Nucleic Acid Amplification and Detection at Room Temperature
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- SHERLOCK BIOSCIENCES INC
- Filing Date
- 2023-06-30
- Publication Date
- 2026-07-08
AI Technical Summary
Current nucleic acid amplification and detection methods require temperatures higher than room temperature, which can be impractical for point-of-care applications, especially in environments with limited resources.
Isothermal nucleic acid amplification techniques using specific compositions and methods that enable robust amplification and sensitive detection of nucleic acids at room temperature, including the use of double-stranded DNA target sequences, SDA primers, cleavage enzymes, DNA polymerases, and single-stranded binding proteins, along with detection methods utilizing guide nucleic acids and Cas enzymes for secondary cleavage.
Enables highly sensitive and efficient amplification and detection of nucleic acids, particularly those in low abundance, at room temperature, facilitating point-of-care diagnostics without the need for temperature cycling.
Smart Images

Figure 00000097_0000 
Figure 00000097_0001 
Figure 00000097_0002
Abstract
Description
Background Art
[0001] The amplification and / or detection of nucleic acids in a sample (e.g., a biological sample and / or an environmental sample) is becoming increasingly important in various diagnostic, therapeutic, social, and other situations.
Summary of the Invention
[0002] The present disclosure recognizes that current nucleic acid amplification and detection methods often rely on temperatures higher than room temperature in combination with cycling temperatures. The present disclosure recognizes that reducing the need for temperatures higher than room temperature is a significant advantage. The present disclosure recognizes that isothermal nucleic acid amplification at room temperature or near room temperature enables highly sensitive diagnostic methods to be performed in a point-of-care environment. The present disclosure recognizes that isothermal nucleic acid amplification at room temperature or near room temperature enables highly sensitive diagnostic methods to be performed in an environment with limited resources.
[0003] The present disclosure provides specific techniques that enable the amplification and detection of nucleic acids in a sample (e.g., a biological sample and / or an environmental sample) at room temperature.
[0004] In some embodiments, the compositions and methods disclosed herein result in robust amplification of the target nucleic acid. Robust amplification of a target nucleic acid sequence refers to compositions and methods that consistently amplify the target nucleic acid sequence to a detectable level. The techniques provided herein enable the highly sensitive detection of a nucleic acid of interest (i.e., a nucleic acid whose nucleotide sequence is the target sequence or includes the target sequence). In some embodiments, the techniques provided are particularly useful or applicable for the detection of nucleic acids present in low abundance (e.g., less than about 10 fM, or less than about 1 fM, or less than about 100 aM).
[0005] The present disclosure provides a composition comprising: (a) a double-stranded DNA target nucleic acid sequence comprising a first native restriction enzyme recognition sequence and a second native restriction enzyme recognition sequence on opposing strands separated by a target nucleic acid region; (b) a first SDA primer comprising (i) a sequence complementary to the first native restriction enzyme recognition sequence, (ii) a 3'-blocking molecule, and (iii) a 5'-stabilizing sequence comprising about 8 to about 20 nucleotides; (c) a second SDA primer comprising (i) a sequence complementary to the second restriction enzyme nickase recognition sequence, (ii) a 3'-blocking molecule, and (iii) a 5'-stabilizing sequence comprising about 8 to about 20 nucleotides; (d) a cleavage enzyme; (e) a DNA polymerase having strand displacement activity; (f) a single-stranded binding protein; and (g) dNTPs.
[0006] The present disclosure provides a method for amplifying a double-stranded DNA target nucleic acid sequence comprising a first native restriction enzyme recognition sequence and a second native restriction enzyme recognition sequence on opposing strands separated by a target nucleic acid region in a sample, the method comprising: (A) contacting the sample with a composition comprising (a) a first SDA primer comprising (i) a sequence complementary to the first native restriction enzyme recognition sequence, (ii) a 3'-blocking molecule, and (iii) a 5'-stabilizing sequence comprising about 8 to about 20 nucleotides; (b) a second SDA primer comprising (i) a sequence complementary to the second native restriction enzyme recognition sequence, (ii) a 3'-blocking molecule, and (iii) a 5'-stabilizing sequence comprising about 8 to about 20 nucleotides; (c) a cleavage enzyme; (d) a DNA polymerase having strand displacement activity; (e) a single-stranded binding protein; and (f) dNTPs, thereby generating a reaction mixture; (B) incubating the reaction mixture under conditions favorable for hybridizing the first and second SDA primers to the double-stranded DNA target nucleic acid sequence in the sample and (ii) amplifying the target nucleic acid, thereby generating a plurality of amplified copies of the target nucleic acid.
[0007] The present disclosure provides a method for detecting a double-stranded DNA target nucleic acid sequence comprising a first native restriction enzyme recognition sequence and a second native restriction enzyme recognition sequence on opposing strands separated by a target nucleic acid region in a sample, the method comprising: (A) contacting at least one copy of the amplified target nucleic acid sequence described herein with a composition comprising (i) a guide nucleic acid comprising a nucleic acid sequence complementary to a DNA cassette, (ii) a Cas enzyme having secondary cleavage activity, and (iii) a nucleic acid reporter probe that is highly sensitive to secondary cleavage activity and has a first uncleaved state and a second cleaved state that are detectably different; and (B) detecting the cleavage of the nucleic acid reporter probe by detecting the difference between the first state and the second state to determine the presence of the target nucleic acid sequence in the sample.
[0008] The present disclosure provides a method for detecting a double-stranded DNA target nucleic acid sequence comprising a first native restriction enzyme recognition sequence and a second native restriction enzyme recognition sequence on opposing strands separated by a target nucleic acid region in a sample, the method comprising: (A) contacting at least one copy of the amplified target nucleic acid sequence described herein with a composition comprising (i) a capture probe and (ii) a complex capture probe comprising a detectable label and a 3'-blocking entity; and (B) detecting the presence of the detectable label bound to a solid substrate to determine the presence of the target nucleic acid sequence in the sample.
[0009] The present disclosure provides a composition comprising (a) a double-stranded DNA target nucleic acid sequence comprising at least one native restriction enzyme recognition sequence, (b) a forward primer comprising (i) a 3' nucleic acid sequence complementary to the target nucleic acid sequence that is downstream or 5' of the native restriction enzyme recognition sequence, and (ii) a 5' SDA primer binding sequence comprising a partial restriction enzyme recognition sequence, (c) a first SDA primer comprising (i) a sequence complementary to at least one native restriction enzyme recognition sequence, (ii) a 3' blocking molecule, and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides, (d) a second SDA primer comprising (i) a sequence complementary to the forward primer and comprising a 5' SDA primer binding sequence comprising a partial restriction enzyme recognition sequence, (ii) a 3' blocking molecule, and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides and comprising a partial restriction enzyme recognition sequence that, together with the partial restriction enzyme recognition sequence within the 5' SDA primer binding sequence, forms a complete restriction enzyme recognition sequence, (e) a cleavage enzyme, (f) a DNA polymerase having strand displacement activity, (g) a single-stranded binding protein, and (h) dNTPs.
[0010] The present disclosure provides a method for amplifying a double-stranded DNA target nucleic acid sequence containing at least one native restriction enzyme sequence in a sample. This method comprises: (A) contacting the sample with a composition comprising (a) a forward primer containing a 3' nucleic acid sequence complementary to the target nucleic acid sequence downstream or at the 5' of a native nickase recognition sequence and a 5'SDA primer binding sequence containing a partial nickase recognition, (b) a cleavage enzyme, (c) a DNA polymerase having strand displacement activity, (d) a single-stranded binding protein, and (e) dNTPs, thereby generating a single-stranded DNA (ssDNA) cassette; (B) contacting the ssDNA cassette of step (A) with a composition comprising (f) a first SDA primer containing (i) a sequence complementary to at least one native restriction enzyme sequence within the target nucleic acid sequence, (ii) a 3' blocking molecule, and (iii) a stabilizing sequence comprising about 8 to about 20 nucleotides, and (g) a second SDA primer containing (i) the 5'SDA primer binding sequence of the forward primer containing a partial restriction enzyme recognition sequence, (ii) a 3' blocking molecule, and (iii) a partial nickase recognition sequence within the 5'SDA primer binding sequence that together with the partial nickase recognition sequence forms a complete restriction enzyme recognition sequence, and a 5' stabilizing sequence comprising about 8 to about 20 nucleotides, thereby generating a reaction mixture; (C) incubating the reaction mixture under conditions favorable for the generation of multiple copies of nucleic acid identical or complementary to the ssDNA cassette.
[0011] The present disclosure provides a method for detecting a double-stranded DNA target nucleic acid sequence containing at least one native restriction enzyme sequence in a sample. This method comprises: (A) contacting at least one copy of the amplified target nucleic acid sequence described herein with a composition comprising (i) a guide nucleic acid containing a nucleic acid sequence complementary to the DNA cassette, (ii) a Cas enzyme having secondary cleavage activity, and (iii) a nucleic acid reporter probe having high sensitivity to the secondary cleavage activity and having a first non-cleaved state and a second cleaved state that are detectably different; (B) detecting the cleavage of the nucleic acid reporter probe by detecting the difference between the first state and the second state to determine the presence of the target nucleic acid sequence in the sample.
[0012] The present disclosure provides a method for detecting a double-stranded DNA target nucleic acid sequence containing at least one native restriction enzyme sequence in a sample, the method comprising: (A) contacting at least one copy of the amplified target nucleic acid sequence described herein with a composition comprising (i) a capture probe and (ii) a complex capture probe comprising a detectable label and a 3'-blocking entity; and (B) detecting the presence of the detectable label bound to the solid substrate to determine the presence of the target nucleic acid sequence in the sample.
[0013] The present disclosure provides a composition comprising: (a) an RNA target nucleic acid; (b) a reverse primer comprising a 5'SDA primer binding sequence comprising (i) a 3' sequence complementary to the RNA target nucleic acid and (ii) a restriction enzyme recognition sequence, a partial restriction enzyme recognition sequence, or a complementary sequence thereof; (c) a reverse transcriptase; and (d) a forward primer comprising a 5'SDA primer binding sequence comprising (i) a 3' sequence complementary to the RNA target polynucleotide and (ii) a restriction enzyme recognition sequence or a partial restriction enzyme recognition sequence, or a complementary sequence thereof; (e) a first SDA primer comprising (i) a sequence complementary to the 5'SDA primer binding sequence of the reverse primer, (ii) a 3'-blocking molecule, and (iii) a 5'-stabilizing sequence comprising about 8 to about 20 nucleotides (when the reverse primer contains only a partial restriction enzyme recognition sequence, the first SDA primer contains a partial restriction enzyme recognition sequence which, together with the partial restriction enzyme recognition sequence within the 5'SDA primer binding sequence of the reverse primer, forms a complete restriction enzyme recognition sequence); (f) a second SDA primer comprising (i) a sequence complementary to the 5'SDA primer binding sequence of the forward primer, (ii) a 3'-blocking molecule, and (iii) a 5'-stabilizing sequence comprising about 8 to about 20 nucleotides (when the forward primer contains only a partial restriction enzyme recognition sequence, the first SDA primer contains a partial restriction enzyme recognition sequence which, together with the partial restriction enzyme recognition sequence within the 5'SDA primer binding sequence of the forward primer, forms a complete restriction enzyme recognition sequence); (g) a cleavage enzyme; (h) a polymerase having strand displacement activity; (i) a single-stranded binding protein; and (j) dNTPs.
[0014] The present disclosure provides a method for amplifying an RNA target nucleic acid sequence in a sample, comprising: (A) contacting the sample with a composition comprising (a) a reverse primer comprising a 5'SDA primer binding sequence containing (i) a 3' sequence complementary to the RNA target nucleic acid and (ii) a restriction enzyme recognition sequence, a partial restriction enzyme recognition sequence, or a complementary sequence thereof, (b) a reverse transcriptase, and (c) a forward primer comprising a 5'SDA primer binding sequence containing (i) a 3' sequence complementary to the RNA target nucleic acid and (ii) a restriction enzyme recognition sequence, a partial restriction enzyme recognition sequence, or a complementary sequence thereof, thereby generating a first reaction mixture; (B) incubating the first reaction mixture under conditions favorable for generating a single-stranded DNA (ssDNA) cassette; (C) contacting the ssDNA cassette of (B) with a composition comprising (d) a first SDA primer comprising a sequence complementary to the 5'SDA primer binding sequence of the reverse primer, a 3' blocking molecule, and a 5' stabilizing sequence comprising about 8 to about 20 nucleotides (when the reverse primer contains only a partial restriction enzyme recognition sequence, the first SDA primer contains a partial restriction enzyme recognition sequence which, together with the partial restriction enzyme recognition sequence within the 5'SDA primer binding sequence of the reverse primer, forms a complete restriction enzyme recognition sequence), (e) a second SDA primer comprising a sequence complementary to the 5'SDA primer binding sequence of the forward primer, a 3' blocking molecule, and a 5' stabilizing sequence comprising about 8 to about 20 nucleotides (when the forward primer contains only a partial restriction enzyme recognition sequence, the first SDA primer contains a partial restriction enzyme recognition sequence which, together with the partial restriction enzyme recognition sequence within the 5'SDA primer binding sequence of the forward primer, forms a complete restriction enzyme recognition sequence), and (f) at least one cleavage enzyme, a polymerase having strand displacement activity, a single-stranded binding protein, and dNTPs, thereby generating a second reaction mixture; and (D) incubating the second reaction mixture under conditions suitable for generating multiple copies of a nucleic acid identical or complementary to the ssDNA cassette.
[0015] The present disclosure provides a method for detecting an RNA target nucleic acid sequence in a sample, the method comprising: (A) contacting at least one copy of a nucleic acid that is identical or complementary to the ssDNA cassette described herein with a composition comprising (i) a guide nucleic acid comprising a nucleic acid sequence complementary to the DNA cassette, (ii) a Cas enzyme having secondary cleavage activity, and (iii) a nucleic acid reporter probe that is highly sensitive to the secondary cleavage activity and has a first non-cleaved state and a second cleaved state that are detectably different; and (B) detecting the cleavage of the nucleic acid reporter probe by detecting the difference between the first state and the second state to determine the presence of the RNA target nucleic acid sequence in the sample.
[0016] The present disclosure provides a method for detecting an RNA target nucleic acid sequence in a sample, the method comprising: (A) contacting at least one copy of an amplified RNA target nucleic acid sequence described herein with a composition comprising (i) a capture probe and (ii) a complex capture probe comprising a detectable label and a 3'-blocking entity; and (B) detecting the presence of the detectable label bound to a solid substrate to determine the presence of the RNA target nucleic acid sequence in the sample.
[0017] The present disclosure provides a composition comprising (a) a target polynucleotide, (b) a first probe comprising a 3'SDA primer binding sequence comprising a partial nickase recognition site or its complementary sequence, a nucleic acid sequence complementary to the target nucleic acid, and a first nucleic acid sensor portion, (c) a second probe comprising a 5'SDA primer binding sequence comprising a partial nickase recognition site or its complementary sequence, a nucleic acid sequence complementary to the target nucleic acid, and a second nucleic acid sensor portion (each nucleic acid sensor portion comprising, respectively, a first and a second reporter element component, encoding the same, or encoding a sequence encoding its template), (d) at least one gap-filling oligo, and (e) a ligase, wherein when the first probe and the second probe are ligated together, a single strand of a DNA cassette encoding at least one reporter and comprising the 3'SDA primer binding sequence and the 5'SDA primer binding sequence is generated, and the SDA primer binding sequence comprises a partial nickase recognition sequence or its complementary sequence.
[0018] The present disclosure provides a composition comprising: (a) a single-stranded DNA cassette encoding at least one reporter and comprising a 3’SDA primer binding sequence and a 5’SDA primer binding site, wherein the 3’ and 5’SDA primer binding sequences comprise a partial nickase recognition sequence or its complementary sequence; (b) a first SDA primer comprising: (i) a sequence complementary to the 3’SDA primer binding sequence, (ii) a 3’ blocking molecule, and (iii) a 5’ stabilizing sequence comprising from about 8 to about 20 nucleotides and comprising a partial nickase recognition sequence which, together with the partial nickase recognition sequence within the 3’SDA primer binding sequence, forms a complete nickase primer binding sequence; (c) a second SDA primer comprising: (i) a sequence complementary to the 5’SDA primer binding sequence, (ii) a 3’ blocking molecule, and (iii) a 5’ stabilizing sequence comprising from about 8 to about 20 nucleotides and comprising a partial nickase recognition site which, together with the partial nickase recognition sequence within the 5’SDA primer binding sequence, forms a complete nickase primer binding sequence; and (d) at least one nickase, a polymerase having strand displacement activity, a single-stranded binding protein, and dNTPs.
[0019] The present disclosure provides (a) a single-stranded DNA (ssDNA) cassette encoding at least one reporter and comprising a 3’SDA primer binding sequence and a 5’SDA primer binding sequence (the 3’ and 5’SDA primer binding sequences comprising a partial nickase recognition sequence or its complementary sequence), (b) a first SDA primer comprising (i) a sequence complementary to the 3’SDA primer binding sequence, (ii) a 3’ blocking molecule, and (iii) a 5’ stabilizing sequence comprising about 8 to about 20 nucleotides (comprising a partial nickase recognition site which, together with the partial nickase recognition sequence within the 3’SDA primer binding sequence, forms a complete nickase primer binding sequence), (c) a second SDA primer comprising (i) a sequence complementary to the 5’SDA primer binding sequence, (ii) a 3’ blocking molecule, (iii) a 5’ stabilizing sequence comprising about 8 to about 20 nucleotides (comprising a partial nickase recognition site which, together with the partial nickase recognition sequence within the 5’SDA primer binding sequence, forms a complete nickase primer binding sequence), and (d) a detection system comprising (i) a guide nucleic acid comprising a nucleic acid sequence complementary to the DNA cassette, and (ii) a Cas enzyme having secondary cleavage activity, (iii) a nucleic acid reporter probe sensitive to the secondary cleavage activity (whereby the nucleic acid reporter probe has detectably different first uncut and second cut states), and (e) a composition comprising at least one nickase, a polymerase having strand displacement activity, a single-stranded binding protein, and dNTPs.
[0020] The present disclosure involves (A) contacting a sample with a composition comprising (a) a first probe comprising a 3’SDA primer binding sequence comprising a partial nicking enzyme recognition sequence or its complementary sequence, a nucleic acid sequence complementary to a target nucleic acid, and a first nucleic acid sensor moiety, (b) a second probe comprising a 5’SDA primer binding sequence comprising a partial nicking enzyme recognition sequence or its complementary sequence, a nucleic acid sequence complementary to the target nucleic acid, and a second nucleic acid sensor moiety (each nucleic acid sensor moiety comprises, encodes, or encodes a template for, each of the first and second reporter element components), (c) at least one gap filling oligo, and (d) a ligase (when ligating the first and second probes together, encoding at least one reporter and generating a single-stranded DNA cassette comprising the 3’SDA primer binding sequence and the 5’SDA primer binding sequence, the SDA primer binding sequence comprising a partial nicking enzyme recognition sequence or its complementary sequence, resulting in the generation of a first reaction mixture), (B) incubating the first reaction mixture under conditions favorable for the generation of a single-stranded DNA (ssDNA) cassette, (C) contacting the ssDNA cassette of (B) with a composition comprising (i) a first SDA primer comprising a sequence complementary to the 3’SDA primer binding sequence, a 3’ blocking molecule, and a stabilizing sequence comprising about 8 to about 20 nucleotides and comprising a partial nicking recognition site (forming a complete nicking primer binding sequence together with the partial nicking enzyme recognition sequence within the 3’SDA primer binding sequence), (ii) a second SDA primer comprising a sequence complementary to the 5’SDA primer binding sequence, a 3’ blocking molecule, and a 5’ stabilizing sequence comprising about 8 to about 20 nucleotides and comprising a partial nicking recognition site (forming a complete nicking primer binding sequence together with the partial nicking enzyme recognition sequence in the 5’SDA primer binding sequence), and (iii) at least one nicking enzyme, a polymerase having strand displacement activity, and a single-stranded binding protein, thereby generating a second reaction mixture, (D) incubating the second reaction mixture under conditions favorable for generating multiple copies of a nucleic acid identical or complementary to the ssDNA cassette, (E) at least one copy of a nucleic acid identical or complementary to the ssDNA cassette,Contacting with a composition comprising a cell-free extract to thereby produce a third reaction mixture, incubating the third reaction mixture under conditions favorable for the production of at least one reporter encoded by an (F) ssDNA cassette, and / or (G) measuring the expression of the reporter protein produced in step (F) to measure the presence and / or amount of a target nucleic acid sequence in a sample, a method for detecting a target nucleic acid sequence in a sample is provided.
[0021] The present disclosure provides (a) a single-stranded DNA cassette encoding at least one reporter and comprising a 3'SDA primer binding sequence and a 5'SDA primer binding sequence (the 3' and 5'SDA primer binding sequences comprising a nickase recognition sequence or a partial nickase recognition sequence or a complementary sequence thereof), (b) a first SDA primer comprising (i) a sequence complementary to the 3'SDA primer binding sequence, (ii) a 3' blocking molecule, and (iii) a T7 promoter sequence, and / or a stabilizing sequence comprising about 8 to about 20 nucleotides (comprising a partial nickase recognition site which, together with the partial nickase recognition site on the 3'SDA primer binding sequence, forms a complete nickase primer binding sequence), (c) a second SDA primer comprising (i) a sequence complementary to the 5'SDA primer binding sequence, (ii) a 3' blocking molecule, (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides (comprising a partial nickase recognition site which, together with the partial nickase recognition sequence within the 5'SDA primer binding sequence, forms a complete nickase primer binding sequence), and (d) a detection system comprising a capture probe, a complex capture probe comprising a detectable label and a 3' blocking molecule, and (e) a composition comprising at least one nickase, a polymerase having strand displacement activity, a single-stranded binding protein, and dNTPs.
[0022] The present disclosure provides a method for detecting an RNA target nucleic acid sequence in a sample, the method comprising: (A) contacting the sample with a composition comprising (i) a reverse primer comprising a 3′ sequence complementary to the RNA target nucleic acid and (ii) a 5′ SDA primer binding sequence (the primer binding sequence comprising a nickase recognition sequence or a partial nickase recognition sequence or a complementary sequence thereof), a reverse transcriptase, (i) a forward primer comprising a 3′ sequence complementary to the RNA target polynucleotide and (ii) a 5′ SDA primer binding sequence (the primer binding sequence comprising a nickase recognition sequence or a partial nickase recognition sequence, or a complementary sequence thereof), thereby generating a first reaction mixture; (B) incubating the first reaction mixture under conditions favorable for the production of a single-stranded DNA (ssDNA) cassette; (C) contacting the ssDNA cassette of (B) with a composition comprising (i) a first SDA primer comprising a sequence complementary to the 5′ SDA primer binding sequence, a 3′ blocking molecule, and a T7 promoter sequence and / or a stabilizing sequence comprising or consisting of about 8 to about 20 nucleotides (when the 5′ SDA primer binding sequence contains only a partial nickase recognition site, the stabilizing sequence contains the partial nickase recognition site, which together with the partial nickase recognition site on the SDA primer binding sequence forms a complete nickase primer binding site), (ii) a second SDA primer comprising a sequence complementary to the 3′ SDA primer binding sequence of the reverse primer, a 3′ blocking molecule, and a stabilizing sequence comprising or consisting of at least 8 to 12 nucleotides (when the 3′ SDA primer binding sequence contains only a partial nickase recognition site, the stabilizing sequence contains the partial nickase recognition site, which together with the partial nickase recognition site on the 3′ SDA primer binding sequence forms a complete nickase primer binding site), and (ii) at least one nickase, a polymerase having strand displacement activity, and a single-stranded binding protein, thereby generating a second reaction mixture; (D) incubating the second reaction mixture under conditions favorable for generating multiple copies of a nucleic acid identical or complementary to the ssDNA cassette; (E) contacting at least one copy of a nucleic acid identical or complementary to the ssDNA cassette with (i) a capture probe,and (ii) contacting with a composition comprising a complex capture probe comprising a detectable label and a 3'-blocking molecule, and (f) detecting the presence of the detectable label bound to the solid substrate to determine the presence of the target nucleic acid sequence in the sample. The present disclosure involves: (a) contacting a sample with a composition comprising (i) a first probe comprising a 3’SDA primer binding sequence comprising a partial nicking enzyme recognition site or its complementary sequence, a nucleic acid sequence complementary to a target nucleic acid, and a first nucleic acid sensor moiety, (ii) a second probe comprising a 5’SDA primer binding sequence comprising a partial nicking enzyme recognition site or its complementary sequence, a nucleic acid sequence complementary to the target nucleic acid, and a second nucleic acid sensor moiety (each nucleic acid sensor moiety comprises, encodes, or encodes a template for each of the first and second reporter element components), (iii) at least one gap-filling oligo, and (iv) a ligase (when ligated together, generates a single-stranded nucleotide cassette encoding at least one reporter and comprising the 3’SDA primer binding sequence and the 5’SDA primer binding sequence, the primer binding sequences comprising a nicking enzyme recognition sequence or a partial nicking enzyme recognition sequence, resulting in the generation of a first reaction mixture); (b) incubating the first reaction mixture under conditions favorable for the generation of the single-stranded nucleotide cassette; (c) contacting the nucleotide cassette of (b) with a composition comprising (i) a first SDA primer comprising a sequence complementary to the 3’SDA primer binding sequence of (a), a 3’ blocking molecule, and a stabilizing sequence comprising about 8 to about 20 nucleotides and comprising a partial nicking enzyme recognition site (which together with the partial nicking enzyme recognition site on the 3’SDA primer binding sequence forms a complete nicking enzyme primer binding site), (c)(i) a second SDA primer comprising a sequence complementary to the 5’SDA primer binding sequence, a 3’ blocking molecule, and a 5’ stabilizing sequence comprising about 8 to about 20 nucleotides and comprising a partial nicking enzyme recognition site (which together with the partial nicking enzyme recognition sequence in the 5’SDA primer binding sequence forms a complete nicking enzyme primer binding sequence), and (ii) at least one nicking enzyme, a polymerase having strand displacement activity, and a single-stranded binding protein, thereby generating a second reaction mixture; (d) incubating the second reaction mixture under conditions favorable for generating multiple copies of a nucleic acid identical or complementary to the nucleotide cassette.(e) contacting at least one copy of a nucleic acid that is identical or complementary to the nucleotide cassette with a composition comprising: (i) a guide nucleic acid comprising a nucleic acid sequence complementary to the nucleotide cassette, (ii) a Cas enzyme having secondary cleavage activity, and (iii) a nucleic acid reporter probe sensitive to the secondary cleavage activity (as a result, the nucleic acid reporter probe has a first uncleaved state and a second cleaved state that are detectably different), (f) detecting cleavage of the nucleic acid reporter probe by detecting the difference between the first state and the second state, and determining the presence of a target nucleic acid sequence in the sample, to provide a method for detecting a target nucleic acid sequence in a sample.,
Brief Description of Drawings
[0023]
Figure 1
[0024]
Figure 2
[0025]
Figure 3
[0026]
Figure 4
[0027]
Figure 5
[0028]
Figure 6
[0029]
Figure 7
[0030]
Figure 8-1
Figure 8-2
Figure 8-3
[0031]
Figure 9
[0032]
Figure 10
[0033]
Figure 11-1
Figure 11-2
[0034]
Figure 12
[0035]
Figure 13
[0036]
Figure 14
[0037]
Figure 15
[0038]
Figure 16
[0039]
Figure 17
[0040]
Figure 18
[0041]
Figure 19
[0042]
Figure 20
[0043]
Figure 21-1
Figure 21-2
Figure 21-3
Figure 21-4
[0044]
Figure 22-1
Figure 22-2
Figure 22-3
Figure 22-4
Figure 22-5
Figure 22-6
[0045]
Figure 23
[0046]
Figure 24-1
Figure 24-2
Figure 24-3
Figure 24-4
[0047]
Figure 25-1
Figure 25-2
Figure 25-3
[0048]
Figure 26
[0049]
Figure 27
[0050]
Figure 28
[0051]
Figure 29
[0052]
Figure 30
[0053]
Figure 31
[0054]
Figure 32
[0055]
Figure 33
[0056]
Figure 34
[0057]
Figure 35
[0058]
Figure 36
[0059]
Figure 37
[0060]
Figure 38-1
Figure 38-2
[0061]
Figure 39
[0062]
Figure 40
[0063]
Figure 41
[0064]
Figure 42
[0065]
Figure 43
[0066]
Figure 44
[0067]
Figure 45
[0068]
Figure 46
[0069]
Figure 47
[0070]
Figure 48
[0071]
Figure 49
[0072]
Figure 50
[0073]
Figure 51
[0074]
Figure 52
[0075]
Figure 53
[0076]
Figure 54
Mode for Carrying Out the Invention
[0077] Definition Normal temperature: As used in this specification, the term "normal temperature" refers to the ambient temperature. Generally, the term "normal temperature" should be understood as the temperature of any object or environment surrounding the article. The measurement of normal temperature can be achieved by using a thermometer or a sensor. The normal temperature of an article depends on the temperature of the surroundings. The surroundings can have any temperature, for example, a temperature less than 95°C, for example, less than 90°C, for example, less than 85°C, for example, less than 80°C, for example, less than 75°C, for example, less than 70°C, for example, less than 65°C, for example, less than 60°C, for example, less than 55°C, for example, less than 50°C, for example, less than 45°C, for example, less than 40°C, for example, less than 35°C, for example, less than 30°C, for example, less than 25°C, for example, less than 24°C, for example, less than 23°C, for example, less than 22°C, for example, less than 21°C, for example, less than 20°C. Exemplary normal temperature ranges include 5°C to 50°C, for example, 10°C to 40°C, for example, 15°C to 35°C, for example, 20°C to 30°C, for example, 20°C to 25°C, for example, 20°C to 22°C.
