Gene Regulatory Elements and Uses Thereof

JP2025525378A5Pending Publication Date: 2026-07-01REGEL THERAPEUTICS INC

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
REGEL THERAPEUTICS INC
Filing Date
2023-06-21
Publication Date
2026-07-01

AI Technical Summary

Technical Problem

Existing gene therapy technologies face challenges in selectively targeting therapeutic interventions to specific cell populations in the central nervous system (CNS) to minimize off-target effects and enhance efficacy.

Method used

The use of genetic regulatory elements and vectors, such as those comprising specific nucleotide sequences (SEQ ID NOs: 1-13) and promoters, to selectively express heterologous nucleotide sequences in neurons of the CNS, reducing expression in non-neuronal cells like glial cells and endothelial cells.

Benefits of technology

Enhances expression specificity and efficacy of gene therapy in neurons of the CNS, minimizing off-target effects in other organs like liver, heart, and muscle.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

Provided herein are regulatory elements that can restrict expression of heterologous nucleotide sequences to specific neuronal populations and regions of the central nervous system (CNS). Also provided herein are vectors containing such regulatory elements, as well as the use of such regulatory elements and vectors for selective expression in the CNS.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 63 / 354,110, filed June 21, 2022, which is incorporated herein by reference in its entirety for all purposes.

[0002] Electronic Sequence Listing Reference The contents of the electronic sequence listing (REGT_002_01WO_SeqList_ST26.xml; size: 31,745 bytes, created on June 14, 2023) are incorporated herein by reference in their entirety.

[0003] Technical Field The present disclosure relates to genetic regulatory elements and their uses for expressing heterologous nucleotide sequences. [Background technology]

[0004] background Gene therapy has the potential to revolutionize the treatment of genetic diseases. However, the clinical application of this promising technology requires overcoming significant technical limitations. Among these is the need to restrict therapeutic intervention to cell populations specifically affected by the disease in order to reduce off-target effects and increase therapeutic efficacy. Summary of the Invention

[0005] overview The present specification provides (i) a heterologous nucleotide sequence, and (ii) a vector comprising: (a) the nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (b) the reverse nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (c) the complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (d) the reverse complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; or (e) a nucleotide sequence comprising one or more regions of about 100 base pairs (bp) or more having at least 75% or more sequence identity to any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11. In some embodiments, the vector further comprises a promoter.

[0006] In some embodiments, the vector comprises, in 5' to 3' order, (i) a promoter; (ii) (a) a nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (b) the reverse nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (c) the complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (d) the reverse complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; or (e) a nucleotide sequence comprising one or more regions of about 100 bp or more having at least 75% or more sequence identity to any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; and (iii) a heterologous nucleotide sequence.

[0007] In some embodiments, the vector comprises, in 5' to 3' order, (i) (a) the nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (b) the reverse nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (c) the complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (d) the reverse complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; or (e) a nucleotide sequence comprising one or more regions of about 100 bp or more having at least 75% or more sequence identity to any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; and (ii) a promoter; and (iii) a heterologous nucleotide sequence.

[0008] In some embodiments, the vector comprises, in 5' to 3' order, (i) a promoter; (ii) a heterologous nucleotide sequence; and (iii) (a) the nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (b) the reverse nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (c) the complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (d) the reverse complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; or (e) a nucleotide sequence comprising one or more regions of about 100 bp or more having at least 75% or more sequence identity to any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11.

[0009] In some embodiments, the vector is a non-viral vector. In some embodiments, the non-viral vector is a plasmid vector.

[0010] In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is an adeno-associated virus (AAV) vector or an adenovirus vector.

[0011] In some embodiments, the AAV vector comprises a 5' AAV inverted terminal repeat (ITR) and a 3' AAV ITR flanked by heterologous nucleotide sequences, a promoter, and (a) the nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (b) the reverse nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (c) the complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (d) the reverse complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; or (e) a nucleotide sequence comprising one or more regions of about 100 bp or more having at least 75% or more sequence identity to any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11.

[0012] In some embodiments, the AAV vector comprises, in 5' to 3' order: (i) 5' AAV (ii) a promoter; (iii) (a) the nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (b) the reverse nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (c) the complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (d) the reverse complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; or (e) a nucleotide sequence comprising one or more regions of about 100 bp or more having at least 75% or more sequence identity to any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (iv) a heterologous nucleotide sequence; and (v) a 3' AAV ITR.

[0013] In some embodiments, the AAV vector comprises, in 5' to 3' order, (i) a 5' AAV ITR; (ii) (a) the nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (b) the reverse nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (c) the complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (d) the reverse complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; or (e) a nucleotide sequence comprising a region of about 100 bp or more having at least 75% or more sequence identity to any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (iii) a promoter; (iv) a heterologous nucleotide sequence; and (v) a 3' AAV ITR. Includes ITR.

[0014] In some embodiments, the AAV vector comprises, in 5' to 3' order: (i) 5' AAV (ii) a promoter; (iii) a heterologous nucleotide sequence; (iv) comprising: (a) the nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (b) the reverse nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (c) the complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (d) the reverse complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; or (e) a nucleotide sequence comprising one or more regions of about 100 bp or more having at least 75% or more sequence identity to any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; and (v) a 3' AAV ITR.

[0015] In some embodiments, the promoter comprises an RNA-polymerase II binding site, a TATA box, a TF2B recognition element (BRE), a motif 10 element (MTE), or a downstream promoter element (DPE).

[0016] In some embodiments, the promoter is a minimal promoter. In some embodiments, the minimal promoter is a human beta globin minimal promoter.

[0017] In some embodiments, the vector further comprises an enhancer. In some embodiments, the vector further comprises or encodes a polyadenylation signal sequence. In some embodiments, the vector further comprises or encodes a Kozak sequence. In some embodiments, the vector further comprises or encodes a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), a hepatitis B virus post-transcriptional regulatory element, an RNA transport element (RTE), a WPRE3, or a wsl3 regulatory element. In some embodiments, the vector further comprises an artificial intron. In some embodiments, the vector further encodes a 2A self-cleaving peptide. In some embodiments, the vector further comprises or encodes an internal ribosome entry site (IRES).

[0018] In some embodiments, the heterologous nucleotide sequence encodes a protein.In some embodiments, the heterologous nucleotide sequence encodes a gene silencing nucleic acid.In some embodiments, the heterologous nucleotide sequence encodes a CRISPR-associated protein.In some embodiments, the heterologous nucleotide sequence further encodes a guide RNA (gRNA).

[0019] The present specification provides a viral particle comprising the vector disclosed herein. In some embodiments, the viral particle is a recombinant adenovirus particle. In some embodiments, the viral particle is a recombinant AAV (rAAV) particle. In some embodiments, the rAAV particle is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh.8, AAVrh.10, AAVrh32.33, AAVrh.74, AAVhu.68, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, snake AAV, and avian AAV. The particles are bearded dragon AAV, AAV2i8, AAV2g9, AAV-LK03, AAV7m8, AAVAnc80, TM-AAV6, AAV-PHP.A, AAV-PHP.B, AAV-PHP.S, AAV-PHP.eB, AAV-CAP.B10, AAV2-r3.45, AAV2-LSS, AAV2PFG, AAV2-PPS, AAV2-TLH, or AAV2-GMN serotype particles.

[0020] The present specification provides a population of viral particles comprising a plurality of the viral particles disclosed herein.

[0021] The present specification provides a pharmaceutical composition comprising a vector, viral particle, or population disclosed herein and a pharmaceutically acceptable carrier, vehicle, or diluent.

[0022] The present specification provides a nanoparticle comprising a vector disclosed herein.

[0023] The present specification provides a cell comprising the vector or viral particle disclosed herein. In some embodiments, the cell is a mammalian cell or an insect cell.

[0024] The present specification provides a method for producing rAAV particles, the method comprising (i) culturing the cells disclosed herein under conditions capable of packaging the rAAV particles, and (ii) harvesting the cultured host cells or medium for recovery of the rAAV particles.

[0025] The present specification provides a method for selectively expressing a heterologous nucleotide sequence in neurons of the central nervous system (CNS) in a subject in need thereof, the method comprising administering to the subject a vector, viral particle, population, pharmaceutical composition, or nanoparticle disclosed herein.

[0026] In some embodiments of the methods provided herein, expression of the heterologous nucleotide sequence is enhanced in specific regions of the CNS. In some embodiments, expression of the heterologous nucleotide sequence is enhanced in neurons of one or more of the forebrain, cerebellum, and spinal cord. In some embodiments, expression of the heterologous nucleotide sequence is enhanced in neurons of the forebrain and cerebellum. In some embodiments, expression of the heterologous nucleotide sequence is enhanced in neurons of the forebrain. In some embodiments, expression of the heterologous nucleotide sequence is enhanced in neurons of the cerebellum. In some embodiments, expression of the heterologous nucleotide sequence is enhanced in neurons of the cerebellum and hippocampus. In some embodiments, expression of the heterologous nucleotide sequence is enhanced in neurons of the spinal cord.

[0027] In some embodiments of the methods provided herein, the vector comprises the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 10, and expression of the heterologous nucleotide sequence is enhanced in neurons of the CNS.

[0028] In some embodiments of the methods provided herein, the vector comprises the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 9, and expression of the heterologous nucleotide sequence is enhanced in neurons of the forebrain and cerebellum.

[0029] In some embodiments of the methods provided herein, the vector comprises the nucleotide sequence of SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:11, and expression of the heterologous nucleotide sequence is enhanced in neurons of the forebrain.

[0030] In some embodiments of the methods provided herein, the vector comprises the nucleotide sequence of SEQ ID NO: 6, and expression of the heterologous nucleotide sequence is enhanced in neurons of the cerebellum and hippocampus.

[0031] In some embodiments of the methods provided herein, the vector, viral particle, population, pharmaceutical composition, or nanoparticle is administered to the subject intravenously. In some embodiments of the methods provided herein, the vector, viral particle, population, pharmaceutical composition, or nanoparticle is administered to the subject via injection into the CNS. [Brief explanation of the drawings]

[0032] [Figure 1A] Figure 1A illustrates a schematic and representative images of transgene expression profiles across organs. The expression profiles of regulatory elements CNS2_V4 (SEQ ID NO: 1), CNS2_V3 (SEQ ID NO: 2), CNS2_V7 (SEQ ID NO: 4), and CNS2_V10 (SEQ ID NO: 6) (top to bottom) are shown in the indicated organs after systemic injection of recombinant adeno-associated virus (rAAV) particles (with AAV-PHP.eB capsids) containing the regulatory elements into adult mice after 3 weeks of incubation. Representative images show viral reporter expression. n = 3 mice per construct. Organs shown from left to right are sagittal IHC (immunohistochemistry); cortex; hippocampus; cerebellum; spinal cord; DRG (dorsal root ganglion); liver; heart; muscle; and lung.

