exogenous nucleic acid to be inserted, including the exogenous coding sequence of FAP-CAR and / or the exogenous coding sequence of tumor-CAR described in this document, and (2) a sequence encoding a sequence-specific endonuclease reagent that promotes insertion at the targeted locus. In some cases, the exogenous nucleic acid in (1) does not include a promoter sequence, but the sequence in (2) includes its own promoter.

[0291] The DNA vectors used for random integration described in this document may include (i) a constitutive promoter and the exogenous coding sequence of FAP-CAR described in this document operably linked to the promoter, and / or (ii) an inducible promoter and the exogenous coding sequence of tumor-CAR described in this document operably linked to the promoter, including the exogenous nucleic acid to be inserted.

[0292] As can be derived from the meaning of the term "exogenous sequence" provided in this document, it should be understood that the sequences contained in the DNA vector to be integrated are necessarily "exogenous" as they are intended to be added to the cell's genome. Therefore, the adjective "exogenous" may be omitted in this context.

[0293] According to another aspect, when the CAR is a multi-chain CAR, the nucleic acid in (1) further includes an internal ribosome entry site (IRES) or a "self-cleaving" 2A peptide such as T2A, P2A, E2A or F2A so that the exogenous coding sequence to be inserted is polycistronic. The IRES of the 2A peptide may be before or after the exogenous coding sequence.

[0294] The exogenous polynucleotide sequence encoding the FAP-CAR and / or tumor-CAR can also be introduced into immune cells, such as T cells or NK cells, or into iPSCs, by using a viral vector such as a lentiviral vector. Accordingly, the present disclosure provides a viral vector encoding the FAP-CAR and / or tumor-CAR described herein.

[0295] In some cases, the lentiviral vector or AAV vector contemplated herein may include a sequence encoding a CAR separated by a T2A sequence or a P2A sequence, as forming one transcription unit. In the lentiviral vector, the sequence encoding the FAP-CAR described herein may form an expression cassette that is transcribed under the control of a constitutive exogenous promoter, such as the EF1 alpha promoter derived from the human EF1A1 gene. In some cases, in the lentiviral vector, the sequence encoding the tumor-CAR described herein may form an expression cassette that is transcribed under the control of an inducible exogenous promoter, such as a polynucleotide containing at least one NFAT-responsive element including SEQ ID NO: 114 or SEQ ID NO: 115.

[0296] In some cases, the engineered cells are produced by a process involving random integration of a lentiviral vector containing a constitutive promoter sequence and a polynucleotide encoding the FAP-CAR described herein into the genome of the cells.

[0297] In some cases, the engineered cells are produced by a process involving random integration of a lentiviral vector containing an inducible promoter sequence and a polynucleotide encoding the tumor-CAR described herein into the genome of the cells.

[0298] In some cases, the engineered cells are made by a process that includes random integration into the genome of the cell of one lentiviral vector that includes a cassette comprising a constitutive promoter and a polynucleotide encoding the FAP-CAR described herein, and a cassette comprising an inducible promoter and a polynucleotide encoding the tumor-CAR described herein.

[0299] In some cases, the engineered cells are made by a process that includes targeted integration of an exogenous sequence encoding the FAP-CAR and / or tumor-CAR described herein.

[0300] Thus, in some cases, the engineered cells are made by a process that includes targeted integration into the genome of the cell of a polynucleotide encoding the FAP-CAR described herein via sequence-specific endonuclease-mediated cDNA insertion at a constitutively expressed genetic locus in the genome of the cell. In these cases, the cDNA includes a polynucleotide encoding the FAP-CAR described herein, and the constitutively expressed genetic locus is a locus controlled by an endogenous constitutive promoter as defined herein. In these cases, the expression of the FAP-CAR is controlled by the endogenous constitutive promoter.

[0301] In some cases, the engineered cells are made by a process that includes targeted integration into the genome of the cell of a polynucleotide that includes an exogenous constitutive promoter and an exogenous nucleic acid sequence encoding the FAP-CAR described herein operably linked to the promoter via sequence-specific endonuclease-mediated insertion at a constitutively expressed genetic locus in the genome of the cell. In these cases, the expression of the FAP-CAR is controlled by the exogenous constitutive promoter.

[0302] In some cases, the engineered cells are produced by a process comprising targeted integration into the genome of the cell of a polynucleotide encoding the tumor-CAR described herein via sequence-specific endonuclease-mediated cDNA insertion at an inducible gene locus in the genome of the cell. In these cases, the cDNA comprises a polynucleotide encoding the tumor-CAR described herein, and the inducible gene locus is controlled by an inducible promoter as defined herein. In these cases, the expression of the tumor-CAR is controlled by the endogenous inducible promoter.

[0303] In some cases, the engineered cells are produced by a process comprising targeted integration into the genome of the cell of a polynucleotide comprising an exogenous inducible promoter and an exogenous nucleic acid sequence encoding the tumor-CAR described herein operably linked to the promoter via sequence-specific endonuclease-mediated insertion at an inducible gene locus in the genome of the cell. In these cases, the expression of the tumor-CAR is controlled by the exogenous inducible promoter.

[0304] Another aspect relates to a set or kit of vectors for producing the engineered immune cells described herein.

[0305] In one aspect, there is provided a set of vectors comprising at least one vector comprising a nucleic acid sequence encoding FAP-CAR placed under the transcriptional control of a constitutive promoter, and at least one vector comprising a nucleic acid sequence encoding tumor-CAR placed under the transcriptional control of an inducible promoter.

[0306] In another aspect, (a) at least one vector comprising a nucleic acid sequence encoding the FAP-CAR described herein placed between a left homology region and a right homology region, wherein the left homology region and the right homology region are homologous to a locus targeted by the endonuclease of (b), and (b) At least one sequence-specific endonuclease that targets one constitutively expressed gene locus, such as EF1A, CD52, GAPDH, hPGK, UBC, TRAC, TRBC, TRGC, TRDC, B2M, CD5, CS1, CD45, RPBSA, CD4, or CD8, and / or (c) At least one vector comprising a nucleic acid sequence encoding the tumor-CAR described herein, placed between a left homology region and a right homology region, wherein the left homology region and the right homology region are homologous to the locus targeted by the endonuclease of (d), and (d) At least one sequence-specific endonuclease that targets one inducible gene locus, such as PDCD1, CD25, TIM3, TIGIT, CCL1, NR4A3, EGR3, G0S2, IL22, RGS16, FASLG, RDH10, CSF1, GM-CSF, LAG3, CTLA-4, IL10, NUR77, or FOXP3 A kit is provided that includes.

[0307] In another aspect, (a) At least one vector comprising a nucleic acid sequence containing a constitutive promoter and a nucleic acid sequence encoding the FAP-CAR described herein operably linked to the promoter, and (b) At least one vector comprising a nucleic acid sequence containing an inducible promoter and a nucleic acid sequence encoding the tumor-CAR described herein operably linked to the promoter A kit is provided that includes.

[0308] In another aspect, (a) At least one vector comprising a nucleic acid sequence containing a constitutive promoter and a nucleic acid sequence encoding the FAP-CAR described herein operably linked to the promoter, and (b) At least one vector comprising a nucleic acid sequence encoding the tumor-CAR described herein, disposed between a left homology region and a right homology region, wherein the left homology region and the right homology region are homologous to a locus targeted by the endonuclease of (c). (c) At least one sequence-specific endonuclease that targets one inducible gene locus, such as PDCD1, CD25, TIM3, TIGIT, CCL1, NR4A3, EGR3, G0S2, IL22, RGS16, FASLG, RDH10, CSF1, GM-CSF, LAG3, CTLA-4, IL10, NUR77, FOXP3. A kit comprising the above is provided.