[0078] About: When the term "about" is used in relation to a value in this specification, it means a value that is similar to the reference value in the context. Generally, those skilled in the art with a good understanding of the context will fully understand the degree of the relevant difference encompassed by "about" in that context. For example, in some embodiments, the term "about" may encompass a range of values within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less of the reference value.
[0079] Approximately: As used herein, the term "approximately" or "about" when applied to one or more target values refers to a value similar to the stated reference value. In certain embodiments, the term "approximately" or "about" refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less in either direction (above or below) of the stated reference value, unless otherwise stated or apparent from the context (except in cases where such a number exceeds 100% of the possible values).
[0080] Linkage: As used herein, the term "linkage" is generally understood to mean a non-covalent associative bond between two or more entities. "Direct" linkage involves physical contact between entities or moieties, and indirect linkage involves physical interaction through physical contact by one or more intermediate entities. Generally, linkages between two or more entities can be evaluated in any of a variety of contexts, including when the interacting entities or sites are studied alone or in the context of a more complex system (e.g., while covalently or otherwise bound to a carrier entity and / or in a biological system or cell).
[0081] Biological Sample: As used herein, the term "biological sample" generally refers to a sample obtained or derived from a biological source of interest (e.g., tissue or organism or cell culture) described herein. In some embodiments, the source of interest is or includes an organism such as an animal or a human. In some embodiments, the biological sample is or includes a biological tissue or fluid. In some embodiments, the biological sample can be or include bone marrow, blood, blood cells, ascites, tissue or fine needle biopsy sample, cell-containing body fluid, free nucleic acid, sputum, saliva, urine, cerebrospinal fluid, peritoneal fluid, pleural effusion, feces, lymph, gynecological fluid, skin swab, vaginal swab, oral swab, nasal swab, lavage or wash fluid such as ductal lavage or bronchoalveolar lavage fluid, aspirate, scrape, bone marrow specimen, tissue biopsy specimen, surgical specimen, feces, other body fluids, secretions, and / or excretions, and / or cells thereof. In some embodiments, the biological sample is or includes cells obtained from an individual. In some embodiments, the cells obtained are or include cells from the individual from whom the sample is obtained. In some embodiments, the sample is a "primary sample" obtained directly from the source of interest by any suitable means. For example, in some embodiments, the primary biological sample is obtained by a method selected from the group consisting of biopsy (e.g., fine needle aspirate or tissue biopsy), surgery, collection of body fluid (e.g., blood, lymph, feces, etc.). In some embodiments, as apparent from the context, the term "sample" means a preparation obtained by processing a primary sample (e.g., by removing one or more components and / or adding one or more agents). For example, filtration using a semipermeable membrane. Such a "processed sample" may contain, for example, nucleic acids or proteins extracted from the sample or obtained by subjecting the primary sample to procedures (e.g., amplification or reverse transcription of mRNA, separation and / or purification of specific components, etc.).
[0082] Cell lysate: As used herein, the term "cell lysate" or "cellular lysate" means a fluid containing the contents of one or more disrupted cells (i.e., cells with disrupted membranes). In some embodiments, the cell lysate contains both hydrophilic and hydrophobic cellular components. In some embodiments, the cell lysate mainly contains hydrophilic components. In some embodiments, the cell lysate mainly contains hydrophobic components. In some embodiments, the cell lysate is a lysate of one or more cells selected from the group consisting of plant cells, microbial (e.g., bacterial or fungal) cells, animal cells (e.g., mammalian cells), human cells, and combinations thereof. In some embodiments, the cell lysate is a lysate of one or more abnormal cells such as cancer cells. In some embodiments, the cell lysate is a crude lysate in that little or no purification is performed after cell disruption. In some embodiments, such a lysate is referred to as a "primary" lysate. In some embodiments, one or more isolation or purification steps are performed on the primary lysate, provided that the term "lysate" means a preparation containing multiple cellular components and not a pure preparation of individual components.
[0083] Composition: As used herein, those skilled in the art will understand that the term "composition" can be used to mean a physically distinct element containing one or more specific components. Generally, unless otherwise specified, a composition can be in any form, such as a gas, gel, liquid, solid, etc.
[0084] Comprising: A composition or method described herein as “comprising” one or more named elements or steps is open-ended, meaning that the named elements or steps are essential, but that other elements or steps may be added within the scope of the composition or method. To avoid redundancy, any composition or method described as “comprising” (or “comprises”) one or more named elements or steps also represents the corresponding, more limited composition or method “consisting essentially of” the same named elements or steps, which means that the composition or method includes the named essential elements or steps and may include additional elements or steps that do not substantially affect the basic and novel characteristics(s) of the composition or method. It should also be understood that any composition or method described herein as “comprising” or “consisting essentially of” one or more named elements or steps also represents the corresponding, more limited, closed-ended composition or method “consisting of” any other elements or steps not named. In any composition or method disclosed herein, any known or disclosed equivalents of any of the named essential elements or steps may be used in place of that element or step.
[0085] Determine: Many of the methodologies described herein include a step of "determine". Those skilled in the art, upon reading this specification, will understand that such "determination" can be made using or achieved by use of any of a variety of techniques available to those skilled in the art, including, for example, the specific techniques explicitly mentioned in this specification. In some embodiments, determining involves manipulation of a physical sample. In some embodiments, determining involves consideration and / or manipulation of data or information, for example, using a computer or other processing unit adapted to perform a relevant analysis. In some embodiments, determining involves receiving relevant information and / or materials from a source. In some embodiments, the determination includes comparing one or more characteristics of a sample or entity to a comparable reference.
[0086] Expression: As used herein, "expression" of a nucleic acid sequence refers to one or more of the following events: (1) production of an RNA template from a DNA sequence (e.g., by transcription), (2) processing of the RNA transcript (e.g., by splicing, editing, 5' capping, and / or 3' end formation), (3) translation of the RNA into a polypeptide or protein, and / or (4) post-translational modification of the polypeptide or protein.
[0087] Native nickase site: As used herein, refers to a nickase site that occurs naturally in a nucleic acid sequence (e.g., the nickase site is not introduced by manipulation and / or amplification of the nucleic acid sequence).
[0088] Nucleic acid: As used herein, in its broadest sense, it means any compound and / or substance that can be incorporated into, or can incorporate, an oligonucleotide chain. In some embodiments, a nucleic acid is a compound and / or substance that can be incorporated into, or can incorporate, an oligonucleotide chain by a phosphodiester bond. As will be apparent from the context, in some embodiments, "nucleic acid" means individual nucleic acid residues (e.g., nucleotides and / or nucleosides), and in some embodiments, "nucleic acid" means an oligonucleotide chain containing individual nucleic acid residues. In some embodiments, the "nucleic acid" is or includes RNA. In some embodiments, the "nucleic acid" is or includes DNA. In some embodiments, the nucleic acid is, comprises, or consists of one or more natural nucleic acid residues. In some embodiments, the nucleic acid is, comprises, or consists of one or more nucleic acid analogs. In some embodiments, a nucleic acid analog differs from a nucleic acid in that it does not utilize a phosphodiester backbone. For example, in some embodiments, the nucleic acid is, comprises, or consists of one or more "peptide nucleic acids", which are known in the art, have a peptide bond in the backbone instead of a phosphodiester bond, and are considered to be within the scope of the present disclosure. Alternatively, or additionally, in some embodiments, the nucleic acid has one or more phosphorothioate and / or 5'-N-phosphoramidite bonds instead of phosphodiester bonds. In some embodiments, the nucleic acid is, comprises, or consists of one or more natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine).In some embodiments, the nucleic acid is, comprises, or consists of one or more nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, 2-thiocytidine, methylated bases, intercalating bases, and combinations thereof). In some embodiments, the nucleic acid comprises one or more modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose) compared to that of natural nucleic acids. In some embodiments, the nucleic acid has a nucleotide sequence encoding a functional gene product such as RNA or protein. In some embodiments, the nucleic acid comprises one or more introns. In some embodiments, the nucleic acid is prepared by one or more of isolation from natural sources, enzymatic synthesis (in vivo or in vitro) by polymerization based on a complementary template, replication in recombinant cells or systems, and chemical synthesis. In some embodiments, the nucleic acid has a residue length of at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 20, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000 or more. In some embodiments, the nucleic acid is partially or completely single-stranded, and in some embodiments, the nucleic acid is partially or completely double-stranded.In some embodiments, the nucleic acid has a nucleotide sequence comprising at least one element that encodes a polypeptide or is complementary to a sequence encoding a polypeptide. In some embodiments, the nucleic acid has enzymatic activity.
[0089] Polypeptide: As used herein, it refers to any polymer chain of amino acids. In some embodiments, the polypeptide has a natural amino acid sequence. In some embodiments, the polypeptide has a non-natural amino acid sequence. In some embodiments, the polypeptide has a modified amino acid sequence in that it is artificially designed and / or produced. In some embodiments, the polypeptide can comprise or consist of natural amino acids, non-natural amino acids, or both. In some embodiments, the polypeptide can comprise or consist of only natural amino acids or only non-natural amino acids. In some embodiments, the polypeptide can contain D-amino acids, L-amino acids, or both. In some embodiments, the polypeptide can contain only D-amino acids. In some embodiments, the polypeptide can contain only L-amino acids. In some embodiments, the polypeptide can include one or more pendant groups or other modifications, such as modifications of or attachments to one or more amino acid side chains, at the N-terminus of the polypeptide, the C-terminus of the polypeptide, or any combination thereof. In some embodiments, such pendant groups or modifications can be selected from the group consisting of acetylation, amidation, lipidation, methylation, pegylation, etc. (including combinations thereof). In some embodiments, the polypeptide may be cyclic and / or may contain a cyclic moiety. In some embodiments, the polypeptide is not cyclic and / or does not contain a cyclic moiety. In some embodiments, the polypeptide is linear. In some embodiments, the polypeptide can be or include a stapled polypeptide. In some embodiments, the term "polypeptide" can be appended to the name of a reference polypeptide, activity, or structure, in which case this is used herein to refer to a polypeptide that shares the relevant activity or structure and can thus be considered a member of the same class or family of polypeptides. For each such class, the present specification provides exemplary polypeptides within the class for which the amino acid sequence and / or function are known, and / or those skilled in the art will be aware of them.In some embodiments, such exemplary polypeptides are reference polypeptides of a polypeptide class or family. In some embodiments, members of a polypeptide class or family exhibit significant sequence homology or identity with the class's reference polypeptide and, in some embodiments, with all polypeptides within the class, share a common sequence motif (e.g., a characteristic sequence element), and / or share a common activity (in some embodiments, at an equivalent level or within a specified range). For example, in some embodiments, the member polypeptide exhibits an overall degree of sequence homology or identity with the reference polypeptide of at least about 30-40%, often about 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more, and / or contains at least one region (e.g., a conserved region that may be or include a characteristic sequence element in some embodiments) exhibiting very high sequence identity of often 90% or even more, 95%, 96%, 97%, 98%, or 99%. Such conserved regions typically encompass at least 3-4, often up to 20 or more amino acids, and in some embodiments, the conserved region includes at least one stretch of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more amino acids. In some embodiments, the related polypeptide can comprise or consist of a fragment of the parent polypeptide. In some embodiments, a useful polypeptide can comprise or consist of multiple fragments, each of which is in a different spatial arrangement relative to what is found in the polypeptide of interest and is found in the same parent polypeptide (e.g., fragments directly linked to the parent may be spatially separated in the polypeptide of interest or vice versa, and / or the fragments may be present in the polypeptide of interest in a different order than the parent), and thus the polypeptide of interest is a derivative of its parent polypeptide.
[0090] Protein: As used herein, the term "protein" refers to a polypeptide (i.e., a string of at least two amino acids linked together by peptide bonds). A protein can contain moieties other than amino acids (e.g., it can be a glycoprotein, a proteoglycan, etc.) and / or can be otherwise processed or modified. One of ordinary skill in the art will understand that a "protein" can be a complete polypeptide chain produced by a cell (regardless of the presence or absence of a signal sequence) or a characteristic portion thereof. One of ordinary skill in the art will understand that a protein can optionally contain multiple polypeptide chains that are joined, for example, by one or more disulfide bonds or associated by other means. A polypeptide can contain L-amino acids, D-amino acids, or both and can contain any of a variety of amino acid modifications or analogs known in the art. Useful modifications include, for example, terminal acetylation, amidation, methylation, etc. In some embodiments, a protein can contain natural amino acids, non-natural amino acids, synthetic amino acids, and combinations thereof. The term "peptide" is generally used to mean a polypeptide having a length of less than about 100 amino acids, less than about 50 amino acids, less than 20 amino acids, or less than 10 amino acids. In some embodiments, a protein is an antibody, an antibody fragment, a biologically active portion thereof, and / or a unique portion thereof.
[0091] Reference: As used herein, it describes a standard or control against which a comparison is made. For example, in some embodiments, a target agent, animal, individual, population, sample, sequence, or value is compared to a reference or control agent, animal, individual, population, sample, sequence, or value. In some embodiments, the reference or control is tested and / or determined substantially simultaneously with the target test or determination. In some embodiments, the reference or control is an optionally tangible medium embodied historical reference or control. Usually, as understood by those skilled in the art, the reference or control is determined or analyzed under conditions or circumstances comparable to the object of evaluation. Those skilled in the art will understand when there is sufficient similarity to justify the reliance on and / or comparison to a particular reference or control considered.
[0092] Sample: As used herein, the term "sample" generally refers to a biological sample obtained from or derived from a source of interest, as described herein. In some embodiments, the source of interest is a biological source or an environmental source. In some embodiments, the source of interest is or can include cells or organisms such as microorganisms, plants, animals (e.g., humans). In some embodiments, the source of interest is or includes a biological tissue or body fluid. In some embodiments, the biological tissue or body fluid can be or include amniotic fluid, aqueous humor, ascites, bile, bone marrow, blood, breast milk, cerebrospinal fluid, cerumen, chyle, chime, semen, endolymph, exudate, feces, gastric acid, gastric juice, lymph, mucus, pericardial fluid, perilymph, peritoneal fluid, pleural fluid, pus, catarrhal secretion, saliva, sebum, semen, serum, smegma, sputum, synovial fluid, sweat, tears, urine, vaginal secretion, vitreous humor, vomitus, and / or combinations or components thereof. In some embodiments, the body fluid can be or include intracellular fluid, extracellular fluid, intravascular fluid (plasma), interstitial fluid, lymphatic fluid, and / or transcellular fluid. In some embodiments, the body fluid can be or include plant exudate. In some embodiments, the biological tissue or sample can be obtained, for example, by aspiration, biopsy (e.g., fine needle or tissue biopsy), swab (e.g., oral, nasal, skin, or vaginal swab), scraping, surgery, lavage or washing (e.g., bronchoalveolar, duct, nasal, eye, oral, uterine, vaginal, or other lavage or washing). In some embodiments, the biological sample is or includes cells obtained from an individual. In some embodiments, the sample is a "primary sample" obtained directly from the source of interest by any suitable means. In some embodiments, as is apparent from the context, the term "sample" refers to a preparation obtained by treating the primary sample (e.g., by removing one or more of its components and / or by adding one or more agents thereto). For example, filtration using a semipermeable membrane.Such a "processed sample" may contain, for example, nucleic acids or proteins that are extracted from a sample or obtained by subjecting a primary sample to one or more techniques (such as nucleic acid amplification or reverse transcription, separation and / or purification of specific components, etc.). In some embodiments, the sample may be an "unpurified" sample in that it has been relatively little processed and / or may be a complex in that it contains components of a relatively diverse chemical class.
[0093] Subject: As used herein, the term "subject" refers to an organism, such as a mammal (e.g., a human, non-human mammal, non-human primate, primate, laboratory animal, mouse, rat, hamster, gerbil, cat, dog). In some embodiments, the human subject is an adult, adolescent, or pediatric subject. In some embodiments, the subject has a disease, disorder, or condition, such as a disease, disorder, or condition that can be treated as provided herein, such as a cancer or tumor listed herein. In some embodiments, the subject is susceptible to a disease, disorder, or condition, and in some embodiments, the susceptible subject has a predisposition to develop a disease, disorder, or condition and / or exhibits an increased risk (compared to the average risk observed in a reference subject or reference population). In some embodiments, the subject exhibits one or more symptoms of a disease, disorder, or condition. In some embodiments, the subject does not exhibit a specific symptom (e.g., a clinical symptom of a disease) or characteristic of a disease, disorder, or condition. In some embodiments, the subject does not exhibit any symptoms or characteristics of a disease, disorder, or condition. In some embodiments, the subject is a patient. In some embodiments, the subject is an individual who has received or has had administered thereto a diagnosis and / or therapy.
[0094] Detailed description of specific embodiments In some aspects, the disclosure provides compositions and methods for the circumferential amplification of a target nucleic acid. In some embodiments, detection of the target nucleic acid amplicon (i.e., the DNA cassette) follows amplification.
[0095] In some aspects, the present disclosure provides systems that utilize nucleic acid sensor technology to first hybridize (and in some embodiments, in a target sequence-dependent manner) to a target nucleic acid of interest, and use those systems to generate a detectable output.
[0096] Composition The present disclosure provides compositions useful for the amplification of a target nucleic acid. In some embodiments, the present disclosure provides compositions useful for the amplification and detection of a target nucleic acid.
[0097] In some embodiments, the present disclosure provides compositions useful for the generation of a target amplicon (e.g., a DNA cassette), the preparation of multiple copies of a nucleic acid identical to the target amplicon (e.g., a DNA cassette), and the detection of at least one copy of a nucleic acid identical or complementary to the target amplicon (e.g., a DNA cassette(s)). In some embodiments, the compositions of the present disclosure may be used to generate, for example, at room temperature, a single-stranded DNA cassette (ssDNA) or multiple copies of a nucleic acid identical or complementary to the ssDNA cassette. In some embodiments, such compositions are used to generate a single-stranded DNA cassette (ssDNA) or multiple copies of a nucleic acid identical or complementary to the ssDNA cassette, for example, under isothermal conditions (e.g., without the need for temperature cycling). In some embodiments, the compositions provided herein detect an ssDNA cassette, for example, at room temperature. In some embodiments, the compositions provided herein detect an ssDNA cassette, for example, under isothermal conditions (e.g., without the need for temperature cycling).
[0098] In some embodiments, the compositions provided herein comprise a target nucleic acid.
[0099] In some embodiments, the compositions provided herein include oligonucleotide binders (e.g., primers and / or probes). In some embodiments, the compositions provided herein include one or more oligonucleotide binders (e.g., primers and / or probes). In some embodiments, the oligonucleotide binders of the present disclosure are designed to specifically bind to a target nucleic acid.
[0100] In some embodiments, the composition includes ligase.
[0101] In some embodiments, the composition includes reverse transcriptase.
[0102] In some embodiments, the composition includes a cleavage enzyme. In some embodiments, the composition includes a restriction enzyme. In some embodiments, the composition includes a nickase.
[0103] In some embodiments, the composition includes a single-stranded binding protein.
[0104] In some embodiments, the composition includes a strand-displacing polymerase.
[0105] In some embodiments, the composition includes dNTPs. In some embodiments, the composition includes one or more modified dNTPs.
[0106] In some embodiments, components and compositions for detecting an ssDNA cassette, or multiple copies of nucleic acids identical or complementary to the ssDNA cassette, are also included in the compositions of the present disclosure. In some embodiments, the compositions according to the present disclosure include a nucleic acid probe labeled detectably, a guide nucleic acid, and a Cas enzyme (e.g., a Cas enzyme having secondary cleavage activity).
[0107] Sample In some embodiments, the sample comprises a target nucleic acid. In some embodiments, the sample is an environmental sample. In some embodiments, the sample is a biological sample. In some embodiments, the sample is from a subject. In some embodiments, the sample is from a human subject. In some embodiments, the sample is blood, saliva, sputum, mucus, urine, or feces. In some embodiments, the sample is a swab of a surface on or within the human body. In some embodiments, the sample is a swab of a mucosal surface or mucosa. In some embodiments, the sample is a nasal swab, a buccal swab, a cervical swab, a vaginal swab, or a throat swab.
[0108] In some embodiments, the sample is processed. In some embodiments, the sample is processed to isolate components of the sample. In some embodiments, the sample is processed to isolate nucleic acids (e.g., RNA and / or DNA). In some embodiments, the sample is processed to isolate RNA. In some embodiments, the sample is processed to isolate DNA. In some embodiments, the sample is processed to separate double-stranded nucleic acids into single-stranded nucleic acids.
[0109] In some embodiments, a sample is prepared or processed to provide a nucleic acid preparation. In some embodiments, a lysis buffer is used to prepare or process the sample. In some embodiments, the sample is prepared as shown in FIG. 26. In some embodiments, the lysis buffer contains a surfactant. In some embodiments, the sample (e.g., virus particles and / or cells) is lysed (e.g., processed) using an amphoteric surfactant (e.g., as in Example 1). In some embodiments, the sample (e.g., virus particles and / or cells) is lysed (e.g., processed) using the amphoteric surfactant described in 63 / 358,044, filed herein on July 1, 2022 and incorporated herein by reference. In some embodiments, such amphoteric surfactants are selected from the group consisting of LAPAO, LDAO, and DDAO. Certain surfactants (e.g., certain amphoteric surfactants such as LAPAO, LDAO, and DDAO) show surprising effectiveness when used for lysis of virus particles and / or release of nucleic acids from virus particles, whereby a nucleic acid preparation is obtained. The advantages of certain embodiments of the lysis techniques provided include, in particular, providing a useful nucleic acid preparation without using one or more conventional processing steps, e.g., purification, isolation, or extraction steps that are generally required or utilized to remove surfactants.
[0110] In some embodiments, the concentration of the amphoteric surfactant is in the range of 0.01% to 10%. In some embodiments, the lysis buffer contains an amphoteric surfactant and HCl. In some embodiments, the concentration of HCl is in the range of 4 mM to 4 M. In some embodiments, the pH of the lysis buffer is in the range of 0 to 6. In some embodiments, the amphoteric surfactant is selected from the group consisting of LAPAO, LDAO, and DDAO. In some embodiments, the concentration of LAPAO is in the range of 0.01% to 10%. In some embodiments, the concentration of LDAO is in the range of 0.02% to 4%. In some embodiments, the lysis buffer further contains sodium decanoate.
[0111] Figure 27 shows exemplary lysis and nucleic acid processing steps at room temperature. As shown, a sample containing human saliva pooled in the matrix of cell lysate and inactivated intact virus is first treated with a lysis buffer (e.g., containing zwitterionic surfactant), and then treated with a "ligation solution" without a conventional treatment or "clean-up" step. A nucleic acid preparation suitable for high-sensitivity detection techniques is obtained.
[0112] In some embodiments, the sample (e.g., virus particles and / or cells) is lysed (e.g., treated) using sodium hydroxide (NaOH). In some embodiments, the sample is lysed with NaOH at room temperature (e.g., at ambient temperature). In some embodiments, the concentration of NaOH is from about 1 mM NaOH to about 200 mM NaOH. In some embodiments, the concentration of NaOH is from about 10 mM NaOH to about 100 mM. In some embodiments, the sample is lysed with NaOH for about 1 second to about 10 minutes, e.g., about 10 seconds to about 8 minutes, e.g., about 1 minute to about 5 minutes, e.g., about 2 minutes to about 4 minutes. In some embodiments, the sample is treated with NaOH to inhibit or reduce RNase activity. In some embodiments, viral nucleic acid is released from the viral sample by NaOH. In some embodiments, double-stranded DNA or RNA is denatured (e.g., strands are separated) by NaOH.
[0113] In some embodiments, a sample (e.g., a virus particle and / or a cell) is lysed (e.g., processed) using potassium hydroxide (KOH). In some embodiments, a sample containing DNA (e.g., dsDNA) is treated with KOH. In some embodiments, the sample is lysed with KOH at room temperature (e.g., at about room temperature). In some embodiments, the concentration of KOH is from about 1 mM KOH to about 200 mM KOH. In some embodiments, the concentration of KOH is from about 10 mM KOH to about 100 mM. In some embodiments, the sample is lysed with KOH for about 1 second to about 10 minutes, such as about 10 seconds to about 8 minutes, such as about 1 minute to about 5 minutes, such as about 2 minutes to about 4 minutes. In some embodiments, the sample is treated with KOH to inhibit or reduce RNase activity. In some embodiments, KOH releases viral nucleic acid from a viral sample. In some embodiments, KOH denatures double-stranded DNA or RNA (e.g., the strands separate). In some such embodiments, KOH denaturation causes dsDNA to separate and ssDNA to be produced.