[0033] [Figure 1B]Figure 1B illustrates a schematic and representative images of transgene expression profiles across organs. The expression profiles of regulatory elements (CNS2_V4 (SEQ ID NO: 1), CNS2_V4.1 (SEQ ID NO: 10), CNS2_V3 (SEQ ID NO: 2), CNS2_V3.3 (SEQ ID NO: 9), CNS2_V7 (SEQ ID NO: 4), CNS2_V7.1 (SEQ ID NO: 11), CNS2_V11 (SEQ ID NO: 5), and CNS2_V10 (SEQ ID NO: 6) are shown (top to bottom) in the indicated organs after systemic injection of rAAV particles (with AAV-PHP.eB capsids) containing regulatory elements into adult mice after 3 weeks of incubation. Representative images show viral reporter expression. N = at least 3 mice per construct. Organs shown from left to right are sagittal IHC (immunohistochemistry); cortex; hippocampus; striatum; cerebellum; spinal cord; DRG (dorsal root ganglion); liver; heart; muscle; and lung.

[0034] [Figure 2] Figures 2A-2C illustrate the results from quantitative analysis of the intensity, specificity, and sensitivity of transgene expression using regulatory elements CNS2_V3 (V3) (SEQ ID NO: 2), CNS2_V4 (V4) (SEQ ID NO: 1), and CNS2_V7 (V7) (SEQ ID NO: 4). Results for neurons in the cortex (expressing the pan-neuronal marker NeuN) correspond to the data shown in Figure 1A. Figure 2A illustrates the analysis of specificity to neurons. Figure 2B illustrates the analysis of sensitivity to neurons. Figure 2C illustrates the analysis of sensitivity by cortical layer.

[0035] [Figure 3A]Figures 3A-3D illustrate the results from quantitative analysis of the intensity, specificity, and sensitivity of transgene expression using regulatory elements CNS2_V4 (SEQ ID NO: 1), CNS2_V4.1 (SEQ ID NO: 10), CNS2_V3 (SEQ ID NO: 2), CNS2_V3.3 (SEQ ID NO: 9), CNS2_V7 (SEQ ID NO: 4), and CNS2_V7.1 (SEQ ID NO: 11). Results for neurons in relevant regions (expressing the pan-neuronal marker NeuN) correspond to the data shown in Figure 1B. Figure 3A illustrates the analysis of specificity for neurons within the somatosensory cortex (ssctx). [Figure 3B] FIG. 3B illustrates the results of an analysis of sensitivity for neurons within the sexensory cortex (ssctx). [Figure 3C] FIG. 3C illustrates the analysis of sensitivity by cortical layer. [Figure 3D] FIG. 3D illustrates the results of the analysis of sensitivity to neurons within the striatum.

[0036] [Figure 4] Figures 4A-4B illustrate results from a study of transgene expression after intracerebroventricular (ICV) injection of rAAV particles (with AAV9 capsids) containing the regulatory element CNS2_V4.1 (SEQ ID NO: 10) into postnatal day 1 (PND1) mice after 4 weeks of incubation. Figure 4A illustrates images of fluorescent reporter (dTomato) expression driven by CNS2_V4.1 in the brain. Figure 4B illustrates analysis of dCas9 transgene expression driven by CNS2_V4.1 as detected by qPCR. DETAILED DESCRIPTION OF THE INVENTION

[0037] Detailed Description The present disclosure provides regulatory elements that can selectively express heterologous nucleotide sequences in specific neuronal populations and regions of the central nervous system (CNS) while reducing or preventing expression of the heterologous nucleotide sequence in other organs. The regulatory elements enhance expression of the heterologous nucleotide sequence in neurons and reduce or prevent expression in other cell populations (e.g., glial cells, microglial cells, and endothelial cells). When incorporated into DNA-based expression vectors, the regulatory elements can be used to reduce off-target effects and increase the efficacy of gene therapy. These regulatory elements have shown evidence of broad applicability, with the same expression profiles observed when different rAAV serotypes were used to deliver the same regulatory element and express different transgenes in mice of different ages.

[0038] Regulatory Elements and Vectors The present disclosure provides genetic regulatory elements for selectively expressing heterologous nucleotide sequences in neurons of the CNS. When incorporated into a DNA-based expression vector, these regulatory elements can restrict the expression of heterologous nucleotide sequences to neurons of the CNS. In some embodiments, the regulatory elements restrict the expression of heterologous nucleotide sequences to neurons of the CNS with at least about 75%, about 80%, about 85%, about 90%, about 95%, or about 99% specificity for this cell type. In some embodiments, the regulatory elements restrict the expression of heterologous nucleotide sequences to neurons of the CNS with at least about 75%, about 80%, about 85%, about 90%, about 95%, or about 99% selectivity for this cell type.

[0039] In some embodiments, the regulatory elements restrict expression of the heterologous nucleotide sequence to neurons of the forebrain and cerebellum with at least about 75%, about 80%, about 85%, about 90%, about 95%, or about 99% specificity for that cell type. In some embodiments, the regulatory elements restrict expression of the heterologous nucleotide sequence to neurons of the forebrain and cerebellum with at least about 75%, about 80%, about 85%, about 90%, about 95%, or about 99% selectivity for that cell type.

[0040] In some embodiments, the regulatory elements restrict expression of the heterologous nucleotide sequence to neurons of the forebrain with at least about 75%, about 80%, about 85%, about 90%, about 95%, or about 99% specificity for that cell type. In some embodiments, the regulatory elements restrict expression of the heterologous nucleotide sequence to neurons of the forebrain with at least about 75%, about 80%, about 85%, about 90%, about 95%, or about 99% selectivity for that cell type.

[0041] In some embodiments, the regulatory elements restrict expression of the heterologous nucleotide sequence to neurons of the cerebellum with at least about 75%, about 80%, about 85%, about 90%, about 95%, or about 99% specificity for that cell type. In some embodiments, the regulatory elements restrict expression of the heterologous nucleotide sequence to neurons of the cerebellum with at least about 75%, about 80%, about 85%, about 90%, about 95%, or about 99% selectivity for that cell type.

[0042] In some embodiments, the regulatory elements restrict expression of the heterologous nucleotide sequence to neurons of the cerebellum and neurogenic niche with at least about 75%, about 80%, about 85%, about 90%, about 95%, or about 99% specificity for this cell type. In some embodiments, the regulatory elements restrict expression of the heterologous nucleotide sequence to neurons of the cerebellum and neurogenic niche with at least about 75%, about 80%, about 85%, about 90%, about 95%, or about 99% selectivity for this cell type.

[0043] In some embodiments, the regulatory element expresses the heterologous nucleotide sequence in non-neuronal cells of the CNS (e.g., glial cells, microglial cells, or endothelial cells) with a specificity of up to about 25%, about 20%, about 15%, about 10%, about 5%, or about 1% for that cell type. In some embodiments, the regulatory element expresses the heterologous nucleotide sequence in non-neuronal cells of the CNS (e.g., glial cells, microglial cells, or endothelial cells) with a selectivity of up to about 25%, about 20%, about 15%, about 10%, about 5%, or about 1% for that cell type.

[0044] In some embodiments, the regulatory elements do not express the heterologous nucleotide sequence in one or more of the liver, heart, muscle, and lung.

[0045] The present specification provides a genetic regulatory element comprising the nucleotide sequence of any of SEQ ID NOs: 1 to 13, the reverse nucleotide sequence of any of SEQ ID NOs: 1 to 13, the complementary nucleotide sequence of any of SEQ ID NOs: 1 to 13, or the reverse complementary sequence of any of SEQ ID NOs: 1 to 13.

[0046] The present specification provides a gene regulatory element comprising the nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11, the reverse nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11, the complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11, or the reverse complement sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11.

[0047] The present specification provides a vector (e.g., a DNA vector) comprising (i) a heterologous nucleotide sequence, and (ii) a nucleotide sequence of any of SEQ ID NOs: 1 to 13, the reverse nucleotide sequence of any of SEQ ID NOs: 1 to 13, the complementary nucleotide sequence of any of SEQ ID NOs: 1 to 13, or the reverse complementary sequence of any of SEQ ID NOs: 1 to 13.

[0048] The present specification provides a vector (e.g., a DNA vector) comprising: (i) a heterologous nucleotide sequence; and (ii) the nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; the reverse nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; the complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; or the reverse complement sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11.

[0049] In some embodiments, the vector comprises (i) a heterologous nucleotide sequence, and (ii) a nucleotide sequence comprising one or more regions of about 100 base pairs (bp) or more having at least 75%, 80%, 85%, 90%, 95%, 97%, or 99% or more sequence identity to any of SEQ ID NOs: 1-13.

[0050] In some embodiments, the vector comprises (i) a heterologous nucleotide sequence, and (ii) a nucleotide sequence comprising one or more regions of about 100 base pairs (bp) or more having at least 75%, 80%, 85%, 90%, 95%, 97%, or 99% or more sequence identity to any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11.

[0051] In some embodiments, the vector comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 of the regulatory elements disclosed herein. In some embodiments, the vector comprises 2, 3, 4, 5, 6, 7, or 8 of the regulatory elements CNS2_V4 (SEQ ID NO: 1), CNS2_V4.1 (SEQ ID NO: 10), CNS2_V3 (SEQ ID NO: 2), CNS2_V3.3 (SEQ ID NO: 9), CNS2_V7 (SEQ ID NO: 4), CNS2_V7.1 (SEQ ID NO: 11), CNS2_V11 (SEQ ID NO: 5), and CNS2_V10 (SEQ ID NO: 6).

[0052] In some embodiments, the vectors provided herein further comprise a promoter. In some embodiments, the promoter is a minimal promoter. In some embodiments, the minimal promoter comprises one or more short sequences capable of promoting transcription. In some embodiments, the promoter comprises an RNA polymerase II binding site, a TATA box, a TF2B recognition element (BRE), a motif 10 element (MTE), or a downstream promoter element (DPE). The TATA transcriptional regulatory activation site is described, for example, in Francois et al., (2005) J. Virol. 79(17):11082-11094.

[0053] In some embodiments, the promoter is a human beta globin minimal promoter.

[0054] In some embodiments, the promoter is recognized by RNA polymerase II. In some embodiments, the promoter is recognized by RNA polymerase III. In some embodiments, the promoter is a human U6 (hU6) promoter, a mouse U6 promoter, or a human H1 promoter.