[0309] In still further embodiments, (a) At least one vector comprising a nucleic acid sequence encoding the FAP-CAR described herein, disposed between a left homology region and a right homology region, wherein the left homology region and the right homology region are homologous to a locus targeted by the endonuclease of (b), and (b) At least one sequence-specific endonuclease that targets one constitutively expressed gene locus, such as EF1A, CD52, GAPDH, hPGK, UBC, TRAC, TRBC, TRGC, TRDC, B2M, CD5, CS1, CD45, RPBSA, CD4, or CD8, and / or (c) At least one vector comprising a nucleic acid sequence comprising an inducible promoter and a nucleic acid sequence encoding the tumor-CAR described herein operably linked to the promoter. A kit comprising the above is provided.

[0310] In another embodiment, (a) At least one vector comprising a cassette comprising a constitutive promoter and a nucleic acid sequence encoding a FAP-CAR as described herein, operably linked to said promoter, wherein the cassette of (a) is placed between a left homology region and a right homology region, and the left homology region and the right homology region are homologous to a locus targeted by the endonuclease of (b), and (b) At least one sequence-specific endonuclease that targets a target gene locus, and / or (c) At least one vector comprising a cassette comprising an inducible promoter and a nucleic acid sequence encoding a tumor-CAR as described herein, operably linked to said promoter, wherein the cassette of (c) is placed between a left homology region and a right homology region, and the left homology region and the right homology region are homologous to a locus targeted by the endonuclease of (d), and (d) At least one sequence-specific endonuclease that targets a target gene locus A kit is provided that includes the above.

[0311] In this latter aspect, since the FAP-CAR and the tumor-CAR are under the control of a specific exogenous promoter, there is no limitation as to whether the target gene loci of (b) and (d) need to be inducible or need to be constitutively expressed. Thus, in this latter aspect, the target gene locus of (b) may be inducible or constitutively expressed, and the target gene locus of (d) may be inducible or constitutively expressed.

[0312] In some of the kits, the sequence-specific endonuclease of (b) is a TALE nuclease. In some cases, the TALE nuclease of (b) targets one endogenous constitutively expressed gene locus selected from the group consisting of EF1A, CD52, GAPDH, hPGK, UBC, TRAC, TRBC, TRGC, TRDC, B2M, CD5, CS1, CD45, RPBSA, CD4, and CD8. In some cases, the TALE nuclease of (b) targets one endogenous constitutively expressed gene locus selected from the group consisting of EF1A, TRAC, B2M, CD52, CS1, CD45, CD5, and GAPDH. In some cases, the TALE nuclease of (b) targets one endogenous constitutively expressed gene locus selected from the group consisting of EF1A, TRAC, B2M, and CD52.

[0313] In some of the kits, the sequence-specific endonuclease of (d) or (c) is a TALE nuclease.

[0314] In some cases, the TALE nuclease of (d) or (c) targets one inducible gene locus selected from the group consisting of PDCD1, CD25, TIM3, TIGIT, CCL1, NR4A3, EGR3, G0S2, IL22, RGS16, FASLG, RDH10, CSF1, GM-CSF, LAG3, CTLA-4, IL10, NUR77, and FOXP3.

[0315] In some cases, the TALE nuclease of (d) or (c) targets one inducible gene locus selected from the group consisting of PDCD1, CD25, GM-CSF, TIM3, and TIGIT.

[0316] In some cases, the TALE nuclease of (d) or (c) can target one inducible gene locus that is PDCD1.

[0317] In some cases, when the vector of the kit does not include a promoter that controls the transcription of the exogenous nucleic acid sequence contained in the vector, the transcription of the exogenous nucleic acid sequence is controlled by the endogenous promoter of the targeted endogenous locus after integration into the genome of the cell.

[0318] In some cases, when the vector of the kit includes a promoter that controls the transcription of the exogenous nucleic acid sequence contained in the vector, the transcription of the exogenous nucleic acid sequence is controlled by the exogenous promoter after integration into the genome of the cell. Activation and expansion of immune cells Regardless of whether before or after gene modification, the immune cells described herein can be activated or expanded even if they can be activated or proliferate independently of the antigen-binding mechanism. For example, T cells can be activated and expanded using the methods described in, for example, U.S. Patent Nos. 6,352,694, 6,534,055, 6,905,680, 6,692,964, 5,858,358, 6,887,466, 6,905,681, 7,144,575, 7,067,318, 7,172,869, 7,232,566, 7,175,843, 5,883,223, 6,905,874, 6,797,514, 6,867,041, and 7,572,631. T cells can be expanded in vitro or in vivo. T cells generally expand by contacting with an agent that stimulates the CD3 TCR complex and co-stimulatory molecules on the surface of the T cells, thereby generating an activation signal for the T cells. For example, chemical substances such as calcium ionophore A23187, phorbol 12-myristate 13-acetate (PMA), or mitogenic lectins such as phytohemagglutinin (PHA) can be used to generate an activation signal for T cells.

[0319] As a non-limiting example, a T cell population can be stimulated in vitro by contact with an anti-CD3 antibody, or an antigen-binding fragment of an anti-CD3 antibody, or an anti-CD2 antibody immobilized on a surface, or contact with a protein kinase C activator (e.g., bryostatin) combined with a calcium ionophore. For co-stimulation of accessory molecules on the surface of T cells, ligands that bind to the accessory molecules are used. For example, under conditions appropriate to stimulate the proliferation of T cells, a population of T cells can be contacted with an anti-CD3 antibody and an anti-CD28 antibody. Conditions appropriate for culturing T cells can include a suitable medium (e.g., Minimum Essential Medium or RPMI Medium 1640, or X-vivo 5 (Lonza)) containing factors necessary for growth and viability, such as serum (e.g., fetal bovine serum or human fetal serum), interleukin-2 (IL-2), insulin, IFN-g, IL-4, IL-7, GM-CSF, IL-10, IL-12, IL-15, TGFp, and TNF-, or other additives known to those skilled in the art for cell growth. Other additives for cell growth include, but are not limited to, surfactants, plasmanate, and reducing agents such as N-acetyl-cysteine and 2-mercaptoethanol. The medium can be serum-free or supplemented with an appropriate amount of serum (or plasma) or a defined set of hormones, and / or cytokines in an amount sufficient for T cell growth and expansion, and can include amino acids, sodium pyruvate, and vitamins added to RPMI 1640, A1M-V, DMEM, MEM, a-MEM, F-12, X-Vivo 1, and X-Vivo 20, OptTmizer. Antibiotics, such as penicillin and streptomycin, are included only in experimental cultures and not in cultures of cells to be injected into a subject. Target cells are maintained under conditions necessary to support growth, for example, at an appropriate temperature (e.g., 37°C) and atmosphere (e.g., air and 5% CO2). T cells exposed to different stimulation times can exhibit different characteristics.

[0320] In some cases, the cells may be expanded by co-culturing with tissues or cells. The cells may be expanded in vivo, for example, in the blood of a subject after administration of the cells to the subject.

[0321] For example, any biological activity exhibited by engineered immune cells expressing a CAR, including cytokine production and secretion, degranulation, proliferation, or any combination thereof, can be determined.

[0322] In some cases, the biological activity determined in step (iii) is cytokine secretion, cell proliferation, or both.

[0323] Biological activity can be measured by methods well known to those skilled in the art, such as in vitro and / or ex vivo methods.

[0324] The secretion of any cytokine can be measured, for example, the secretion of IFNγ and TNFα can be determined. Standard methods for determining cytokine secretion include ELISA and flow cytometry. These methods are described, for example, by Sachdeva et al. (Front Biosci, 2007, 12:4682 - 95) and Pike et al. (2016) (Methods in Molecular Biology, Vol. 1458, Humana Press, New York, NY).