[0114] In some embodiments, the sample may be an "unpurified" sample in that it is relatively little processed and / or a complex in that it contains components of a relatively diverse chemical class.
[0115] In some embodiments, the cell-free extract is a crude extract. In some embodiments, a cell-free extract is produced by a cell-free protein expression system (including but not limited to, PURExpress, etc.).
[0116] Target nucleic acid In some embodiments, the techniques provided herein (e.g., methods or compositions) amplify and / or detect one or more target nucleic acids (s). In some embodiments, the target nucleic acid is deoxyribonucleic acid (DNA). In some embodiments, the target nucleic acid is ribonucleic acid (RNA). In some embodiments, the target nucleic acid is single-stranded. In some embodiments, the target nucleic acid is double-stranded.
[0117] Those skilled in the art are aware of methods for generating ssDNA from RNA (e.g., reverse transcriptase) or sdDNA (heat-denatured or KOH-denatured). In some embodiments, the target RNA is converted to ssDNA. In some embodiments, the target dsDNA is converted to ssDNA.
[0118] In some embodiments, the target nucleic acid is present in the sample. In some embodiments, the sample contains one or more target nucleic acids (plural available). In some embodiments, the sample contains one or more target nucleic acids (plural available) and nucleic acids other than one or more target nucleic acids (plural available). In some embodiments, the target nucleic acid is derived from eukaryotes. In some embodiments, the target nucleic acid is derived from prokaryotes. In some embodiments, the target nucleic acid is parasitic (e.g., protozoa), bacterial, viral, or fungal. In some embodiments, the target nucleic acid is human.
[0119] In some embodiments, the target nucleic acid contains a target nucleic acid region. In some embodiments, the target nucleic acid region is a nucleotide sequence amplified and / or detected by the methods and compositions provided herein.
[0120] In some embodiments, the target nucleic acid contains one or more restriction enzyme recognition sequences. In some embodiments, the target nucleic acid contains two or more restriction enzyme recognition sequences. In some embodiments, one or more restriction enzyme recognition sequences are natural restriction enzyme recognition sequences, i.e., such restriction enzyme recognition sequences naturally exist in the target nucleic acid and are not added by any manipulation or amplification of the target nucleic acid. In some embodiments, the target nucleic acid contains a restriction enzyme recognition sequence upstream or 5' of the target nucleic acid region and a restriction enzyme recognition sequence downstream or 3' of the target nucleic acid region.
[0121] In some embodiments, the restriction enzyme recognition sequence is a nickase recognition sequence. In some embodiments, the target nucleic acid comprises a nickase recognition sequence (e.g., a native nickase recognition sequence). In some embodiments, the target nucleic acid comprises one or more nickase recognition sequences (e.g., a native nickase recognition sequence). In some embodiments, the target nucleic acid comprises one or more nickase recognition sequences (e.g., a native nickase recognition sequence). In some embodiments, the target nucleic acid comprises a nickase recognition sequence upstream or 5' of the target nucleic acid region and a nickase recognition sequence downstream or 3' of the target nucleic acid region.
[0122] In some embodiments, the target nucleic acid does not comprise a restriction enzyme recognition sequence (e.g., a nickase recognition sequence) or a portion thereof. In some embodiments, a full restriction enzyme recognition sequence (e.g., a nickase recognition sequence) or a partial restriction enzyme recognition sequence (e.g., a nickase recognition sequence), or a complementary sequence thereof, is added to the target nucleic acid sequence shown herein below (e.g., by a primer and / or a probe).
[0123] In some embodiments, the target nucleic acid comprises one or more sequences capable of hybridizing to one or more oligonucleotide binders. In some embodiments, the target nucleic acid comprises at least one oligonucleotide binding sequence (i.e., a sequence capable of hybridizing to an oligonucleotide binder). In some embodiments, the target nucleic acid comprises two oligonucleotide binding sequences. In some embodiments, the target nucleic acid comprises a first oligonucleotide binding sequence and a second oligonucleotide binding sequence. For example, the target nucleic acid may comprise a reverse complementary sequence of the first oligonucleotide binding sequence and the second oligonucleotide binding sequence, and the reverse complementary sequences of the first oligonucleotide binding sequence and the second oligonucleotide binding sequence are adjacent to the target nucleic acid region. The target nucleic acid region refers to a sequence within the target nucleic acid that is specifically amplified. In some embodiments, the oligonucleotide binding sequence is a primer binding sequence. In some embodiments, the oligonucleotide binding sequence is a probe binding sequence.
[0124] In some embodiments, the oligonucleotide binding sequence comprises from about 10 to about 16 nucleotides. In some embodiments, the nucleotides in the oligonucleotide binding sequence are contiguous nucleotides in the primary sequence of the target nucleic acid (i.e., there are no additional intervening nucleotides or other molecules between the contiguous nucleotides). In some embodiments, the oligonucleotide binding sequence comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16 nucleotides. In some embodiments, the oligonucleotide binding sequence comprises at most 16, at most 15, at most 14, at most 13, at most 12, at most 11, at most 10 nucleotides.
[0125] Oligonucleotide binding agent In some embodiments, the compositions and methods of the present disclosure comprise one or more oligonucleotide binding agents (e.g., probes or primers). In some embodiments, the compositions and methods of the present disclosure comprise one or more primers (e.g., forward primers, reverse primers, strand displacement amplification (SDA) primers, or combinations thereof). In some embodiments, the compositions and methods of the present disclosure comprise one or more probes (e.g., a first probe, a second probe, or combinations thereof). In some embodiments, the compositions and methods of the present disclosure comprise one or more probes and one or more primers.
[0126] In some embodiments, the compositions and methods provided herein utilize one or more oligonucleotide binding agents to generate target amplicons such as ssDNA cassettes.
[0127] In some embodiments, the compositions and methods provided herein utilize one or more oligonucleotide binding agents to amplify a target nucleic acid sequence and / or an ssDNA cassette.
[0128] In some embodiments, the compositions and methods provided herein utilize one or more oligonucleotide binders to detect a target nucleic acid, or a copy thereof.
[0129] In some embodiments, the oligonucleotide binder comprises a sequence complementary to the target nucleic acid. In some embodiments, the oligonucleotide binder comprises a sequence complementary to an SDA primer or a portion thereof (e.g., an SDA primer binding sequence). In some embodiments, the oligonucleotide binder comprises an SDA primer binding sequence. In some embodiments, the oligonucleotide binder comprises a stabilizing sequence. In some embodiments, the oligonucleotide binder comprises a blocking molecule. In some embodiments, the oligonucleotide binder comprises a nickase recognition site or a partial nickase recognition site, or a complement thereof. In some embodiments, the oligonucleotide binder (e.g., a probe) comprises one or more portions encoding a reporter element component.
[0130] Target-complementary sequence In some embodiments, the oligonucleotide binder (e.g., a primer or a probe) comprises a sequence complementary to the target nucleic acid sequence.
[0131] In some embodiments, the oligonucleotide binder comprises a sequence complementary to the target nucleic acid sequence, which comprises a natural restriction enzyme recognition sequence or a portion thereof. In some embodiments, the oligonucleotide binder comprises a sequence complementary to a natural restriction enzyme recognition sequence (e.g., a first natural restriction enzyme recognition sequence and / or a second natural restriction enzyme recognition sequence) or a portion thereof.
[0132] In some embodiments, the portion of the oligonucleotide binding sequence complementary to the target nucleic acid sequence is at the 3' end of the oligonucleotide binder.
[0133] In some embodiments, the sequence complementary to the target nucleic acid sequence (e.g., the oligonucleotide binding sequence) is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% complementary to the target nucleic acid sequence. In some embodiments, the sequence complementary to the target nucleic acid sequence is 100% complementary to the target nucleic acid.
[0134] In some embodiments, the sequence complementary to the target nucleic acid sequence (e.g., the portion of the oligonucleotide binding sequence complementary to the target nucleic acid sequence) comprises from about 5 to about 16 nucleotides. In some embodiments, the sequence complementary to the target nucleic acid sequence comprises at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16 nucleotides. In some embodiments, the nucleic acid sequence complementary to the target nucleic acid comprises at most 16 nucleotides, at most 15, at most 14, at most 13, at most 12, at most 11, at most 10, at most 9, at most 8, at most 7, at most 6, at most 5 nucleotides.
[0135] Restriction enzyme recognition sequence In some embodiments, the oligonucleotide binder comprises a complete restriction enzyme recognition sequence, or a sequence complementary thereto. In some embodiments, the oligonucleotide binder comprises a partial restriction enzyme recognition sequence, or a sequence complementary thereto.
[0136] In some embodiments, the oligonucleotide binder comprises a complete nickase recognition sequence, or a sequence complementary thereto. In some embodiments, the oligonucleotide binder comprises a partial nickase recognition sequence, or a sequence complementary thereto.
[0137] In some embodiments, the nickase recognition sequence is, consists of, or comprises the nucleotide sequences listed in Table 1 or sequences complementary thereto. In some embodiments, a partial nickase recognition sequence comprises a portion of the nickase recognition sequences listed in Table 1 or a sequence complementary thereto. The terms "nickase recognition sequence" and "nickase recognition site" are used herein interchangeably.
[0138] In some embodiments, the nickase recognition sequence is about 3 to about 7 nucleotides. In some embodiments, the nickase recognition sequence is 3 nucleotides. In some embodiments, the nickase recognition sequence is 4 nucleotides. In some embodiments, the nickase recognition sequence is 5 nucleotides. In some embodiments, the nickase recognition sequence is 6 nucleotides. In some embodiments, the nickase recognition sequence is 7 nucleotides.
[0139] In some embodiments, the nickase recognition sequence comprises two cytosine nucleotides followed by a thymine, guanine, or adenine nucleotide.
[0140] SDA primer binding sequence In some embodiments, an oligonucleotide binder (e.g., a primer or a probe) comprises an SDA primer binding sequence. In some embodiments, the SDA primer binding sequence is located at the 5' end of the oligonucleotide binder. In some embodiments, the SDA primer binding sequence comprises or consists of about 8 to about 12 nucleotides. In some embodiments, the SDA primer binding sequence comprises at least 8 nucleotides, at least 9, at least 10, at least 11, at least 12 nucleotides. In some embodiments, the SDA primer binding sequence comprises at most 12 nucleotides, at most 11, at most 10, at most 9, at most 8 nucleotides.
[0141] In some embodiments, the SDA primer binding sequence comprises a complete restriction enzyme recognition sequence (e.g., a nickase recognition sequence) or its complementary sequence. In some embodiments, the SDA primer binding sequence comprises a partial restriction enzyme recognition sequence (e.g., a portion of a nickase recognition sequence) or its complementary sequence. In some embodiments, the nickase recognition sequence is or comprises the nucleotide sequence listed in Table 1 or its complementary sequence. In some embodiments, the partial nickase recognition sequence comprises a portion of the nickase recognition sequence listed in Table 1 or a sequence complementary thereto.
[0142] In some embodiments, the SDA primer binding sequence comprises (i) a complete restriction enzyme recognition sequence (e.g., a nickase recognition sequence), a partial restriction enzyme recognition sequence (e.g., a nickase recognition sequence), or their complementary sequences, and (ii) an additional SDA primer binding sequence. In some embodiments, the additional SDA primer binding sequence comprises from about 2 to about 6 nucleotides. In some embodiments, the additional SDA primer binding sequence is complementary to the target nucleic acid sequence (e.g., complementary to the nucleotide sequence within the target nucleic acid adjacent to the oligonucleotide binding sequence).
[0143] Stabilizing sequence In some embodiments, the oligonucleotide binder comprises a stabilizing sequence. In some embodiments, the stabilizing sequence extends from the 5' end of the oligonucleotide binder. In some embodiments, the stabilizing sequence comprises from about 8 to about 20 nucleotides. In some embodiments, the stabilizing sequence comprises at least 8 nucleotides, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20 nucleotides. In some embodiments, the stabilizing sequence comprises at most 20 nucleotides, at most 19, at most 18, at most 17, at most 16, at most 15, at most 14, at most 13, at most 12, at most 11, at most 10, at most 9, at most 8 nucleotides.
[0144] In some embodiments, the stabilizing sequence comprises a partial restriction enzyme recognition sequence (e.g., a nickase recognition sequence). In some embodiments, the stabilizing sequence comprises a partial restriction enzyme recognition sequence (e.g., a nickase recognition sequence) and an additional nucleotide sequence. In some embodiments, such additional sequences are about 2 to about 20 nucleotides in length. In some embodiments, the nucleotides of the additional sequence, alone or together with the restriction enzyme recognition sequence (e.g., the partial nickase recognition sequence), can be any nucleotides that do not form a complete restriction enzyme recognition sequence (e.g., a nickase recognition sequence). In some embodiments, the stabilizing sequence does not include a restriction enzyme recognition sequence (e.g., a partial nickase recognition sequence) or a complete restriction enzyme recognition sequence (e.g., a nickase recognition sequence).
[0145] In some embodiments, the stabilizing sequence comprises an RNA polymerase binding sequence. In some embodiments, the stabilizing sequence is or comprises a T7 RNA polymerase promoter. In some embodiments, the RNA polymerase binding sequence is a eukaryotic RNA polymerase binding sequence. In some embodiments, the RNA polymerase binding sequence is a bacteriophage RNA polymerase binding sequence. In some embodiments, the RNA polymerase binding sequence is an RNA polymerase I, RNA polymerase II, RNA polymerase III, RNA polymerase IV, RNA polymerase V, Nr virion RNA polymerase, or T7 RNA polymerase binding sequence. In some embodiments, the RNA polymerase binding sequence is a T7 RNA polymerase binding sequence. In some embodiments, the RNA polymerase binding sequence is a bacterial RNA polymerase binding sequence. In some embodiments, the T7 RNA polymerase promoter is TAATACGACTCACTATAGG (SEQ ID NO: 70) or comprises it.
[0146] In some embodiments, the stabilizing sequence is a linear single-stranded sequence.
[0147] In some embodiments, the stabilizing sequence is a hairpin stabilizer. In some embodiments, the hairpin stabilizer includes a hairpin-loop structure, i.e., the stabilizing sequence conforms to a folded form (e.g., a stem stabilizer) in which the 5' end of the stabilizing sequence or a portion thereof hybridizes to the 3' end of the hybridization sequence or a portion thereof. In some embodiments, the folded form includes a stem portion of the stabilizer and a loop portion of the stabilizer. In some embodiments, the loop of the stabilizer is single-stranded. In some embodiments, the stem of the stabilizer is double-stranded. An exemplary hairpin stabilizing sequence is shown in FIG. 39.
[0148] Blocking molecule In some embodiments, an oligonucleotide binder (e.g., a primer such as an SDA primer) includes a 3' blocking molecule.
[0149] In some embodiments, the blocking molecule blocks the extension of the SDA primer in the 3' direction (e.g., prevents the progression of nucleotide sequence extension) by chemically modifying the 3' OH group of the 3' terminal nucleotide of the SDA primer. In some embodiments, the 3' OH chemical modification prevents the strand-displacing polymerase from adding additional nucleotides to the 3' terminal nucleotide of the primer.
[0150] In some embodiments, the 3' blocking molecule can also inhibit the exponential amplification of primer dimers.
[0151] In some embodiments, the 3' blocking molecule blocks the extension of the SDA primer in the 3' direction when bound to the 3' end of the primer. In some embodiments, the blocking molecule binds to the 3' OH group of the 3' terminal nucleotide of the primer.
[0152] In some embodiments, the blocking molecule is selected from the group consisting of 3' ddNTP, 3' inverted dT, 3' carbon chain spacer, 3' hexanediol, 3' amino spacer, and 3' phosphorylation.
[0153] In some embodiments, the 3'ddNTP is a dideoxynucleotide triphosphate that does not have a 3'OH group required for extension. In some embodiments, the deoxynucleotide triphosphate is selected from the group consisting of ddTTP, ddATP, ddGTP, and ddCTP.
[0154] In some embodiments, 3'Inverted dT has a 3'-3' bond that inhibits extension.
[0155] In some embodiments, the 3' carbon chain spacer is a carbon chain bonded to the 3'OH group that blocks extension. In some embodiments, the carbon chain spacer may be 3C, 4C, 5C, 6C, 7C, 8C, 9C, 10C, 11C, 12C, or longer.
[0156] In some embodiments, 3' hexanediol is a C6 glycol chain bonded to the 3'OH group that blocks extension.
[0157] In some embodiments, the 3' amino spacer binds to the 3'OH group of the oligonucleotide binder required for extension. In some embodiments, the 3' amino spacer is a carbon chain of 4C, 5C, 6C, 7C, 8C, 9C, 10C, 11C, 12C, or more that has a methoxy group at C1 and an NH2 group bonded to the last carbon of the 3' amino spacer.
[0158] In some embodiments, 3' phosphorylation is a phosphate group bonded to the 3'OH required for extension.
[0159] In some embodiments, the blocking molecule is hexanediol (3C6). In some embodiments, the blocking molecule is 3SpC3.
[0160] Sensor portion In some embodiments, the oligonucleotide binder (e.g., a probe) comprises a first and / or a second nucleic acid sensor moiety. In some embodiments, the first probe comprises a first sensor moiety. In some embodiments, the second probe comprises a second sensor moiety. As used herein, a probe pair may comprise a nucleic acid sensor set. The nucleic acid sensor set comprises at least a first nucleic acid sensor moiety and a second nucleic acid sensor moiety.
[0161] In some embodiments, the first nucleic acid sensor moiety comprises a sequence that is at least one reporter element, encodes it, or is its template. In some embodiments, the second nucleic acid sensor moiety comprises a sequence that is at least one reporter element, encodes it, or is its template. When the first and second nucleic acid sensor moieties are contacted with a sample containing a target nucleic acid, the target nucleic acid hybridizes with both the first and second nucleic acid sensor moieties, such that the first and second nucleic acid sensor moieties are adjacent to each other, and as a result, these adjacent moieties are ligated by one or more of (i) ligation to produce a ligation product and / or (ii) a template code to produce a ligated template product (e.g., they form a "nick placement").
[0162] In some embodiments, one or both of the nucleic acid sensor moieties may comprise a template element that directs the synthesis of an intact single strand complementary to the nicking placement. For example, if the template element is or comprises a promoter and / or one or more transcription control elements, the system may be or comprise an RNA polymerase, and if the template element is or comprises an origin of replication and / or a binding site for an extensible primer, the system may be or comprise a DNA polymerase (in some embodiments, this may be a thermostable DNA polymerase, comprises a sequence element corresponding to a second extensible primer, and the system comprises an appropriate primer pair for amplifying the duplex of the adjacent strand and its complement).
[0163] In some embodiments, ligation of the first and second nucleic acid sensor portions generates a nucleic acid strand (i.e., a ligation strand) that includes both the first and second reporter elements (or their complements), and this nucleic acid strand, or its complement (e.g., generated by transcription or extension [e.g., primed extension]), or any expression product (e.g., generated by transcription and / or translation), is detectable or generates a detectable signal indicative of the presence and / or amount of a target nucleic acid in a sample, or is a reporter in that it is involved in the generation thereof.
[0164] In some embodiments, the ligation strand may be transcribed and / or translated (e.g., via cell-free components such as a cell-free protein synthesis expression system (CFPS)).
[0165] In some embodiments, the ligation provided herein generates a detectable output. In some embodiments, such a detectable output is or is generated by a polypeptide. In some embodiments, the detectable output may be or include a catalytic output, and in some embodiments, the detectable output may be or include a non-catalytic output.
[0166] In some embodiments, the catalytic output is, for example, an enzyme that catalyzes a reaction that converts one or more substrates into one or more detectable species, or is generated by an enzyme. In some embodiments, the non-catalytic output is or generates a detectable nucleic acid or polypeptide (e.g., acting as an antigen or other specific binding ligand).
[0167] In particular, the present disclosure provides technical formats in which a detectable output is suitable for lateral flow analysis (e.g., is a product detectable by lateral flow, includes such a product, or generates such a product). In some embodiments, the present disclosure provides the insight that multiplexed analysis (e.g., simultaneous detection of multiple products suitable for lateral flow) can be particularly facilitated by combining ligation-mediated detection techniques with lateral flow assessment techniques. Further, the present disclosure shows that such coupling can have certain advantages that enable effective multiplexed analysis of products of different chemical classes (e.g., two or more of nucleic acids, metals, polypeptides, small molecules, antibodies, or fragments thereof).
[0168] In some embodiments, the sensor portion is disposed adjacent to the binder hybridization sequence.
[0169] In some embodiments, the techniques provided herein can include one or more bridging oligonucleotides that hybridize to a target site between, for example, a first nucleic acid sensor portion and a second nucleic acid sensor portion (e.g., a gap filling oligonucleotide (which may be referred to as a “GFO”). In some embodiments, a probe set, e.g., a first and a second probe, includes a nucleic acid sensor that includes two (i.e., a first and a second) nucleic acid sensor portions. In some embodiments, the techniques provided herein can include one or more bridging oligonucleotides that hybridize to a target site between a first nucleic acid sensor and a second nucleic acid sensor.
[0170] In some embodiments, the GFO can reduce background or off-target signals. In some embodiments, in the absence of the GFO, no detectable output is generated by ligation of the first nucleic acid sensor portion and the second nucleic acid sensor portion. In some embodiments, the output generated by ligation of the first nucleic acid sensor portion and the second nucleic acid sensor portion in the absence of the GFO is not a reporter element. In some embodiments, the output generated by ligation of the first nucleic acid sensor portion and the GFO, or the second nucleic acid sensor portion and the GFO, is not a reporter element.
[0171] In some embodiments, the GFO includes a primer element. In some embodiments, ligation of the first nucleic acid sensor portion, the second nucleic acid sensor portion, and the GFO generates a nucleic acid strand (i.e., the ligation strand) that includes both the first and second reporter elements (or their complements), and this nucleic acid strand, itself or its complement (e.g., generated by transcription or extension [e.g., primed extension]), or any expression product (e.g., generated by transcription and / or translation) is detectable or generates a detectable signal indicating the presence and / or amount of the target nucleic acid in the sample or is involved in the generation and is thus a reporter. In some embodiments, the ligation strand is amplified (e.g., by polymerase chain reaction, such as isothermal rolling circle amplification). In some embodiments, the amplification utilizes at least the primer element within the GFO.
[0172] In some embodiments, the GFO includes at least one reporter element or encodes or includes one or more nucleic acid sensor portions having one or more sequences that are templates. In some embodiments, the GFO is or encodes or includes at least one reporter element.
[0173] Modification In some embodiments, the oligonucleotide binders provided herein include one or more modified nucleotides (e.g., modified ribonucleotides, modified deoxyribonucleotides, or combinations thereof).
[0174] In some embodiments, the oligonucleotide binders are modified using nuclease-resistant modifications so that the phosphodiester bonds of restriction enzyme recognition sequences on one strand of the chain are protected. In some embodiments, the nuclease-resistant modifications include phosphorothioate (PTO), boranophosphate, methylphosphate, or peptide internucleotide linkages. In some embodiments, modified internucleotide linkages, e.g., PTO linkages, can be chemically synthesized within oligonucleotide probes and primers or incorporated into double-stranded nucleic acids by polymerase, e.g., by using one or more α-thiol modified deoxynucleotides. In some embodiments, the oligonucleotide is a modified oligonucleotide and the internucleotide linkage is a PTO linkage.
[0175] In some embodiments, the dNTPs provided herein include one or more modified nucleotides.
[0176] In some embodiments, the modified nucleotides are selected from the group consisting of α-thiol nucleotides, borano derivatives, 2'-O-methyl (2'OMe) modified bases, and 2'-fluoro bases. In some embodiments, the oligonucleotide binder includes one or more α-nucleotide binders. Those skilled in the art will understand that a restriction enzyme can cleave both strands of double-stranded DNA. In some embodiments, incorporation of modified nucleotides into one strand of double-stranded DNA prevents cleavage of both strands by the restriction enzyme. In some embodiments, incorporation of modified nucleotides into one strand of double-stranded DNA allows the restriction enzyme to cleave only the unmodified strand and leave the modified strand intact.
[0177] In some embodiments, the modified nucleotide is a peptide nucleic acid (PNA). In some embodiments, the modified nucleotide is a locked nucleic acid (LNA). Peptide nucleic acids, locked nucleic acids, or combinations thereof may be used to alter primer Tm and / or specificity. Primers that include peptide nucleotides, locked nucleotides, or combinations may be particularly useful in methods of detecting a target nucleotide sequence having one or more SNP sites to enhance specificity.
[0178] In some embodiments, the modified nucleotide is a 2'-fluoro-nucleic acid or a 2'-O-methyl-nucleic acid. Primers that include 2'-fluoro-nucleic acid modifications, 2'-O-methyl-nucleic acid modifications, or combinations are more nuclease resistant compared to unmodified primers and have a higher Tm for the 2'-fluoro-nucleic acid modification and / or 2'-O-methyl-nucleotide modification domain(s).
[0179] In some embodiments, the modified deoxyribonucleotide is a phosphorothioate deoxyribonucleotide. In some embodiments, the modified deoxyribonucleotide is a phosphodiester deoxyribonucleotide. In some embodiments, the modified deoxyribonucleotides provided herein destabilize the helix. In some embodiments, a nucleic acid that includes a modified deoxyribonucleotide melts at a lower temperature compared to a control that does not have the modified deoxyribonucleotide. In some embodiments, a nucleic acid that includes a modified deoxyribonucleotide can be amplified at a lower temperature compared to a control that does not have the modified deoxyribonucleotide.
[0180] In some embodiments, the primer includes a modified nucleotide in place of at least one guanine or adenine. In some embodiments, the modified nucleotide is 2-aminopurine (e.g., a purine analog of guanine and adenine). In some embodiments, primers that include 2-aminopurine are useful in fluorescence readouts.
[0181] In some embodiments, one or more of the modifications recited herein provide a primer that is more resistant to nucleases and / or proteases compared to an unmodified primer or other nucleotide.
[0182] Exemplary oligonucleotide Reverse primer In some embodiments, the compositions and methods of the disclosure include one or more reverse primers. In some embodiments, the oligonucleotide binder is a reverse primer. In some embodiments, the reverse primer includes a nucleic acid sequence complementary to a target nucleic acid (e.g., an RNA target polynucleotide). In some embodiments, the reverse primer includes a sequence complementary to the target nucleic acid at the 3' end of the reverse primer. In some embodiments, the reverse primer includes an SDA primer binding sequence. In some embodiments, the reverse primer includes a stabilizing sequence.
[0183] In some embodiments, the reverse primer includes, in the 5' to 3' direction, a stabilizing sequence, an SDA primer binding sequence, and a sequence complementary to the target nucleic acid. In some embodiments, the stabilizing sequence and the SDA primer binding sequence are separated by one or more nucleotides. In some embodiments, the SDA primer binding sequence and the nucleic acid sequence complementary to the target nucleic acid are separated by one or more nucleotides. In some embodiments, the stabilizing sequence includes a partial nickase recognition sequence or its complementary sequence. In some embodiments, the stabilizing sequence and the SDA primer binding sequence together form a complete restriction enzyme recognition sequence (e.g., a nickase recognition sequence). In some embodiments, the stabilizing sequence includes a restriction enzyme recognition sequence (e.g., a complete nickase recognition sequence).