[0055] In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter is an inducible promoter. In some embodiments, the promoter is a tissue-specific promoter. In some embodiments, the promoter is an avian beta-actin (CBA) promoter, a GUSB240 promoter, a GUSB379 promoter, a HSVTK promoter, a CMV promoter, an SV40 early promoter, an SV40 late promoter, a metallothionein promoter, a mouse mammary tumor virus (MMTV) promoter, a Rous sarcoma virus (RSV) promoter, a polyhedrin promoter, an EF-1α promoter, a dihydrofolate reductase (DHFR) promoter, or a phosphoglycerol kinase (PGK) promoter. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 2]

[0056] In some embodiments, the vectors provided herein comprise: (a) a promoter; (b) a nucleotide sequence of any of SEQ ID NOs: 1-13; the reverse nucleotide sequence of any of SEQ ID NOs: 1-13; the complementary nucleotide sequence of any of SEQ ID NOs: 1-13; the reverse complementary sequence of any of SEQ ID NOs: 1-13; or a nucleotide sequence comprising one or more regions of about 100 bp or more having at least 75% or more sequence identity to any of SEQ ID NOs: 1-13; and (c) a heterologous nucleotide sequence.

[0057] In some embodiments, the vectors provided herein comprise: (a) a promoter; (b) a nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; the reverse nucleotide sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; the complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; the reverse complement of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; or a nucleotide sequence comprising one or more regions of about 100 bp or more having at least 75% or more sequence identity to any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; and (c) a heterologous nucleotide sequence.

[0058] In some embodiments, the vectors provided herein comprise, in 5' to 3' order, (i) a promoter; (ii) (a) a nucleotide sequence of any of SEQ ID NOs: 1-13; (b) the reverse nucleotide sequence of any of SEQ ID NOs: 1-13; (c) the complementary nucleotide sequence of any of SEQ ID NOs: 1-13; (d) the reverse complementary nucleotide sequence of any of SEQ ID NOs: 1-13; or (e) a nucleotide sequence comprising one or more regions of about 100 bp or more having at least 75% or more sequence identity to any of SEQ ID NOs: 1-13; and (iii) a heterologous nucleotide sequence.

[0059] In some embodiments, the vectors provided herein comprise, in 5' to 3' order, (i) a promoter; (ii) (a) a nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (b) the reverse nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (c) the complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (d) the reverse complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; or (e) a nucleotide sequence comprising one or more regions of about 100 bp or more having at least 75% or more sequence identity to any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; and (iii) a heterologous nucleotide sequence.

[0060] In some embodiments, the vectors provided herein comprise, in 5' to 3' order, (i) (a) a nucleotide sequence of any of SEQ ID NOs: 1-13; (b) the reverse nucleotide sequence of any of SEQ ID NOs: 1-13; (c) the complementary nucleotide sequence of any of SEQ ID NOs: 1-13; (d) the reverse complementary nucleotide sequence of any of SEQ ID NOs: 1-13; or (e) a nucleotide sequence comprising one or more regions of about 100 bp or more having at least 75% or more sequence identity to any of SEQ ID NOs: 1-13; and (ii) a promoter; and (iii) a heterologous nucleotide sequence.

[0061] In some embodiments, the vectors provided herein comprise, in 5' to 3' order, (i) (a) the nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (b) the reverse nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (c) the complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (d) the reverse complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; or (e) a nucleotide sequence comprising one or more regions of about 100 bp or more having at least 75% or more sequence identity to any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; and (ii) a promoter; and (iii) a heterologous nucleotide sequence.

[0062] In some embodiments, the vectors provided herein comprise, in 5' to 3' order, (i) a promoter; (ii) a heterologous nucleotide sequence; and (iii) (a) a nucleotide sequence of any of SEQ ID NOs: 1-13; (b) the reverse nucleotide sequence of any of SEQ ID NOs: 1-13; (c) the complementary nucleotide sequence of any of SEQ ID NOs: 1-13; (d) the reverse complementary nucleotide sequence of any of SEQ ID NOs: 1-13; or (e) a nucleotide sequence comprising one or more regions of about 100 bp or more having at least 75% or more sequence identity to any of SEQ ID NOs: 1-13.

[0063] In some embodiments, the vectors provided herein comprise, in 5' to 3' order, (i) a promoter; (ii) a heterologous nucleotide sequence; and (iii) (a) the nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (b) the reverse nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (c) the complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (d) the reverse complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; or (e) a nucleotide sequence comprising one or more regions of about 100 bp or more having at least 75% or more sequence identity to any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11.

[0064] In some embodiments, the vectors provided herein further comprise an enhancer.

[0065] In some embodiments, the vectors provided herein further comprise or encode a polyadenylation (polyA) signal sequence. As used herein, "polyadenylation signal sequence" refers to a DNA sequence that, when transcribed, regulates the addition of a polyA tail to an mRNA transcript. In some embodiments, the polyA signal sequence is an SV40, human, bovine, or rabbit polyA signal sequence. In some embodiments, the polyA signal sequence is an SV40 polyA signal sequence. In some embodiments, the polyA sequence is a β-globin polyA signal sequence. In some embodiments, the polyA signal sequence is a human growth hormone polyA signal sequence or a bovine growth hormone polyA signal sequence.

[0066] In some embodiments, the SV40 polyA signal sequence is AACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGC (SEQ ID NO: 18) Comprises or consists of

[0067] In some embodiments, the human growth hormone polyadenylation signal (bGHpA) sequence is Gggtggcatccctgtgaccctccccagtgcctctcctggccctggaagttgccactccagtgcccaccagccttgtcctaataaaattaagttgcatcattttgtctgactaggtgtcct tctataatattatggggtggaggggggtggtatggagcaaggggcaagttgggaagacaacctgtagggcctgcggggtctattgggaaccaagctggagtgcagtggcacaatcttggct cactgcaatctccgcctcctgggttcaagcgattctcctgcctcagcctcccgagttgttgggattccaggcatgcatgaccaggctcagctaatttttgtttttttggtagagacggggt ttcaccatattggccaggctggtctccaactcctaatctcaggtgatctacccaccttggcctcccaaattgctgggattacaggcgtgaaccactgctcccttccctgtcctt (SEQ ID NO: 25) Comprises or consists of

[0068] In some embodiments, the human β-globin polyadenylation signal (hBGpA) sequence is Gctcgctttcttgctgtccaatttctattaaaggttcctttgttccctaagtccaactactaaactgggggatattatgaagggccttgagcatctggat tctgcctaataaaaaacatttattttcattgcaatgatgtatttaaattatttctgaatattttactaaaaagggaatgtgggaggtcagtgcatttaaaa cataaagaaatgaagagctagttcaaaccttgggaaaatacactatatcttaaactccatgaaagaaggtgaggctgcaaacagctaatgcacattggcaa cagcccctgatgcctatgccttattcatccctcagaaaaggattcaagtagaggcttgatttggaggttaaagttttgctatgctgtatttta (SEQ ID NO: 26) It consists of a kamahata and a kamahata.

[0069] In some embodiments, the vectors provided herein further comprise or encode a Kozak sequence (e.g., a DNA sequence transcribed into an RNA Kozak sequence). In some embodiments, the vector comprises a Kozak sequence upstream of the transgene. In some embodiments, the Kozak sequence is encoded by GCCACC (SEQ ID NO: 19). In some embodiments, the Kozak sequence (e.g., an RNA Kozak sequence) comprises or consists of ACCAUGG (SEQ ID NO: 20), GCCGCCACCAUGG (SEQ ID NO: 21), CCACCAUG (SEQ ID NO: 22), or CCACCAUGG (SEQ ID NO: 23).

[0070] In some embodiments, the vectors provided herein further comprise or encode a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). See, e.g., Wang and Verma, Proc. Natl. Acad. Sci., USA, 96:3906-3910 (1999). In some embodiments, the vectors comprise or encode a hepatitis B virus post-transcriptional regulatory element (HBVPRE) and / or an RNA transport element (RTE). In some embodiments, the WPRE or HBVPRE sequence is any of the WPRE or HBVPRE sequences disclosed in U.S. Patent No. 6,136,597 or U.S. Patent No. 6,287,814. In some embodiments, the vectors provided herein further comprise or encode a WPRE3 or wsl3 regulatory element.

[0071] In some embodiments, WPRE3 is GATAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCT TTCATTTTCTCCTCCTTGTATAAATCCTGGTTAGTTCTTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTT (SEQ ID NO: 24) Contains or is encoded by

[0072] In some embodiments, the WPRE is (SEQ ID NO: 27) Contains or is encoded by

[0073] In some embodiments, the vectors provided herein further comprise an artificial intron. In some embodiments, the vectors provided herein further comprise a chimeric intron.

[0074] In some embodiments, the vectors provided herein further encode a 2A self-cleaving peptide.

[0075] In some embodiments, the vectors provided herein further comprise or encode an internal ribosome entry site (IRES). In some embodiments, the IRES is located at the 5' end of the gene of interest, allowing RNA translation in a cap-independent manner. The transcribed IRES can directly bind to a ribosomal subunit so that the start codon of the mRNA is properly oriented within the ribosome for translation. The IRES sequence is usually located in the 5' UTR (immediately upstream of the start codon) of the mRNA. The IRES functionally replaces the need for various protein factors that interact with the eukaryotic translation machinery.

[0076] The present specification provides a vector comprising: (a) a promoter; (b) a nucleotide sequence of any of SEQ ID NOs: 1-13, or the reverse complement of any of SEQ ID NOs: 1-13; and (c) a heterologous nucleotide sequence, which comprises or encodes one or more of the following: an enhancer, a polyadenylation signal sequence, a Kozak sequence, a WPRE, a Hepatitis B virus post-transcriptional regulatory element, an RTE, a WPRE3, a wsl3 regulatory element, an artificial intron, a chimeric intron, a 2A self-cleaving peptide, and an IRES.

[0077] The present specification provides a vector comprising: (a) a promoter; (b) the nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11, or the reverse complement of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, or SEQ ID NO:11; and (c) a heterologous nucleotide sequence, which comprises or encodes one or more of the following: an enhancer, a polyadenylation signal sequence, a Kozak sequence, a WPRE, a Hepatitis B virus post-transcriptional regulatory element, an RTE, a WPRE3, a wsl3 regulatory element, an artificial intron, a chimeric intron, a 2A self-cleaving peptide, and an IRES.

[0078] In some embodiments, the vectors provided herein further encode a nuclear localization signal (NLS). In some embodiments, the NLS is a Simian Virus 40 (SV40) NLS. In some embodiments, the NLS is a nucleoplasmin NLS.

[0079] The genetic regulatory elements provided herein can be used to restrict gene therapy intervention (e.g., gene replacement, gene regulation, gene editing, and / or modulation of cellular activity) to distinct neuronal populations within the CNS while preventing or reducing the effects of the gene therapy intervention in any other organ.

[0080] In some embodiments, the heterologous nucleotide sequence encodes a protein.

[0081] In some embodiments, the heterologous nucleotide sequence encodes a gene silencing nucleic acid. In some embodiments, the gene silencing nucleic acid is a short hairpin RNA (shRNA). In some embodiments, the gene silencing nucleic acid is a small interfering RNA (siRNA).

[0082] In some embodiments, the heterologous nucleotide sequence encodes a CRISPR-associated protein. In some embodiments, the heterologous nucleotide sequence encodes a nuclease-deficient CRISPR-associated protein (also known as a catalytically inactive CRISPR nuclease, a dead Cas protein, or a dCas protein). In some embodiments, the heterologous nucleotide sequence encodes a CRISPR-associated protein and a guide RNA (gRNA).

[0083] In some embodiments, the heterologous nucleotide sequence encodes a Transcription Activator-Like Protein Effector (TALE) protein.

[0084] In some embodiments, the vectors provided herein are plasmids or viral expression cassettes containing additional nucleic acid sequences. In some embodiments, the vectors provided herein can be used to generate recombinant viral particles that function as viral vectors for gene delivery. In some embodiments, the vectors provided herein are formulated for use via non-viral delivery systems. Additionally, provided herein are plasmids containing any of the vector nucleic acid sequences disclosed herein.

[0085] In some embodiments, the vectors provided herein are non-viral vectors. In some embodiments, the vectors are plasmid vectors. In some embodiments, the vectors are bacterial plasmid vectors. In some embodiments, the vectors are yeast plasmid vectors. In some embodiments, the vectors are bacterial artificial chromosome vectors, yeast plasmid vectors, or yeast minichromosome vectors.

[0086] In some embodiments, the vectors provided herein are viral vectors.

[0087] In some embodiments, the viral vector is an adenoviral vector. Adenoviral vectors and recombinant adenoviruses are described, for example, in U.S. Patent No. 10,781,427. In some embodiments, the adenoviral vector is a helper-dependent adenoviral vector that lacks all viral genes except for the psi packaging and inverted terminal repeat (ITR) sequences.

[0088] In some embodiments, the viral vector is an adeno-associated viral (AAV) vector.

[0089] In some embodiments, the AAV vectors provided herein are self-complementary. In some embodiments, the AAV vectors provided herein are single-stranded.

[0090] In some embodiments, the AAV vectors provided herein comprise a heterologous nucleotide sequence, a promoter, and a first AAV ITR located upstream of the nucleotide sequence of any of SEQ ID NOs: 1-13; the reverse nucleotide sequence of any of SEQ ID NOs: 1-13; the complementary nucleotide sequence of any of SEQ ID NOs: 1-13; the reverse complement of any of SEQ ID NOs: 1-13; or a nucleotide sequence comprising one or more regions of about 100 bp or more having at least 75% or more sequence identity to any of SEQ ID NOs: 1-13; and a second AAV ITR located downstream of the heterologous nucleotide sequence, a promoter, and the nucleotide sequence of any of SEQ ID NOs: 1-13; the reverse nucleotide sequence of any of SEQ ID NOs: 1-13; the complementary nucleotide sequence of any of SEQ ID NOs: 1-13; the reverse complement of any of SEQ ID NOs: 1-13; or a nucleotide sequence comprising one or more regions of about 100 bp or more having at least 75% or more sequence identity to any of SEQ ID NOs: 1-13. ITRs are sequences that mediate proviral integration of AAV and packaging of AAV DNA into virions.

[0091] In some embodiments, the AAV vectors provided herein comprise a first AAV ITR located upstream of a heterologous nucleotide sequence, a promoter, and a nucleotide sequence comprising one or more regions of about 100 bp or more having at least 75% or more sequence identity to any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; the nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; the complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; the reverse complement of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11. the reverse nucleotide sequence of any of SEQ ID NOs: 1, 2, 4, 5, 6, 9, 10, and 11; the complementary nucleotide sequence of any of SEQ ID NOs: 1 to 13; the reverse complementary sequence of any of SEQ ID NOs: 1, 2, 4, 5, 6, 9, 10, and 11, or a nucleotide sequence comprising one or more regions of about 100 bp or more having at least 75% sequence identity to any of SEQ ID NOs: 1, 2, 4, 5, 6, 9, 10, and 11.

[0092] In some embodiments, the AAV vectors provided herein comprise a 5' AAV inverted terminal repeat (ITR) and a 3' AAV ITR flanking the heterologous nucleotide sequence, a promoter, and (a) a nucleotide sequence of any of SEQ ID NOs: 1-13; (b) the reverse nucleotide sequence of any of SEQ ID NOs: 1-13; (c) the complementary nucleotide sequence of any of SEQ ID NOs: 1-13; (d) the reverse complementary nucleotide sequence of any of SEQ ID NOs: 1-13; or (e) a nucleotide sequence comprising one or more regions of about 100 bp or more having at least 75% or more sequence identity to any of SEQ ID NOs: 1-13.

[0093] In some embodiments, the AAV vectors provided herein comprise a 5' AAV inverted terminal repeat (ITR) and a 3' AAV ITR flanked by heterologous nucleotide sequences, a promoter, and (a) the nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (b) the reverse nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (c) the complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (d) the reverse complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; or (e) a nucleotide sequence comprising one or more regions of about 100 bp or more having at least 75% or more sequence identity to any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11.

[0094] In some embodiments, the AAV vectors provided herein comprise, in 5' to 3' order, (i) a 5' AAV ITR; (ii) a promoter; (iii) (a) a nucleotide sequence of any of SEQ ID NOs: 1-13; (b) the reverse nucleotide sequence of any of SEQ ID NOs: 1-13; (c) the complementary nucleotide sequence of any of SEQ ID NOs: 1-13; (d) the reverse complementary nucleotide sequence of any of SEQ ID NOs: 1-13; or (e) a nucleotide sequence comprising one or more regions of about 100 bp or more having at least 75% or more sequence identity to any of SEQ ID NOs: 1-13; (iv) a heterologous nucleotide sequence; and (v) a 3' AAV ITR.

[0095] In some embodiments, the AAV vectors provided herein comprise, in 5' to 3' order: (i) 5'VVA (ii) a promoter; (iii) (a) the nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (b) the reverse nucleotide sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (c) the complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (d) the reverse complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; or (e) a nucleotide sequence comprising one or more regions of about 100 bp or more having at least 75% or more sequence identity to any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (iv) a heterologous nucleotide sequence; and (v) a 3' AAV ITR.

[0096] In some embodiments, the AAV vectors provided herein comprise, in 5' to 3' order, (i) a 5' AAV ITR; (ii) (a) a nucleotide sequence of any of SEQ ID NOs: 1-13; (b) the reverse nucleotide sequence of any of SEQ ID NOs: 1-13; (c) the complementary nucleotide sequence of any of SEQ ID NOs: 1-13; (d) the reverse complementary nucleotide sequence of any of SEQ ID NOs: 1-13; or (e) a nucleotide sequence comprising one or more regions of about 100 bp or more having at least 75% or more sequence identity to any of SEQ ID NOs: 1-13; (iii) a promoter; (iv) a heterologous nucleotide sequence; and (v) a 3' AAV ITR.

[0097] In some embodiments, the AAV vectors provided herein comprise, in 5' to 3' order: (i) 5'AAV ITR; (ii) (a) the nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11, (b) the reverse nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (c) the complementary nucleotide sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (d) the reverse complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; or (e) a nucleotide sequence comprising one or more regions of about 100 bp or more having at least 75% or more sequence identity to any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (iii) a promoter; (iv) a heterologous nucleotide sequence; and (v) a 3' AAV ITR.

[0098] In some embodiments, the AAV vectors provided herein comprise, in 5' to 3' order, (i) a 5' AAV ITR; (ii) a promoter; (iii) a heterologous nucleotide sequence; (iv) (a) a nucleotide sequence of any of SEQ ID NOs: 1-13; (b) the reverse nucleotide sequence of any of SEQ ID NOs: 1-13; (c) the complementary nucleotide sequence of any of SEQ ID NOs: 1-13; (d) the reverse complementary nucleotide sequence of any of SEQ ID NOs: 1-13; or (e) a nucleotide sequence comprising one or more regions of about 100 bp or more having at least 75% or more sequence identity to any of SEQ ID NOs: 1-13; and (v) a 3' AAV ITR.

[0099] In some embodiments, the AAV vectors provided herein comprise, in 5' to 3' order: (i) 5'AAV (ii) a promoter; (iii) a heterologous nucleotide sequence; (iv) comprising: (a) the nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (b) the reverse nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (c) the complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (d) the reverse complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; or (e) a nucleotide sequence comprising one or more regions of about 100 bp or more having at least 75% or more sequence identity to any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; and (v) a 3' AAV ITR.

[0100] The viral vectors and plasmids provided herein can be used to generate recombinant viral particles.

[0101] The present specification provides a viral particle (also called a virion) comprising a vector disclosed herein. In some embodiments, the viral particle is a recombinant adenovirus particle. In some embodiments, the viral particle is a recombinant AAV (rAAV) particle. In some embodiments, the rAAV particle is an AAV-PHP.eB serotype particle. In some embodiments, the rAAV particle is an AAV9 serotype particle. In some embodiments, the rAAV particle is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh.8, AAVrh.10, AAVrh32.33, AAVrh.74, AAVhu.68, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, snake AAV, bearded dragon AAV, AAV2i8, AAV1i8, AAV1i9, AAV2i10, AAV2i11, AAV2i12, AAV2i13, AAVrh.8, AAVrh.10, AAVrh32.33, AAVrh.74, AAVhu.68, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, snake AAV, bearded dragon AAV, AAV2i8, AAV2i9, AAV3i9, AAV4i10, AAV4i11, AAV4i12, AAV4i13, AAVrh.8, AAVrh.10, AAVrh32.33, AAVrh.74, AAVhu.68, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, snake AAV, bearded dragon AAV, AAV2i8, AAV2i9, AAV3i9, AAV4i11, AAV4i1 AV2g9, AAV-LK03, AAV7m8, AAVAnc80, TM-AAV6, AAV-PHP.A, AAV-PHP.B, AAV-PHP.S, AAV-PHP.eB, AAV-CAP.B10, AAV2-r3.45, AAV2-LSS, AAV2PFG, AAV2-PPS, AAV2-TLH, or AAV2-GMN serotype particles, or any other AAV serotype particles now known or later discovered.

[0102] The present specification provides a population of viral particles comprising a plurality of the viral particles disclosed herein.The present specification provides a population of recombinant adenovirus particles comprising a plurality of the recombinant adenovirus particles disclosed herein.The present specification provides a population of rAAV particles comprising a plurality of the rAAV particles disclosed herein.

[0103] In some embodiments, the vectors provided herein are suitable for delivery via non-viral delivery systems. In some embodiments, the vectors provided herein are formulated for delivery via non-viral delivery systems. In some embodiments, the non-viral delivery system is a lipid nanoparticle or an exosome. In some embodiments, the non-viral system for gene delivery can be lipid-based, polymer-based, or other nanomaterial-based. Cationic lipids or cationic polymers can form complexes with nucleic acid molecules to generate synthetic vehicles for gene delivery.

[0104] The present specification provides a cell comprising any of the vectors or viral particles disclosed herein.