[0325] The level of cytokine secretion can be measured, for example, as the maximum level of cytokine (e.g., IFNγ) secreted per CAR-expressing immune cell (e.g., CAR-T cell), for example, the maximum amount of IFNγ secreted per CAR-T cell.

[0326] To evaluate "degranulation", standard methods can be used, including, for example, CD107a degranulation assays, or measurement of secreted granzyme B or perforin (e.g., as described in Lorenzo-Herrero et al. (Methods Mol Biol (2019) 1884:119 - 130), Betts et al., Methods in Cell Biology (2004) 75:497 - 512).

[0327] To evaluate "proliferation" activity, standard methods can be performed, mainly based on methods including measurement of DNA synthesis, detection of proliferation-specific markers, measurement of continuous cell division using cell membrane-binding dyes, measurement of cell DNA content, and measurement of cell metabolism.

[0328] In some cases, the methods described herein enable the production of T cells engineered within a limited time frame of about 15 - 30 days, such as 15 - 20 days, or 18 - 20 days, such that the full immunotherapeutic potential of the cells, particularly with respect to their cytotoxic activity, is maintained.

[0329] These cells can be derived from, or be members of, cell populations that can originate from a single donor or patient, or be members of such cell populations. In some cases, these cell populations can be expanded under closed culture recipient in accordance with best manufacturing practice requirements and frozen prior to injection into the patient to provide a "ready-to-use" or "off-the-shelf" therapeutic composition.

[0330] In some cases, a significant number of cells can be obtained from the same leukapheresis, which can be important for obtaining sufficient doses to treat patients. Although differences can be observed between cell populations from different donors, the number of immune cells procured by leukapheresis is generally about 10 8 ~10 10cells. PBMCs contain several types of cells such as granulocytes, monocytes, and lymphocytes, of which 30-60% are T cells, which generally correspond to 10 8 ~10 9 primary T cells of an individual donor.

[0331] In some cases, the methods described herein generally result in a population of engineered cells that reach more than about 10 8 T cells, more generally more than about 10 9 T cells, even more generally more than about 10 10 T cells, usually more than 10 11 T cells. In some cases, the T cells are gene edited at at least two different loci.

[0332] Thus, such a composition of engineered cells or a population of engineered cells can be used as a therapeutic agent, inter alia, to treat any of the cancers herein, e.g., melanoma, neuroblastoma, glioma, or lung tumor, breast tumor, colon tumor, prostate tumor, or ovarian tumor in a patient in need of treatment, for the treatment of solid tumors in a patient such as a cancer tumor.

[0333] Also included herein are therapeutically effective immune cell populations comprising at least 30%, at least 50%, or at least 80% of the engineered cells described herein.

[0334] This document discloses a population of primary TCR-negative immune cells, such as T cells, derived from, for example, a single donor, wherein at least 20%, at least 30%, at least 50%, at least 90%, at least 95%, at least 96%, or at least 97% of the cells in said population have been genetically modified using sequence-specific reagents to be TCR-negative.

[0335] The term "TCR-negative immune cell" refers to immune cells such as T cells or NK cells in which the expression of TCR cannot be detected by standard antibody-based methods such as flow cytometry, Western blot, ELISA, etc. TCR-negative immune cells include immune cells in which two endogenous alleles encoding components of the T cell receptor have been genetically modified (e.g., disrupted), resulting in a state where the presence of TCR on the cell surface of the manipulated cells is suppressed and / or undetectable. TCR-negative immune cells also include immune cells that do not normally express the TCR gene in their unmanipulated, natural state, such as in the case of NK cells.

[0336] The term "CD52-negative immune cell" refers to immune cells such as T cells or NK cells in which the expression of CD52 cannot be detected by standard antibody-based methods such as flow cytometry, Western blot, ELISA, etc. CD52-negative immune cells include immune cells in which two endogenous alleles encoding CD52 have been genetically modified (e.g., disrupted), resulting in a state where the presence of CD52 on the cell surface of the manipulated cells is suppressed and / or undetectable.

[0337] The term "B2M-negative immune cell" refers to immune cells such as T cells or NK cells in which the expression of β2M cannot be detected by standard antibody-based methods such as flow cytometry, Western blot, ELISA, etc. B2M-negative immune cells include immune cells in which two endogenous alleles encoding β2M have been genetically modified (e.g., disrupted), resulting in a state where the presence of β2M on the cell surface of the manipulated cells is suppressed and / or undetectable.

[0338] The "PDCD1-negative immune cell" refers to an immune cell such as a T cell or an NK cell in which the expression of PD1 cannot be detected by standard antibody-based methods such as flow cytometry, Western blot, and ELISA. The PDCD1-negative immune cells include immune cells in which two endogenous alleles encoding PD1 have been genetically modified (e.g., disrupted), resulting in a state where the presence of PD1 on the cell surface of the manipulated cells is suppressed and / or undetectable.

[0339] The "GM-CSF-negative immune cell" refers to an immune cell such as a T cell or an NK cell in which the expression of GM-CSF cannot be detected by standard antibody-based methods such as flow cytometry, Western blot, and ELISA. The GM-CSF-negative immune cells include immune cells in which two endogenous alleles encoding GM-CSF have been genetically modified (e.g., disrupted), resulting in a state where the presence of GM-CSF on the cell surface of the manipulated cells is suppressed and / or undetectable.

[0340] Methods of treatment and products for use in immunotherapy One aspect relates to a pharmaceutical composition comprising a therapeutically effective amount of the immune cells described herein.

[0341] Also described herein are compositions comprising a therapeutically effective amount of the immune cells described herein for use in the treatment of cancers such as cancers characterized by the presence of FAP in the tumor microenvironment.

[0342] Also contemplated herein are methods of treating cancers such as cancers characterized by the presence of FAP in the tumor microenvironment, comprising administering a therapeutically effective amount of the engineered immune cells described herein.

[0343] The cancers that can be treated by the compositions, cells, or methods of treatment described herein are not limited.

[0344] The cancer can be a solid tumor or a blood cancer.

[0345] The cancer expressing a solid tumor antigen can be selected from any one of breast cancer, ovarian cancer, endometrial cancer, cervical cancer, bladder cancer, kidney cancer, melanoma, lung cancer, prostate cancer, testicular cancer, thyroid cancer, brain cancer, esophageal cancer, gastric cancer, pancreatic cancer, colorectal cancer, or liver cancer.

[0346] Examples of the cancer expressing a solid tumor antigen include breast cancer (e.g., triple-negative breast cancer), pancreatic cancer, and lung cancer (e.g., malignant pleural mesothelioma).

[0347] The blood cancer characterized by the presence of FAP in the tumor microenvironment can be selected from the group consisting of myelofibrosis, myelodysplastic syndrome, acute myeloid leukemia, non-Hodgkin lymphoma, and multiple myeloma.

[0348] All of the above cancers can be treated by the engineered immune cells or pharmaceutical compositions described herein.

[0349] The cancers that are advantageously treated by the engineered immune cells or pharmaceutical compositions described herein are cancers in which the targeted tumor antigen is also present in normal healthy tissues.

[0350] In some cases, the cancer is ovarian cancer, and the tumor antigen is selected from one or more of mesothelin, glycoprotein 72 (TAG72), MUC16, Her2, 5T4, and FRα.

[0351] In some cases, the cancer is breast cancer, and the tumor antigen is selected from one or more of MUC28z, NKG2D, HRG1β, and HER2.

[0352] In some cases, the cancer is prostate cancer, and the tumor antigen is selected from one or more of prostate stem cell antigen (PSCA) and prostate-specific membrane antigen (PSMA).

[0353] In some cases, the cancer is renal cancer and the tumor antigen is carbonic anhydrase-IX (CA-IX).