[0184] In some embodiments, the reverse primer comprises a complete restriction enzyme recognition sequence (e.g., a complete nickase recognition sequence) or its complementary sequence. In some embodiments, the reverse primer comprises a partial restriction enzyme recognition sequence (e.g., a nickase recognition sequence) or its complementary sequence.
[0185] Forward primer In some embodiments, the compositions and methods of the present disclosure include one or more forward primers. In some embodiments, the oligonucleotide binder is a forward primer. In some embodiments, the forward primer comprises a nucleic acid sequence complementary to a target nucleic acid (e.g., an RNA and / or DNA target polynucleotide). In some embodiments, the sequence complementary to the target nucleic acid is at the 3' end of the forward primer. In some embodiments, the forward primer comprises an SDA primer binding sequence.
[0186] In some embodiments, the forward primer comprises, in the 5' to 3' direction, an SDA primer binding sequence and a nucleic acid sequence complementary to the target nucleic acid. In some embodiments, the SDA primer binding sequence and the nucleic acid sequence complementary to the target nucleic acid are separated by one or more nucleotides. In some embodiments, the SDA primer binding sequence comprises a partial restriction enzyme recognition sequence (e.g., a partial nickase recognition sequence).
[0187] In some embodiments, the forward primer comprises a partial restriction enzyme recognition sequence (e.g., a partial nickase recognition sequence). Bump primer
[0188] In some embodiments, the compositions and methods of the present disclosure include one or more bump primers. In some embodiments, the bump primer is complementary to the target nucleic acid sequence and binds upstream of the primer (i.e., at the 5' end of the target nucleic acid with respect to binding to the primer). In some embodiments, the bump primer is useful when separating the newly synthesized DNA strand from its template. In some embodiments, the bump primer binds to the DNA template upstream of the forward primer, thereby separating the synthetic strand ssDNA generated by the forward primer.
[0189] In some embodiments, when using KOH to lyse the sample, one or more bump primers are not used.
[0190] Probe In some embodiments, the compositions and methods of the present disclosure include one or more probes. In some embodiments, the oligonucleotide is a probe. In some embodiments, the probe includes a nucleic acid sequence complementary to the target nucleic acid. In some embodiments, the probe includes an SDA primer binding sequence. In some embodiments, the probe includes a first and / or second nucleic acid sensor moiety as described hereinabove. In some embodiments, when the first and second nucleic acid sensor moieties are ligated together, they generate an ssDNA cassette encoding at least one reporter and including one or more SDA primer binding sequences.
[0191] The probe is the probe described in PCT Publication WO2020 / 037038, published on February 20, 2020, entitled "In Vitro Detection", the probe described in PCT Publication WO2020 / 191376, published on September 24, 2020, entitled "System", and the probe described in PCT Publication WO2021 / 050560, published on March 18, 2021, entitled "System" (the contents of each are incorporated herein by reference in their entirety).
[0192] In some embodiments, the probe comprises a restriction enzyme recognition sequence (e.g., a nickase recognition sequence). In some embodiments, the probe comprises a partial restriction enzyme recognition sequence (e.g., a partial nickase recognition sequence).
[0193] In some embodiments, the capture probe is a biotinylated capture probe. In some embodiments, the capture probe has a 5'-biotin modification. In some embodiments, the capture probe is about 10 to about 20 nucleotides. In some embodiments, the capture probe comprises a 3'-blocking molecule. In some embodiments, the capture probe comprises a stabilizing sequence (e.g., a linear single-stranded sequence, a hairpin stabilizer, or a combination thereof). In some embodiments, the capture probe comprises a restriction enzyme recognition sequence, e.g., a nickase recognition sequence. In some embodiments, the restriction enzyme recognition sequence and / or the nickase recognition sequence comprises one or more modifications (e.g., PTO linkage). In some embodiments, the capture probe comprises a target nucleic acid sequence or its complementary sequence. In some embodiments, the capture probe comprises a repeat strip pull down sequence. In some embodiments, the strip pull down sequence is the nucleotide sequence of SEQ ID NO: 71 (TGTATGTATGTATGA).
[0194] In some embodiments, the probe is a complex probe. In some embodiments, the complex capture probe is about 10 to about 20 nucleotides. In some embodiments, the complex capture probe comprises a target nucleic acid sequence or its complementary sequence. In some embodiments, the complex capture probe comprises a repeat strip pull down sequence. In some embodiments, the strip pull down sequence is the nucleotide sequence of SEQ ID NO: 71.
[0195] Strand displacement amplification (SDA) primer In some embodiments, the compositions and methods provided herein include one or more strand displacement amplification (SDA) primers. In some embodiments, the use of SDA primers (s) with short caps added during SDA amplification prevents non-specific dimerization at low temperatures with low specificity of DNA hybridization.
[0196] In some embodiments, the oligonucleotide binder is an SDA primer. In some embodiments, the SDA primer includes a nucleotide sequence complementary to the target nucleic acid sequence. In some embodiments, the SDA primer includes a sequence complementary to a native restriction enzyme recognition sequence (e.g., a native nicking enzyme recognition sequence). In some embodiments, the SDA primer includes a nucleotide sequence complementary to the SDA primer binding sequence. In some embodiments, the SDA primer includes a complete restriction enzyme recognition sequence (e.g., a nicking enzyme recognition sequence) or its complementary sequence. In some embodiments, the SDA primer includes a blocking molecule. In some embodiments, the SDA primer includes a 3' blocking molecule. In some embodiments, the blocking molecule blocks the extension of the SDA primer in the 3' direction (e.g., prevents the progression of the extension of the nucleotide sequence). In some embodiments, the SDA primer includes a stabilizing sequence.
[0197] In some embodiments, the SDA primer hybridizes to the target nucleic acid sequence or its complementary sequence. In some embodiments, the SDA primer binds to the SDA primer binding sequence introduced into the ssDNA cassette by an oligonucleotide binder (e.g., a primer and / or a probe) or its complement.
[0198] In some embodiments, after a complementary target nucleic acid sequence containing a native restriction enzyme recognition sequence (e.g., a native nickase recognition sequence) within the ssDNA cassette, or binding of an SDA primer to the SDA primer binding sequence within the ssDNA cassette and subsequent polymerase-based extension, a double-stranded restriction enzyme recognition sequence (e.g., a nickase recognition sequence) is produced (e.g., the generated amplicon contains a double-stranded restriction enzyme recognition sequence (e.g., a nickase recognition sequence)). When introducing a nick and then extending based on a polymerase, a target nucleic acid sequence or the reverse complementary sequence of the ssDNA is generated. Nick introduction can occur by using a nickase or by using a restriction enzyme in combination with incorporating one or more modified dNTPs into one strand of the double-stranded restriction enzyme recognition sequence to ensure that only one strand is cleaved (e.g., within the polymerase extension or the SDA primer).
[0199] In some embodiments, the compositions and methods of the present disclosure include SDA primers useful for amplifying a target nucleic acid sequence (e.g., including a native restriction enzyme recognition sequence, e.g., a native nickase recognition sequence). In some embodiments, the compositions and methods of the present disclosure include SDA primers useful for amplifying an ssDNA cassette. In some embodiments, the compositions and methods provided herein generate multiple copies of nucleic acids identical to an ssDNA cassette and / or a target nucleic acid sequence having one or more native restriction enzyme recognition sequences (e.g., native nickase recognition sequences). In some embodiments, the ssDNA cassette is amplified using the SDA primers provided herein to generate multiple amplified ssDNA cassettes.
[0200] In some embodiments, the SDA primer includes a 3'-blocking molecule. In some embodiments, an SDA primer having a 3'-blocking molecule prevents non-specific dimerization at a lower temperature (e.g., room temperature) where DNA hybridization is not specific.
[0201] In some embodiments, the SDA primer is from about 16 to about 33 nucleotides. In some embodiments, the SDA primer is at most 33 nucleotides, such as at most 32, such as at most 31, such as at most 30, such as at most 29, such as at most 28, such as at most 27, such as at most 26, such as at most 25, such as at most 24, such as at most 23, such as at most 22, such as at most 21, such as at most 20, such as at most 19, such as at most 18, such as at most 17, such as at most 16 nucleotides.
[0202] In some embodiments, the SDA primer comprises an RNA polymerase binding sequence.
[0203] In some embodiments, the SDA primer comprises a hairpin stabilizer (e.g., the stabilizing sequence forms a double-stranded hairpin), and a sequence complementary to a target nucleic acid sequence comprising a complete nickase recognition sequence.
[0204] Enzyme Cleavage enzyme In some embodiments, the compositions and methods provided herein utilize a cleavage enzyme that aids in the amplification of a target nucleic acid sequence. In some embodiments, the cleavage enzyme may cleave one strand of a double-stranded target nucleic acid such as double-stranded DNA, and a polymerase (e.g., a DNA polymerase having strand displacement activity) may extend the target nucleic acid sequence.
[0205] In some embodiments, the cleavage enzyme is a restriction enzyme. Those skilled in the art are aware of restriction enzymes useful in the methods and compositions described herein. For example, those skilled in the art are aware of enzymes provided by commercial sources, such as the enzymes listed at www.neb.com / products / restriction-endonucleases.
[0206] Restriction enzymes are proteins isolated from bacteria that cleave DNA sequences at sequence-specific sites, generating DNA fragments with known sequences at each end. Restriction enzymes are generally classified into five types, which differ in their structure, whether they cleave their DNA substrates at their recognition sites, or whether the recognition and cleavage sites are separated from each other. Some restriction enzymes cleave DNA by making two incisions, each traversing one sugar-phosphate backbone (i.e., each strand) of the DNA double helix.
[0207] In some embodiments, a restriction enzyme is used in combination with one or more modified dNTPs. In some embodiments, following hybridization of an oligonucleotide binder to a target nucleic acid sequence, a strand-displacing DNA polymerase uses dNTPs and one or more modified dNTPs to extend the 3’ end of the oligonucleotide binder. In some embodiments, the restriction enzyme recognition sequence of a restriction enzyme is formed from one or more modified dNTP bases (s) incorporated into the reverse complementary strand, which act to block cleavage of said strand by cleavage by the restriction enzyme. In some embodiments, when a restriction enzyme recognizes its recognition sequence, it cleaves only the primer strand that does not contain modified dNTPs at the cleavage site, thus leaving the other modified strand intact (i.e., nicks). In some embodiments, the nick can be extended by a strand-displacing DNA polymerase that uses dNTPs and one or more modified dNTPs to displace the first primer strand.
[0208] Using restriction enzymes has several advantages compared to, for example, using nickases. One example is that there are far more restriction enzymes available that are not nickases than nickases, which means that the restriction enzyme(s) used in the methods or compositions of the present disclosure can be selected from a potentially large number of restriction enzymes to identify an enzyme with excellent properties regarding a given application, such as reaction temperature, buffer compatibility, stability, and reaction rate (sensitivity).
[0209] In some embodiments, the cleavage enzyme is a nickase. A nickase (or nicking endonuclease) is a subgroup of restriction enzymes that cleave only one strand of dsDNA.
[0210] When restriction enzymes bind to their recognition sequences within a DNA sequence, they hydrolyze both strands of the double-stranded target nucleic acid (i.e., the duplex) simultaneously. Two independent hydrolysis reactions proceed in parallel to hydrolyze each strand and thereby cleave the DNA strand, which is most often driven by the presence of two catalytic sites within the restriction enzyme. However, a nickase is a modified restriction enzyme that hydrolyzes only one strand of the duplex, generating a "nicked" (e.g., one strand is cleaved) DNA molecule rather than a cleavage. There are three natural nickases, Nt.BstNBI, Nb.BtsI, and Nb.BsrDI. They consist of the large subunits of heterodimeric restriction endonucleases. Therefore, the catalytic site present in the small subunit that catalyzes the cleavage of the other strand is completely absent. In some embodiments, the nickase does not exhibit double-strand cleavage activity. In some embodiments, the nickase recognizes a specific nickase recognition sequence within a nucleic acid sequence (e.g., a target polynucleotide).
[0211] In some embodiments, the compositions and methods of the present disclosure include nicking enzymes. In some embodiments, the compositions and methods provided herein use nicking enzymes to introduce a nick into a double-stranded DNA complex containing a primer (e.g., a capped SDA primer), enabling removal of a 3' blocking group during primer extension. In some embodiments, the compositions and methods provided herein use nicking enzymes to introduce a nick into a double-stranded nucleic acid, enabling strand displacement during extension. Nick, nicking, and nick introduction all refer to the cleavage of one strand (e.g., the target polynucleotide) of a dsDNA molecule by a nicking enzyme. The nicking enzymes used herein can introduce a nick at a specific nicking enzyme recognition sequence. The term cognate nicking enzyme is used to describe a nicking enzyme and its corresponding nicking enzyme recognition sequence. An example of a cognate pair is shown in Table 1.
[0212] In some embodiments, the nicking enzyme is cognate to a nicking enzyme recognition sequence on an oligonucleotide binder (e.g., a primer or probe). In some embodiments, the nicking enzyme is cognate to a nicking enzyme recognition sequence within the target nucleic acid and thus within the target amplicon.
[0213] In some embodiments, the nicking enzyme binds to a newly formed ssDNA cassette or a target nucleic acid containing one or more complete nicking enzyme recognition sites and introduces a nick into one strand (e.g., the SDA primer), thereby enabling a strand displacement polymerase to remove a 3' blocking molecule and extend the SDA primer.
[0214] In some embodiments, the nicking enzyme binds to a newly formed or pre-existing double-stranded target amplicon and introduces a nick into the strand to be extended from the SDA primer. In some embodiments, the nicking enzyme introduces a nick into the double-stranded target amplicon, which contributes to strand displacement at room temperature by a polymerase (e.g., a DNA polymerase).
[0215] In some embodiments, the compositions and methods of the present disclosure include nickases. In some embodiments, the nickase is selected from the group consisting of Nt.CviPII, Nb.BbvCI, Nb.Bpu10I, Nb.Bsal, Nb.BsmI, Nb.BsrDI, Nb.BstNBIP, Nb.BstSEIP, Nb.BtsI, Nb.SapI, Nt.AlwI, Nt.BbvCI, Nt.BhaIIIP, Nt.BpulOI, Nt.BpulOIB, Nt.Bsal, Nt.BsmAI, Nt.BsmBI, Nt.BspD6I, Nt.BspQI, Nt.Bst9I, Nt.BstSEI, Nt.CviARORFMP, Nt.CviFRORFAP, Nt.BstNBI, Nt.CviQII, Nt.CviQXI, Nt.EsaSS1198P, Nt.MlyI, and Nt.SapI. The nickase is associated with one or more nickase recognition sequences; see Table 1 below in this specification. A complete nickase recognition sequence is a sequence that is recognized by the nickase and at which nicking is introduced. A partial nickase recognition site or a part of a nickase recognition site is a sequence that has a part of the complete recognition sequence.
Table 1-1
Table 1-2
[0216] One of ordinary skill in the art will recognize that various nickases other than those listed in the present disclosure can be used in the compositions and / or methods of the present invention. In some embodiments, the nickase is Nt.CviPII. In some embodiments, the nickase is Nb.BbvCI.
[0217] In some embodiments, the oligonucleotide binders and / or target nucleic acid sequences according to the present disclosure comprise a complete or partial nickase recognition site. In some embodiments, the oligonucleotide binder comprises a partial nickase recognition sequence. In some embodiments, a partial nickase recognition sequence derived from an SDA primer and a partial nickase recognition sequence derived from a primer binding sequence form a complete nickase recognition sequence.
[0218] The nickases provided herein may be active, for example, at room temperature. In some embodiments, the nickase is stable and / or active at a temperature in the range of about 14 °C to about 45 °C, such as about 15 °C to about 35 °C.
[0219] Polymerase In some embodiments, the compositions and methods provided herein utilize a polymerase having strand displacement activity to amplify a target nucleic acid sequence and / or an ssDNA cassette. In some embodiments, the compositions and methods of the present disclosure comprise a polymerase. In some embodiments, the polymerase is a polymerase comprising strand displacement activity. A polymerase comprising strand displacement activity can displace downstream DNA during extension. In some embodiments, the polymerase is a DNA polymerase. In some embodiments, the strand displacement polymerase comprises extension activity at room temperature. In some embodiments, the strand displacement polymerase comprises extension activity at a temperature in the range of about 14 °C to about 45 °C, such as about 15 °C to about 35 °C. In some embodiments, the strand displacement polymerase has extension activity at room temperature.
[0220] In some embodiments, the DNA polymerase having strand displacement activity is selected from the group consisting of Bsu DNA polymerase I (Bsu DNAP), phi29, Bst20 DNA polymerase (Bst DNAP), Klenow Large Fragment (LF), Klenow Exo-, Bsu Large Fragment, Isopol, and Isopol SD+, or variants thereof. In some embodiments, the DNA polymerase having strand displacement activity is Bsu or a variant thereof. In some embodiments, the DNA polymerase having strand displacement activity is selected from the group consisting of Bsu DNAP, Klenow LF, Klenow Exo-, and Isopol, and Bst DNAP. In some embodiments, the DNA polymerase having strand displacement activity is Klenow or a variant thereof.
[0221] In some embodiments, the DNA polymerase having strand displacement activity is active at low temperatures. In some embodiments, the DNA polymerase having strand displacement activity is active at 15°C, 14°C, 13°C, 12°C. In some embodiments, the DNA polymerase having strand displacement activity is active at 14 to about 45°C, for example, about 15 to about 35°C.
[0222] In some embodiments, the DNA polymerase having strand displacement activity extends the SDA primer from the nick after cleavage and displaces the 3' blocking molecule.
[0223] Single-stranded binding protein The compositions and methods provided herein utilize single-stranded binding proteins (SSBPs) in some embodiments. SSBPs can stabilize the displaced strand during strand displacement polymerase extension. In some embodiments, the compositions or methods provided herein include an SSBP. In some embodiments, the SSBP binds to a DNA strand that is displaced by a strand displacement polymerase. In some embodiments, the SSBP binds to an oligonucleotide binder (e.g., a primer and / or a probe). In some embodiments, binding of the SSBP to the oligonucleotide binder prevents or reduces non-specific binding. In some embodiments, the SSB protein promotes nick extension by a polymerase (e.g., a DNA polymerase). In some embodiments, the SSBP is selected from the group consisting of RpA, T7 gp2.5, T4 gene 32 protein (T4gp32), EcoSSB, TaqSSB, and TthSSB. In some embodiments, the SSBP is T4gp32.
[0224] In some embodiments, the concentration of the single-stranded binding protein in the composition according to the present disclosure is at least 100 ng / μl, at least 200 ng / μl, at least 300 ng / μl, at least 400 ng / μl.
[0225] In some embodiments, T4gp32 is present in the composition in the range of 100 ng / μl to 500 ng / μl, such as 200 ng / μl to 500 ng / μl, such as 300 ng / μl to 400 ng / μl.
[0226] Reverse transcriptase In some embodiments, the techniques provided herein include a reverse transcriptase. In some embodiments, the reverse transcriptase has RNaseH activity. In some embodiments, the reverse transcriptase is selected from the group consisting of MMLV, AMV, Protoscript II, Superscript I and II and II and IV, RTx, GOScript, Sensiscript, Primescript, and Maxima.
[0227] Ligase In some embodiments, the compositions and methods of the present disclosure include a ligase. In some embodiments, the ligase is selected from the group consisting of SplintR, T4 ligase, T3 ligase, and T7 ligase. In some embodiments, the ligase is SplintR ligase. In some embodiments, the ligase is T4 DNA ligase. In some embodiments, the concentration of the ligase is in the range of 10 nM to 5 μM (e.g., 500 nM).
[0228] Cas enzyme The Cas enzymes were first identified as part of the CRISPR ("clustered regularly interspaced short palindromic repeats")-Cas ("CRISPR-associated") system that provides adaptive immunity to microorganisms against infectious nucleic acids. Those skilled in the art are aware of a vast number of Cas enzymes, as well as the sequence elements and functional features that classify them into different classes. Class 1 CRISPR-Cas systems have multi-subunit effector complexes, and class 2 systems have single-subunit effectors.
[0229] At least six different "types" of Cas proteins have been described, with types I, II, and IV being class 1 enzymes, while types II (including Cas9), V (including Cas12 and Cas14), and VI (including Cas13) are class 2 enzymes. Techniques for identifying and classifying Cas enzymes (e.g., based on the presence, organization, and / or sequence of the RuvC domain and / or one or more other sequence elements) are now well known in the art. Furthermore, many Cas variants have been prepared, and those skilled in the art have a sufficient understanding of the structural (e.g., sequence) elements that are involved in (e.g., necessary and / or sufficient for) the activity of Cas enzymes.
[0230] One of ordinary skill in the art, upon reading this application, will understand that the provided technology can utilize any Cas enzyme (or its variant, e.g., a modified variant) having cleavage activity that is suitable for use in various embodiments and is activated by binding of a guide nucleic acid. Further, one of ordinary skill in the art, upon reading this disclosure, will well understand, for example, design choices suitable for matching a particular type of Cas with a particular Cas-activating nucleic acid and / or cleavage substrate (e.g., a nucleic acid reporter probe).
[0231] In particular, certain Cas enzymes, including certain type V and type VI Cas enzymes, such as Cas12, Cas13, and Cas14 (e.g., Cpf1 / Cas12a, C2c2 / Cas13a, Cas13b, Cas13c, Cas14a, etc.), have been shown to have nonspecific nuclease activity that is activated when their guide nucleic acid binds to its target. This nonspecific cleavage activity is often referred to as "collateral cleavage."
[0232] Recently, nucleic acid detection systems have been developed that utilize the collateral cleavage activity of Cas proteins to detect the presence of a target nucleic acid of interest (or, more precisely, a nucleic acid containing a target site in its nucleotide sequence). In many embodiments, the compositions and methods utilize a Cas enzyme having collateral activity and detect cleavage of a nucleic acid reporter probe that is sensitive to activation of that activity / collateral cleavage activity of the Cas enzyme.
[0233] In some embodiments, the Cas enzyme is a Cas12 enzyme. In some embodiments, the Cas12 enzyme is an LbaCas12 enzyme. In some embodiments, the Cas enzyme is a Cas13 enzyme. In some embodiments, the Cas13 enzyme is a Cas13a enzyme.
[0234] In some embodiments, the Cas enzyme is a thermostable Cas enzyme. In some embodiments, the Cas enzyme is thermostable in the range of about 4°C to about 65°C.
[0235] When a Cas appropriate for the type of nucleic acid (i.e., RNA, ssDNA, or dsDNA) present in the Cas-activated nucleic acid contacts the Cas target nucleic acid, its cleavage (e.g., secondary cleavage) activity is activated, an appropriate nucleic acid reporter probe is cleaved, and a detectable signal is generated.
[0236] Guide polynucleotide In some embodiments, the guide nucleic acid hybridizes to a target nucleic acid region within the target nucleic acid. In some embodiments, the guide nucleic acid is complementary to a target nucleic acid region within the target nucleic acid.
[0237] Cas enzymes are activated to cleave nucleic acids (regardless of whether they are specific or non-specific) when their guide nucleic acids hybridize to a complementary sequence (target nucleic acid region or a portion thereof). It is well established that researchers can modify guide nucleic acids to hybridize to any target nucleic acid region. Furthermore, it is well established that guide nucleic acids may include natural nucleotides, nucleotide analogs, and / or combinations thereof. All of those established findings are relevant to the present disclosure and can be used in its practice.
[0238] For example, one of ordinary skill in the art will understand that in some embodiments, the guide nucleic acid can have a length (and / or the portion that hybridizes to the Cas recognition element) within the range of about 16 to 28 nucleotides (e.g., about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, or about 28 nucleotides).
[0239] One of ordinary skill in the art also understands that in certain embodiments, the guide nucleic acid may be less than 100% fully complementary (e.g., about 90%, about 91%, about 92%, 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% complementary) to the relevant Cas recognition element.
[0240] Buffer The methods and compositions provided herein include a buffer that provides reaction conditions suitable for amplification and / or detection of a target nucleic acid. In some embodiments, the buffer includes components that one of ordinary skill in the art would understand to be in a buffer for DNA amplification. In some embodiments, the composition further includes a buffer in which circumferential amplification of the target nucleic acid can occur. In some embodiments, the buffer includes deoxynucleotides (dNTPs). In some embodiments, the buffer includes ribonucleotides (rNTPs). In some embodiments, the buffer includes Tris or acetate. In some embodiments, the buffer includes potassium ions (K+). In some embodiments, the buffer includes potassium acetate or potassium chloride. In some embodiments, the buffer includes magnesium ions (Mg2+). In some embodiments, the buffer includes magnesium chloride. In some embodiments, the buffer includes a polymerase chain reaction accelerator (e.g., dimethyl sulfoxide (DMSO), glycerol, formamide, bovine serum albumin, ammonium sulfate, polyethylene glycol, gelatin, tween® 20, triton X®-100, or N,N,N-trimethylglycine (betaine)). In some embodiments, T7 RNA polymerase is active in the buffer. In some embodiments, Cas13 polymerase is active in the buffer. In some embodiments, Cas12 is active in the buffer.
[0241] In some embodiments, the buffer is selected from the group consisting of Tris, phosphate, HEPES, DIPSO, MOBS, HEPPSO, TAPSO, EPPS, tricine, Gly-Gly, bicine, HEPB, TEA, TAPS, AMPD, TABS, AMPSO, CHES, and CAPSO.
[0242] In some embodiments, the buffer has buffering capacity in the range of about pH 7 to about pH 8.
[0243] In some embodiments, the compositions and methods of the present disclosure include PEG. In some embodiments, the composition or method includes 1% to 20% PEG, such as 5% to 15% PEG. In some embodiments, the composition includes 10% PEG. In some embodiments, the PEG is PEG having a molecular weight in the range of 200 to PEG3350, 200 to 1000. In some embodiments, the PEG is PEG3350.
[0244] Use and Methods One of ordinary skill in the art, upon reading the present disclosure, will understand that the provided compositions and methods may be utilized in a number of different situations including, but not limited to, targeted nucleic acid synthesis (e.g., production of ssDNA cassettes), amplification, detection, or combinations thereof. In some embodiments, the provided compositions and methods may be used to determine or confirm the presence or absence of a target nucleic acid. In some embodiments, the provided compositions and methods may be used to amplify a target nucleic acid. In some embodiments, the provided compositions and methods may be used to detect or quantify the amount of target nucleic acid present in a particular sample.
[0245] In some embodiments, the SDA reaction of the present disclosure proceeds via amplification of an input of ssDNA (e.g., ssDNA cassette or ssDNA target nucleic acid) to a number of dsDNA amplicons at room temperature (e.g., 16 - 25 °C).
[0246] In some embodiments, the input of ssDNA (e.g., ssDNA cassette or ssDNA target nucleic acid) is generated using ligation, reverse transcriptase, or lysis (e.g., buffer and / or heating), etc.
[0247] In some embodiments, the present disclosure provides compositions and methods useful for the production of ssDNA cassettes.
[0248] In some embodiments, the present disclosure provides compositions and methods useful for the amplification of target nucleic acids.
[0249] In some embodiments, the present disclosure provides compositions and methods useful for detecting target nucleic acids.
[0250] DNA cassette The present disclosure provides various methods for generating ssDNA cassettes using, for example, the native nickase recognition sequences shown in FIG. 25, reverse transcription shown in FIGS. 22 and / or 38, and / or ligation shown in FIGS. 20 and / or 21.
