Nucleic acid compound

Abstract

The present invention provides novel nucleic acid compounds suitable for therapeutic use. In addition, the present invention provides methods for producing these compounds, as well as methods for using such compounds for the treatment of various diseases and conditions.

Description

Technical Field

[0001] The present invention provides novel nucleic acid compounds suitable for therapeutic use. In addition, the present invention provides methods for making such compounds, as well as methods for using such compounds for treating various diseases and conditions.

Background Art

[0002] Nucleic acid compounds can have important therapeutic applications in medicine. Nucleic acids can be used to silence genes that are the cause of specific diseases. Gene silencing prevents the formation of proteins by inhibiting translation. Importantly, gene silencing agents are promising alternatives to traditional small organic compounds that inhibit the function of disease-related proteins. siRNA, antisense RNA, and microRNA are oligonucleotides / oligonucleosides that prevent protein formation by gene silencing.

[0003] In particular, numerous modified siRNA compounds for diagnostic and therapeutic purposes, including siRNA / RNAi therapeutic agents for treating various diseases including central nervous system diseases, inflammatory diseases, metabolic disorders, oncology, infectious diseases, and eye diseases, have been developed over the past 20 years.

[0004] The present invention relates to nucleic acid compounds for use in the treatment and / or prevention of diseases.

Summary of the Invention

Means for Solving the Problems

[0005] According to a first aspect of the present invention, there is provided a nucleic acid for inhibiting the expression of HCII, comprising a double-stranded region including a first strand and a second strand that is at least partially complementary to the first strand, wherein the first strand: (i) is at least partially complementary to a portion of RNA transcribed from the HCII gene; and (ii) contains at least 17 consecutive nucleosides that differ from any one of the sequences of the first strand listed in Table 2 by 0 or 1 nucleoside.

[0006] According to a second aspect of the present invention, there is provided a nucleic acid for inhibiting the expression of HCII, comprising a double-stranded region including a first strand and a second strand that is at least partially complementary to the first strand, wherein the first strand: (i) is at least partially complementary to a portion of RNA transcribed from the HCII gene; and (ii) contains at least 17 consecutive nucleosides that differ from any one of the modified sequences of the first strand listed in Table 3 by 0 or 1 nucleoside.

[0007] The nucleic acid described herein, wherein the first strand contains nucleosides 2 to 18 of any one of the sequences according to the first and second aspects of the present invention.

[0008] The nucleic acid according to the first aspect of the present invention, wherein the second strand contains a nucleoside sequence of at least 17 consecutive nucleosides that differ from any one of the sequences of the second strand listed in Table 2 by 0 or 1 nucleoside, and the second strand has a region of at least 85% complementarity over 17 consecutive nucleosides with respect to the first strand.

[0009] The nucleic acid according to the first aspect of the present invention, wherein the second strand contains a nucleoside sequence of at least 17 consecutive nucleosides that differ from any one of the sequences of the second strand listed in Table 2 by 0 or 1 nucleoside, and the double-stranded region contains at least 14, 15, 16, or 17 complementary base pairs.

[0010] The second strand comprises a nucleoside sequence of at least 17 consecutive nucleosides that differs from any one of the modified sequences of the second strand listed in Table 4 by 0 or 1 nucleoside, and the second strand has a region of at least 85% complementarity over 17 consecutive nucleosides with respect to the first strand, the nucleic acid according to the second aspect of the present invention.

[0011] The second strand comprises a nucleoside sequence of at least 17 consecutive nucleosides that differs from any one of the modified sequences of the second strand listed in Table 4 by 0 or 1 nucleoside, and the double-stranded region comprises at least 14, 15, 16, or 17 complementary base pairs, the nucleic acid according to the second aspect of the present invention.

[0012] The first strand comprises any one of the sequences of the first strand listed in Table 2, the nucleic acid according to the first aspect of the present invention.

[0013] The first strand comprises any one of the modified sequences of the first strand listed in Table 3, the nucleic acid according to the second aspect of the present invention.

[0014] The second strand comprises any one of the sequences of the second strand listed in Table 2, the nucleic acid according to the first aspect of the present invention.

[0015] The second strand comprises any one of the modified sequences of the second strand listed in Table 4, the nucleic acid according to the second aspect of the present invention.

[0016] The first strand comprises any one of the following sequences: SEQ ID NO: 140, SEQ ID NO: 152, SEQ ID NO: 136, SEQ ID NO: 138, SEQ ID NO: 139, SEQ ID NO: 151, SEQ ID NO: 162, SEQ ID NO: 166, SEQ ID NO: 186, SEQ ID NO: 188, SEQ ID NO: 194, SEQ ID NO: 224, SEQ ID NO: 235, SEQ ID NO: 236, SEQ ID NO: 238, SEQ ID NO: 239, SEQ ID NO: 240, SEQ ID NO: 124, SEQ ID NO: 135, the nucleic acid according to the first aspect of the present invention.

[0017] The first strand is a nucleic acid according to the second aspect of the present invention, comprising any one of the following sequences: SEQ ID NO: 560, SEQ ID NO: 392, SEQ ID NO: 376, SEQ ID NO: 378, SEQ ID NO: 379, SEQ ID NO: 391, SEQ ID NO: 402, SEQ ID NO: 406, SEQ ID NO: 426, SEQ ID NO: 428, SEQ ID NO: 434, SEQ ID NO: 464, SEQ ID NO: 475, SEQ ID NO: 476, SEQ ID NO: 478, SEQ ID NO: 479, SEQ ID NO: 480, SEQ ID NO: 499, SEQ ID NO: 504, SEQ ID NO: 518, SEQ ID NO: 519, SEQ ID NO: 539, SEQ ID NO: 555, SEQ ID NO: 559.

[0018] The second strand is a nucleic acid according to the first aspect of the present invention, comprising any one of the following sequences: SEQ ID NO: 260, SEQ ID NO: 272, SEQ ID NO: 256, SEQ ID NO: 258, SEQ ID NO: 259, SEQ ID NO: 271, SEQ ID NO: 282, SEQ ID NO: 286, SEQ ID NO: 306, SEQ ID NO: 308, SEQ ID NO: 314, SEQ ID NO: 344, SEQ ID NO: 355, SEQ ID NO: 356, SEQ ID NO: 358, SEQ ID NO: 359, SEQ ID NO: 360, SEQ ID NO: 244, SEQ ID NO: 255.

[0019] The second strand is a nucleic acid according to the second aspect of the present invention, comprising any one of the following sequences: SEQ ID NO: 760, SEQ ID NO: 592, SEQ ID NO: 576, SEQ ID NO: 578, SEQ ID NO: 579, SEQ ID NO: 591, SEQ ID NO: 602, SEQ ID NO: 606, SEQ ID NO: 626, SEQ ID NO: 628, SEQ ID NO: 634, SEQ ID NO: 664, SEQ ID NO: 675, SEQ ID NO: 676, SEQ ID NO: 678, SEQ ID NO: 679, SEQ ID NO: 680, SEQ ID NO: 699, SEQ ID NO: 704, SEQ ID NO: 718, SEQ ID NO: 719, SEQ ID NO: 739, SEQ ID NO: 755, SEQ ID NO: 759.

[0020] A nucleic acid comprising, consisting of, or consisting essentially of first and second strands that differ from any one of the following first and second sequences by 0 or 1 nucleoside.

[0021]

Table 1

[0022] A nucleic acid comprising, consisting of, or consisting essentially of first and second strands that each comprise a nucleoside sequence that differs from either one of the following first and second sequences by 0 or 1 nucleoside.

[0023] [Table 2]

[0024] A nucleic acid comprising, consisting of, or consisting essentially of first and second strands that each comprise a nucleoside sequence that differs from either one of the following first and second sequences by 0 or 1 nucleoside.

[0025] [Table 3]

[0026] A nucleic acid comprising, consisting of, or consisting essentially of first and second strands that each comprise a nucleoside sequence that differs from either one of the following first and second sequences by 0 or 1 nucleoside.

[0027] [Table 4]

[0028] A nucleic acid comprising, consisting of, or consisting essentially of first and second strands that each comprise a nucleoside sequence that differs from either one of the following first and second sequences by 0 or 1 nucleoside.

[0029] [Table 5]

[0030] A nucleic acid comprising, consisting of, or consisting essentially of first and second strands that each comprise a nucleoside sequence that differs from either one of the following first and second sequences by 0 or 1 nucleoside.

[0031] [Table 6]

[0032] A nucleic acid comprising, consisting of, or consisting essentially of first and second strands that contain a nucleoside sequence that differs from either one of the following first and second sequences by 0 or 1 nucleoside.

[0033] [Table 7]

[0034] A nucleic acid comprising, consisting of, or consisting essentially of first and second strands that contain a nucleoside sequence that differs from either one of the following first and second sequences by 0 or 1 nucleoside.

[0035] [Table 8]

[0036] A nucleic acid comprising, consisting of, or consisting essentially of first and second strands that contain a nucleoside sequence that differs from either one of the following first and second sequences by 0 or 1 nucleoside.

[0037] [Table 9]

[0038] A nucleic acid comprising, consisting of, or consisting essentially of first and second strands that contain a nucleoside sequence that differs from either one of the following first and second sequences by 0 or 1 nucleoside.

[0039] [Table 10]

[0040] A nucleic acid comprising, consisting of, or essentially consisting of first and second strands having a nucleoside sequence that differs from either one of the following first and second sequences by 0 or 1 nucleoside.

[0041] [Table 11]

[0042] A nucleic acid comprising, consisting of, or essentially consisting of first and second strands having a nucleoside sequence that differs from either one of the following first and second sequences by 0 or 1 nucleoside.

[0043] [Table 12]

[0044] A nucleic acid comprising, consisting of, or essentially consisting of first and second strands having a nucleoside sequence that differs from either one of the following first and second sequences by 0 or 1 nucleoside.

[0045] [Table 13]

[0046] A nucleic acid comprising, consisting of, or essentially consisting of first and second strands having a nucleoside sequence that differs from either one of the following first and second sequences by 0 or 1 nucleoside.

[0047] [Table 14]

[0048] A conjugate for inhibiting the expression of an HCII target gene in a cell, said conjugate comprising a nucleic acid disclosed herein and one or more ligand moieties.

[0049] A pharmaceutical composition comprising the nucleic acid disclosed herein together with a pharmaceutically acceptable excipient or carrier.

[0050] A nucleic acid or a pharmaceutical composition for use in therapy.

[0051] A nucleic acid or a pharmaceutical composition for use in the prevention or treatment of a disease associated with a hemostatic disorder, such as a disease associated with a hemostatic disorder like hemophilia.

Brief Description of the Drawings

[0052]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5-1

Figure 5-2

Figure 5-3

Figure 5-4

Figure 5-5

Figure 5-6

Figure 5-7

Figure 5-8

Figure 6-1

Figure 6-2

Figure 6-3

Figure 6-4

Figure 6-5

Figure 6-6

Figure 7

Figure 8

Figure 9-1

Figure 9-2

Figure 9-3

Figure 9-4

Figure 10

Figure 11

Mode for Carrying Out the Invention

[0053] Definitions The "first strand" is also referred to herein as the antisense strand or the guide strand, which can be used interchangeably herein, and refers to a nucleic acid strand, such as a strand of siRNA, such as dsiRNA, that contains a region that is substantially complementary to a target sequence, such as an mRNA. As used herein, the term "region of complementarity" refers to a region of the antisense strand that is substantially complementary to a sequence, such as a target sequence. If the region of complementarity is not completely complementary to the target sequence, the mismatches can be, typically, in the internal region or the terminal region of the molecule. In some embodiments, the double-stranded nucleic acids of the invention, such as siRNA agents, contain nucleoside mismatches in the antisense strand.

[0054] The "second strand" (also referred to herein as the sense strand or the passenger strand, which can be used interchangeably herein) refers to a nucleic acid, such as a strand of siRNA, that contains a region that is substantially complementary to the region of the antisense strand as defined herein.

[0055] In the context of a molecule comprising a nucleic acid with a ligand moiety and optionally also a linker moiety, the nucleic acids of the invention may be referred to as oligonucleosides or oligonucleoside moieties.

[0056] Oligonucleotides are short nucleic acid polymers. Oligonucleotides contain phosphodiester bonds between their nucleoside components (base + sugar), but the present invention is not limited to oligonucleotides that are always joined by such phosphodiester bonds between adjacent nucleosides, and other oligomers of nucleosides joined by bonds other than phosphodiester bonds are contemplated. For example, the bond between nucleosides may be a phosphorothioate bond. Thus, the term "oligonucleoside" as used herein encompasses both oligonucleotides and other oligomers of nucleosides. According to the present invention, oligonucleosides that are nucleic acids having at least a portion that is an oligonucleotide are preferred. According to the present invention, oligonucleosides having one or more or most of the phosphodiester backbone bonds between nucleosides are also preferred. According to the present invention, oligonucleosides having one or more or most of the phosphodiester backbone bonds between nucleosides and also having one or more phosphorothioate backbone bonds between nucleosides (typically in the terminal regions of the first and / or second strands) are also preferred.

[0057] In this specification, the nucleic acids according to the present invention are preferably double-stranded oligonucleosides containing one or more phosphorothioate backbone bonds between nucleosides. Thus, in all cases where the present application refers to oligonucleotides, particularly in the chemical structures disclosed herein, the oligonucleotide may equally well be an oligonucleoside as defined herein.

[0058] In some embodiments, the double-stranded nucleic acids of the present invention, such as siRNA agents, contain nucleoside mismatches in the sense strand. In some embodiments, the nucleoside mismatch is present, for example, within 5, 4, 3, 2, or 1 nucleoside from the 3' end of the nucleic acid, such as siRNA.

[0059] In another embodiment, the nucleoside mismatch is present, for example, in the 3' terminal nucleoside of the nucleic acid, such as siRNA.

[0060] The "target sequence" (which may also be referred to as target RNA or target mRNA) refers to a continuous portion of the nucleoside sequence of an mRNA molecule formed during gene transcription, including the mRNA that is the product of RNA processing of the primary transcript.

[0061] The target sequence may be about 10 to 35 nucleosides in length, for example, about 15 to 30 nucleosides in length. For example, the target sequence may be 15 to 30 nucleosides in length, 15 to 29, 15 to 28, 15 to 27, 15 to 26, 15 to 25, 15 to 24, 15 to 23, 15 to 22, 15 to 21, 15 to 20, 15 to 19, 15 to 18, 15 to 17, 18 to 30, 18 to 29, 18 to 28, 18 to 27, 18 to 26, 18 to 25, 18 to 24, 18 to 23, 18 to 22, 18 to 21, 18 to 20, 19 to 30, 19 to 29, 19 to 28, 19 to 27, 19 to 26, 19 to 25, 19 to 24, 19 to 23, 19 to 22, 19 to 21, 19 to 20, 20 to 30, 20 to 29, 20 to 28, 20 to 27, 20 to 26, 20 to 25, 20 to 24, 20 to 23, 20 to 22, 20 to 21, 21 to 30, 21 to 29, 21 to 28, 21 to 27, 21 to 26, 21 to 25, 21 to 24, 21 to 23, or 21 to 22 nucleosides in length. Ranges and lengths intermediate to those listed above are also contemplated as being part of the present invention.

[0062] The term "ribonucleoside" or "nucleoside" can also refer to a modified nucleoside, as will be described in more detail below.

[0063] The nucleic acid may be DNA or RNA and may contain modified nucleosides. A preferred nucleic acid is RNA.

[0064] As used interchangeably herein, the terms "iRNA", "siRNA", "RNAi agent", and "iRNA agent", "RNA interference agent" refer to agents that include RNA and mediate the targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway. siRNA directs the sequence-specific degradation of mRNA by RNA interference (RNAi).

[0065] Double-stranded RNA is referred to herein as "double-stranded siRNA (dsiRNA) agent", "double-stranded siRNA (dsiRNA) molecule", "double-stranded RNA (dsRNA) agent", "double-stranded RNA (dsRNA) molecule", "dsiRNA agent", "dsiRNA molecule", or "dsiRNA", and refers to a complex of ribonucleic acid molecules having a double-stranded structure containing two antiparallel and substantially complementary nucleic acid strands that are said to have a "sense" direction and an "antisense" direction with respect to the target RNA.

[0066] Most of the nucleosides of each strand of a nucleic acid, such as a dsiRNA molecule, are preferably ribonucleosides, but in that case, each strand or both strands may further contain one or more non-ribonucleosides, such as deoxyribonucleosides or modified nucleosides. In addition, as used herein, "siRNA" may include ribonucleosides having chemical modifications.

[0067] The term "modified nucleoside" independently refers to a nucleoside having a modified sugar moiety, a modified internucleoside linkage, or a modified nucleobase, or any combination thereof. Thus, the term modified nucleoside includes substitutions, additions, or removals of, for example, functional groups or atoms to the internucleoside linkage, sugar moiety, or nucleobase. Any such modifications used in siRNA-type molecules are included within "iRNA" or "RNAi agent" or "siRNA" or "siRNA agent" for the purposes of this specification and the claims.

[0068] The two strands forming the double-stranded structure may be different parts of a larger molecule or may be separate molecules, such as RNA molecules.

[0069] The term "nucleoside overhang" refers to at least one unpaired nucleoside extending from the double-stranded structure of the nucleic acid according to the present invention. The nucleic acid according to the present invention may contain an overhang of at least one nucleoside, or alternatively, the overhang may contain at least two nucleosides, at least three nucleosides, at least four nucleosides, at least five nucleosides, or more nucleosides. The nucleoside overhang may contain or consist of nucleosides / nucleoside analogs containing deoxynucleosides. The overhang may be present in the sense strand, the antisense strand, or any combination thereof. Further, the nucleosides of the overhang may be present at the 5'-end, 3'-end, or both ends of either the antisense strand or the sense strand.

[0070] In certain embodiments, the antisense strand has an overhang of 1 to 10 nucleosides, such as 0 to 3, 1 to 3, 2 to 4, 2 to 5, 4 to 10, 5 to 10, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides at the 3'-end or 5'-end.

[0071] "Blunt" or "blunt end" means that there are no unpaired nucleosides at the ends of the double-stranded nucleic acid, that is, there is no nucleoside overhang. Examples of the nucleic acid of the present invention include those having no nucleoside overhang at one end or those having no nucleoside overhang at either end.

[0072] Unless otherwise indicated, the term "complementary," when used to describe a first nucleoside sequence in relation to a second nucleoside sequence as would be understood by one of ordinary skill in the art, refers to the ability of an oligonucleoside containing the first nucleoside sequence to hybridize with an oligonucleoside containing the second nucleoside sequence under certain conditions to form a double-stranded structure. Such conditions may be, for example, stringent conditions, which may include 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, for 12 - 16 hours at 50°C or 70°C, followed by washing (see, e.g., Molecular Cloning: A Laboratory Manual, Sambrook et al. (1989) Cold Spring Harbor Laboratory Press).

[0073] The complementary sequences in the nucleic acids described herein, e.g., within dsiRNA, include base pairing over the entire length of one or both of the nucleoside sequences of an oligonucleoside containing a first nucleoside sequence and an oligonucleoside containing a second nucleoside sequence. Such sequences can be referred to herein as being "perfectly complementary" to each other. However, herein, when a first sequence is referred to as being "substantially complementary" or "partially complementary" to a second sequence, the two sequences may be perfectly complementary or may form one or more, but preferably no more than 5, mismatch base pairs, such as 2, 4, or 5 mismatch base pairs, while retaining the ability to hybridize under conditions most relevant to the ultimate application, e.g., inhibition of gene expression via the RISC pathway. Overhangs shall not be considered mismatches with respect to the determination of complementarity. Further, for example, a nucleic acid, e.g., dsiRNA, containing one oligonucleoside 17 nucleosides in length and another oligonucleoside 19 nucleosides in length, wherein the longer oligonucleoside contains a 17-nucleoside sequence that is perfectly complementary to the shorter oligonucleoside, can be referred to as "perfectly complementary."

[0074] Also, a "complementary" sequence, as used herein, may include, or consist solely of, non-Watson-Crick base pairs or base pairs formed from non-natural and modified nucleosides, so long as it meets the above requirements with respect to its ability to hybridize. Such non-Watson-Crick base pairs include, but are not limited to, G:U wobble base pairing or Hoogsteen base pairing.

[0075] The terms "complementary," "fully complementary," and "substantially / partially complementary" can be used herein with respect to base matching between nucleic acids, such as between the sense and antisense strands of a dsiRNA, or between the antisense strand of a double-stranded nucleic acid, such as an siRNA agent, and a target sequence.

[0076] Within the present invention, the second strand of a nucleic acid according to the present invention, particularly a dsiRNA for inhibiting HCII, is at least partially complementary to the first strand of said nucleic acid. In certain embodiments, the first and second strands of a nucleic acid according to the present invention are partially complementary when they have a length of at least 17 base pairs and form a double-stranded region containing 1, 2, 3, 4, or 5 or fewer mismatched base pairs.

[0077] In certain embodiments, the first and second strands of a nucleic acid according to the present invention are partially complementary when they have a length of 19 base pairs and form a double-stranded region having 1, 2, 3, 4, or 5 or fewer mismatched base pairs. In certain embodiments, the first and second strands of a nucleic acid according to the present invention are partially complementary when they have a length of 21 base pairs and form a double-stranded region having 1, 2, 3, 4, or 5 or fewer mismatched base pairs.

[0078] Alternatively, the first and second strands of the nucleic acid according to the present invention form a double-stranded region having a length of at least 17 base pairs, wherein at least 14, 15, 16, or 17 of said base pairs are complementary base pairs, particularly Watson-Crick base pairs, and are partially complementary when forming the double-stranded region.

[0079] In certain embodiments, the first and second strands of the nucleic acid according to the present invention form a double-stranded region having a length of 19 base pairs, wherein at least 14, 15, 16, 17, 18, or all 19 of the base pairs are complementary base pairs, particularly Watson-Crick base pairs, and are partially complementary when forming the double-stranded region. In certain embodiments, the first and second strands of the nucleic acid according to the present invention form a double-stranded region having a length of 21 base pairs, wherein at least 16, 17, 18, 19, 20, or all 21 of the base pairs are complementary base pairs, particularly Watson-Crick base pairs, and are partially complementary when forming the double-stranded region.

[0080] As used herein, a nucleic acid that is "substantially complementary" or "partially complementary" to at least a portion of messenger RNA (mRNA) refers to a nucleic acid that is substantially or partially complementary to a continuous portion of the mRNA of interest (e.g., an mRNA encoding a gene). In certain embodiments, the continuous portion of the mRNA is one of the sequences listed in Table 1, i.e., any one of SEQ ID NOs: 2 to 121. For example, a nucleic acid is complementary to at least a portion of the mRNA of a gene of interest if its sequence is substantially or partially complementary to an uninterrupted portion of the mRNA encoding that gene.

[0081] Thus, in some preferred embodiments, the antisense oligonucleosides disclosed herein are completely complementary to the target gene sequence.

[0082] In other embodiments, the antisense oligonucleosides disclosed herein are substantially or partially complementary to the target RNA sequence and are at least about 80% complementary over their entire length to an equivalent region of the target RNA sequence, e.g., at least about 85%, 86%, 87%, 88%, 89%, about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary, or 100% complementary, and include a continuous nucleoside sequence.

[0083] In certain embodiments, the first (antisense) strand of the nucleic acid according to the invention is partially or fully complementary to a continuous portion of the RNA transcribed from the HCII gene. In certain embodiments, the first strand of the nucleic acid according to the invention is partially or fully complementary to a continuous portion of at least 17 nucleosides of the HCII mRNA. In certain embodiments, the first strand of the nucleic acid according to the invention is partially or fully complementary to a continuous portion of 17, 18, 19, 20, 21, 22, or 23 nucleosides of the HCII mRNA. In certain embodiments, the first strand of the nucleic acid according to the invention is partially or fully complementary to a continuous portion of 17, 18, 19, 20, 21, 22, or 23 nucleosides of any one of the sequences listed in Table 1, i.e., any one of SEQ ID NOs: 2 to 121.

[0084] In certain embodiments, the first (antisense) strand of the nucleic acid according to the invention comprises a continuous nucleoside sequence of at least 17 nucleosides, and at least 14, 15, 16, or 17 nucleosides of said continuous nucleoside sequence are partially complementary to a continuous portion of the HCII mRNA when they are complementary to a continuous portion of the HCII mRNA. In certain embodiments, the first strand of the nucleic acid according to the invention comprises a continuous nucleoside sequence of at least 17 nucleosides, and at least 14, 15, 16, or 17 nucleosides of said continuous nucleoside sequence are complementary to a continuous portion of any one of the sequences listed in Table 1, i.e., any one of SEQ ID NOs: 2 to 121. In certain embodiments, the first strand of the nucleic acid according to the invention comprises a continuous nucleoside sequence of 19 nucleosides, and at least 14, 15, 16, 17, 18, or all 19 nucleosides of said continuous nucleoside sequence are complementary to a continuous portion of any one of the sequences listed in Table 1, i.e., any one of SEQ ID NOs: 2 to 121. In certain embodiments, the first strand of the nucleic acid according to the invention comprises a continuous nucleoside sequence of 23 nucleosides, and at least 18, 19, 20, 21, 22, or all 23 nucleosides of said continuous nucleoside sequence are complementary to a continuous portion of any one of the sequences listed in Table 1, i.e., any one of SEQ ID NOs: 2 to 101.

[0085] In some embodiments, the nucleic acid of the invention, e.g., siRNA, comprises a sense strand that is substantially or partially complementary to the antisense oligonucleotide, and the antisense oligonucleotide is, in turn, complementary to the target gene sequence and comprises a continuous nucleoside sequence. The nucleoside sequence of the sense strand is typically at least about 80% complementary, e.g., about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary, or 100% complementary, over its entire length to the equivalent region of the nucleoside sequence of the antisense strand.

[0086] In some embodiments, the nucleic acids of the invention, such as siRNA, are substantially or partially complementary to a target sequence and are at least 80% complementary over the entire length of the target sequence, for example, about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary, or 100% complementary, and include an antisense strand comprising a continuous nucleoside sequence.

[0087] As used herein, a "subject" is an animal, including a mammal (such as a primate (human, non-human primate, such as a monkey and chimpanzee, etc.) or a non-primate) or a bird, that expresses a target gene either endogenously or heterologously when the target gene sequence has sufficient complementarity to promote target knockdown against a nucleic acid, such as an siRNA agent. In certain preferred embodiments, the subject is a human.