[0354] In some cases, the cancer is gastric cancer and the tumor antigen is selected from one or more of Trop2, Claudin 18.2, NKG2D, folate receptor 1 (FOLR1), and HER2.

[0355] In some cases, the cancer is pancreatic cancer and the tumor antigen is selected from one or more of mesothelin, MUC1, CXCR2, B7-H3, CD133, CD24, PSCA, CEA, and Her-2.

[0356] In some cases, the cancer is lung cancer and the tumor antigen is selected from one or more of mesothelin, receptor tyrosine kinase-like orphan receptor 1 specific (ROR1), EGFRvIII, erythropoietin-producing hepatocellular carcinoma A2 (EphA2), PSCA, MUC1, and DLL3.

[0357] In some cases, the cancer is liver cancer and the tumor antigen is selected from one or more of MUC1, CEA, glypican-3, and epithelial cell adhesion molecule (EPCAM).

[0358] In some cases, the cancer is colorectal cancer and the tumor antigen is selected from one or more of MUC1, NKG2D, CD133, GUCY2C (guanylate cyclase 2C), TAG-72 doublecortin-like kinase 1 (DCLK1), and CEA.

[0359] In some cases, the blood cancer is myelofibrosis and the tumor antigen is CALR.

[0360] In some cases, the blood cancer is myelodysplastic syndrome and the tumor antigen is selected from one or more of CD123, CD33, and NKG2D.

[0361] In some cases, the blood cancer is acute myeloid leukemia, and the tumor antigen is selected from one or more of CD123, CLL-1, IL1RAP, CD33, CD135, CD70, CD44, CD276, ILT3, CD7, CD47, TIM3, CD96, and VISTA.

[0362] In some cases, the blood cancer is acute lymphoblastic leukemia, and the tumor antigen is selected from one or more of CD19, CD22, CD79a, CD10, CD2, CD3, CD4, CD5, CD7, CD8, CRLF2, and CD38.

[0363] In some cases, the blood cancer is non-Hodgkin lymphoma, and the tumor antigen is selected from one or more of CD19, CD20, CD22, CD80, CD37, CD79, CD30, CD70, and CD38.

[0364] In some cases, the blood cancer is multiple myeloma, and the tumor antigen is selected from one or more of BCMA, CD19, CD138, CS1, CD38, TACI, APRIL, GPRC5D, and CD44v6.

[0365] The treatment using the engineered primary immune cells described in this document can be remission-inducing, curative, or preventive.

[0366] In some cases, the patient may receive preconditioning lymphodepletion (temporary depletion of the immune system) before administration of the engineered T cells. In some cases, the lymphodepletion is only a partial depletion of the patient's immune system and not a complete depletion. In some cases, the combination of IL-2 treatment and preconditioning lymphodepletion may enhance the persistence of the cell therapy agent.

[0367] In some cases, the engineered immune cells such as the T cells described in this document, regardless of the course of lymphodepletion by administration of, for example, cyclophosphamide and / or fludarabine, and / or alemtuzumab, about 10 6 ~10 9It can be administered in an amount of cells / kg.

[0368] In some cases, cells or cell populations containing engineered immune cells such as T cells described in this document are about 10 cells per kg of body weight 4 ~10 9 cells, about 10 cells 5 ~5×10 6 cells / kg body weight, or about 10 cells 5 ~10 6 cells / kg body weight (including all integer values of cell numbers within these ranges). Dosing in CAR-T cell therapy is, for example, 10 cells or 10 5 cells or 10 6 ~10 9 cells / kg administration, and may include, for example, a course of lymphodepletion with fludarabine, cyclophosphamide or alemtuzumab, or any combination thereof, regardless of the presence or absence.

[0369] Cells or cell populations can be administered in one or more doses. In some cases, an effective amount of cells is administered as a single dose. In some cases, an effective amount of cells is administered as multiple doses over a period of time. The timing of administration is within the discretion of the attending physician and is determined by the patient's clinical condition. Cells or cell populations can be obtained from any source, such as a blood bank or donor. Individual needs vary, but determining the optimal range of effective amounts of specific cell types for specific diseases or conditions is within the scope of the skills of those skilled in the art.

[0370] The effective amount of engineered immune cells such as CAR-T cells means an amount that provides a therapeutic or prophylactic benefit. The dosage administered is determined by the recipient's age, health status, and weight, the type of concurrent treatment if any, the frequency of treatment, and the nature of the desired effect.

[0371] The treatment with engineered immune cells described in this book can be further combined with one or more therapies for cancer selected from the group consisting of antibody therapy, chemotherapy, cytokine therapy, dendritic cell therapy, gene therapy, hormone therapy, laser phototherapy, and radiation therapy.

[0372] For example, the treatment with engineered immune cells described in this book can be combined with the administration of an immune checkpoint antagonist that can be intravenously administered in an amount of about 200 mg to 400 mg (including all integer values within these ranges).

[0373] Regarding engineered T cells that contain an inactivated TCR, constitutively express FAP-CAR, and express tumor-CAR upon activation of the T cells, what is described in this book can equally apply to engineered NK cells that constitutively express FAP-CAR and express tumor-CAR upon activation of natural killer cells.

[0374] Such engineered NK cells are necessarily TCR-negative. The NK cells described in this book can be donor-derived or cell line-derived, such as the NK92 cell line. In some cases, the engineered NK cells are derived from engineered iPSCs described in this book that have been differentiated into NK cells.

[0375] Optionally, the engineered NK cells have reduced expression of the B2M gene mediated by gene inactivation and / or gene silencing and / or insertion of at least one exogenous polynucleotide encoding a CAR as defined in this book into the β2M locus of the genome of the NK cells.

[0376] The engineered NK cells may have reduced expression of the CD52 gene mediated by gene inactivation and / or gene silencing and / or insertion of at least one exogenous polynucleotide encoding a CAR as defined in this book into the CD52 locus of the genome of the NK cells.

[0377] In some cases, the engineered NK cells contain either the inactivated CD52 gene or the B2M gene.

[0378] Therefore, in this document, a) an exogenous nucleic acid sequence encoding a chimeric antigen receptor (CAR) that targets fibroblast activation protein (FAP) ( "FAP-CAR") under the transcriptional control of an exogenous or endogenous constitutive promoter, and b) an exogenous nucleic acid sequence encoding a chimeric antigen receptor (CAR) that targets a tumor antigen ( "tumor-CAR") under the transcriptional control of an exogenous or endogenous inducible promoter are provided, which are engineered NK cells, wherein the exogenous nucleic acid sequences a) and b) are integrated into the genome of the cell, the expression of tumor-CAR is inducible upon activation of the NK cells, Optionally, engineered NK cells are also provided, wherein the NK cells are genetically modified to suppress or inhibit the expression of at least one gene that controls MHC complex surface presentation, such as B2M or CIITA, in NK cells.

[0379] Similar FAP-CARs and tumor-CARs as described in this document can be expressed in the NK cells to produce engineered FAP / tumor-CAR-NK, which can be used in a method for treating cancers characterized by the presence of FAP in the tumor microenvironment, such as solid tumors and blood cancers, as described in this document.

[0380] Therefore, in this document, a pharmaceutical composition is also described that includes (i) an exogenous nucleic acid sequence encoding FAP-CAR under the transcriptional control of an exogenous or endogenous constitutive promoter, (ii) an exogenous nucleic acid sequence encoding tumor-CAR under the transcriptional control of an exogenous or endogenous inducible promoter, and (iii) optionally, an inactivated β2M gene, and includes engineered NK cells.