[0251] In some embodiments, the ssDNA cassette is useful in the amplification methods described herein.
[0252] In some embodiments, one or more oligonucleotide binders provided herein are used to generate ssDNA cassettes from target nucleic acid sequences (e.g., RNA or double-stranded DNA). In some embodiments, ssDNA cassettes having SDA primer binding sequences at both ends are generated. In some embodiments, the ssDNA cassette is about 30 to about 300 nucleotides. In some embodiments, the SDA primer that hybridizes to the ssDNA cassette is extended by a DNA polymerase (e.g., Bsu DNA polymerase). In some embodiments, a nickase can cleave the SDA primer (e.g., Nb.BbvCl), and then the DNA polymerase can extend the nick, thereby discarding the 3' blocking molecule of the SDA primer.
[0253] In some embodiments, ssDNA cassettes are generated by utilizing two native nickase sequences in the target nucleic acid. In some embodiments, the SDA primers provided herein hybridize to a target nucleic acid sequence containing a native nickase recognition sequence, and then a nick is introduced into the SDA primer and the DNA polymerase extends the nick.
[0254] In some embodiments, an ssDNA cassette is generated by utilizing reverse transcriptase. In some embodiments, the oligonucleotide binders provided herein (e.g., forward primer and reverse primer) are used to generate a unique ssDNA cassette. In some embodiments, one or more SDA primers can then be used to amplify the ssDNA cassette.
[0255] In some embodiments, the ssDNA cassette comprises the SDA primer binding sequences provided herein. In some embodiments, the ssDNA cassette comprises one or more SDA primer binding sequences. In some embodiments, the ssDNA cassette comprises two or more SDA primer binding sequences.
[0256] In some embodiments, the ssDNA cassette comprises a target nucleic acid sequence or its complementary sequence, and one or more SDA primer binding sequences. In some embodiments, the SDA primer binding sequences are located at the 3' and 5' termini of the target amplicon.
[0257] In some embodiments, ligation techniques are utilized to generate ssDNA cassettes (e.g., by utilizing one or more of the probes provided herein that hybridize to a target nucleic acid and subsequently ligating using a gap filling oligo (GFO)). In some embodiments, the present disclosure utilizes ligation techniques for hybridization to a target nucleic acid. Thus, the ligation step is sequence specific to the target nucleic acid. In some embodiments, a set of ligation oligonucleotides is designed that hybridize together across adjacent target nucleic acid regions so as to ligate together hybridized oligonucleotides by the activity of a ligase to form an ssDNA cassette. This ssDNA cassette includes a complement of the entire selected target site and two SDA primer binding sequences. In some embodiments, the ssDNA cassette also includes a Cas recognition element that was not part of the same oligonucleotide prior to ligation, and typically a template element.
[0258] One of ordinary skill in the art will recognize that there are various systems that couple functional elements located on separate oligonucleotides of a set only when the set is ligated by ligation in the presence of a target nucleic acid of interest, using a set of ligation oligonucleotides, where each of the oligonucleotides of the set hybridizes to an adjacent portion of the target site (see, e.g., promoter-ligation-activation-transcription amplification of nucleic acid sequences described in U.S. Patent No. 5,194,370, U.S. Patent 6,955,901, and multiplex ligation probe amplification [MLPA] described in Nucleic Acids Research 30:e27, 2002, see, e.g., Nucleic Acids Research 42:1831, 2013, U.S. Patent Application US2014 / 0179539, and Nucleic Acids Research 33:e116, 2016 for RNA sprint nucleic acid ligase activity). Thus, one of ordinary skill in the art is well aware of the design parameters associated with the construction of the oligonucleotides within the oligonucleotide sets provided herein (see also U.S. Patent Application US2008 / 0090238).
[0259] Amplification In some embodiments, the disclosure provides methods for amplifying a target nucleic acid, e.g., a double-stranded DNA target nucleic acid comprising a first native restriction enzyme recognition sequence and a second native restriction enzyme recognition sequence on opposing strands separated by a target nucleic acid region, a double-stranded DNA target nucleic acid comprising at least one native restriction enzyme sequence, or an RNA target nucleic acid in a sample.
[0260] Amplification can be performed over a wide temperature range. The optimal temperature for amplification can be determined by the optimal temperatures of the relevant polymerase and restriction enzyme, as well as the melting temperature of the hybridization region of the oligonucleotide primers.
[0261] In some embodiments, the methods provided herein do not use temperature cycling. Further, the amplification step does not require controlled temperature variations, hot start or warm start, preheating, or controlled temperature decrease. In some embodiments, the methods according to the present disclosure enable amplification over a wide temperature range (e.g., 15°C to 60°C, e.g., 20°C to 60°C, e.g., 15°C to 45°C, or 15°C to 35°C).
[0262] In some embodiments, amplification is performed at room temperature. In some embodiments, amplification is performed without temperature cycling. In some embodiments, amplification is performed under isothermal conditions. In some embodiments, amplification is performed at a maximum of 50°C, a maximum of 45°C, a maximum of 40°C, a maximum of 35°C, a maximum of 30°C, a maximum of 25°C, a maximum of 20°C, or a maximum of 15°C.
[0263] In some embodiments, the present disclosure provides a method for amplifying a double-stranded DNA target nucleic acid comprising a first native restriction enzyme recognition sequence and a second native restriction enzyme recognition sequence on opposing strands separated by a target nucleic acid region in a sample, the method comprising: (A) contacting the sample with (a) (i) a sequence complementary to the first native restriction enzyme recognition sequence, (ii) a 3' blocking molecule, and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides comprising a first SDA primer, (b) (i) a sequence complementary to the second native restriction enzyme recognition sequence, (ii) a 3' blocking molecule, and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides comprising a second SDA primer, (c) a cleavage enzyme, (d) a DNA polymerase having strand displacement activity, (e) a single-stranded binding protein, (f) dNTP to form a reaction mixture, thereby generating a reaction mixture, (B) The reaction mixture is (i) the first and second SDA primers that hybridize to the double-stranded DNA target nucleic acid in the sample, and (ii) incubating under conditions suitable for amplification of the target nucleic acid thereby generating multiple copies of the amplified target nucleic acid. (In some embodiments, the present disclosure provides a method for amplifying a double-stranded DNA target nucleic acid sequence containing at least one natural restriction enzyme sequence in a sample, the method comprising:
[0264] (A) contacting the sample with a composition comprising: (a) a forward primer comprising a 3' nucleic acid sequence complementary to the target nucleic acid sequence downstream or 5' of the natural nickase recognition sequence, and a 5' SDA primer binding sequence comprising a partial nickase recognition; (b) a cleavage enzyme; (c) a DNA polymerase having strand displacement activity; (d) a single-stranded binding protein; (e) dNTP thereby generating a single-stranded DNA (ssDNA) cassette; (B) contacting the ssDNA cassette of step (A) with a composition comprising: (f) (i) a sequence complementary to at least one natural restriction enzyme sequence within the target nucleic acid sequence; (ii) a 3' blocking molecule; and (iii) a stabilizing sequence comprising about 8 to about 20 nucleotides thereby forming a first SDA primer; and (g) (i) a sequence complementary to the 5' SDA primer binding sequence of the forward primer, comprising a partial restriction enzyme recognition sequence; (ii) a 3' blocking molecule; and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides and a partial nickase recognition sequence that together with the partial nickase recognition sequence within the 5' SDA primer binding sequence forms a complete restriction enzyme recognition sequence thereby forming a second SDA primer; (h) A second SDA primer, comprising contacting with a composition comprising thereby generating a reaction mixture, incubating the reaction mixture under conditions favorable for the production of multiple copies of nucleic acids that are identical or complementary to the (C) ssDNA cassette.
[0265] In some embodiments, the present disclosure provides (A) a sample, (a) (i) a 3' sequence complementary to the RNA target nucleic acid, and (ii) a reverse primer comprising a 5' SDA primer binding sequence comprising a restriction enzyme recognition sequence, a partial restriction enzyme recognition sequence, or a complementary sequence thereof contacting with a composition comprising (b) reverse transcriptase, and (c) (i) a 3' sequence complementary to the RNA target nucleic acid, and (ii) a forward primer comprising a 5' SDA primer binding sequence comprising a restriction enzyme recognition sequence, a partial restriction enzyme recognition sequence, or a complementary sequence thereof contacting with a composition comprising thereby generating a first reaction mixture, incubating the first reaction mixture under conditions favorable for the production of single-stranded DNA (ssDNA) cassette, (B) (C) the ssDNA cassette of (B), (d) (i) a sequence complementary to the 5' SDA primer binding sequence of the reverse primer, (ii) a 3' blocking molecule, and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides a first SDA primer (when the reverse primer comprises only a partial restriction enzyme recognition sequence, the first SDA primer comprises a partial restriction enzyme recognition sequence, which together with the partial restriction enzyme recognition sequence within the 5' SDA primer binding sequence of the reverse primer forms a complete restriction enzyme recognition sequence), comprising (e) (i) A sequence complementary to the 5′ SDA primer binding sequence of the forward primer, (ii) a 3′ blocking molecule, and (iii) a 5′ stabilizing sequence comprising about 8 to about 20 nucleotides A second SDA primer comprising (when the forward primer contains only a partial restriction enzyme recognition sequence, the first SDA primer contains a partial restriction enzyme recognition sequence which, together with the partial restriction enzyme recognition sequence within the 5′ SDA primer binding sequence of the forward primer, forms a complete restriction enzyme recognition sequence), and (f) contacting with a composition comprising at least one cleavage enzyme, a polymerase having strand displacement activity, a single-stranded binding protein, dNTP thereby generating a second reaction mixture, and incubating the second reaction mixture under conditions favorable for the production of multiple copies of nucleic acid identical or complementary to the ssDNA cassette, to provide a method for amplifying an RNA target nucleic acid sequence in a sample. (D) comprising incubating the second reaction mixture under conditions favorable for the production of multiple copies of nucleic acid identical or complementary to the ssDNA cassette.
[0266] Detection The target nucleic acid and / or the ssDNA cassette can be detected in several ways. Those skilled in the art are familiar with various techniques useful for the detection of nucleic acids. In some embodiments, the present disclosure provides techniques for detecting a target nucleic acid, an ssDNA cassette, or both.
[0267] In some embodiments, the present disclosure provides a method for detecting a target nucleic acid sequence, e.g., a double-stranded DNA target nucleic acid sequence comprising a first native restriction enzyme recognition sequence and a second native restriction enzyme recognition sequence on opposite strands separated by the target nucleic acid region, a double-stranded DNA target nucleic acid sequence comprising at least one native restriction enzyme sequence, or an RNA target nucleic acid sequence in a sample.
[0268] In some embodiments, the detection technique includes, for example, absorbance, CRISPR / Cas detection (e.g., CRISPR-SHERLOCK), FRET, gel electrophoresis, lateral flow, mass spectrometry, PCR, real-time PCR, and / or spectroscopy. In some embodiments, the detection technique includes, for example, chemiluminescence, electrochemical techniques, fluorescence, detection of intercalating dyes, electrophoresis, and / or radiation.
[0269] In some embodiments, the detection step is performed by detecting a change in fluorescence as an indicator of amplification of the target nucleotide sequence.
[0270] In some embodiments, the change in fluorescence is an increase in the intensity of fluorescence emission of a nucleic acid probe labeled detectably.
[0271] In some embodiments, the detection technique includes, for example, colorimetry, turbidity, other types of catalysts, molecular beacons, and other oligonucleotide-based probes, aptamers, or lateral flow.
[0272] In some embodiments, the method according to the present disclosure includes detection of non-specific target nucleotide sequences. In non-specific nucleotide detection, a non-specific nucleotide reporter, such as a non-specific fluorescent DNA reporter, is used to detect nucleotide acids regardless of the specific sequence. Exemplary non-specific nucleic acid reporters include ethidium bromide, propidium iodide, crystal violet, dUTP-binding probes, DAIP (4'-,6-diamidino-2-phenylindole), 7-AAD (7-aminoactinomycin D), Hoechst33258, Hoechst33342, Hoechst34580, PICOGREEN, SYBR dyes, such as SYBR Green I, SYBR Green II, SYBR Gold. In some embodiments, the method for detecting a target nucleotide sequence utilizes a SYBR dye. In some embodiments, the method for detecting a target nucleotide sequence utilizes SYBR Green.
[0273] In some embodiments, the double-stranded DNA-binding dye is a minor groove-binding dye. In some embodiments, the minor groove-binding dye is SYBR Green I and II, DAPI, PicoGreen, or a combination thereof. In some embodiments, the double-stranded DNA-binding dye is an intercalating dye. In some embodiments, the intercalating dye is ethidium bromide, propidium iodide, EvaGreen, or a combination thereof.
[0274] In some embodiments, the techniques provided may be multiplexed. As described herein, in some embodiments, the techniques provided may be particularly useful for multiplexed (e.g., simultaneous) analysis of multiple products suitable for lateral flow assessment.
[0275] In some embodiments, the techniques provided may be multiplexed using, for example, different Cas enzymes (and / or readouts) for different target nucleic acid sequences and / or different ligation oligonucleotides.
[0276] In some embodiments, the detection methods contemplated by the present disclosure include CRISPR-based detection methods. Certain CRISPR / Cas enzymes have been identified to exhibit secondary cleavage activity when activated by binding to a target site recognized by the guide polynucleotide to which they are complexed. Cas12, Cas13, and Cas14 are non-limiting examples of CRISPR / Cas enzymes that have been shown to have such secondary cleavage activity. Some CRISPR / Cas enzymes with secondary cleavage activity digest or cleave single-stranded nucleic acids (e.g., nucleic acid probes labeled detectably). The secondary activity has been utilized in the development of CRISPR / Cas detection (e.g., diagnostic) techniques to achieve detection of nucleic acids (e.g., Cas target nucleic acids) or their complements containing relevant target sites in biological and / or environmental sample(s).
[0277] In some embodiments, the Cas enzyme has secondary activity.
[0278] CRISPR-SHERLOCK is a detection technique that includes contacting a sample that may contain a CRISPR-Cas complex comprising a Cas enzyme having secondary cleavage activity, a guide polynucleotide selected or modified to be complementary to a target nucleotide sequence (e.g., a Cas target nucleic acid sequence), and a target nucleotide sequence comprising the Cas target nucleic acid. In some embodiments, the CRISPR / Cas-based detection may be a CRISPR-Cas13-based detection system. In some embodiments, the CRISPR / Cas-based detection system is a CRISPR / Cas12-based detection system. In some embodiments, the CRISPR / Cas13 or CRISPR / Cas12-based detection system is a CRISPR-SHERLOCK detection system. In some embodiments, the methods according to the present disclosure utilize a CRISPR-SHERLOCK detection system. In some embodiments, amplified nucleotides comprising the target nucleotide sequence are incubated with a guide polynucleotide capable of binding to the target nucleotide sequence, a nucleic acid probe detectably labeled, and a Cas enzyme.
[0279] In some embodiments, the Cas enzyme is a heat-resistant Cas enzyme. The thermostable Cas enzyme can be a heat-resistant Cas enzyme described in US Publication US2023 / 0002811, published on January 5, 2023, titled "APPLICATION OF CAS PROTEIN, METHOD FOR DETECTING TARGET NUCLEIC ACID MOLECULE AND KIT", PCT Publication WO2020 / 142754, published on July 9, 2021, titled "PROGRAMMABLE NUCLEASE IMPROVEMENTS AND COMPOSITIONS AND METHODS FOR NUCLEIC ACID AMPLIFICATION AND DETECTION", PCT Publication WO2021 / 154866, published on August 5, 2021, titled "IMPROVED DETECTION ASSAYS", and PCT Publication WO2023 / 009526, published on February 2, 2023, titled "IMPROVED CRISPR-CAS TECHNOLOGIES" (the content of each is incorporated herein by reference in its entirety).
[0280] In some embodiments, the detectably labeled nucleic acid probe comprises a fluorophore terminus and a quencher group. In some embodiments, the detectably labeled nucleic acid probe comprises a fluorophore at the 5' terminus and a quencher group at the 3' terminus.
[0281] In some embodiments, the techniques according to the present disclosure utilize a guide polynucleotide. When incubated with a target polynucleotide, the guide polynucleotide can bind to a target nucleic acid region as an amplified nucleotide comprising the target nucleic acid region.
[0282] In some embodiments, the guide polynucleotide is complementary to a target nucleic acid region having one or more SNP mutations.
[0283] In some embodiments, increased transcript production can reduce the period required, particularly, for detecting nucleic acids. In some embodiments, the detection method includes a CRISPR-Cas based detection method (e.g., CRISPR-SHERLOCK). In some embodiments, the disclosed systems for nucleic acid synthesis and / or nucleic acid amplification and / or detection of nucleic acids are implemented in a single reaction vessel (a "one-pot" embodiment).
[0284] In some embodiments, the present disclosure provides a method for detecting a double-stranded DNA target nucleic acid sequence comprising a first native restriction enzyme recognition sequence and a second native restriction enzyme recognition sequence on opposing strands separated by a target nucleic acid region in a sample, the method comprising (A) contacting at least one copy of the amplified target nucleic acid sequence generated by the amplification method described herein with a composition comprising (i) a guide nucleic acid comprising a nucleic acid sequence complementary to a DNA cassette, and (ii) a Cas enzyme having secondary cleavage activity, (iii) a nucleic acid reporter probe that is sensitive to the secondary cleavage activity (the nucleic acid reporter probe has detectably different first uncleaved and second cleaved states) ; and
[0285] (B) detecting cleavage of the nucleic acid reporter probe by detecting a difference between the first and second states to determine the presence of the target nucleic acid sequence in the sample.
[0286] In some embodiments, the present disclosure provides a method for detecting a double-stranded DNA target nucleic acid sequence comprising a first native restriction enzyme recognition sequence and a second native restriction enzyme recognition sequence on opposing strands separated by a target nucleic acid region in a sample, the method comprising (A) contacting at least one copy of the amplified target nucleic acid sequence generated by the amplification method described herein with a composition comprising (i) a capture probe, and (ii) a complex capture probe comprising a detectable label and a 3' blocking entity. (B) detecting the presence of a detectable label bound to a solid matrix or bound to a moiety enabling binding to a solid material to determine the presence of a target nucleic acid sequence in a sample.
[0287] In some embodiments, the capture probe is a biotinylated capture probe. In some embodiments, the capture probe has a 5'-biotin modification. In some embodiments, the capture probe is about 10 to about 20 nucleotides. In some embodiments, the capture probe includes a 3'-blocking molecule. In some embodiments, the capture probe includes a stabilizing sequence (e.g., a linear single-stranded sequence, a hairpin stabilizer, or a combination thereof). In some embodiments, the capture probe includes a restriction enzyme recognition sequence, e.g., a nickase recognition sequence. In some embodiments, the restriction enzyme recognition sequence and / or the nickase recognition sequence includes one or more modifications (e.g., PTO linkage). In some embodiments, the capture probe includes a target nucleic acid sequence or its complementary sequence. In some embodiments, the capture probe includes a repeat strip pull down sequence. In some embodiments, the strip pull down sequence is the nucleotide sequence of SEQ ID NO: 71 (TGTATGTATGTATGA).
[0288] In some embodiments, the complex capture probe is about 10 to about 20 nucleotides. In some embodiments, the complex capture probe includes a target nucleic acid sequence or its complementary sequence. In some embodiments, the complex capture probe includes a repeat strip pull down sequence. In some embodiments, the strip pull down sequence is the nucleotide sequence of SEQ ID NO: 71.
[0289] In some embodiments, the methods and compositions provided herein can distinguish target nucleotides having sequences that contain only single nucleotide polymorphism(s) (SNP) and identify said target nucleotides. In some embodiments, the techniques provided can be utilized to detect SNP-containing nucleic acids. In some embodiments, the techniques provided can be used to detect SNP-containing nucleic acids in patient-derived sample(s). In some embodiments, the identification of nucleic acids having sequences that contain disease-associated SNP(s) can be utilized to provide information for diagnosis and / or treatment planning. In some embodiments, the number of target nucleic acids that can be distinguished from other target nucleic acids can be further expanded or improved by using multiple guide RNAs according to the disclosed techniques.
[0290] In some embodiments, the disclosed techniques can achieve the detection of one or more microorganisms or other infectious agents in a sample. In some embodiments, such a sample can be, for example, a biological sample that may be taken from a subject and may or may not include environmental samples (such as, or including, soil, water, etc.). In some embodiments, the microorganism can be, for example, a bacterium, a fungus, a yeast, a protozoan, a parasite, or a virus.
[0291] In some embodiments, the disclosed techniques are required for other techniques that identify a specific microorganism species or other infectious agent in a sample, or monitor the presence of microorganisms or other infectious agents over time (e.g., the presence of a specific microorganism or infectious protein (antigen), antibody, antibody gene, detection of a specific phenotype (e.g., bacterial resistance), monitoring of disease progression and / or outbreak, and antibiotic screening.
[0292] In some embodiments, the techniques provided achieve certain benefits and / or advantages compared to alternative techniques, such as techniques that may utilize conventional amplification methods. For example, in some embodiments, the techniques provided result in a reduced detection time compared to conventional detection methods.
[0293] Alternatively or additionally, in some embodiments, the technology provided may be particularly suitable for use in point-of-care devices. Thus, in some embodiments, the technology provided can guide a treatment plan (e.g., selection of treatment type and / or dosage and / or treatment duration).
[0294] In some embodiments, a water sample, such as a freshwater sample, a wastewater sample, or a saline sample, can be evaluated for cleanliness and / or safety, and / or potability to detect, for example, the presence of microbial contamination.
[0295] In some embodiments, the technology provided is useful for the evaluation of environmental samples. For example, residential / commercial / industrial surfaces made of any material including, but not limited to, metal, wood, plastic, rubber, etc. may be swabbed and tested for contaminants. By way of some examples, a soil sample may be tested for the presence of viral particles or fragments thereof, pathogenic bacteria or parasites, or other microorganisms for both environmental purposes and / or human, animal, or plant disease testing. A water sample, such as a freshwater sample, a wastewater sample, or a saline sample, can be evaluated for cleanliness and safety, and / or potability to detect, for example, the presence of viral particles, and / or Cryptosporidium parvum, Giardia lamblia, and / or other microbial contamination.
[0296] The identification of microorganisms can be useful and / or necessary for any number of applications, and thus any type of sample from any source deemed appropriate by one of ordinary skill in the art may be used in accordance with the present invention.
[0297] In some embodiments, the technology of the present invention is useful for genotyping.
[0298] The methods provided herein can be performed over a wide temperature range. The optimal temperature for each step is determined by the optimal temperatures of the relevant polymerase and restriction enzymes, as well as the melting temperature of the hybridization region of the oligonucleotide primers.
[0299] In some embodiments, the methods provided herein do not use temperature cycling. Further, the amplification step does not require controlled variation in temperature, nor a hot start or warm start, preheating, or a controlled temperature decrease. In some embodiments, the methods according to the present disclosure enable amplification over a wide temperature range (e.g., 15°C to 60°C, e.g., 20°C to 60°C, e.g., 15°C to 45°C, or 15°C to 35°C).
[0300] The methods are effective over a wide range of target nucleic acid concentrations, including detection down to very low target nucleic acid copy numbers. In some embodiments, the compositions and methods disclosed herein result in robust amplification of the target nucleic acid. Robust amplification of the target nucleic acid refers to compositions and methods that consistently amplify the target nucleic acid to a detectable level. One of ordinary skill in the art will understand that robustness depends on the starting concentration of the target nucleic acid in the composition or method. For example, the compositions and methods provided herein are generally expected to robustly amplify and detect attomolar amounts of target nucleic acid, e.g., at least 2 aM, at least 3 aM, at least 4 aM, at least 5 aM, at least 10 aM, at least 20 aM, at least 50 aM, or at least 100 aM of target nucleic acid.
[0301] In some embodiments, the target nucleic acid is present in a sample and is detected at a concentration of at least 2 attomolar (aM). For example, the target nucleic acid may be present in the sample at a concentration of at least 2 aM, at least 3 aM, at least 4 aM, at least 5 aM, at least 10 aM, at least 20 aM, at least 50 aM, or at least 100 aM. In some embodiments, the target nucleic acid is present in the sample at a concentration of 2 - 5 aM, 2 - 10 aM, 2 - 20 aM, 2 - 40 aM, 2 - 100 aM, 5 - 10 aM, 5 - 20 aM, 5 - 40 aM, 5 - 100 aM, 10 - 20 aM, 10 - 50 aM, 20 - 50 aM, 10 - 100 aM, 50 - 100 aM, 1 - 1000 aM, 5 - 1000 aM, or 50 - 1000 aM. In some embodiments, the sample contains other molecules, such as other non-target nucleic acids, in addition to the target nucleic acid.
[0302] In some embodiments, the methods and compositions of the present disclosure can detect a target nucleic acid present in a sample at a concentration of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 copies per microliter. In some embodiments, the methods and compositions of the present disclosure can detect a target nucleic acid present at a concentration of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 copies per reaction.
[0303] In some embodiments, a poly-T oligo is added to the detection step. Without wishing to be bound by any particular theory, the poly-T oligo may sequester excess SSB, such as T4gp32, and prevent the SSB protein from binding to the detection probe (i.e., reduce or eliminate background noise).
[0304] In some embodiments, the present invention provides a method suitable for multiplexing. In some embodiments, several different capture probes are utilized to capture a specific ssDNA cassette.
[0305] Kit This specification provides a kit for implementing the present method. The parts kit may include the compositions or their components described in this specification.
[0306] In some embodiments, a kit for implementing a method of amplifying, detecting, or combining a target nucleic acid sequence from a sample is provided. In some embodiments, the parts kit includes the compositions of the present disclosure and / or one or more of its components. In some embodiments, the parts kit may include a target nucleic acid, an oligonucleotide binder, an amplification reagent, and / or instructions for use.
[0307] In some embodiments, a kit for implementing a method of detecting a target nucleic acid sequence in a sample is provided. In some embodiments, the parts kit includes the composition according to the present invention. In some such embodiments, the parts kit may also include an amplification reagent, a device, and / or instructions for use. For example, in some particular embodiments, the parts kit may include a detector system useful for detecting a target nucleotide sequence.
[0308] In some embodiments, the parts kit also includes a control nucleic acid that can be added to the samples described herein.
Examples
[0309] Example 1: Viral particle lysis at room temperature This example demonstrates effective lysis of viral particles achieved at room temperature by using the lysis techniques provided herein.
[0310] Samples containing pooled saliva, BEIγ-irradiated SARS-CoV-2 virus (inactivated and intact virus), RNAsin, and EDTA. The starting pH of the pooled saliva was 8.4. The concentration of BEIγ-irradiated virus in the sample was 10,000 cp / ul. The concentration of RNAsin in the sample was 1 U / μl (N2511, Promega).
[0311] Two different stock (20x) lysis buffers were prepared, each of which contained zwitterionic surfactants. Specifically, as described in the following table, a LAPAO / HCl stock solution and a LDAO / NaClO / HCl stock solution were prepared.