[0088] The terms "treat" or "treatment" refer to beneficial or desired results, including, but not limited to, alleviation or amelioration of one or more symptoms associated with gene expression. "Treatment" may also mean extending the survival period as compared to the expected survival period without treatment. Treatment may include prevention of the onset of complications, for example, reduction of liver damage in a subject with a liver infection.

[0089] A "therapeutically effective amount," as used herein, is an amount of a nucleic acid, such as siRNA, that is intended to achieve treatment of a disease (e.g., by reducing, ameliorating, or maintaining an existing disease or one or more symptoms or associated complications thereof) when administered to a patient for treating a subject having the disease.

[0090] The phrase "pharmaceutically acceptable" as used herein refers to compounds, substances, compositions, or dosage forms that are suitable for use in contact with the tissues of human and animal subjects without undue toxicity, irritation, allergic response, or other problems or complications and that have a reasonable benefit / risk ratio.

[0091] As used herein, the phrase "pharmaceutically acceptable carrier" means a pharmaceutically acceptable substance, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid, or solvent encapsulating material, that is involved in the transport or conveyance of the subject compound from one organ or part of the body to another organ or part of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject to be treated.

[0092] Where values or ranges of parameters are recited, intermediate values and ranges that fall within the recited values are also intended to be part of the present invention.

[0093] As used herein, the articles "a" and "an" are used to refer to one or more than one (i.e., at least one) of the grammatical objects of the article.

[0094] As used herein, the term "comprising" is used to mean "including but not limited to" and is used interchangeably therewith.

[0095] As used herein, the term "or" means "and / or" and is used interchangeably therewith, unless the context clearly dictates otherwise. For example, "sense strand or antisense strand" is understood to mean "sense strand or antisense strand, or sense strand and antisense strand".

[0096] As used herein, the term "about" is used to mean within the typical ranges of tolerance in the art. For example, "about" can be understood to be about two standard deviations from the mean. In certain embodiments, about means +10%. In certain embodiments, about means +5%. It is understood that when "about" is present before a series of numbers or a range, "about" can modify each of the numbers in that series of numbers or range.

[0097] The term "at least" before a number or series of numbers is understood to include the number adjacent to the term "at least", as well as all subsequent numbers or integers that can logically be included as apparent from the context. For example, the number of nucleosides in a nucleic acid molecule must be an integer. For example, "at least 18 nucleosides of a 21-nucleoside nucleic acid molecule" means that 18, 19, 20, or 21 nucleosides have the stated property. When "at least" is present before a series of numbers or a range, it is understood that "at least" can modify each of the numbers in that series of numbers or range.

[0098] As used herein, "below" or "less than" is understood to mean the value adjacent to this phrase, and, theoretically lower, and in some cases, logically zero value or integer. For example, a duplex having a protrusion "of 2 nucleosides or less" has a protrusion of 2, 1, or 0 nucleosides. When "below" is present after a series of numbers or a range, it is understood that "below" can modify each of the numbers in that series of numbers or range.

[0099] The terminal region of the strand is the last 5 nucleosides from the 5' or 3' end.

[0100] The various embodiments of the present invention can be combined as determined to be appropriate by one of ordinary skill in the art.

[0101] Apurinic / apyrimidinic nucleoside In certain embodiments, the nucleic acid according to the invention has one, for example two, for example three, for example four, or more apurinic / apyrimidinic nucleosides. Apurinic / apyrimidinic nucleosides are modified nucleosides because they lack the base normally found at the 1-position of the sugar moiety. Typically, hydrogen will be present at the 1-position of the sugar moiety of the apurinic / apyrimidinic nucleosides present in the nucleic acid according to the invention.

[0102] The abasic nucleoside is present in the terminal region of the second strand and preferably is located within the terminal 5 nucleosides of the end of the strand. The terminal region may be the terminal 5 nucleosides including the abasic nucleoside.

[0103] The second strand may include the following preferred features (all combinations are specifically contemplated unless mutually exclusive): Two or more abasic nucleosides in the terminal region of the second strand, and / or Two or more abasic nucleosides in either the 5' or 3' terminal region of the second strand, and / or Two or more abasic nucleosides in either the 5' or 3' terminal region of the second strand, which are present in a protrusion as described herein, and / or Two or more consecutive abasic nucleosides in the terminal region of the second strand, preferably one such abasic nucleoside is the terminal nucleoside, two or more consecutive abasic nucleosides, and / or Two or more consecutive abasic nucleosides in either the 5' or 3' terminal region of the second strand, preferably one such abasic nucleoside is the terminal nucleoside of either the 5' or 3' terminal region of the second strand, two or more consecutive abasic nucleosides, and / or An inverse internucleoside linkage connecting at least one abasic nucleoside to an adjacent base nucleoside in the terminal region of the second strand, and / or An inverse internucleoside linkage connecting at least one abasic nucleoside to an adjacent base nucleoside in either the 5' or 3' terminal region of the second strand, and / or An abasic nucleoside as the second last nucleoside connected via an inverse linkage to a nucleoside that is not the terminal nucleoside (referred to herein as the third last nucleoside), and / or Apurinic nucleosides as two terminal nucleosides connected via 5'-3' linkage when the chain is read in the direction towards the end containing the terminal nucleoside, Apurinic nucleosides as two terminal nucleosides connected via 3'-5' linkage when the chain is read in the direction towards the end containing the terminal nucleoside, Apurinic nucleosides at the two terminal positions, wherein the second last nucleoside is connected to the third last nucleoside via an inverted linkage, and the inverted linkage is a 5-5' inverted linkage or a 3'-3' inverted linkage, Apurinic nucleosides at the two terminal positions, wherein the second last nucleoside is connected to the third last nucleoside via an inverted linkage, (1) The inverted linkage is a 5-5' inverted linkage, and the linkage between the terminal apurinic nucleoside and the second last apurinic nucleoside is 3'5' when read towards the end containing the terminal apurinic nucleoside and the second last apurinic nucleoside, or (2) The inverted linkage is a 3-3' inverted linkage, and the linkage between the terminal apurinic nucleoside and the second last apurinic nucleoside is 5'3' when read towards the end containing the terminal apurinic nucleoside and the second last apurinic nucleoside, either of which is an apurinic nucleoside.

[0104] Preferably, an apurinic nucleoside is present at the end of the second strand.

[0105] Preferably, in the terminal region of the second strand, preferably two or at least two apurinic nucleosides are present at the end and the second last position.

[0106] Preferably, two or more apurinic nucleosides are consecutive, for example, all apurinic nucleosides may be consecutive. For example, the terminal 1 nucleoside or the terminal 2 nucleosides or the terminal 3 nucleosides or the terminal 4 nucleosides may be apurinic nucleosides.

[0107] Also, except when there is only one abasic nucleoside at the end, the abasic nucleoside may be linked to an adjacent nucleoside via a 5'-3' phosphodiester linkage or a reverse linkage. When there is only one abasic nucleoside, it will have a reverse linkage with the adjacent nucleoside.

[0108] Reverse linkage (also called inverse linkage, which is also found in the art) includes any of the 5'-5', 3'-3', 3'-2', or 2'-3' phosphodiester linkages between adjacent sugar moieties of nucleosides.

[0109] An abasic nucleoside that is not at the end will have two phosphodiester linkages, one with each adjacent nucleoside, which may be reverse linkages, or 5'-3 phosphodiester bonds, or one of each.

[0110] A preferred embodiment includes two abasic nucleosides at the end and the second-to-last position of the second strand, and the reverse internucleoside linkage is located between the second-to-last (abasic) nucleoside and the third-to-last nucleoside.

[0111] Preferably, there are two abasic nucleosides at the end and the second-to-last position of the second strand. The second-to-last nucleoside is linked to the third-to-last nucleoside via a reverse internucleoside linkage and is linked to the terminal nucleoside via a 5'-3' or 3'-5' phosphodiester linkage (when read in the direction of the end of the molecule).

[0112] Preferably, the nucleic acid according to the invention contains one or more abasic nucleosides. Optionally, one or more abasic nucleosides are present in the terminal region of the second strand and / or at least one abasic nucleoside is linked to an adjacent base nucleoside via a reverse internucleoside linkage.

[0113] Typically, the second strand contains two consecutive abasic nucleosides in the 5' terminal region of the second strand, one such abasic nucleoside being the terminal nucleoside of the 5' terminal region of the second strand and the other abasic nucleoside being the second last nucleoside of the 5' terminal region of the second strand, (a) said second last abasic nucleoside being linked via an inverted internucleoside linkage to the adjacent first base nucleoside of the adjacent 5' proximal region, (b) the inverted linkage being a 5-5' inverted linkage, and (c) the linkage between the terminal abasic nucleoside and the second last abasic nucleoside being 3'-5' when read towards the end containing the terminal abasic nucleoside and the second last abasic nucleoside. More typically, (i) the first strand and the second strand each have a length of 23 nucleosides, (ii) two phosphorothioate internucleoside linkages are present between three consecutive positions in said 5' proximal region of the second strand, the first phosphorothioate internucleoside linkage being present between (a) said adjacent first base nucleoside and the adjacent second base nucleoside of said 5' proximal region of the second strand, and the second phosphorothioate internucleoside linkage being present between said adjacent second base nucleoside and the adjacent third base nucleoside of said 5' proximal region of the second strand, (iii) two phosphorothioate internucleoside linkages are present between three consecutive positions in both the 5' and 3' terminal regions of the first strand, the terminal nucleosides in each of said 5' and 3' terminal regions of the first strand being attached by phosphorothioate internucleoside linkages to the adjacent second last nucleosides at 5' and 3', respectively, and each of the first 5' and 3' second last nucleosides being attached by phosphorothioate internucleoside linkages to the adjacent third last nucleosides at 5' and 3', respectively, and (iv) the second strand of the nucleic acid is conjugated directly or indirectly to one or more ligand moieties in the 3' terminal region of the second strand.

[0114] Alternatively, the second strand preferably contains two consecutive abasic nucleosides in the overhang of the 3' end region of the second strand, one such abasic nucleoside being the terminal nucleoside of the 3' end region of the second strand and the other abasic nucleoside being the second last nucleoside of the 3' end region of the second strand, (a) the second last abasic nucleoside is connected via an inverse internucleoside linkage to the adjacent first base nucleoside of the adjacent 3' proximal region, (b) the inverse linkage is a 3-3' inverse linkage, and (c) the linkage between the terminal abasic nucleoside and the second last abasic nucleoside is 5'-3' when read towards the end containing the terminal abasic nucleoside and the second last abasic nucleoside. More typically, (i) the first and second strands each have a length of 23 nucleosides, (ii) two phosphorothioate internucleoside linkages are present between three consecutive positions in the 3' proximal region of the second strand, the first phosphorothioate internucleoside linkage being present between the adjacent first base nucleoside of (a) and the adjacent second base nucleoside of the 3' proximal region of the second strand, and the second phosphorothioate internucleoside linkage being present between the adjacent second base nucleoside and the adjacent third base nucleoside of the 3' proximal region of the second strand, (iii) two phosphorothioate internucleoside linkages are present between three consecutive positions in both the 5' and 3' end regions of the first strand, the terminal nucleosides in each of the 5' and 3' end regions of the first strand being attached by phosphorothioate internucleoside linkages to the adjacent second last nucleosides at 5' and 3', respectively, and each of the first 5' and 3' second last nucleosides being attached by phosphorothioate internucleoside linkages to the adjacent third last nucleosides at 5' and 3', respectively, and (iv) the second strand of the nucleic acid is directly or indirectly conjugated with one or more ligand moieties in the 5' end region of the second strand.

[0115] Examples of such structures are as follows (the specific RNA nucleosides shown are not limiting and may be any RNA nucleoside). A 3’-3’ inverse linkage (and the last phosphodiester bond between two abasic molecules in the 5’-3’ direction when read towards the end of the molecule is also shown)

[0116]

Chem.

[0117]

Chem.

[0118] One or more abasic nucleosides present in the nucleic acid are provided in the presence of one or more inverse nucleoside linkages, i.e., 5’-5’ or 3’-3’ inverse nucleoside linkages. The inverse linkage results from a change in the orientation of the adjacent nucleoside sugars, such that the sugars will have a 3’-5’ orientation as opposed to the conventional 5’-3’ orientation (based on the numbering of the ring atoms of the nucleoside sugar). One or more abasic nucleosides present in the nucleic acid of the present invention preferably contain such inverted nucleoside sugars.

[0119] When the terminal nucleoside has an inverted orientation, this results in an "inversion" of the terminal configuration of the entire nucleic acid. Certain structures illustrated and referred to herein are represented using the conventional 5'-3' direction (based on the numbering of the ring atoms of the nucleoside sugar), but the change in orientation and the presence of a terminal nucleoside with a proximal 3'-3' reverse linkage will result in a nucleic acid having an overall 5'-5' terminal structure (i.e., the conventional 3' terminal nucleoside becomes the 5' terminal nucleoside), which will be understood. Alternatively, it will be understood that the change in orientation and the presence of a terminal nucleoside with a proximal 5'-5' reverse linkage will result in a nucleic acid having an overall 3'-3' terminal structure.

[0120] The proximal 3'-3' or 5'-5' reverse linkages described herein may include reverse linkages that are directly adjacent / attached to a terminal nucleoside having an inverted orientation, e.g., a single terminal nucleoside having an inverted orientation. Alternatively, the proximal 3'-3' or 5'-5' reverse linkages described herein may include reverse linkages that are adjacent to two or more nucleosides having an inverted orientation, e.g., two or more terminal region nucleosides such as the terminal and the second last nucleoside, having an inverted orientation. Thus, the reverse linkage may be attached to the second last nucleoside having an inverted orientation. One of ordinary skill in the art will understand that the inverted orientation described above can result in a nucleic acid molecule having the overall 3'-3' or 5'-5' terminal structure described herein, but it will also be understood that if one or more additional reverse linkages and / or nucleosides having an inverted orientation are present, the overall nucleic acid can have a 3'-5' terminal structure corresponding to the 5' / 3' terminus of the conventional configuration.

[0121] In one aspect, the nucleic acid may have a 3'-3' reverse linkage and the terminal sugar moiety may contain a 5' OH rather than a 5' phosphate group at the 5' position of the terminal sugar.

[0122] Thus, one of ordinary skill in the art will clearly understand that 5'-5', 3'-3', and 3'-5' (read in that terminal direction) terminal variants of the more general 5'-3' structure (based on the numbering of the ring atoms of the terminal nucleoside sugar) depicted herein are within the scope of the present disclosure when one or more inverse linkages are present.

[0123] For example, in the situation of one or more nucleosides having an inverse orientation that creates an inverse internucleoside linkage and / or an inverse terminus, when the relative position of the linkage (e.g., relative to the linker) or the position of internal features (e.g., modified nucleosides) is defined relative to the 5' or 3' terminus of the nucleic acid, the 5' or 3' terminus is the conventional 5' or 3' terminus that would have been present if the inverse linkage were not arranged, and the conventional 5' or 3' terminus is determined by considering the majority of the directionality of the internal nucleoside linkages and / or nucleoside orientation within the nucleic acid. From such internal linkages and / or nucleoside orientation, it is possible to determine which terminus of the nucleic acid constitutes the conventional 5' and 3' termini (based on the numbering of the ring atoms of the terminal nucleoside sugar) of a molecule without the presence of an inverse linkage.

[0124] For example, in the structure shown below, abasic residues are present at the first two positions located at the 5' terminus. When the terminal nucleoside has an inverse orientation, the 5' terminus shown in the following figure, which is the conventional 5' terminus, may actually contain a 3'OH with the inverse nucleoside at the terminal position. Nevertheless, when reading in the standard 5'[PO4] to 3'[OH] direction of the nucleic acid molecule (referring to the numbering of the ring atoms of the nucleoside sugar), which can be used to determine the conventional 5' and 3' termini that would be found to have no inverse terminus arrangement, the majority of the molecule contains conventional internucleoside linkages connecting the 3'OH of one sugar to the 5' phosphate of the next sugar. 5'A-A-Me-Me-Me-Me-Me-Me-F-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me3'

[0125] In some embodiments, the second (sense) strand of the nucleic acid according to the invention has the following 5'-terminal motif [Chemical formula] {wherein B represents a nucleoside base, T represents H, OH or a 2'-ribose modification, Z represents the remaining nucleosides of the second strand} and contains two consecutive abasic nucleosides in the 5'-terminal region as shown herein.

[0126] In some embodiments, the second (sense) strand of the nucleic acid according to the invention has the following 5'-terminal motif [Chemical formula] {wherein B represents a nucleoside base, T represents H, OH or a 2'-ribose modification (preferably a 2'-ribose modification, more preferably a 2'-Me or 2'-F ribose modification), V represents O or S (preferably O), R represents H or C 1~4 alkyl (preferably H), Z represents the remaining nucleosides of the second strand}, more preferably the following 5'-terminal motif [Chemical formula] {wherein B represents a nucleoside base, T represents a 2'-ribose modification (preferably a 2'-Me or 2'-F ribose modification), Z represents the remaining nucleosides of the second strand} and contains two consecutive abasic nucleosides in the 5'-terminal region as shown herein.

[0127] Inverse conjugation is preferably located at the end of a nucleic acid, such as RNA, distal to the ligand portion of the molecule, such as the GalNAc-containing portion.

[0128] A GalNAc-siRNA construct having 5'-GalNAc on the sense strand can have an inverse conjugation at the end opposite to the sense strand.

[0129] A GalNAc-siRNA construct having 3'-GalNAc on the sense strand can have an inverse conjugation at the end opposite to the sense strand.

[0130] In a preferred embodiment, the second (sense) strand of the nucleic acid according to the invention has the following 5'-terminal motif

Chemical formula

Chemical formula

[0131] Length of the nucleic acid In one aspect, i) the first strand of the nucleic acid has a length in the range of 17 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 19 or 23 nucleosides, and / or ii) the second strand of the nucleic acid has a length in the range of 17 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 19 or 21 nucleosides.

[0132] Typically, the double-stranded region of the nucleic acid is 17 to 30 nucleosides in length, more preferably 19 or 21 nucleosides in length. Similarly, the complementary region between the first strand and the portion of the RNA transcribed from the HCII gene is 17 to 30 nucleosides in length.

[0133] Nucleic acid modification In certain embodiments, the nucleic acids of the invention, such as RNA, such as dsiRNA, do not include further modifications, such as chemical modifications or conjugations known in the art and described herein.

[0134] In other preferred embodiments, the nucleic acids of the invention, such as RNA, such as dsiRNA, are further chemically modified to enhance stability or other beneficial properties.

[0135] In certain embodiments of the invention, substantially all of the nucleosides are modified.

[0136] The nucleic acids characterized by the present invention can be synthesized or modified by methods well established in the art, such as those described in "Current protocols in nucleic acid chemistry", Beaucage, S.L. et al. (eds.), John Wiley & Sons, Inc., New York, NY, USA. This document is hereby incorporated herein by reference.

[0137] Modifications include terminal modifications, such as 5'-terminal modifications (phosphorylation, conjugation, inverted ligation) or 3'-terminal modifications (conjugation, DNA nucleosides within RNA, or RNA nucleosides within DNA, inverted ligation, etc.); base modifications, such as stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, substitution by conjugate bases; sugar modifications (e.g., at the 2'- or 4'-position) or sugar substitution; or backbone modifications, including modifications or substitutions of the phosphodiester linkage, such as those containing a modified backbone or lacking an internucleoside linkage between natural nucleosides.

[0138] Specific examples of nucleic acids, such as siRNA compounds useful in the embodiments described herein, include, but are not limited to, RNAs that contain a modified backbone or lack an internucleoside linkage between natural nucleosides. Nucleic acids, such as RNAs with a modified backbone, include, among others, those that do not have a phosphorus atom in the backbone. For the purposes of this specification and sometimes as referred to in the art, modified nucleic acids, such as RNAs, that do not have a phosphorus atom in the internucleoside backbone can also be considered oligonucleosides. In some embodiments, modified nucleic acids, such as siRNAs, will have a phosphorus atom in their internucleoside backbone.

[0139] Modified nucleic acid backbones, such as RNA backbones, include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl phosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-aminophosphoramidates and aminoalkyl phosphoramidates, thionophosphoramidates, thionoalkyl phosphonates, thionoalkyl phosphotriesters, and boranophosphates having the normal 3'-5' linkages, their 2'-5' linkage analogs, and those having an inverted polarity where adjacent pairs of nucleoside units are linked 5'-3' or 5'-2'. Also included are various salts, mixed salts, and free acid forms.

[0140] In addition, a modified nucleic acid, such as RNA, may contain one or more substituted sugar moieties. The nucleic acids characterized herein, such as siRNA, such as dsiRNA, may contain at the 2'-position one of the following: OH, F, O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-, or N-alkynyl; or O-alkyl-O-alkyl, and the alkyl, alkenyl, and alkynyl may or may not be substituted. 2'-O-methyl and 2'-F are preferred modifications.

[0141] In certain preferred embodiments, the nucleic acid contains at least one modified nucleoside.

[0142] The nucleic acids of the present invention may contain one or more modified nucleosides in the first strand and / or the second strand.

[0143] In some embodiments, substantially all of the nucleosides of the sense strand and all of the nucleosides of the antisense strand contain modifications.

[0144] In some embodiments, all of the nucleosides of the sense strand and substantially all of the nucleosides of the antisense strand contain modifications.

[0145] In some embodiments, all of the nucleosides of the sense strand and all of the nucleosides of the antisense strand contain modifications.

[0146] In one embodiment, at least one of the modified nucleosides is selected from the group consisting of: deoxy-nucleosides, 3'-terminal deoxy-thymidine (dT) nucleosides, 2'-O-methyl modified nucleosides (also referred to herein as 2'-Me, where Me is methoxy), 2'-fluoro modified nucleosides, 2'-deoxy modified nucleosides, locked nucleosides, unlocked nucleosides, nucleosides with restricted conformation, constrained ethyl nucleosides, abasic nucleosides, 2'-amino modified nucleosides, 2'-O-allyl modified nucleosides, 2'-O-alkyl modified nucleosides, 2'-hydroxyl modified nucleosides, 2'-methoxyethyl modified nucleosides, 2'-O-alkyl modified nucleosides, morpholino nucleosides, phosphoramidates, unnatural bases including nucleosides, tetrahydropyran modified nucleosides, 1,5-anhydrohexitol modified nucleosides, cyclohexenyl modified nucleosides, nucleosides containing phosphorothioate groups, nucleosides containing methylphosphonate groups, nucleosides containing 5'-phosphate, and nucleosides containing 5'-phosphate mimics. In another embodiment, the modified nucleoside comprises a short sequence of 3'-terminal deoxy-thymidine nucleoside (dT).

[0147] The modification of the nucleoside can preferably be selected from the group including, but not limited to, LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-alkyl, 2'-O-allyl, 2'-C-allyl, 2'-fluoro, 2'-deoxy, 2'-hydroxyl, and combinations thereof. In another embodiment, the modification of the nucleoside is a 2'-O-methyl ("2'-Me") or 2'-fluoro modification.

[0148] One preferred modification is a modification selected, optionally, from 2'-Me modification or 2'-F modification at the 2'-OH group of the ribose sugar.

[0149] Preferred nucleic acids contain one or more nucleosides in the first strand and / or the second strand, which are modified as follows to form modified nucleosides.

[0150] The modification is a modification selected from an optional 2'-Me modification or 2'-F modification at the 2'-OH group of the ribose sugar, nucleic acid.

[0151] The first strand is a nucleic acid that contains a 2'-F modification at any of the 2nd, 6th, 14th positions, or any combination thereof, counted from the 1st position of the first strand.

[0152] The second strand is a nucleic acid that contains a 2'-F modification at any of the 7th, 9th, 11th positions, or any combination thereof, counted from the 1st position of the second strand.

[0153] The first strand and the second strand each contain a 2'-Me modification and a 2'-F modification, nucleic acid.

[0154] At least one heat destabilizing modification, preferably at one or more of positions 1 to 9 of the first strand counted from the 1st position of the first strand, and / or at one or more of the positions of the second strand aligned with positions 1 to 9 of the first strand, nucleic acid, wherein the destabilizing modification is selected from modified unlocked nucleic acid (UNA) and glycol nucleic acid (GNA), preferably glycol nucleic acid, more preferably (S)-glycol nucleic acid.

[0155] A nucleic acid containing at least one heat destabilizing modification at the 7th position of the first strand counted from the 1st position of the first strand.

[0156] A nucleic acid that is an siRNA oligonucleoside, wherein the siRNA oligonucleoside contains three or more 2'-F modifications at positions 6 to 12 of the second strand counted from the 1st position of the second strand, for example, 4, 5, 6, or 7 2'-F modifications at positions 6 to 12 of the second strand.

[0157] A nucleic acid that is a siRNA oligonucleoside, wherein the second strand contains at least 3, for example 4, 5, or 6 2'-Me modifications at positions 1 to 6 of the second strand, counted from the 1st position of the second strand.

[0158] A nucleic acid that is a siRNA oligonucleoside, wherein the first strand contains at least 5 consecutive 2'-Me modifications in the 3' terminal region, preferably including the terminal nucleoside of the 3' terminal region, or within at least 1 or 2 nucleosides from the terminal nucleoside of the 3' terminal region.

[0159] A nucleic acid that is a siRNA oligonucleoside, wherein the first strand contains 7 consecutive 2'-Me modifications in the 3' terminal region, preferably including the terminal nucleoside of the 3' terminal region.

[0160] A nucleic acid that is a siRNA oligonucleoside, wherein each of the first strand and the second strand contains an alternating modification pattern, preferably a perfect alternating modification pattern, along the entire length of each of the first strand and the second strand. The nucleosides of the first strand are modified by (i) 2’Me modification of the odd-numbered nucleosides counted from the 1st position of the first strand, and (ii) 2’F modification of the even-numbered nucleosides counted from the 1st position of the first strand. The nucleosides of the second strand are modified by (i) 2’F modification of the odd-numbered nucleosides counted from the 1st position of the second strand, and (ii) 2’Me modification of the even-numbered nucleosides counted from the 1st position of the second strand. Typically, such a perfect alternating modification pattern is present in blunt-ended oligonucleosides, and each of the first strand and the second strand is 19 nucleosides in length.