[0105] In some embodiments, the cell is a prokaryotic cell. In some embodiments, the cell is a eukaryotic cell. In some embodiments, the eukaryotic cell can be a mammalian cell, an insect cell, a plant cell, a fungal cell, a eukaryotic algae cell, a nematode cell, a protozoan cell, or a fish cell.

[0106] In some embodiments, the cell is a mammalian cell. In some embodiments, the mammalian cell is a Chinese hamster ovary (CHO) cell, a COS cell, a Vero cell, an SP2 / 0 cell, an NS / O myeloma cell, a human embryonic kidney cell, an immature hamster kidney cell, a HeLa cell, a human B cell, a cv-1 / EBNA cell, an L cell, a 3T3 cell, a HEPG2 cell, a PerC6 cell, a 293 cell, or an MDCK cell. In some embodiments, the mammalian cell is a HEK293 cell. In some embodiments, the mammalian cell is a CHO cell.

[0107] In some embodiments, the cells are insect cells. In some embodiments, the insect cells are Spodoptera frugiperda cells (e.g., Sf9 or ExpiSf9™ cell lines). The Sf9 insect cell line (Thermo Fisher Scientific, Waltham, MA) is a clonal isolate derived from the parent S. frugiperda cell line IPLB-Sf-21-AE. ExpiSf9™ cells (Thermo Fisher Scientific, Waltham, MA) are unengineered derivatives of Sf9 insect cells adapted to high-density suspension growth.

[0108] Pharmaceutical Composition The present specification provides a pharmaceutical composition comprising any of the vectors, viral particles, nucleic acid molecules, or populations of viral particles disclosed herein and a pharmaceutically acceptable carrier, vehicle, or diluent. "Pharmaceutically acceptable" refers to a non-toxic or otherwise undesirable material, i.e., the material can be administered to a subject without causing any undesirable biological effects. Generally, a pharmaceutically acceptable material has one or more advantages that outweigh any undesirable biological effects that the material may have. Undesirable biological effects may include, for example, excessive toxicity, irritation, allergic responses, and other problems and complications.

[0109] For injection, the carrier is typically a liquid. For other methods of administration, the carrier can be either solid or liquid.

[0110] In some embodiments, the pharmaceutical composition may include other medicinal agents, pharmaceutical agents, stabilizers, buffers, adjuvants and / or diluents.

[0111] In some embodiments, the pharmaceutical composition comprises at least one pharmaceutically acceptable carrier, excipient, and / or vehicle, such as a solvent, buffer, solution, dispersion medium, coating, antibacterial agent, antifungal agent, isotonic agent, and absorption delaying agent. In some embodiments, the pharmaceutically acceptable carrier, excipient, and / or vehicle comprises saline, buffered saline, dextrose, water, glycerol, sterile isotonic aqueous buffer, or a combination thereof. In some embodiments, the pharmaceutically acceptable carrier, excipient, and / or vehicle comprises phosphate buffered saline, sterile saline, lactose, sucrose, calcium phosphate, dextran, agar, pectin, peanut oil, sesame oil, pharmaceutical grade mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate, polyol (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc.), or suitable mixtures thereof. In some embodiments, the compositions disclosed herein further comprise an emulsifying or wetting agent, or a pH buffering agent. Such species may be present in small amounts (e.g., less than 10% by weight of the composition, e.g., less than 5% by weight of the composition, less than 2% by weight of the composition, less than 1% by weight of the composition).

[0112] In some embodiments, the pharmaceutical composition further comprises one or more other pharmaceutical ingredients, such as one or more preservatives or chemical stabilizers. Examples of preservatives and chemical stabilizers include, but are not limited to, chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, phenol, parachlorophenol, and albumin. In some embodiments, the compositions disclosed herein further comprise an antibacterial and / or antifungal agent, such as paraben, chlorobutanol, phenol, sorbic acid, and thimerosal; an isotonic agent, such as sugar and sodium chloride; and / or an agent that delays absorption, such as aluminum monostearate and gelatin.

[0113] In some embodiments, the pharmaceutical composition is in the form of an injectable solution or dispersion, for example, an aqueous solution or dispersion.In some embodiments, the pharmaceutical composition is a sterile powder for extemporaneously preparing a sterile injectable solution or sterile dispersion.Dispersions can be prepared in water, glycerol, liquid polyethylene glycol, oil, or mixtures thereof.The pharmaceutical composition provided herein can be introduced into delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, etc.

[0114] In some embodiments, the pharmaceutical composition comprises or consists of a sterile saline (e.g., pharmaceutical grade saline) solution and the vector. In some embodiments, the pharmaceutical composition comprises or consists of the vector and sterile water (e.g., pharmaceutical grade water). In some embodiments, the pharmaceutical composition comprises or consists of the vector and phosphate buffered saline (PBS) (e.g., pharmaceutical grade PBS).

[0115] In some embodiments, the pharmaceutical compositions provided herein comprise a vector and one or more excipients, in some embodiments, the excipients are water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.

[0116] In some embodiments, the pharmaceutical compositions provided herein include a lipid moiety. For example, the vector can be introduced into a preformed liposome or lipoplex made from a mixture of cationic lipids and neutral lipids. In some embodiments, the vector complex with the mono- or polycationic lipid is formed without the presence of neutral lipids. In some embodiments, the lipid moiety is selected to increase the distribution of the pharmaceutical to specific cells or tissues. In some embodiments, the lipid moiety is selected to increase the distribution of the pharmaceutical to neurons.

[0117] In some embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Some delivery systems are useful for preparing certain pharmaceutical compositions, including those containing hydrophobic compounds. In some embodiments, an organic solvent such as dimethyl sulfoxide is used. In some embodiments, the pharmaceutical composition comprises a nanoparticle-based delivery system. In some embodiments, poly(lactic-co-glycolic acid) (PLGA), poly(β-amino ester) (PBAE), and / or polyethyleneimine (PEI) are used to formulate the nanoparticles.

[0118] In some embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver the vector to a particular tissue or cell type. For example, in some embodiments, the pharmaceutical composition comprises a liposome coated with a tissue- or cell-specific antibody.

[0119] In some embodiments, the pharmaceutical composition includes a cosolvent system. Some cosolvent systems include, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In some embodiments, such cosolvent systems are used for hydrophobic compounds. A non-limiting example of such a cosolvent system is the VPD cosolvent system, which is an absolute ethanol solution containing 3 wt% benzyl alcohol, 8 wt% of the nonpolar surfactant polysorbate 80, and 65 wt% polyethylene glycol 300. The proportions of such cosolvent systems can be varied significantly without significantly changing their solubility and toxicity characteristics. Furthermore, the identity of the cosolvent components can be varied; for example, other surfactants can be used in place of polysorbate 80, the fraction size of polyethylene glycol can be changed, other biocompatible polymers can be substituted for polyethylene glycol, e.g., polyvinylpyrrolidone, and other sugars or polysaccharides can be substituted for dextrose.

[0120] The present specification provides nanoparticles comprising the vectors disclosed herein. In some embodiments, the nanoparticles are lipid nanoparticles. In some embodiments, the nanoparticles are solid lipid nanoparticles (SLN).

[0121] In some embodiments, the pharmaceutical composition comprises a carrier and is formulated in an aqueous solution, e.g., water or a physiologically compatible buffer such as Hank's solution, Ringer's solution, or physiological saline buffer. In some embodiments, other ingredients are included (e.g., ingredients that aid in solubility or function as preservatives). In some embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents, etc. In some embodiments, injectable pharmaceutical compositions are prepared in unit dosage form, e.g., in ampoules or multi-dose containers. Some injectable pharmaceutical compositions are suspensions, solutions, or emulsions in oily or aqueous vehicles and may contain formulatory agents, e.g., suspending agents, stabilizers, and / or dispersing agents. Exemplary solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils, e.g., sesame oil, synthetic fatty acid esters, e.g., ethyl oleate or triglycerides, and liposomes.

[0122] In some embodiments, the vectors can be mixed with pharmaceutically acceptable active and / or inactive substances to prepare pharmaceutical compositions or formulations. The methods for formulating compositions and pharmaceutical compositions depend on several criteria, including, but not limited to, the route of administration, the extent of the disease, or the dose to be administered.

[0123] In some embodiments, the pharmaceutical composition is suitable for or formulated for systemic administration, hi some embodiments, the pharmaceutical composition is suitable for or formulated for intravenous administration.

[0124] In some embodiments, the pharmaceutical composition is suitable for or formulated for intraventricular, intrathecal, intracarotid, or intraparenchymal injection.

[0125] Methods for generating rAAV particles The present specification provides methods for producing rAAV particles using any of the vectors and cells disclosed herein.

[0126] The present specification provides a method for producing rAAV particles, the method comprising: (i) culturing cells containing a vector disclosed herein under conditions that allow packaging of the rAAV particles; and (ii) harvesting the cultured host cells or medium for recovery of the rAAV particles.

[0127] In some embodiments, methods for producing rAAV particles include providing a cell with (a) a vector containing two AAV ITRs located 5' and 3' to a polynucleotide sequence desired to be packaged into an rAAV particle, and (b) AAV sequences sufficient for replication and encapsidation of the nucleic acid template into an AAV protein capsid (e.g., AAV rep and AAV cap sequences encoding AAV capsid subunits, also referred to as "helper functions"). Typically, the AAV rep and AAV cap sequences are not flanked by AAV ITRs, as this would prevent rescue and / or packaging of these sequences.

[0128] The vector (nucleic acid template), rep sequence, cap sequence, and any other helper functions necessary to generate the rAAV particles disclosed herein can be delivered to packaging host cells using any suitable genetic element. Further details regarding methods for preparing rAAV particles are provided in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY; Fisher et al., J. Virol., 70:520-532 (1993); and US Pat. No. 5,478,745.

[0129] The nucleic acid template and AAV rep and cap sequences are provided under conditions such that a viral vector comprising the nucleic acid template packaged within an AAV protein capsid is produced within the cell. The method can further include recovering the packaged viral vector from the cell. The packaged viral vector can be recovered from the culture medium and / or by lysing the cells.

[0130] The cell may be a cell that is permissive for AAV viral replication. Any suitable cell known in the art may be used. In some embodiments, the cell is a mammalian cell (e.g., HEK293 cell). In some embodiments, the cell may be a trans-complementing packaging cell line that provides a replication-deficient helper virus, such as a function missing from HEK293 cells or other E1a trans-complementing cells. The helper sequence may be integrated into a chromosome or maintained as a stable extrachromosomal element.

[0131] In some embodiments, rAAV particles are produced using a triple transfection method such as that described in US 6,001,650. In some embodiments, rAAV is produced by transfecting host cells with an AAV vector (i.e., an AAV expression cassette) to be packaged into rAAV particles, an AAV helper function vector, and an accessory function vector. The AAV helper function vector encodes "AAV helper function" sequences (i.e., rep and cap) that function in trans for productive AAV replication and encapsidation. Non-limiting examples of AAV helper function vectors include the pHLP19 and pRep6cap6 vectors described in US 6,001,650 and US 6,156,303, respectively. The accessory function vector encodes nucleotide sequences for non-AAV-derived viral and / or cellular functions (i.e., "accessory functions") that are dependent on AAV replication. Accessory functions include functions required for AAV replication, including, but not limited to, portions involved in activation of AAV gene transcription, stage-specific AAV mRNA splicing, AAV DNA replication, synthesis of the cap expression product, and AAV capsid assembly. Viral-based accessory functions can be derived from any of the known helper viruses, such as adenovirus, herpesvirus (e.g., other than herpes simplex virus type 1), and vaccinia virus.

[0132] In some embodiments, rAAV is produced using a recombinant baculovirus vector. The production of rAAV using a baculovirus vector is described, for example, in Urabe et al. (2002) Hum Gene Ther 13(16):1935-1943, Smith et al. (2009) Mol Ther 17(11):1888-1896, US 8,945,918; US 9,879,282, and US 2018 / 0371495. In some embodiments, the baculovirus vector genome is derived from Autographa californica multicapsid nuclear polyhedrosis virus (AcMNPV), Bombyx mori nuclear polyhedrosis virus (BmNPV), Helicoverpa amigera (HearNPV), or Spodoptera exigaa MNPV. The baculovirus vector is used to produce recombinant AAV in insect cells (e.g., Spodoptera frugiperda cells). In some embodiments, Sf9 or ExpiSf9™ Spodoptera frugiperda cell lines are used to produce rAAV. In some embodiments, the methods of the present disclosure include co-infecting insect cells with a population of recombinant baculovirus (rBV) to produce the rAAV disclosed herein. At least two populations of rBV can be used in the methods of the present disclosure. Methods for producing recombinant baculovirus are known in the art (see, for example, Bac-to-Bac® Baculovirus Expression System (Thermo Fisher Scientific, Waltham, MA)).

[0133] In some embodiments, the rAAV particles produced by the methods provided herein comprise an AAV-PHP.eB capsid protein. In some embodiments, the rAAV particles produced by the methods provided herein comprise an AAV9 capsid protein. In some embodiments, the rAAV particles produced by the methods provided herein comprise an AAV1, AAV2, AAV3 (including types 3A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh32.33, AAVrh.8, AAVrh.10, AAVrh.74, AAVhu.68, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, snake AAV, bearded dragon AAV, or any of the following capsid proteins: ...-PHP.eB capsid protein, AAV-PHP.eB capsid protein, AAV-PHP.eB capsid protein, AAV-PHP.eB capsid protein, AAV-PHP.eB capsid protein, AAV-PHP.eB capsid protein, AAV-PHP.eB capsid protein, AAV-PHP.eB capsid protein, AAV-PHP.eB capsid protein, AAV-PHP.eB capsid protein, AAV-PHP.eB capsid protein, AAV-PHP.eB AAV, AAV2i8, AAV2g9, AAV-LK03, AAV7m8, AAVAnc80, TM-AAV6, AAV-PHP.A, AAV-PHP.B, AAV-PHP.S, AAV-PHP.eB, AAV-CAP.B10, AAV2-r3.45, AAV2-LSS, AAV2PFG, AAV2-PPS, AAV2-TLH, or AAV2-GMN capsid protein, or any other AAV capsid protein now known or later discovered.

[0134] How to use vectors The present specification provides a method for selectively expressing a heterologous nucleotide sequence in neurons of the CNS in a subject in need thereof, the method comprising administering to the subject a vector, viral particle, population, pharmaceutical composition, or nanoparticle disclosed herein.

[0135] In some embodiments of the methods disclosed herein, the regulatory elements restrict expression of the heterologous nucleotide sequence to neurons of the CNS with at least about 75%, about 80%, about 85%, about 90%, about 95%, or about 99% specificity for that cell type. In some embodiments of the methods disclosed herein, the regulatory elements restrict expression of the heterologous nucleotide sequence to neurons of the CNS with at least about 75%, about 80%, about 85%, about 90%, about 95%, or about 99% selectivity for that cell type.

[0136] In some embodiments of the methods disclosed herein, the regulatory elements express the heterologous nucleotide sequence in non-neuronal cells of the CNS (e.g., glial or endothelial cells) with a specificity of up to about 25%, about 20%, about 15%, about 10%, about 5%, or about 1% for that cell type. In some embodiments of the methods disclosed herein, the regulatory elements express the heterologous nucleotide sequence in non-neuronal cells of the CNS (e.g., glial or endothelial cells) with a selectivity of up to about 25%, about 20%, about 15%, about 10%, about 5%, or about 1% for that cell type.

[0137] In some embodiments of the methods disclosed herein, expression of a heterologous nucleotide sequence is enhanced in a specific region of the CNS. The terms "enhanced" and "sensitivity" can be used interchangeably. The regulatory elements provided herein, when incorporated into a DNA-based expression vector, are capable of driving functional expression of a heterologous nucleotide sequence in a specific region of the brain with a sensitivity of greater than 10% for neurons in a given target region (i.e., the forebrain), while preventing expression of the heterologous nucleotide sequence in other regions of the brain (e.g., less than 5% sensitivity to cells or less than 2% sensitivity to cells).

[0138] In some embodiments of the methods disclosed herein, the regulatory elements restrict expression of the heterologous nucleotide sequence to neurons of the CNS with at least about 70% specificity for this cell type and enhance expression of the heterologous nucleotide sequence in a particular region of the brain with greater than 10% sensitivity for neurons in a given target region.

[0139] In some embodiments of the methods disclosed herein, the regulatory elements restrict expression of the heterologous nucleotide sequence to neurons of the CNS with at least about 80% specificity for this cell type and enhance expression of the heterologous nucleotide sequence in a particular region of the brain with greater than 10% sensitivity for neurons in a given target region.

[0140] In some embodiments of the methods disclosed herein, the regulatory elements restrict expression of the heterologous nucleotide sequence to neurons of the CNS with at least about 90% specificity for this cell type, and enrich for and enhance expression of the heterologous nucleotide sequence in specific regions of the brain with a sensitivity of greater than 10% for neurons in a given target region.

[0141] In some embodiments of the methods disclosed herein, expression of the heterologous nucleotide sequence is enhanced in neurons of one or more of the forebrain, cerebellum, and spinal cord. In some embodiments, expression of the heterologous nucleotide sequence is enhanced in neurons of the forebrain and cerebellum. In some embodiments, expression of the heterologous nucleotide sequence is enhanced in neurons of the forebrain. In some embodiments, expression of the heterologous nucleotide sequence is enhanced in neurons of the cerebellum. In some embodiments, expression of the heterologous nucleotide sequence is enhanced in neurons of the spinal cord. In some embodiments, expression of the heterologous nucleotide sequence is enhanced in neurons of the neurogenic niche.

[0142] In some embodiments, the vector comprises the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 10, and expression of the heterologous nucleotide sequence is enhanced in neurons of the CNS (e.g., pan-neuronal expression across all brain regions).

[0143] In some embodiments, the vector comprises the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 9, and expression of the heterologous nucleotide sequence is enhanced in neurons of the forebrain and cerebellum.

[0144] In some embodiments, the vector comprises the nucleotide sequence of SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:11, and expression of the heterologous nucleotide sequence is enhanced in neurons of the forebrain.

[0145] In some embodiments, the vector comprises the nucleotide sequence of SEQ ID NO: 6, and expression of the heterologous nucleotide sequence is enhanced in neurons of the cerebellum and hippocampus.

[0146] In some embodiments, the vector, viral particle, population, pharmaceutical composition, or nanoparticle is administered to the subject via systemic administration.In some embodiments, the vector, viral particle, population, pharmaceutical composition, or nanoparticle is administered to the subject intravenously.In some embodiments, the vector, viral particle, population, pharmaceutical composition, or nanoparticle is administered to the subject via injection into the CNS.In some embodiments of the methods provided herein, the vector, viral particle, population, pharmaceutical composition, or nanoparticle is administered to the subject via ICV injection.

[0147] In some embodiments, the subject has or is suspected of having a disease or disorder associated with inappropriate expression of proteins or nucleic acids in neurons of the CNS. In some embodiments, the subject has or is suspected of having a disease or disorder associated with inappropriate expression of proteins or nucleic acids in neurons of one or more of the forebrain, cerebellum, and spinal cord. In some embodiments, the subject has or is suspected of having a disease or disorder associated with inappropriate expression of proteins or nucleic acids in neurons of the neurogenic niche.

[0148] In some embodiments, the subject has or is suspected of having a neurodegenerative, neurological, neurodevelopmental, or neuropsychiatric disease or disorder.

[0149] In some embodiments, administering to a subject a vector, a viral particle, a population, a pharmaceutical composition, or a nanoparticle disclosed herein is used to treat or prevent a disease or disorder associated with inappropriate protein or nucleic acid expression in neurons of the CNS. In some embodiments, administering to a subject a vector, a viral particle, a population, a pharmaceutical composition, or a nanoparticle disclosed herein is used to reduce or ameliorate one or more symptoms of a disease or disorder associated with inappropriate protein or nucleic acid expression in neurons of the CNS.

[0150] In some embodiments, the subject is a human. In some embodiments, the subject is under 2 years of age. In some embodiments, the subject is between about 2 years of age and about 18 years of age. In some embodiments, the subject is 18 years of age or older.

[0151] definition Unless otherwise noted, terms used herein have definitions commonly used in the art. Some terms are defined below, and additional definitions may be found in the remainder of the detailed description.

[0152] The term "a" or "an" can refer to one or more of that instance, i.e., to a plurality of referents. Thus, the terms "a," "an," "one or more," and "at least one" are used interchangeably herein. In addition, a reference to "an element" with the indefinite article "a" or "an" does not exclude the possibility that there is more than one of that element, unless the context clearly requires that there be one or only one of that element.

[0153] Unless otherwise specified or clear from the context, the term "about" means within 10% of the reported numerical value (except where such number is greater than 100% or less than 0% of the possible values). When used in conjunction with a range or series of values, the term "about" applies to the endpoints of that range or each recited value in the series, unless otherwise indicated. As used in this application, the terms "about" and "approximately" are used as equivalent terms.

[0154] As used herein, the terms "specificity" and "sensitivity" are defined as follows: For quantification of colocalization analysis, cells expressing the indicated reporter are counted using only the corresponding color channel, and cells expressing the pan-neuronal marker NeuN (i.e., neurons) are independently identified using only the corresponding color channel. The ratio of cells co-expressing both markers to the total number of cells expressing the reporter alone is then calculated and reported as the mean ± s.e.m. (standard error of the mean) (i.e., specificity). The ratio of cells co-expressing both markers to the total number of cells expressing the pan-neuronal marker is calculated and reported as the mean ± s.e.m. (i.e., sensitivity).

[0155] As used herein, the term "vector" refers to a delivery vehicle for a polynucleotide (e.g., a heterologous nucleotide sequence). A vector can be used to deliver a heterologous nucleotide sequence to a host cell. In some embodiments, a vector contains a heterologous nucleotide sequence encoding a protein or a gene silencing nucleic acid operatively inserted therein, allowing expression of the protein or gene silencing nucleic acid in genetic engineering recombinant techniques. A vector can be used to transform, transduce, or transfect a host cell and allow genetic material elements carried by the vector to be expressed within the host cell. A "vector" can be any suitable vector, including chromosomal vectors, non-chromosomal vectors, and synthetic nucleic acid vectors.

[0156] As used herein, the term "heterologous" refers to material derived from any source other than its natural source. For example, the term "heterologous nucleotide sequence" refers to a nucleotide sequence from a non-natural source or location that has been artificially introduced into a biological system.

[0157] As used herein, the term "gRNA molecule" or "gRNA" refers to a guide RNA that can target a CRISPR nuclease or a nuclease-deficient CRISPR-associated protein to a target nucleic acid. Depending on the context, the term "gRNA molecule" refers to the guide ribonucleic acid or the nucleic acid encoding the gRNA.

[0158] As used herein, the term "sequence identity" refers to the degree to which two optimally aligned polynucleotide or polypeptide sequences are invariant across a window of alignment, e.g., nucleotide or amino acid alignment. The "percent identity" for an aligned segment of a test sequence and a reference sequence is the number of identical residues shared by the two aligned sequences, i.e., the entire reference sequence or a smaller defined portion of the reference sequence, divided by the total number of residues in the reference sequence segment. The "percent identity" is the percent identity multiplied by 100. Percent identity can be calculated using Clustal Omega, an alignment program available at ebi.ac.uk / Tools / msa / clustalo using default parameters. See Sievers et al., "Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega" (2011 October 11) Molecular Systems Biology 7:539. Extensions such as tags are not included in the calculation of sequence identity.

[0159] As used herein, a regulatory sequence (e.g., a promoter or a gene control element provided herein) is considered to be "operably linked" when it is in a functional position and orientation relative to the nucleic acid sequence it regulates for controlling transcription initiation and / or expression of that sequence.

[0160] As used herein, the term "self-complementary," when referring to AAV, refers to an AAV vector containing nucleic acid (i.e., DNA) that spontaneously anneals to form dimeric inverted repeat molecules, resulting in faster and more robust transgene expression compared to conventional single-stranded (ss) AAV genomes. See, e.g., McCarty, Molecular Therapy 16(10):1648-1656 (2008). Unlike conventional ssAAV, self-complementary AAV (scAAV) can bypass second-strand synthesis, a rate-limiting step in gene expression. Furthermore, double-stranded scAAV is less susceptible to DNA degradation after viral transduction, resulting in increased copy numbers of stable episomes.

[0161] As used herein, a "therapeutically effective amount" is an amount of a vector, viral particle, population of viral particles, pharmaceutical composition, or nanoparticle provided herein effective to treat or prevent a disease or disorder, or ameliorate a sign or symptom thereof, in a subject. A "therapeutically effective amount" may vary depending, for example, on the disease and / or symptoms of the disease, the severity of the disease and / or symptoms of the disease or disorder, the age, weight, and / or health of the patient being treated, and the judgment of the prescribing physician.

[0162] Any concentration range, percentage range, ratio range, or integer range herein should be understood to include any integer value within the stated range, and, where appropriate, fractions thereof (e.g., tenths and hundredths of integers), unless otherwise stated.

[0163] The use of the alternative (eg, "or") should be understood to mean either one, both, or any combination thereof of the alternatives.

[0164] All references, articles, publications, patents, patent publications, and patent applications cited herein are incorporated herein by reference in their entirety for all purposes. However, mention of any reference, article, publication, patent, patent publication, or patent application cited herein is not, and should not be considered as, an admission or any indication that they constitute valid prior art or form part of the common general knowledge in any country throughout the world.

[0165] The headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described.

[0166] Numbered Aspects Without limiting the scope of any appended claims, the present disclosure describes the following numbered aspects of the disclosure:

[0167] Aspect 1. A vector comprising: (i) a heterologous nucleotide sequence; and (ii) (a) the nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (b) the reverse nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (c) the complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (d) the reverse complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; or (e) a nucleotide sequence comprising one or more regions of about 100 base pairs (bp) or more having at least 75% or more sequence identity to any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11.

[0168] Embodiment 2. The vector of embodiment 1, wherein the vector further comprises a promoter.

[0169] (b) the reverse nucleotide sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (c) the complementary nucleotide sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (d) the reverse complementary nucleotide sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; or (e) one or more regions of nucleotide sequence of about 100 bp or more having at least 75% or more sequence identity to any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11, and (iii) a heterologous nucleotide sequence.

[0170] Aspect 4. The vector of Aspect 2, comprising, in 5' to 3' order: (i) (a) the nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (b) the reverse nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (c) the complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (d) the reverse complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; or (e) a nucleotide sequence comprising one or more regions of about 100 bp or more having at least 75% or more sequence identity to any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; and (ii) a promoter; and (iii) a heterologous nucleotide sequence.

[0171] (ii) a heterologous nucleotide sequence; and (iii) a nucleotide sequence comprising, in 5' to 3' order: (i) a promoter; (ii) a heterologous nucleotide sequence; and (iii) (a) the nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (b) the reverse nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (c) the complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (d) the reverse complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; or (e) a nucleotide sequence comprising one or more regions of about 100 bp or more having at least 75% or more sequence identity to any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11.

[0172] Embodiment 6. The vector according to any one of embodiments 1 to 5, wherein the vector is a non-viral vector.

[0173] Embodiment 7. The vector of embodiment 6, wherein the non-viral vector is a plasmid vector.

[0174] Embodiment 8. The vector according to any one of embodiments 1 to 5, wherein the vector is a viral vector.

[0175] Embodiment 9. The vector of embodiment 8, wherein the viral vector is an adeno-associated virus (AAV) vector or an adenovirus vector.

[0176] Aspect 10. The vector of Aspect 9, wherein the AAV vector comprises a 5' AAV inverted terminal repeat (ITR) and a 3' AAV ITR flanked by heterologous nucleotide sequences, a promoter, and (a) the nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (b) the reverse nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (c) the complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (d) the reverse complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; or (e) a nucleotide sequence comprising one or more regions of about 100 bp or more having at least 75% or more sequence identity to any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11.

[0177] (ii) a promoter; (iii) a vector comprising, in 5' to 3' order: (i) a 5' AAV ITR; (ii) a promoter; (a) the nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (b) the reverse nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (c) the complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (d) the reverse complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; or (e) one or more regions of about 100 bp or more having at least 75% or more sequence identity to any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (iv) a heterologous nucleotide sequence; and (v) a 3' AAV 11. The vector of embodiment 10, comprising an ITR.

[0178] (ii) a nucleotide sequence comprising, in 5' to 3' order: (i) a 5' AAV ITR; (ii) (a) the nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (b) the reverse nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (c) the complementary nucleotide sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (d) the reverse complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; or (e) a nucleotide sequence comprising one or more regions of about 100 bp or more having at least 75% or more sequence identity to any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (iii) a promoter; (iv) a heterologous nucleotide sequence; and (v) a 3' AAV 11. The vector of embodiment 10, comprising an ITR.

[0179] (ii) a promoter; (iii) a heterologous nucleotide sequence; (iv) a nucleotide sequence comprising, in 5' to 3' order: (i) a 5' AAV ITR; (ii) a promoter; (iii) a heterologous nucleotide sequence; (iv) (a) the nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (b) the reverse nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (c) the complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; (d) the reverse complementary nucleotide sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; or (e) a nucleotide sequence comprising one or more regions of about 100 bp or more having at least 75% or more sequence identity to any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11; and (v) a 3' AAV 11. The vector of embodiment 10, comprising an ITR.

[0180] Embodiment 14. The vector according to any one of embodiments 2 to 13, wherein the promoter comprises an RNA-polymerase II binding site, a TATA box, a TF2B recognition element (BRE), a motif 10 element (MTE), or a downstream promoter element (DPE).

[0181] Embodiment 15. The vector according to any one of embodiments 2 to 13, wherein the promoter is a minimal promoter.

[0182] Embodiment 16. The vector of embodiment 15, wherein the minimal promoter is a human beta globin minimal promoter.

[0183] Embodiment 17. The vector according to any one of embodiments 1 to 16, wherein the vector further comprises an enhancer.

[0184] Embodiment 18. The vector according to any one of embodiments 1 to 17, wherein the vector further comprises or encodes a polyadenylation signal sequence.

[0185] Embodiment 19. The vector according to any one of embodiments 1 to 18, wherein the vector further comprises or encodes a Kozak sequence.

[0186] Embodiment 20. The vector of any one of embodiments 1 to 19, wherein the vector further comprises or encodes a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), a hepatitis B virus post-transcriptional regulatory element, an RNA transport element (RTE), a WPRE3, or a wsl3 regulatory element.

[0187] Embodiment 21. The vector according to any one of embodiments 1 to 20, wherein the vector further comprises an artificial intron.

[0188] Embodiment 22. The vector according to any one of embodiments 1 to 21, wherein the vector further encodes a 2A self-cleaving peptide.

[0189] Embodiment 23. The vector according to any one of embodiments 1 to 22, wherein the vector further comprises or encodes an internal ribosome entry site (IRES).

[0190] Embodiment 24. The vector of any one of embodiments 1 to 23, wherein the heterologous nucleotide sequence encodes a protein.

[0191] Embodiment 25. The vector of any one of embodiments 1 to 23, wherein the heterologous nucleotide sequence encodes a gene silencing nucleic acid.

[0192] Embodiment 26 The vector of any one of embodiments 1 to 23, wherein the heterologous nucleotide sequence encodes a CRISPR-associated protein.

[0193] Embodiment 27. The vector of embodiment 26, wherein the heterologous nucleotide sequence further encodes a guide RNA (gRNA).

[0194] Aspect 28: A viral particle comprising the vector according to any one of Aspects 1 to 5 and 8 to 27.

[0195] Embodiment 29. The viral particle according to embodiment 28, wherein the viral particle is a recombinant adenoviral particle.

[0196] Embodiment 30. The viral particle according to embodiment 28, wherein the viral particle is a recombinant AAV (rAAV) particle.

[0197] Aspect 31. The rAAV particle is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh.8, AAVrh.10, AAVrh32.33, AAVrh.74, AAVhu.68, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, snake AAV, bearded dragon AAV, A 31. The viral particle of embodiment 30, which is an AV2i8, AAV2g9, AAV-LK03, AAV7m8, AAVAnc80, TM-AAV6, AAV-PHP.A, AAV-PHP.B, AAV-PHP.S, AAV-PHP.eB, AAV-CAP.B10, AAV2-r3.45, AAV2-LSS, AAV2PFG, AAV2-PPS, AAV2-TLH, or AAV2-GMN serotype particle.