Table 2
[0312] The lysis buffer was added to the mock sample, and the combination was incubated at room temperature (in this case, 22 °C) for a short time (specifically, 30 seconds in the reaction shown in Figure 26). This lysis reaction was stopped with a neutralization buffer (100 mM Tris, pH 9.0 for the 20x stock solution). The lysis reactions were carried out under different pH conditions including pH 2.5, pH 4.5, pH 6, pH 6.5, pH 7.5, pH 8, and pH 10. The reactants were adjusted with HCl to achieve the desired pH.
[0313] Viral particle lysis / nucleic acid preparations were evaluated by measuring the Ct value of the sample. A high Ct value indicated that viral particle lysis was insufficient or absent, while optimal viral particle lysis was indicated by a low Ct value.
[0314] Positive control As a positive control for lysis, an equivalent mock sample containing pooled saliva, BEI γ-irradiated SARS-CoV-2 virus, RNAsin, and EDTA was exposed to high temperature (specifically, incubated at 95 °C for 5 minutes) without adding a lysis buffer (e.g., LAPAO / HCl stock solution or LDAO / NaClO / HCl stock solution) or other surfactants.
[0315] Negative control Three different negative controls were prepared.
[0316] (i) "No lysis" contains a mock sample (pooled saliva, BEIγ-irradiated SARS-CoV-2 virus, RNAsin, and EDTA) without adding any lysis buffer containing surfactant and HCl. The sample was maintained at room temperature. Thus, the "no lysis" control sample was not exposed to surfactant(s), HCl, or heat.
[0317] (ii) "HCl" contains a mock sample (pooled saliva, BEIγ-irradiated SARS-CoV-2 virus, RNAsin, and EDTA) without adding any surfactant but was exposed to HCl. The sample was maintained at room temperature. Thus, the "HCl" control sample was not exposed to surfactant(s) or heat.
[0318] (iii) "Neg" or no-template control (NTC) contains only water or buffer.
[0319] As can be seen from the figures, for example, as shown in Figure 27, when using the lysis buffer provided herein, under heating conditions, an effective lysis comparable to that achieved with the positive control was achieved at pH conditions of at least less than about 6.0, particularly less than about 4.5. Figure 27 shows the results observed when the lysis reaction was carried out under different pH conditions. In particular, Figure 27 shows that lower Ct values were achieved at lower pH values. Thus, in this example, the specific effectiveness of the provided lysis reaction at low pH (i.e., better viral particle lysis) is described. The maximum lysis level was observed at the lowest pH (2.5) tested. However, these tests may not have reached the limit.
[0320] In particular, this example surprisingly shows that effective lysis of viral particles (e.g., of enveloped viral particles) in a biological sample (e.g., a crude sample, particularly a saliva sample) can be achieved by using a lysis reagent composition such as a zwitterionic surfactant (e.g., LAPAO or LDAO) at a low pH (e.g., less than 6.5, preferably less than 4.5 (particularly including less than about pH 3.0)) and at room temperature (e.g., about 22 °C). Further, the lysis achieved can be comparable to heat lysis (e.g., as observed when incubated at 95 °C for 5 minutes).
[0321] Furthermore, this example surprisingly shows that the effective lysis conditions provided are rapidly and gently neutralized by the simple addition of Tris, yielding a lysis composition suitable for further nucleic acid processing or manipulation. In particular, the present disclosure provides the insight that by using the specific zwitterionic surfactants provided herein (e.g., LAPAO and LDAO), a “Goldilocks” effect of sufficient lysis can be achieved without unwanted inhibition of downstream processing or reaction steps.
[0322] Thus, in many embodiments, subsequent manipulation and / or analysis of the nucleic acids prepared by the lysis provided herein do not require the purification or extraction steps normally required or utilized to remove surfactants. Rather, enzymes or other agents (e.g., ligases, alternatively or additionally, one or more cleavage systems such as CRISPR / Cas, TALEN, zinc fingers, restriction enzymes, and / or one or more hybridization reagents such as oligonucleotides - e.g., probes or primers) can be added directly to the lysis reaction (e.g., simultaneously or sequentially with any neutralization buffer).
[0323] Accordingly, the present disclosure provides a lysis technique that is highly compatible with nucleic acid processing and, in particular, in some embodiments, can enable so-called “one-pot” evaluations.
[0324] Example 2: Amplification of Dual Epitope Cassette (Mock Trigger) Using Different SDA Primers This example shows the amplification of a DNA cassette using different SDA primers.
[0325] Amplification of Dual Epitope Cassette (Mock Trigger) Using Different SDA Primers, TGAGGAGGAGTAATACGACTCACTATAGGGCATAAGACAAATACGACTCTGTCAGAGAGAATTAAGTAAGGAGGTTTTTTATGGATTACAAAGACCACGATGGTGACTACAAAGACCATGATATAGATTACAAGGATGATGATGATAAATTTTTAAGTGTGTCACTTAACATTTGTACATGGTCACATCCTCAATTCGAGAAGTAATAATCTCCTCCTCAGCGATCTTCGACCTTC (SEQ ID NO: 17). The amplification reaction contained either 1× Custmart, 100 ng / μL of T4 gp32 (single-stranded binding protein), 0.5 mM dNTP, and 0.25 U / μL of Bsu DNAP and 0.5 U / μL of Nb.BbvCI nickase (low), or 0.5 U / μL of Bsu DNAP and 1 U / μL of Nb.BbvCI nickase (high).
[0326] Different SDA primers were added at 1 μM: · Non-blocking standard type: GAAGGTCGAAGATCGCTGAGGAGGAG (SEQ ID NO: 21), · Non-blocking shortened type: GGGATCGCTGAGGAGGAG (SEQ ID NO: 22), and · Blocking standard type: GAAGGTCGAAGATCGCTGAGGAGGAG (SEQ ID NO: 23) (blocked with 3C6).
[0327] The expression cassette was amplified for 2 hours, followed by expression for 2 hours using the NEBExpress kit, and the 3×FLAG-1×StrepII dual epitope expression cassette was detected by lateral flow. The results show that the non-blocking shortened primers brought about amplification, while the primers with a blocking group showed better performance even when longer primers were used (Figure 1).
[0328] Example 3: Amplification of Dual Epitope Cassettes of Different Lengths This example shows the amplification of DNA cassettes of different lengths. The reaction contained 1×Custmart, 100 ng / μL of T4gp32, 0.5 mM of dNTP, 0.25 U / μL of Bsu DNAP, 0.5 U / μL of Nb.BbvCI nickase, and 1 μM of the shortened SDA primer (SEQ ID NO: 22). Different expressions were added at the indicated concentrations: · TGAGGAGGAGTAATACGACTCACTATAGGGCATAAGACAAATACGACTCTGTCAGAGAGAATTAAGTAAGGAGGTTTTTTATGGATTACAAAGACCACGATGGTGACTACAAAGACCATGATATAGATTACAAGGATGATGATGATAAATTTTTAAGTGTGTCACTTAACATTTGTACATGGTCACATCCTCAATTCGAGAAGTAATAATCTCCTCCTCAGCGATCTTCGACCTTC (SEQ ID NO: 17) (386 bp), · TGAGGAGGAGTAATACGACTCACTATAGGGCATAAGACAAATACGACTCTGTCAGAGAGAATTAAGTAAGGAGGTTTTTTATGGATTACAAAGACCACGATGGTGACTACAAAGACCATGATATAGATTACAAGGATGATGATGATAAATTTTTAAGTGTGTCACTTAACATTTGTACAAGTGCGTGGTCACATCCTCAATTCGAGAAGGGCGGCGGGAGTGGAGGTGGCTCCGGTGGATCTGCTTGGTCACACCCCCAATTCGAAAAATAATAATCTCCTCCTCAGCGATCTTCGACCTTC (SEQ ID NO: 18) (220 bp), · TGAGGAGGAGTAATACGACTCACTATAGGGCATAAGACAAATACGACTCTGTCAGAGAGAATTAAGTAAGGAGGTTTTTTATGGATTACAAGGATGATGATGATAAATTTTTAAGTGTGTCACTTAACATTTGTACATGGTCACATCCTCAATTCGAGAAGTAATAATCTCCTCCTCAGCGATCTTCGACCTTC (SEQ ID NO: 19) (244 bp), and · TGAGGAGGAGTAATACGACTCACTATAGGGCATAAGACAAATACGACTCTGTCAGAGAGAATTAAGTAAGGAGGTTTTTTATGGATTACAAGGATGATGATGATAAATTTTTAAGTGTGTCACTTAACATTTGTACAAGTGCGTGGTCACATCCTCAATTCGAGAAGGGCGGCGGGAGTGGAGGTGGCTCCGGTGGATCTGCTTGGTCACACCCCCAATTCGAAAAATAATAATCTCCTCCTCAGCGATCTTCGACCTTC (SEQ ID NO: 20) (178 bp).
[0329] The cassette starting material was amplified for 2 hours, and subsequently the product was gel electrophoresed on a 2% E-Gel. 3×F 1×S (SEQ ID NO: 18) and 1×F 1×S (SEQ ID NO: 20), having nucleotide lengths of 220 bp and 178 bp respectively, were amplified and detected using various SDA primer concentrations (Figure 2).
[0330] Example 4: Amplification of Dual Epitope Cassettes of Different Lengths This example shows the amplification of dual epitope cassettes of different lengths.
[0331] The reaction mixture contained 1×Custmart, 100 ng / μL of T4gp32, 0.5 mM of dNTP, 0.25 U / μL of Bsu DNAP, 0.5 U / μL of Nb.BbvCI nickase, and 1 μM of a shortened SDA primer (SEQ ID NO: 22). Different expressions were added at the indicated concentrations · SEQ ID NO: 17 (386 bp), · SEQ ID NO: 18 (220 bp), · SEQ ID NO: 19 (244 bp), and · SEQ ID NO: 20 (178 bp).
[0332] The cassette was amplified for 2 hours, and subsequently expressed for 2 hours using the NEBExpress kit, and the dual epitope peptide was detected by lateral flow. Amplification was improved when the cassette was shorter and the SDA primer concentration was higher, compared to when the cassette was longer and the SDA primer concentration was lower (Figure 3).
[0333] Example 5: Lateral Flow LOD of Cassettes Using Cap-SDA This example shows the lateral flow LOD of cassettes using Cap-SDA.
[0334] The reactants contained 1× Custmart, 100 ng / uL of T4 gp32, 0.5 mM of dNTP, 0.25 U / uL of Bsu DNA Polymerase, 0.5 U / uL of Nb.BbvCI nickase, and 1 uM of a blocking SDA primer (blocked with SEQ ID NO: 23 (3C6)). The 3×FLAG-1×StrepII cassette (SEQ ID NO: 17) was added at the indicated concentrations (2 fM, 200 aM, 20 aM, 2 aM, and 200 zM). The cassette was amplified for 2 hours and then expressed for 2 hours using the NEBExpress kit, and the dual epitope peptide was detected by lateral flow.
[0335] When the cassette was amplified and expressed, it was detected at all cassette concentrations (in the range of 2 fM to 200 zM). This example demonstrated the ability to detect the cassette when present at very low concentrations in the sample (Figure 4).
[0336] Example 5: Ligation reaction followed by amplification using single-stranded binding protein This example shows the reduction of the NTC background signal from a ligation reaction amplified by Cap-SDA using hyperthermostable (ET)-SSB.
[0337] The ligation reaction mixture contained 1×T4 ligase buffer, 2 nM probe mixture (TGAGGAGGAGTAATACGACTCACTATAGGGGCACAATCACCAA (SEQ ID NO: 24), AAGATCTGAATCGTGGTCACATCCTCAATTCGAGAAGTAATAATCTCCTCCTCA (SEQ ID NO: 25) (including 5PHOS), TCAAAGTTGAATCTGCATAAGGAGGTTTTTTATGGATTACAAAGACCACGATGGTGACTACAAAGACCATGATATAGATTACAAGGATGATGATGATAAATCAGAGACAAAGTCATT (SEQ ID NO: 26) (including 5PHOS)), 500 nM SplintR ligase, and 10% PEG-3350 and / or 25 ng / μL ET-SSB if indicated. After 30 minutes, these reaction mixtures were further amplified by Cap-SDA. The Cap-SDA reaction mixture contained 1×Custmart, 100 ng / μL of T4gp32, 0.5 mM of dNTP, 0.25 U / μL of Bsu DNA polymerase, 0.5 U / μL of Nb.BbvCI nickase, and 1 μM of a blocked SDA primer (SEQ ID NO: 23 (blocked with 3C6)). The ligation reaction mixtures were amplified for 2 hours, followed by expression for 2 hours using the NEBExpress kit, and the dual epitope peptide was detected by lateral flow.
[0338] Using a single-stranded binding protein (ET-SSB) during amplification reduces the NTC background signal (Figure 5).
[0339] Example 7: Ligation Reaction and Subsequent Amplification This example demonstrates the reduction of the NTC background signal from a ligation reaction mixture amplified by Cap-SDA using an A probe containing a ribosome binding site (RBS) (novel design).
[0340] The ligation reaction mixture contained 1×T4 ligase buffer, 2 nM probe mixture (SEQ ID NO: 24, SEQ ID NO: 25 (including 5PHOS), SEQ ID NO: 26 (including 5PHOS 10 (old design)), and TGAGGAGGAGTAATACGACTCACTATAGGGGATTAAGTAAGGAGGTTTTTTATGGCACAATCACCAA (SEQ ID NO: 27), AAGATCTGAATCGTGGTCACATCCTCAATTCGAGAAGTAATAATCTCCTCCTCA (SEQ ID NO: 28) (including 5PHOS), TCAAAGTTGAATCTGCAGATTACAAAGACCACGATGGTGACTACAAAGACCATGATATAGATTACAAGGATGATGATGATAAATCAGAGACAAAGTCATT (SEQ ID NO: 29) (including 5PHOS (new design))), 500 nM SplintR ligase, and 10% PEG-3350 and / or 25 ng / μL ET-SSB if indicated. After 30 minutes, these reaction mixtures were further amplified by Cap-SDA. The Cap-SDA reaction mixture contained 1×Custmart, 100 ng / μL of T4gp32, 0.5 mM dNTP, 0.25 U / μL of Bsu DNA polymerase, 0.5 U / μL of Nb.BbvCI nickase, and 1 μM of a blocked SDA primer (blocked with 3C6, SEQ ID NO: 23). The ligation reaction mixtures were amplified for 2 hours, followed by expression for 2 hours using the NEBExpress kit, and the dual epitope peptide was detected by lateral flow.
[0341] This example shows that a probe design (old design) with the RBS incorporated into the GFO resulted in a significant background signal in all combinations of PEG and / or SSB tested in the ligation step, while a probe design (new design) with the RBS incorporated into the A probe resulted in a low background, especially in the presence of SSB (Figure 6).
[0342] Example 8: Ligation and Subsequent Amplification This example shows the detection of the SARS gRNA target in the ligation reaction products amplified by Cap-SDA using different probe designs.
[0343] The ligation reaction mixture consisted of 1× T4 ligase buffer, 2 nM of a probe mixture (30 bp standard - SEQ ID NO: 27, SEQ ID NO: 28 (including 5PHOS), SEQ ID NO: 29 (including 5PHOS), 40 bp Gap - TGAGGAGGAGTAATACGACTCACTATAGGGGATTAAGTAAGGAGGTTTTTTATGTTATTAGCTGTATGT (SEQ ID NO: 30), CAGCGTACCCGTAGGCTGGTCACATCCTCAATTCGAGAAGTAATAATCTCCTCCTCA (SEQ ID NO: 31) (including 5PHOS), ACAGTTGCACAATCAGATTACAAAGACCACGATGGTGACTACAAAGACCATGATATAGATTACAAGGATGATGATGATAAATCTGAATCGACAAG (SEQ ID NO: 32) (including 5PHOS), 51 bp HybSeqs Equal Length - TGAGGAGGAGTAATACGACTCACTATAGGGGATTAAGTAAGGAGGTTTTTTATGTTATTAGCTGTATGTACAGTTGCACA (SEQ ID NO: 33), ATCGACAAGCAGCGTACCCGTAGGCTGGTCACATCCTCAATTCGAGAAGTAATAATCTCCTCCTCA (SEQ ID NO: 34) (including 5PHOS), ATCACCAATCAAAGTTGAATCTGCAGATTACAAAGACCACGATGGTGACTACAAAGACCATGATATAGATTACAAGGATGATGATGATAAATCAGAGACAAAGTCATTAAGATCTGA (SEQ ID NO: 35) (including 5PHOS), 51 bpHybSeqs - TGAGGAGGAGTAATACGACTCACTATAGGGGATTAAGTAAGGAGGTTTTTTATGTTATTAGCTGTATGTACAGTTGCACAATCACCAA (SEQ ID NO: 36), AAGATCTGAATCGACAAGCAGCGTACCCGTAGGCTGGTCACATCCTCAATTCGAGAAGTAATAATCTCCTCCTCA (SEQ ID NO: 37) (including 5PHOS), TCAAAGTTGAATCTGCAGATTACAAAGACCACGATGGTGACTACAAAGACCATGATATAGATTACAAGGATGATGATGATAAATCAGAGACAAAGTCATT (SEQ ID NO: 38) (including 5PHOS), 500 nM SplintR ligase, 10% PEG - 3350, and 25 ng / uL ET - SSB. After 30 minutes, these reactions were further amplified by Cap - SDA. The Cap - SDA reaction contained 1×Custmart, 100 ng / uL of T4gp32, 0.5 mM of dNTP, 0.25 U / uL of Bsu DNAP, 0.5 U / uL of Nb.BbvCI nickase, and 1 uM of a blocked SDA primer (SEQ ID NO: 23 (blocked with 3C6)). The ligation reaction was amplified for 2 hours, followed by expression for 2 hours using the NEBExpress kit, and the dual epitope peptide was detected by lateral flow.
[0344] Figure 7 shows that the signal intensity is improved by introducing a gap between two hybridization regions using a longer hybridization length (Figure 7).
[0345] Example 9: Detection of synthetic ssDNA target This example shows the detection of a synthetic ssDNA target containing the ORF1 SARS sequences (Long Trig - TGAGGAGGAGATGTTCAACAATGGGGTTTTACAGGTAACCTACAAAGCAACCATGATCTGTATTGTCAAGTCCACTCCTCCTCA (SEQ ID NO: 40), Short Trig - TGAGGAGGAGATACAGATCATGGTTGCTTTGTAGGTTACCTGTAAAACCTCCTCCTCA (SEQ ID NO: 39)).
[0346] The Cap - SDA reaction mixture contained 1×Custmart, 100 ng / μL of T4gp32, 0.5 mM of dNTP, 1 mM of rNTP, 2.5 mM of DTT, 5 U / μL of T7 RNAP, 200 nM of RNAse Alert, 1 μM of a blocked SDA primer (SEQ ID NO: 23 (blocked with 3C6)), 100 nM of a blocked T7 - SDA primer (TAATACGACTCACTATAGGGCTGAGGAGGAG (SEQ ID NO: 41) (blocked with 3C6)), and 10 nM of a Cas13 / crRNA complex (GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACGAUCAUGGUUGCUUUGUAGGUUACCUGU (SEQ ID NO: 69)). They also contained either 0.5 U / μL of Bsu DNAP and 1 U / μL of Nb.BbvCI nickase from a low - concentration (LC) stock (5 U / μL Bsu, 10 U / μL Nb.BbvCI), or the same amounts of polymerase and nickase from a high - concentration (HC) stock (50 U / μL Bsu, 400 U / μL Nb.BbvCI), or contained a high - concentration IsoPol DNAP stock (35 U / μL Isopol) instead of Bsu. Detection was performed in real - time by measuring fluorescence with a plate reader.
[0347] This example shows that the use of the LC enzyme stock solution (5 U / μL Bsu, 10 U / μL Nb.BbvCI) combined with a high level of glycerol did not result in a decrease in performance compared to the HC enzyme stock solution (50 U / μL Bsu, 400 U / μL Nb.BbvCI) (Figure 8).
[0348] Example 10: Detection of Synthetic ssDNA Targets This example shows the detection of a synthetic ssDNA target (DNA cassette) containing the ORF1 SARS sequence (Short Trig - SEQ ID NO: 39) with or without treatment with Klenow Fragment (KF).
[0349] The Cap - SDA reaction mixture contained 1×Custmart, 100 ng / μL of T4gp32, 0.5 mM dNTP, 1 mM rNTP, 2.5 mM DTT, 5 U / μL of T7 RNAP, 1 μM blocking SDA primer (SEQ ID NO: 23 (blocked with 3C6)), 100 nM blocking T7 - SDA primer (SEQ ID NO: 41 (blocked with 3C6)), 0.5 U / μL of Bsu DNAP, and 1 U / μL of Nb.BbvCI nickase from a high - concentration stock (50 U / μL Bsu, 400 U / μL Nb.BbvCI). Additionally, either 1×EvaGreen dye was added or 200 nM of RNAse Alert using a 10 nM Cas13 / crRNA complex (Seq53) was added. Detection was performed in real - time by measuring fluorescence with a plate reader. The blocking SDA primers were pre - treated either as untreated (suspended in water) or KF - treated (incubated at 37 °C for 1 hour with 0.5 U / μL of Klenow Fragment in Tris buffer containing 10 mM MgCl2 and no dNTP, followed by heat - killing at 85 °C for 20 minutes). The 3′ - exonuclease activity of KF enriches only the blocked primers and cleaves the unblocked primers.
[0350] This example shows that treatment of the SDA primers with KF delayed the start of the NTC curve without delaying the start of the target curve (measured with either Evagreen dsDNA dye or Cas13 output) (Figure 9).
[0351] Example 11: Amplification after Reverse Transcriptase and Ligase Reactions This example shows the detection of SARS irradiated virus particles using either reverse transcriptase (A) or ligase reaction (B), followed by amplification by Cap-SDA.
[0352] Prior to detection, the encapsulated SARS virus was lysed using the SARSBEGONE reagent (0.1% LAPAO and 10 mM HCL, neutralized with 100 mM Tris pH9). The reverse transcriptase reaction contained 1× Protoscript II buffer, 10 mM DTT, 4 U / μL Protoscript II RT Pol, 25 ng / μL ET-SSB, 0.1 U / μL RNaseH, 0.5 mM dNTP, and 20 nM F primer and R primer (TGAGGAGGAGATGTTCAACAATGGG (SEQ ID NO: 42) and CCGATCGCTGAGGAGGAGTGGACTTGACAA (SEQ ID NO: 46)). The ligation reaction contained 1× T4 ligase buffer, 2 nM probe mixture (TGAGGAGGAGGACAATACAGATCA (SEQ ID NO: 56), TGGTTGCTTTGT (SEQ ID NO: 57) (containing 5PHOS), AGGTTACCTGTAAACTCCTCCTCA (SEQ ID NO: 58) (containing 5PHOS), 500 nM SplintR ligase, 10% PEG-3350, and 25 ng / μL ET-SSB. The Cap-SDA reaction contained 1× Custmart, 100 ng / μL T4gp32, 0.5 mM dNTP, 1 mM rNTP, 2.5 mM DTT, 5 U / μL T7 RNAP, 1 μM blocking SDA primer (SEQ ID NO: 23 (blocked with 3C6)), 100 nM blocking T7-SDA primer (SEQ ID NO: 41 (blocked with 3C6)), 0.5 U / μL Bsu DNAP, 1 U / μL Nb.BbvCI nickase from high concentration stock (50 U / μL Bsu, 400 U / μL Nb.BbvCI), 200 nM RNAse Alert, and 10 nM Cas13 / crRNA complex (SEQ ID NO: 69). Detection was performed in real-time by measuring fluorescence with a plate reader.
[0353] These data indicate that both the RT polymerase and SplintR ligation-based workflows are compatible with the SARSBEGONE lysis reagent (Figure 10).
[0354] Example 12: Reverse Transcriptase Reaction and Subsequent Amplification This example shows the detection of SARS gRNA using reverse transcriptase and subsequent amplification by Cap-SDA.
[0355] The reverse transcriptase reaction contained 1× Protoscript II buffer, 10 mM DTT, 4 U / μL Protoscript II RT Pol, 25 ng / μL ET-SSB, 0.1 U / μL RNaseH, 0.5 mM dNTP, and the indicated RT primers (F and Rv2 pair design, SEQ ID NO: 42, TGAGGAGGAGATGTTCAACAAT (SEQ ID NO: 43), TGAGGAGGAGATGTTCAACA (SEQ ID NO: 44), CCGATCGCTGAGGAGGAGTGGACTTGACAATAC (SEQ ID NO: 45), SEQ ID NO: 46, and CCGATCGCTGAGGAGGAGTGGACTTGAC (SEQ ID NO: 47)).
[0356] The Cap-SDA reaction contained 1× Custmart, 100 ng / μL T4gp32, 0.5 mM dNTP, 1 mM rNTP, 2.5 mM DTT, 5 U / μL T7 RNAP, 1 μM blocking SDA primer (blocked with 3C6, SEQ ID NO: 23), 100 nM blocking T7-SDA primer (blocked with 3C6, SEQ ID NO: 41), 0.5 U / μL Bsu DNAP, 1 U / μL Nb.BbvCI nickase from high concentration stock (50 U / μL Bsu, 400 U / μL Nb.BbvCI), 200 nM RNAse Alert, and 10 nM Cas13 / crRNA complex (SEQ ID NO: 69). Detection was performed in real-time by measuring fluorescence with a plate reader, showing endpoint signals at 120 minutes or 150 minutes.
[0357] The results show that the range of hybridization lengths (10 nt - 15 nt primers) and primer concentrations (20 aM - 1 M) for reverse transcriptase primers can facilitate signal detection (Figure 11).
[0358] Example 13: Reverse Transcriptase Reaction Containing Bump Primers and Subsequent Amplification This example shows the detection of SARS gRNA using reverse transcriptase and subsequent amplification by Cap - SDA.
[0359] The reverse transcriptase reaction contained 1×Protoscript II buffer, 10 mM DTT, 4 U / μL Protoscript II RT Pol, 25 ng / μL ET - SSB, 0.1 U / μL RNaseH, 0.5 mM dNTP, and the indicated RT primers (SEQ ID NO: 42, TGAGGAGGAGTGGACTTGACAATAC (SEQ ID NO: 48), and ATTACGTCTATAATC (SEQ ID NO: 49)) including bump primers. The Cap - SDA reaction contained 1×Custmart, 100 ng / μL T4gp32, 0.5 mM dNTP, 1 mM rNTP, 2.5 mM DTT, 5 U / μL T7 RNAP, 1 μM blocking SDA primer (blocked with 3C6, SEQ ID NO: 23), 100 nM blocking T7 - SDA primer (blocked with 3C6, SEQ ID NO: 41), 0.5 U / μL Bsu DNAP, 1 U / μL Nb.BbvCI nickase from high - concentration stock (50 U / μL Bsu, 400 U / μL Nb.BbvCI), 200 nM RNAse Alert, and 10 nM Cas13 / crRNA complex (SEQ ID NO: 69). Detection was performed in real - time by measuring fluorescence with a plate reader.
[0360] The results show that the RT - SDA workflow can be used even with the addition of bump primers (Figure 12).
[0361] Example 14: Reverse Transcriptase Reaction and Subsequent Amplification This example shows the detection of SARS gRNA using reverse transcriptase followed by amplification by Cap-SDA.