[0161] The 1st position of the first strand or the second strand is closest to the end of the nucleic acid (any deprotected nucleosides are ignored), and is the nucleoside joined to the adjacent nucleoside (the 2nd position) via an internal bond from 3' to 5' when read in the direction away from that end of the molecule, based on the bond between the sugar moieties of the backbone.

[0162] Thus, it can be understood that the "first position of the sense strand" is the most 5'-terminal nucleoside of the conventional 5' end of the sense strand (excluding abasic nucleosides). Typically, the nucleoside at this first position of the sense strand will be equivalent to the 5'-nucleoside of the selected target nucleic acid sequence. More generally, the sense strand will have nucleosides equivalent to those of the target nucleic acid sequence starting from this first position of the sense strand, although acceptable mismatches between the sequences are also possible.

[0163] As used herein, the "first position of the antisense strand" is the most 5'-terminal nucleoside of the conventional 5' end of the antisense strand (excluding abasic nucleosides). As described above, there will be a region of complementarity between the sense strand and the antisense strand, and thus the antisense strand will also have a region of complementarity to the target nucleic acid sequence referred to above.

[0164] In certain embodiments, the nucleic acid, such as an siRNA agent, further comprises at least one phosphorothioate or methylphosphonate internucleoside linkage. For example, the phosphorothioate or methylphosphonate internucleoside linkage may be present at the 3'-end or terminal region of one strand, i.e., the sense strand or the antisense strand, or at the termini of both strands, the sense strand and the antisense strand.

[0165] In certain embodiments, the phosphorothioate or methylphosphonate internucleoside linkage may be present at the 5'-end or terminal region of one strand, i.e., the sense strand or the antisense strand, or at the termini of both strands, the sense strand and the antisense strand.

[0166] In certain embodiments, the phosphorothioate or methylphosphonate internucleoside linkage may be present at both the 5'- and 3'-ends or terminal regions of one strand, i.e., the sense strand or the antisense strand, or at the termini of both strands, the sense strand and the antisense strand.

[0167] Any nucleic acid may contain one or more phosphorothioate (PS) modifications within the nucleic acid, for example, at least two PS internucleoside linkages at the ends of the strand.

[0168] At least one of the oligoribonucleoside strands preferably contains at least two consecutive phosphorothioate modifications in the last three nucleosides of the oligonucleoside.

[0169] Accordingly, the present invention relates to a nucleic acid disclosed herein, which contains phosphorothioate internucleoside linkages between at least two or three consecutive positions, such as the 5' and / or 3' terminal regions and / or near-terminal regions of the second strand, wherein the near-terminal region is preferably adjacent to the terminal region where the one or more abasic nucleosides of the second strand are located.

[0170] The nucleic acids disclosed herein each contain phosphorothioate internucleoside linkages between at least two or three consecutive positions in the 5' and / or 3' terminal regions of the first strand, and preferably, the terminal positions in the 5' and / or 3' terminal regions of the first strand are attached to their adjacent positions by phosphorothioate internucleoside linkages.

[0171] The nucleic acid strand may be an RNA containing phosphorothioate internucleoside linkages between three consecutive nucleosides that are consecutive to two abasic nucleosides located at the ends.

[0172] A preferred nucleic acid is a double-stranded RNA containing two adjacent abasic nucleosides at the 5' end of the second strand and a ligand moiety containing one or more GalNAc ligand moieties at the 3' end on the opposite side of the second strand. More preferably, the same nucleic acid may further contain a phosphorothioate bond between the nucleotides at positions 3-4 and 4-5 of the second strand when read from position 1 of the second strand. Even more preferably, the same nucleic acid may further contain 2'-F modifications at positions 7, 9, and 11 of the second strand.

[0173] Preferred modifications are as follows.

[0174] The modified nucleoside of the second strand has a modification pattern (5'-3') by any one of the following: Me-Me-Me-Me-Me-Me-F-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-F-Me-Me, or Me-Me-Me-Me-Me-F-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me, or Me-Me-Me-Me-Me-Me-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me, or Me-Me-Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me, or Me-Me-Me-Me-Me-Me-F-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me A nucleic acid comprising the same.

[0175] The modified nucleoside of the second strand has a modification pattern (5'-3') by any one of the following: Me(s)Me(s)Me-Me-Me-Me-F-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-F-Me-Me, or Me(s)Me(s)Me-Me-Me-F-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me, or Me(s)Me(s)Me-Me-Me-Me-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me, or Me(s)Me(s)Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me, or Me(s)Me(s)Me-Me-Me-Me-F-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me, or Me-Me-Me-Me-Me-Me-F-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-F(s)Me(s)Me, or Me-Me-Me-Me-Me-F-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me(s)Me(s)Me, or Me-Me-Me-Me-Me-Me-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me(s)Me(s)Me, or Me-Me-Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me(s)Me(s)Me, or Me-Me-Me-Me-Me-Me-F-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me(s)Me(s)Me, comprising wherein (s) is a phosphorothioate internucleoside linkage, a nucleic acid.

[0176] The modified nucleosides of the second strand have a modification pattern (5'-3') by any one of the following: ia-ia-Me-Me-Me-Me-Me-Me-F-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-F-Me-Me, or ia-ia-Me-Me-Me-Me-Me-F-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me, or ia-ia-Me-Me-Me-Me-Me-Me-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me, or ia-ia-Me-Me-Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me, or ia-ia-Me-Me-Me-Me-Me-Me-F-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me, or Me-Me-Me-Me-Me-Me-F-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-F-Me-Me-ia-ia-, or Me-Me-Me-Me-Me-F-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-ia-ia-, or Me-Me-Me-Me-Me-Me-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-ia-ia-, or Me-Me-Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me-ia-ia-, or Me-Me-Me-Me-Me-Me-F-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me-ia-ia- and contains wherein ia represents an inverted abasic nucleoside, and when the inverted abasic nucleoside represented by ia-ia is present at the 3'-end of the second strand, the inverted abasic nucleoside is present in a 2-nucleoside overhang, a nucleic acid.

[0177] The modified nucleoside of the second strand has a modification pattern (5'-3') by any one of the following: ia-ia-Me(s)Me(s)Me-Me-Me-Me-F-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-F-Me-Me, or ia-ia-Me(s)Me(s)Me-Me-Me-F-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me, or ia-ia-Me(s)Me(s)Me-Me-Me-Me-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me, or ia-ia-Me(s)Me(s)Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me, or ia-ia-Me(s)Me(s)Me-Me-Me-Me-F-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me, or ​Me-Me-Me-Me-Me-Me-F-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-F(s)Me(s)Me-ia-ia, or Me-Me-Me-Me-Me-F-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me(s)Me(s)Me-ia-ia, or Me-Me-Me-Me-Me-Me-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me(s)Me(s)Me-ia-ia, or Me-Me-Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me(s)Me(s)Me-ia-ia, or Me-Me-Me-Me-Me-Me-F-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me(s)Me(s)Me-ia-ia, comprising wherein (s) is a phosphorothioate nucleoside internucleoside linkage, ia represents an inverted abasic nucleoside, and when the inverted abasic nucleoside represented by ia-ia is present at the 3'-end of the second strand, the inverted abasic nucleoside is present in the overhang of two nucleosides, a nucleic acid.

[0178] The modified nucleosides have the following modification patterns: Modification pattern 1: Second strand (5'-3'): Me-Me-Me-Me-Me-Me-F-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-F-Me-Me, First strand (5'-3'): Me-F-Me-F-Me-F-Me-F-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me-Me-Me or Modification pattern 2: Second strand (5'-3'): Me-Me-Me-Me-Me-F-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5'-3'): Me-F-Me-F-Me-F-Me-F-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me-Me-Me Or modified pattern 3: Second strand (5’-3’): Me-Me-Me-Me-Me-Me-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5’-3’): Me-F-Me-F-Me-F-Me-F-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me-Me-Me Or modified pattern 4: Second strand (5’-3’): Me-Me-Me-Me-Me-Me-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5’-3’): Me-F-Me-F-Me-F-Me-Me-Me-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me-Me-Me Or modified pattern 5: Second strand (5’-3’): Me-Me-Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5’-3’): Me-F-Me-Me-Me-F-Me-Me-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me-Me-Me Or modified pattern 6: A nucleic acid comprising any one of Second strand (5’-3’): Me-Me-Me-Me-Me-Me-F-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5’-3’): Me-F-Me-Me-Me-F-Me-Me-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me-Me-Me

[0179] The modified nucleoside has the following modified pattern: Modified pattern 1: Second strand (5’-3’): Me(s)Me(s)Me-Me-Me-Me-F-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-F-Me-Me, First strand (5’-3’): Me(s)F(s)Me-F-Me-F-Me-F-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me(s)Me(s)Me Or modified pattern 2: Second strand (5’-3’): Me(s)Me(s)Me-Me-Me-F-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5’-3’): Me(s)F(s)Me-F-Me-F-Me-F-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me(s)Me(s)Me Or modified pattern 3: Second strand (5’-3’): Me(s)Me(s)Me-Me-Me-Me-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5’-3’): Me(s)F(s)Me-F-Me-F-Me-F-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me(s)Me(s)Me Or modified pattern 4: Second strand (5’-3’): Me(s)Me(s)Me-Me-Me-Me-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5’-3’): Me(s)F(s)Me-F-Me-F-Me-Me-Me-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me(s)Me(s)Me Or modified pattern 5: Second strand (5’-3’): Me(s)Me(s)Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5’-3’): Me(s)F(s)Me-Me-Me-F-Me-Me-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me(s)Me(s)Me Or modified pattern 6: Second strand (5’-3’): Me(s)Me(s)Me-Me-Me-Me-F-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5’-3’): Me(s)F(s)Me-Me-Me-F-Me-Me-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me(s)Me(s)Me, including any one of them, wherein (s) is a phosphorothioate nucleoside internucleoside linkage, a nucleic acid.

[0180] The modified nucleosides have the following modification patterns: Modification pattern 1: Second strand (5’-3’): Me-Me-Me-Me-Me-Me-F-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-F(s)Me(s)Me, First strand (5’-3’): Me(s)F(s)Me-F-Me-F-Me-F-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me(s)Me(s)Me Or modification pattern 2: Second strand (5’-3’): Me-Me-Me-Me-Me-F-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me(s)Me(s)Me, First strand (5’-3’): Me(s)F(s)Me-F-Me-F-Me-F-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me(s)Me(s)Me Or modification pattern 3: Second strand (5’-3’): Me-Me-Me-Me-Me-Me-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me(s)Me(s)Me, First strand (5’-3’): Me(s)F(s)Me-F-Me-F-Me-F-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me(s)Me(s)Me Or modification pattern 4: Second strand (5’-3’): Me-Me-Me-Me-Me-Me-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me(s)Me(s)Me, First strand (5’-3’): Me(s)F(s)Me-F-Me-F-Me-Me-Me-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me(s)Me(s)Me Or modification pattern 5: Second strand (5’-3’): Me-Me-Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me(s)Me(s)Me, First strand (5’-3’): Me(s)F(s)Me-Me-Me-F-Me-Me-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me(s)Me(s)Me Or modified pattern 6: Second strand (5’-3’): Me-Me-Me-Me-Me-Me-F-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me(s)Me(s)Me, first strand (5’-3’): Me(s)F(s)Me-Me-Me-F-Me-Me-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me(s)Me(s)Me, including any one of them, where (s) is a phosphorothioate internucleoside linkage, a nucleic acid.

[0181] The modified nucleoside has the following modified patterns: Modified pattern 1: Second strand (5’-3’): ia-ia-Me-Me-Me-Me-Me-Me-F-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-F-Me-Me, first strand (5’-3’): Me-F-Me-F-Me-F-Me-F-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me-Me-Me Or modified pattern 2: Second strand (5’-3’): ia-ia-Me-Me-Me-Me-Me-F-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me, first strand (5’-3’): Me-F-Me-F-Me-F-Me-F-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me-Me-Me Or modified pattern 3: Second strand (5’-3’): ia-ia-Me-Me-Me-Me-Me-Me-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me, first strand (5’-3’): Me-F-Me-F-Me-F-Me-F-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me-Me-Me Or modified pattern 4: Second strand (5’-3’): ia-ia-Me-Me-Me-Me-Me-Me-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me, first strand (5’-3’): Me-F-Me-F-Me-F-Me-Me-Me-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me-Me-Me Or modified pattern 5: Second strand (5’-3’): ia-ia-Me-Me-Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5’-3’): Me-F-Me-Me-Me-F-Me-Me-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me-Me-Me Or modified pattern 6: Second strand (5’-3’): ia-ia-Me-Me-Me-Me-Me-Me-F-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5’-3’): Me-F-Me-Me-Me-F-Me-Me-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me-Me-Me, including any one of them, In the formula, ia represents an inverted abasic nucleoside, a nucleic acid.

[0182] The modified nucleoside has the following modified patterns: Modified pattern 1: Second strand (5’-3’): Me-Me-Me-Me-Me-Me-F-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-F-Me-Me-ia-ia, First strand (5’-3’): Me-F-Me-F-Me-F-Me-F-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me-Me-Me Or modified pattern 2: Second strand (5’-3’): Me-Me-Me-Me-Me-F-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-ia-ia, First strand (5’-3’): Me-F-Me-F-Me-F-Me-F-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me-Me-Me Or modified pattern 3: Second strand (5’-3’): Me-Me-Me-Me-Me-Me-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-ia-ia, First strand (5’-3’): Me-F-Me-F-Me-F-Me-F-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me-Me-Me Or modified pattern 4: Second strand (5’-3’): Me-Me-Me-Me-Me-Me-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-ia-ia, First strand (5’-3’): Me-F-Me-F-Me-F-Me-Me-Me-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me-Me-Me Or modified pattern 5: Second strand (5’-3’): Me-Me-Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me-ia-ia, First strand (5’-3’): Me-F-Me-Me-Me-F-Me-Me-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me-Me-Me Or modified pattern 6: Second strand (5’-3’): Me-Me-Me-Me-Me-Me-F-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me-ia-ia, - First strand (5’-3’): Me-F-Me-Me-Me-F-Me-Me-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me-Me-Me, including any one of them Wherein, ia represents an inverted abasic nucleoside, and when the inverted abasic nucleoside represented by ia-ia is present at the 3’ end of the second strand, the inverted abasic nucleoside is present in the overhang of two nucleosides, nucleic acid.

[0183] The modified nucleoside has the following modified pattern: Modified pattern 1: Second strand (5’-3’): ia-ia-Me(s)Me(s)Me-Me-Me-Me-F-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-F-Me-Me, First strand (5’-3’): Me(s)F(s)Me-F-Me-F-Me-F-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me(s)Me(s)Me Or modified pattern 2: Second strand (5’-3’): ia-ia-Me(s)Me(s)Me-Me-Me-F-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5’-3’): Me(s)F(s)Me-F-Me-F-Me-F-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me(s)Me(s)Me Or modified pattern 3: Second strand (5’-3’): ia-ia-Me(s)Me(s)Me-Me-Me-Me-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5’-3’): Me(s)F(s)Me-F-Me-F-Me-F-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me(s)Me(s)Me Or modified pattern 4: Second strand (5’-3’): ia-ia-Me(s)Me(s)Me-Me-Me-Me-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5’-3’): Me(s)F(s)Me-F-Me-F-Me-Me-Me-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me(s)Me(s)Me Or modified pattern 5: Second strand (5’-3’): ia-ia-Me(s)Me(s)Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5’-3’): Me(s)F(s)Me-Me-Me-F-Me-Me-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me(s)Me(s)Me Or modified pattern 6: Second strand (5’-3’): ia-ia-Me(s)Me(s)Me-Me-Me-Me-F-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5’-3’): Me(s)F(s)Me-Me-Me-F-Me-Me-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me(s)Me(s)Me, including any one of them, wherein, (s) is a phosphorothioate nucleoside internucleoside linkage, and ia represents an inverted abasic nucleoside, a nucleic acid.

[0184] The modified nucleosides have the following modification patterns: Modification pattern 1: Second strand (5’-3’): Me-Me-Me-Me-Me-Me-F-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-F(s)Me(s)Me-ia-ia, First strand (5’-3’): Me(s)F(s)Me-F-Me-F-Me-F-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me(s)Me(s)Me Or modification pattern 2: Second strand (5’-3’): Me-Me-Me-Me-Me-F-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me(s)Me(s)Me-ia-ia, First strand (5’-3’): Me(s)F(s)Me-F-Me-F-Me-F-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me(s)Me(s)Me Or modification pattern 3: Second strand (5’-3’): Me-Me-Me-Me-Me-Me-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me(s)Me(s)Me-ia-ia, First strand (5’-3’): Me(s)F(s)Me-F-Me-F-Me-F-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me(s)Me(s)Me Or modification pattern 4: Second strand (5’-3’): Me-Me-Me-Me-Me-Me-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me(s)Me(s)Me-ia-ia, First strand (5’-3’): Me(s)F(s)Me-F-Me-F-Me-Me-Me-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me(s)Me(s)Me Or modified pattern 5: Second strand (5’-3’): Me-Me-Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me(s)Me(s)Me-ia-ia, First strand (5’-3’): Me(s)F(s)Me-Me-Me-F-Me-Me-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me(s)Me(s)Me Or modified pattern 6: Second strand (5’-3’): Me-Me-Me-Me-Me-Me-F-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me(s)Me(s)Me-ia-ia, First strand (5’-3’): Me(s)F(s)Me-Me-Me-F-Me-Me-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me(s)Me(s)Me, including any one of them, wherein (s) is a phosphorothioate nucleoside internucleoside linkage, ia represents an inverted abasic nucleoside, and when the inverted abasic nucleoside represented by ia-ia is present at the 3’ end of the second strand, the inverted abasic nucleoside is present in a 2-nucleoside overhang, nucleic acid.

[0185] The modified nucleoside has the following modified pattern: Modified pattern 4: Second strand (5’-3’): ia-ia-Me(s)Me(s)Me-Me-Me-Me-F-Me-F-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5’-3’): Me(s)F(s)Me-F-Me-F-Me-Me-Me-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me(s)Me(s)Me, including wherein (s) is a phosphorothioate nucleoside internucleoside linkage and ia represents an inverted abasic nucleoside, The nucleic acid is particularly preferred.

[0186] The first strand contains a 2’ sugar modification pattern, and the modification is selected from at least 2’Me and 2’F sugar modifications, provided that the total number of 2’F sugar modifications in the first strand does not consist of 4 2’F modifications nor 6 2’F modifications, nucleic acid.

[0187] A nucleic acid in which the first strand contains a 2'-sugar modification pattern, said modification being selected from at least 2'-Me and 2'-F sugar modifications, and the total number of 2'-F sugar modifications in the first strand consists of 3, 5, or 7 2'-F modifications.

[0188] A nucleic acid in which the first strand contains a 2'-sugar modification pattern, said modification being selected from at least 2'-Me and 2'-F sugar modifications, and the total number of 2'-F sugar modifications in the first strand consists of 3 2'-F modifications.

[0189] A nucleic acid in which the first strand contains a 2'-sugar modification pattern, said modification being selected from at least 2'-Me and 2'-F sugar modifications, and the total number of 2'-F sugar modifications in the first strand consists of 5 2'-F modifications.

[0190] The first strand has the following 2'-sugar modification pattern (5'-3'): Me-F-Me-X2-Me-F-(Me)7-(F-Me)2-X3-Me-X4-(Me)3 and wherein X2, X3, and X4 are selected from 2'-Me and 2'-F sugar modifications, provided that at least one of X2, X3, and X4 is a 2'-F sugar modification and the other two sugar modifications are 2'-Me sugar modifications.

[0191] The first strand has the following 2'-sugar modification pattern (5'-3'): Me-F-Me-X2-Me-F-(Me)7-(F-Me)2-X3-Me-X4-(Me)3 and wherein X2 is a 2'-F sugar modification and X3 and X4 are 2'-Me sugar modifications.

[0192] The first strand has the following 2'-sugar modification pattern (5'-3'): Me-F-Me-X2-Me-F-(Me)7-(F-Me)2-X3-Me-X4-(Me)3 and wherein X3 is a 2'-F sugar modification and X2 and X4 are 2'-Me sugar modifications.

[0193] The first strand has the following 2'-sugar modification pattern (5'-3'): Me-F-Me-X2-Me-F-(Me)7-(F-Me)2-X3-Me-X4-(Me)3 and wherein X4 is a 2'-F sugar modification and X2 and X3 are 2'-Me sugar modifications, a nucleic acid.

[0194] The first strand contains a 2'-sugar modification pattern, said modification being selected from at least 2'-Me and 2'-F sugar modifications, and the total number of 2'-F sugar modifications of the first strand consists of 7 2'-F modifications, a nucleic acid.

[0195] The first strand has the following 2'-sugar modification pattern (5'-3'): Me-F-Me-X2-Me-F-Me-(F)2-(Me)4-(F-Me)2-X3-Me-X4-(Me)3 and wherein X2, X3, and X4 are selected from 2'-Me and 2'-F sugar modifications, provided that at least one of X2, X3, and X4 is a 2'-F sugar modification and the other two sugar modifications are 2'-Me sugar modifications, a nucleic acid.

[0196] The first strand has the following 2'-sugar modification pattern (5'-3'): Me-F-Me-X2-Me-F-Me-(F)2-(Me)4-(F-Me)2-X3-Me-X4-(Me)3 and wherein X2 is a 2'-F sugar modification and X3 and X4 are 2'-Me sugar modifications, a nucleic acid.

[0197] The first strand has the following 2'-sugar modification pattern (5'-3'): Me-F-Me-X2-Me-F-Me-(F)2-(Me)4-(F-Me)2-X3-Me-X4-(Me)3 and wherein X3 is a 2'-F sugar modification and X2 and X4 are 2'-Me sugar modifications, a nucleic acid.

[0198] The first strand has the following 2'-sugar modification pattern (5'-3'): Me-F-Me-X2-Me-F-Me-(F)2-(Me)4-(F-Me)2-X3-Me-X4-(Me)3 comprising a nucleic acid wherein X4 is a 2'-F sugar modification and X2 and X3 are 2'-Me sugar modifications.

[0199] The first strand has the following 2'-sugar modification pattern (5'-3'): Me-F-(Me)3-X1-(Me)7-F-Me-F-(Me)7 comprising a nucleic acid wherein X1 is a heat destabilizing modification.

[0200] The first strand has the following 2'-sugar modification pattern (5'-3'): Me-F-(Me)3-X1-Me-(F)2-(Me)4-F-Me-F-(Me)7 comprising a nucleic acid wherein X1 is a heat destabilizing modification.

[0201] The second strand has the following 2'-sugar modification pattern (5'-3'): (Me)8-(F)3-(Me) 10 comprising a nucleic acid.

[0202] The second strand has the following 2'-sugar modification pattern (5'-3'): (Me)8-(F)3-(Me) 10 , comprising a nucleic acid wherein the first strand comprises a 2'-sugar modification pattern, said modification being selected from at least 2'-Me and 2'-F sugar modifications, provided that the total number of 2'-F sugar modifications in the first strand is neither four 2'-F modifications nor six 2'-F modifications.

[0203] The second strand has the following 2'-sugar modification pattern (5'-3'): (Me)8-(F)3-(Me) 10 comprising A nucleic acid in which the first strand contains a 2'-sugar modification pattern, said modification being selected from at least 2'-Me and 2'-F sugar modifications, and the total number of 2'-F sugar modifications in the first strand consists of 3, 5, or 7 2'-F modifications.

[0204] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a double-stranded region that is at least 17 nucleosides in length, and the nucleosides of the second strand have the following 2'-sugar modification pattern (5'-3'): (Me)8-(F)3-(Me) 10 comprising The nucleosides of the first strand have the following 2'-sugar modification pattern (5'-3'): Me-F-(Me)3-X1-(Me)7-F-Me-F-(Me)7, wherein X1 is a heat destabilizing modification.

[0205] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a double-stranded region that is at least 17 nucleosides in length, and the nucleosides of the second strand have the following 2'-sugar modification pattern (5'-3'): (Me)8-(F)3-(Me) 10 , comprising The nucleosides of the first strand have the following 2'-sugar modification pattern (5'-3'): (Me-F)3-(Me)7-F-Me-F-(Me)7 comprising.

[0206] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a double-stranded region that is at least 17 nucleosides in length, and the nucleosides of the second strand have the following 2'-sugar modification pattern (5'-3'): (Me)8-(F)3-(Me) 10 comprising the nucleosides of the first strand having the following 2'-sugar modification pattern (5'-3'): Me-F-(Me)3-F-(Me)7-(F-Me)2-F-(Me)5 a nucleic acid.

[0207] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from a target gene and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a double-stranded region that is at least 17 nucleosides in length, and the nucleosides of the second strand have the following 2'-sugar modification pattern (5'-3'): (Me)8-(F)3-(Me) 10 , comprising the nucleosides of the first strand having the following 2'-sugar modification pattern (5'-3'): Me-F-(Me)3-F-(Me)7-F-Me-F-(Me)3-F-(Me)3 a nucleic acid.

[0208] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from a target gene and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a double-stranded region that is at least 17 nucleosides in length, and the nucleosides of the second strand have the following 2'-sugar modification pattern (5'-3'): (Me)8-(F)3-(Me) 10 , comprising the nucleosides of the first strand having the following 2'-sugar modification pattern (5'-3'): Me-F-(Me)3-X1-Me-(F)2-(Me)4-F-Me-F-(Me)7, wherein X1 is a thermolabile modification, a nucleic acid.

[0209] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a double-stranded region that is at least 17 nucleosides in length, and the nucleosides of the second strand have the following 2'-sugar modification pattern (5'-3'): (Me)8-(F)3-(Me) 10 , and the nucleosides of the first strand have the following 2'-sugar modification pattern (5'-3'): (Me-F)3-Me-(F)2-(Me)4-(F-Me)2-(Me)6 A nucleic acid comprising the above.

[0210] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a double-stranded region that is at least 17 nucleosides in length, and the nucleosides of the second strand have the following 2'-sugar modification pattern (5'-3'): (Me)8-(F)3-(Me) 10 , and the nucleosides of the first strand have the following 2'-sugar modification pattern (5'-3'): Me-F-(Me)3-F-Me-(F)2-(Me)4-(F-Me)2-F-(Me)5 A nucleic acid comprising the above.

[0211] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a double-stranded region that is at least 17 nucleosides in length, and the nucleosides of the second strand have the following 2'-sugar modification pattern (5'-3'): (Me)8-(F)3-(Me) 10 , and the nucleosides of the first strand have the following 2'-sugar modification pattern (5'-3'): Me-F-(Me)3-F-Me-(F)2-(Me)4-(F-Me)2-(Me)2-F-(Me)3 A nucleic acid comprising

[0212] The second strand has the following 2'-sugar modification and abasic modification pattern (5'-3'): ia-ia-(Me)8-(F)3-(Me) 10 comprising A nucleic acid, wherein ia represents an inverted abasic nucleoside

[0213] The second strand has the following 2'-sugar modification and abasic modification pattern (5'-3'): ia-ia-(Me)8-(F)3-(Me) 10 comprising, wherein ia represents an inverted abasic nucleoside The first strand comprises a 2'-sugar modification pattern, said modification being selected from at least 2'-Me and 2'-F sugar modifications, provided that the total number of 2'-F sugar modifications in the first strand does not consist of 4 2'-F modifications nor 6 2'-F modifications. A nucleic acid

[0214] The second strand has the following 2'-sugar modification and abasic modification pattern (5'-3'): ia-ia-(Me)8-(F)3-(Me) 10 comprising, wherein ia represents an inverted abasic nucleoside The first strand comprises a 2'-sugar modification pattern, said modification being selected from at least 2'-Me and 2'-F sugar modifications, and the total number of 2'-F sugar modifications in the first strand consists of 3, 5, or 7 2'-F modifications. A nucleic acid

[0215] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from a target gene and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a double-stranded region that is at least 17 nucleosides in length, and the nucleosides of the second strand have the following 2'-sugar modification and abasic modification pattern (5'-3'): ia-ia-(Me)8-(F)3-(Me) 10comprising, wherein ia represents an inverted abasic nucleoside, The nucleosides of the first strand are the following 2'-sugar modification patterns (5'-3'): Me-F-(Me)3-X1-(Me)7-F-Me-F-(Me)7, wherein X1 is a heat destabilizing modification, nucleic acid.

[0216] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a double-stranded region that is at least 17 nucleosides in length, and the nucleosides of the second strand are the following 2'-sugar modification and abasic modification patterns (5'-3'): ia-ia-(Me)8-(F)3-(Me) 10 comprising, wherein ia represents an inverted abasic nucleoside, The nucleosides of the first strand are the following 2'-sugar modification patterns (5'-3'): (Me-F)3-(Me)7-F-Me-F-(Me)7 A nucleic acid comprising.

[0217] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a double-stranded region that is at least 17 nucleosides in length, and the nucleosides of the second strand are the following 2'-sugar modification and abasic modification patterns (5'-3'): ia-ia-(Me)8-(F)3-(Me) 10 comprising, wherein ia represents an inverted abasic nucleoside, The nucleosides of the first strand are the following 2'-sugar modification patterns (5'-3'): Me-F-(Me)3-F-(Me)7-(F-Me)2-F-(Me)5 A nucleic acid comprising.

[0218] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a double-stranded region that is at least 17 nucleosides in length, and the nucleosides of the second strand have the following 2'-sugar modification and abasic modification pattern (5'-3'): ia-ia-(Me)8-(F)3-(Me) 10 wherein ia represents an inverted abasic nucleoside, the nucleosides of the first strand have the following 2'-sugar modification pattern (5'-3'): Me-F-(Me)3-F-(Me)7-F-Me-F-(Me)3-F-(Me)3 A nucleic acid comprising the above.

[0219] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a double-stranded region that is at least 17 nucleosides in length, and the nucleosides of the second strand have the following 2'-sugar modification and abasic modification pattern (5'-3'): ia-ia-(Me)8-(F)3-(Me) 10 wherein ia represents an inverted abasic nucleoside, the nucleosides of the first strand have the following 2'-sugar modification pattern (5'-3'): Me-F-(Me)3-X1-Me-(F)2-(Me)4-F-Me-F-(Me)7, wherein X1 is a heat destabilizing modification, A nucleic acid as described above.

[0220] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a double-stranded region that is at least 17 nucleosides in length, and the nucleosides of the second strand have the following 2'-sugar modification and abasic modification pattern (5'-3'): ia-ia-(Me)8-(F)3-(Me)10 comprising, wherein ia represents an inverted abasic nucleoside, The nucleosides of the first strand have the following 2'-sugar modification pattern (5'-3'): (Me-F)3-Me-(F)2-(Me)4-(F-Me)2-(Me)6 A nucleic acid comprising.

[0221] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a double-stranded region that is at least 17 nucleosides in length, and the nucleosides of the second strand have the following 2'-sugar modification and abasic modification pattern (5'-3'): ia-ia-(Me)8-(F)3-(Me) 10 comprising, wherein ia represents an inverted abasic nucleoside, The nucleosides of the first strand have the following 2'-sugar modification pattern (5'-3'): Me-F-(Me)3-F-Me-(F)2-(Me)4-(F-Me)2-F-(Me)5 A nucleic acid comprising.

[0222] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a double-stranded region that is at least 17 nucleosides in length, and the nucleosides of the second strand have the following 2'-sugar modification and abasic modification pattern (5'-3'): ia-ia-(Me)8-(F)3-(Me) 10 comprising, wherein ia represents an inverted abasic nucleoside, The nucleosides of the first strand have the following 2'-sugar modification pattern (5'-3'): Me-F-(Me)3-F-Me-(F)2-(Me)4-(F-Me)2-(Me)2-F-(Me)3 A nucleic acid comprising.

[0223] The second strand has the following 2'-sugar modification pattern (5'-3'): ia-ia-Me(s)Me(s)(Me)6-(F)3-(Me) 10 comprising wherein ia represents an inverted abasic nucleoside and (s) represents a phosphorothioate linkage, a nucleic acid.

[0224] The second strand has the following 2'-sugar modification pattern (5'-3'): ia-ia-Me(s)Me(s)(Me)6-(F)3-(Me) 10 comprising, wherein ia represents an inverted abasic nucleoside and (s) represents a phosphorothioate linkage, The first strand comprises a 2'-sugar modification pattern, said modification being selected from at least 2'-Me and 2'-F sugar modifications, provided that the total number of 2'-F sugar modifications in the first strand is neither four 2'-F modifications nor six 2'-F modifications, a nucleic acid.

[0225] The second strand has the following 2'-sugar modification pattern (5'-3'): ia-ia-Me(s)Me(s)(Me)6-(F)3-(Me) 10 comprising, wherein ia represents an inverted abasic nucleoside and (s) represents a phosphorothioate linkage, The first strand comprises a 2'-sugar modification pattern, said modification being selected from at least 2'-Me and 2'-F sugar modifications, and the total number of 2'-F sugar modifications in the first strand is three, five, or seven 2'-F modifications, a nucleic acid.

[0226] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from a target gene and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a double-stranded region that is at least 17 nucleosides in length, and the nucleosides of the second strand have the following 2'-sugar modification and abasic modification pattern (5'-3'): ia-ia-Me(s)Me(s)(Me)6-(F)3-(Me) 10comprising, wherein ia represents an inverted abasic nucleoside, (s) represents a phosphorothioate linkage, The nucleosides of the first strand are the following 2'-sugar modification patterns (5'-3'): comprising Me(s)F(s)(Me)3-X1-(Me)7-F-Me-F-(Me)5(s)Me(s)Me, wherein X1 is a thermolabile modification, a nucleic acid.

[0227] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a double-stranded region that is at least 17 nucleosides in length, and the nucleosides of the second strand are the following 2'-sugar modification and abasic modification patterns (5'-3'): ia-ia-Me(s)Me(s)(Me)6-(F)3-(Me) 10 comprising, wherein ia represents an inverted abasic nucleoside, (s) represents a phosphorothioate linkage, The nucleosides of the first strand are the following 2'-sugar modification patterns (5'-3'): Me(s)F(s)Me-F-Me-F-(Me)7-F-Me-F-(Me)5(s)Me(s)Me A nucleic acid comprising.

[0228] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a double-stranded region that is at least 17 nucleosides in length, and the nucleosides of the second strand are the following 2'-sugar modification and abasic modification patterns (5'-3'): ia-ia-Me(s)Me(s)(Me)6-(F)3-(Me) 10 comprising, wherein ia represents an inverted abasic nucleoside, (s) represents a phosphorothioate linkage, The nucleosides of the first strand are the following 2'-sugar modification patterns (5'-3'): Me(s)F(s)(Me)3-F-(Me)7-(F-Me)2-F-(Me)3(s)Me(s)Me A nucleic acid comprising

[0229] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a double-stranded region that is at least 17 nucleosides in length, and the nucleosides of the second strand have the following 2'-sugar modification and abasic modification pattern (5'-3'): ia-ia-Me(s)Me(s)(Me)6-(F)3-(Me) 10 wherein ia represents an inverted abasic nucleoside and (s) represents a phosphorothioate linkage, The nucleosides of the first strand have the following 2'-sugar modification pattern (5'-3'): Me(s)F(s)(Me)3-F-(Me)7-F-Me-F-(Me)3-F-Me(s)Me(s)Me A nucleic acid comprising

[0230] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a double-stranded region that is at least 17 nucleosides in length, and the nucleosides of the second strand have the following 2'-sugar modification and abasic modification pattern (5'-3'): ia-ia-Me(s)Me(s)(Me)6-(F)3-(Me) 10 wherein ia represents an inverted abasic nucleoside and (s) represents a phosphorothioate linkage, The nucleosides of the first strand have the following 2'-sugar modification pattern (5'-3'): Me(s)F(s)(Me)3-X1-Me-(F)2-(Me)4-F-Me-F-(Me)5(s)Me(s)Me, wherein X1 is a thermolabile modification, a nucleic acid.

[0231] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a double-stranded region that is at least 17 nucleosides in length, and the nucleosides of the second strand have the following 2'-sugar modification and abasic modification pattern (5'-3'): ia-ia-Me(s)Me(s)(Me)6-(F)3-(Me) 10 wherein ia represents an inverted abasic nucleoside and (s) represents a phosphorothioate linkage, The nucleosides of the first strand have the following 2'-sugar modification pattern (5'-3'): Me(s)F(s)Me-F-Me-F-Me-(F)2-(Me)4-(F-Me)2-(Me)4(s)Me(s)Me A nucleic acid comprising the same.

[0232] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a double-stranded region that is at least 17 nucleosides in length, and the nucleosides of the second strand have the following 2'-sugar modification and abasic modification pattern (5'-3'): ia-ia-Me(s)Me(s)(Me)6-(F)3-(Me) 10 wherein ia represents an inverted abasic nucleoside and (s) represents a phosphorothioate linkage, The nucleosides of the first strand have the following 2'-sugar modification pattern (5'-3'): Me(s)F(s)(Me)3-F-Me-(F)2-(Me)4-(F-Me)2-F-(Me)3(s)Me(s)Me A nucleic acid comprising the same.

[0233] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a double-stranded region that is at least 17 nucleosides in length, and the nucleosides of the second strand have the following 2'-sugar modification and abasic modification pattern (5'-3'): ia-ia-Me(s)Me(s)(Me)6-(F)3-(Me) 10 wherein ia represents an inverted abasic nucleoside, and (s) represents a phosphorothioate linkage, The nucleosides of the first strand have the following 2'-sugar modification pattern (5'-3'): Me(s)F(s)(Me)3-F-Me-(F)2-(Me)4-(F-Me)2-(Me)2-F-Me(s)Me(s)Me A nucleic acid comprising the above.

[0234] Preferred modifications are as follows. Modification pattern 1: Second strand (5'-3'): ia-ia-Me-Me-Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5'-3'): Me-F-Me-Me-Me-X1-Me-Me-Me-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me-Me-Me, wherein X1 is a thermolabile modification; Or modification pattern 2: Second strand (5'-3'): ia-ia-Me-Me-Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5'-3'): Me-F-Me-F-Me-F-Me-Me-Me-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me-Me-Me ; Or modification pattern 3: Second strand (5’-3’): ia-ia-Me-Me-Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5’-3’): Me-F-Me-Me-Me-F-Me-Me-Me-Me-Me-Me-Me-F-Me-F-Me-F-Me-Me-Me-Me-Me ; Or modification pattern 4: Second strand (5’-3’): ia-ia-Me-Me-Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5’-3’): Me-F-Me-Me-Me-F-Me-Me-Me-Me-Me-Me-Me-F-Me-F-Me-Me-Me-F-Me-Me-Me ; Or modification pattern 5: Second strand (5’-3’): ia-ia-Me-Me-Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5’-3’): Me-F-Me-Me-Me-X1-Me-F-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me-Me-Me, where X1 is a thermolabile modification; Or modification pattern 6: Second strand (5’-3’): ia-ia-Me-Me-Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5’-3’): Me-F-Me-F-Me-F-Me-F-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me-Me-Me ; Or modification pattern 7: Second strand (5’-3’): ia-ia-Me-Me-Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5’-3’): Me-F-Me-Me-Me-F-Me-F-F-Me- Me-Me-Me-F-Me-F-Me-F-Me-Me-Me-Me-Me ; or modification pattern 8: Second strand (5’-3’): ia-ia-Me-Me-Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5’-3’): Me-F-Me-Me-Me-F-Me-F-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-F-Me-Me-Me wherein ia represents an inverted abasic nucleoside.

[0235] More preferred modifications are as follows. Modification pattern 1: Second strand (5’-3’): ia-ia-Me(s)Me(s)Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5’-3’): Me(s)F(s)Me-Me-Me-X1-Me-Me-Me-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me(s)Me(s)Me, wherein X1 is a thermolabile modification; or modification pattern 2: Second strand (5’-3’): ia-ia-Me(s)Me(s)Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5’-3’): Me(s)F(s)Me-F-Me-F-Me-Me-Me-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me(s)Me(s)Me ; or modification pattern 3: Second strand (5’-3’): ia-ia-Me(s)Me(s)Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5’-3’): Me(s)F(s)Me-Me-Me-F-Me-Me-Me-Me-Me-Me-Me-F-Me-F-Me-Me-Me-F-Me(s)Me(s)Me ; or modification pattern 4: Second strand (5’-3’): ia-ia-Me(s)Me(s)Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5’-3’): Me(s)F(s)Me-Me-Me-F-Me-Me-Me-Me-Me-Me-Me-F-Me-F-Me-Me-Me-F-Me(s)Me(s)Me ; or modification pattern 5: Second strand (5’-3’): ia-ia-Me(s)Me(s)Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5’-3’): Me(s)F(s)Me-Me-Me-X1-Me-F-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me(s)Me(s)Me, where X1 is a thermolabile modification; or modification pattern 6: Second strand (5’-3’): ia-ia-Me(s)Me(s)Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5’-3’): Me(s)F(s)Me-F-Me-F-Me-F-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-Me-Me(s)Me(s)Me ; or modification pattern 7: Second strand (5’-3’): ia-ia-Me(s)Me(s)Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5’-3’): Me(s)F(s)Me-Me-Me-F-Me-F-F-Me -Me-Me-Me-F-Me-F-Me-F-Me-Me-Me(s)Me(s)Me ; or modification pattern 8: Second strand (5’-3’): ia-ia-Me(s)Me(s)Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me, First strand (5’-3’): Me(s)F(s)Me-Me-Me-F-Me-F-F-Me-Me-Me-Me-F-Me-F-Me-Me-Me-F-Me(s)Me(s)Me; wherein (s) is a phosphorothioate internucleoside linkage and ia represents an inverted abasic nucleoside.

[0236] Conjugation Another modification of the nucleic acids of the present invention, such as RNA, such as siRNA, involves conjugating the nucleic acid, such as siRNA, to one or more ligand moieties to enhance, for example, the activity, cellular distribution, or cellular uptake into cells of the nucleic acid, such as siRNA.

[0237] In some embodiments, the described ligand moiety may be attached to the nucleic acid, such as an siRNA oligonucleoside, via a linker that may or may not be cleavable. The term "linker" or "linking group" means an organic moiety that connects two parts of a compound, for example, covalently attaches two parts of a compound.

[0238] The ligand can be attached to the 3’ or 5’ end of the sense strand.

[0239] The ligand is preferably conjugated to the 3’ end of the sense strand of the nucleic acid, such as an siRNA agent.

[0240] Accordingly, in a further aspect, the present invention relates to a conjugate for inhibiting the expression of a target gene in a cell, said conjugate comprising a nucleic acid moiety and one or more ligand moieties, said nucleic acid moiety comprising a nucleic acid as disclosed herein.

[0241] In one aspect, the second strand of the nucleic acid is conjugated directly or indirectly (e.g., via a linker) to one or more ligand moieties, said ligand moieties typically being present in the terminal region of the second strand, preferably its 3' terminal region.

[0242] In certain embodiments, the ligand moiety comprises GalNAc or a GalNAc derivative attached to the nucleic acid, e.g., dsiRNA, via a linker.

[0243] Accordingly, the present invention relates to a conjugate wherein the ligand moiety comprises i) one or more GalNAc ligands, and / or ii) one or more GalNAc ligand derivatives, and / or iii) one or more GalNAc ligands conjugated to said nucleic acid via a linker and relates to a conjugate.

[0244] Said GalNAc ligand may be conjugated directly or indirectly to the 5' or 3' terminal region of the sense strand of the nucleic acid, preferably its 3' terminal region.

[0245] GalNAc ligands are well known in the art and are described, inter alia, in European Patent No. 3775207.

[0246] In some embodiments, the GalNAc ligand is included in any one of the linkers shown in FIGS. 1-4 or FIG. 5 (Formula XI), wherein the "oligonucleotide" may be any nucleic acid disclosed herein. Thus, the "oligonucleotide" may include linkages other than phosphodiester linkages, such as one or more phosphorothioate linkages. Preferably, the nucleic acid according to the present invention is a double-stranded oligonucleoside as defined herein, and the linker is conjugated to the second strand via a phosphodiester bond, more preferably to the 3'-terminal region of the second strand.

[0247] In some embodiments, the GalNAc ligand is included in the linker shown in FIG. 3, wherein the "oligonucleotide" may be any nucleic acid disclosed herein. Thus, the "oligonucleotide" may include linkages other than phosphodiester linkages, such as one or more phosphorothioate linkages. Preferably, the nucleic acid according to the present invention is a double-stranded oligonucleoside as defined herein, and the linker is conjugated to the second strand via a phosphodiester bond, more preferably to the 3'-terminal region of the second strand.

[0248] In some embodiments, the GalNAc ligand is included in the linker shown in FIG. 5 (Formula XI), wherein the "oligonucleotide" may be any nucleic acid disclosed herein. Thus, the "oligonucleotide" may include linkages other than phosphodiester linkages, such as one or more phosphorothioate linkages. Preferably, the nucleic acid according to the present invention is a double-stranded oligonucleoside as defined herein, and the linker is conjugated to the second strand via a phosphodiester bond, more preferably to the 3'-terminal region of the second strand.

[0249] In some embodiments, the GalNAc ligand is included in any one of the linkers shown in FIGS. 1-4 or FIG. 5 (Formula XI), wherein "oligonucleotide" represents a nucleic acid according to the present invention, and the nucleic acid according to the present invention comprises or consists of a modified or unmodified second strand comprising SEQ ID NO: 260 or SEQ ID NO: 272. Preferably, the linker is conjugated via a phosphodiester bond to the 3' terminal region of the second strand, i.e., the 3' terminal region of SEQ ID NO: 260 or SEQ ID NO: 272.

[0250] In some embodiments, the GalNAc ligand is included in the linker shown in FIG. 3, wherein "oligonucleotide" represents a nucleic acid according to the present invention, and the nucleic acid according to the present invention comprises or consists of a modified or unmodified second strand comprising SEQ ID NO: 260 or SEQ ID NO: 272. Preferably, the linker is conjugated via a phosphodiester bond to the 3' terminal region of the second strand, i.e., the 3' terminal region of SEQ ID NO: 260 or SEQ ID NO: 272.

[0251] In some embodiments, the GalNAc ligand is included in the linker shown in FIG. 5 (Formula XI), wherein "oligonucleotide" represents a nucleic acid according to the present invention, and the nucleic acid according to the present invention comprises or consists of a modified or unmodified second strand comprising SEQ ID NO: 260 or SEQ ID NO: 272. Preferably, the linker is conjugated via a phosphodiester bond to the 3' terminal region of the second strand, i.e., the 3' terminal region of SEQ ID NO: 260 or SEQ ID NO: 272.

[0252] In some embodiments, the GalNAc ligand is included in any one of the linkers shown in FIGS. 1-4 or FIG. 5 (Formula XI), wherein "oligonucleotide" represents a nucleic acid according to the present invention, and the nucleic acid according to the present invention comprises or consists of a modified second strand comprising SEQ ID NO: 774 or SEQ ID NO: 778. Preferably, the linker is conjugated via a phosphodiester bond to the 3' terminal region of the second strand, i.e., the 3' terminal region of SEQ ID NO: 774 or SEQ ID NO: 778.

[0253] In some embodiments, the GalNAc ligand is included in the linker shown in FIG. 3, wherein "oligonucleotide" represents the nucleic acid according to the present invention, and the nucleic acid according to the present invention includes or consists of a modified second strand containing SEQ ID NO: 774 or SEQ ID NO: 778. Preferably, the linker is conjugated to the 3'-terminal region of the second strand, i.e., the 3'-terminal region of SEQ ID NO: 774 or SEQ ID NO: 778, via a phosphodiester bond.

[0254] In some embodiments, the GalNAc ligand is included in the linker shown in FIG. 5 (Formula XI), wherein "oligonucleotide" represents the nucleic acid according to the present invention, and the nucleic acid according to the present invention includes or consists of a modified second strand containing SEQ ID NO: 774 or SEQ ID NO: 778. Preferably, the linker is conjugated to the 3'-terminal region of the second strand, i.e., the 3'-terminal region of SEQ ID NO: 774 or SEQ ID NO: 778, via a phosphodiester bond.

[0255] In some embodiments, the GalNAc ligand is included in any one of the linkers shown in FIGS. 1-4 or FIG. 5 (Formula XI), wherein "oligonucleotide" represents the nucleic acid according to the present invention, and the nucleic acid according to the present invention includes a modified first strand containing or consisting of SEQ ID NO: 764 and a modified second strand containing or consisting of SEQ ID NO: 774. Preferably, the linker is conjugated to the 3'-terminal region of the second strand, i.e., the 3'-terminal region of SEQ ID NO: 774, via a phosphodiester bond.

[0256] In some embodiments, the GalNAc ligand is included in the linker shown in FIG. 3, wherein "oligonucleotide" represents the nucleic acid according to the present invention, and the nucleic acid according to the present invention includes a modified first strand containing or consisting of SEQ ID NO: 764 and a modified second strand containing or consisting of SEQ ID NO: 774. Preferably, the linker is conjugated to the 3'-terminal region of the second strand, i.e., the 3'-terminal region of SEQ ID NO: 774, via a phosphodiester bond.

[0257] In some embodiments, the GalNAc ligand is included in the linker shown in FIG. 5 (Formula XI), wherein "oligonucleotide" represents the nucleic acid according to the present invention, and the nucleic acid according to the present invention comprises a modified first strand comprising or consisting of SEQ ID NO: 764, and a modified second strand comprising or consisting of SEQ ID NO: 774. Preferably, the linker is conjugated to the 3'-terminal region of the second strand, i.e., the 3'-terminal region of SEQ ID NO: 774, via a phosphodiester bond.

[0258] In some embodiments, the GalNAc ligand is included in any one of the linkers shown in FIGS. 1-4 or FIG. 5 (Formula XI), wherein "oligonucleotide" represents the nucleic acid according to the present invention, and the nucleic acid according to the present invention comprises a modified first strand comprising or consisting of SEQ ID NO: 768, and a modified second strand comprising or consisting of SEQ ID NO: 778. Preferably, the linker is conjugated to the 3'-terminal region of the second strand, i.e., the 3'-terminal region of SEQ ID NO: 778, via a phosphodiester bond.

[0259] In some embodiments, the GalNAc ligand is included in the linker shown in FIG. 3, wherein "oligonucleotide" represents the nucleic acid according to the present invention, and the nucleic acid according to the present invention comprises a modified first strand comprising or consisting of SEQ ID NO: 768, and a modified second strand comprising or consisting of SEQ ID NO: 778. Preferably, the linker is conjugated to the 3'-terminal region of the second strand, i.e., the 3'-terminal region of SEQ ID NO: 778, via a phosphodiester bond.

[0260] In some embodiments, the GalNAc ligand is included in the linker shown in Figure 5 (Formula XI), wherein "oligonucleotide" represents the nucleic acid according to the present invention, and the nucleic acid according to the present invention includes a modified first strand comprising or consisting of SEQ ID NO: 768, and a modified second strand comprising or consisting of SEQ ID NO: 778. Preferably, the linker is conjugated via a phosphodiester bond to the 3'-terminal region of the second strand, i.e., to the 3'-terminal region of SEQ ID NO: 778.

[0261] In some embodiments, the GalNAc ligand is included in the linker shown in Figure 3, wherein "oligonucleotide" represents the nucleic acid according to the present invention, and the nucleic acid according to the present invention includes a modified first strand comprising or consisting of SEQ ID NO: 764, and a modified second strand comprising or consisting of SEQ ID NO: 774. The second strand has the following structure

Chemical formula

[0262] In some embodiments, the GalNAc ligand is included in the linker shown in Figure 5 (Formula XI), wherein "oligonucleotide" represents the nucleic acid according to the present invention, and the nucleic acid according to the present invention includes a modified first strand comprising or consisting of SEQ ID NO: 764, and a modified second strand comprising or consisting of SEQ ID NO: 774. The second strand has the following structure

Chemical formula

[0263] In some embodiments, the GalNAc ligand is included in the linker shown in Figure 3, wherein "oligonucleotide" represents a nucleic acid according to the present invention, and the nucleic acid according to the present invention includes a modified first strand comprising or consisting of SEQ ID NO: 768, and a modified second strand comprising or consisting of SEQ ID NO: 778, and the second strand has the following structure

Chemical formula

[0264] In some embodiments, the GalNAc ligand is included in the linker shown in Figure 5 (Formula XI), wherein "oligonucleotide" represents a nucleic acid according to the present invention, and the nucleic acid according to the present invention includes a modified first strand comprising or consisting of SEQ ID NO: 768, and a modified second strand comprising or consisting of SEQ ID NO: 778, and the second strand has the following structure

Chemical formula

[0265] Vectors and Cells In one aspect, the present invention provides a cell comprising a nucleic acid such as an inhibitory RNA [RNAi] described herein.

[0266] In one aspect, the present invention provides a cell comprising a vector described herein.

[0267] Pharmaceutically acceptable composition In one aspect, the present invention provides a pharmaceutical composition for inhibiting the expression of a target gene, the composition comprising a nucleic acid disclosed herein.

[0268] The pharmaceutically acceptable composition may comprise an excipient and / or a carrier.

[0269] Some examples of substances that can serve as pharmaceutically acceptable carriers include the following: (1) sugars, such as lactose, glucose, and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; (4) tragacanth powder; (5) malt; (6) gelatin; (7) lubricants, such as magnesium stearate, sodium lauryl sulfate, and talc; (8) excipients, such as cocoa butter and suppository wax; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol, and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffer solutions; (21) polyesters, polycarbonates, and / or polyanhydrides; (22) bulking agents, such as polypeptides and amino acids; (23) serum components, such as serum albumin, HDL, and LDL; and (22) other non-toxic compatible substances used in pharmaceutical formulations.

[0270] Typical pharmaceutical carriers include, but are not limited to, the following: binders (such as pregelatinized corn starch, polyvinylpyrrolidone, or hydroxypropylmethylcellulose, etc.), fillers (such as lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylate, or calcium hydrogen phosphate, etc.), lubricants (such as magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metal stearates, hydrogenated vegetable oil, corn starch, polyethylene glycol, sodium benzoate, sodium acetate, etc.), disintegrants (such as starch, sodium starch glycolate, etc.), and wetting agents (such as sodium lauryl sulfate, etc.).

[0271] For formulating the compositions of the present invention, pharmaceutically acceptable organic or inorganic excipients that do not cause adverse reactions with nucleic acids and are suitable for parenteral administration can also be used. Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohols, polyethylene glycol, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone, etc.

[0272] Formulations for topical administration of nucleic acids can include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of nucleic acids in liquid or solid oil bases. The solutions may also contain buffers, diluents, and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients that do not cause adverse reactions with nucleic acids and are suitable for parenteral administration can be used.

[0273] In one embodiment, the nucleic acid or composition is administered in a non-buffered solution. In certain embodiments, the non-buffered solution is saline or water. In other embodiments, the nucleic acid, e.g., an siRNA agent, is administered in a buffered solution. In such embodiments, the buffer solution may contain acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof. For example, the buffer solution may be phosphate buffered saline (PBS).

[0274] Dosage The pharmaceutical composition of the present invention can be administered in a dosage sufficient to inhibit gene expression. Generally, a suitable dosage of the nucleic acid of the present invention, e.g., siRNA, ranges from about 0.001 to about 200.0 milligrams per kilogram of recipient body weight per day, and will generally range from about 1 to 50 mg per kilogram of body weight per day. Typically, a suitable dosage of the nucleic acid of the present invention, e.g., siRNA, will range from about 0.1 mg / kg to about 5.0 mg / kg, such as from about 0.3 mg / kg to about 3.0 mg / kg.

[0275] A repeated dosage regimen may include administering a therapeutic amount of the nucleic acid, e.g., siRNA, periodically, such as once a day or once a year. In certain embodiments, the nucleic acid, e.g., siRNA, is administered about once a month to once every quarter (i.e., once every about 3 months).

[0276] In various embodiments, the nucleic acid, e.g., the siRNA agent, is administered at a dose of about 0.01 mg / kg to about 10 mg / kg or about 0.5 mg / kg to about 50 mg / kg. In some embodiments, the nucleic acid, e.g., the siRNA agent, is administered at a dose of about 10 mg / kg to about 30 mg / kg. In certain embodiments, the nucleic acid, e.g., the siRNA agent, is administered at a dose selected from about 0.5 mg / kg, 1 mg / kg, 1.5 mg / kg, 3 mg / kg, 5 mg / kg, 10 mg / kg, and 30 mg / kg. In certain embodiments, the nucleic acid, e.g., the agent, is administered at a dose of about 0.1 mg / kg to about 5.0 mg / kg once a week, once a month, once every two months, or once a quarter (i.e., once every three months). In certain embodiments, the nucleic acid, e.g., the siRNA agent, is administered to the subject once a week. In certain embodiments, the nucleic acid, e.g., the siRNA agent, is administered to the subject once a month. In certain embodiments, the nucleic acid, e.g., the siRNA, is administered once every quarter (i.e., about once every three months).

[0277] After the initial treatment regimen, treatment may be administered less frequently. For example, after administration once or twice a week for three months, administration may be repeated once a month, once every six months, or once a year or longer.

[0278] The pharmaceutical composition can be administered once daily, or as two, three, or more divided doses at appropriate intervals throughout the day, or even using delivery by sustained infusion or controlled release formulations. In that case, the nucleic acid, e.g., the siRNA, contained in each divided dose will have to be made proportionally smaller in order to achieve the total daily dosage. Dosage units can also be formulated to be delivered over several days, for example, using conventional sustained release formulations that provide for the sustained release of the nucleic acid, e.g., the siRNA, over several days. Sustained release formulations are well known in the art and are particularly useful for the delivery of agents at specific sites, such as those that can be used with the agents of the present invention. In this embodiment, the dosage unit contains a corresponding multiple of the daily dose.

[0279] In other embodiments, a single dose of the pharmaceutical composition may be of long - term persistence, such that subsequent doses are administered at intervals within 3, 4, or 5 days, or at intervals within 1, 2, 3, or 4 weeks. In some embodiments of the present invention, a single dose of the pharmaceutical composition of the present invention is administered once a week. In other embodiments of the present invention, a single dose of the pharmaceutical composition of the present invention is administered once every two months. In certain embodiments, the siRNA is administered about once a month to about once every three months (i.e., about once every three months), or even once every six months or once every twelve months.

[0280] The estimation of the effective dosage and in vivo half - life of the individual nucleic acids, such as siRNA, encompassed by the present invention can be carried out using conventional methodologies or based on in vivo tests using appropriate animal models known in the art.

[0281] The pharmaceutical composition of the present invention can be administered in a number of ways depending on whether local or systemic treatment is desired and depending on the site to be treated. Administration can be local (e.g., by transdermal patch), pulmonary, such as by inhalation or insufflation of a powder or aerosol, including by nebulizer, intratracheal, intranasal, epidermal and transdermal, oral, or parenteral. Parenteral administration includes intravenous, intra - arterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion, subcutaneous, e.g., by an implantable device, or intracranial, e.g., intraparenchymal, intrathecal, or intraventricular administration. In certain preferred embodiments, the composition is administered by intravenous infusion or injection. In certain embodiments, the composition is administered by subcutaneous injection.

[0282] In one embodiment, a nucleic acid, such as an agent, is administered subcutaneously to a subject.

[0283] Nucleic acids, such as siRNA, can be delivered to target specific tissues (e.g., specific hepatocytes).

[0284] Methods for inhibiting HCII gene expression The present invention also provides a method for inhibiting HCII gene expression in a cell. Such methods include contacting the cell with an effective amount of a nucleic acid of the invention for inhibiting HCII gene expression in the cell, such as an siRNA agent, such as a double-stranded siRNA agent, thereby inhibiting HCII gene expression in the cell. It should be noted that the nucleic acid "for inhibiting the expression of HCII" is preferably a nucleic acid capable of inhibiting HCII expression, as described hereinafter.

[0285] Contact between the cell and a nucleic acid, such as siRNA, such as a double-stranded siRNA agent, can be carried out in vitro or in vivo. Contacting the cell with a nucleic acid in vivo, for example, includes contacting a cell or cell population within a subject, such as a human subject, with a nucleic acid, such as siRNA. Combinations of in vitro and in vivo methods for contacting the cell are also possible. As discussed above, the contact with the cell may be direct or indirect. Further, the contact with the cell can be achieved by a targeting ligand moiety comprising any ligand moiety described herein or known in the art. In a preferred embodiment, the targeting ligand moiety is a carbohydrate moiety, such as a GalNAc3 ligand, or any other ligand moiety that directs the siRNA agent to the site of interest.

[0286] The term "inhibit" as used herein is used interchangeably with "reduce", "silence", "down-regulate", "suppress", and other similar terms and includes inhibition at any level.

[0287] In some embodiments of the methods of the invention, the expression of the HCII gene is preferably inhibited by at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% as determined by qPCR as described herein and / or when siRNA is introduced into target cells by transfection, or inhibited to a level below the detection level of the assay. In certain embodiments, such methods include clinically relevant inhibition of the expression of the HCII target gene, as demonstrated by clinically relevant outcomes after treating a subject with an agent that reduces the expression of the gene.

[0288] In some embodiments, when the nucleic acid of the invention is transfected into a cell, it inhibits the expression of the HCII gene with an IC50 value lower than 2000 pM, 1900 pM, 1800 pM, 1700 pM, 1600 pM, 1500 pM, 1400 pM, 1300 pM, 1200 pM, 1100 pM, 1000 pM, 900 pM, 800 pM, 700 pM, 600 pM, 500 pM, 400 pM, 300 pM, 200 pM, or 100 pM, preferably as determined by qPCR, more preferably by reverse transcriptase (RT)-qPCR, as described herein.

[0289] In preferred embodiments, when the nucleic acid of the invention is transfected into a cell, it inhibits the expression of the HCII gene with an IC50 value lower than 2000 pM. In more preferred embodiments, when the nucleic acid of the invention is transfected into a cell, it inhibits the expression of the HCII gene with an IC50 value lower than 1000 pM. In even more preferred embodiments, when the nucleic acid of the invention is transfected into a cell, it inhibits the expression of the HCII gene with an IC50 value lower than 500 pM. In the most preferred embodiments, when the nucleic acid of the invention is transfected into a cell, it inhibits the expression of the HCII gene with an IC50 value lower than 100 pM.

[0290] Inhibition of the expression of the HCII gene can be quantified by the following method. Huh7 cells (a human hepatocyte-derived cell line, obtained from the JCRB cell bank) may be maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% FBS at 37°C in a 5% CO2 atmosphere. Next, siRNA duplexes targeting HCII mRNA or negative control siRNA (siRNA control, sense strand 5'-UUCUCCGAACGUGUCACGUTT-3' (SEQ ID NO: 788), antisense strand 5'-ACGUGACACGUUCGGAGAATT-3' (SEQ ID NO: 787)) may be transfected into the cells using 10×3-fold serial dilutions over a final duplex concentration range of 20 nM to 1 pM. Transfection can be carried out by adding 9.7 μL of Opti-MEM (ThermoFisher) + 0.3 μL of Lipofectamine RNAiMAX (ThermoFisher) to each 10 μL of siRNA duplex. The mixture may be incubated at room temperature for 15 minutes and then added to 100 μL of complete growth medium containing 20,000 Huh7 cells. The cells may be incubated at 37°C / 5% CO2 for 24 hours before purifying total RNA using the RNeasy 96 kit (Qiagen). Each duplex can be tested by transfection in duplicate wells in a single experiment. cDNA synthesis may be carried out using the FastQuant RT (with gDNase) kit (Tiangen). Real-time quantitative PCR (qPCR) may be carried out using the FastStart Universal Probe Master kit (Roche) with primers specific for human HCII (Hs00164821_m1) and human GAPDH (Hs02786624_g1) on an ABI Prism 7900HT or ABI QuantStudio 7. qPCR can be performed in duplicate on cDNA derived from each well to calculate the average cycle threshold (Ct). Relative HCII expression can be calculated from the average Ct value using the comparative Ct (ΔΔCt) method and normalized to GAPDH and to untreated cells. The maximum percent inhibition of HCII expression and the IC50 value can be calculated using a four-parameter (variable slope) model using GraphPad Prism9.

[0291] Alternatively or in addition, inhibition of HCII gene expression can be characterized by a reduction in the average relative expression of the HCII gene.

[0292] In some embodiments, transfection of cells with 0.1 nM of the nucleic acid of the invention results in an average relative expression of HCII that is less than 1, 0.9, 0.8, 0.7, 0.6, 0.5, or 0.4, as measured preferably by qPCR, more preferably by reverse transcriptase (RT)-qPCR, as described herein.

[0293] In some embodiments, transfection of cells with 1 nM of the nucleic acid of the invention results in an average relative expression of HCII that is less than 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4 or 0.3, as measured preferably by qPCR, more preferably by reverse transcriptase (RT)-qPCR, as described herein.

[0294] The average relative expression of the HCII gene can be quantified by the following method. Huh7 cells (human hepatocyte-derived cell line, obtained from the JCRB cell bank) may be maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% FBS at 37 °C in a 5% CO2 atmosphere. An siRNA duplex targeting HCII mRNA or a negative control siRNA (siRNA control, sense strand 5'-UUCUCCGAACGUGUCACGUTT-3' (SEQ ID NO: 788), antisense strand 5'-ACGUGACACGUUCGGAGAATT-3' (SEQ ID NO: 787)) may be transfected into the cells at final duplex concentrations of 1 nM and 0.1 nM. Transfection can be carried out by adding 9.7 μL of Opti-MEM (ThermoFisher) + 0.3 μL of Lipofectamine RNAiMAX (ThermoFisher) to 10 μL of each siRNA duplex. The mixture may be incubated at room temperature for 15 minutes and then added to 100 μL of complete growth medium containing 20,000 Huh7 cells. The cells may be incubated at 37 °C / 5% CO2 for 24 hours before purifying total RNA using the RNeasy 96 kit (Qiagen). Each duplex can be tested by transfection in duplicate wells in two independent experiments. cDNA synthesis can be carried out using the FastQuant RT (with gDNase) kit (Tiangen). Real-time quantitative PCR (qPCR) can be carried out using the FastStart Universal Probe Master kit (Roche) with primers specific for human HCII (Hs00164821_m1) and human GAPDH (Hs02786624_g1) on an ABI Prism 7900HT or an ABI QuantStudio 7. qPCR can be carried out in duplicate on the cDNA derived from each well, and the average Ct can be calculated. Relative HCII expression can be calculated from the average Ct values using the comparative Ct (ΔΔCt) method and normalized to GAPDH and to untreated cells. Inhibition of HCII gene expression may be represented by a reduction in the amount of mRNA of the target HCII gene as compared to a suitable control. In other embodiments, inhibition of HCII gene expression may be evaluated in terms of a reduction in gene expression, such as protein expression or a parameter functionally related to a signal transduction pathway.

[0295] Method for treating or preventing a disease associated with HCII gene expression The present invention also provides a method for reducing or inhibiting HCII gene expression in a cell using a nucleic acid of the present invention, such as siRNA, or a composition comprising a nucleic acid of the present invention, such as siRNA. Such methods include contacting the cell with a nucleic acid of the present invention, such as dsiRNA, and maintaining the cell for a time sufficient to obtain degradation of the HCII mRNA transcript, thereby inhibiting expression of the HCII gene in the cell. Reduction of gene expression can be evaluated by any method known in the art.

[0296] In the method of the present invention, the cell may be contacted in vitro or in vivo, i.e., the cell may be present in a subject.

[0297] A cell suitable for treatment using the method of the present invention may be any cell that expresses a gene of interest associated with a disease associated with a hemostatic disorder, such as a hemostatic disorder such as hemophilia.

[0298] The in vivo method of the present invention comprises administering to a subject a composition comprising a nucleic acid of the present invention, such as siRNA, wherein the nucleic acid, such as siRNA, comprises a nucleoside sequence complementary to at least a portion of the RNA transcript of the HCII gene of the mammal to be treated.

[0299] The present invention further provides a method for treating a subject in need thereof. The treatment method of the present invention comprises administering to a subject, for example, a subject who would benefit from reduction or inhibition of the expression of the HCII gene, a pharmaceutical composition comprising a nucleic acid such as the siRNA of the present invention, for example, an siRNA targeting HCII or a nucleic acid targeting a gene, in a therapeutically effective amount. The disease to be treated is related to a disorder of hemostasis, for example, a disease associated with a disorder of hemostasis such as hemophilia.

[0300] Hemophilia (haemophilia or hemophilia) is an almost hereditary genetic disorder with a defect in the body's ability to produce blood clots, a process necessary to stop bleeding. As a result, subjects bleed for longer periods after injury, bruise easily, and have a high risk of bleeding within joints or the brain. Subjects with mild cases of the disease may only have symptoms after an accident or during surgery. Bleeding into joints, also called hemarthrosis, can cause permanent damage, while bleeding within the brain can cause long-term headaches, seizures, or a decrease in the level of consciousness.

[0301] There are two main types of hemophilia: hemophilia A, which occurs due to low levels of factor VIII coagulation, and hemophilia B, which occurs due to low levels of factor IX coagulation. They are typically inherited from parents through the X chromosome, which has a non-functional gene. Rarely, new mutations can occur during early development, or hemophilia can develop later in life due to antibodies formed against the clotting factors. Other types include hemophilia C, which occurs due to low levels of factor XI, von Willebrand disease, which occurs due to low levels of a substance called von Willebrand factor, and parahemophilia, which occurs due to low levels of factor V. Hemophilia A, B, and C prevent the proper functioning of the intrinsic pathway, which is necessary when damage to the blood vessel endothelium occurs. Acquired hemophilia is associated with cancer, autoimmune disorders, and pregnancy. Diagnosis is made by testing blood for its ability to clot and its clotting factor levels.

[0302] In certain embodiments, the nucleic acids of the invention are suitable for use in therapy, or for the treatment of hemophilia A, B, and / or C. In certain embodiments, the nucleic acids of the invention are suitable for use in therapy, or for the treatment of hemophilia A and / or B. In certain embodiments, the nucleic acids of the invention are suitable for use in therapy, or for the treatment of acquired hemophilia. In certain embodiments, the nucleic acids of the invention are suitable for use in therapy, or for the treatment of von Willebrand disease. In certain embodiments, the nucleic acids of the invention are suitable for use in therapy, or for the treatment of parahemophilia.

[0303] Without being bound by theory, treatment with the nucleic acids of the invention results in a boost of coagulation factor levels such that bleeding can be reduced or prevented. Thus, in preferred embodiments, treatment with the nucleic acids of the invention reduces or prevents bleeding episodes in subjects suffering from hemophilia. In another preferred embodiment, treatment with the nucleic acids of the invention reduces or prevents bleeding into joints in subjects suffering from hemophilia. In certain embodiments, treatment with the nucleic acids of the invention reduces or prevents bleeding into muscle or the brain in subjects suffering from hemophilia.

[0304] The nucleic acids of the invention, such as siRNAs, may be administered as "naked" nucleic acids or "naked" siRNAs administered in the absence of a pharmaceutical composition. The naked nucleic acids may be present in a suitable buffer solution. The buffer solution may contain acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof. In one embodiment, the buffer solution is phosphate buffered saline (PBS). The pH and osmotic pressure of the buffer solution can be adjusted to be suitable for administration to a subject.

[0305] Alternatively, the nucleic acids of the invention, such as siRNAs, may be administered as a pharmaceutical composition, such as a dsiRNA liposomal formulation.

[0306] In one embodiment, the method includes administering a composition described herein such that the expression of the HCII gene decreases over a period of, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 12, 16, 18, 24 hours, 28, 32, or about 36 hours. In one embodiment, the expression of the HCII target gene decreases over a long period, for example, at least about 2, 3, 4 days or longer, for example, about 1 week, 2 weeks, 3 weeks, or 4 weeks, or longer, for example, about 1 month, 2 months, or 3 months.

[0307] To treat a disease associated with a hemostatic disorder, such as a disease associated with a hemostatic disorder such as hemophilia, a therapeutically effective amount of a nucleic acid, such as siRNA, for example, about 0.01 mg / kg to about 200 mg / kg, can be administered to a subject.

[0308] The nucleic acid, such as siRNA, can be administered by intravenous infusion periodically over a period of time. In certain embodiments, after an initial treatment regimen, treatment may be administered at a lower frequency. Administration of siRNA can reduce the gene product level of the HCII target gene, for example, to a level below at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% in the cells or tissues of the patient, or the detection level of the assay method used. In certain embodiments, administration results in clinical stabilization or preferably a clinically relevant reduction of at least one sign or symptom of the HCII gene-related disorder.

[0309] Alternatively, a nucleic acid, e.g., siRNA, can be administered subcutaneously, i.e., by subcutaneous injection. One or more injections can be used to deliver the desired daily dose of the nucleic acid, e.g., siRNA, to a subject. The injections may be repeated over a period of time. Administration may be repeated periodically. In certain embodiments, after an initial treatment regimen, treatment may be administered at a lower frequency. A repeat dose regimen may include administering a therapeutic amount of the nucleic acid periodically, e.g., once daily to once a year. In certain embodiments, the nucleic acid is administered about once a month to about once every quarter (i.e., about once every three months).

[0310] In one aspect, the present invention can be applied to the compounds, methods, compositions, or uses of Proposition Numbers 1 to 101 below, and the reference to any of the formulas of Propositions 1 to 101 refers only to the formulas defined within Propositions 1 to 101. Such formulas are reproduced in Figure 5. In particular, the oligonucleoside moiety represented by Z in any of the following propositions may include a nucleic acid for inhibiting the expression of HCII as defined in any of the claims below in this specification.

[0311] 1. The following structure:

[0312]

Chemical formula

[0313] 2. The compound according to claim 1, wherein R1 is hydrogen in each occurrence.

[0314] 3. The compound according to claim 1, wherein R1 is methyl.

[0315] 4. The compound according to claim 1, wherein R1 is ethyl.

[0316] 5. The compound according to any one of claims 1 to 4, wherein R2 is hydroxy.

[0317] 6. The compound according to any one of claims 1 to 4, wherein R2 is halo.

[0318] 7. The compound according to claim 6, wherein R2 is fluoro.

[0319] 8. The compound according to claim 6, wherein R2 is chloro.

[0320] 9. The compound according to claim 6, wherein R2 is bromo.

[0321] 10. The compound according to claim 6, wherein R2 is iodo.

[0322] 11. The compound according to claim 6, wherein R2 is nitro.

[0323] 12. The compound according to any one of claims 1 to 11, wherein X1 is methylene.

[0324] 13. The compound according to any one of claims 1 to 11, wherein X1 is oxygen.

[0325] 14. The compound according to any one of propositions 1 to 11, wherein X1 is sulfur.

[0326] 15. The compound according to any one of propositions 1 to 14, wherein X2 is methylene.

[0327] 16. The compound according to any one of propositions 1 to 15, wherein X2 is oxygen.

[0328] 17. The compound according to any one of propositions 1 to 16, wherein X2 is sulfur.

[0329] 18. The compound according to any one of propositions 1 to 17, wherein m = 3.

[0330] 19. The compound according to any one of propositions 1 to 18, wherein n = 6.

[0331] 20. X1 is oxygen, X2 is methylene, and preferably, q = 1, r = 2, s = 1, t = 1, v = 1, for the compound according to propositions 13 and 15.

[0332] 21. Both X1 and X2 are methylene, and preferably, q = 1, r = 3, s = 1, t = 1, v = 1, for the compound according to propositions 12 and 15.

[0333] 22. Z is,

[0334]

Chemical formula

[0335] 23. The compound according to Proposition 22, wherein the oligonucleoside is an RNA compound capable of modulating, preferably inhibiting, the expression of a target gene.

[0336] 24. The compound according to Proposition 23, wherein the RNA compound comprises an RNA duplex comprising a first strand and a second strand, the first strand is at least partially complementary to the RNA sequence of the target gene, the second strand is at least partially complementary to the first strand, and each of the first strand and the second strand has 5' and 3' ends.

[0337] 25. The compound according to Proposition 24, wherein the RNA compound is attached to an adjacent phosphate at the 5' end of its second strand.

[0338] 26. The compound according to Proposition 24, wherein the RNA compound is attached to an adjacent phosphate at the 3' end of its second strand.

[0339] 27. A compound of formula (II).

[0340]

Chemical formula

[0341] 28. A compound of formula (III).

[0342]

Chemical formula

[0343] 29. The oligonucleoside comprises an RNA duplex containing a first strand and a second strand, the first strand is at least partially complementary to the RNA sequence of the target gene, the second strand is at least partially complementary to the first strand, each of the first strand and the second strand has 5' and 3' ends, and the RNA duplex is attached to an adjacent phosphate at the 5' end of its second strand, the compound according to claim 27 or 28.

[0344] 30. A composition comprising the compound of formula (II) defined in claim 27 and the compound of formula (III) defined in claim 28, optionally dependent on claim 29.

[0345] 31. The composition according to claim 30, wherein the compound of formula (III) defined in claim 28 is present in an amount in the range of 10-15% by weight of the composition.

[0346] 32. A compound of formula (IV).

[0347]

Chemical formula

[0348] 33. A compound of formula (V).

[0349]

Chemical formula

[0350] 34. The oligonucleoside comprises an RNA duplex containing a first strand and a second strand, the first strand is at least partially complementary to the RNA sequence of the target gene, the second strand is at least partially complementary to the first strand, each of the first strand and the second strand has 5' and 3' ends, and the RNA duplex is attached to an adjacent phosphate at the 3' end of its second strand, the compound according to claim 32 or 33.

[0351] 35. A composition comprising the compound of formula (IV) defined in Proposition 32 and the compound of formula (V) defined in Proposition 33, optionally dependent on Proposition 34.

[0352] 36. The composition according to Proposition 35, wherein the compound of formula (V) defined in Proposition 33 is present in an amount in the range of 10 to 15% by weight of the composition.

[0353] 37. An oligonucleoside comprising an RNA duplex further comprising one or more riboses modified at the 2'-position, preferably a plurality of riboses modified at the 2'-position, which is a compound defined in any of Propositions 1 to 29 or 32 to 34.

[0354] 38. The compound according to Proposition 37, wherein the modification is selected from 2'-O-methyl, 2'-deoxy-fluoro, and 2'-deoxy.

[0355] 39. An oligonucleoside further comprising one or more deprotecting moieties at one or more termini, which is a compound according to any of Propositions 1 to 29, 32 to 34, or 37 to 38.

[0356] 40. The one or more deprotecting moieties are not present at the termini of the oligonucleoside chain carrying the ligand moiety, and / or the one or more deprotecting moieties are selected from phosphorothioate internucleoside linkages, phosphorodithioate internucleoside linkages, and inverted abasic nucleosides, and the inverted abasic nucleoside is present at the distal end of the chain carrying the ligand moiety, which is a compound according to Proposition 39.

[0357] 41. The ligand moiety illustrated in formula (I) of Proposition 1 comprises one or more ligands, which is a compound according to any of Propositions 1 to 29, 32 to 34, or 37 to 40.

[0358] 42. The ligand moiety illustrated in formula (I) of Proposition 1 comprises one or more carbohydrate ligands, which is a compound according to Proposition 41.

[0359] 43. The compound according to proposition 42, wherein the one or more carbohydrates may be monosaccharides, disaccharides, trisaccharides, tetrasaccharides, oligosaccharides, or polysaccharides.

[0360] 44. The compound according to proposition 43, wherein the one or more carbohydrates comprise one or more galactose moieties, one or more lactose moieties, one or more N-acetylgalactosamine moieties, and / or one or more mannose moieties.

[0361] 45. The compound according to proposition 44, wherein the one or more carbohydrates comprise one or more N-acetyl-galactosamine moieties.

[0362] 46. The compound according to proposition 45, comprising two or three N-acetylgalactosamine moieties.

[0363] 47. The compound according to any one of propositions 41 to 46, wherein the one or more ligands are attached in a linear or branched configuration.

[0364] 48. The compound according to proposition 47, wherein the one or more ligands are attached as a bifurcated or trifurcated branched configuration.

[0365] 49. The moiety shown in formula (I) of proposition 1:

[0366]

Chemical formula

[0367]

Chemical formula

[0368] [Chemical formula] wherein, A I is hydrogen or a suitable hydroxy protecting group, a is an integer of 2 or 3, c and d are independently an integer of 1 to 6, or

[0369] [Chemical formula] wherein, A I is hydrogen or a suitable hydroxy protecting group, a is an integer of 2 or 3, e is an integer of 2 to 10, the compounds described in Propositions 46 to 48.

[0370] 50. The said part shown in the formula (I) of Proposition 1:

[0371] [Chemical formula] is of the formula (VII):

[0372] [Chemical formula] wherein, A I is hydrogen, a is an integer of 2 or 3, the compounds described in Propositions 46 to 48.

[0373] 51. The compound according to claim 49 or 50, wherein a = 2.

[0374] 52. The compound according to claim 49 or 50, wherein a = 3.

[0375] 53. The compound according to claim 49, wherein b = 3.

[0376] 54. The compound of formula (VIII).

[0377]

Chemical formula

[0378] 55. The compound of formula (IX).

[0379]

Chemical formula

[0380] 56. The oligonucleoside comprises an RNA duplex containing a first strand and a second strand, the first strand is at least partially complementary to the RNA sequence of the target gene, the second strand is at least partially complementary to the first strand, each of the first strand and the second strand has 5' and 3' ends, and the RNA duplex is attached to an adjacent phosphate at the 5' end of its second strand. The compound according to claim 54 or 55.

[0381] 57. A composition comprising the compound of formula (VIII) defined in claim 54 and the compound of formula (IX) defined in claim 55, optionally dependent on claim 56.

[0382] 58. The composition according to claim 57, wherein the compound of formula (IX) defined in claim 55 is present in an amount in the range of 10-15% by weight of the composition.

[0383] 59. The compound of formula (X).

[0384] [Chemistry]

[0385] 60. A compound of formula (XI).

[0386] [Chemistry]

[0387] 61. An oligonucleoside comprising an RNA duplex comprising a first strand and a second strand, wherein the first strand is at least partially complementary to an RNA sequence of a target gene, the second strand is at least partially complementary to the first strand, each of the first strand and the second strand has 5' and 3' termini, and the RNA duplex is attached to an adjacent phosphate at the 3' terminus of its second strand, a compound according to claim 59 or 60.

[0388] 62. A composition comprising a compound of formula (X) defined in claim 59 and a compound of formula (XI) defined in claim 60, optionally dependent on claim 61.

[0389] 63. The composition according to claim 62, wherein the compound of formula (XI) defined in claim 60 is present in an amount in the range of 10 to 15% by weight of the composition.

[0390] 64. A compound according to any one of claims 54 to 63, wherein the oligonucleoside comprises an RNA duplex further comprising one or more riboses modified at the 2' position, preferably a plurality of riboses modified at the 2' position.

[0391] 65. The compound according to claim 64, wherein the modification is selected from 2'-O-methyl, 2'-deoxy-fluoro, and 2'-deoxy.

[0392] 66. A compound according to any one of claims 54 to 65, wherein the oligonucleoside further comprises one or more deprotecting moieties at one or more termini.

[0393] 67. The one or more deprotection moieties are not present at the termini of the oligonucleoside chain carrying the ligand moiety and / or the one or more deprotection moieties are selected from phosphorothioate internucleoside linkages, phosphorodithioate internucleoside linkages, and inverted abasic nucleosides, wherein the inverted abasic nucleoside is present at the distal end of the chain carrying the ligand moiety and is shown by any of the formulas (VIII), (IX), (X), or (XI) of any one of propositions 54, 55, 59, or 60, a compound according to proposition 66.

[0394] 68. A method for preparing a compound according to any one of propositions 1 to 29, 32 to 34, 37 to 56, 59 to 61, and 64 to 67, and / or a composition according to any one of propositions 30, 31, 35, 36, 57, 58, 62, 63, comprising reacting compounds of formulas (XII) and (XIII):

[0395]

Chemical formula

[0396] 69. The compound of formula (XII) is a compound of formulas (XIV) and (XV):

[0397]

Chemical formula

[0398] 70. The compound of formula (XII) is of formula (XIIa);

[0399]

Chemical formula

[0400]

Chemical formula

[0401] 71. The compound of formula (XII) is of formula (XIIb),

[0402] [Chemical formula] The compound of formula (XIII) is of formula (XIIIa),

[0403] [Chemical formula] The oligonucleoside comprises an RNA duplex comprising a first strand and a second strand, the first strand is at least partially complementary to the RNA sequence of the target gene, the second strand is at least partially complementary to the first strand, each of the first strand and the second strand has 5' and 3' ends, and the RNA duplex is attached to an adjacent phosphate at the 5' end of its second strand. The method according to claim 68 for preparing a compound according to any one of claims 20, 25, 28, 29, 55, 56 and / or a composition according to any one of claims 30, 31, 57, 58.

[0404] 72. The compound of formula (XII) is of formula (XIIc),

[0405] [Chemical formula] The compound of formula (XIII) is of formula (XIIIa),

[0406]

Chem.

[0407] 73. The compound of formula (XII) is of formula (XIId),

[0408]

Chem.

[0409]

Chem.

[0410] 74. The compound of formula (XIIIa) may be represented by the formula (XIIIb):

[0411] [ka] The method of any one of Propositions 70 to 73,

[0412] 75. The compound of formula (XIV) is either of formula (XIVa) or of formula (XIVb):

[0413] [ka] The compound of formula (XV) is either of formula (XVa) or of formula (XIVb):

[0414] [ka] The oligonucleoside comprises an RNA duplex comprising a first strand and a second strand, the first strand being at least partially complementary to an RNA sequence of a target gene and the second strand being at least partially complementary to said first strand, each of the first strand and the second strand having a 5' and a 3' end, (i) said RNA duplex being attached to adjacent phosphates at the 5' end of the second strand in formula (XVa), or (ii) said RNA duplex being attached to adjacent phosphates at the 3' end of the second strand in formula (XVb). The method of Proposition 69, which is dependent on Propositions 70 to 73.

[0415] 76. A compound of formula (XII):

[0416] [ka] During the ceremony, R1, in each occurrence, is independently selected from the group consisting of hydrogen, methyl, and ethyl; R2 is selected from the group consisting of hydrogen, hydroxy, -OC 1~3 alkyl, -C(=O)OC 1~3 alkyl, halo, and nitro, X1 and X2 are each independently selected from the group consisting of methylene, oxygen, and sulfur, q, r, s, t, v are independently integers from 0 to 4, provided that (i) q and r cannot both be 0 at the same time, (ii) s, t, and v cannot all be 0 at the same time, Z is an oligonucleoside moiety, Compound.

[0417] 77. A compound of formula (XIIa).

[0418]

Chem.

[0419] 78. A compound of formula (XIIb).

[0420]

Chem.

[0421] 79. A compound of formula (XIIc).

[0422]

Chem.

[0423] 80. A compound of formula (XIId).

[0424]

Chem.

[0425] 81. A compound of formula (XIII), wherein

[0426]

Chem.

[0427] 82. The compound of formula (XIIIa).

[0428]

Chem.

[0429] 83. The compound of formula (XIIIb).

[0430]

Chem.

[0431] 84. A compound of formula (XIV),

[0432]

Chem.

[0433] 85. A compound of formula (XIVa).

[0434] [Chemical formula]

[0435] 86. A compound of formula (XIVb).

[0436] [Chemical formula]

[0437] 87. A compound of formula (XV),

[0438] [Chemical formula] wherein, R1 is independently selected from the group consisting of hydrogen, methyl, and ethyl at each occurrence, X1 is selected from the group consisting of methylene, oxygen, and sulfur, q and r are independently integers from 0 to 4, provided that q and r cannot be 0 simultaneously, Z is an oligonucleoside moiety, compound.

[0439] 88. A compound of formula (XVa).

[0440] [Chemical formula]

[0441] 89. A compound of formula (XVb).

[0442] [Chemical formula]

[0443] 90. Use of a compound according to any one of propositions 1 to 29, 32 to 34, 37 to 56, 59 to 61, and 64 to 67, and / or a composition according to any one of propositions 30, 31, 35, 36, 57, 58, 62, and 63, for preparing a compound according to any one of propositions 76, 81 to 84, 87.

[0444] 91. Use of a compound according to any one of propositions 1 to 29, 32 to 34, 37 to 56, 59 to 61, and 64 to 67, wherein R2 = F, and / or a composition according to any one of propositions 30, 31, 35, 36, 57, 58, 62, and 63, for preparing a compound according to proposition 85.

[0445] 92. Use of a compound according to any one of propositions 1 to 29, 32 to 34, 37 to 56, 59 to 61, and 64 to 67, wherein R2 = OH, and / or a composition according to any one of propositions 30, 31, 35, 36, 57, 58, 62, and 63, for preparing a compound according to proposition 86.

[0446] 93. Use of a compound according to any one of propositions 20, 25, 27, 29, 54, 56, and / or a composition according to any one of propositions 30, 31, 57, 58, for preparing a compound according to proposition 77.

[0447] 94. Use of a compound according to any one of propositions 20, 25, 28, 29, 55, 56, and / or a composition according to any one of propositions 30, 31, 57, 58, for preparing a compound according to proposition 78.

[0448] 95. Use of a compound according to any one of propositions 21, 26, 32, 34, 59, 61, and / or a composition according to any one of propositions 35, 36, 62, 63, for preparing a compound according to proposition 79.

[0449] 96. Use of a compound according to any one of propositions 21, 26, 33, 34, 60, 61 and / or a composition according to any one of propositions 35, 36, 62, 63, for preparing a compound according to proposition 80.

[0450] 97. Use of a compound according to any one of propositions 20, 25, 27 to 29, 54 to 56 and / or a composition according to any one of propositions 30, 31, 57, 58, for preparing a compound according to proposition 88.

[0451] 98. Use of a compound according to any one of propositions 21, 26, 32 to 34, 59 to 61 and / or a composition according to any one of propositions 35, 36, 62, 63, for preparing a compound according to proposition 89.

[0452] 99. A compound or composition obtainable or obtainable by a method according to any one of propositions 68 to 75.

[0453] 100. A pharmaceutical composition comprising a compound according to any one of propositions 1 to 29, 32 to 34, 37 to 56, 59 to 61, and 64 to 67 and / or a composition according to any one of propositions 30, 31, 35, 36, 57, 58, 62, and 63, together with a pharmaceutically acceptable carrier, diluent, or excipient.

[0454] 101. A compound according to any one of propositions 1 to 29, 32 to 34, 37 to 56, 59 to 61, and 64 to 67 and / or a composition according to any one of propositions 30, 31, 35, 36, 57, 58, 62, and 63, for use in therapy.

[0455] In another aspect, the present invention can be applied to the compounds, methods, compositions, or uses of item numbers 1 to 56 below, and the reference to any formula in the items refers only to the formulas defined within items 1 to 56. Such formulas are reproduced in Figure 6. In particular, the oligonucleoside moiety represented by Z in any of the following items may contain a nucleic acid for inhibiting the expression of HCII as defined in any of the claims hereinafter in this specification.

[0456] 1. The following structure:

[0457]

Chemical formula

[0458] 2. The compound according to item 1, wherein s is an integer selected from 4 to 12.

[0459] 3. The compound according to item 2, wherein s is 6.

[0460] 4. The compound according to any one of items 1 to 3, wherein r is an integer selected from 4 to 14.

[0461] 5. The compound according to item 4, wherein r is 6.

[0462] 6. The compound according to item 4, wherein r is 12.

[0463] 7. The compound according to item 5, which is dependent on item 3.

[0464] 8. The compound according to item 6, which is dependent on item 3.

[0465] 9. Z is

[0466] [Chemical formula] and is such that wherein Z1, Z2, Z3, and Z4 are each independently oxygen or sulfur at each occurrence, one of the bonds between P and Z2 and between P and Z3 is a single bond and the other is a double bond, A compound according to any one of items 1 to 8.

[0467] 10. The oligonucleoside is an RNA compound capable of modulating, preferably inhibiting, the expression of a target gene, a compound according to any one of items 1 to 9.

[0468] 11. The RNA compound comprises an RNA duplex comprising a first strand and a second strand, the first strand is at least partially complementary to the RNA sequence of the target gene, the second strand is at least partially complementary to the first strand, and each of the first strand and the second strand has 5' and 3' ends, a compound according to item 10.

[0469] 12. The RNA compound is attached to an adjacent phosphate at the 5' end of its second strand, preferably also dependent on items 3 and 6, a compound according to item 11.

[0470] 13. The RNA compound is attached to an adjacent phosphate at the 3' end of its second strand, preferably also dependent on items 3 and 5, a compound according to item 11.

[0471] 14. A compound of formula (II), preferably dependent on item 12.

[0472] [Chemical formula]

[0473] 15. A compound of formula (III), preferably dependent on item 13.

[0474] [Chem.]

[0475] 16. An oligonucleoside comprising an RNA duplex further comprising one or more riboses modified at the 2'-position, preferably a plurality of riboses modified at the 2'-position, is a compound defined in any one of items 1 to 15.

[0476] 17. The compound according to item 16, wherein the modification is selected from 2'-O-methyl, 2'-deoxy-fluoro, and 2'-deoxy.

[0477] 18. An oligonucleoside further comprising one or more deprotecting moieties at one or more termini is a compound according to any one of items 1 to 17.

[0478] 19. The one or more deprotecting moieties are not present at the termini of the oligonucleoside chain carrying the linker / ligand moiety, and / or the one or more deprotecting moieties are selected from phosphorothioate internucleoside linkages, phosphorodithioate internucleoside linkages, and inverted abasic nucleosides, and the inverted abasic nucleosides are present in the distal strand of the same chain as the terminus carrying the linker / ligand moiety. The compound according to item 18.

[0479] 20. The compound according to any one of items 1 to 19, wherein the ligand moiety illustrated in formula (I) of item 1 comprises one or more ligands.

[0480] 21. The compound according to item 20, wherein the ligand moiety illustrated in formula (I) of item 1 comprises one or more carbohydrate ligands.

[0481] 22. The compound according to item 21, wherein the one or more carbohydrates may be monosaccharides, disaccharides, trisaccharides, tetrasaccharides, oligosaccharides, or polysaccharides.

[0482] 23. The one or more carbohydrates of the compound according to item 22 include one or more galactose moieties, one or more lactose moieties, one or more N-acetylgalactosamine moieties, and / or one or more mannose moieties.

[0483] 24. The one or more carbohydrates of the compound according to item 23 include one or more N-acetyl-galactosamine moieties.

[0484] 25. The compound according to item 24 includes two or three N-acetylgalactosamine moieties.

[0485] 26. The one or more ligands of the compound according to any of the preceding items are attached in a linear or branched configuration.

[0486] 27. The one or more ligands of the compound according to item 26 are attached as a bifurcated or trifurcated branched configuration.

[0487] 28. The moiety illustrated in formula (I) of item 1:

[0488]

Chemical formula

[0489]

Chemical formula

[0490] [Chemical formula] In the formula, A I is hydrogen or a suitable hydroxy protecting group, a is an integer of 2 or 3, c and d are independently an integer of 1 to 6, or

[0491] [Chemical formula] In the formula, A I is hydrogen or a suitable hydroxy protecting group, a is an integer of 2 or 3, e is an integer of 2 to 10, The compound according to items 20 to 27.

[0492] 29. The said part illustrated in formula (I) of item 1:

[0493] [Chemical formula] is formula (VII):

[0494] [Chemical formula] wherein, A I is hydrogen, a is an integer of 2 or 3, The compound according to any one of items 1 to 28.

[0495] 30. The compound according to item 28 or 29, where a = 2.

[0496] 31. The compound according to item 28 or 29, where a = 3.

[0497] 32. The compound according to item 28, wherein b = 3.

[0498] 33. The compound of formula (VIII).

[0499] [Chemical formula]

[0500] 34. The compound of formula (IX).

[0501] [Chemical formula]

[0502] 35. The compound according to item 33 or 34, wherein the oligonucleoside further comprises an RNA duplex containing one or more riboses modified at the 2'-position, preferably a plurality of riboses modified at the 2'-position.

[0503] 36. The compound according to item 35, wherein the modification is selected from 2'-O-methyl, 2'-deoxy-fluoro, and 2'-deoxy.

[0504] 37. The compound according to any one of items 33 to 36, wherein the oligonucleoside further comprises one or more cleavage protecting moieties at one or more termini.

[0505] 38. The one or more cleavage protecting moieties are not present at the termini of the oligonucleoside chain carrying the linker / ligand moiety, and / or the one or more cleavage protecting moieties are selected from phosphorothioate internucleoside linkages, phosphorodithioate internucleoside linkages, and inverted abasic nucleosides, and the inverted abasic nucleoside is present at the distal end of the same strand as the terminus carrying the linker / ligand moiety. The compound according to item 37.

[0506] 39. The oligonucleoside comprises an RNA duplex containing a first strand and a second strand, the first strand is at least partially complementary to the RNA sequence of the target gene, the second strand is at least partially complementary to the first strand, each of the first strand and the second strand has 5' and 3' ends, and the RNA duplex is attached to an adjacent phosphate at the 5' end of its second strand, the compound according to item 33.

[0507] 40. The oligonucleoside comprises an RNA duplex containing a first strand and a second strand, the first strand is at least partially complementary to the RNA sequence of the target gene, the second strand is at least partially complementary to the first strand, each of the first strand and the second strand has 5' and 3' ends, and the RNA duplex is attached to an adjacent phosphate at the 3' end of its second strand, the compound according to item 34.

[0508] 41. A method for preparing the compound according to any one of items 1 to 40, comprising compounds of formulas (X) and (XI):

[0509]

Chemical formula

[0510] 42. The compound of formula (X) is of formula (Xa),

[0511]

Chemical formula

[0512] [Chemistry] The oligonucleoside comprises an RNA duplex comprising a first strand and a second strand, the first strand is at least partially complementary to the RNA sequence of the target gene, the second strand is at least partially complementary to the first strand, each of the first strand and the second strand has 5' and 3' ends, and the RNA duplex is attached to an adjacent phosphate at the 5' end of its second strand. The method according to item 41 for preparing the compound according to any one of items 6, 8 to 14, 16 to 33, and 35 to 40.

[0513] 43. The compound of formula (X) is of formula (Xb),

[0514] [Chemistry] The compound of formula (XI) is of formula (XIa),

[0515] [Chemistry] The oligonucleoside comprises an RNA duplex comprising a first strand and a second strand, the first strand is at least partially complementary to the RNA sequence of the target gene, the second strand is at least partially complementary to the first strand, each of the first strand and the second strand has 5' and 3' ends, and the RNA duplex is attached to an adjacent phosphate at the 3' end of its second strand. The method according to item 41 for preparing the compound according to any one of items 5, 7, 9 to 13, 15 to 32, and 34 to 40.

[0516] 44. The compound of formula (XIa) is of formula (XIb),

[0517] [Chemistry] The method according to item 42 or 43.

[0518] 45. Compound of formula (X):

[0519] [Chemical formula] wherein In the formula, r is independently an integer selected from 1 to 16, Z is an oligonucleoside moiety, Compound.

[0520] 46. Compound of formula (Xa).

[0521] [Chemical formula]

[0522] 47. Compound of formula (Xb).

[0523] [Chemical formula]

[0524] 48. Compound of formula (XI):

[0525] [Chemical formula] wherein In the formula, s is independently an integer selected from 1 to 16, Z is an oligonucleoside moiety, Compound.

[0526] 49. Compound of formula (XIa).

[0527] [Chemical formula]

[0528] 50. A compound of formula (XIb).

[0529] [Chemical formula]

[0530] 51. Use of a compound according to any one of items 45 and 48 to 50 for preparing a compound according to any one of items 1 to 40.

[0531] 52. Use of a compound according to item 46 for preparing a compound according to any one of items 6, 8 to 14, 16 to 33, and 35 to 40.

[0532] 53. Use of a compound according to item 47 for preparing a compound according to any one of items 5, 7, 9 to 13, 15 to 32, and 34 to 40.

[0533] 54. A compound or composition obtainable or obtainable by a method according to any one of items 41 to 44.

[0534] 55. A pharmaceutical composition comprising a compound according to any one of items 1 to 40 together with a pharmaceutically acceptable carrier, diluent, or excipient.

[0535] 56. A compound according to any one of items 1 to 40 for use in therapy. Examples

[0536] The present invention will be more fully understood by reference to the following examples. However, such examples should not be construed as limiting the scope of the present invention. The examples and embodiments described herein are for illustrative purposes only, and various modifications or changes based thereon will be suggested to those skilled in the art, and it is understood that they are included within the spirit and scope of the present application, as well as within the scope of the appended claims.

Example

[0537] Synthesis of Tether 1 Basic experimental conditions: Thin-layer chromatography (TLC) was performed on silica-coated aluminum plates using a 254 nm fluorescent indicator from Macherey-Nagel. Compounds were visualized under UV light (254 nm) or by spraying with 5% H2SO4 in methanol (MeOH) or ninhydrin reagent according to Stahl (from Sigma-Aldrich) followed by heating. Flash chromatography was performed using Biotage Sfar silica 10, 25, 50, or 100 g columns (Uppsala, Sweden) on a Biotage Isolera One flash chromatography instrument equipped with a dual variable UV wavelength detector (200 - 400 nm).

[0538] All humidity-sensitive reactions were carried out under anhydrous conditions using dry glassware, anhydrous solvents, and an argon atmosphere. All commercially available reagents were purchased from Sigma-Aldrich, and the solvents were purchased from Carl Roth GmbH + Co. KG. D-Galactosamine pentaacetate was purchased from AK scientific.

[0539] Using a Dionex UltiMate 3000RS UHPLC system and a Thermo Scientific MSQ Plus mass spectrometer, HPLC / ESI-MS was performed using a Waters Acquity UPLC Protein BEH C4 column (300 Å, 1.7 μm, 2.1×100 mm) at 60 °C. The solvent system consisted of solvent A, which was H2O containing 0.1% formic acid, and solvent B, which was acetonitrile (ACN) containing 0.1% formic acid. A gradient from 5% to 100% B was used at a flow rate of 0.4 mL / min for 15 minutes. Detector and conditions: Corona ultra charged aerosol detection (from esa). Nebulizer temperature: 25 °C. N2 pressure: 35.1 psi. Filter: Corona.

[0540] 1 H and 13 C NMR spectra were recorded at room temperature on a Varian spectrometer operating at 500 MHz ( 1 H NMR) and 125 MHz ( 13 C NMR). Chemical shifts are reported in ppm relative to the solvent residual peak (CDCl3 - 1 H NMR: δ 7.26 ppm and 13 C NMR δ 77.2 ppm; DMSO-d6 - 1 H NMR: δ 2.50 ppm and 13 C NMR δ 39.5 ppm). Coupling constants are reported in Hertz. Signal splitting patterns are described as singlet (s), doublet (d), triplet (t), or multiplet (m).

[0541] Synthetic route of the conjugate building block TriGalNAc_tether1:

[0542]

Chem.

[0543] Preparation of Compound 2: D-Galactosamine pentaacetate (3.00 g, 7.71 mmol, 1.0 equiv) was dissolved in anhydrous dichloromethane (DCM) (30 mL) under argon, and trimethylsilyl trifluoromethanesulfonate (TMSOTf, 4.28 g, 19.27 mmol, 2.5 equiv) was added. The reaction mixture was stirred at room temperature for 3 h. The reaction mixture was diluted with DCM (50 mL) and washed with cold saturated aqueous NaHCO3 (100 mL) and water (100 mL). The organic layer was separated, dried over Na2SO4, and concentrated to give the title compound as a yellow oil. It was purified by flash chromatography (gradient elution: 0 - 10% MeOH in DCM, 10 CV). The product was obtained as a colorless oil (2.5 g, 98%, rf = 0.45 (2% MeOH in DCM)).

[0544]

Chemical formula

[0545] Preparation of Compound 4: Compound 2 (2.30 g, 6.98 mmol, 1.0 equiv) and azido-PEG3-OH (1.83 g, 10.5 mmol, 1.5 equiv) were dissolved in anhydrous DCM (40 mL) under argon, and molecular sieve 3 Å (5 g) was added to the solution. The mixture was stirred at room temperature for 1 h. Then TMSOTf (0.77 g, 3.49 mmol, 0.5 equiv) was added to the mixture, and the reaction was stirred overnight. The molecular sieve was filtered off, the filtrate was diluted with DCM (100 mL), and washed with cold saturated aqueous NaHCO3 (100 mL) and water (100 mL). The organic layer was separated, dried over Na2SO4, and the solvent was removed under reduced pressure. The crude material was purified by flash chromatography (gradient elution: 0 - 3% MeOH in DCM, 10 CV) to give the title product as a pale yellow oil (3.10 g, 88%, rf = 0.25 (2% MeOH in DCM)). MS: C 20 H 32 N4O 11 Calculated for, 504.21. Found 505.4. 11H NMR (500 MHz, CDCl3) δ 6.21 - 6.14 (m, 1H), 5.30 (dd, J = 3.4, 1.1 Hz, 1H), 5.04 (dd, J = 11.2, 3.4 Hz, 1H), 4.76 (d, J = 8.6 Hz, 1H), 4.23 - 4.08 (m, 3H), 3.91 - 3.80 (m, 3H), 3.74 - 3.59 (m, 9H), 3.49 - 3.41 (m, 2H), 2.14 (s, 3H), 2.02 (s, 3H), 1.97 (d, J = 4.2 Hz, 6H). 13 13C NMR (125 MHz, CDCl3) δ 170.6 (C), 170.5 (C), 170.4 (C), 170.3 (C), 102.1 (CH), 71.6 (CH), 70.8 (CH), 70.6 (CH), 70.5 (CH), 70.3 (CH2), 69.7 (CH2), 68.5 (CH2), 66.6 (CH2), 61.5 (CH2), 23.1 (CH3), 20.7 (3xCH3).

[0546]

Chem.

[0547] Preparation of Compound 5: Compound 4 (1.00 g, 1.98 mmol, 1.0 equiv) was dissolved in a mixture of ethyl acetate (EtOAc) and MeOH (30 mL 1:1 volume / volume), and Pd / C (100 mg) was added. The reaction mixture was degassed by vacuum / argon cycle (3 times) and hydrogenated overnight under balloon pressure. The reaction mixture was filtered through celite and washed with EtOAc (30 mL). The solvent was removed under reduced pressure to obtain the title compound as a colorless oil (0.95 g, quantitative yield, rf = 0.25 (10% MeOH in DCM)). This compound was used without further purification. MS: C 20 H 34 N2O 11 calculated value, 478.2. Found 479.4.

[0548]

Chem.

[0549] Preparation of Compound 7: Tris{[2-(tert-butoxycarbonyl)ethoxy]methyl}-methylamine 6 (3.37 g, 6.67 mmol, 1.0 eq) was dissolved in a mixture of DCM / water (40 mL 1:1 volume / volume), and Na2CO3 (0.18 g, 1.7 mmol, 0.25 eq) was added with vigorous stirring. Benzyl chloroformate (2.94 mL, 20.7 mmol, 3.10 eq) was added dropwise to the previous mixture, and the reaction was stirred at room temperature for 24 h. The reaction mixture was diluted with CH2Cl2 (100 mL) and washed with water (100 mL). The organic layer was separated and dried over Na2SO4. The solvent was removed under reduced pressure, and the resulting crude material was purified by flash chromatography (gradient elution: 0 - 10% ethyl acetate in cyclohexane, 12 CV) to give the title compound as a pale yellow oil (3.9 g, 91%, rf = 0.56 (10% EtOAc in cyclohexane)). MS: C 33 H 53 NO 11 Calculated for, 639.3. Found 640.9. 1 H NMR (500 MHz, DMSO-d6) δ 7.38 - 7.26 (m, 5H), 4.97 (s, 2H), 3.54 (t, 6H), 3.50 (s, 6H), 2.38 (t, 6H), 1.39 (s, 27H). 13 C NMR (125 MHz, DMSO-d6) δ 170.3 (3xC), 154.5 (C), 137.1 (C), 128.2 (2xCH), 127.7 (CH), 127.6 (2xCH), 79.7 (3xC), 68.4 (3xCH2), 66.8 (3xCH2), 64.9 (C), 58.7 (CH2), 35.8 (3xCH2), 27.7 (9xCH3).

[0550]

Chemical Structure

[0551] Preparation of Compound 8: Cbz-NH-tris-Boc-ester 7 (0.20 g, 0.39 mmol, 1.0 equiv) was dissolved in CH2Cl2 (1 mL) under argon, trifluoroacetic acid (TFA, 1 mL) was added, and the reaction was stirred at room temperature for 1 hour. The solvent was removed under reduced pressure, and the residue was co-evaporated three times with toluene (5 mL) and dried under high vacuum to obtain the compound as the TFA salt (0.183 g, 98%). This compound was used without further purification. MS: C 21 H 29 NO 11 Calculated for, 471.6. Found 472.4.

[0552]

Chem.

[0553] Preparation of Compound 9: CbzNH-tris-COOH 8 (0.72 g, 1.49 mmol, 1.0 equiv) and GalNAc-PEG3-NH2 5 (3.56 g, 7.44 mmol, 5.0 equiv) were dissolved in N,N-dimethylformamide (DMF) (25 mL). Then, to this solution were added N,N,N',N'-tetramethyl-O-(1H-benzotriazol-1-yl)uronium hexafluorophosphate (HBTU) (2.78 g, 7.44 mmol, 5.0 equiv), 1-hydroxybenzotriazole hydrate (HoBt) (1.05 g, 7.44 mmol, 5.0 equiv) and N,N-diisopropylethylamine (DIPEA) (2.07 mL, 11.9 mmol, 8.0 equiv), and the reaction was stirred for 72 hours. The solvent was removed under reduced pressure, the residue was dissolved in DCM (100 mL), and washed with saturated aqueous NaHCO3 (100 mL). The organic layer was dried over Na2SO4, the solvent was evaporated, and the crude material was purified by flash chromatography (gradient elution: 0 - 5% MeOH in DCM, 14 CV). The product was obtained as a pale yellow oil (1.2 g, 43%, rf = 0.20 (5% MeOH in DCM)). MS: C 81 H 125 N7O 41 Calculated for, 1852.9. Found 1854.7. 11H NMR (500 MHz, DMSO-d6) δ 7.90 - 7.80 (m, 10H), 7.65 - 7.62 (m, 4H), 7.47 - 7.43 (m, 3H), 7.38 - 7.32 (m, 8H), 5.24 - 5.22 (m, 3H), 5.02 - 4.97 (m, 4H), 4.60 - 4.57 (m, 3H), 4.07 - 3.90 (m 10H), 3.67 - 3.36 (m, 70H), 3.23 - 3.07 (m, 25H), 2.18 (s, 10H), 2.00 (s, 13H), 1.89 (s, 11H), 1.80 - 1.78 (m, 17H). 13 13C NMR (125 MHz, DMSO-d6) δ 170.1 (C), 169.8 (C), 169.7 (C), 169.4 (C), 169.2 (C), 169.1 (C), 142.7 (C), 126.3 (CH), 123.9 (CH), 118.7 (CH), 109.7 (CH), 100.8 (CH), 70.5 (CH), 69.8 (CH), 69.6 (CH), 69.5 (CH), 69.3 (CH2), 69.0 (CH2), 68.2 (CH2), 67.2 (CH2), 66.7 (CH2), 61.4 (CH2), 22.6 (CH2), 22.4 (3xCH3), 20.7 (9xCH3).

[0554]

Chem.

[0555] Preparation of Compound 10: The trifurcated GalNAc compound 9 (0.27 g, 0.14 mmol, 1.0 equiv) was dissolved in MeOH (15 mL), and 3 drops of acetic acid (AcOH) and Pd / C (30 mg) were added. The reaction mixture was degassed by vacuum / argon cycle (3 times) and hydrogenated overnight under balloon pressure. Mass spectrometry was performed following the completion of the reaction, and the resulting mixture was filtered through a thin pad of celite. The solvent was evaporated, and the obtained residue was dried under high vacuum and used in the next step without further purification. The product was obtained as a pale yellow oil (0.24 g, quantitative yield). MS: C 73 H 119 N7O 39 Calculated value for, 1718.8. Measured value 1719.3.

[0556]

Chem.

[0557] Preparation of Compound 11: The commercially available bis(N-hydroxysuccinimide ester) of suberic acid (3.67 g, 9.9 mmol, 1.0 equiv) was dissolved in DMF (5 mL), and triethylamine (1.2 mL) was added. To this solution, a solution of 3-azido-1-propylamine (1.0 g, 9.9 mmol, 1.0 equiv) in DMF (5 mL) was added dropwise. The reaction was stirred at room temperature for 3 h. The reaction mixture was diluted with EtOAc (100 mL) and washed with water (50 mL). The organic layer was separated, dried over Na2SO4, and the solvent was removed under reduced pressure. The crude material was purified by flash chromatography (gradient elution: 0 - 5% MeOH in DCM, 16 CV). The product was obtained as a white solid (1.54 g, 43%, rf = 0.71 (5% MeOH in DCM)). MS: C 15 H 23 Calculated value for N5O5, 353.4. Measured value 354.3.

[0558]

Chem.

[0559] Preparation of TriGalNAc(12): The branched GalNAc compound 10 (0.35 g, 0.24 mmol, 1.0 equivalent) and compound 11 (0.11 g, 0.31 mmol, 1.5 equivalents) were dissolved in DCM (5 mL) under argon, and triethylamine (0.1 mL, 0.61 mmol, 3.0 equivalents) was added. The reaction mixture was stirred at room temperature overnight. The solvent was removed under reduced pressure, and the residue was dissolved in EtOAc (100 mL) and washed with water (100 mL). The organic layer was separated and dried over Na2SO4. The solvent was evaporated, and the resulting crude material was purified by flash chromatography (gradient elution: 0 - 10% MeOH in DCM, 20 CV) to obtain the title compound as a white, fluffy solid (0.27 g, 67%, rf = 0.5 (10% MeOH in DCM)). MS: C 84 H 137 N 11 O 41 Calculated value for, 1957.1. Found 1959.6.

[0560] Conjugation of the tether 1 with the siRNA strand: Monofluorocyclooctyne (MFCO) conjugation at the 5'- or 3'-terminus 5'-Terminal MFCO conjugation

[0561]

Chem.

[0562]

Chem.

[0563] Basic conditions for MFCO conjugation: The amine-modified single strand was dissolved at 700 OD / mL in 50 mM carbonate / bicarbonate buffer pH 9.6 / dimethyl sulfoxide (DMSO) 4:6 (volume / volume). To this solution, 1 molar equivalent of a DMF solution of 35 mM MFCO-C6-NHS ester (Berry & Associates, catalog number LK4300) was added. The reaction was carried out at room temperature, and after 1 hour, another 1 molar equivalent of the MFCO solution was added. The reaction was allowed to proceed for a further 1 hour and monitored by LC / MS. To achieve quantitative consumption of the starting material, at least 2 molar equivalents in excess of the MFCO NHS ester reagent were required relative to the amino-modified oligonucleotide. The reaction mixture was diluted 15-fold with water, filtered through a Sartorius 1.2 μm filter, and then purified by reverse phase (reserve phase) (RP HPLC) using an Akta Pure instrument (GE Healthcare).

[0564] Purification was carried out using a Waters XBridge C18 Prep 19×50 mm column. Buffer A was 100 mM TEAAc pH 7, and buffer B contained 95% acetonitrile in buffer A. A flow rate of 10 mL / min and a temperature of 60 °C were used. A UV trace at 280 nm was recorded. A gradient of 0 - 100% B was used within 60 column volumes.

[0565] Fractions containing the full-length conjugate oligonucleotide were pooled, precipitated with 3M NaOAc, pH 5.2 and 85% ethanol in a freezer, and the collected pellet was dissolved in water. The sample was desalted by size exclusion chromatography, concentrated using a speed-vac concentrator, and the conjugate oligonucleotide was obtained in an isolated yield of 40 - 80%. 5’-GalNAc-T1 conjugate

[0566]

Chemical formula

[0567]

Chem.

[0568] Basic procedure for TriGalNAc conjugation: The MFCO-modified single strand was dissolved in water at 2000 OD / mL, and 1 equivalent of a DMF solution of compound 12 (10 mM) was added to this solution. The reaction was carried out at room temperature, and after 3 hours, 0.7 molar equivalent of the compound 12 solution was added. The reaction was allowed to proceed overnight and monitored for completion by LCMS. The conjugate was diluted 15-fold with water, filtered through a Sartorius 1.2 μm filter, and then purified by RP HPLC on an Akta Pure instrument (GE Healthcare).

[0569] RP HPLC purification was carried out using a Waters XBridge C18 Prep 19×50 mm column. Buffer A was 100 mM triethylammonium acetate pH 7, and buffer B contained 95% acetonitrile in buffer A. A flow rate of 10 mL / min and a temperature of 60 °C were used. A UV trace at 280 nm was recorded. A gradient of 0 - 100% B was used within 60 column volumes.

[0570] Fractions containing the full-length conjugate oligonucleotide were pooled, precipitated with 3M NaOAc, pH 5.2 and 85% ethanol in a freezer, and the collected pellet was dissolved in water to obtain an oligonucleotide solution of approximately 1000 OD / mL. O-acetate was removed by adding 20% aqueous ammonia. Quantitative removal of such protecting groups was verified by LC-MS.

[0571] The conjugate was desalted by size exclusion chromatography using Sephadex G25 Fine resin (GE Healthcare) on an Akta Pure (GE Healthcare) instrument to obtain the conjugate oligonucleotide in an isolated yield of 50 - 70%.

[0572] The following scheme further shows the synthetic route.

[0573] [Chemical formula]

[0574] [Chemical formula]

[0575] [Chemical formula]

[0576] [Chemical formula]

[0577] [Chemical formula] [Example]

[0578] Double-strand annealing To generate the desired siRNA double strand, two complementary strands were annealed by combining equimolar aqueous solutions of both strands. The mixture was placed in a water bath at 70 °C for 5 minutes, followed by allowing cooling to ambient temperature within 2 hours. The double strand was lyophilized for 2 days and stored at -20 °C.

[0579] The double-stranded chains were analyzed by analytical SEC HPLC using a Superdex™ 75 Increase 5 / 150 GL column 5 × 153–158 mm (Cytiva) on a Dionex Ultimate 3000 (Thermo Fisher Scientific) HPLC instrument. The mobile phase consisted of 1× PBS containing 10% acetonitrile. An isocratic gradient was run for 10 minutes at room temperature at a flow rate of 1.5 mL / min. UV traces at 260 and 280 nm were recorded. Water (LC-MS grade) was purchased from Sigma-Aldrich, and phosphate-buffered saline (PBS; 10×, pH 7.4) was purchased from GIBCO (Thermo Fisher Scientific).

Example

[0580] Synthesis of tether 2 Basic experimental conditions: Thin-layer chromatography (TLC) was performed on silica-coated aluminum plates using a Macherey-Nagel 254 nm fluorescent indicator. Compounds were visualized under UV light (254 nm) or after spraying with 5% H2SO4 in methanol (MeOH) or ninhydrin reagent according to Stahl (from Sigma-Aldrich) followed by heating. Flash chromatography was performed on a Biotage Isolera One flash chromatography instrument equipped with a dual variable UV wavelength detector (200–400 nm) using Biotage Sfar silica 10, 25, 50, or 100 g columns (Uppsala, Sweden).

[0581] All humidity-sensitive reactions were carried out under anhydrous conditions using dry glassware, anhydrous solvents, and an argon atmosphere. All commercially available reagents were purchased from Sigma-Aldrich, and the solvents were purchased from Carl Roth GmbH+Co.KG. D-Galactosamine pentaacetate was purchased from AK scientific.

[0582] Using a Dionex UltiMate 3000RS UHPLC system and a Thermo Scientific MSQ Plus mass spectrometer, HPLC / ESI-MS was performed using a Waters Acquity UPLC Protein BEH C4 column (300 Å, 1.7 μm, 2.1×100 mm) at 60 °C. The solvent system consisted of solvent A, which was H2O containing 0.1% formic acid, and solvent B, which was acetonitrile (ACN) containing 0.1% formic acid. A gradient from 5% to 100% B was used at a flow rate of 0.4 mL / min over 15 minutes. Detector and conditions: Corona ultra charged aerosol detection (from esa). Nebulizer temperature: 25 °C. N2 pressure: 35.1 psi. Filter: Corona.

[0583] 1 H and 13 C NMR spectra were recorded at room temperature on a Varian spectrometer operating at 500 MHz ( 1 H NMR) and 125 MHz ( 13 C NMR). Chemical shifts are reported in ppm relative to the solvent residual peaks (CDCl3 - 1 H NMR: δ 7.26 ppm and 13 C NMR δ 77.2 ppm; DMSO-d6 - 1 H NMR: δ 2.50 ppm and 13 C NMR δ 39.5 ppm). Coupling constants are reported in Hertz. Signal splitting patterns are described as singlet (s), doublet (d), triplet (t), or multiplet (m).

[0584] Synthetic route of the conjugate building block TriGalNAc_tether2:

[0585]

Chem.

[0586] Preparation of Compound 2: D-Galactosamine pentaacetate (3.00 g, 7.71 mmol, 1.0 equiv) was dissolved in anhydrous dichloromethane (DCM) (30 mL) under argon, and trimethylsilyl trifluoromethanesulfonate (TMSOTf, 4.28 g, 19.27 mmol, 2.5 equiv) was added. The reaction mixture was stirred at room temperature for 3 h. The reaction mixture was diluted with DCM (50 mL) and washed with cold saturated aqueous NaHCO3 (100 mL) and water (100 mL). The organic layer was separated, dried over Na2SO4, and concentrated to give the title compound as a yellow oil. It was purified by flash chromatography (gradient elution: 0 - 10% MeOH in DCM, 10 CV). The product was obtained as a colorless oil (2.5 g, 98%, rf = 0.45 (2% MeOH in DCM)).

[0587] [Chemical formula]

[0588] Preparation of Compound 4: Compound 2 (2.30 g, 6.98 mmol, 1.0 equiv) and azido-PEG3-OH (1.83 g, 10.5 mmol, 1.5 equiv) were dissolved in anhydrous DCM (40 mL) under argon, and molecular sieves 3 Å (5 g) were added to the solution. The mixture was stirred at room temperature for 1 h. Then TMSOTf (0.77 g, 3.49 mmol, 0.5 equiv) was added to the mixture, and the reaction was stirred overnight. The molecular sieves were filtered off, the filtrate was diluted with DCM (100 mL), and washed with cold saturated aqueous NaHCO3 (100 mL) and water (100 mL). The organic layer was separated, dried over Na2SO4, and the solvent was removed under reduced pressure. The crude material was purified by flash chromatography (gradient elution: 0 - 3% MeOH in DCM, 10 CV) to give the title product as a pale yellow oil (3.10 g, 88%, rf = 0.25 (2% MeOH in DCM)). MS: C 20 H 32 N4O 11 Calculated for, 504.21. Found 505.4. 11H NMR (500 MHz, CDCl3) δ 6.21 - 6.14 (m, 1H), 5.30 (dd, J = 3.4, 1.1 Hz, 1H), 5.04 (dd, J = 11.2, 3.4 Hz, 1H), 4.76 (d, J = 8.6 Hz, 1H), 4.23 - 4.08 (m, 3H), 3.91 - 3.80 (m, 3H), 3.74 - 3.59 (m, 9H), 3.49 - 3.41 (m, 2H), 2.14 (s, 3H), 2.02 (s, 3H), 1.97 (d, J = 4.2 Hz, 6H). 13 13C NMR (125 MHz, CDCl3) δ 170.6 (C), 170.5 (C), 170.4 (C), 170.3 (C), 102.1 (CH), 71.6 (CH), 70.8 (CH), 70.6 (CH), 70.5 (CH), 70.3 (CH2), 69.7 (CH2), 68.5 (CH2), 66.6 (CH2), 61.5 (CH2), 23.1 (CH3), 20.7 (3xCH3).

[0589]

Chem.

[0590] Preparation of Compound 5: Compound 4 (1.00 g, 1.98 mmol, 1.0 equiv) was dissolved in a mixture of ethyl acetate (EtOAc) and MeOH (30 mL, 1:1 volume / volume), and Pd / C (100 mg) was added. The reaction mixture was degassed by vacuum / argon cycle (3 times) and hydrogenated overnight under balloon pressure. The reaction mixture was filtered through celite and washed with EtOAc (30 mL). The solvent was removed under reduced pressure to give the title compound as a colorless oil (0.95 g, quantitative yield, rf = 0.25 (10% MeOH in DCM)). This compound was used without further purification. MS: C 20 H 34 N2O 11 calculated value, 478.2. Found 479.4.

[0591]

Chem.

[0592] Preparation of Compound 7: Tris{[2-(tert-butoxycarbonyl)ethoxy]methyl}-methylamine 6 (3.37 g, 6.67 mmol, 1.0 equiv) was dissolved in a mixture of DCM / water (40 mL 1:1 volume / volume), and Na2CO3 (0.18 g, 1.7 mmol, 0.25 equiv) was added with vigorous stirring. Benzyl chloroformate (2.94 mL, 20.7 mmol, 3.10 equiv) was added dropwise to the previous mixture, and the reaction was stirred at room temperature for 24 h. The reaction mixture was diluted with CH2Cl2 (100 mL) and washed with water (100 mL). The organic layer was separated and dried over Na2SO4. The solvent was removed under reduced pressure, and the resulting crude material was purified by flash chromatography (gradient elution: 0 - 10% ethyl acetate in cyclohexane, 12 CV) to give the title compound as a pale yellow oil (3.9 g, 91%, rf = 0.56 (10% EtOAc in cyclohexane)). MS: C 33 H 53 NO 11 Calculated for, 639.3. Found 640.9. 1 H NMR (500 MHz, DMSO-d6) δ 7.38 - 7.26 (m, 5H), 4.97 (s, 2H), 3.54 (t, 6H), 3.50 (s, 6H), 2.38 (t, 6H), 1.39 (s, 27H). 13 C NMR (125 MHz, DMSO-d6) δ 170.3 (3xC), 154.5 (C), 137.1 (C), 128.2 (2xCH), 127.7 (CH), 127.6 (2xCH), 79.7 (3xC), 68.4 (3xCH2), 66.8 (3xCH2), 64.9 (C), 58.7 (CH2), 35.8 (3xCH2), 27.7 (9xCH3).

[0593]

Chemical Structure

[0594] Preparation of Compound 8: Cbz-NH-tris-Boc-ester 7 (0.20 g, 0.39 mmol, 1.0 equiv) was dissolved in CH2Cl2 (1 mL) under argon, trifluoroacetic acid (TFA, 1 mL) was added, and the reaction mixture was stirred at room temperature for 1 h. The solvent was removed under reduced pressure, and the residue was co-evaporated with toluene (5 mL) three times and dried under high vacuum to obtain the compound as the TFA salt (0.183 g, 98%). This compound was used without further purification. MS: C 21 H 29 NO 11 Calculated for, 471.6. Found 472.4.

[0595]

Chem.

[0596] Preparation of Compound 9: CbzNH-tris-COOH 8 (0.72 g, 1.49 mmol, 1.0 equiv) and GalNAc-PEG3-NH2 5 (3.56 g, 7.44 mmol, 5.0 equiv) were dissolved in N,N-dimethylformamide (DMF) (25 mL). Then, N,N,N’,N’-tetramethyl-O-(1H-benzotriazol-1-yl)uronium hexafluorophosphate (HBTU) (2.78 g, 7.44 mmol, 5.0 equiv), 1-hydroxybenzotriazole hydrate (HoBt) (1.05 g, 7.44 mmol, 5.0 equiv) and N,N-diisopropylethylamine (DIPEA) (2.07 mL, 11.9 mmol, 8.0 equiv) were added to this solution, and the reaction mixture was stirred for 72 h. The solvent was removed under reduced pressure, the residue was dissolved in DCM (100 mL), and washed with saturated aqueous NaHCO3 (100 mL). The organic layer was dried over Na2SO4, the solvent was evaporated, and the crude material was purified by flash chromatography (gradient elution: 0 - 5% MeOH in DCM, 14 CV). The product was obtained as a pale yellow oil (1.2 g, 43%, rf = 0.20 (5% MeOH in DCM)). MS: C 81 H 125 N7O 41 Calculated for, 1852.9. Found 1854.7. 11H NMR (500 MHz, DMSO-d6) δ 7.90 - 7.80 (m, 10H), 7.65 - 7.62 (m, 4H), 7.47 - 7.43 (m, 3H), 7.38 - 7.32 (m, 8H), 5.24 - 5.22 (m, 3H), 5.02 - 4.97 (m, 4H), 4.60 - 4.57 (m, 3H), 4.07 - 3.90 (m 10H), 3.67 - 3.36 (m, 70H), 3.23 - 3.07 (m, 25H), 2.18 (s, 10H), 2.00 (s, 13H), 1.89 (s, 11H), 1.80 - 1.78 (m, 17H). 13 13C NMR (125 MHz, DMSO-d6) δ 170.1 (C), 169.8 (C), 169.7 (C), 169.4 (C), 169.2 (C), 169.1 (C), 142.7 (C), 126.3 (CH), 123.9 (CH), 118.7 (CH), 109.7 (CH), 100.8 (CH), 70.5 (CH), 69.8 (CH), 69.6 (CH), 69.5 (CH), 69.3 (CH2), 69.0 (CH2), 68.2 (CH2), 67.2 (CH2), 66.7 (CH2), 61.4 (CH2), 22.6 (CH2), 22.4 (3xCH3), 20.7 (9xCH3).

[0597] [Chemical formula]

[0598] Preparation of Compound 10: The branched GalNAc compound 9 (0.27 g, 0.14 mmol, 1.0 equiv) was dissolved in MeOH (15 mL), and 3 drops of acetic acid (AcOH) and Pd / C (30 mg) were added. The reaction mixture was degassed by vacuum / argon cycle (3 times) and hydrogenated overnight under balloon pressure. Mass spectrometry was performed following the completion of the reaction, and the resulting mixture was filtered through a thin pad of celite. The solvent was evaporated, and the obtained residue was dried under high vacuum and used in the next step without further purification. The product was obtained as a pale yellow oil (0.24 g, quantitative yield). MS: C 73 H 119 N7O 39 Calculated value for, 1718.8. Found 1719.3.

[0599]

Chem.

[0600] Preparation of Compound 14: The branched GalNAc compound 10 (0.45 g, 0.26 mmol, 1.0 equiv), HBTU (0.19 g, 0.53 mmol, 2.0 equiv) and DIPEA (0.23 mL, 1.3 mmol, 5.0 equiv) were dissolved in DCM (10 mL) under argon. To this mixture, a solution of compound 13 (0.14 g, 0.53 mmol, 2.0 equiv) in DCM (5 mL) was added dropwise. The reaction was stirred at room temperature overnight. The solvent was removed, and the residue was dissolved in EtOAc (50 mL), washed with water (50 mL) and dried over Na2SO4. The solvent was evaporated, and the crude material was purified by flash chromatography (gradient elution: 0 - 5% MeOH in DCM, 20 CV). The product was obtained as a white, fluffy solid (0.25 g, 48%, rf = 0.4 (10% MeOH in DCM)). MS: Calculated value for C88H137N7O42, 1965.1. Found 1965.6.

[0601]

Chem.

[0602] Preparation of TriGalNAc(15): The branched GalNAc compound 14 (0.31 g, 0.15 mmol, 1.0 equiv) was dissolved in EtOAc (15 mL), and Pd / C (40 mg) was added. The reaction mixture was degassed by vacuum / argon cycle (3 times) and hydrogenated overnight under balloon pressure. The completion of the reaction was monitored by mass spectrometry, and the resulting mixture was filtered through a thin pad of celite. The solvent was removed under reduced pressure, and the obtained residue was dried under high vacuum overnight. The residue was used for conjugation with oligonucleosides without further purification (0.28 g, quantitative yield). MS: C 81 H 131 N7O 42 Calculated value of, 1874.9. Measured value 1875.3.

[0603] Conjugation of Tether 2 and siRNA strand: TriGalNAc Tether 2 (GalNAc-T2) conjugation at the 5'-end or 3'-end 5'-GalNAc-T2 conjugate

[0604]

Chem.

[0605]

Chem.

[0606] Preparation of TriGalNAc Tether 2 NHS ester: To a solution of carboxylic acid Tether 2 (Compound 15, 227 mg, 121 μmol) in DMF (2.1 mL), N-hydroxysuccinimide (NHS) (15.3 mg, 133 μmol) and N,N'-diisopropylcarbodiimide (DIC) (19.7 μL, 127 μmol) were added. The solution was stirred at room temperature for 18 hours and used for the subsequent conjugation reaction without purification.

[0607] Basic conditions for triGalNAc tether 2 conjugation: The amine-modified single strand was dissolved at 700 OD / mL in 50 mM carbonate / bicarbonate buffer pH 9.6 / DMSO 4:6 (volume / volume). To this solution, a 1 molar equivalent solution of tether 2 NHS ester (57 mM) in DMF was added. The reaction was carried out at room temperature and after 1 hour, another 1 molar equivalent of the NHS ester solution was added. The reaction was allowed to proceed for a further 1 hour and the progress of the reaction was monitored by LCMS. To achieve quantitative consumption of the starting material, at least a 2 molar equivalent excess of the NHS ester reagent was required relative to the amino-modified oligonucleotide. The reaction mixture was diluted 15-fold with water, filtered through a Sartorius 1.2 μm filter and then purified by reverse phase (RP HPLC) on an Akta Pure (GE Healthcare) instrument.

[0608] Purification was carried out using a Waters XBridge C18 Prep 19×50 mm column. Buffer A was 100 mM TEAA pH 7 and buffer B contained 95% acetonitrile in buffer A. A flow rate of 10 mL / min and a temperature of 60 °C were used. A UV trace at 280 nm was recorded. A gradient of 0 - 100% B was used within 60 column volumes.

[0609] Fractions containing the full-length conjugate oligonucleotide were pooled and precipitated with 3M NaOAc, pH 5.2 and 85% ethanol in a freezer and then dissolved in water at 1000 OD / mL. O-acetate was removed with 20% aqueous ammonium hydroxide until complete (monitored by LC-MS).

[0610] The conjugate was desalted by size exclusion chromatography using Sephadex G25 Fine resin (GE Healthcare) on an Akta Pure (GE Healthcare) instrument to obtain the conjugate oligonucleotide in 60 - 80% isolated yield.

[0611] The conjugate was characterized by HPLC-MS analysis using a Dionex Ultimate 3000 (Thermo Fisher Scientific) HPLC equipped with a Compact ESI-Qq-TOF mass spectrometer (Bruker Daltonics), with a 2.1×50 mm XBridge C18 column (Waters). Buffer A was 16.3 mM triethylamine, 100 mM HFIP in 1% aqueous MeOH, and buffer B contained 95% MeOH in buffer A. A flow rate of 250 μL / min and a temperature of 60 °C were used. UV traces at 260 and 280 nm were recorded. A gradient of 1-100% B was used within 31 minutes.

[0612] The following scheme further shows the synthetic route.

[0613]

Chem.

[0614]

Chem.

[0615]

Chem.

[0616]

Chem.

Example

[0617] Double-strand annealing To generate the desired siRNA duplex, the two complementary strands were annealed by combining equimolar aqueous solutions of both strands. The mixture was placed in a water bath at 70 °C for 5 minutes, followed by allowing cooling to ambient temperature within 2 hours. The duplex was lyophilized for 2 days and stored at -20 °C.

[0618] The double-strand was analyzed by analytical SEC HPLC using a Superdex™ 75 Increase 5 / 150 GL column 5×153-158 mm (Cytiva) on a Dionex Ultimate 3000 (Thermo Fisher Scientific) HPLC instrument. The mobile phase consisted of 1×PBS containing 10% acetonitrile. An isocratic gradient was run at a flow rate of 1.5 mL / min for 10 minutes at room temperature. UV traces at 260 and 280 nm were recorded. Water (LC-MS grade) was purchased from Sigma-Aldrich and phosphate-buffered saline (PBS; 10×, pH 7.4) was purchased from GIBCO (Thermo Fisher Scientific).

Example

[0619] Alternative synthetic route of conjugate building block TriGalNAc-tether2:

Chem.

Chem.

[0620] Conjugation of tether2 with siRNA strand: TriGalNAc tether2 (GalNAc-T2) conjugation at the 5'-end or 3'-end Conjugation conditions

Chem.

[0621]

Chem.

[0622]

Chem.

Example

[0623] Solid-phase synthesis method: scale ≤ 1 μmol The synthesis of the siRNA sense and antisense strands was carried out on a commercially available solid support made of porous controlled glass with a universal linker (universal CPG, loading 40 μmol / g; LGC Biosearch or Glen Research) using a MerMade192X synthesizer.

[0624] RNA phosphoramidites were purchased from ChemGenes or Hongene.

[0625] The 2'-O-methyl phosphoramidites used were as follows: 5'-(4,4'-dimethoxytrityl)-N-benzoyl-adenosine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-acetyl-cytidine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-isobutyryl-guanosine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-uridine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite.

[0626] The 2'-F-phosphoramidites used were as follows: 5'-dimethoxytrityl-N-benzoyl-deoxyadenosine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-dimethoxytrityl-N-acetyl-deoxycytidine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-dimethoxytrityl-N-isobutyryl-deoxyguanosine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, and 5'-dimethoxytrityl-deoxythymidine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite.

[0627] All phosphoramidites except 2'-O-methyl-uridine phosphoramidite were dissolved in DMF / MeCN (1:4, volume / volume) at a concentration of 0.05 M in anhydrous acetonitrile (Honeywell Research Chemicals). Iodine (DNAchem) at a concentration of 0.02 M in acetonitrile / pyridine / H2O was used as the oxidizing reagent. Thiolation of phosphorothioate linkages was carried out using 0.2 M PADS (TCI) in acetonitrile / pyridine 1:1 volume / volume. 5-Ethylthiotetrazole (ETT) at a concentration of 0.25 M mM in acetonitrile was used as the activator solution.

[0628] Inverted deoxy base phosphoramidite, 3-O-dimethoxytrityl-2-deoxyribose-5-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite was purchased from Chemgenes (ANP-1422) or Hongene (OP-040).

[0629] In each cycle, DMT was removed with a deblocking solution, 3% TCA in DCM (DNAchem).

[0630] The coupling time was 180 seconds. The oxidant contact time was set to 80 seconds and the thiolation time was 2 * 100 seconds.

[0631] At the end of the synthesis, the oligonucleotide was cleaved from the solid support using an NH4OH:EtOH solution 4:1 (volume / volume) (TCI) at 45 °C for 20 hours. The solid support was then filtered, the filter was washed well with H2O, and the volume of the mixed solution was reduced by evaporation under reduced pressure.

[0632] The oligonucleotide was processed using an Amicon Ultra-2 centrifugal filter unit; PBS buffer (10×, Teknova, pH 7.4, sterile) by ultracentrifugation or by EtOH precipitation from 1 M sodium acetate to form the sodium salt.

[0633] The identity of the single-stranded siRNA was evaluated by MS ESI, followed by annealing in water to form the final double-stranded siRNA, and the duplex purity was evaluated by size exclusion chromatography.

Example

[0634] Solid-phase synthesis method: scale ≥ 5 μmol The synthesis of the siRNA sense strand and antisense strand was carried out on a commercially available solid support made of porous controlled glass with a universal linker (universal CPG, loading 40 μmol / g; LGC Biosearch or Glen Research) on a MerMade12 synthesizer at a scale of 5 μmol. The sense strand for 3'-conjugation was synthesized at 12 μmol on a 3'-PT-amino modified substance C6 CPG 500 Å solid support (LGC) with a loading of 86 μmol / g.

[0635] RNA phosphoramidites were purchased from ChemGenes or Hongene.

[0636] The 2'-O-methyl phosphoramidites used were as follows: 5'-(4,4'-dimethoxytrityl)-N-benzoyl-adenosine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-acetyl-cytidine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-isobutyryl-guanosine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-uridine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite.

[0637] The 2'-F-phosphoramidites used were as follows: 5'-dimethoxytrityl-N-benzoyl-deoxyadenosine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-dimethoxytrityl-N-acetyl-deoxycytidine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-dimethoxytrityl-N-isobutyryl-deoxyguanosine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, and 5'-dimethoxytrityl-deoxythymidine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite.

[0638] The inverted abasic phosphoramidite, 3-O-dimethoxytrityl-2-deoxyribose-5-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, was purchased from Chemgenes (ANP-1422) or Hongene (OP-040).

[0639] All phosphoramidites except 2'-O-methyl-uridine phosphoramidite dissolved in DMF / MeCN (1:4, volume / volume) were dissolved in anhydrous acetonitrile (Honeywell Research Chemicals) at a concentration of 0.05 M. Iodine (DNAchem) at 0.02 M in acetonitrile / pyridine / H2O was used as the oxidizing reagent. Thiolation of phosphorothioate linkages was carried out using 0.2 M PADS (TCI) in acetonitrile / pyridine 1:1 volume / volume. 5-Ethylthiotetrazole (ETT) at 0.25 M mM in acetonitrile was used as the activator solution.

[0640] In each cycle, the DMT was removed with the deblock solution, 3% TCA (DNAchem) in DCM.

[0641] For the case of the chain synthesized with universal CPG, the coupling was carried out for 130 seconds using 8 equivalents of amidite. The oxidation time was 47 seconds and the thiolation time was 210 seconds.

[0642] For the case of the chain synthesized with 3’-PT-amino-modified substance C6 CPG, the coupling was carried out for 2 * 150 seconds using 8 equivalents of amidite. The oxidation time was 47 seconds and the thiolation time was 250 seconds.

[0643] At the end of the synthesis, the oligonucleotide was cleaved from the solid support using a 4:1 (volume / volume) NH4OH:EtOH solution (TCI) at 45 °C for 20 hours. The solid support was then filtered, the filter was washed well with H2O, and the volume of the mixed solution was reduced by evaporation under reduced pressure.

[0644] The oligonucleotide was treated by ethanol precipitation from 1M sodium acetate to form the sodium salt.

[0645] The single-stranded oligonucleotide was purified by IP-RP HPLC on an Xbridge BEH C18 5μm, 130Å, 19×150mm (Waters) column using a gradient of B in A. Mobile phase A: 240 mM HFIP, 7 mM TEA, and 5% methanol in water; mobile phase B: 240 mM HFIP, 7 mM TEA in methanol.

[0646] The single-stranded purity and identity were evaluated by UPLC / MS ESI- on an Xbridge BEH C18 2.5μm, 3×50mm (Waters) column using a gradient of B in A. Mobile phase A: 100 mM HFIP, 5 mM TEA in water; mobile phase B: 20% of mobile phase A: 80% acetonitrile (volume / volume).

[0647] The sense strand was conjugated according to the protocol provided in any of Examples 1, 3, or 5.

[0648] Subsequently, the sense strand and the antisense strand were annealed in water to form the final double-stranded siRNA, and the double-strand purity was evaluated by size-exclusion chromatography.

Example

[0649] Nucleic acid sequence The siRNA oligonucleotides according to the present invention target HCII. The full-length DNA sequence of the HCII target is as follows (SEQ ID NO: 1): ACCTTGGCCTCCCAAAGTGTTGGGATTACAGGTGTAAGCCACCATGCCTGGTCTGGAAAGCATTTAGATCACTGCTTGGTTTTAGCAAGAACTAGGAAAGGTTGTCACATTATTCTCAATCTAAGAGAGTACATAAGCCAGGCC

[0650] Table 1 below provides the oligonucleoside mRNA target sequences of HCII, along with the corresponding positions in transcript NM_000185.4. It should be understood that SEQ ID NOs: 2 to 121 relate to the human (Homo sapiens) mRNA sequence.

[0651] [Table 15] JPEG2025524134000132.jpg248163JPEG2025524134000133.jpg248163JPEG2025524134000134.jpg148166

[0652] Table 2 provides the unmodified first (antisense) strand sequences and the corresponding unmodified second (sense) strand sequences of the siRNA oligonucleosides according to the present invention, along with the corresponding positions in the entire gene sequence of SEQ ID NO: 1 below.

[0653] [Table 16] JPEG2025524134000136.jpg248165JPEG2025524134000137.jpg248165JPEG2025524134000138.jpg248165JPEG2025524134000139.jpg248165JPEG2025524134000140.jpg248165JPEG2025524134000141.jpg138170

[0654] Table 3 provides the modified first (antisense) sequences of the siRNA oligonucleosides according to the present invention below, together with the corresponding unmodified first (antisense) sequences.

[0655]

Table 17

[0656] Table 4 provides the modified second (sense) sequences of the siRNA oligonucleosides according to the present invention below, together with the corresponding unmodified second (sense) sequences.

[0657]

Table 18

[0658] Some of the sequences of the modified second strand shown in Table 4 above contain the preferred 5’iaia motif. However, it should also be understood that the scope of these modified second strand sequences further includes the Me / F modified second strand in the absence of the 5’iaia motif.

[0659] Table 5 identifies duplexes having duplex IDs that reference the modified antisense and sense IDs of Tables 3 and 4 above.

[0660]

Table 19

[0661] For the duplexes in Table 5: ETXM116 - ETXM215, ETXM236 - ETXM315, ETXM1135 - ETXM1182, and ETXM1217 - 1234 have a double-stranded structure according to Figure 8a and have a 2-nucleoside overhang at the 3'-end of the antisense.

[0662] ETXM216 - ETXM235 have a double-stranded structure according to Figure 8b, that is, a 19-mer blunt-end construct.

[0663] The definitions provided in the above table: A - Adenosine C - Cytidine G - Guanosine T - Thymidine m - 2'-O-methyl f - 2'-fluoro s - phosphorothioate bond o - thermolabile nucleoside ia - inverted abasic nucleoside

Example

[0664] Inhibition screening of HCII expression in human Huh7 cells Huh7 cells (a human hepatocyte-derived cell line, obtained from the JCRB cell bank) were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% FBS at 37 °C in a 5% CO2 atmosphere. siRNA duplexes targeting HCII mRNA or negative control siRNA (siRNA control, sense strand 5'-UUCUCCGAACGUGUCACGUTT-3' (SEQ ID NO: 788), antisense strand 5'-ACGUGACACGUUCGGAGAATT-3' (SEQ ID NO: 787)) were transfected into the cells at final duplex concentrations of 1 nM and 0.1 nM. Transfection was performed by adding 9.7 μL of Opti-MEM (ThermoFisher) + 0.3 μL of Lipofectamine RNAiMAX (ThermoFisher) to 10 μL of each siRNA duplex. The mixture was incubated at room temperature for 15 minutes and then added to 100 μL of complete growth medium containing 20,000 Huh7 cells. The cells were incubated at 37 °C / 5% CO2 for 24 hours before purifying total RNA using the RNeasy 96 kit (Qiagen). Each duplex was tested by transfection in duplicate wells in two independent experiments.

[0665] cDNA synthesis was performed using the FastQuant RT (with gDNase) kit (Tiangen). Real-time quantitative PCR (qPCR) was performed using the FastStart Universal Probe Master kit (Roche) with primers specific for human HCII (Hs00164821_m1) and human GAPDH (Hs02786624_g1) on an ABI Prism 7900HT or ABI QuantStudio 7.

[0666] qPCR was performed in duplicate on cDNA derived from each well, and the average Ct was calculated. Relative HCII expression was calculated from the average Ct values using the comparative Ct (ΔΔCt) method and normalized to GAPDH and to untreated cells. Based on the results of the primary screening, siRNA duplexes showing excellent activity were selected for dose-response follow-up. The results are shown in Figure 9. The sequences of the RNAi molecules are shown in Table 5.

Example

[0667] Dose-response for inhibition of HCII expression in human Huh7 cells Huh7 cells (a human hepatocyte-derived cell line obtained from the JCRB cell bank) were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% FBS at 37 °C in a 5% CO2 atmosphere. siRNA duplexes targeting HCII mRNA or negative control siRNA (siRNA control, sense strand 5'-UUCUCCGAACGUGUCACGUTT-3' (SEQ ID NO: 788), antisense strand 5'-ACGUGACACGUUCGGAGAATT-3' (SEQ ID NO: 787)) were transfected into cells using 10×3-fold serial dilutions over a final duplex concentration range of 20 nM to 1 pM. Transfection was performed by adding 9.7 μL of Opti-MEM (ThermoFisher) + 0.3 μL of Lipofectamine RNAiMAX (ThermoFisher) to 10 μL of each siRNA duplex. The mixture was incubated at room temperature for 15 minutes and then added to 100 μL of complete growth medium containing 20,000 Huh7 cells. Cells were incubated at 37 °C / 5% CO2 for 24 hours before total RNA was purified using the RNeasy 96 kit (Qiagen). Each duplex was tested by transfection in duplicate wells in a single experiment.

[0668] cDNA synthesis was performed using the FastQuant RT (gDNase Plus) Kit (Tiangen). Real-time quantitative PCR (qPCR) was performed using the FastStart Universal Probe Master Kit (Roche) with primers specific for human HCII (Hs00164821_m1) and human GAPDH (Hs02786624_g1) on an ABI Prism 7900HT or an ABI QuantStudio 7.

[0669] qPCR was performed in duplicate on cDNA from each well, and the average Ct was calculated. Relative HCII expression was calculated from the average Ct values using the comparative Ct (ΔΔCt) method and normalized to GAPDH and to untreated cells. The maximum percent inhibition and IC50 values of HCII expression were calculated using a four-parameter (variable slope) model using GraphPad Prism9. The results are shown in Figure 9. The sequences of the RNAi molecules are shown in the relevant tables herein.

[0670]

Table 20

[0671]

Table 21

[0672] The present invention is not intended to be limited in scope to the specific disclosed embodiments provided, for example, to illustrate various aspects of the present invention. Various modifications to the compositions and methods described will become apparent from the description and teachings herein. Such variations can be made without departing from the true scope and spirit of the present disclosure and are intended to be within the scope of the present disclosure.

[0673] If there is any ambiguity between the sequences provided herein and those of the accompanying Sequence Listing, the sequences provided herein shall be considered to be the correct sequences.

Claims

1. A nucleic acid for inhibiting HCl expression, comprising a double-stranded region including a first strand and a second strand at least partially complementary to the first strand, wherein the first strand is (i) It is at least partially complementary to the portion of RNA transcribed from the HCII gene, (ii) A sequence of at least 17 consecutive nucleosides that differ by 0 or 1 nucleosides from any one of the sequences of the first chain listed in Table 2, Nucleic acid.

2. A nucleic acid for inhibiting HCl expression, comprising a double-stranded region including a first strand and a second strand at least partially complementary to the first strand, wherein the first strand is (i) It is at least partially complementary to the portion of RNA transcribed from the HCII gene, (ii) A sequence of at least 17 nucleosides that differ by 0 or 1 nucleosides from any one of the modification sequences of the first chain listed in Table 3, Nucleic acid.

3. The nucleic acid according to claim 1, wherein the second strand comprises a nucleoside sequence of at least 17 consecutive nucleosides that differ by 0 or 1 nucleosides from any one of the second strand sequences listed in Table 2, and the second strand has a region that is at least 85% complementary to the first strand across the 17 consecutive nucleosides.

4. The nucleic acid according to claim 2, wherein the second strand comprises a nucleoside sequence of at least 17 consecutive nucleosides that differ by 0 or 1 nucleosides from any one of the modification sequences of the second strand listed in Table 4, and the second strand has a region that is at least 85% complementary to the first strand across the 17 consecutive nucleosides.

5. The nucleic acid according to claim 1, wherein the first chain comprises any one of the sequences of the first chain listed in Table 2.

6. The nucleic acid according to claim 2, wherein the first chain comprises any one of the modification sequences of the first chain listed in Table 3.

7. The nucleic acid according to claim 3, wherein the second chain comprises any one of the second chain sequences listed in Table 2.

8. The nucleic acid according to claim 4, wherein the second chain comprises any one of the modification sequences of the second chain listed in Table 4.

9. The nucleic acid according to claim 5, wherein the first strand includes one of the following sequences: SEQ ID NO: 140, SEQ ID NO: 152, SEQ ID NO: 136, SEQ ID NO: 138, SEQ ID NO: 139, SEQ ID NO: 151, SEQ ID NO: 162, SEQ ID NO: 166, SEQ ID NO: 186, SEQ ID NO: 188, SEQ ID NO: 194, SEQ ID NO: 224, SEQ ID NO: 235, SEQ ID NO: 236, SEQ ID NO: 238, SEQ ID NO: 239, SEQ ID NO: 240, SEQ ID NO: 124, SEQ ID NO:

135.

10. The nucleic acid according to claim 6, wherein the first chain includes one of the following sequences: SEQ ID NO: 560, SEQ ID NO: 392, SEQ ID NO: 376, SEQ ID NO: 378, SEQ ID NO: 379, SEQ ID NO: 391, SEQ ID NO: 402, SEQ ID NO: 406, SEQ ID NO: 426, SEQ ID NO: 428, SEQ ID NO: 434, SEQ ID NO: 464, SEQ ID NO: 475, SEQ ID NO: 476, SEQ ID NO: 478, SEQ ID NO: 479, SEQ ID NO: 480, SEQ ID NO: 499, SEQ ID NO: 504, SEQ ID NO: 518, SEQ ID NO: 519, SEQ ID NO: 539, SEQ ID NO: 555, SEQ ID NO:

559.

11. The nucleic acid according to claim 7, wherein the second strand includes one of the following sequences: SEQ ID NO: 260, SEQ ID NO: 272, SEQ ID NO: 256, SEQ ID NO: 258, SEQ ID NO: 259, SEQ ID NO: 271, SEQ ID NO: 282, SEQ ID NO: 286, SEQ ID NO: 306, SEQ ID NO: 308, SEQ ID NO: 314, SEQ ID NO: 344, SEQ ID NO: 355, SEQ ID NO: 356, SEQ ID NO: 358, SEQ ID NO: 359, SEQ ID NO: 360, SEQ ID NO: 244, SEQ ID NO:

255.

12. The nucleic acid according to claim 8, wherein the second chain includes one of the following sequences: SEQ ID NO: 760, SEQ ID NO: 592, SEQ ID NO: 576, SEQ ID NO: 578, SEQ ID NO: 579, SEQ ID NO: 591, SEQ ID NO: 602, SEQ ID NO: 606, SEQ ID NO: 626, SEQ ID NO: 628, SEQ ID NO: 634, SEQ ID NO: 664, SEQ ID NO: 675, SEQ ID NO: 676, SEQ ID NO: 678, SEQ ID NO: 679, SEQ ID NO: 680, SEQ ID NO: 699, SEQ ID NO: 704, SEQ ID NO: 718, SEQ ID NO: 719, SEQ ID NO: 739, SEQ ID NO: 755, SEQ ID NO:

759.

13. The following are the first and second sequences: Table 1 The nucleic acids according to claims 1 and 3, comprising first and second strands which contain, consist of, or are essentially made from a nucleoside sequence that differs from any one of the following by 0 or 1 nucleosides.

14. The following are the first and second sequences: Table 2 The nucleic acids according to claims 2 and 4, comprising first and second strands which contain, consist of, or are essentially made from a nucleoside sequence that differs from any one of the following by 0 or 1 nucleosides.

15. The following are the first and second sequences: Table 3 Table 4 or Table 5 The nucleic acid according to claim 13, comprising first and second strands which contain, consist of, or are essentially made from a nucleoside sequence that differs from any one of the following by 0 or 1 nucleosides.

16. The following are the first and second sequences: Table 6 Table 7 Table 8 Table 9 or Table 10 The nucleic acid according to claim 14, comprising first and second strands which contain, consist of, or are essentially made from a nucleoside sequence that differs from any one of the following by 0 or 1 nucleoside.

17. The nucleic acid according to any one of claims 1 to 12, which is an siRNA oligonucleoside.

18. The nucleic acid according to any one of claims 1 to 12, wherein one or more nucleosides of the first and / or second chains are modified to form a modified nucleoside.

19. The nucleic acid according to any one of claims 1 to 12, further comprising one or more debased nucleosides.

20. The nucleic acid according to claim 19, wherein one or more debasic nucleosides are located in the terminal region of the second chain, and / or at least one debasic nucleoside is linked to an adjacent base nucleoside via an inverse nucleoside linkage.

21. The nucleic acid according to any one of claims 1 to 12, comprising one or more phosphorothioate nucleoside linkages.

22. A pharmaceutical composition comprising the nucleic acid according to any one of claims 1 to 12, in combination with a pharmaceutically acceptable excipient or carrier.

23. A pharmaceutical composition according to claim 22 for use in therapeutic purposes.

24. The pharmaceutical composition according to claim 22, for use in the prevention or treatment of diseases associated with impaired hemostasis.

25. The pharmaceutical composition according to claim 24, wherein the disease associated with the impaired hemostasis is hemophilia.

Images