[0198] Embodiment 32. A population of virus particles comprising a plurality of virus particles according to any one of embodiments 28 to 32.

[0199] Embodiment 33. A pharmaceutical composition comprising a vector according to any one of embodiments 1 to 27, a viral particle according to any one of embodiments 28 to 32, or a population according to embodiment 32, and a pharmaceutically acceptable carrier, vehicle, or diluent.

[0200] Aspect 34. A nanoparticle comprising the vector according to any one of aspects 1 to 7 and 14 to 27.

[0201] Embodiment 35. A cell comprising the vector according to any one of embodiments 1 to 27 or the viral particle according to any one of embodiments 28 to 32.

[0202] Embodiment 36. The cell according to embodiment 35, which is a mammalian cell or an insect cell.

[0203] Embodiment 37. A method of producing rAAV particles, comprising: (i) culturing the cells of embodiment 35 or 36 under conditions capable of packaging the rAAV particles; and (ii) harvesting the cultured host cells or medium for recovery of the rAAV particles.

[0204] Embodiment 38. A method for selectively expressing a heterologous nucleotide sequence in neurons of the central nervous system (CNS) in a subject in need thereof, the method comprising administering to the subject a vector according to any one of embodiments 1 to 27, a viral particle according to any one of embodiments 28 to 32, a population according to embodiment 32, a pharmaceutical composition according to embodiment 33, or a nanoparticle according to embodiment 34.

[0205] Embodiment 39 The method of embodiment 38, wherein heterologous nucleotide sequence expression is enhanced in specific regions of the CNS.

[0206] Embodiment 40 The method of embodiment 38, wherein expression of the heterologous nucleotide sequence is enhanced in neurons of one or more of the forebrain, cerebellum, and spinal cord.

[0207] Embodiment 41 The method of embodiment 38, wherein expression of the heterologous nucleotide sequence is enhanced in neurons of the forebrain and cerebellum.

[0208] Embodiment 42 The method of embodiment 38, wherein expression of the heterologous nucleotide sequence is enhanced in neurons of the forebrain.

[0209] Embodiment 43 The method of embodiment 38, wherein expression of the heterologous nucleotide sequence is enhanced in neurons of the cerebellum.

[0210] Embodiment 44 The method of embodiment 38, wherein expression of the heterologous nucleotide sequence is enhanced in neurons of the spinal cord.

[0211] Embodiment 45. The method of embodiment 38, wherein the vector comprises the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 10, and wherein expression of the heterologous nucleotide sequence is enhanced in neurons of the CNS.

[0212] Embodiment 46 The method according to embodiment 38, wherein the vector comprises the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 9, and wherein expression of the heterologous nucleotide sequence is enhanced in neurons of the forebrain and cerebellum.

[0213] Embodiment 47. The method of embodiment 38, wherein the vector comprises the nucleotide sequence of SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 11, and wherein expression of the heterologous nucleotide sequence is enhanced in neurons of the forebrain.

[0214] Embodiment 48 The method according to embodiment 38, wherein the vector comprises the nucleotide sequence of SEQ ID NO: 6, and wherein expression of the heterologous nucleotide sequence is enhanced in neurons of the cerebellum and hippocampus.

[0215] Embodiment 49. The method of any one of embodiments 38 to 48, wherein the vector, viral particle, population, pharmaceutical composition, or nanoparticle is administered intravenously to the subject.

[0216] Embodiment 50. The method of any one of embodiments 38 to 48, wherein the vector, viral particle, population, pharmaceutical composition, or nanoparticle is administered to the subject via injection into the CNS.

[0217] The present disclosure will be further clarified by the following examples, which are intended to be purely illustrative of the disclosure and not limiting in any way. [Example]

[0218] example Generation and analysis of regulatory elements Identification of regulatory elements The sequences of 13 synthetic regulatory elements were engineered using a proprietary method: the Regulatory Element High-Throughput Screening (RE-HTS) platform, which combines comprehensive analysis of genomic and epigenomic next-generation sequencing data associated with a target cell type to identify short DNA sequences predicted to be capable of restricting viral transgene expression to that target cell type.

[0219] Cloning and generation of rAAV Regulatory elements were then de novo synthesized and individually cloned into custom vectors. The custom vectors contained (from 5' to 3') the 5' AAV ITR, a cloning site, the coding sequence for the red fluorescent reporter tDTomato or the coding sequence for dCas9, a WPRE, a polyadenylation sequence, and the 3' AAV ITR. This vector was synthesized de novo and used as a common backbone for all constructs. The "dCas" or "dead Cas" protein is a nuclease-deficient CRISPR-associated protein (also known as a catalytically inactive CRISPR nuclease). These constructs contained a minimal promoter sequence immediately downstream of the 5' AAV ITR followed by one of the regulatory elements. Complete plasmid Sanger sequencing was then performed to ensure the integrity of each construct. The corresponding rAAV was produced in-house using standard production methods. PEI was used for transfection, and an OptiPrep gradient (Sigma, USA) was used for viral particle purification. All batches produced were in the range of 10E+11 to 10E+13 viral genomes per ml.

[0220] Systemic virus injection For systemic injections in adult mice, 10E+11 viral particles produced with the AAV capsid PHP.eB (Chan et al., Nat. Neurosci. 20, 1172-1179 (2017)) were injected into the tail vein of the animals. Post-injection monitoring was performed for 5 days after injection.

[0221] immunohistochemistry All virus-injected animals were transcardially perfused with 4% paraformaldehyde (PFA). Organs were placed in 4% PFA for 3 hours and then sectioned using a Leica VTS1200 vibrating sector. Free-floating sections were permeabilized with 0.3% Triton X100, 5% normal donkey serum, and PBS for 30 minutes. Next, sections were incubated overnight at 4°C with the indicated combination of primary antibodies: rabbit anti-Ds-red at 1:1000 (Clontech, 632496) and mouse anti-NeuN at 1:500 (Invitrogen, MA5-33103) in 0.1% Triton X100. These sections were then washed three times with PBS, incubated with Alexa Fluor-conjugated secondary antibodies at 1:1,000 (Invitrogen, USA), counterstained with DAPI (Sigma, USA), and mounted on glass slides using FluoroMount-G (Sigma, USA).

[0222] Quantification, statistics, and reproducibility For expression analysis, fluorescent images were acquired at standardized magnification and exposure time for each organ. Representative images comparable across constructs are shown in Figures 1A and 1B. Representative images of transgene expression driven by the engineered regulatory elements across the indicated brain heatmap and brain regions and organs are shown. Note that the heatmap has five levels, with darker shades corresponding to a higher percentage of cells expressing the transgene (i.e., the darkest shade represents the strongest expression observed, and the lightest shade represents little to no expression).

[0223] The expression profiles of regulatory elements CNS2_V4 (SEQ ID NO: 1), CNS2_V3 (SEQ ID NO: 2), CNS2_V7 (SEQ ID NO: 4), and CNS2_V10 (SEQ ID NO: 6) are shown in Figure 1A. CNS2_V4 showed neuron-specific expression throughout the CNS. CNS2_V3 showed highly enriched neuron-specific expression in the forebrain and cerebellum. CNS2_V7 showed highly enriched neuron-specific expression in the forebrain. CNS2_V10 showed highly enriched neuron-specific expression in the cerebellum and neurogenic niche.

[0224] The expression profiles of regulatory elements CNS2_V4 (SEQ ID NO: 1), CNS2_V4.1 (SEQ ID NO: 10), CNS2_V3 (SEQ ID NO: 2), CNS2_V3.3 (SEQ ID NO: 9), CNS2_V7 (SEQ ID NO: 4), CNS2_V7.1 (SEQ ID NO: 11), CNS2_V11 (SEQ ID NO: 5), and CNS2_V10 (SEQ ID NO: 6) are shown in Figure 1B. CNS2_V4 and CNS2_V4.1 showed pan-neuronal expression across all brain regions. CNS2_V3 and CNS2_V3.3 showed forebrain- and cerebellum-enriched expression. CNS2_V7, CNS2_V7.1, and CNS2_V11 showed forebrain-enriched expression. CNS2_V10 showed cerebellum and hippocampus-enriched expression.

[0225] For quantification of colocalization analysis, cells expressing the indicated reporters were counted using only the corresponding color channel, and cells expressing the pan-neuronal marker NeuN (i.e., neurons) were independently identified using only the corresponding color channel. The ratio of cells co-expressing both markers to the total number of cells expressing the reporter alone was then calculated and reported as the mean ± SEM (i.e., specificity). The ratio of cells co-expressing both markers to the total number of cells expressing the pan-neuronal marker was also calculated and reported as the mean ± SEM (i.e., sensitivity). Quantification was performed using a minimum of two independent biological replicates, and all replicates were highly concordant. Results corresponding to the data in Figure 1A are shown in Figure 2A, Figure 2B, and Figure 2C.

[0226] Results corresponding to the data in Figure 1B are shown in Figures 3A-3D. Results of quantitative analysis of the intensity, specificity, and sensitivity of transgene expression after systemic injection of adult mice with PHP.eB capsids and 3 weeks of incubation are shown. Figure 3A shows the percent specificity of transgene expression (dTomato) to neurons within the somatosensory cortex (as determined by NeuN expression). Figure 3B shows the percent sensitivity (percentage of the neuronal population captured) of transgene expression to neurons within the somatosensory cortex after systemic administration. Figure 3C shows the percent sensitivity of transgene expression across cortical layers within the somatosensory cortex. Figure 3D shows the percent sensitivity of transgene expression in neurons within the striatum.

[0227] Upon systemic delivery of rAAV (ie, by injection into the circulatory system), these sequences did not induce transgene expression in any organ other than the brain.

[0228] Intraventricular virus injection For ICV injection into postnatal mice, 5E+10 viral particles produced with the AAV capsid AAV9 were injected on PND 1. After 4 weeks of incubation, animals were harvested on postnatal day 29 (PND 29).

[0229] Analysis of early postnatal ICV injections of AAV9 containing regulatory elements driving either dTomato or dCas9 Representative images of transgene expression after ICV injection with AAV9 capsid at P1 and after 4 weeks of incubation (animals harvested at P29) are shown in Figures 4A and 4B. Figure 4A shows images of fluorescent reporter (dTomato) expression driven by CNS2_V4.1 (SEQ ID NO: 10) in the brain. Figure 4B shows analysis of dCas9 transgene expression driven by CNS2_V4.1 (SEQ ID NO: 10) detected by qPCR.

[0230] These data suggest that regulatory elements retain their properties across injection methods, ages, transgenes, and serotypes. The CNS2_V4.1 regulatory element showed the same expression profile upon ICV injection with AAV9 capsids at PND1 compared to systemic injection with AAV PHP.eB capsids in adults.

Claims

[Claim 1] The invention described in the specification.