[0362] The reverse transcription reaction contained 1× Protoscript II buffer, 10 mM DTT, 4 U / μL Protoscript II RT Pol, 25 ng / μL ET-SSB, 0.1 U / μL RNaseH, 0.5 mM dNTP, and the indicated RT primers (SEQ ID NO: 42 and SEQ ID NO: 46). The Cap-SDA reaction contained 1× Custmart, 100 ng / μL T4gp32, 0.5 mM dNTP, 1 mM rNTP, 2.5 mM DTT, 5 U / μL T7 RNAP, 1 μM blocking SDA primer (blocked at 3C6, SEQ ID NO: 23), 100 nM blocking T7-SDA primer (blocked at 3C6, SEQ ID NO: 41), 0.5 U / μL Bsu DNAP, 1 U / μL Nb.BbvCI nickase from high concentration stock (50 U / μL Bsu, 400 U / μL Nb.BbvCI), 200 nM RNAse Alert, and 10 nM Cas13 / crRNA complex (SEQ ID NO: 69). Additionally, the Cap-SDA reaction either did not contain Klenow LF or contained 0.0125 U / μL Klenow LF. Detection was performed in real-time by measuring fluorescence with a plate reader.
[0363] Figure 13 shows that the sensitivity of the RT-SDA workflow is improved when low concentrations of Klenow Large Fragment DNA polymerase are added to the SDA reaction (Figure 13).
[0364] Example 15: Ligation Reaction and Subsequent Amplification This example shows the detection of SARS gRNA using a ligation reaction (using probes with different hybridization lengths as shown in Figure 14) followed by amplification by Cap-SDA.
[0365] The ligation reaction mixture contained 1×T4 ligase buffer, 2 nM of probe mixture (probe mixture 1 - TGAGGAGGAGATACAGATCATGGT (SEQ ID NO: 50), TGCTTTGTAG (SEQ ID NO: 51) (containing 5PHOS), GTTACCTGTAAAACCTCCTCCTCA (SEQ ID NO: 52) (containing 5PHOS 34, 35, 36), probe mixture 2 - TGAGGAGGAGATACAGATCATGGT (SEQ ID NO: 53), TGCTTTGTAGGT (SEQ ID NO: 54) (containing 5PHOS), TACCTGTAAAACCCCTCCTCCTCA (SEQ ID NO: 55) (containing 5PHOS 37, 38, 39), probe mixture 3 - SEQ ID NO: 56, SEQ ID NO: 57 (containing 5PHOS), SEQ ID NO: 58 (containing 5PHOS), probe mixture 4 - TGAGGAGGAGCCATGGACTTGACAATACAGATCA (SEQ ID NO: 59), TGGTTGCTTTGT (SEQ ID NO: 60) (containing 5PHOS), AGGTTACCTGTAAAACCCCATTGTCTCCTCCTCA (SEQ ID NO: 61) (containing 5PHOS), 500 nM of SplintR ligase, 10% PEG - 3350, and 25 ng / μL of ET - SSB. The Cap - SDA reaction mixture contained 1×Custmart, 100 ng / μL of T4gp32, 0.5 mM of dNTP, 1 mM of rNTP, 2.5 mM of DTT, 5 U / μL of T7 RNAP, 1 μM of blocking SDA primer (SEQ ID NO: 23 (blocked with 3C6)), 100 nM of blocking T7 - SDA primer (SEQ ID NO: 41 (blocked with 3C6)), 0.5 U / μL of Bsu DNAP, 1 U / μL of Nb.BbvCI nickase from high - concentration stock (50 U / μL Bsu, 400 U / μL Nb.BbvCI), 200 nM RNAse Alert, and 10 nM Cas13 / crRNA complex (SEQ ID NO: 69). Detection was performed in real - time by measuring fluorescence with a plate reader, and the signal at the 120 - minute time point was displayed.
[0366] The results show that probe mixture 1 using short probes (14 nt) and short GFOs, as well as probe mixture 4 using long probes (24 nt), result in a loss of sensitivity, i.e., the ability to detect the target nucleic acid sequence (Figure 14).
[0367] Example 16: Detection of ssDNA synthetic target This example shows the detection of a 2 fM ssDNA synthetic target containing the SARS ORF1 sequence by Cap-SDA (TGAGGAGGAGGACAATACAGATCATGGTTGCTTTGTAGGTTACCTGTAAACTCCTCCTCA (SEQ ID NO: 68)).
[0368] The Cap-SDA reaction contained 1×Custmart, 100 ng / uL of T4 gp32, 0.5 mM dNTP, 1 mM rNTP, 2.5 mM DTT, 5 U / uL of T7 RNAP, 1 uM blocking SDA primer (SEQ ID NO: 23 (blocked with 3C6)), 100 nM blocking T7-SDA primer (SEQ ID NO: 41 (blocked with 3C6)), 0.5 U / uL of Bsu DNAP, 1 U / uL of Nb.BbvCI nickase from high-concentration stock (50 U / uL Bsu, 400 U / uL Nb.BbvCI), and 10 nM Cas13 / crRNA complex (SEQ ID NO: 69). Additionally, either 200 nM or 8 uM of a fluorophore-quencher reporter was included (RURURURURURURURURURURURU (SEQ ID NO: 62) (containing 56FAM and 3BQH1), RURURURURU (SEQ ID NO: 63) (containing 56FAM and 3BQH1), ATRURUGC (SEQ ID NO: 64) (containing 5HEX and 3IWBK)). Detection was performed in real-time by measuring fluorescence with a plate reader.
[0369] The results show that both FAM and HEX can be used for the Cas13 cleavage reporter, and the shorter the sequence of the cleavage reporter, the shorter the time until results are obtained. (Figure 15).
[0370] Example 17: Ligation reaction and subsequent amplification This example shows the colorimetric detection of SARS gRNA at the indicated concentrations, using a ligase reaction followed by amplification by Cap-SDA.
[0371] The ligation reaction contained 1×T4 ligase buffer, 2 nM probe mixture, 500 nM SplintR ligase, 10% PEG-3350, and 25 ng / uL ET-SSB. The Cap-SDA reaction contained 1×Custmart, 100 ng / uL T4gp32, 0.5 mM dNTP, 1 mM rNTP, 2.5 mM DTT, 5 U / uL T7 RNAP, 1 uM blocking SDA primer (blocked at 3C6, SEQ ID NO: 23), 100 nM blocking T7-SDA primer (blocked at 3C6, SEQ ID NO: 41), 0.5 U / uL Bsu DNAP, 1 U / uL Nb.BbvCI nickase from high-concentration stock (50 U / uL Bsu, 400 U / uL Nb.BbvCI), 20 uM FQ reporter (containing 56FAM and 3BQH1, SEQ ID NO: 63), and 10 nM Cas13 / crRNA complex (SEQ ID NO: 69). Detection was performed in real time by observing the color change and a photograph was taken at 90 minutes.
[0372] The results show that a visible color change occurred upon reporter activation using a fluorescence-quencher cleavage reporter concentration of 20 aM - 1 fM, which was not observed in the control samples (Figure 16).
[0373] Example 18: Amplification of dsDNA Containing a Natural Nickase Site This example shows the detection in a one-pot SDA reaction of a dsDNA target (CCGATCGCTGAGGAGGAGTGGACTTGACAATACAGATCATGGTTGCTTTGTAGGTTACCTGTAAAACCCCATTGTTGAACATCAATCATAAACGGATTATAGACGTAATCAAATCCAATAGA, SEQ ID NO: 65) containing a natural nickase site.
[0374] The Cap-SDA reactants included 1x Custmart, 100 ng / μL of T4 gp32, 0.5 mM of dNTP, 1 mM of rNTP, 2.5 mM of DTT, 5 U / μL of T7 RNAP, 1 μM of blocking SDA primer (blocked with SEQ ID NO: 23 (3C6)), 100 nM of blocking T7-SDA primer (blocked with SEQ ID NO: 41 (3C6)), 0.5 U / μL of Bsu DNAP, 1 U / μL of Nb.BbvCI nickase from high-concentration stock (50 U / μL Bsu, 400 U / μL Nb.BbvCI), 200 nM of FQ reporter (SEQ ID NO: 63 (containing 5’6FAM and 3’BQH1)), and 10 nM of Cas13 / crRNA complex (SEQ ID NO: 69). Additionally, F primer and F bump primer (SEQ ID NO: 42 and SEQ ID NO: 49) were added. Detection was performed in real time by measuring fluorescence with a plate reader.
[0375] The results showed one-pot detection of dsDNA targets (Figure 17). The bump primer was used to single-strand the DNA strands generated by the opposing primers after priming and extension.
[0376] Example 19: Lateral Flow Detection of ssDNA This example shows the detection of ssDNA synthesis targets (SEQ ID NO: 68, - indicates 0 fM and + indicates 20 fM) in a lateral flow output from Cap-SDA reactants using capture oligos.
[0377] The Cap-SDA reaction mixture contained 1×Custmart, 100 ng / μL of T4 gp32, 0.5 mM of dNTP, 1 mM of rNTP, 2.5 mM of DTT, 5 U / μL of T7 RNAP, 1 μM of blocking SDA primer (blocked with SEQ ID NO: 23 (3C6)), 100 nM of blocking T7-SDA primer (blocked with SEQ ID NO: 41 (3C6)), 0.5 U / μL of Bsu DNAP, and 1 U / μL of Nb.BbvCI nickase from high-concentration stock (50 U / μL Bsu, 400 U / μL Nb.BbvCI). Additionally, biotin-probe and FAM-probe at the indicated concentrations were added (TACCTGTAAACTCCTCCTCA (SEQ ID NO: 66) (including 3’ BIOTEG) and ATCATGGTTGCTTTGTAGGT (SEQ ID NO: 67) (including 5’ 6-FAM and 3C6)). After 2 hours, detection was performed using a biotin-FAM lateral flow strip.
[0378] The results show the detection of an SDA amplification cassette using two hybridization probes and a lateral flow strip (Figure 18).
[0379] Example 20: Detection of ssDNA This example shows the detection of an ssDNA synthetic target (2 fM, SEQ ID NO: 68) by Cap-SDA reaction under standard or pH-adjusted conditions.
[0380] The Cap-SDA reaction mixture contained 1x Custmart, 100 ng / uL of T4 gp32, 0.5 mM dNTP, 1 mM rNTP, 2.5 mM DTT, 5 U / uL of T7 RNAP, 1 uM of blocking SDA primer (blocked at 3C6, SEQ ID NO: 23), 100 nM of blocking T7-SDA primer (blocked at 3C6, SEQ ID NO: 41), 0.5 U / uL of Bsu DNAP, 1 U / uL of Nb.BbvCI nickase from high concentration stock (50 U / uL Bsu, 400 U / uL Nb.BbvCI), 200 nM of FQ reporter (SEQ ID NO: 63 containing 5’6FAM and 3’BQH1), and 10 nM of Cas13 / crRNA complex (SEQ ID NO: 69). Additionally, either 8.3 mM of NaOH and 3.33 mM of Tris pH 7.5 were added or nothing was added. Detection was performed in real-time by measuring fluorescence with a plate reader.
[0381] The results show that the Cap-SDA reaction using a higher pH than the standard resulted in more rapid detection of the ssDNA target (Figure 19).
[0382] Example 21: Amplification Using Nb.BbvCI Endogenous Nick This example demonstrates the detection of a dsDNA genomic target (Ct-extracted genome) using the Nb.BbvCI endogenous nick site by a Cap-SDA reaction without using a bump primer (using only the opposing primer).
[0383] The Cap-SDA reaction mixture contained 100 mM Tris pH 7, 10 mM KOAc, 100 ng / μL T4 gp32, 0.5 mM dNTP, 1 mM rNTP, 2.5 mM DTT, 5 U / μL T7 RNAP, 1 μM blocking SDA primer (25 nucleotides in length, blocked with 3C6), 100 nM blocking T7-SDA primer (30 nucleotides in length, blocked with 3C6), 100 nM 22-nucleotide opposing oligo, 0.5 U / μL Bsu DNAP, 1 U / μL Nb.BbvCI nickase from high-concentration stock (50 U / μL Bsu, 400 U / μL Nb.BbvCI), 200 nM FQ reporter (rUrUrUrUrU (SEQ ID NO: 2) (containing 5′ 6FAM fluorophore and 3′ BQH1 quencher)), and 10 nM Cas13 / crRNA complex (GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACUUAGUUCCUAGGUACUAUACGUUAUGUC (SEQ ID NO: 1)). Target dsDNA was denatured in a mixture of 80 mM KOH and 30 mM MgOAc and then added to the reaction mixture to initiate the reaction (final KOH was 40 mM and final MgOAc was 15 mM). The reaction was carried out at room temperature.
[0384] This example shows dsDNA amplification by Nb.BbvCI nickase using a single endogenous nick site without using a bump primer (Figure 28). This example shows a detection method that eliminates the need to design additional primers (Figure 28) and also shows improved assay speed and sensitivity compared to workflows using bump primers (Figure 17).
[0385] Example 22: Amplification Using Nickases Nt.CviPII and LwCas13a This example shows the detection of a dsDNA genomic target (Ng extracted genome) by Cap-SDA reaction with nickases Nt.CviPII and LwCas13a using a short endogenous CCD nickase recognition site.
[0386] The Cap-SDA reactants contained 50 mM Tris pH 8.75, 50 mM KOAc, 200 ng / uL T4 gp32, 0.5 mM dNTP, 0.5 mM rNTP, 2.5 mM DTT, 2 U / uL T7 RNAP, 250 nM of each blocking SDA primer (both having a length of 29 nucleotides and blocked with 3C6), 200 nM of the blocking T7-SDA primer (having a length of 28 nucleotides and blocked with 3C6), 0.5 U / uL Bsu DNAP, 0.05 U / uL of Nt.CviPII nickase from a high concentration stock (165 U / uL Bsu, 20 U / uL Nt.CviPII), 200 nM of the FQ reporter (rUrUrUrUrU (SEQ ID NO: 2) containing a 5’ 6FAM fluorophore and a 3’ BQH1 quencher), and 10 nM of the Cas13 / crRNA complex. The target dsDNA was diluted in 30 mM MgOAc and then added to the reactants to initiate the reaction (final MgOAc was 15 mM). The reaction was carried out at room temperature.
[0387] This data shows detection using an Nt.CviPII-based workflow targeting two opposing endogenous nick sites and Cas13 signal output. Figure 29 shows high sensitivity of the target and detection within 10 - 15 minutes. Compared to the Nb.BbvCI-based workflow, the sensitivity and time to result are improved (time to result has changed from 25 - 90 minutes to 10 - 15 minutes compared to Figure 28).
[0388] Example 23: Amplification Using Nickases Nt.CviPII and LbCas12a This example shows the detection of a dsDNA genomic target (Ng extracted genome) by a Cap-SDA reaction using nickases Nt.CviPII and LbCas12a using short endogenous CCD nickase recognition sites.
[0389] The Cap-SDA reaction mixture contained 50 mM Tris pH 8.75, 50 mM KOAc, 150 ng / µL T4 gp32, 0.5 mM dNTP, 2.5 mM DTT, 1 µM of each blocking SDA primer (TGCTGCAGCTAGAAGTCCGAGAAGT (SEQ ID NO: 3) (blocked by 3C6) and TGCTGCAGCTAGAAGTCCGTAGACA (SEQ ID NO: 4) (blocked by 3C6)), 0.5 U / µL Bsu DNA polymerase, 0.1 U / µL Nt.CviPII nickase from high-concentration stock (165 U / µL Bsu, 20 U / µL Nt.CviPII), 200 nM FQ reporter (TTATTTTATT (SEQ ID NO: 5) (containing 56FAM fluorophore and 3BQH1 quencher)), and 10 nM Cas12 / gRNA complex (UAAUUUCUACUAAGUGUAGAUGAAGTGATGACGAGTGTCTA (SEQ ID NO: 6)). The target dsDNA was diluted in 30 mM MgOAc and then added to the reaction mixture to initiate the reaction (final MgOAc was 15 mM). The reaction was carried out at room temperature.
[0390] This data shows detection using an Nt.CviPII-based workflow targeting two opposing endogenous nick sites and Cas12 signal output. Figure 30 shows that the target nucleic acid can be detected within 8 minutes using this Nt.CviPII-based workflow.
[0391] Example 24: Amplification Using Nickase Nt.CviPII This example shows the detection of dsDNA genomic targets (Ng-extracted genome) by Cap-SDA reaction with nickase Nt.CviPII using short endogenous CCD nickase recognition sites in a direct oligopulldown assay on a lateral flow strip.
[0392] The amplified substance is detected by direct capture on a lateral flow strip (capture order 4×TGTA). The Cap-SDA reaction mixture contained 50 mM Tris pH 8.75, 50 mM KOAc, 200 ng / μL T4gp32, 0.5 mM dNTP, 2.5 mM DTT, 250 nM blocking SDA primers (both 29 nucleotides in length and blocked with 3C6), 0.5 U / μL Bsu DNAP, 0.05 U / μL Nt.CviPII nickase from high concentration stock (165 U / μL Bsu, 20 U / μL Nt.CviPII), and 250 nM amplicon capture probe. The target dsDNA was diluted in 30 mM MgOAc and then added to the reaction mixture to initiate the reaction (final MgOAc was 15 mM). After the reaction was carried out at room temperature for 30 minutes, it was performed on a lateral flow strip. The lateral flow running buffer contained 50 mM Tris pH 8.75, 50 mM KOAc, 2% Ecosurf, and 2 μM poly-T oligo to reduce background.
[0393] This data shows detection using a cSDA amplification reaction with a direct oligopulldown assay on a lateral flow strip. All reaction bands (200, 200, 100, 100, 20, 20, 20, 20) were visible on the lateral flow strip (Figure 31).
[0394] Example 25: Amplification Using Nickase Nt.CviPII and Subsequent Multiplex Detection This example shows multiplex detection of two dsDNA genomic targets (either Ct or Ng extracted genome) by a Cap-SDA reaction using nickase Nt.CviPII with a short endogenous CCD nickase recognition site.
[0395] The amplified material is detected by direct capture on a lateral flow strip (capture sequence 4×TGTA (for Ng) and 4×TTGA (for Ct)). The Cap-SDA reaction mixture contained 50 mM Tris pH 8.75, 50 mM KOAc, 200 ng / μL T4gp32, 0.5 mM dNTPs, 2.5 mM DTT, 250 nM blocking SDA primer (29 or 32 nucleotides in length, blocked with 3C6), 0.5 U / μL Bsu DNA polymerase, 0.05 U / μL Nt.CviPII nickase from high concentration stock (165 U / μL Bsu, 20 U / μL Nt.CviPII), and 250 nM amplicon capture probe. The target dsDNA was diluted in 30 mM MgOAc and then added to the reaction mixture to initiate the reaction (final MgOAc was 15 mM). The reaction was carried out at room temperature for 30 minutes and then performed on a lateral flow strip. The lateral flow running buffer contained 50 mM Tris pH 8.75, 50 mM KOAc, 2% Ecosurf, and 2 μM polyT oligo to reduce background.
[0396] The Nt.CviPII workflow using lateral flow readout was multiplexable (Figure 32). Specifically, two primer pairs were amplified independently in the presence of each other and their products were detected independently on a lateral flow strip using different pulldown capture sequences (Figure 32).
[0397] Example 26: Amplification Using Nickase Nt.CviPII This example demonstrates the detection of a dsDNA genomic target (Ng extracted genome) by Cap-SDA reaction using nickase Nt.CviPII with a short endogenous CCD nickase recognition site.
[0398] The amplified substance is detected by direct capture on a lateral flow strip (capture order 4×TGTA). The "Biophos" capture probe used is single-stranded or contains a hairpin. The Cap-SDA reaction mixture contained 50 mM Tris pH 8.75, 50 mM KOAc, 500 ng / μL T4gp32, 0.5 mM dNTP, 2.5 mM DTT, 250 nM each of blocking SDA primers (both 29 nucleotides in length and blocked with 3C6), 0.5 U / μL Bsu DNAP, 0.05 U / μL Nt.CviPII nickase from high concentration stock (165 U / μL Bsu, 20 U / μL Nt.CviPII), and 250 nM amplicon capture probe. The target dsDNA was diluted in 30 mM MgOAc in the presence of 10 ng / μL background hgDNA and then added to the reaction mixture to initiate the reaction (final MgOAc was 15 mM). The reaction was carried out at room temperature for 30 minutes and then performed on a lateral flow strip. The lateral flow running buffer contained 50 mM Tris pH 8.75, 50 mM KOAc, 2% Ecosurf, and 2 μM polyT oligo to reduce background.
[0399] Background DNA is known to be the major inhibitory compound found in clinical sample matrices. This example shows that the use of a hairpin stabilizer - Biophos SDA primer improves the performance of the cSDA assay in the presence of human genomic DNA (Figure 33).
[0400] Example 27: Amplification Using Single-Stranded or Double-Stranded Hairpin SDA Primers This example shows the detection of a synthetic ssDNA target (TGAGGAGGAGGAAGTGGATGACGAGTGTCTACTCCCCCTCA (SEQ ID NO: 7)) by Cap-SDA reaction using a primer stabilizer that is either a single-stranded or double-stranded hairpin.
[0401] The Cap-SDA reaction mixture contained 50 mM Tris pH 8.75, 50 mM KOAc, 100 ng / μL or 200 ng / μL of T4 gp32 as indicated, 0.5 mM dNTP, 0.2× EvaGreen DNA dye, 2.5 mM DTT, 1 μM blocking SDA primer (GAAGGTCGAAGATCGCTGAGGAGGAG (SEQ ID NO: 8) (blocked with 3SpC3)) and an SDA primer having a length of 38 nucleotides (blocked with 3SpC3), 0.5 U / μL of Bsu DNA polymerase, and 1 U / μL of Nb.BbvCI nickase from a high concentration stock (165 U / μL Bsu, 400 U / μL). The target ssDNA was diluted in 75 mM MgOAc and then added to the reaction mixture to initiate the reaction (final MgOAc was 15 mM). The reaction was carried out at room temperature. The average values of two replicates are shown.
[0402] The results show that amplification using an SDA primer with a hairpin stabilizer results in faster amplification compared to an SDA primer with a single-strand stabilizer, i.e., the detection time is shortened when using an SDA primer with a hairpin stabilizer (Figure 34). Furthermore, the performance of the hairpin stabilizer is independent of the T4 gp32 concentration, while the single-strand stabilizer decreases dramatically at high T4 gp32 concentrations (Figure 34). Using a hairpin stabilizer allows for a higher T4 gp32 concentration, which is very beneficial in the presence of clinical sample matrices containing significant amounts of background DNA.
[0403] Example 28: Amplification Using Single-Stranded or Double-Stranded Hairpin SDA Primers This example shows the detection of a dsDNA genomic target (Ng-extracted genome) by Cap-SDA reaction using a primer stabilizer that is either a single-stranded or double-stranded hairpin. The reaction was carried out in the presence or absence of a 20 ng human genomic DNA background.
[0404] The Cap-SDA reactants were 50 mM Tris pH 8.75, 50 mM KOAc, 200 ng / uL T4 gp32, 0.5 mM dNTP, 1 mM rNTP, 2.5 mM DTT, 5 U / uL T7 RNAP, 250 nM each of blocking SDA primers (blocked with 3C6, SEQ ID NO: 3), (blocked with 3C6, SEQ ID NO: 4), or SDA primers having a length of 36 nucleotides and blocked with 3C6), 200 nM blocking T7-SDA primer (TAATACGACTCACTATAGGGCCGAGAAGTG (SEQ ID NO: 9) (blocked with 3SpC3)), 0.5 U / uL Bsu DNAP, 0.05 U / uL Nt.CviPII nickase from high-concentration stock (165 U / uL Bsu, 20 U / uL Nt.CviPII), 200 nM FQ reporter (SEQ ID NO: 2 (containing 56FAM fluorophore and 3BQH1 quencher)), and 10 nM Cas13 / crRNA complex (GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACAGACACUCGUCAUCACUUCU (SEQ ID NO: 10)). The target ssDNA was diluted in 75 mM MgOAc and then added to the reactants to initiate the reaction (final MgOAc was 15 mM). The reaction was carried out at room temperature. The average values of two replicate tests are shown.
[0405] Figure 35 shows that in amplification using Cap-SDA primers with a single-strand stabilizer, the target nucleic acid in the presence of human genomic DNA could not be stably detected, while in Cap-SDA primers with a hairpin stabilizer, stable detection of the target nucleic acid in the presence of human genomic DNA was shown compared to amplification and detection in the absence of human genomic DNA (Figure 35). The hairpin stabilizer can help recover signal loss when amplifying in the presence of human background DNA. When using Cap-SDA primers with a hairpin stabilizer instead of those with a single-strand stabilizer, a high T4 gp32 concentration is tolerated.
[0406] Example 29: SDA Using Nt.CviPII Nickase This example shows the detection of a synthetic ssDNA target (CCATGCACGTGCGAAGAAGCTATAAGACATGTACGTGCATGGACTTCTAGCTGCAGCA (SEQ ID NO: 11)) by Cap-SDA reaction using Nt.CviPII nickase with a short CCD nickase recognition site.
[0407] The Cap-SDA reaction mixture contained 50 mM Tris pH 8.75, 50 mM KOAc, 400 ng / uL T4gp32, 0.5 mM dNTP, 2.5 mM DTT, 500 nM blocking SDA primer (TGCTGCAGCTAGAAGTCCATGCACGT (SEQ ID NO: 12) (blocked with 3C6)), 0.2× Evagreen DNA dye, 0.5 U / uL Bsu DNA polymerase from high concentration stock (165 U / uL Bsu, 20 U / uL Nt.CviPII), and 0.05 U / uL Nt.CviPII nickase. The target ssDNA was diluted in 30 mM MgOAc and then added to the reaction mixture to initiate the reaction (final MgOAc was 15 mM). The reaction was carried out at room temperature. The SDA primer was pre-treated with Klenow Large Fragment (KF) by incubating at 37°C for 1 hour in 50 mM Tris pH 8.75, 50 mM KOAc, 10 mM MgOAc, and 1 U / uL Klenow Large Fragment or without Klenow Large Fragment, followed by inactivation at 85°C for 20 minutes.
[0408] A Klenow Fragment DNA polymerase with specific 3’exo activity was used to improve the purity of the Cap-SDA primer pool and enrich the SDA primer with a blocked 3’ end. The Cap-SDA primer with a free 3’ end can be extended by DNA polymerase.
[0409] This data shows that removing the capless primer with a free 3’ end reduces the rate of primer dimer formation, thereby improving assay performance (Figure 36).
[0410] Example 30: Amplification Using Nickase Nt.CviPII This example demonstrates the detection of synthetic ssDNA targets (SEQ ID NOs: 31, 32, 33, 34 shown in Table 3) by Cap-SDA reaction using nickase Nt.CviPII with a short CCD nickase recognition site. [Table 3]
[0411] The Cap-SDA reaction mixture contained 50 mM Tris pH 8.75, 50 mM KOAc, 400 ng / μL T4gp32, 0.5 mM dNTP, 2.5 mM DTT, 500 nM blocking SDA primer (blocked with 3C6), 0.2x Evagreen DNA dye, 0.5 U / μL Bsu DNA polymerase, and 0.05 U / μL Nt.CviPII nickase from a high-concentration stock (165 U / μL Bsu, 20 U / μL Nt.CviPII). The target ssDNA was diluted in 30 mM MgOAc and then added to the reaction mixture to initiate the reaction (final MgOAc was 15 mM). The reaction was carried out at room temperature. The ssDNA targets either did not contain an internal nicking sequence in the amplicon region or contained one internal nicking sequence in the amplicon region.