[0381] Still other aspects described herein are pharmaceutical compositions as described above for use in the treatment of cancer characterized by the presence of FAP in the tumor microenvironment such as solid tumors and blood cancers, wherein the exogenous nucleic acid sequences a) and b) are integrated into the genome of the cell and the expression of the tumor-CAR is inducible upon activation of NK cells.

[0382] The above description provides means and processes for making and using the present invention, enabling its making and use by those skilled in the art, and this enablement is provided in particular with respect to the subject matter of the appended claims which form part of the original description.

[0383] When numerical limits or ranges are described herein, both endpoints are included. Also, all values and subranges within the numerical limits or ranges are specifically included as if explicitly written out.

[0384] Based on the general description of the present invention, further understanding can be obtained by referring to specific specific examples, but the examples are presented herein for illustrative purposes only and are not intended to limit the scope of the claimed invention.

Examples

[0385] Example 1: Materials TALE nuclease targeting TRAC, PDCD1, or CS1 TALEN-mRNAs targeting TRAC (SEQ ID NO: 74 and SEQ ID NO: 75), TALEN-mRNAs targeting PDCD1 (SEQ ID NO: 72 and SEQ ID NO: 73), or TALEN-mRNAs targeting CS1 (SEQ ID NO: 82 and SEQ ID NO: 83) were produced by Trilink.

[0386] AAV construct The FAP-CAR construct was inserted into the AAV vector in-frame with the TRAC locus and peptide 2A. The TRAC-FAP-CAR donor matrix consists of a 300-bp TRAC left homology arm and a TRAC right homology arm, and a self-cleaving 2A peptide that enables the expression of FAP-CAR (SEQ ID NO: 111).

[0387] The mesothelin-CAR (“Meso-CAR”) construct was inserted into the AAV vector together with peptide 2A in-frame with the PDCD1 locus. The PDCD1-Meso-CAR donor matrix consists of a 300-bp PDCD1 left homology arm and a PDCD1 right homology arm, and a self-cleaving 2A peptide that enables the expression of Meso-CAR. Further, following Meso-CAR is an EF1A promoter that drives the PDCD1-independent expression of the truncated surface protein DLNGFR. Thus, DLNGFR expression is used as a reporter for matrix insertion at the PDCD1 locus and for the cell enrichment method described below (SEQ ID NO: 112).

[0388] AAV particles containing either the TRAC-FAP-CAR vector or the PDCD1-Meso-CAR vector were produced by Vigene.

[0389] rLV construct Using a recombinant lentiviral vector containing the FAP-CAR coding sequence (SEQ ID NO: 113) under the EF1A promoter, the FAP-CAR expression cassette was randomly inserted into the genome. Lentiviral particles were produced by Flash Therapeutics.

[0390] Example 2: Generation of CAR-T cells with constitutive expression of FAP-CAR and inducible expression of Meso-CAR by AAV transduction This example describes the generation of universal CAR-T cells with constitutive expression of FAP-CAR and inducible expression of Meso-CAR. The FAP-CAR construct was inserted at the endogenous TRAC locus, while the Meso-CAR construct was inserted at the endogenous PDCD1 locus. Expression of FAP-CAR and Meso-CAR was driven by the endogenous TRA promoter and PDCD1 promoter, respectively (A, B, and C in FIG. 2).

[0391] Engineered CAR-T cells To constitutively express FAP-CAR on the surface of primary T cells, cryopreserved PBMCs were thawed at 37°C, washed, and resuspended in OpTmizer medium supplemented with AB human serum (5%), and incubated overnight at 37°C in a 5% CO2 incubator. Subsequently, the cells were activated with TransAct in OpTmizer medium (culture medium) supplemented with AB human serum (5%) and recombinant human interleukin-2 (rhIL-2, 350 IU / ml) in a CO2 incubator. Three days after activation, T cells were electroporated using 5 μg each of mRNA encoding a Talen™ arm specific for TRAC (SEQ ID NO: 74 and SEQ ID NO: 75) and mRNA encoding a Talen™ arm specific for PDCD1 (SEQ ID NO: 72 and SEQ ID NO: 73). Transfection was performed using the Pulse Agile technique by applying two pulses of 800 V for 0.1 mS and then four pulses of 130 V for 0.2 mS in a 0.4 cm gap cuvette in Cytoporation buffer T (BTX Harvard Apparatus, Holliston, Massachusetts). Subsequently, the electroporated cells were immediately transferred into pre-warmed OpTmizer serum-free medium and incubated at 37°C for 15 minutes. Then, the cells were concentrated and incubated in the presence of TRAC-FAP-CAR AAV particles (MOI = 1.1E5 vg / cell) and PDCD1-Meso-CAR AAV particles (MOI = 7.5E4 vg / cell) containing the donor matrices shown in B and C of Figure 2, respectively. After culturing at 30°C for 2 hours, OpTmizer medium supplemented with 10% AB serum and IL-2 was added to the cell suspension, and the mixture was incubated for 16 hours under the same culture conditions. Thereafter, the cells were cultured at 37°C in the presence of 5% CO2.

[0392] Enrichment of PDCD1-Meso-CAR-T by magnetic selection of DLNGFR-positive cells As described above, cells in which the Meso-CAR matrix was integrated at the PDCD1 locus express a non-functional truncated LNGFR (DLNGFR) protein on the surface. Positive selection of DLNGFR-positive T cells was performed by magnetic selection using MACSelect (trademark) LNGFR microbeads according to the manufacturer's protocol (Miltenyi). Positive selection of DLNGFR+ cells (A in Figure 3) resulted in significant enrichment of PDCD1-integrated Meso-CAR-T cells as measured by ddPCR (B in Figure 3). These cells were then analyzed by flow cytometry for TRAC knockout, FAP-CAR expression (A in Figure 4-1), and Meso-CAR expression after 24-hour activation with PMA (20 μM) / ionomycin (800 ng / ml) (B in Figure 4-2). More than 90% TRAC knockout could be achieved, and more than 50% of the edited T cells expressed FAP-CAR (A in Figure 4-1). Furthermore, PDCD1-positive cells were reduced from 18% (Mock control) to 2 - 5% (B in Figure 4-2).

[0393] Example 3: Generation of CAR-T cells with constitutive expression of FAP-CAR by lentiviral transduction and inducible expression of Meso-CAR by AAV-mediated targeted integration T cells were electroporated with TALENs to knockout the TRAC gene and the PDCD1 gene, and transduced with a lentivirus for constitutively expressing a CAR against the FAP protein and an AAV for targeted integration of Meso-CAR at the PDCD1 locus.

[0394] To express FAP-CAR on the surface of primary T cells, cryopreserved PBMCs were thawed at 37°C, washed, and resuspended in OpTmizer medium supplemented with AB human serum (5%), and incubated overnight at 37°C in a 5% CO2 incubator. Subsequently, the cells were activated with Transact in OpTmizer medium (culture medium) supplemented with AB human serum (5%) and recombinant human interleukin-2 (rhIL-2, 350 IU / ml) in a CO2 incubator. On the same day as activation, T cells were transduced with lentiviral particles containing anti-FAP CAR (SEQ ID NO: 113 (Table 2, CLSFAP1-CAR)) expressed under the control of the EF1A promoter at an MOI of 10.

[0395] Four days after transduction, FAP-CAR-T cells were electroporated using 5 μg each of Talen (registered trademark) arm mRNA specific for TRAC (SEQ ID NO: 74 and SEQ ID NO: 75) or Talen (registered trademark) arm mRNA specific for PDCD1 (SEQ ID NO: 72 and SEQ ID NO: 73). Transfection was performed using Pulse Agile technology by applying two pulses of 800 V for 0.1 mS and then four pulses of 130 V for 0.2 mS in a 0.4 cm gap cuvette in Cytoporation Buffer T (BTX Harvard Apparatus, Holliston, Massachusetts). Subsequently, the electroporated cells were immediately transferred to pre-warmed Optmizer serum-free medium and incubated at 37°C for 15 minutes. Then, the cells were concentrated and incubated in the presence of PD1-Meso-CAR AAV particles (MOI = 7.5E4 vg / cell) containing the donor matrix shown in C of Figure 2. After culturing at 30°C for 2 hours, OpTmizer medium supplemented with 10% AB serum and IL-2 was added to the cell suspension, and the mixture was incubated for 16 hours under the same culture conditions. Thereafter, the cells were cultured at 37°C in the presence of 5% CO2.

[0396] Enrichment of PD1-MesoCAR-T cells by magnetic selection of DLNGFR-positive cells As described above, cells in which the Meso-CAR matrix was integrated at the PDCD1 locus express a non-functional truncated LNGFR (DLNGFR) protein on the surface. Positive selection of DLNGFR-positive T cells was performed by magnetic selection using MACSelect (trademark) LNGFR microbeads according to the manufacturer's protocol (Miltenyi). Positive selection of DLNGFR+ cells resulted in significant enrichment of PDCD1-integrated Meso-CAR-T cells as measured by ddPCR (Figure 5). These cells were then analyzed for TRAC knockout, FAP-CAR expression, and Meso-CAR expression 24 hours after activation by overnight incubation in 12-well tissue culture plates coated with 1 mg / ml of FAP protein (LakePharma) (Figure 6). Importantly, Meso-CAR was not detectable, but the sequence of Meso-CAR was targeted at the PDCD1 locus, but in the absence of FAP-CAR. On the other hand, when FAP-CAR was constitutively expressed, FAP protein was able to induce Meso-CAR expression in 14% of the edited T cells. This clearly shows tight control of Meso-CAR expression upon FAP activation. Surprisingly, FAP-CAR T cells and Meso-CAR T cells were not co-expressed.

[0397] Example 4: Cytotoxic activity of CAR-T cells with constitutive expression of FAP-CAR and inducible expression of Meso-CAR This example shows that combining constitutive expression of FAP-CAR with inducible expression of a tumor antigen-targeted CAR enhances specific killing of tumor cells. Enriched engineered T cells generated in Example 2 were used.

[0398] Seeding of tumor-CAF spheroids A three-dimensional spheroid model of mesothelin-expressing triple-negative breast cancer (TNBC) cells and TNBC-derived FAP-expressing CAF cells was established. This model allows mimicking of the tumor microenvironment, including the spatial organization and properties of the actual tumor. 10 cells transduced to express GFP and the reporter gene nanoluciferase 4Individual mesothelin-expressing HCC70 cells (HCC70-NL-GFP) were seeded at a ratio of 2:1 with TNBC-derived CAFs in DMEM + 10% FBS medium on low-attachment 96-well round-bottom plates. Under these conditions, tumor cells and CAF cells self-organize into spheroids that mimic in vivo tumor characteristics.

[0399] TRAC against tumor-CAF spheroids FAPCAR PDCD1 MesoCAR Cytolytic activity of T cells TRAC against HCC70-NL-GFP tumor cells in tumor-CAF spheroids FAPCAR PDCD1 MesoCAR The cytolytic activity of T cells (as described in Example 2) was determined 2 days after spheroid seeding by adding TRAC FAPCAR PDCD1 MesoCAR to the spheroids plated as described above at a tumor cell:CAR-T ratio of 1:2. TRAC KO PDCD1 KO , TRAC FAPCAR PDCD1 KO , and TRAC KO PDCD1 MesoCAR were used as controls. After 72 hours of co-incubation with different edited T cells, lysis of HCC70-NL-GFP was determined by imaging the spheroids with Incucyte ZOOM and analyzed for GFP expression (Figure 7). From the assay, i) the activity of TRAC FAPCAR PDCD1 KO was improved compared to TRAC KO PDCD1 MesoCAR , and ii) the absence of activity of TRAC KO PDCD1 MesoCAR or TRAC KO PDCD1 KO was shown, demonstrating a stringent CAR-inducible system. Finally, the highest killing was observed with TRAC FAPCAR PDCD1 MesoCAR (Panel A of Figure 7).

[0400] Furthermore, TRAC FAPCARPDCD1 KO T cells and TRAC FAPCAR PDCD1 MesoCAR Only slight killing of HCC70-NL-GFP alone spheroids was observed in both T cells and PDCD1 (B in Figure 7), indicating that the killing of tumor cells observed in the presence of CAF is mediated by Meso-CAR. Therefore, FAP + The presence of CAF is necessary for the expression and activity of Meso-CAR. Therefore, this strategy + localizes anti-mesothelin CAR-T activity only to tumors containing CAF, enabling reduction of "on-target, off-tumor" cytotoxicity. Furthermore, since CAF is known to be tumor-promoting, CAF cytotoxicity combined with killing of tumor cells is a strategy to rapidly inhibit tumor promotion.

[0401] Example 5: In vivo safety measurement To demonstrate that this strategy increases in vivo anti-tumor activity while reducing "on-target, off-tumor" cytotoxicity, human mesothelioma cell line NCI-H226 ("NCI-H226 tumor alone") and NCI-H226 cells mixed with FAP protein-expressing NCI-H226 cells ("NCI-H226-FAP") are implanted subcutaneously into the left flank of immunodeficient NSG mice at a ratio of 4:1. NCI-H226 tumor alone in this system mimics the "on-target, off-tumor" site. CAR-T cells engineered as in Example 1 or Example 2 are injected into the mice. TRAC FAPCAR PDCD1 MesoCAR T cells show maximum cytotoxic activity against NCI-H226-FAP tumors but only slight killing activity against NCI-H226 tumor alone in the same mice.

[0402] Example 6: Identification of some inducible promoters upon CAR-T cell activation Anti-CS1-CART cells were produced using the 18-day process described briefly below.

[0403] Human PBMCs were thawed and activated using TransAct beads. Three days later, the cells were electroporated with mRNA encoding a TRAC-specific TALE nuclease (SEQ ID NO: 74 and SEQ ID NO: 75) and a CS1-specific TALE nuclease (SEQ ID NO: 82 and SEQ ID NO: 83). Two days later, the cells were transduced with a lentiviral vector driving the expression of a CS1-specific second-generation CAR (SEQ ID NO: 96), followed by an in vitro expansion step and magnetic depletion of the remaining alpha / beta TCR-positive cells. At the end of the production process, the CAR-T cells were filled into vials and cryopreserved.

[0404] A portion of the CS1-CAR-T cells was thawed, and CAR+ T cells were selected by flow-activated cell sorting (FACS) using a CAR-specific reagent (“inactivated cell sample”).

[0405] In parallel, another portion of the CS1-CAR-T cells was thawed and activated using plate-bound CS1 recombinant protein (SEQ ID NO: 97). Twenty-four hours after activation, CAR+ T cells were selected by FACS (“activated cell sample”).

[0406] Inactivated and activated samples obtained from two independent donors were analyzed by RNA-seq.

[0407] To identify genes induced by activation, genes with a maximum expression level at 0 hours lower than 100 TPM (transcripts per million kilobases), a minimum expression level at 24 hours higher than 50 TPM, and a fold change between the average expression at 0 hours and the average expression at 24 hours greater than 5 were selected.

[0408] These criteria led to the identification of 159 genes (shown in Figure 8). From this literature-based list, we identified genes that have a detrimental effect on T cell proliferation, tumor infiltration, or function. Some of them are shown in Table 7.

Table 7

[0409] Example 7: In vivo FAP-CAR;TRAC KO PDCD1 Meso-CAR Measurement of "on-tumor" cytolytic activity and bystander cytolytic activity of T cells To evaluate the in vivo activity and safety of our inducible dual CAR T cell approach, we developed a mouse bilateral tumor model with an "on-tumor" site that is positive for both FAP and mesothelin and an "off-tumor" site that is FAP-negative and mesothelin-positive. First, 5×10 6 human mesothelioma cell line NCI-H226 expressing the tumor antigen mesothelin ("NCI-H226 tumor") were implanted subcutaneously in the left flank of immunodeficient NSG mice, and 5×10 6 NCI-H226 expressing the tumor antigens mesothelin and FAP protein at a 50% cell presence ratio ("NCI-H226-FAP 50% tumor") were implanted subcutaneously in the right flank (A in Figure 9-1). The "NCI-H226 tumor" in this system mimics an "on-target, off-tumor" site.

[0410] Next, 15×10 6 CAR + T cells engineered as in Example 1 or Example 2 were injected intravenously into the mice (B in Figure 9-1). Seven days later (D7), some of these mice were euthanized, the tumors were excised, and processed into single cell suspensions by digestion with Accutase at 37°C for 15 minutes. Flow cytometry analysis of the tumor cell suspensions revealed significant accumulation of CD45 KO PDCD1 KO T cells and FAP-CAR;TRAC KO PDCD1 Meso-CAR T cells in both the NCI-H226 tumor and the NCI-H226-FAP 50% tumor of mice treated with these cells (C in Figure 9-1). Notably, in the NCI-H226-FAP of both treatment groups + cells 50%There are far more CD45 + cells in tumors, which show antigen-driven expansion. These CD45 + cells were further analyzed for mesothelin-CAR expression. As expected, Meso-CAR expression was higher in FAP-CAR;TRAC KO PDCD1 Meso-CAR T cells-treated mice NCI-H226-FAP 50% CD45 in tumors + cells only, significantly detected compared to background expression in tumors of FAP-CAR;TRAC KO PDCD1 KO T cells-treated mice NCI-H226-FAP 50% tumors (D in Figure 9-1). Meso-CAR expression in CD45 KO PDCD1 Meso-CAR cells in NCI-H226 tumors of FAP-CAR;TRAC + PDCD1

[0411] The remaining mouse cohorts were further monitored for tumor growth over 3 more weeks. During the study, only treatment with FAP-CAR;TRAC KO PDCD1 Meso-CAR T cells resulted in significant regression of NCI-H226-FAP 50% tumors, indicating increased cytotoxicity due to co-expression of both FAP-CAR and Meso-CAR in these tumors (E in Figure 9-2). Furthermore, NCI-H226 tumors in FAP-CAR;TRAC KO PDCD1 Meso-CAR T cell-treated mice showed no growth reduction compared to all other treatment groups (F in Figure 9-2). In summary, our study demonstrated that dual-inducible FAP-CAR;TRAC KO PDCD1 Meso-CARDemonstrate the enhanced cytotoxic activity of the T cells and establish the safety of the T cells, as observed by the minimal bystander killing of FAP-negative, mesothelin-positive NCI-H226 tumors in the same mice.

Claims

1. a) An exogenous nucleic acid sequence encoding a chimeric antigen receptor (CAR) ("FAP-CAR") that targets fibroblast-activating protein (FAP) under the transcriptional regulation of a constitutive promoter, b) Exogenous nucleic acid sequences encoding chimeric antigen receptors (CARs) ("tumor-CARs") that target tumor antigens under the transcriptional regulation of an inducible promoter, and Manipulated immune cells including, Engineered immune cells in which the exogenous nucleic acid sequences a) and b) are integrated into the genome of the cells, and the expression of the tumor-CAR can be induced upon activation of the immune cells.

2. a) The constitutive promoter is selected from the group consisting of EF1A promoter, CD52 promoter, GAPDH promoter, CMV promoter, hPGK promoter, UBC promoter, SV40 promoter, PGK promoter, CAGG promoter, TRAC promoter, TRBC promoter, TRGC promoter, TRDC promoter, B2M promoter, CD5 promoter, CS1 promoter, CD45 promoter, RPBSA promoter, CD4 promoter, and CD8 promoter, and / or b) The inducible promoter is selected from the group consisting of the PDCD1 promoter, CD25 promoter, TIM3 promoter, TIGIT promoter, CCL1 promoter, NR4A3 promoter, EGR3 promoter, G0S2 promoter, IL22 promoter, RGS16 promoter, FASLG promoter, RDH10 promoter, CSF1 promoter, GM-CSF promoter, LAG3 promoter, CTLA-4 promoter, IL10 promoter, NUR77 promoter, FOXP3 promoter, and NFAT-responsive element. The manipulated immune cells according to claim 1.

3. The manipulated immune cells according to claim 1 or 2, wherein the immune cells are primary immune cells such as macrophages, natural killer cells, or T cells, and the T cells are inflammatory T lymphocytes, cytotoxic T lymphocytes, or helper T lymphocytes.

4. The aforementioned immune cells, (i) - To suppress or inhibit the expression of at least one gene encoding a component of the T cell receptor (TCR), such as the TCRα gene, the TCRβ gene, or the TCRα gene and the TCRβ gene; and / or - To suppress or inhibit the expression of at least one gene encoding an MHC-I protein selected from β2m and HLA; and / or - To suppress or inhibit the expression of genes encoding immune checkpoint proteins and / or receptors for immune checkpoint proteins; and / or - To confer resistance to at least one immunosuppressant or chemotherapy agent. and, (ii) Optionally, include the suicide gene, Genetically modified, engineered immune cells according to claim 1 or 2.

5. The manipulated immune cells according to claim 1 or 2, wherein the immune cells are one or more of the following: TCR-negative, B2M-negative, PDCD1-negative, and CD52-negative.

6. The manipulated immune cells according to claim 1 or 2, wherein the tumor antigen targeted by the tumor-CAR is an antigen present in a solid tumor or hematological malignancy, and the tumor or malignancy is characterized by the presence of FAP in the tumor or malignancy microenvironment.

7. The tumor antigens mentioned above are CEA, ERBB2, EGFR, GD2, mesothelin, MUC1, PSMA, GD2, PSMA1, LAP3, ANXA3, TAG72, MUC16, 5T4, FRα, MUC28z, NKG2D, HRG1β, PSCA, PSMA, CA-IX, Trop2, Claudin 18.2, FOLR1, CXCR2, B7-H3, CD133, CD24, ROR1, EGFR, EGFRvIII, VEGF, Eph The engineered immune cells according to claim 1 or 2, wherein the antigens present in both solid tumors and some normal healthy tissues are A2, DLL3, glypican-3, EpCAM, GUCY2C, DCLK1, HER receptors HER1, HER2, HER3, HER4, PEM, A33, G250, carbohydrate antigens Ley, Lex, Leb, STEAP1, CD166, CD24, CD44, E-cadherin, SPARC, or ErbB3.

8. The aforementioned FAP-CAR, (a1) An extracellular FAP-binding domain comprising the VH and VL amino acid sequences of a monoclonal anti-FAP antibody, (b1) A hinge selected from the FcγRIII hinge, CD8α hinge, and IgG1 hinge, (c1) A transmembrane domain including a CD8α transmembrane domain or a CD28 transmembrane domain, (d1) (i) A cytoplasmic domain containing a CD3 zeta signaling domain, and optionally (ii) a 4-1BB or CD28 costimulatory domain Including, and / or The aforementioned tumor-CAR (a2) An extracellular tumor antigen binding domain comprising the VH and VL amino acid sequences of a monoclonal antitumor antigen antibody, (b2) A hinge selected from the FcγRIII hinge, CD8α hinge, and IgG1 hinge, (c2) A transmembrane domain including a CD8α transmembrane domain or a CD28 transmembrane domain, (d2) (i) a cytoplasmic domain including a CD3 zeta signaling domain and (ii) a 4-1BB or CD28 co-stimulatory domain The manipulated immune cells according to claim 1 or 2, comprising:

9. The aforementioned FAP-CAR, (1) A VH comprising an amino acid sequence having at least 80%, at least 90%, at least 95%, or at least 99% identity with the variable heavy chain (VH) of SEQ ID NO: 7, and containing the H-CDR of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3; and a VL comprising an amino acid sequence having at least 80%, at least 90%, at least 95%, or at least 99% identity with the variable light chain (VL) of SEQ ID NO: 8, and containing the L-CDR of SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO:

6. (2) A VH comprising an amino acid sequence having at least 80%, at least 90%, at least 95%, or at least 99% identity with the variable heavy chain (VH) of SEQ ID NO: 18, and containing the H-CDR of SEQ ID NO: 12, SEQ ID NO: 13, and SEQ ID NO: 14, and a VL comprising an amino acid sequence having at least 80%, at least 90%, at least 95%, or at least 99% identity with the variable light chain (VL) of SEQ ID NO: 19, and containing the L-CDR of SEQ ID NO: 15, SEQ ID NO: 16, and SEQ ID NO: 17, (3) A VH having an amino acid sequence that is at least 80%, at least 90%, at least 95%, or at least 99% identical to the variable heavy chain (VH) of SEQ ID NO: 29, and containing the H-CDR of SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, and a VL having an amino acid sequence that is at least 80%, at least 90%, at least 95%, or at least 99% identical to the variable light chain (VL) of SEQ ID NO: 30, and containing the L-CDR of SEQ ID NO: 26, SEQ ID NO: 27, and SEQ ID NO: 28, or (4) A VH containing an amino acid sequence having at least 80%, at least 90%, at least 95%, or at least 99% identity with the variable heavy chain (VH) of SEQ ID NO: 40, and containing the H-CDR of SEQ ID NO: 34, SEQ ID NO: 35, and SEQ ID NO: 36; and a VL containing an amino acid sequence having at least 80%, at least 90%, at least 95%, or at least 99% identity with the variable light chain (VL) of SEQ ID NO: 41, and containing the L-CDR of SEQ ID NO: 37, SEQ ID NO: 38, and SEQ ID NO:

39. The manipulated immune cell according to claim 1 or 2, comprising an extracellular FAP-binding domain.

10. The aforementioned tumor-CARs are CEA, ERBB2, EGFR, GD2, mesothelin, MUC1, PSMA, GD2, PSMA1, LAP3, ANXA3, TAG72, MUC16, 5T4, FRα, MUC28z, NKG2D, HRG1β, PSCA, PSMA, CA-IX, Trop2, Claudin 18.2, FOLR1, CXCR2, B7-H3, CD133, CD24, ROR1, EGFR, EGFRvIII, VEGF, Ep The engineered immune cell according to claim 1 or 2, comprising an extracellular binding domain that targets a tumor antigen selected from the group consisting of hA2, DLL3, glypican-3, EpCAM, GUCY2C, DCLK1, HER receptors HER1, HER2, HER3, HER4, PEM, A33, G250, carbohydrate antigens Ley, Lex, Leb, STEAP1, CD166, CD24, CD44, E-cadherin, SPARC, and ErbB3.

11. The aforementioned tumor-CAR a) A sequence comprising the H-CDR of SEQ ID NO: 47, SEQ ID NO: 48, and SEQ ID NO: 49, and the L-CDR of SEQ ID NO: 50, SEQ ID NO: 51, and SEQ ID NO: 52, and comprising an amino acid sequence having at least 80%, at least 90%, at least 95%, or at least 99% identity with the amino acid sequence described in SEQ ID NO: 53, b) A compound comprising the H-CDR of SEQ ID NO: 55, SEQ ID NO: 56, and SEQ ID NO: 57, and the L-CDR of SEQ ID NO: 58, SEQ ID NO: 59, and SEQ ID NO: 60, and comprising an amino acid sequence having at least 80%, at least 90%, at least 95%, or at least 99% identity with the amino acid sequence described in SEQ ID NO: 61, c) A CDR comprising the H-CDR of SEQ ID NO: 63, SEQ ID NO: 64, and SEQ ID NO: 65, and the L-CDR of SEQ ID NO: 66, SEQ ID NO: 67, and SEQ ID NO: 68, and comprising an amino acid sequence having at least 80%, at least 90%, at least 95%, or at least 99% identity with the amino acid sequence described in SEQ ID NO: 69, or d) An amino acid sequence comprising H-CDR and L-CDR included in the amino acid sequence of SEQ ID NO: 71, and having at least 80%, at least 90%, at least 95%, or at least 99% identity with the amino acid sequence described in SEQ ID NO:

71. The manipulated immune cell according to claim 1 or 2, comprising an extracellular binding domain.

12. A pharmaceutical composition comprising a therapeutically effective amount of the manipulated immune cells described in claim 1 or 2.

13. Use of a therapeutically effective amount of manipulated immune cells according to claim 1 or 2 in the manufacture of a drug for use in the treatment of cancer characterized by the presence of FAP in the tumor microenvironment.

14. The use according to claim 13, wherein the cancer is a solid tumor or hematological cancer such as breast cancer, ovarian cancer, endometrial cancer, cervical cancer, bladder cancer, kidney cancer, melanoma, lung cancer, prostate cancer, testicular cancer, thyroid cancer, brain cancer, esophageal cancer, stomach cancer, pancreatic cancer, colorectal cancer, liver cancer, myelofibrosis, myelodysplastic syndrome, acute myeloid leukemia, non-Hodgkin lymphoma, or multiple myeloma.

15. A method for producing a cell population comprising the manipulated immune cells described in claim 1 or 2, (i) A step of preparing donor-derived immune cells or induced pluripotent stem cells (iPSCs), (ii) Optionally, the step of inactivating the potential expression of T cell receptors (TCRs) in the cells or the presentation of TCRs on the surface of the cells, (iii) The step of integrating into the genome of the cell an exogenous nucleic acid sequence encoding a chimeric antigen receptor (CAR) ("FAP-CAR") that targets fibroblast-activating protein (FAP) under the transcriptional control of a constitutive promoter, (iv) The step of integrating into the genome of the cell an exogenous nucleic acid sequence encoding a chimeric antigen receptor (CAR) ("tumor-CAR") that targets a tumor antigen under the transcriptional control of an inducible promoter, (v) The step of optionally isolating manipulated cells that do not express TCR on the cell surface. Methods that include...

16. The method according to claim 15, wherein the integration occurs by random integration, such as the integration of a lentiviral vector, or by gene-targeted integration, such as nuclease-mediated cDNA insertion at a single targeted gene locus in the genome of the cell.

17. The method according to claim 15, comprising the step of inactivating at least one of the TRAC locus, B2M locus, and CD52 locus in the genome of the cell.

18. (a) a nucleic acid sequence comprising a constitutive promoter, and at least one vector comprising a nucleic acid sequence encoding the FAP-CAR as defined in claim 8, operably linked to the promoter, (b) at least one vector comprising a nucleic acid sequence encoding a tumor-CAR as defined in claim 8, positioned between a left homology region and a right homology region, wherein the left homology region and the right homology region are homologous to loci targeted by the endonuclease of (c), (c) At least one sequence-specific endonuclease that targets an inducible gene locus such as PDCD1, CD25, TIM3, TIGIT, CCL1, NR4A3, EGR3, G0S2, IL22, RGS16, FASLG, RDH10, CSF1, GM-CSF, LAG3, CTLA-4, IL10, NUR77, or FOXP3 gene locus A kit that includes this.