[0412] This data shows that when using the Nt.CviPII workflow targeting two opposing natural nick sites, the target region can be amplified even when additional endogenous nick sites are present within the amplicon (i.e., between the two opposing nick sites targeted by the primers) (Figure 37). This enables targeting a much wider range of sequences, providing more flexibility in designs that take into account conserved sequences and unwanted similarities to cross-reactive species.
[0413] Example 31: Sponge Oligo Nucleotides Neutralize T4gp32-Related Background This example shows that the background test line signal can be removed by adding Sponge Oligo nucleotides to the running buffer.
[0414] The capped SDA reaction containing 50 mM Tris pH 8.75, 50 mM KOAc, 200 ng / uL T4gp32, 0.5 mM dNTP, 2.5 mM DTT, and 250 nM amplicon capture probe was diluted 1:1 with a running buffer containing either 50 mM Tris pH 8.75 and 50 mM KOAc, 10% non-fat milk in 50 mM Tris pH 8.75 and 50 mM KOAc, or 2 uM "Sponge Oligo" in 50 mM Tris pH 8.75 and 50 mM KOAc. The mixture was then flowed onto a lateral flow strip designed to pull down the positive control oligo by either hapten pulldown or oligo pulldown.
[0415] When a reaction containing both T4gp32 and the capture probe is flowed onto a lateral flow strip such as Hapten Pulldown or Oligo Pulldown using only Tris running buffer, a significant background test line signal is observed (see Figure 40). The background noise is induced by the presence of T4gp32 in combination with the detection probe. Adding milk protein to the running buffer as a blocking method reduced the background test line signal somewhat (Figure 40). The addition of Sponge Oligo to the running buffer was an efficient method for neutralizing the background (Figure 40). Sponge Oligo likely binds to excess T4gp32 and neutralizes its background-inducing behavior.
[0416] Example 32: Viral Particle Lysis at Room Temperature This example shows effective lysis of viral particles and effective inhibition of RNase at room temperature by using the lysis techniques provided herein.
[0417] Viral lysis FluA and SARS-CoV-2 frozen titer determination virus stocks were added to either 10 mM Tris-HCl, 1 mM EDTA (pH 8.0) buffer (TE buffer), or one of three nasal swab matrices (created by eluting one anterior nasal swab in 1 mL of TE buffer). These artificial specimens were treated with 20 mM sodium hydroxide (NaOH) or a heat lysis step of 95 °C / 3 min, and 5 mM TCEP (reducing agent) present was used as a positive control. A portion of the lysed material was added to a reverse transcriptase (RT) reaction at room temperature (22 °C) to convert the released viral RNA to cDNA at a 1:1 ratio. The RT reaction was stopped by heat inactivating the RT reaction. A portion of the RT reaction was added to a standard qPCR reaction using primers and taqman probes specific to the appropriate virus.
[0418] Viral particle lysis preparations were evaluated by measuring the Cq value of the samples. A high Cq value indicated that viral particle lysis was insufficient or absent, while optimal viral particle lysis was indicated by a low Cp value.
[0419] The results show that FluA (Figure 41A) and SARS-CoV-2 (SCV2) (Figure 41B) viruses can be effectively lysed and detected in nasal swab matrices at room temperature with 20 mM NaOH, equivalent to or better than the heat lysis control conditions.
[0420] RNase inhibition Nasal swab matrices were created by eluting one anterior nasal swab in 1 mL of TE buffer. The swab matrices were then treated with a commercially available RNase inhibitor or 15 mM NaOH. Residual RNase activity was analyzed using a standard RNase Alert protocol.
[0421] The results indicate that NaOH treatment effectively reduced the amount of RNase activity present in the samples (Figure 42). NaOH has the additional advantage of inhibiting RNase present in the clinical matrix and protecting the viral genome released from both pre-lysed virions and virions lysed by the treatment.
[0422] pH solution Samples were generated by diluting a SARS-CoV-2 (SCV2) virus stock in TE buffer. Samples were treated with KOH concentrations of 10 mM, 25 mM, 50 mM, 75 mM, or 100 mM, or NaOH concentrations of 10 mM, 25 mM, 50 mM, 75 mM, or 100 mM. A heat lysis step of 95 °C / 3 min was used as a positive lysis control. A portion of the lysed material was added to a reverse transcriptase (RT) reaction at room temperature (22 °C in this case) to convert the released viral RNA to cDNA at a 1:1 ratio. The RT reaction was stopped by heat inactivating the RT. A portion of the RT reaction was then added to a standard qPCR reaction using primers and taqman probes specific for the appropriate virus.
[0423] Virus particle lysis preparations were evaluated by measuring the Cq value of the samples. High Cq values indicated insufficient or no lysis of virus particles, while optimal virus particle lysis was indicated by low Cp values.
[0424] These results show that both NaOH and KOH are effective in releasing viral nucleic acids over a range of concentrations (Figure 43).
[0425] Hydroxide-based chemical lysis of non-enveloped viruses Samples were prepared by diluting a human adenovirus stock in TE buffer. Samples were left at room temperature (22 °C), heated to 95 °C (heat lysis), or treated for 5 minutes while increasing the concentration of NaOH (20 mM, 40 mM, 60 mM, 80 mM, 100 mM, or 200 mM).
[0426] After treatment, the solution was analyzed by qPCR, and viral nucleic acid release was determined using human adenovirus-specific PCR primers and taqman probes.
[0427] The results show that NaOH lysis of non-enveloped human adenovirus at room temperature releases more DNA than heat lysis (Figure 44).
[0428] Example 33: Bacterial lysis at room temperature This example demonstrates effective bacterial lysis at room temperature by using the lysis techniques provided herein.
[0429] Bacterial lysis Samples were generated by diluting freshly grown N. gonorrhoeae or C. Trachomatis (from frozen stock) in TE buffer. The samples were then treated with KOH concentrations of 10 mM, 25 mM, 50 mM, 75 mM, or 100 mM. The bead method (bead lysis) was used as a positive control. A portion of the lysate was then added to a standard qPCR reaction using primers and taqman probes specific for the appropriate bacteria.
[0430] Bacterial lysis preparations were evaluated by measuring the Cq value of the samples. High Cq values indicated insufficient or no bacterial lysis, while optimal viral particle lysis was indicated by low Cq values.
[0431] The results show that KOH lysis at high concentrations, specifically above 25 mM, is efficient at releasing bacterial nucleic acids over a certain concentration range (Figures 45A - B). In particular, at concentrations of 100 mM and 200 mM, lysis similar to or better than bead lysis was shown (Figures 45A - B).
[0432] Addition of surfactant Samples were generated by diluting N. gonorrhoeae in TE buffer. Subsequently, the samples were treated with 50 mM KOH and additional surfactant as shown in Figure 46. The bead method (bead lysis) was used as a positive control.
[0433] By adding surfactant, the lysis efficiency at low concentrations of KOH can be enhanced.
[0434] Example 34: Lysis at Various Incubation Temperatures This example demonstrates effective bacterial lysis at various temperatures by using the lysis techniques provided herein.
[0435] Samples were prepared by diluting N. gonorrhoeae in TE buffer. As shown below, the samples were treated with KOH or additives and incubated at the indicated temperatures for 3 - 5 minutes. Thermal lysis at 95 °C was used as a positive control. A portion of the lysate was added to the PCR reaction, and the nucleic acid concentration reflecting nucleic acid release was measured for each sample. The results were normalized against thermal lysis at 100% (95 °C).
[0436] PI64 9 Samples were treated with KOH or HCl or 0.5% PI64 9 and incubated at room temperature (22 °C), 50 °C or 65 °C (see the table below).
Table 4
[0437] The results show that 50 mM KOH achieves effective bacterial lysis regardless of temperature or the addition of additional surfactant, while Pl64 alone is not effective (Figure 47). Treatment with 13.5 mM HCl showed better lysis at higher temperatures with the addition of additional surfactant, but not as good as KOH (Figure 47).
[0438] ESH9 The samples were treated with KOH or HCl and 3% ESH9 and incubated at room temperature (22 °C), 50 °C, or 70 °C for 3 - 5 minutes.
Table 5
[0439] These results show effective lysis of N. gonorrhoeae using 50 mM KOH, regardless of the lysis temperature. Treatment with HCl + Ecosurf showed better lysis at higher temperatures, especially at 50 °C and 65 °C lysis, but was less effective than KOH (Figure 48). Furthermore, no lysis was observed with incubation alone at 50 °C or 70 °C without surfactant or additive (Figure 48).
[0440] NP40 - certain KOH concentrations The samples were treated with 50 mM KOH or HCl and 1% - 3% NP40 and incubated at room temperature (22 °C) or 50 °C for 3 - 5 minutes.
Table 6
[0441] The results show that NP40 alone is not effective in releasing gDNA and that effective bacterial lysis is achieved with 50 mM KOH, regardless of temperature or addition of additional surfactant (Figure 49). Treatment with 13.5 mM HCl showed better lysis at higher temperatures with the addition of additional surfactant, but not as good as KOH (Figure 49).
[0442] NP40 - various KOH concentrations The samples were treated with 0 mM - 50 mM KOH or HCl and 3% NP40 and incubated at room temperature (22 °C) or 50 °C for 3 - 5 minutes.
Table 7
[0443] The results show that in the presence of 3% NP40, the same lysis as with 50 mM KOH alone can be achieved using a lower concentration of KOH (Figure 50).
[0444] Improvement of LAMP-Cas detection Samples were treated with 50 mM KOH and incubated at room temperature (22 °C) for 3 - 10 minutes. The lysed samples containing the released nucleic acids were amplified by LAMP and detected by the Cas detection system.
[0445] The results show that when the samples were lysed either with KOH or heat lysis, the LoD was improved compared to the no-lysis control (Figure 51).
[0446] Example 35: KOH lysis of N. gonorrhoeae in vaginal matrix in LAMP-Cas This example shows effective bacterial lysis within the vaginal matrix by using the lysis techniques provided herein.
[0447] Samples were prepared by diluting N. gonorrhoeae in vaginal swab matrix (one swab eluted in 3 mL of buffer). Samples were treated with 0 mM, 15 mM, 25 mM, 50 mM, or 85 mM KOH and DNA was detected by LAMP-Cas reaction (performed at 60 °C in ABI QS5).
[0448] The results show that at low KOH concentrations, specifically 15 mM KOH, there is no improvement in the sensitivity to the LAMP Cas reaction compared to no KOH treatment. Treating bacterial cells in the vaginal matrix at higher concentrations, specifically 25 mM or above, improves the sensitivity of the LAMP Cas reaction (Figure 52). Treatment of bacterial cells with KOH above 25 mM releases more genomic DNA for downstream amplification.
[0449] Equivalents Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, numerous equivalents to the specific embodiments of the invention described herein. The scope of the invention is not intended to be limited to the foregoing description, but rather is as set forth in the following claims.
Claims
1. (a) A double-stranded DNA target nucleic acid sequence comprising a first native restriction enzyme recognition sequence and a second native restriction enzyme recognition sequence on the opposing strand, separated by the target nucleic acid region, (b) (i) A sequence complementary to the first natural restriction enzyme recognition sequence, (ii) 3' blocking molecule, and (iii) 5' stabilizing sequence containing at least 8 nucleotides Including the first SDA primer, (c) (i) A sequence complementary to the second restriction enzyme recognition sequence, (ii) 3' blocking molecule, and (iii) 5' stabilizing sequence containing at least 8 nucleotides A second SDA primer, (d) cleavage enzyme, (e) DNA polymerase having strand substitution activity, (f) Single-chain binding proteins, and (g) dNTP A composition containing the following:
2. The composition according to claim 1, wherein the 3'-blocking molecule of the first and / or second SDA primer is selected from the group consisting of 3'ddNTP, 3'Inverted dT, 3'carbon chain spacer, 3'hexanediol, 3'amino spacer, and 3'phosphorylation, and the 3'carbon chain spacer is a carbon chain bonded to a 3'OH group that blocks extension.
3. The composition according to claim 1, wherein at least one of the 5' stabilizing sequences is a hairpin stabilizing sequence.
4. The composition according to claim 1, wherein at least one of the 5' stabilizing sequences includes a T7 promoter sequence.
5. (i) The DNA polymerase is selected from the group consisting of Bsu DNAP, Klenow LF, Klenow Exo-, and Isopol, and Bst DNAP. (ii) The single-chain binding protein is T4gp32, or (iii) The composition according to claim 1, wherein the concentration of the single-chain binding protein is at least 200 ng / μl.
6. The composition according to claim 1, wherein the composition further comprises KOAc or PEG.
7. (i) The first and second innate restriction enzyme recognition sequences are about 3 to about 7 nucleotides, (ii) The first and second natural restriction enzyme recognition sequences are natural nickase recognition sequences, or (iii) The composition according to claim 1, wherein the first and second innate restriction enzyme recognition sequences are CCD nickase recognition sequences, and the nickase is Nt. CviPII nickase.
8. The composition according to claim 1, wherein at least one of the dNTPs is a modified dNTP.
9. The composition according to claim 1, wherein the first SDA primer sequence complementary to the first innate restriction enzyme recognition sequence and the second SDA primer sequence complementary to the second innate restriction enzyme recognition sequence each comprise (i) one or more modified nucleotides and (ii) one or more phosphorothioate (PTO) bonds.
10. The composition further comprises (h) (i) A guide nucleic acid containing a nucleic acid sequence complementary to the target nucleic acid region or portion thereof, (ii) A Cas enzyme having secondary cleavage activity, wherein the Cas enzyme is a Cas13 enzyme or a Cas12 enzyme, and (iii) A nucleic acid reporter probe that is highly sensitive to the secondary cleavage activity and, as a result, has detectably distinct first uncleaved state and second cleaved state. Detection system including The composition according to claim 1, comprising:
11. The composition according to claim 10, wherein the nucleic acid reporter probe comprises a fluorophore and a quencher.
12. The composition further comprises (h) (i) Capture probe, and (ii) A composite capture probe including a detectable label and a 3' blockage entity Detection system including The composition according to claim 1, comprising:
13. The composition according to claim 12, wherein the capture probe is a biotinylated capture probe and the complex capture probe is about 10 to about 20 nucleotides.
14. The composition according to claim 12, wherein the capture probe includes a stabilizing array.
15. The composition according to claim 1, wherein the at least one nickase recognition sequence is a GCTGAGG nickase recognition sequence.
16. A method, (a) Amplifying a double-stranded DNA target nucleic acid sequence comprising a first native restriction enzyme recognition sequence and a second native restriction enzyme recognition sequence on the opposing strand, separated by the target nucleic acid region in the sample, wherein the amplification is performed (A) The sample is (a) cleavage enzyme, (b) DNA polymerase having strand displacement activity, (c) Single-chain binding proteins, and (f) dNTP Contact with a composition containing, This generates a single-stranded DNA (ssDNA) cassette, (B) The ssDNA cassette produced in step (A) (e) (i) A sequence complementary to the first natural restriction enzyme recognition sequence, (ii) 3' blocking molecule, and (iii) 5' stabilizing sequence containing at least 8 nucleotides Including the first SDA primer, (f) (i) A sequence complementary to the second natural restriction enzyme recognition sequence, (ii) 3' blocking molecule, and (iii) 5' stabilizing sequence containing at least 8 nucleotides A second SDA primer, (g) a cutting enzyme; (h) DNA polymerase having strand substitution activity, (i) Single-chain binding proteins, (j) dNTP Contact with a composition containing, This generates a reaction mixture, (C) The reaction mixture is incubated under conditions suitable for generating multiple copies of nucleic acid identical or complementary to the ssDNA cassette. This includes the amplification, which involves generating multiple amplified copies of the target nucleic acid, and (b) detecting the double-stranded DNA target nucleic acid sequence, wherein the detection is (1) (A) At least one of the multiple copies of the amplified target nucleic acid, (i) A guide nucleic acid containing a nucleic acid sequence complementary to the DNA cassette, and (ii) Cas enzyme having secondary cleavage activity, (iii) A nucleic acid reporter probe that is highly sensitive to the secondary cleavage activity and, as a result, has detectably distinct first uncleaved state and second cleaved state. Contact with a composition containing, (B) By detecting the difference between the first state and the second state, the cleavage of the nucleic acid reporter probe is detected, and the presence of the target nucleic acid sequence in the sample is determined, or (2) (A) At least one of the amplified target nucleic acids of the plurality of copies, (i) Capture probe, and (ii) A composite capture probe including a detectable label and a 3' blockage entity Contact with a composition containing, (B) Determining the presence of the target nucleic acid sequence in the sample by detecting the presence of the detectable label bound to a solid substrate, wherein the amplification and detection are performed (i) at room temperature, (ii) without temperature cycling, and (iii) at a maximum of 50°C, the amplification The method, including the method described above.
17. A composition, (a) RNA target nucleic acid, (b) (i) a 3' sequence complementary to the RNA target nucleic acid, and (ii) A 5'SDA primer binding sequence comprising a restriction enzyme recognition sequence, a partial restriction enzyme recognition sequence, or a complementary sequence thereof. Reverse primers including (c) Reverse transcriptase, (d) (i) a 3' sequence complementary to the RNA target polynucleotide, and (ii) 5'SDA primer conjugation containing a restriction enzyme recognition sequence or a partial restriction enzyme recognition sequence, or a complementary sequence thereof. forward primers containing (e) (i) A sequence of the reverse primer that is complementary to the 5'SDA primer binding sequence, (ii) 3' blocking molecule, and (iii) 5' stabilizing sequence containing at least 8 nucleotides A first SDA primer comprising, in which the reverse primer comprises only a partial restriction enzyme recognition sequence, the first SDA primer comprises a partial restriction enzyme recognition sequence which, together with the partial restriction enzyme recognition sequence in the 5'SDA primer binding sequence of the reverse primer, forms a complete restriction enzyme recognition sequence. (f) (i) A sequence of the forward primer that is complementary to the 5'SDA primer binding sequence, (ii) 3' blocking molecule, and (iii) 5' stabilizing sequence containing at least 8 nucleotides A second SDA primer comprising, in which the forward primer comprises only a partial restriction enzyme recognition sequence, the first SDA primer comprises a partial restriction enzyme recognition sequence which, together with the partial restriction enzyme recognition sequence in the 5'SDA primer binding sequence of the forward primer, forms a complete restriction enzyme recognition sequence. (g) a cutting enzyme; (h) Polymerase having chain substitution activity, (i) Single-chain binding proteins, (j) dNTP, (k) KOAc or PEG, and (l) A detection system, (A) (i) A guide nucleic acid comprising a nucleic acid sequence complementary to the target nucleic acid region or portion thereof, and (ii) Cas enzyme having secondary cleavage activity, (iii) A nucleic acid reporter probe that is highly sensitive to the secondary cleavage activity and as a result has detectably distinct first uncleaved state and second cleaved state, or (B) (i) Capture probe, and (ii) A composite capture probe including a detectable label and a 3' blockage entity Detection system including The composition comprising, wherein the restriction enzyme recognition sequence in (b), (d), (e), or (f) is a nickase recognition sequence, and the nickase is Nt. CviPII nickase or Nb. BbvCI nickase.
18. The composition according to claim 17, wherein the composition further comprises a bump primer.
19. A method, (1) Amplifying the RNA target nucleic acid sequence in the sample, (A) The sample, (a) (i) a 3' sequence complementary to the RNA target nucleic acid, and (ii) A 5'SDA primer binding sequence comprising a restriction enzyme recognition sequence, a partial restriction enzyme recognition sequence, or a complementary sequence thereof. Reverse primers including (b) Reverse transcriptase, (c) (i) a 3' sequence complementary to the RNA target nucleic acid, and (ii) 5'SDA primer binding sequence containing a restriction enzyme recognition sequence, a partial restriction enzyme recognition sequence, or a complementary sequence thereof. forward primer containing Contact with a composition containing, This generates the first reaction mixture, (B) The first reaction mixture is incubated under conditions favorable for the production of a single-stranded DNA (ssDNA) cassette. (C)(B) The ssDNA cassettes (d) (i) A sequence of the reverse primer that is complementary to the 5'SDA primer binding sequence, (ii) 3' blocking molecule, and (iii) 5' stabilizing sequence containing at least 8 nucleotides A first SDA primer comprising, wherein the reverse primer comprises only a partial restriction enzyme recognition sequence, the first SDA primer comprises a partial restriction enzyme recognition sequence which, together with the partial restriction enzyme recognition sequence in the 5'SDA primer binding sequence of the reverse primer, forms a complete restriction enzyme recognition sequence. (e) (i) A sequence of the forward primer that is complementary to the 5'SDA primer binding sequence, (ii) 3' blocking molecule, and (iii) 5' stabilizing sequence containing at least 8 nucleotides A second SDA primer comprising, in which the forward primer comprises only a partial restriction enzyme recognition sequence, the first SDA primer comprises a partial restriction enzyme recognition sequence which, together with the partial restriction enzyme recognition sequence in the 5' SDA primer binding sequence of the forward primer, forms a complete restriction enzyme recognition sequence, and (f) at least one cleavage enzyme, polymerase having chain substitution activity, single-chain binding protein, dNTP Contact with a composition containing, This generates a second reaction mixture, (D) The amplification, which includes incubating the second reaction mixture under conditions preferred for generating multiple copies of nucleic acid identical or complementary to the ssDNA cassette, and (2) To detect the RNA target nucleic acid sequence in the sample, wherein the detection is (a) (A) At least one of the plurality of copies of the nucleic acid, (i) A guide nucleic acid containing a nucleic acid sequence complementary to the DNA cassette, and (ii) Cas enzyme having secondary cleavage activity, (iii) A nucleic acid reporter probe that is highly sensitive to the secondary cleavage activity and, as a result, has detectably distinct first uncleaved state and second cleaved state. Contact with a composition containing, (B) The detection includes detecting the difference between the first state and the second state, thereby detecting the cleavage of the nucleic acid reporter probe and determining the presence of the RNA target nucleic acid sequence in the sample, or (b) (A) At least one of the plurality of copies of the nucleic acid, (i) Capture probe, and (ii) A composite capture probe including a detectable label and a 3' blockage entity Contact with a composition containing, (B) The detection includes detecting the presence of the detectable label bound to a solid substrate and determining the presence of the RNA target nucleic acid sequence in the sample. The method, including the method described above.
20. (a) Target polynucleotides, (b) A first probe comprising a 3'SDA primer binding sequence including a partial nickase recognition site or its complement, a nucleic acid sequence complementary to the target nucleic acid, and a first nucleic acid sensor portion. (c) A second probe comprising a 5'SDA primer binding sequence containing a partial nickase recognition site or its complement, a nucleic acid sequence complementary to the target nucleic acid, and a second nucleic acid sensor portion, wherein each nucleic acid sensor portion comprises a sequence that is, codes for, or codes for the first and second report element components, respectively, the second probe, (d) at least one gap-filling oligo, (e) Ligauze, and (f) 2-10% PEG A composition comprising, The composition wherein, when the first and second probes are ligated together, a single strand of DNA cassette is generated which encodes at least one reporter and includes a 3'SDA primer-binding sequence and a 5'SDA primer-binding sequence, wherein the SDA primer-binding sequence includes a partial nickase recognition sequence or a complementary sequence thereof.
21. A method for detecting a target nucleic acid sequence in a sample, (A) The sample is (i) A first probe comprising a 3'SDA primer binding sequence containing a partial nickase recognition site or its complement, a nucleic acid sequence complementary to the target nucleic acid, and a first nucleic acid sensor portion, (ii) A second probe comprising a 5'SDA primer binding sequence containing a partial nickase recognition site or its complement, a nucleic acid sequence complementary to the target nucleic acid, and a second nucleic acid sensor portion, wherein each nucleic acid sensor portion comprises a sequence that is, codes for, or codes for the first and second report element components, respectively, the second probe, (iii) at least one gap-filling oligo, and (iv) Ligauze Contact with a composition containing, When ligated together, at least one reporter is encoded, and a single strand of nucleotide cassette is generated containing a 3'SDA primer-binding sequence and a 5'SDA primer-binding sequence, wherein the primer-binding sequence contains a nickase recognition sequence or a partial nickase recognition sequence, thereby generating a first reaction mixture. (B) The first reaction mixture is incubated under conditions preferred for the production of single-stranded nucleotide cassettes. (C) The nucleotide cassette of (B) (i) (a) A sequence complementary to the 3'SDA primer binding sequence, (b) 3' blocking molecule, and (c) A stabilizing sequence comprising at least eight nucleotides, including a partial nickase recognition site that, together with the partial nickase recognition site on the 3'SDA primer binding sequence, forms a complete nickase primer binding site. Including the first SDA primer, (ii) (a) A sequence complementary to the 5'SDA primer binding sequence, (b) 3' blocking molecule, and (c) A 5' stabilizing sequence comprising at least eight nucleotides and including a partial nickase recognition site that, together with the partial nickase recognition sequence in the 5' SDA primer binding sequence, forms a complete nickase primer binding sequence. A second SDA primer, including, (iii) at least one nicasse, a polymerase having chain displacement activity, and one This chain binding protein Contact with a composition containing, This generates a second reaction mixture, (D) The detection method comprising incubating the second reaction mixture under conditions favorable for generating multiple copies of nucleic acids identical or complementary to the nucleotide cassette.
22. The nucleotide cassette is an ssDNA cassette, and the method further (I) (e) At least one copy of nucleic acid identical or complementary to the nucleotide cassette, (i) A guide nucleic acid containing a nucleic acid sequence complementary to the nucleotide cassette, (ii) Cas enzyme having secondary cleavage activity, and (iii) A nucleic acid reporter probe that is highly sensitive to the secondary cleavage activity and, as a result, has detectably distinct first uncleaved state and second cleaved state. Contact with a composition containing, (f) By detecting the difference between the first state and the second state, the cleavage of the nucleic acid reporter probe is detected, and the presence of the target nucleic acid sequence in the sample is determined, or The nucleotide cassette contains at least one copy of the nucleic acid that is identical or complementary to the nucleotide cassette, (II) (e) At least one copy of the nucleic acid that is identical or complementary to the nucleotide cassette, (i) Capture probe, and (ii) A complex capture probe containing a detectable label and a 3'-blocking molecule. Contact with a composition containing, (f) Determining the presence of the target nucleic acid sequence in the sample by detecting the presence of the detectable label bound to the solid substrate. The method according to claim 21, including the method described in claim 21.
23. (i) a 3' nucleic acid sequence complementary to a target nucleic acid sequence located downstream or at 5' of the first or second innate restriction enzyme recognition sequence, and (ii) 5' SDA primer binding sequence containing a partial restriction enzyme recognition sequence forward primer The composition according to claim 1, further comprising:
24. The second SDA primer is (i) A sequence complementary to the 5'SDA primer binding sequence of the forward primer, which includes a partial restriction enzyme recognition sequence. (ii) 3' blocking molecule, and (iii) A 5' stabilizing sequence comprising at least 8 nucleotides, which together with the partial restriction enzyme recognition sequence in the 5' SDA primer binding sequence to form a complete restriction enzyme recognition sequence. The composition according to claim 23, comprising: