Double-stranded RNA targeting angiotensinogen (AGT) and methods of use thereof

Abstract

The present disclosure relates to isolated oligonucleotides comprising a duplex region that targets angiopoietin-like 3 (AGT), as well as delivery systems, kits and compositions comprising same, and methods of using same to inhibit or downregulate AGT.

Description

[Technical Field]

[0001] Related Applications This application claims priority to and benefit of U.S. Provisional Application No. 63 / 395,445, filed August 5, 2022, the contents of which are incorporated herein by reference in their entirety.

[0002] Incorporation by reference of sequence listing The Sequence Listing XML associated with this application has been provided electronically in XML file format and is hereby incorporated by reference in its entirety. The XML file containing the Sequence Listing XML is named "SANB_009_001WO_SeqList_ST26.xml." The XML file is 655,027 bytes in size and was created on August 7, 2023. [Background technology]

[0003] Angiotensinogen (mRNA) is an α2-globulin precursor of angiotensin. It is produced in the liver, kidneys, adrenal glands, brain, heart, blood vessels, and adipose tissue, and is a hormone that causes vasoconstriction and regulates blood pressure. Angiotensinogen is part of the renin-angiotensin-aldosterone system (RAAS), which plays an important role in regulating blood pressure. Active renin in plasma cleaves angiotensinogen (produced by the liver) into angiotensin I, which is then converted into angiotensin II by the circulation and locally expressed angiotensin-converting enzyme (ACE). Angiotensin II exerts its effects on the RAAS by binding to the angiotensin II type 1 receptor (AT1R), resulting in arterial vasoconstriction, renal tubular and glomerular effects, such as enhanced Na+ reabsorption or regulation of glomerular filtration rate. Furthermore, AT1R stimulation by angiotensin II, along with other stimuli such as adrenocorticotropic hormone, antidiuretic hormone, catecholamines, endothelin, serotonin, and Mg2+ and K+ levels, leads to aldosterone release, which in turn promotes Na+ and K+ excretion in the renal distal convoluted tubule.

[0004] Excessive angiotensin II production due to dysregulation of RAAS and / or AT1R stimulation leads to hypertension.Hypertension is the main risk factor for various diseases, disorders and conditions, such as shortened life expectancy, chronic kidney disease, stroke, myocardial infarction, heart failure, aneurysm (e.g., aortic aneurysm), peripheral artery disease, heart damage (e.g., cardiac enlargement or hypertrophy) and other cardiovascular-related diseases, disorders and / or conditions.Therefore, there is a need in the art for alternative and combined therapies for the subjects with angiotensin-related diseases. Summary of the Invention

[0005] The present disclosure provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence substantially identical to a region comprising 19 to 25 nucleotides from the 5' end of an angiotensinogen (AGT) mRNA sequence according to SEQ ID NO: 1 and between any one of nucleotide positions selected from a) 9 to 29; b) 166 to 196; c) 394 to 480; d) 744 to 968; e) 1110 to 1331; f) 1410 to 1676; and g) 1726 to 1894, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region.

[0006] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising 19-25 nucleotides from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1 to any one of nucleotide positions selected from a) 9-29; b) 166-196; c) 394-480; d) 744-968; e) 1110-1331; f) 1410-1676; and g) 1726-1894, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region.

[0007] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region comprising 19 to 25 nucleotides from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1 to any one of nucleotide positions selected from a) 9 to 29; b) 166 to 196; c) 394 to 480; d) 744 to 968; e) 1110 to 1331; f) 1410 to 1676; and g) 1726 to 1894.

[0008] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is substantially identical to a region from the 5' end of the AGT mRNA sequence according to SEQ ID NO:1 to any one of nucleotide positions selected from 1829 to 1857.

[0009] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region from the 5' end of the AGT mRNA sequence according to SEQ ID NO:1 to any one of nucleotide positions selected from 1829 to 1857.

[0010] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between the 5' end of the AGT mRNA sequence according to SEQ ID NO:1 and any one of nucleotide positions selected from 1829 to 1857.

[0011] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is substantially identical to a region between the 5' end of the AGT mRNA sequence according to SEQ ID NO:1 and any one of nucleotide positions selected from a) 166-196; b) 394-480; c) 744-968; d) 1110-1331; e) 1410-1676; and f) 1726-1894.

[0012] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region from the 5' end of the AGT mRNA sequence according to SEQ ID NO:1 to any one of nucleotide positions selected from a) 166-196; b) 394-480; c) 744-968; d) 1110-1331; e) 1410-1676; and f) 1726-1894.

[0013] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 166-196; b) 394-480; c) 744-968; d) 1110-1331; e) 1410-1676; and f) 1726-1894 from the 5' end of the AGT mRNA sequence according to SEQ ID NO:1.

[0014] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence substantially identical to a region comprising the sequence from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1 to any one of nucleotide positions selected from a) 9 to 29; b) 168 to 189; c) 784 to 808; d) 1264 to 1289; e) 1607 to 1630; f) 1814 to 1835; and g) 1843 to 1882.

[0015] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising the sequence from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1 to any one of nucleotide positions selected from a) 9 to 29; b) 168 to 189; c) 784 to 808; d) 1264 to 1289; e) 1607 to 1630; f) 1814 to 1835; and g) 1843 to 1882.

[0016] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence identical to a region comprising the sequence from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1 to any one of nucleotide positions selected from a) 9 to 29; b) 168 to 189; c) 784 to 808; d) 1264 to 1289; e) 1607 to 1630; f) 1814 to 1835; and g) 1843 to 1882.

[0017] In some embodiments of the isolated oligonucleotide of the present disclosure, the isolated oligonucleotide is capable of inducing degradation of AGT mRNA.

[0018] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand is a single-stranded RNA molecule.In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand is a single-stranded RNA molecule.In some embodiments of the isolated oligonucleotide of the present disclosure, both the sense strand and the antisense strand are single-stranded RNA molecules.

[0019] In some embodiments of the isolated oligonucleotide of the present disclosure, the single-stranded RNA molecule of the sense strand comprises a 3' overhang.In some embodiments, in the single-stranded RNA molecule of the sense strand, the 3' overhang comprises at least one nucleotide.In some embodiments, in the single-stranded RNA molecule of the sense strand, the 3' overhang comprises two nucleotides.

[0020] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense single-stranded RNA molecule comprises a 3' overhang. In some embodiments, in the antisense single-stranded RNA molecule, the 3' overhang comprises at least one nucleotide. In some embodiments, in the antisense single-stranded RNA molecule, the 3' overhang comprises two nucleotides.

[0021] In some embodiments of the isolated oligonucleotides of the present disclosure, the 3' overhang comprises any one of thymidine-thymidine (dTdT), adenine-adenine (AA), cysteine-cysteine (CC), guanine-guanine (GG), or uracil-uracil (UU).

[0022] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises an RNA sequence at least 20 nucleotides in length. In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises an RNA sequence 20 nucleotides in length.

[0023] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises an RNA sequence at least 22 nucleotides in length. In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises an RNA sequence 22 nucleotides in length.

[0024] In some embodiments of the isolated oligonucleotides of the present disclosure, the double-stranded region is 19-21 nucleotides in length. In some embodiments of the isolated oligonucleotides of the present disclosure, the double-stranded region is 20 nucleotides in length.

[0025] In some embodiments of the isolated oligonucleotides of the present disclosure, the double-stranded region comprises an antisense strand and a sense strand according to any one of the antisense and sense strand sequence pairs in Tables 1-4, as described in the detailed description.

[0026] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 2-56.

[0027] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 57-111.

[0028] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 2-56, and the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 57-111, wherein the antisense and sense strand sequences have sufficient complementarity to allow formation of a double-stranded region between the antisense and sense strands.

[0029] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a sequence identical to a region comprising the sequence between any one of nucleotide positions selected from a) 9 to 29; b) 166 to 196; c) 394 to 480; d) 744 to 968; e) 1110 to 1331; f) 1410 to 1676; and g) 1726 to 1894 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates expression of AGT mRNA by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45%, or 45% to 50%) at a dose of 0.02 nM.

[0030] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a sequence identical to a region comprising the sequence between any one of nucleotide positions selected from a) 9 to 29; b) 166 to 196; c) 394 to 480; d) 744 to 968; e) 1110 to 1331; f) 1410 to 1676; and g) 1726 to 1894 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide, at a dose of 0.02 nM, inhibits AGT Attenuate mRNA expression by at least 50% (e.g., 50%-55%, 55%-60%, 60%-65%, 65%-70%, 70%-75%, 75%-80%, 80%-85%, 85%-90%, 90%-95%, or 95%-99%, 99%-100%).

[0031] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a sequence identical to a region comprising the sequence between any one of nucleotide positions selected from a) 9 to 29; b) 166 to 196; c) 394 to 480; d) 744 to 968; e) 1110 to 1331; f) 1410 to 1676; and g) 1726 to 1894 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates expression of AGT mRNA by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45%, or 45% to 50%) at a dose of 0.1 nM.

[0032] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a sequence identical to a region comprising the sequence between any one of nucleotide positions selected from a) 9 to 29; b) 166 to 196; c) 394 to 480; d) 744 to 968; e) 1110 to 1331; f) 1410 to 1676; and g) 1726 to 1894 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide, at a dose of 0.1 nM, inhibits AGT Attenuate mRNA expression by at least 50% (e.g., 50%-55%, 55%-60%, 60%-65%, 65%-70%, 70%-75%, 75%-80%, 80%-85%, 85%-90%, 90%-95%, or 95%-99%, 99%-100%).

[0033] The present disclosure also provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand is selected from the group consisting of: a) 11-42; b) 144-215; c) 264-284; d) 303-323; e) 325-345; f) 355-405; g) 441-481; h) 503-552; i) 560-580; j) 690-731; k) 742-802; l) 863-883; m) 922-966; n) 1036-1056; o) 1099-1153; p) 1189-1209; q) 1233-1255; r) 1258-1282; and ad) 2075-2095. The antisense strand comprises a nucleotide sequence that is substantially identical to a region comprising 19 to 25 nucleotides between any one of nucleotide positions selected from s) 1300-1367; t) 1403-1465; u) 1479-1517; v) 1601-1624; w) 1631-1651; x) 1722-1753; y) 1756-1861; z) 1863-1890; aa) 1901-1948; ab) 2017-2047; ac) 2049-2071; and ad) 2075-2095, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region.

[0034] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand is selected from the group consisting of from the 5' end of the angiotensinogen (AGT) mRNA sequence according to SEQ ID NO: 1: a) 11-42; b) 144-215; c) 264-284; d) 303-323; e) 325-345; f) 355-405; g) 441-481; h) 503-552; i) 560-580; j) 690-731; k) 742-802; l) 863-883; m) 922-966; n) 1036-1056; o) 1099-1153; p) 1189-1209; q) 1233-1255; r) 1258-1282; s) 1300-1367; t a) 1403-1465; u) 1479-1517; v) 1601-1624; w) 1631-1651; x) 1722-1753; y) 1756-1861; z) 1863-1890; aa) 1901-1948; ab) 2017-2047; ac) 2049-2071; and ad) 2075-2095, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide comprises a nucleotide sequence substantially identical to a region comprising 19-25 nucleotides between any one of nucleotide positions selected from ... Attenuate mRNA expression by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45%, or 45% to 50%).

[0035] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand is selected from the group consisting of from the 5' end of the angiotensinogen (AGT) mRNA sequence according to SEQ ID NO: 1: a) 11-42; b) 144-215; c) 264-284; d) 303-323; e) 325-345; f) 355-405; g) 441-481; h) 503-552; i) 560-580; j) 690-731; k) 742-802; l) 863-883; m) 922-966; n) 1036-1056; o) 1099-1153; p) 1189-1209; q) 1233-1255; r) 1258-1282; s) 1300-1367; t a) 1403-1465; u) 1479-1517; v) 1601-1624; w) 1631-1651; x) 1722-1753; y) 1756-1861; z) 1863-1890; aa) 1901-1948; ab) 2017-2047; ac) 2049-2071; and ad) 2075-2095, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide comprises a nucleotide sequence substantially identical to a region comprising 19-25 nucleotides between any one of nucleotide positions selected from AGT at a dose of 0.1 nM. Attenuate mRNA expression by at least 50% (e.g., 50%-55%, 55%-60%, 60%-65%, 65%-70%, 70%-75%, 75%-80%, 80%-85%, 85%-90%, 90%-95%, or 95%-100%).

[0036] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand is selected from the group consisting of from the 5' end of the angiotensinogen (AGT) mRNA sequence according to SEQ ID NO: 1: a) 11-42; b) 144-215; c) 264-284; d) 303-323; e) 325-345; f) 355-405; g) 441-481; h) 503-552; i) 560-580; j) 690-731; k) 742-802; l) 863-883; m) 922-966; n) 1036-1056; o) 1099-1153; p) 1189-1209; q) 1233-1255; r) 1258-1282; s) 1300-1367; t) and ad) 2075-2095, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide comprises a nucleotide sequence substantially identical to a region comprising 19 to 25 nucleotides between any one of nucleotide positions selected from 1403-1465; u) 1479-1517; v) 1601-1624; w) 1631-1651; x) 1722-1753; y) 1756-1861; z) 1863-1890; aa) 1901-1948; ab) 2017-2047; ac) 2049-2071; ... isolated oligonucleotide comprises a nucleotide sequence substantially identical to a region comprising 19 to 25 nucleotides between any one of nucleotide positions selected from 1403-1465; u) 1479-1517; Attenuate mRNA expression by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45%, or 45% to 50%).

[0037] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand is selected from the group consisting of from the 5' end of the angiotensinogen (AGT) mRNA sequence according to SEQ ID NO: 1: a) 11-42; b) 144-215; c) 264-284; d) 303-323; e) 325-345; f) 355-405; g) 441-481; h) 503-552; i) 560-580; j) 690-731; k) 742-802; l) 863-883; m) 922-966; n) 1036-1056; o) 1099-1153; p) 1189-1209; q) 1233-1255; r) 1258-1282; s) 1300-1367; t a) 1403-1465; u) 1479-1517; v) 1601-1624; w) 1631-1651; x) 1722-1753; y) 1756-1861; z) 1863-1890; aa) 1901-1948; ab) 2017-2047; ac) 2049-2071; and ad) 2075-2095, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide comprises a nucleotide sequence substantially identical to a region comprising 19-25 nucleotides between any one of nucleotide positions selected from AGT at a dose of 0.02 nM. Attenuate mRNA expression by at least 50% (e.g., 50%-55%, 55%-60%, 60%-65%, 65%-70%, 70%-75%, 75%-80%, 80%-85%, 85%-90%, 90%-95%, or 95%-100%).

[0038] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 2, 3, 16, 30, 35, 37, 40, 41, 44, or 55.

[0039] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 57, 58, 71, 85, 90, 92, 95, 96, 99, or 110.

[0040] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 2, 3, 16, 30, 35, 37, 40, 41, 44, or 55, and the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 57, 58, 71, 85, 90, 92, 95, 96, 99, or 110, wherein the antisense and sense strand sequences have sufficient complementarity to allow formation of a double-stranded region between the antisense and sense strands.

[0041] In some embodiments of the isolated oligonucleotide of the present disclosure, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5'UCAAAAAAAAUGCUGUUCAGCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 71 (5'CUGAACAGCAUUUUUUUUGA3').

[0042] In some embodiments of the isolated oligonucleotide of the present disclosure, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5'UCACUUUUUUGUUUCACAAACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 85 (5'UUUGUGAAACAAAAAAGUGA3').

[0043] In some embodiments of the isolated oligonucleotide of the present disclosure, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5'UGGAACACUUUUUUGUUUCACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5'UGAAACAAAAAAGUGUUCCA3').

[0044] In some embodiments of the isolated oligonucleotide of the present disclosure, the double-stranded region comprises an antisense strand of a nucleic acid sequence according to SEQ ID NO: 3 (5'UUUGAAAAGGGAACACUUUUUU3') and a sense strand of a nucleic acid sequence according to SEQ ID NO: 58 (5'AAAAGUGUUCCCUUUUCAAA3').

[0045] In some embodiments of the isolated oligonucleotide of the present disclosure, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'UCAAUUUUUGUUCUCAACUUGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 90 (5'AAGUUGAGAACAAAAAUUGA3').

[0046] In some embodiments of the isolated oligonucleotide of the present disclosure, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5'UAAAACCCAAUUUUUGUUCUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 110 (5'AGAACAAAAAUUGGGUUUUA3').

[0047] In some embodiments of the isolated oligonucleotide of the present disclosure, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5'UAUUUUAAAACCCAAUUUUUGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 92 (5'AAAAAUUGGGUUUUAAAAUA3').

[0048] In some embodiments of the isolated oligonucleotide of the present disclosure, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 40 (5'UAUACUUUAAUUUUAAAACCCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 95 (5'GGUUUUAAAAUUAAAGUAUA3').

[0049] In some embodiments of the isolated oligonucleotide of the present disclosure, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 41 (5'UUAUACUUUAAUUUUAAAACCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 96 (5'GUUUUAAAAUUAAAGUAUAA3').

[0050] In some embodiments of the isolated oligonucleotide of the present disclosure, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5'UGUACUCUCAUUGUGGAUGACG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 99 (5'UCAUCCACAAUGAGAGUACA3').

[0051] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand or the antisense strand, or both, comprise one or more modified nucleotides.

[0052] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a monomethyl-protected phosphate mimic (5'-MeEP).

[0053] In some embodiments of the isolated oligonucleotides of the present disclosure, a terminal or internal nucleotide in the sense strand or antisense strand, or both, is linked to a targeting ligand.

[0054] In some embodiments of the isolated oligonucleotides of the present disclosure, the targeting ligand comprises at least one GalNAc G1b moiety.

[0055] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the formula: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15'.

[0056] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the formula: 5'(M)o(F)o(M)5(F)1(M)1(F)4(M)93'.

[0057] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand is i) the antisense strand of a nucleic acid sequence according to SEQ ID NO: 447 (5'[MeEPmUs][fCs][fA][mA][fA][mA][fA][mA][mA][fA][mU][mG][mC][fU][mG][fU][mU][mC][mA][mGs][mCs][mA]3'); ii) the antisense strand of a nucleic acid sequence according to SEQ ID NO: 448 (5'[MeEPmUs][fCs][fA][mC][fU][mU][fU][mU][fU][mG][mU][m U][fU][mC][fA][mC][mA][mA][mAs][mCs][mA] 3'); iii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 449 (5'[MeEPmUs][fGs][fG][mA][fA][mC][fA][mC][mU][fU][mU][mU][mU][fU][mG][fU][mU][mU][mC][mAs][mCs][mA] 3'); iv) the antisense strand of the nucleic acid sequence of SEQ ID NO: 450 (5'[MeEPmUs][fUs][fU][fU][mG][fA][mA][f A][mA][mG][fG][mG][mA][mA][fC][mA][fC][mU][mU][mU][mUs][mUs][mU]3'); v) the antisense strand of the nucleic acid sequence of SEQ ID NO: 451 (5'[MeEPmUs][fCs][fA][mA][fU][mU][fU][mU][mU][fG][mU][mU][mC][fU][mC][fA][mA][mC][mU][mU][mUs][mGs][mA]3'); vi) the antisense strand of the nucleic acid sequence of SEQ ID NO: 452 (5'[MeEPmUs][ vii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 453 (5'[MeEPmUs][fAs][fU][mU][fU][mU][fA][mA][mA][fA][mC][mC][mC][fA][mA][fU][mU][mU][fU][mU][fG][mU][mU][mU][mC][mUs][mCs][mA]3'); vii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 453 (5'[MeEPmUs][fAs][fU][mU][fU][mU][fA][mA][mA][fA][mC][mC][mC][fA][mA][fU][mU][mU][mU][mU][mU][mUs][mGs][mU]3');viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 454 (5'[MeEPmUs][fAs][fU][mA][fC][mU][fU][mU][mA][fA][mU][mU][mU][fU][mA][fA][mA][mC][mCs][mCs][mA]3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 455 (5'[MeEPmUs][fUs][fA][mU][fA][mC][fU][mU][mU][f x) the antisense strand of a nucleic acid sequence of SEQ ID NO: 456 (5'[mUs][fGs][fU][mA][fC][mU][fC][mU][mC][fA][mU][mU][mG][fU][mG][fG][mA][mU][mG][mAs][mCs][mG]3'); xi) the antisense strand of a nucleic acid sequence according to SEQ ID NO: 457 (5'[EPmUs][fGs][fU][mA][fC][mU][fC][mU][mC][fA][mU][mU][mG][fU][mG][fG][mA][mU][mG][mAs][mCs][mG]3'); or xii) the antisense strand of a nucleic acid sequence according to SEQ ID NO: 458 (5'[MeEPmUs][fGs][fU][mA][fC][mU][fC][mU][mC][fA][mU][mU][mG][fU][mG][fG][mA][mU][mG][mAs][mCs][mG]3'), wherein "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate internucleotide linkage, and "MeEP" is a monomethyl protected phosphate mimic. ;

[0058] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand is: i) the sense strand of a nucleic acid sequence according to SEQ ID NO: 460 (5'[mCs][mUs][mG][mA][mA][fC][mA][fG][fC][fA][fU][mU][mU][mU][mU][mU][mU][mU][mUs][mGs][mA][Glb][Glb][Glb] 3'); ii) the sense strand of a nucleic acid sequence according to SEQ ID NO: 461 (5'[mUs][mUs][mU][mG][mU][fG][mA][fA][fA][fC][fA][mA][mA][mA] [mA][mA][mG][mUs][mGs][mA][Glb][Glb][Glb]3'); iii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 462 (5'[mUs][mGs][mA][mA][mA][fC][mA][fA][fA][fA][mA][mG][mU][mG][mU][mU][mCs][mCs][mA][Glb][Glb]3'); iv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 463 (5'[mAs][mAs][mA][mA][mG][fU][mG][fU] [fU][fC][fC][mC][mU][mU][mU][mU][mC][mAs][mAs][mA][G1b][G1b][G1b]3'); v) the sense strand of the nucleic acid sequence according to SEQ ID NO: 464 (5'[mAs][mAs][mG][mU][mU][fG][mA][fG][fA][fA][fC][mA][mA][mA][mA][mA][mU][mU][mGs][mA][G1b][G1b][G1b]3'); vi) the sense strand of the nucleic acid sequence according to SEQ ID NO: 465 (5'[mAs][mGs][ vii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 466 (5'[mAs][mAs][mA][mA][mA][fU][mU][fG][fG][fG][fU][mU][mU][mU][mA][mA][mAs][mU][mA][Glb][Glb][Glb]3'); vii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 466 (5'[mAs][mAs][mA][mA][mA][fU][mU][fG][fG][fG][fU][mU][mU][mU][mA][mA][mAs][mU][mA][Glb][Glb]3');viii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 467 (5'[mGs][mGs][mU][mU][mU][fU][mA][fA][fA][fA][fU][mU][mA][mA][mA][mG][mU][mAs][mUs][mA][Glb][Glb][Glb]3'); ix) the sense strand of the nucleic acid sequence according to SEQ ID NO: 468 (5'[mGs][mUs][mU][mU][mU][fA][mA][fA][fA][fU][fU][mA][mA][mA][mG][mU][mA][mU][mAs][mA][Glb][Glb] or x) the sense strand of a nucleic acid sequence according to SEQ ID NO: 469 (5'[mUs][mCs][mA][mU][mC][fC][mA][fC][fA][fA][fU][mG][mA][mG][mA][mG][mU][mAs][mCs][mA][Glb][Glb][Glb]3'), wherein "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate internucleotide linkage, and "Glb" is a GalNAc Glb moiety;

[0059] The present disclosure also provides vectors encoding the isolated oligonucleotides disclosed herein.

[0060] The present disclosure also provides a delivery system comprising the isolated oligonucleotide or vector disclosed herein.

[0061] The present disclosure also provides a pharmaceutical composition comprising an isolated oligonucleotide, vector, or delivery system disclosed herein and a pharmaceutically acceptable carrier, diluent, or excipient.

[0062] The present disclosure also provides kits comprising the isolated oligonucleotides, vectors, delivery systems, or pharmaceutical compositions disclosed herein.

[0063] The present disclosure also provides a method for inhibiting or downregulating the expression or levels of AGT in a subject in need thereof, comprising administering to the subject an effective amount of an isolated oligonucleotide, vector, delivery system or pharmaceutical composition disclosed herein.

[0064] The present disclosure also provides a method for inhibiting or down-regulating the expression or level of AGT in a subject in need thereof, comprising administering to the subject an effective amount of a first and at least a second oligonucleotide disclosed herein, wherein the first and at least a second oligonucleotide comprise different sequences.

[0065] The present disclosure also provides a method for treating or preventing a disease or disorder associated with aberrant or increased expression or activity of AGT, or a disease or disorder in which AGT plays a role, in a subject in need thereof, comprising administering to the subject an effective amount of an isolated oligonucleotide, vector, delivery system, or pharmaceutical composition disclosed herein. [Brief explanation of the drawings]

[0066] [Figure 1] Figure 1 is a graph showing the efficacy of the siRNA compounds listed in Table 2 in silencing human AGT in cultured Huh-7 cells at 0.02 nM. Compounds were transfected into cells at a concentration of 0.02 nM. Data are presented as the percentage of remaining human AGT mRNA compared to mock transfection, normalized to Gapdh mRNA levels (mean, + / - SEM). Each bar represents a single compound tested.

[0067] [Figure 2]Figure 2 is a graph showing the effectiveness of the siRNA compounds listed in Table 2 in silencing human AGT in cultured Huh-7 cells at 0.1 nM. Compounds were transfected into cells at 0.1 nM concentrations. Data are presented as the percentage of remaining human AGT mRNA compared to mock transfection, normalized to Gapdh mRNA levels (mean, + / - SEM). Each bar represents a single compound tested.

[0068] [Figure 3] Figure 3 is a graph showing the in vivo efficacy of the compounds listed in Table 3 in mouse HDI liver at 1 mg / kg on day 4 post-dose. Data are presented as % of remaining human AGT mRNA relative to PBS when normalized to NeoR mRNA levels (mean, + / - SEM).

[0069] [Figure 4] Figure 4 is a graph showing the in vivo dose response of the compounds listed in Table 3 in mouse HDI liver at 0.3, 1, or 3 mg / kg on day 4 post-dose. Data are presented as % of remaining human AGT mRNA relative to PBS when normalized to NeoR mRNA levels (mean, + / - SEM).

[0070] [Figure 5A] Figure 5A is a graph showing the in vivo efficacy of the compounds listed in Table 4 in cynomolgus monkeys (Macaca fascicularis) after a single subcutaneous dose of 3 mg / kg. Liver Cyno AGT mRNA was measured over time. Data were normalized to pre-dose mRNA levels for each animal. [Figure 5B] Figure 5B is a graph showing the in vivo efficacy evaluation of the compounds listed in Table 4 in cynomolgus monkeys (Macaca fascicularis) after a single subcutaneous dose of 3 mg / kg. Residual serum AGT protein was measured over time. Data were normalized to pre-dose protein levels for each animal. DETAILED DESCRIPTION OF THE INVENTION

[0071] The present disclosure provides an isolated oligonucleotide(s) that form a double-stranded region, preferably a small interfering RNA (siRNA), that can reduce AGT mRNA expression, which in turn can result in a reduced level of AGT protein expression in target cells. The oligonucleotides disclosed herein can be therapeutically applied in modulating the expression of AGT for the treatment of diseases, including, but not limited to, cardiovascular disease (CVD), hypertension, atherosclerosis, etc.

[0072] The present disclosure has identified specific regions within the AGT mRNA that provide targets for binding double-stranded oligonucleotides, such as siRNA, that result in a reduction in the expression level of AGT mRNA.

[0073] The AGT mRNA sequence described herein is the AGT mRNA sequence with accession number NM_001384479.1. [ka]

[0074] The present disclosure provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence substantially identical to a region comprising 19 to 25 nucleotides from the 5' end of an angiotensinogen (AGT) mRNA sequence according to SEQ ID NO: 1 and between any one of nucleotide positions selected from a) 9 to 29; b) 166 to 196; c) 394 to 480; d) 744 to 968; e) 1110 to 1331; f) 1410 to 1676; and g) 1726 to 1894, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region.

[0075] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising 19 to 25 nucleotides from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1 and between any one of nucleotide positions selected from a) 9 to 29; b) 166 to 196; c) 394 to 480; d) 744 to 968; e) 1110 to 1331; f) 1410 to 1676; and g) 1726 to 1894.

[0076] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region comprising 19 to 25 nucleotides from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1 to any one of nucleotide positions selected from a) 9 to 29; b) 166 to 196; c) 394 to 480; d) 744 to 968; e) 1110 to 1331; f) 1410 to 1676; and g) 1726 to 1894.

[0077] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is substantially identical to a region from the 5' end of the AGT mRNA sequence according to SEQ ID NO:1 to any one of nucleotide positions selected from 1829 to 1857.

[0078] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region from the 5' end of the AGT mRNA sequence according to SEQ ID NO:1 to any one of nucleotide positions selected from 1829 to 1857.

[0079] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between the 5' end of the AGT mRNA sequence according to SEQ ID NO:1 and any one of nucleotide positions selected from 1829 to 1857.

[0080] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is substantially identical to a region from the 5' end of the AGT mRNA sequence according to SEQ ID NO:1 to any one of nucleotide positions selected from (a) 1829-1849 and (b) 1837-1857.

[0081] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region from the 5' end of the AGT mRNA sequence according to SEQ ID NO:1 to any one of nucleotide positions selected from (a) 1829-1849 and (b) 1837-1857.

[0082] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region from the 5' end of the AGT mRNA sequence according to SEQ ID NO:1 to any one of nucleotide positions selected from (a) 1829-1849 and (b) 1837-1857.

[0083] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is substantially identical to a region between the 5' end of the AGT mRNA sequence according to SEQ ID NO:1 and any one of nucleotide positions selected from a) 166-196; b) 394-480; c) 744-968; d) 1110-1331; e) 1410-1676; and f) 1726-1894.

[0084] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region from the 5' end of the AGT mRNA sequence according to SEQ ID NO:1 to any one of nucleotide positions selected from a) 166-196; b) 394-480; c) 744-968; d) 1110-1331; e) 1410-1676; and f) 1726-1894.

[0085] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 166-196; b) 394-480; c) 744-968; d) 1110-1331; e) 1410-1676; and f) 1726-1894 from the 5' end of the AGT mRNA sequence according to SEQ ID NO:1.

[0086] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is substantially identical to a region between any one of the nucleotide positions selected from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 166-186; b) 176-196; c) 493-414; d) 460-480; e) 744-764; f) 778-798; g) 929-949; h) 948-968; i) 1110-1130; j) 1134-1154; k) 1306-1326; l) 1311-1331; m) 1410-1430; n) 1605-1629; o) 1643-1676; p) 1726-1752; q) 1785-1805; r) 1816-1894.

[0087] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 166-186; b) 176-196; c) 493-414; d) 460-480; e) 744-764; f) 778-798; g) 929-949; h) 948-968; i) 1110-1130; j) 1134-1154; k) 1306-1326; l) 1311-1331; m) 1410-143 0; n) 1605 to 1629; o) 1643 to 1676; p) 1726 to 1752; q) 1785 to 1805; r) 1816 to 1894.

[0088] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of the nucleotide positions selected from a) 166-186; b) 176-196; c) 493-414; d) 460-480; e) 744-764; f) 778-798; g) 929-949; h) 948-968; i) 1110-1130; j) 1134-1154; k) 1306-1326; l) 1311-1331; m) 1410-1430; n) 1605-1629; o) 1643-1676; p) 1726-1752; q) 1785-1805; r) 1816-1894 from the 5' end of the AGT mRNA sequence according to SEQ ID NO:1.

[0089] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence substantially identical to a region comprising the sequence from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1 to any one of nucleotide positions selected from a) 9 to 29; b) 168 to 189; c) 784 to 808; d) 1264 to 1289; e) 1607 to 1630; f) 1814 to 1835; and g) 1843 to 1882.

[0090] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising the sequence from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1 to any one of nucleotide positions selected from a) 9 to 29; b) 168 to 189; c) 784 to 808; d) 1264 to 1289; e) 1607 to 1630; f) 1814 to 1835; and g) 1843 to 1882.

[0091] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence identical to a region comprising the sequence from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1 to any one of nucleotide positions selected from a) 9 to 29; b) 168 to 189; c) 784 to 808; d) 1264 to 1289; e) 1607 to 1630; f) 1814 to 1835; and g) 1843 to 1882.

[0092] The AGT mRNA sequence according to SEQ ID NO: 1 described herein is any heterologous mRNA sequence having sufficient identity to the AGT sequence according to Accession No. NM_001384479.1 described herein to allow binding to the antisense strand of the oligonucleotides of the present disclosure.

[0093] In some embodiments of the isolated oligonucleotide of the present disclosure, the isolated oligonucleotide is capable of inducing degradation of AGT mRNA.

[0094] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand is a single-stranded RNA molecule.In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand is a single-stranded RNA molecule.In some embodiments of the isolated oligonucleotide of the present disclosure, both the sense strand and the antisense strand are single-stranded RNA molecules.

[0095] In some embodiments, the isolated oligonucleotide of the present disclosure is a small interfering RNA (siRNA). Accordingly, the present disclosure provides an siRNA, wherein the siRNA comprises a sense region and an antisense region complementary to the sense region, which together form an RNA duplex, and the sense region comprises a sequence at least 70% to 100% identical to the AGT mRNA sequence.

[0096] definition "RNAi" or "RNA interference" refers to the process of sequence-specific post-transcriptional gene silencing mediated by double-stranded RNA (dsRNA). The double-stranded RNAs siRNA (small interfering RNA), miRNA (microRNA), shRNA (short hairpin RNA), ddRNA (DNA-directed RNA), piRNA (Piwi-interacting RNA), or rasiRNA (repeat-associated siRNA), as well as modified forms thereof, can all mediate RNA interference. These dsRNA molecules may be commercially available or may be designed and prepared based on known sequence information. The antisense strand of these molecules may comprise RNA, DNA, PNA, or a combination thereof. These DNA / RNA chimeric polynucleotides include, but are not limited to, double-stranded polynucleotides composed of DNA and RNA that inhibit the expression of a target gene. These dsRNA molecules may also contain one or more modified nucleotides, which can be incorporated into either strand, as described herein.

[0097] In RNAi gene silencing or knockdown process, dsRNA is introduced into organism, which comprises a first (antisense) strand that is complementary to a part of target gene, and a second (sense) strand that is completely or partially complementary to the first antisense strand.After being introduced into organism, target gene-specific dsRNA is processed into relatively small fragments (siRNA), and then distributed throughout organism, which can reduce the messenger RNA of target gene, and can cause the phenotype that can closely resemble the phenotype that results from the complete or partial deletion of target gene.

[0098] Certain dsRNA in cells can be acted upon by the Dicer enzyme, a ribonuclease III enzyme. Dicer can process dsRNA into shorter dsRNA fragments, i.e., siRNA. RNAi also involves an endonuclease complex known as the RNA-induced silencing complex (RISC). Following cleavage by Dicer, siRNA enters the RISC complex and directly cleaves the single-stranded RNA target that has a sequence complementary to the antisense strand of the siRNA duplex. The other strand of the siRNA is the passenger strand. Cleavage of the target RNA occurs in the center of the region complementary to the antisense strand of the siRNA duplex. Therefore, siRNA can downregulate or knock down gene expression by mediating RNA interference in a sequence-specific manner.

[0099] As used herein, " target gene " or " target sequence " refers to a gene or gene sequence whose corresponding RNA is targeted for degradation by the RNAi pathway using dsRNA or siRNA as described herein.For example, to target a gene using siRNA, the siRNA comprises an antisense region that is complementary or substantially complementary to at least a portion of the target gene or sequence, and a sense strand that is complementary to the antisense strand.When introduced into a cell, the siRNA instructs the RISC complex to cleave the RNA that contains the target sequence, thereby degrading the RNA.

[0100] As used herein, "oligonucleotide," "nucleic acid," "nucleotide sequence," and "polynucleotide" are used interchangeably and encompass both RNA and DNA, including cDNA, genomic DNA, mRNA, synthetic (e.g., chemically synthesized) DNA or RNA, and chimeras of RNA and DNA. The terms polynucleotide, nucleotide sequence, or nucleic acid refer to a chain of nucleotides regardless of chain length. A nucleic acid can be double-stranded or single-stranded. If single-stranded, the nucleic acid can be the sense strand or the antisense strand. Nucleic acids can be synthesized using oligonucleotide analogs or derivatives (e.g., inosine or phosphorothioate nucleotides). Such oligonucleotides can be used, for example, to prepare nucleic acids with altered base-pairing abilities or increased nuclease resistance. The present disclosure further provides nucleic acids that are complements (which can be either full complements or partial complements) of the nucleic acids, nucleotide sequences, or polynucleotides of the present disclosure. When dsRNA is produced synthetically, less common bases such as inosine, 5-methylcytosine, 6-methyladenine, and hypoxanthine can also be used in antisense, dsRNA, and ribozyme pairing. Other modifications, such as modifications to the phosphodiester backbone or to 2'-fluoro, 2'-hydroxy, or 2'O-methyl in the ribose sugar group of the RNA, can also be made.

[0101] The term "isolated" can refer to a nucleic acid, nucleotide sequence, or polypeptide that is substantially free of cellular material, viral material, and / or culture medium (if produced by recombinant DNA technology), or chemical precursors or other chemicals (if chemically synthesized). Furthermore, an "isolated fragment" is a fragment of a nucleic acid, nucleotide sequence, or polypeptide that is not naturally occurring as a fragment and would not be found in the natural state. "Isolated" does not imply that the preparation is technically pure (homogeneous), but rather that the polypeptide or nucleic acid is sufficiently pure to provide a form that can be used for its intended purpose.

[0102] The terms "region" and "fragment" are used interchangeably and apply to oligonucleotides.

[0103] AGT mRNA sequences described herein are understood to refer to the full-length AGT mRNA nucleotide sequence unless otherwise indicated. In some embodiments, an AGT mRNA sequence can be a nucleotide sequence that is shorter in length compared to a reference nucleic acid, or a nucleotide sequence of an AGT mRNA sequence that comprises, consists essentially of, and / or consists of a nucleotide sequence of consecutive nucleotides identical or nearly identical (e.g., 60%, 70%, 80%, 90%, 92%, 95%, 98%, or 99% identical) to a reference nucleic acid or nucleotide sequence. Such nucleic acid fragments according to the present disclosure can, where appropriate, be included in a larger polynucleotide of which they are a component. In some embodiments, such fragments can comprise, consist essentially of, and / or consist of an oligonucleotide having a length of at least about 8, 10, 12, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 150, 200, or more consecutive nucleotides of a nucleic acid or nucleotide sequence according to the present disclosure.

[0104] As used herein, a "complementary" polynucleotide is one that can base-pair according to standard Watson-Crick complementarity rules. Specifically, purines base-pair with pyrimidines, forming combinations such as guanine paired with cytosine (G:C) and adenine paired with either thymine (A:T) in the case of DNA, or adenine paired with uracil (A:U) in the case of RNA. For example, the sequence "AGT" binds to the complementary sequence "TCA." It is understood that two polynucleotides can hybridize to each other even if they are not completely complementary to each other, so long as each has at least one region that is substantially complementary to the other.

[0105] As used herein, the term "substantially complementary" refers to at least 90% (e.g., 91, 92, 93, 94, 95, 96, 97, 98, or 99%) complementary to the sense strand that is substantially identical to a nucleotide sequence within a defined region of SEQ ID NO: 1. As used herein, the term "substantially complementary" means that two nucleic acid sequences are complementary over at least about 90%, 95%, or 99% of their nucleotides.

[0106] In some embodiments, two nucleic acid sequences can be complementary over at least 90%, 95%, 96%, 97%, 98%, 99% or more of their nucleotides. In some embodiments, two nucleic acid sequences can be 90%-95% complementary, 70%-100% complementary, 95%-96% complementary, 90%-100% complementary, 96%-97% complementary, 60%-80% complementary, 97%-98% complementary, 70%-90% complementary, 98%-99% complementary, 80%-100% complementary, or 99%-100% complementary.

[0107] The term "substantially complementary" can also mean that two nucleic acid sequences, a sense strand and an antisense strand, have sufficient complementarity to allow binding between the sense strand and the antisense strand to form a double-stranded region comprising 19 to 25 nucleotides in length. The term "substantially complementary" can also mean that two nucleic acid sequences can hybridize under high stringency conditions, and such conditions are well known in the art.

[0108] As used herein, the terms "substantially identical" or "sufficient identity," used interchangeably herein, refer to a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% (e.g., 70% to 80%, 8% to 90%, or 90% to 95%, or 95% to 99%, or 99% to 100%) identical to a nucleotide sequence within a defined region of SEQ ID NO:1.

[0109] As used herein, the term "identity" refers to the following comparison of sequences: To determine the percent identity of two nucleic acid sequences, the sequences can first be aligned to each other to allow for comparison of these sequences. For this purpose, for example, gaps can be inserted into the sequence of the first nucleic acid sequence, and the nucleotide can be compared with the corresponding position of the second nucleic acid sequence. If a position in the first nucleic acid sequence is occupied by the same nucleotide as that in the second sequence, the two sequences are identical at this position. The percent identity between two sequences is a function of the number of identical positions divided by the number of all positions compared in the examined sequences.

[0110] "Percent identity" or "% identity," as used interchangeably herein with respect to aligned segments of a test sequence and a reference sequence, is the percent of identical elements shared by the two aligned sequences divided by the total number of elements in the reference sequence segment, i.e., the entire reference sequence or a smaller, defined portion of the reference sequence.

[0111] "Nucleotide sequence" and "nucleic acid sequence" are used interchangeably herein unless otherwise indicated.

[0112] The percent identity of two sequences can be determined using a mathematical algorithm. A preferred, but non-limiting, example of a mathematical algorithm that can be used to compare two sequences is the algorithm of Karlin et al. (1993), PNAS USA, 90:5873-5877. Such an algorithm is incorporated into the NBLAST program, which can identify sequences with a desired identity to the sequences disclosed herein. To obtain gapped alignments, the "Gapped BLAST" program can be used, as described herein, as described in Altschul et al. (1997), Nucleic Acids Res, 25:3389-3402. When using BLAST and Gapped BLAST programs, the preset parameters of the particular program (e.g., NBLAST) can be used. Sequences can be further aligned using the Genetic Computing Group's GAP (Global Alignment Program) version 9, using a preset (BLOSUM62) matrix (values -4 to +11), with a gap open penalty of -12 (for the first zero in a gap) and a gap extension penalty of -4 (for each additional consecutive zero in a gap). After alignment, percent identity is calculated by expressing the number of matches as a percentage of the nucleic acid content in the claimed sequence. The methods described for determining percent identity of two nucleic acid sequences can also be used for encoded amino acid sequences, if desired.

[0113] Useful methods for determining sequence identity are also disclosed in Guide to Huge Computers (Martin J. Bishop, ed., Academic Press, San Diego (1994)), and Carillo, H., and Lipton, D., (Applied Math 48:1073 (1988)). More specifically, preferred computer programs for determining sequence identity include, but are not limited to, the Basic Local Alignment Search Tool (BLAST) program, publicly available from the National Center for Biotechnology Information (NCBI), National Library of Medicine, National Institutes of Health, Bethesda, Md. 20894; BLAST Manual, Altschul et al., NCBI, NLM, NIH; (Altschul et al. See, al., J. Mol. Biol. 215:403-410 (1990); the BLAST program version 2.0 or higher allows for the introduction of gaps (deletions and insertions) into the alignment; for peptide sequences, BLASTX can be used to determine sequence identity, and for polynucleotide sequences, BLASTN can be used to determine sequence identity. The percent identity can be 70% identity or greater, e.g., at least 70% identity, at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 98% identity, at least 99% identity, or 100% identity.

[0114] As used herein, "heterologous" refers to a nucleic acid sequence that originates from another species, or originates from the same species or organism but has been modified from either its original form or the form primarily expressed in the cell. Thus, a nucleotide sequence that originates from an organism or species different from the cell into which it is introduced is heterologous with respect to that cell and the progeny of that cell. Furthermore, a heterologous nucleotide sequence includes a nucleotide sequence that originates from and is inserted into the same native cell type of origin, but exists in a non-native state, e.g., in a different copy number and / or under the control of regulatory sequences different from those found in nature.

[0115] Double-stranded RNA targeting AGT The present disclosure provides an isolated oligonucleotide comprising a double-stranded RNA (dsRNA) duplex region that targets the AGT mRNA sequence for degradation. The double-stranded RNA molecule of the present disclosure can be in the form of any type of RNA interference molecule known in the art. In some embodiments, the double-stranded RNA molecule is a small interfering RNA (siRNA). In other embodiments, the double-stranded RNA molecule is a short hairpin RNA (shRNA) molecule. In other embodiments, the double-stranded RNA molecule is a Dicer substrate that is processed in cells to generate siRNA. In other embodiments, the double-stranded RNA molecule is part of a microRNA precursor molecule.

[0116] In some embodiments, the dsRNA is a small interfering RNA (siRNA) that targets the AGT mRNA sequence for degradation. In some embodiments, the siRNA targeting AGT is packaged into a delivery system (e.g., nanoparticle) described herein.

[0117] The isolated oligonucleotides of the present disclosure that target AGT for degradation can comprise a sense strand that is at least 70% identical to any fragment of AGT mRNA, for example, the AGT mRNA of SEQ ID NO: 1. In some embodiments, the sense strand comprises, or consists essentially of, a sequence at least 70%, at least 80%, at least 90%, at least 95%, or 100% identical to any fragment of SEQ ID NO: 1. The siRNAs that target AGT for degradation can comprise an antisense strand that is at least 70% identical to a sequence complementary to any fragment of AGT mRNA, for example, the AGT mRNA of SEQ ID NO: 1. In some embodiments, the antisense strand comprises, or consists essentially of, a sequence at least 70%, at least 80%, at least 90%, at least 95%, or 100% identical to a sequence complementary to any fragment of SEQ ID NO: 1. In some embodiments, the sense and antisense regions are complementary and base-pair to form an RNA duplex structure. The fragment of AGT mRNA that has percent identity to the sense region of the siRNA and is complementary to the antisense region of the siRNA can be the protein coding sequence of the mRNA, the untranslated region (UTR) of the mRNA (5'UTR or 3'UTR), or both.

[0118] In some embodiments, the isolated oligonucleotide of the present disclosure comprises a sense region and an antisense region complementary to the sense region that together form an RNA duplex, wherein the sense region comprises a sequence that is at least 70% identical to the AGT mRNA sequence. In some embodiments, the sense region is identical to the AGT mRNA sequence.

[0119] As used herein, the term "sense strand" or "sense region" refers to a nucleotide sequence of an siRNA molecule that is partially or completely complementary to at least a portion of the corresponding antisense strand or antisense region of the siRNA molecule. The sense strand of the isolated oligonucleotide of the disclosed molecule can include a nucleic acid sequence that has a certain degree of identity with a target nucleic acid sequence, such as the AGT mRNA sequence. In some cases, the sense region can have 100% identity, i.e., complete identity or homology, with the target nucleic acid sequence. In other cases, there can be one or more mismatches between the sense region and the target nucleic acid sequence. For example, there can be 1, 2, 3, 4, 5, 6, or 7 mismatches between the sense region and the target nucleic acid sequence.

[0120] As used herein, the term "antisense strand" or "antisense region" refers to the nucleotide sequence of an isolated oligonucleotide of the present disclosure that is partially or completely complementary to at least a portion of a target nucleic acid sequence. The antisense strand of an isolated oligonucleotide of the disclosed molecule can comprise a nucleic acid sequence that is complementary to at least a portion of the corresponding sense strand of the isolated oligonucleotide.

[0121] In some embodiments, the sense region comprises a sequence that is at least 70% identical, at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 97% identical, at least 99% identical, or 100% identical to the sequence of SEQ ID NO:1 or a region of SEQ ID NO:1 disclosed herein. In some embodiments, the sense region consists essentially of a sequence that is at least 70% identical, at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 97% identical, at least 99% identical, or 100% identical to the sequence of SEQ ID NO:1 or a region of SEQ ID NO:1 disclosed herein. In some embodiments, the sense region comprises a sequence identical to the sequence of SEQ ID NO:1 or a region of SEQ ID NO:1 as disclosed herein.

[0122] In some embodiments, the sense region of an isolated oligonucleotide of the present disclosure targeting AGT has one or more mismatches between the sequence of the isolated oligonucleotide and the AGT sequence. For example, the sequence of the sense region may have 1, 2, 3, 4, or 5 mismatches between the sequence of the sense region of the isolated oligonucleotide and the AGT sequence. In some embodiments, the AGT sequence is the AGT 3' untranslated region sequence (3'UTR). Without wishing to be bound by theory, it is believed that siRNAs targeting the 3'UTR have a higher mismatch tolerance compared to mismatches in isolated oligonucleotides targeting the coding region of a gene. Furthermore, the isolated oligonucleotide RNA may be tolerant to mismatches outside the seed region. As used herein, the "seed region" of an isolated oligonucleotide refers to base pairs 2 to 8 of the antisense region of the isolated oligonucleotide, i.e., the strand of the isolated oligonucleotide that is complementary to and hybridizes to the target mRNA.

[0123] In some embodiments, the antisense region comprises a sequence at least 70% identical, at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 97% identical, at least 99% identical, or 100% identical to the sequence of SEQ ID NO:1 or a sequence complementary to a region of SEQ ID NO:1 disclosed herein. In some embodiments, the antisense region consists essentially of a sequence at least 70% identical, at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 97% identical, at least 99% or 100% identical to the sequence of SEQ ID NO:1 or a sequence complementary to a region of SEQ ID NO:1. In some embodiments, the sense region consists essentially of the sequence of SEQ ID NO:1 or a sequence complementary to a region of SEQ ID NO:1.

[0124] The antisense region of the AGT-targeting isolated oligonucleotide of the present disclosure is complementary to the sense region. In some embodiments, the sense region and the antisense region are fully complementary (no mismatches). In some embodiments, the antisense region is partially complementary to the sense region, i.e., there are 1, 2, 3, 4, or 5 mismatches between the sense region and the antisense region.

[0125] Generally, the isolated oligonucleotides of the present disclosure comprise an RNA duplex about 16 to about 25 nucleotides in length. In some embodiments, the RNA duplex is about 17 to about 24 nucleotides in length, about 18 to about 23 nucleotides in length, or about 19 to about 22 nucleotides in length. In some embodiments, the RNA duplex is 19 nucleotides in length. In some embodiments, the RNA duplex is 20 nucleotides in length.

[0126] In some embodiments of the isolated oligonucleotide of the present disclosure, sense strand is a single-stranded RNA molecule.In some embodiments of the isolated oligonucleotide of the present disclosure, antisense strand is a single-stranded RNA molecule.In some embodiments of the isolated oligonucleotide of the present disclosure, both sense strand and antisense strand are single-stranded RNA molecules.In some embodiments of the isolated oligonucleotide of the present disclosure, the siRNA that targets AGT comprises two different single-stranded RNAs, the first comprises a sense region, and the second comprises an antisense region, which hybridize to form an RNA duplex.

[0127] In some embodiments, the isolated oligonucleotides of the present disclosure can have one or more overhangs from the double-stranded region. The overhangs, which are single-stranded regions that are not base-paired, can be 1 to 8 nucleotides in length or longer. The overhangs can be 3' overhangs, which have a single-stranded region of 1 to 8 nucleotides at the 3' end of the strand. The overhangs can be 5' overhangs, which have a single-stranded region of 1 to 8 nucleotides at the 5' end of the strand.

[0128] The overhangs of the isolated oligonucleotides of the present disclosure may be the same length or may be different lengths.

[0129] In some embodiments of the isolated oligonucleotide of the present disclosure, the single-stranded RNA molecule of the sense strand comprises a 3' overhang.In some embodiments, in the single-stranded RNA molecule of the sense strand, the 3' overhang comprises at least one nucleotide.In some embodiments, in the single-stranded RNA molecule of the sense strand, the 3' overhang comprises two nucleotides.

[0130] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense single-stranded RNA molecule comprises a 3' overhang. In some embodiments, in the antisense single-stranded RNA molecule, the 3' overhang comprises at least one nucleotide. In some embodiments, in the antisense single-stranded RNA molecule, the 3' overhang comprises two nucleotides.

[0131] In further embodiments, both ends of the isolated oligonucleotide of the present disclosure have an overhang, e.g., a 3' dinucleotide overhang at each end. The overhangs at the 5' and 3' ends may be of different lengths or the same length.

[0132] The overhangs of the isolated oligonucleotides of the present disclosure can comprise one or more deoxyribonucleotides, one or more ribonucleotides, or a combination of deoxyribonucleotides and ribonucleotides. In some embodiments, one or both of the overhanging nucleotides of the siRNA can be 2'-deoxyribonucleotides.

[0133] In some embodiments, the first single-stranded RNA molecule comprises a first 3' overhang. In some embodiments, the second single-stranded RNA molecule comprises a second 3' overhang. In some embodiments, the first and second 3' overhangs comprise a dinucleotide.

[0134] In some embodiments of the isolated oligonucleotides of the present disclosure, the 3' overhang comprises any one of thymidine-thymidine (dTdT), adenine-adenine (AA), cysteine-cysteine (CC), guanine-guanine (GG), or uracil-uracil (UU). In some embodiments, the isolated oligonucleotides of the present disclosure, the 3' overhang comprises a thymidine-thymidine (dTdT) or uracil-uracil (UU) overhang. In some embodiments, the 3' overhang comprises a uracil-uracil (UU) overhang. Without wishing to be bound by theory, it is believed that 3' overhangs, such as dinucleotide overhangs, enhance siRNA-mediated mRNA degradation by increasing the rate of siRNA-RISC complex formation and / or cleavage of the target mRNA by the siRNA-RISC complex.

[0135] In some embodiments, the isolated oligonucleotide of the present disclosure can have one or more blunt ends, where the double-stranded region ends without overhang, and the strand forms base pairs with the end of the double-stranded region.In some embodiments, the isolated oligonucleotide of the present disclosure can have one or more blunt ends, or can have one or more overhangs, or can have a combination of blunt ends and overhang ends.For example, the 5' end of siRNA can be blunt, and the 3' end of the same isolated oligonucleotide can comprise overhang, or vice versa.

[0136] In some embodiments, both ends of the isolated oligonucleotide of the present disclosure are blunt ended.

[0137] In some embodiments of the isolated oligonucleotides of the present disclosure, the double-stranded region comprises an antisense strand and a sense strand according to any one of the antisense and sense strand sequence pairs in Tables 1-4, as described below. [Table 1-1] [Table 1-2] [Table 1-3]

[0138] In some embodiments, the sense region comprises a sequence selected from any one of the group of sense strand / passenger strand sequences listed in Tables 1-4. In some embodiments, the antisense region comprises a sequence selected from any one of the group of antisense strand / guide strand sequences listed in Tables 1-4. In some embodiments, the sense and antisense regions comprise complementary sequences selected from the group listed in Tables 1-4.

[0139] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 2-56.

[0140] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 57-111.

[0141] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 2-56, and the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 57-111, wherein the antisense and sense strand sequences have sufficient complementarity to allow formation of a double-stranded region between the antisense and sense strands.

[0142] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1 and any one of nucleotide positions selected from 1829 to 1857, and the double-stranded region comprises i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5'UGGAACACUUUUUUGUUUCACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5'UGAAACAAAAAAGUGUUCCA3'); or ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5'UUUGAAAAGGGAACACUUUUUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5'AAAAGUGUUCCCUUUUCAAA3').

[0143] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 166-196; b) 394-480; c) 744-968; d) 1110-1331; e) 1410-1676; and f) 1726-1894 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the double-stranded region is selected from: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5'UCUCUCAUUGUGGAUGACGAGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5'UCGUCAUCCACAAUGAGAGA3'); i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5'UCGUCAUCCACAAUGAGAGA3'). i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5'UCUCACAGGUACUCUCAUUGUG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 60 (5'CAAUGAGAGUACCUGUGAGA3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5'UCAUAGCUCACUGUGCAUGCCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 61 (5'GCAUGCACAGUGAGCUAUGA3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5'UUAGAGAGAGGCCAGGGUGCCA3') ') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 62 (5'GCACCCUGGCCUCUCUCUAA3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 8 (5'UUGAAGUCCAGAGAGCGUGGGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 63 (5'CCACGCUCUCUGGACUUCAA3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 9 (5'UCUGUCAAUCUUCUCAGCAGCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 64 (5'CUGCUG vii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 10 (5'UGUCCACCCAGAACUCCUGGGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 65 (5'CCAGGAGUUCUGGGUGGACA3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5'UCAGACACUGAGGUGCUGUUGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 66 (5'AACAGCACCUCAGUGUCUGA3');ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5'UUUUGCUGGAAAGUGAGACCCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 67 (5'GGUCUCACUUUCCAGCAAAA3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5'UGUUUCUUCAUCCAGUUGAGGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 68 (5'CUCAACUGGAUGAAGAAACA3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 14 (5'UAAAAUGCUGUUCAG xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5'UAAAAAAAUGCUGUUCAGCACC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 70 (5'UGCUGAACAGCAUUUUUUUA3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5'UCAAAAAAAAAUGCUGUUCAGCA3'). strand and the sense strand of the nucleic acid sequence according to SEQ ID NO: 71 (5'CUGAACAGCAUUUUUUUUGA3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5'UCAGCAAACAGGAAUGGGCGGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 72 (5'CGCCCAUUCCUGUUUGCUGA3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 18 (5'UGAAGAAAAGGUGGGAGACUGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 73 (5'AGUCUCCCACCUU xvi) the sense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5'UUUAGAAGAAAAGGUGGGAGAC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 74 (5'CUCCCACCUUUCUUCUAAA3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 20 (5'UAUUAGAAGAAAAGGUGGGAGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 75 (5'UCCCACCUUUUCUUCUAAUA3');xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5'UGAGAAACGGCUGCUUUCCAGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 76 (5'UGGAAAGCAGCCGUUUCUCA3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5'UUUAGACCAAGGAGAAACGGCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 77 (5'CCGUUUCUCCUUGGUCUAAA3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 23 (5'UCUUAGACCAAGGA xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5'UCACUUAGACCAAGGAGAAACG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 79 (5'UUUCUCCUUGGUCUAAGUGA3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 25 (5'UAAAAUAAACCCAGCAAACUGG3'). xxiv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 26 (5'UUUCUCUAAAAUAAACCCAGCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 81 (5'CUGGGUUUAUUUUAGAGAAA3'); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 27 (5'UUUUUUGGAACAGUAGUCCCGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 82 (5'GGGACUACUGUU xxvi) the sense strand of the nucleic acid sequence according to SEQ ID NO: 28 (5'UGUUUCACAAACAAGCUGGUCG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 83 (5'ACCAGCUUGUUUGUGAAACA3'); xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 29 (5'UUUUUUUGUUUCACAAACAAGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 84 (5'UUGUUUGUGAAACAAAAAAA3');xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5'UCACUUUUUUGUUUCACAAACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 85 (5'UUUGUGAAACAAAAAAGUGA3'); xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5'UCUUGAAAAGGGAACACUUUUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 86 (5'AAAGUGUUCCCUUUUCAAGA3'); xxx) SEQ ID NO: 32 (5'UUGUUCUCAACU xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5'UAUUUUUGUUCUCAACUUGAAA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 88 (5'UCAAGUUGAGAACAAAAAUA3'); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5'UAAUUUUUGUUCUCAACUUGAA3'). strand, and the sense strand of the nucleic acid sequence according to SEQ ID NO: 89 (5'CAAGUUGAGAACAAAAAUUA3'); xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'UCAAUUUUUGUUCUCAACUUGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 90 (5'AAGUUGAGAACAAAAAUUGA3'); andxxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 36 (5'UUUUUAAAACCCAAUUUUUGUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 91 (5'CAAAAAUUG xxxv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5'UAUUUUAAAACCCAAUUUUUGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 92 (5'AAAAAUUGGGUUUUAAAAUA3'); xxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 38 (5'UAAUUUUAAAACCCAAUUUUUG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 93 (5'AAAAUUGGGUUUUAAAAUUA3');xxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 39 (5'UUUAAUUUUAAAACCCAAUUUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 94 (5'AAUUGGGUUUUAAAAUUAAA3'); xxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 40 (5'UAUACUUUAAUUUUAAAACCCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 95 (5'GGUUUUAAAAUUAAAGUAUA3'). xxxix) the antisense of the nucleic acid sequence according to SEQ ID NO: 41 (5'UUAUACUUUAAUUUUAAAACCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 96 (5'GUUUUAAAAUUAAAGUAUAA3'); or xL) the antisense of the nucleic acid sequence according to SEQ ID NO: 51 (5'UCUCAUUAGAAGAAAAGGUGGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 106 (5'CACCUUUUCUUCUAAUGAGA3');

[0144] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 9-29; b) 168-189; c) 784-808; d) 1264-1289; e) 1607-1630; f) 1814-1835; and g) 1843-1882, wherein the double-stranded region is identical to i) the antisense strand of a nucleic acid sequence according to SEQ ID NO: 42 (5'UGUAGUACCCAGAACAACGGCA3') and SEQ ID NO: 97 (5'CCGUUGUUCUGGGUACU ACA3'); ii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5'UUACUCUCAUUGUGGAUGACGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 98 (5'GUCAUCCACAAUGAGAGUAA3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5'UGUACUCUCAUUGUGGAUGACG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 99 (5'UCAUCCACAAUGAGAGUACA3'); iv) SEQ ID NO: 45 (5'UAUGAACCUG 100 (5'AGAAGAUUGACAGGUUCAUA3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 46 (5'UCUGCAUGAACCUGUCAAUCUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 101 (5'GAUUGACAGGUUCAUGCAGA3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 47 (5'UCUCAAUUUUUGCAGGUUCAGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 102 ( vii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 48 (5'UCAUUGCUCAAUUUUUGCAGGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 103 (5'CUGCAAAAAUUGAGCAAUGA3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5'UUAGAAGAAAAGGUGGGAGACU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 104 (5'UCUCCCACCUUUUCUUCUAA3');ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 50 (5'UCAUUAGAAGAAAAGGUGGGAG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 105 (5'CCCACCUUUUCUUCUAAUGA3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5'UUUAAAACCCAAUUUUUGUUCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 111 (5'AACAAAAAUUGGGUUUUAAA3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 52 (5'UUUCACAAACAAGCUGGUCGGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 107 (5'CGACCAGCUUGUUUGUGAAA3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5'UUUAAAACCCAAUUUUUGUUCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 111 (5'AACAAAAAUUGGGUUUUAAA3'). xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 54 (5'UCUCAACUUGAAAAGGGAACAC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 109 (5'GUUCCCUUUUCAAGUUGAGA3'); or xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5'UAAAACCCAAUUUUUGUUCUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 110 (5'AGAACAAAAAUUGGGUUUUA3');

[0145] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a sequence identical to a region comprising the sequence between any one of nucleotide positions selected from a) 9 to 29; b) 166 to 196; c) 394 to 480; d) 744 to 968; e) 1110 to 1331; f) 1410 to 1676; and g) 1726 to 1894 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates expression of AGT mRNA by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45%, or 45% to 50%) at a dose of 0.02 nM.

[0146] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a sequence identical to a region comprising a sequence between any one of nucleotide positions selected from a) 9 to 29; b) 166 to 196; c) 394 to 480; d) 744 to 968; e) 1110 to 1331; f) 1410 to 1676; and g) 1726 to 1894 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates expression of AGT mRNA by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45%, or 45% to 50%) at a dose of 0.02 nM and attenuates expression of AGT mRNA by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45%, or 45% to 50%) at a dose of 0.02 nM. The double-stranded region is selected from the group consisting of: i) an antisense strand of the nucleic acid sequence of SEQ ID NO: 5 (5'UCUCACAGGUACUCUCAUUGUG3') and a sense strand of the nucleic acid sequence of SEQ ID NO: 60 (5'CAAUGAGAGUACCUGUGAGA3'); ii) an antisense strand of the nucleic acid sequence of SEQ ID NO: 6 (5'UCAUAGCUCACUGUGCAUGCCA3') and a sense strand of the nucleic acid sequence of SEQ ID NO: 61 (5'GCAUGCACAGUGAGCUAUGA3'); iii) an antisense strand of the nucleic acid sequence of SEQ ID NO: 7 (5'UUAGAGAGAGGCCAGGGUGCCA3') and a sense strand of the nucleic acid sequence of SEQ ID NO: 62 (5'GCACCCUGGCCUCUCUCUAA3') ) the sense strand of the nucleic acid sequence according to SEQ ID NO: 8 (5'UUGAAGUCCAGAGAGCGUGGGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 63 (5'CCACGCUCUCUGGACUUCAA3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 9 (5'UCUGUCAAUCUUCUCAGCAGCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 64 (5'CUGCUGAGAAGAUUGACAGA3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 10 (5'UGUCCACCCAGAACUCCUGGGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 65 (5'CCAGGAGUUCUGGGUGGACA3');vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5'UCAGACACUGAGGUGCUGUUGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 66 (5'AACAGCACCUCAGUGUCUGA3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5'UUUUGCUGGAAAGUGAGACCCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 67 (5'GGUCUCACUUUCCAGCAAAA3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5'UGUUUCUUCAU x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5'UCAGCAAACAGGAAUGGGCGGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 72 (5'CGCCCAUUCCUGUUUGCUGA3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 18 (5'UGAAGAAAAGGUGGGAGACUGG3'). strand and the sense strand of the nucleic acid sequence according to SEQ ID NO: 73 (5'AGUCUCCCACCUUUUCUUCA3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5'UUUAGAAGAAAAGGUGGGAGAC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 74 (5'CUCCCACCUUUUCUUCUAAA3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5'UGAGAAACGGCUGCUUUCCAGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 76 (5'UGGAAAGCAG xiv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5'UUUAGACCAAGGAGAAACGGCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 77 (5'CCGUUUCUCCUUGGUCUAAA3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 23 (5'UCUUAGACCAAGGAGAAACGGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 78 (5'CGUUUCUCCUUGGUCUAAGA3');xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5'UCACUUAGACCAAGGAGAAACG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 79 (5'UUUCUCCUUGGUCUAAGUGA3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5'UAAAACCCAAUUUUUGUUCUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 110 (5'AGAACAAAAAUUGGGUUUUA3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 27 (5'UUUUUUGGAA xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 32 (5'UUGUUCUCAACUUGAAAAGGGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 87 (5'CCUUUUCAAGUUGAGAACAA3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5'UAUUUUUGUUCUCAACUUGAAA3'). xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5'UAAUUUUUGUUCUCAACUUGAA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 89 (5'CAAGUUGAGAACAAAAAUUA3'); xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 36 (5'UUUUUAAAACCCAAUUUUUGUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 91 (5'CAAAAAUUGGGU xxiii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 38 (5'UAAUUUUAAAACCCAAUUUUUG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 93 (5'AAAAUUGGGUUUUAAAAUUA3'); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 39 (5'UUUAAUUUUAAAACCCAAUUUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 94 (5'AAUUGGGUUUUAAAAUUAAA3');xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 41 (5'UUAUACUUUAAUUUUAAAACCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 96 (5'GUUUUAAAAUUAAAGUAUAA3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 42 (5'UGUAGUACCCAGAACAACGGCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 97 (5'CCGUUGUUCUGGGUACUACA3'); xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 47 (5'UCUCAAUUUUUGCAG XXVIII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 48 (5'UCAUUGCUCAAUUUUUGCAGGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 103 (5'CUGCAAAAAUUGAGCAAUGA3'); XXIX) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 51 (5'UCUCAUUAGAAGAAAAGGUGGG3'). , and the sense strand of the nucleic acid sequence according to SEQ ID NO: 106 (5'CACCUUUUCUUCUAAUGAGA3'); xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 52 (5'UUUCACAAACAAGCUGGUCGGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 107 (5'CGACCAGCUUGUUUGUGAAA3'); xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5'UUUAAAACCCAAUUUUUGUUCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 111 (5'AACAAAAAUUGGGUU xxxii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 25 (5'UAAAAUAAACCCAGCAAACUGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 80 (5'AGUUUGCUGGGUUUAUUUUA3'); or xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 26 (5'UUUCUCUAAAAUAAACCCAGCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 81 (5'CUGGGUUUAUUUUAGAGAAA3');

[0147] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a sequence identical to a region comprising the sequence between any one of nucleotide positions selected from a) 9 to 29; b) 166 to 196; c) 394 to 480; d) 744 to 968; e) 1110 to 1331; f) 1410 to 1676; and g) 1726 to 1894 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide, at a dose of 0.02 nM, inhibits AGT Attenuate mRNA expression by at least 50% (e.g., 50%-55%, 55%-60%, 60%-65%, 65%-70%, 70%-75%, 75%-80%, 80%-85%, 85%-90%, 90%-95%, or 95%-99%, 99%-100%).

[0148] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence identical to a region comprising a sequence between any one of nucleotide positions selected from a) 9 to 29; b) 166 to 196; c) 394 to 480; d) 744 to 968; e) 1110 to 1331; f) 1410 to 1676; and g) 1726 to 1894 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region ... AGT mRNA sequence according to SEQ ID NO: 1. The double-stranded region was selected from the group consisting of: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5'UGGAACACUUUUUUGUUUCACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5'UGAAACAAAAAAGUGUUCCA3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5'UUUGAAAAGGGAACACUUUUUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5'AAAAGUGUUCCCUUUUCAAA3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5'UCUCUCAUUGUGGAUGACGAGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5'UCGUCAUCCACAAUGAGAGA3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5'UAAAAAAAUGCUGUUCAGCA CC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 70 (5'UGCUGAACAGCAUUUUUUUA3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5'UCAAAAAAAAUGCUGUUCAGCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 71 (5'CUGAACAGCAUUUUUUUUGA3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 20 (5'UAUUAGAAGAAAAGGUGGGAGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 75 (5'UCCCACCUUUUCUUCUAAUA3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 29 (5'UUUUUUUGUUUCACAAACAAGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 84 (5'UUGUUUGUGAAACAAAAAAA3');viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5'UCACUUUUUUGUUUCACAAACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 85 (5'UUUGUGAAACAAAAAAGUGA3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5'UCUUGAAAAGGGAACACUUUUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 86 (5'AAAGUGUUCCCUUUUCAAGA3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'UCAAUUUUUGUUCU xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5'UAUUUUAAAACCCAAUUUUUGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 92 (5'AAAAAUUGGGUUUUAAAAUA3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 40 (5'UAUACUUUAAUUUUAAAACCCA3'). , and the sense strand of the nucleic acid sequence according to SEQ ID NO: 95 (5'GGUUUUAAAAUUAAAGUAUA3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5'UUACUCUCAUUGUGGAUGACGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 98 (5'GUCAUCCACAAUGAGAGUAA3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5'UGUACUCUCAUUGUGGAUGACG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 99 (5'UCAUCCACAAUG xv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 46 (5'UCUGCAUGAACCUGUCAAUCUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 101 (5'GAUUGACAGGUUCAUGCAGA3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5'UUAGAAGAAAAGGUGGGAGACU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 104 (5'UCUCCCACCUUUUCUUCUAA3');xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 50 (5'UCAUUAGAAGAAAAGGUGGGAG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 105 (5'CCCACCUUUUCUUCUAAUGA3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 54 (5'UCUCAACUUGAAAAGGGAACAC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 109 (5'GUUCCCUUUUCAAGUUGAGA3'); the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5'UAAAAAAAUGCUGUUCAGCACC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 70 (5'UGCUGAACAGCAUUUUUUUA3'); or the antisense strand of the nucleic acid sequence according to SEQ ID NO: 45 (5'UAUGAACCUGUCAAUCUUCUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 100 (5'AGAAGAUUGACAGGUUCAUA3'). ;

[0149] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a sequence identical to a region comprising the sequence from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1 to any one of nucleotide positions selected from a) 9 to 29; b) 166 to 196; c) 394 to 480; d) 744 to 968; e) 1110 to 1331; f) 1410 to 1676; and g) 1726 to 1894, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide at a dose of 0.1 nM attenuates AGT mRNA expression induced by the isolated oligonucleotide of the present disclosure by 50% to 75% (e.g., 50% to 55%, 55% to 60%, 60% to 65%, 65% to 70%, or 70% to 75%).

[0150] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a sequence identical to a region comprising a sequence between any one of nucleotide positions selected from a) 9 to 29; b) 166 to 196; c) 394 to 480; d) 744 to 968; e) 1110 to 1331; f) 1410 to 1676; and g) 1726 to 1894 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region ... The double-stranded region attenuates mRNA expression by at least 50%, and the double-stranded region is selected from the group consisting of: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5'UGGAACACUUUUUUGUUUCACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5'UGAAACAAAAAAGUGUUCCA3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5'UUUGAAAAGGGAACACUUUUUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5'AAAAGUGUUCCCUUUUCAAA3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5'UCUCUCAUUGUGGAUGACGAGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5'UCGUCAUCCACAAUGAGAGA3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5'UCUCACAGGUACUCUCAUUGUG3') ) and the sense strand of the nucleic acid sequence according to SEQ ID NO: 60 (5'CAAUGAGAGUACCUGUGAGA3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5'UCAUAGCUCACUGUGCAUGCCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 61 (5'GCAUGCACAGUGAGCUAUGA3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5'UUAGAGAGAGGCCAGGGUGCCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 62 (5'GCACCCUGGCCUCUCUCUAA3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 8 (5'UUGAAGUCCAGAGAGCGUGGGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 63 (5'CCACGCUCUCUGGACUUCAA3');viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 9 (5'UCUGUCAAUCUUCUCAGCAGCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 64 (5'CUGCUGAGAAGAUUGACAGA3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 10 (5'UGUCCACCCAGAACUCCUGGGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 65 (5'CCAGGAGUUCUGGGUGGACA3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5'UCAGACACUGAGGU xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5'UAAAACCCAAUUUUUGUUCUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 110 (5'AGAACAAAAAUUGGGUUUUA3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5'UUUUGCUGGAAAGUGAGACCCU3'). strand and the sense strand of the nucleic acid sequence according to SEQ ID NO: 67 (5'GGUCUCACUUUCCAGCAAAA3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5'UGUUUCUUCAUCCAGUUGAGGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 68 (5'CUCAACUGGAUGAAGAAACA3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 14 (5'UAAAAUGCUGUUCAGCACCUCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 69 (5'AGGUGCUGAA xv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5'UAAAAAAAUGCUGUUCAGCACC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 70 (5'UGCUGAACAGCAUUUUUUUA3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 27 (5'UUUUUUGGAACAGUAGUCCCGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 82 (5'GGGACUACUGUUCCAAAAAA3');xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5'UCAAAAAAAAUGCUGUUCAGCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 71 (5'CUGAACAGCAUUUUUUUUGA3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5'UCAGCAAACAGGAAUGGGCGGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 72 (5'CGCCCAUUCCUGUUUGCUGA3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 18 (5'UGAAGAAAAG xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5'UUUAGAAGAAAAGGUGGGAGAC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 74 (5'CUCCCACCUUUUCUUCUAAA3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 20 (5'UAUUAGAAGAAAAGGUGGGAGA3'). xxii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5'UGAGAAACGGCUGCUUUCCAGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 76 (5'UGGAAAGCAGCCGUUUCUCA3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5'UUUAGACCAAGGAGAAACGGCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 77 (5'CCGUUUCUCC xxiv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 23 (5'UCUUAGACCAAGGAGAAACGGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 78 (5'CGUUUCUCCUUGGUCUAAGA3'); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 25 (5'UAAAAUAAACCCAGCAAACUGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 80 (5'AGUUUGCUGGGUUUAUUUUA3');xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5'UCACUUAGACCAAGGAGAAACG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 79 (5'UUUCUCCUUGGUCUAAGUGA3'); xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 26 (5'UUUCUCUAAAAUAAACCCAGCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 81 (5'CUGGGUUUAUUUUAGAGAAA3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 28 (5'UGUUUCACAA xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 29 (5'UUUUUUUGUUUCACAAACAAGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 84 (5'UUGUUUGUGAAACAAAAAAA3'); xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5'UCACUUUUUUGUUUCACAAACA3'). xxxi) the sense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5'UCUUGAAAAGGGAACACUUUUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 86 (5'AAAGUGUUCCCUUUUCAAGA3'); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 32 (5'UUGUUCUCAACUUGAAAAGGGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 87 (5'CCUUUUCAAGUU XXXIII) the sense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5'UAUUUUUGUUCUCAACUUGAAA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 88 (5'UCAAGUUGAGAACAAAAAUA3'); XXXIV) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5'UAAUUUUUGUUCUCAACUUGAA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 89 (5'CAAGUUGAGAACAAAAAUUA3');xxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'UCAAUUUUUGUUCUCAACUUGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 90 (5'AAGUUGAGAACAAAAAUUGA3'); xxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 36 (5'UUUUUAAAACCCAAUUUUUGUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 91 (5'CAAAAAUUGGGUUUUAAAAA3'); xxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5'UAUUUUAAAAC xxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 38 (5'UAAUUUUAAAACCCAAUUUUUG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 93 (5'AAAAUUGGGUUUUAAAAUUA3'); xxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 39 (5'UUUAAUUUUAAAACCCAAUUUU3'). xL) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 40 (5'UAUACUUUAAUUUUAAAACCCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 95 (5'GGUUUUAAAAUUAAAGUAUA3'); xL) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 41 (5'UUAUACUUUAAUUUUAAAACCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 96 (5'GUUUUAAAAUUAAA xLii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 42 (5'UGUAGUACCCAGAACAACGGCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 97 (5'CCGUUGUUCUGGGUACUACA3') (63.2); xLiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5'UUACUCUCAUUGUGGAUGACGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 98 (5'GUCAUCCACAAUGAGAGUAA3');xLiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5'UGUACUCUCAUUGUGGAUGACG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 99 (5'UCAUCCACAAUGAGAGUACA3'); xLv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 45 (5'UAUGAACCUGUCAAUCUUCUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 100 (5'AGAAGAUUGACAGGUUCAUA3'); xLvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 46 (5'UCUGCAUGAACCUGUCAA xLvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 47 (5'UCUCAAUUUUUGCAGGUUCAGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 102 (5'UGAACCUGCAAAAAUUGAGA3'); xLviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 48 (5'UCAUUGCUCAAUUUUUGCAGGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 103 (5'CUGC; xLix) the sense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5'UUAGAAGAAAAGGUGGGAGACU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 104 (5'UCUCCCACCUUUUCUUCUAA3'); L) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 50 (5'UCAUUAGAAGAAAAGGUGGGAG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 105 (5'CCCACCUUUUCUUCUAAUGA3'); Li) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 51 (5'UCUCAUUAGAAGAAAAGGUGGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 106 (5'CACCUUUUCUUCUAAUGAGA3'); Lii) SEQ ID NO: 52 (5'UUUCACAAACAAGCUGGUCGGU3'). and the sense strand of the nucleic acid sequence according to SEQ ID NO: 107 (5'CGACCAGCUUGUUUGUGAAA3'); Liii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 53 (5'UUUUCACAAACAAGCUGGUCGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 108 (5'GACCAGCUUGUUUGUGAAAA3'); Liv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 54 (5'UCUCAACUUGAAAAGGGAACAC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 109 (5'GUUCCCUUUUCAAGUUGAGA3'); or Lv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5'UUUAAAACCCAAUUUUUGUUCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 111 (5'AACAAAAAUUGGGUUUUAAA3').

[0151] The present disclosure also provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand is selected from the group consisting of: a) 11-42; b) 144-215; c) 264-284; d) 303-323; e) 325-345; f) 355-405; g) 441-481; h) 503-552; i) 560-580; j) 690-731; k) 742-802; l) 863-883; m) 922-966; n) 1036-1056; o) 1099-1153; p) 1189-1209; q) 1233-1255; r) 1258-1282; and ad) 2075-2095. The antisense strand comprises a nucleotide sequence that is substantially identical to a region comprising 19 to 25 nucleotides between any one of nucleotide positions selected from s) 1300-1367; t) 1403-1465; u) 1479-1517; v) 1601-1624; w) 1631-1651; x) 1722-1753; y) 1756-1861; z) 1863-1890; aa) 1901-1948; ab) 2017-2047; ac) 2049-2071; and ad) 2075-2095, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region.

[0152] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand is selected from the group consisting of from the 5' end of the angiotensinogen (AGT) mRNA sequence according to SEQ ID NO: 1: a) 11-42; b) 144-215; c) 264-284; d) 303-323; e) 325-345; f) 355-405; g) 441-481; h) 503-552; i) 560-580; j) 690-731; k) 742-802; l) 863-883; m) 922-966; n) 1036-1056; o) 1099-1153; p) 1189-1209; q) 1233-1255; r) 1258-1282; s) 1300-1367; t) and ad) 2075-2095, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide comprises a nucleotide sequence substantially identical to a region comprising 19 to 25 nucleotides between any one of nucleotide positions selected from 1403-1465; u) 1479-1517; v) 1601-1624; w) 1631-1651; x) 1722-1753; y) 1756-1861; z) 1863-1890; aa) 1901-1948; ab) 2017-2047; ac) 2049-2071; ... isolated oligonucleotide comprises a nucleotide sequence substantially identical to a region comprising 19 to 25 nucleotides between any one of nucleotide positions selected from 1403-1465; u) 1479-1517; Attenuate mRNA expression by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45%, or 45% to 50%).

[0153] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand is selected from the group consisting of from the 5' end of the angiotensinogen (AGT) mRNA sequence according to SEQ ID NO: 1: a) 11-42; b) 144-215; c) 264-284; d) 303-323; e) 325-345; f) 355-405; g) 441-481; h) 503-552; i) 560-580; j) 690-731; k) 742-802; l) 863-883; m) 922-966; n) 1036-1056; o) 1099-1153; p) 1189-1209; q) 1233-1255; r) 1258-1282; s) 1300-1367; t a) 1403-1465; u) 1479-1517; v) 1601-1624; w) 1631-1651; x) 1722-1753; y) 1756-1861; z) 1863-1890; aa) 1901-1948; ab) 2017-2047; ac) 2049-2071; and ad) 2075-2095, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide comprises a nucleotide sequence substantially identical to a region comprising 19-25 nucleotides between any one of nucleotide positions selected from AGT at a dose of 0.02 nM. The mRNA expression is attenuated by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45%, or 45% to 50%), and the double-stranded region is composed of i) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 237 (5'UCUGUAGUACCCAGAACAACGG3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 404 (5'GUUGUUCUGGGUACUACAGA3'); ii) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 113 ( iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 126 (5'UCACAGGUACUCUCAUUGUGGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 293 (5'CACAAUGAGAGUACCUGUGA3');iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 128 (5'UCAUUGGCCUUUGCCAGCUGCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 295 (5'CAGCUGGCAAAGGCCAAUGA3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 268 (5'UCUCAACUUGUCUUCGGUGUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 435 (5'ACACCGAAGACAAGUUGAGA3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 130 (5'UAGAAGUUGGCCAG vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 131 (5'UCAAGAAGUUGGCCAGCAUCCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 298 (5'GAUGCUGGCCAACUUCUUGA3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 132 (5'UGGAAGCCCAAGAAGUUGGCCA3'). ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 133 (5'UAUAUACGGAAGCCCAAGAAGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 300 (5'UUCUUGGGCUUCCGUAUAUA3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 134 (5'UUAUAUACGGAAGCCCAAGAAG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 301 (5'UCUUGGGCUUC CGUAUAUAA3'); xi) the sense strand of the nucleic acid sequence according to SEQ ID NO: 137 (5'UAUGCCAUAUAUACGGAAGCCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 304 (5'GCUUCCGUAUAUAUGGCAUA3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 145 (5'UGUGCCAAAGACAGCCGUUGGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 312 (5'CAACGGCUGUCUUUGGCACA3');xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 240 (5'UAUAGAGAGAGGCCAGGGUGCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 407 (5'CACCCUGGCCUCUCUCUAUA3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 241 (5'UGAUUGCCUGUAGCCUGUCAGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 408 (5'UGACAGGCUACAGGCAAUCA3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 242 (5'UCAGUUCUUGUC xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 243 (5'UUAUAGAGAGCCAGGCCCUGCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 410 (5'CAGGGCCUGGCUCUCUAUAA3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 156 (5'UGAACCUGUCAAUCUUCUCAGC3'). xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 245 (5'UGUAGGUGUUGAAAGCCAGGGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 412 (5'CCUGGCUUUCAACACCUACA3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 246 (5'UCAGAACUCCUGGGGCUCGGCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 413 (5'CCGAGCCC xx) the sense strand of the nucleic acid sequence according to SEQ ID NO: 160 (5'UGACACUGAGGUGCUGUUGUCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 327 (5'ACAACAGCACCUCAGUGUCA3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 247 (5'UCUCUCAGUGAAGGGCACUUGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 414 (5'AAGUGCCCUUCACUGAGAGA3');xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 165 (5'UAAGUGAGACCCUCCACCUUGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 332 (5'AAGGUGGAGGGUCUCACUUA3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 167 (5'UGGAAAGUGAGACCCUCCACCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 334 (5'GUGGAGGGUCUCACUUUCCA3'); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 168 (5'UCUGGAAAGU xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 169 (5'UGUUUUGCUGGAAAGUGAGACC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 336 (5'UCUCACUUUCCAGCAAAACA3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 170 (5'UGAGUUUUGCUGGAAAGUGAGA3'). xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 171 (5'UAGUUGAGGGAGUUUUGCUGGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 338 (5'CAGCAAAACUCCCUCAACUA3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 172 (5'UCAGUUGAGGGAGUUUUGCUGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 339 (5'AGCAAAACUCCCUCAACUA3'). xxix) the sense strand of the nucleic acid sequence according to SEQ ID NO: 176 (5'UUUUCUUCAUCCAGUUGAGGGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 343 (5'CCUCAACUGGAUGAAGAAAA3'); xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 248 (5'UUAAGAUCCUUGCAGCACCAGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 415 (5'UGGUGCUGCAAGGAUCUUAA3');xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 177 (5'UGAAUGGCGGGCAGCUCAGCCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 344 (5'GCUGAGCUGCCCGCCAUUCA3'); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 179 (5'UUUUUGCAGGUUCAGCUCGGUG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 346 (5'CCGAGCUGAACCUGCAAAAA3'); xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 180 (5'UUUUUUGCAG xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 269 (5'UCUCUCAUCCGCUUCAAGCUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 436 (5'AGCUUGAAGCGGAUGAGAGA3'); xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 270 (5'UCUCUCUCAUCCGCUUCAAGCU3'). xxxiv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 186 (5'UGACUCUGUGGGCUCUCUCUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 353 (5'AGAGAGAGCCCACAGAGUCA3'); xxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 187 (5'UUAGACUCUGUGGGCUCUCUCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 354 (5'AGAGAGCCCA xxxvi) the sense strand of the nucleic acid sequence according to SEQ ID NO: 254 (5'UCAAACAGGAAUGGGCGGUUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 421 (5'AACCGCCCAUUCCUGUUUGA3'); xxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 190 (5'UAUCAUACACAGCAAACAGGAA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 357 (5'CCUGUUUGCUGUGUAUGAUA3');xxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 191 (5'UGAUCAUACACAGCAAACAGGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 358 (5'CUGUUUGCUGUGUAUGAUCA3'); xxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 195 (5'UCUGGGGCCCUGGCCUCAUGCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 362 (5'CAUGAGGCCAGGGCCCCAGA3'); xL ) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 196 (5'UGUGUUCUGGGGCCCUGGCCUC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 363 (5'GGCCAGGGCCCCAGAACACA3'); xLi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 200 (5'UAGAAAAGGUGGGAGACUGGGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 367 (5'CCAGUCUCCCACCUUUUCUA3'); xLii) SEQ ID NO: 20; xLiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 259 (5'UCUAAAAUAAACCCAGCAAACU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 426 (5'UUUGCUGGGUUUAUUUUAGA3'); xLiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 202 (5'UAUUCUCUAAAAUAAAC xLv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 272 (5'UUUUGGAACAGUAGUCCCGCGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 439 (5'GCGGGACUACUGUUCCAAAA3'); xLvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 273 (5'UUUUUGGAACAGUAGUCCCGCG3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 440 (5'CGGGACUACUGUUCCAAAAA3'); Lvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 274 (5'UCUUUUUGGAACAGUAGUCCCG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 441 (5'GGACUACUGUUCCAAAAAGA3'); xLviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 275 (5'UUUCUUUUUGGAACAGUAGUCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 442 (5'ACUACUGUU Lix) the sense strand of the nucleic acid sequence according to SEQ ID NO: 207 (5'UGUCGGUUGGAAUUCUUUUUGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 374 (5'AAAAAGAAUUCCAACCGACA3'); L) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 208 (5'UCAAACAAGCUGGUCGGUUGGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 375 (5'CAACCGACCAGCUUGUUUGA3');Li) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 211 (5'UUUUUUGUUUCACAAACAAGCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 378 (5'CUUGUUUGUGAAACAAAAAA3'); Lii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 212 (5'UAAAAGGGAACACUUUUUUGUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 379 (5'CAAAAAAGUGUUCCCUUUUA3'); Liii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 217 (5'UUUUAAAACCCA Liv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 219 (5'UCUUUAAUUUUAAAACCCAAUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 386 (5'UUGGGUUUUAAAAUUAAAGA3'); Lv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 220 (5'UAUACAAACCGAAGGCAAUGCA3'). strand and the sense strand of the nucleic acid sequence according to SEQ ID NO: 387 (5'CAUUGCCUUCGGUUUGUAUA3'); Lvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 221 (5'UAAUACAAACCGAAGGCAAUGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 388 (5'AUUGCCUUCGGUUUGUAUUA3'); Lvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 223 (5'UCUAAAUACAAACCGAAGGCAA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 390 (5'GCCUUCGGUUU Lviii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 224 (5'UCACUAAAUACAAACCGAAGGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 391 (5'CUUCGGUUUGUAUUUAGUGA3'); Lix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 225 (5'UAAGACACUAAAUACAAACCGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 392 (5'GGUUUGUAUUUAGUGUCUUA3');Lx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 226 (5'UCAAGACACUAAAUACAAACCG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 393 (5'GUUUGUAUUUAGUGUCUUGA3'); Lxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 235 (5'UGAGAAAUAACCAGCUAUGGUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 402 (5'CCAUAGCUGGUUAUUUCUCA3'); or Lxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 236 (5'UAAGACGUUUAUUACUAACACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 403 (5'UGUUAGUAAUAAACGUCUUA3');

[0154] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand is selected from the group consisting of from the 5' end of the angiotensinogen (AGT) mRNA sequence according to SEQ ID NO: 1: a) 11-42; b) 144-215; c) 264-284; d) 303-323; e) 325-345; f) 355-405; g) 441-481; h) 503-552; i) 560-580; j) 690-731; k) 742-802; l) 863-883; m) 922-966; n) 1036-1056; o) 1099-1153; p) 1189-1209; q) 1233-1255; r) 1258-1282; s) 1300-1367; t a) 1403-1465; u) 1479-1517; v) 1601-1624; w) 1631-1651; x) 1722-1753; y) 1756-1861; z) 1863-1890; aa) 1901-1948; ab) 2017-2047; ac) 2049-2071; and ad) 2075-2095, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide comprises a nucleotide sequence substantially identical to a region comprising 19-25 nucleotides between any one of nucleotide positions selected from AGT at a dose of 0.02 nM. Attenuate mRNA expression by at least 50% (e.g., 50%-55%, 55%-60%, 60%-65%, 65%-70%, 70%-75%, 75%-80%, 80%-85%, 85%-90%, 90%-95%, or 95%-100%).

[0155] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand is selected from the group consisting of from the 5' end of the angiotensinogen (AGT) mRNA sequence according to SEQ ID NO: 1: a) 11-42; b) 144-215; c) 264-284; d) 303-323; e) 325-345; f) 355-405; g) 441-481; h) 503-552; i) 560-580; j) 690-731; k) 742-802; l) 863-883; m) 922-966; n) 1036-1056; o) 1099-1153; p) 1189-1209; q) 1233-1255; r) 1258-1282; s) 1300-1367; t a) 1403-1465; u) 1479-1517; v) 1601-1624; w) 1631-1651; x) 1722-1753; y) 1756-1861; z) 1863-1890; aa) 1901-1948; ab) 2017-2047; ac) 2049-2071; and ad) 2075-2095, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide comprises a nucleotide sequence substantially identical to a region comprising 19-25 nucleotides between any one of nucleotide positions selected from AGT at a dose of 0.02 nM. Increase mRNA expression by at least 50% (e.g., 50%-55%, 55%-60%, 60%-65%, 65%-70%).The double-stranded region is attenuated by 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100%, and the double-stranded region is selected from the group consisting of i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 157 (5'UUUGUCCACCCAGAACUCCUGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 324 (5'AGGAGUUCUGGGUGGACAAA3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5'UUAGAAGAAAAGGUGGGAGACU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 104 (5'UCUCCCACCUUUUCUUCUAA3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 206 (5'UUAAACACU iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 214 (5'UCAACUUGAAAAGGGAACACUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 381 (5'GUGUUCCCUUUCAAGUUGA3'); or v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 218 (5'UUUUAAUUUUAAAACCCAAUUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 385 (5'AUUGGGUUUUAAAAUUAAAA3').

[0156] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand is selected from the group consisting of from the 5' end of the angiotensinogen (AGT) mRNA sequence according to SEQ ID NO: 1: a) 11-42; b) 144-215; c) 264-284; d) 303-323; e) 325-345; f) 355-405; g) 441-481; h) 503-552; i) 560-580; j) 690-731; k) 742-802; l) 863-883; m) 922-966; n) 1036-1056; o) 1099-1153; p) 1189-1209; q) 1233-1255; r) 1258-1282; s) 1300-1367; t a) 1403-1465; u) 1479-1517; v) 1601-1624; w) 1631-1651; x) 1722-1753; y) 1756-1861; z) 1863-1890; aa) 1901-1948; ab) 2017-2047; ac) 2049-2071; and ad) 2075-2095, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide comprises a nucleotide sequence substantially identical to a region comprising 19-25 nucleotides between any one of nucleotide positions selected from ... Attenuate mRNA expression by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45%, or 45% to 50%).

[0157] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand is selected from the group consisting of from the 5' end of the angiotensinogen (AGT) mRNA sequence according to SEQ ID NO: 1: a) 11-42; b) 144-215; c) 264-284; d) 303-323; e) 325-345; f) 355-405; g) 441-481; h) 503-552; i) 560-580; j) 690-731; k) 742-802; l) 863-883; m) 922-966; n) 1036-1056; o) 1099-1153; p) 1189-1209; q) 1233-1255; r) 1258-1282; s) 1300-1367; t a) 1403-1465; u) 1479-1517; v) 1601-1624; w) 1631-1651; x) 1722-1753; y) 1756-1861; z) 1863-1890; aa) 1901-1948; ab) 2017-2047; ac) 2049-2071; and ad) 2075-2095, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide comprises a nucleotide sequence substantially identical to a region comprising 19-25 nucleotides between any one of nucleotide positions selected from AGT at a dose of 0.1 nM. The mRNA expression is attenuated by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45%, or 45% to 50%), and the double-stranded region is composed of i) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 237 (5'UCUGUAGUACCCAGAACAACGG3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 404 (5'GUUGUUCUGGGUACUACAGA3'); ii) a nucleic acid sequence according to SEQ ID NO: 128 ( iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 145 (5'UGUGCCAAAGACAGCCGUUGGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 312 (5'CAACGGCUGUCUUUGGCACA3');iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 240 (5'UAUAGAGAGAGGCCAGGGUGCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 407 (5'CACCCUGGCCUCUCUCUAUA3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 241 (5'UGAUUGCCUGUAGCCUGUCAGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 408 (5'UGACAGGCUACAGGCAAUCA3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 242 (5'UCAGUUCUUGUCCU vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 243 (5'UUAUAGAGAGCCAGGCCCUGCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 410 (5'CAGGGCCUGGCUCUCUAUAA3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 245 (5'UGUAGGUGUUGAAAGCCAGGGU3'). ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 246 (5'UCAGAACUCCUGGGGCUCGGCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 413 (5'CCGAGCCCCAGGAGUUCUGA3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 157 (5'UUUGUCCACCCAGAACUCCUGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 324 (5'AGGAGUUCUGG xi) the sense strand of the nucleic acid sequence according to SEQ ID NO: 160 (5'UGACACUGAGGUGCUGUUGUCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 327 (5'ACAACAGCACCUCAGUGUCA3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 247 (5'UCUCUCAGUGAAGGGCACUUGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 414 (5'AAGUGCCCUUCACUGAGAGA3');xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 165 (5'UAAGUGAGACCCUCCACCUUGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 332 (5'AAGGUGGAGGGUCUCACUUA3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 167 (5'UGGAAAGUGAGACCCUCCACCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 334 (5'GUGGAGGGUCUCACUUUCCA3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 168 (5'UCUGGAAAGUGA xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 171 (5'UAGUUGAGGGAGUUUUGCUGGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 338 (5'CAGCAAAACUCCCUCAACUA3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 177 (5'UGAAUGGCGGGCAGCUCAGCCU3'). xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 182 (5'UAAUUUUUGCAGGUUCAGCUCG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 349 (5'AGCUGAACCUGCAAAAAUUA3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 251 (5'UAUGCUGUUCAGCACCUCCCCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 418 (5'GGGAGGUG xx) the sense strand of the nucleic acid sequence according to SEQ ID NO: 187 (5'UUAGACUCUGUGGGCUCUCUCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 354 (5'AGAGAGCCCACAGAGUCUAA3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 254 (5'UCAAACAGGAAUGGGCGGUUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 421 (5'AACCGCCCAUUCCUGUUUGA3');xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 190 (5'UAUCAUACACAGCAAACAGGAA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 357 (5'CCUGUUUGCUGUGUAUGAUA3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 201 (5'UAAGAAAAGGUGGGAGACUGGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 368 (5'CAGUCUCCCACCUUUUCUUA3'); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 259 (5'UCUAAAAUAA xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 273 (5'UUUUUGGAACAGUAGUCCCGCG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 440 (5'CGGGACUACUGUUCCAAAAA3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 207 (5'UGUCGGUUGGAAUUCUUUUUGG3'). xxvii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 208 (5'UCAAACAAGCUGGUCGGUUGGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 375 (5'CAACCGACCAGCUUGUUUGA3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 219 (5'UCUUUAAUUUUAAAACCCAAUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 386 (5'UUGGGUUU xxix) the sense strand of the nucleic acid sequence according to SEQ ID NO: 220 (5'UAUACAAACCGAAGGCAAUGCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 387 (5'CAUUGCCUUCGGUUUGUAUA3'); xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 221 (5'UAAUACAAACCGAAGGCAAUGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 388 (5'AUUGCCUUCGGUUUGUAUUA3');xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 224 (5'UCACUAAAUACAAACCGAAGGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 391 (5'CUUCGGUUUGUAUUUAGUGA3'); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 225 (5'UAAGACACUAAAUACAAACCGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 392 (5'GGUUUGUAUUUAGUGUCUUA3'); xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 226 (5'UCAAGACACU xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 120 (5'UGGAAGGGGUGUAUGUACACCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 287 (5'GUGUACAUACACCCCUUCCA3'); xxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 236 (5'UAAGACGUUUAUUACUAACACA3'). xxxvi) the sense strand of the nucleic acid sequence according to SEQ ID NO: 122 (5'UGGAUGACGAGGUGGAAGGGGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 289 (5'CCCUUCCACCUCGUCAUCCA3'); xxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 125 (5'UCUCAUUGUGGAUGACGAGGUG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 292 (5'CCUCGUCAUCC ACAAUGAGA3'); xxxviii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 276 (5'UACAAGCUGGUCGGUUGGAAUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 443 (5'UUCCAACCGACCAGCUUGUA3'); xxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 127 (5'UCUUUGCCAGCUGCUCACAGGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 294 (5'CUGUGAGCAGCUGGCAAAGA3');xL) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 239 (5'UUUUCAUCCACAGGGGAUGUCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 406 (5'ACAUCCCCUGUGGAUGAAAA3'); xLI) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 267 (5'UGUUUUGCAGCGACUAGCACCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 434 (5'GUGCUAGUCGCUGCAAAACA3'); xLII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: xLiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 133 (5'UAUAUACGGAAGCCCAAGAAGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 300 (5'UUCUUGGGCUUCCGUAUAUA3'); xLiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 135 (5'UAAGUUGGCCAGCAUCCCGACC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 296 (5'UCGGGAUGCUGGCCAACUUA3'); xLv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 136 (5'UCAUAUAUACGGAAGCCCAAGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 303 (5'UUGGGCUUCCGUAUAUAUGA3'); xLvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 138 (5'UCAUGCCAUAUAUACGGAAGC xLvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 139 (5'UCUGUGCAUGCCAUAUAUACGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 306 (5'GUAUAUAUGGCAUGCACAGA3'); xLviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 144 (5'UCAAAGACAGCCGUUGGGGAGA3'). , and the sense strand of the nucleic acid sequence according to SEQ ID NO: 311 (5'UCCCCAACGGCUGUCUUUGA3'); xL Ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 277 (5'UUUCCAAGGAACACCCAGGAUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 444 (5'UCCUGGGUGUUCCUUGGAAA3'); L) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 149 (5'UGACCUUGUGCGCAUCCAGCCG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 316 (5'GCUGGAUGCGC 151 (5'UCAAACGGCUGCUUCAGGUGCA3') and the sense strand of the nucleic acid sequence of SEQ ID NO: 318 (5'CACCUGAAGCAGCCGUUUGA3'); LII) the antisense strand of the nucleic acid sequence of SEQ ID NO: 152 (5'UCACAAACGGCUGCUUCAGGUG3') and the sense strand of the nucleic acid sequence of SEQ ID NO: 319 (5'CCUGAAGCAGCCGUUUGUGA3');LIII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 153 (5'UUAGAGAGCCAGGCCCUGCACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 320 (5'UGCAGGGCCUGGCUCUCUAA3'); LIV) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 154 (5'UAAGUCCAGAGAGCGUGGGAGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 321 (5'UCCCACGCUCUCUGGACUUA3'); LV) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 155 (5'UGUGAAGUCCAG LVI) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 244 (5'UUUCUGUGAAGUCCAGAGAGCG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 411 (5'CUCUCUGGACUUCACAGAAA3'); LVII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 278 (5'UUCUCAGCAGCAACAUCCAGUU3'). LVIII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 158 (5'UCUGUUGUCCACCCAGAACUCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 325 (5'AGUUCUGGGUGGACAACAGA3'); LIX) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 164 (5'UGUGAGACCCUCCACCUUGUCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 331 (5'ACAAGGUG LX) the sense strand of the nucleic acid sequence according to SEQ ID NO: 166 (5'UGAAAGUGAGACCCUCCACCUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 333 (5'GGUGGAGGGUCUCACUUUCA3'); LXI) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 173 (5'UAUCCAGUUGAGGGAGUUUUGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 340 (5'AAAACUCCCUCAACUGGAUA3');LXII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 178 (5'UCAGAAUGGCGGGCAGCUCAGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 345 (5'UGAGCUGCCCGCCAUUCUGA3'); LXIII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 250 (5'UCUGUUCAGCACCUCCCCCACC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 417 (5'UGGGGGAGGUGCUGAACAGA3'); LXIV) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 184 (5'UAAAAAAUGC LXV) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 185 (5'UAAAAAAAAUGCUGUUCAGCAC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 352 (5'GCUGAACAGCAUUUUUUUUA3'); LXVI) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 270 (5'UCUCUCUCAUCCGCUUCAAGCU3'). LXVII) the sense strand of the nucleic acid sequence according to SEQ ID NO: 437 (5'CUUGAAGCGGAUGAGAGAGA3'); LXVII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 252 (5'UCAGGAAUGGGCGGUUCAGGGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 419 (5'CCUGAACCGCCCAUUCCUGA3'); LXVIII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 188 (5'UCACAGCAAACAGGAAUGGGCG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 355 (5'CCCAUUCC LXIX) the sense strand of the nucleic acid sequence according to SEQ ID NO: 189 (5'UAUACACAGCAAACAGGAAUGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 356 (5'AUUCCUGUUUGCUGUGUAUA3'); LXX) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 192 (5'UUUGAUCAUACACAGCAAACAG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 359 (5'GUUUGCUGUGUAUGAUCAAA3');LXXI) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 193 (5'UUUUGAUCAUACACAGCAAACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 360 (5'UUUGCUGUGUAUGAUCAAAA3'); LXXII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 255 (5'UGAAGUGCAGGGCAGUGGCGCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 422 (5'CGCCACUGCCCUGCACUUCA3'); LXXIII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 194 (5'UCAGGAAGUG LXXIV) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 256 (5'UCUCAUGCUGUGCUCAGCGGGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 423 (5'CCGCUGAGCACAGCAUGAGA3'); LXXV) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 195 (5'UCUGGGGCCCUGGCCUCAUGCU3'). LXXVI) the sense strand of the nucleic acid sequence according to SEQ ID NO: 198 (5'UAAAAGGUGGGAGACUGGGGGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 365 (5'CCCCAGUCUCCCACCUUUUA3'); LXXVII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 199 (5'UGAAAAGGUGGGAGACUGGGGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 366 (5'CCCAGUCUCCC LXXVIII) the sense strand of the nucleic acid sequence according to SEQ ID NO: 271 (5'UCUUUCCAGCUCAAAGUCGACU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 438 (5'UCGACUUUGAGCUGGAAAGA3'); LXXIX) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 257 (5'UUAAACCCAGCAAACUGGGAGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 424 (5'UCCCAGUUUGCUGGGUUUAA3');LXXX) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 204 (5'UCUGGUUCUUGCCUCCCCACCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 371 (5'GUGGGGAGGCAAGAACCAGA3'); LXXXI) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 205 (5'UAAACACUGGUUCUUGCCUCCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 372 (5'GAGGCAAGAACCAGUGUUUA3'); LXXXII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 260 (5'UGUUGGAAUUCU LXXXIII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 209 (5'UUUGUUUCACAAACAAGCUGGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 376 (5'CAGCUUGUUUGUGAAACAAA3'); LXXXIV) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 210 (5'UUUUUGUUUCACAAACAAGCUG3'). LXXXV) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 227 (5'UCUUACAUUCAAGACACUAAAU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 394 (5'UUAGUGUCUUGAAUGUAAGA3'); LXXXVI) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 229 (5'UGUCAUGUUCUUACAUUCAAGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 396 (5'UUGAAUGUAAGA LXXXVII) the sense strand of the nucleic acid sequence according to SEQ ID NO: 262 (5'UGAAAUUCAGGUGCUUGCAUCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 429 (5'AUGCAAGCACCUGAAUUUCA3'); LXXXVIII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 263 (5'UAACAGAAAUUCAGGUGCUUGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 430 (5'AAGCACCUGAAUUUCUGUUA3');LXXXIX) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 265 (5'UCAUUCAAACAGAAAUUCAGGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 432 (5'CUGAAUUUCUGUUUGAAUGA3'); XC) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 266 (5'UGAAAUAACCAGCUAUGGUUCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 433 (5'AACCAUAGCUGGUUAUUUCA3'); XC I) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 196 (5'UGUGUUCUGGGGCCCUGGCCUC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 363 (5'GGCCAGGGCCCCAGAACACA3'); or XCII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 112 (5'UCUUCUGCUGUAGUACCCAGAA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 279 (5'CUGGGUACUACAGCAGAAGA3');

[0158] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand is selected from the group consisting of from the 5' end of the angiotensinogen (AGT) mRNA sequence according to SEQ ID NO: 1: a) 11-42; b) 144-215; c) 264-284; d) 303-323; e) 325-345; f) 355-405; g) 441-481; h) 503-552; i) 560-580; j) 690-731; k) 742-802; l) 863-883; m) 922-966; n) 1036-1056; o) 1099-1153; p) 1189-1209; q) 1233-1255; r) 1258-1282; s) 1300-1367; t a) 1403-1465; u) 1479-1517; v) 1601-1624; w) 1631-1651; x) 1722-1753; y) 1756-1861; z) 1863-1890; aa) 1901-1948; ab) 2017-2047; ac) 2049-2071; and ad) 2075-2095, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide comprises a nucleotide sequence substantially identical to a region comprising 19-25 nucleotides between any one of nucleotide positions selected from AGT at a dose of 0.1 nM. Attenuate mRNA expression by at least 50% (e.g., 50%-55%, 55%-60%, 60%-65%, 65%-70%, 70%-75%, 75%-80%, 80%-85%, 85%-90%, 90%-95%, or 95%-100%).

[0159] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand is selected from the group consisting of from the 5' end of the angiotensinogen (AGT) mRNA sequence according to SEQ ID NO: 1: a) 11-42; b) 144-215; c) 264-284; d) 303-323; e) 325-345; f) 355-405; g) 441-481; h) 503-552; i) 560-580; j) 690-731; k) 742-802; l) 863-883; m) 922-966; n) 1036-1056; o) 1099-1153; p) 1189-1209; q) 1233-1255; r) 1258-1282; s) 1300-1367; t a) 1403-1465; u) 1479-1517; v) 1601-1624; w) 1631-1651; x) 1722-1753; y) 1756-1861; z) 1863-1890; aa) 1901-1948; ab) 2017-2047; ac) 2049-2071; and ad) 2075-2095, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide comprises a nucleotide sequence substantially identical to a region comprising 19-25 nucleotides between any one of nucleotide positions selected from AGT at a dose of 0.1 nM. The double-stranded region is selected from the group consisting of: i) an antisense strand of a nucleic acid sequence according to SEQ ID NO: 113 (5'UAUACCCUUCUGCUGUAGUACC3') and an antisense strand of a nucleic acid sequence according to SEQ ID NO: 280 (5'UACUACAGCAGAAGGGUAUA3'). ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 126 (5'UCACAGGUACUCUCAUUGUGGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 293 (5'CACAAUGAGAGUACCUGUGA3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 268 (5'UCUCAACUUGUCUUCGGUGUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 435 (5'ACACCGAAGACAAGUUGAGA3');iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 130 (5'UAGAAGUUGGCCAGCAUCCCGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 297 (5'GGGAUGCUGGCCAACUUCUA3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 132 (5'UGGAAGCCCAAGAAGUUGGCCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 299 (5'GCCAACUUCUUGGGCUUCCA3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 133 (5'UAUAUACGGAAGCC vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 134 (5'UUAUAUACGGAAGCCCAAGAAG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 301 (5'UCUUGGGCUUCCGUAUAUAA3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 137 (5'UAUGCCAUAUAUACGGAAGCCC3'). ix) the sense strand of the nucleic acid sequence according to SEQ ID NO: 156 (5'UGAACCUGUCAAUCUUCUCAGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 323 (5'UGAGAAGAUUGACAGGUUCA3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 169 (5'UGUUUUGCUGGAAAGUGAGACC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 336 (5'UCUCACUUUCC AGCAAAACA3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 170 (5'UGAGUUUUGCUGGAAAGUGAGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 337 (5'UCACUUUCCAGCAAAACUCA3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 176 (5'UUUUCUUCAUCCAGUUGAGGGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 343 (5'CCUCAACUGGAUGAAGAAAA3');xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 248 (5'UUAAGAUCCUUGCAGCACCAGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 415 (5'UGGUGCUGCAAGGAUCUUAA3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 179 (5'UUUUUGCAGGUUCAGCUCGGUG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 346 (5'CCGAGCUGAACCUGCAAAAA3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 180 (5'UUUUUUGCAGGU xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 181 (5'UAUUUUUGCAGGUUCAGCUCGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 348 (5'GAGCUGAACCUGCAAAAAUA3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 183 (5'UCAAUUUUUGCAGGUUCAGCUC3'). xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 269 (5'UCUCUCAUCCGCUUCAAGCUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 436 (5'AGCUUGAAGCGGAUGAGAGA3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 186 (5'UGACUCUGUGGGCUCUCUCUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 353 (5'AGAGAGAG xx) the sense strand of the nucleic acid sequence according to SEQ ID NO: 253 (5'UAACAGGAAUGGGCGGUUCAGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 420 (5'UGAACCGCCCAUUCCUGUUA3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 191 (5'UGAUCAUACACAGCAAACAGGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 358 (5'CUGUUUGCUGUGUAUGAUCA3');xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 200 (5'UAGAAAAGGUGGGAGACUGGGG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 367 (5'CCAGUCUCCCACCUUUUCUA3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 217 (5'UUUUAAAACCCAAUUUUUGUUC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 384 (5'ACAAAAAUUGGGUUUUAAAA3'); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 258 (5'UAAUAAACCC xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 202 (5'UAUUCUCUAAAAUAAACCCAGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 369 (5'UGGGUUUAUUUUAGAGAAUA3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 206 (5'UUAAACACUGGUUCUUGCCUCC3'). xxvii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 272 (5'UUUUGGAACAGUAGUCCCGCGC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 439 (5'GCGGGACUACUGUUCCAAAA3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 274 (5'UCUUUUUGGAACAGUAGUCCCG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 441 (5'GGACUACU xxix) the sense strand of the nucleic acid sequence according to SEQ ID NO: 275 (5'UUUCUUUUUGGAACAGUAGUCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 442 (5'ACUACUGUUCCAAAAAGAAA3'); xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 211 (5'UUUUUUGUUUCACAAACAAGCU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 378 (5'CUUGUUUGUGAAACAAAAAA3');xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 212 (5'UAAAAGGGAACACUUUUUUGUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 379 (5'CAAAAAAGUGUUCCCUUUUA3'); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 214 (5'UCAACUUGAAAAGGGAACACUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 381 (5'GUGUUCCCUUUUCAAGUUGA3'); xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 218 (5'UUUUAAUUUUAAAACCCAAUUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 385 (5'AUUGGGUUUUAAAAUUAAAA3');

[0160] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 2, 3, 16, 30, 35, 37, 40, 41, 44, or 55.

[0161] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 57, 58, 71, 85, 90, 92, 95, 96, 99, or 110.

[0162] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 2, 3, 16, 30, 35, 37, 40, 41, 44, or 55, and the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 57, 58, 71, 85, 90, 92, 95, 96, 99, or 110, wherein the antisense and sense strand sequences have sufficient complementarity to allow formation of a double-stranded region between the antisense and sense strands.

[0163] In some embodiments of the isolated oligonucleotides of the present disclosure, the isolated oligonucleotides comprise: (a) a sense strand comprising X1 nucleotides, wherein at least one nucleotide is modified with a first modification and each of the remaining nucleotides is independently modified with a second modification, wherein X1 is an integer selected from 13 to 36, and the first and second modifications are different; and (b) an antisense strand comprising X2 nucleotides, wherein at least one nucleotide is modified with a third modification and each of the remaining nucleotides is independently modified with a fourth modification, wherein X2 is an integer selected from 18 to 31, and the third and fourth modifications are different.

[0164] In some embodiments, the X1 nucleotide in the sense strand of the isolated oligonucleotide of this disclosure is 18-21, and the X2 nucleotide in the antisense strand of the isolated oligonucleotide of this disclosure is 20-23. In some embodiments, the X1 nucleotide in the sense strand of the isolated oligonucleotide of this disclosure is 20 or 21, and the X2 nucleotide in the antisense strand of the isolated oligonucleotide of this disclosure is 22 or 23. In some embodiments, the X2 nucleotide in the antisense strand of the isolated oligonucleotide of this disclosure is equal to the X1 nucleotide in the sense strand of the isolated oligonucleotide of this disclosure + 2. In some embodiments, the X1 nucleotide in the sense strand of the isolated oligonucleotide of this disclosure is 21, and the X2 nucleotide in the antisense strand of the isolated oligonucleotide of this disclosure is 23. In some embodiments, the X1 nucleotide in the sense strand of the isolated oligonucleotide of this disclosure is 20, and the X2 nucleotide in the antisense strand of the isolated oligonucleotide of this disclosure is 22.

[0165] In some embodiments of the isolated oligonucleotides of the present disclosure, the isolated oligonucleotides comprise: (a) a sense strand comprising 20 nucleotides, wherein at least one nucleotide is modified with a first modification and each of the remaining nucleotides is independently modified with a second modification, wherein the first and second modifications are the same or different; and (b) an antisense strand comprising 22 nucleotides, wherein at least one nucleotide is modified with a third modification and each of the remaining nucleotides is independently modified with a fourth modification, wherein the third and fourth modifications are the same or different.

[0166] In some embodiments, the sense strand of an isolated oligonucleotide of the present disclosure comprises at least one nucleotide with a modified phosphate backbone. In some embodiments, the antisense strand of an isolated oligonucleotide of the present disclosure comprises at least one nucleotide with a modified phosphate backbone. In some embodiments, the modified phosphate backbone in the sense strand, antisense strand, or both the sense strand and antisense strand of an isolated oligonucleotide of the present disclosure comprises a modified phosphodiester linkage. In some embodiments, the modified phosphodiester linkage is modified by replacing one or more oxygen atoms with a moiety, where the moiety is attached to the phosphorus atom in the phosphodiester linkage through a carbon, nitrogen, or sulfur atom in the moiety, or by forming a 2'-5' linkage. In some embodiments, the modified phosphodiester linkage comprises phosphorothioate, phosphorodithioate, methylphosphonate, phosphoramidate diester, mesyl phosphoramidate, or phosphonoacetate.

[0167] In some embodiments, the isolated oligonucleotides of the present disclosure comprise one or more unnatural base-containing nucleotides, locked nucleotides, or abasic nucleotides. In some embodiments, the terminal nucleotide at the 5' end of the isolated oligonucleotides of the present disclosure comprises a phosphate mimic. In some embodiments, the 5'-phosphate mimic is an ethyl phosphonate, a vinyl phosphonate, or an analog thereof.

[0168] In some embodiments, the antisense strand of the isolated oligonucleotide of the present disclosure comprises at least two single-stranded nucleotides at the 3' end. In some embodiments, the antisense strand of the isolated oligonucleotide of the present disclosure comprises two single-stranded nucleotides at the 3' end.

[0169] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1311 and 1331 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5'UCAAAAAAAAUGCUGUUCAGCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 71 (5'CUGAACAGCAUUUUUUUUGA3').

[0170] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1825 and 1845 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5'UCACUUUUUUGUUUCACAAACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 85 (5'UUUGUGAAACAAAAAAGUGA3').

[0171] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1829 and 1849 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5'UGGAACACUUUUUUGUUUCACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5'UGAAACAAAAAAGUGUUCCA3').

[0172] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1837 and 1857 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5'UUUGAAAAGGGAACACUUUUUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5'AAAAGUGUUCCCUUUUCAAA3').

[0173] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1854 and 1874 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'UCAAUUUUUGUUCUCAACUUGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 90 (5'AAGUUGAGAACAAAAAUUGA3').

[0174] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1860 and 1880 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5'UAAAACCCAAUUUUUGUUCUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 110 (5'AGAACAAAAAUUGGGUUUUA3').

[0175] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1865 and 1885 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5'UAUUUUAAAACCCAAUUUUUGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 92 (5'AAAAAUUGGGUUUUAAAAUA3').

[0176] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1873 and 1893 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 40 (5'UAUACUUUAAUUUUAAAACCCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 95 (5'GGUUUUAAAAUUAAAGUAUA3').

[0177] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1874 and 1894 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 41 (5'UUAUACUUUAAUUUUAAAACCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 96 (5'GUUUUAAAAUUAAAGUAUAA3').

[0178] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 169 and 189 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5'UGUACUCUCAUUGUGGAUGACG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 99 (5'UCAUCCACAAUGAGAGUACA3').

[0179] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 169 to 189; b) 1311 to 1331; and c) 1825 to 1894 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates expression of AGT mRNA by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45%, or 45% to 50%) at a dose of 0.02 nM.

[0180] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 169-189; b) 1311-1331; and c) 1825-1894 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide of the present disclosure comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 169-189; b) 1311-1331; and c) 1825-1894 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the antisense strand is substantially complementary to the sense strand such that the antisense strand and the sense ... The double-stranded region is selected from the group consisting of: i) an antisense strand of the nucleic acid sequence of SEQ ID NO: 16 (5'UCAAAAAAAAUGCUGUUCAGCA3') and a sense strand of the nucleic acid sequence of SEQ ID NO: 71 (5'CUGAACAGCAUUUUUUUUGA3'); ii) an antisense strand of the nucleic acid sequence of SEQ ID NO: 30 (5'UCACUUUUUUGUUUCACAAACA3') and a sense strand of the nucleic acid sequence of SEQ ID NO: 85 (5'UUUGUGAAACAAAAAAGUGA3'); iii) an antisense strand of the nucleic acid sequence of SEQ ID NO: 2 (5'UGGAACACUUUUUUGUUUCACA3') and a sense strand of the nucleic acid sequence of SEQ ID NO: 57 (5'UGAAACAAAAAAGUGUUCCA3'); and iv) an antisense strand of the nucleic acid sequence of SEQ ID NO: 3 (5'UUUGAAAAGGGAACACUUUUUU3'). and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5'AAAAGUGUUCCCUUUUCAAA3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'UCAAUUUUUGUUCUCAACUUGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 90 (5'AAGUUGAGAACAAAAAUUGA3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5'UAAAACCCAAUUUUUGUUCUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 110 (5'AGAACAAAAAUUGGGUUUUA3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5'UAUUUUAAAACCCAAUUUUUGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 92 (5'AAAAAUUGGGUUUUAAAAUA3');viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 40 (5'UAUACUUUAAUUUUAAAACCCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 95 (5'GGUUUUAAAAUUAAAGUAUA3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 41 (5'UUAUACUUUAAUUUUAAAACCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 96 (5'GUUUUAAAAUUAAAGUAUAA3'); or x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5'UGUACUCUCAUUGUGGAUGACG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 99 (5'UCAUCCACAAUGAGAGUACA3');

[0181] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 169 to 189; b) 1311 to 1331; and c) 1825 to 1894 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates expression of AGT mRNA by at least 50% (e.g., 50% to 55%, 55% to 60%, 60% to 65%, 65% to 70%, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100%) at a dose of 0.1 nM.

[0182] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 169-189; b) 1311-1331; and c) 1825-1894 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region ... The double-stranded region attenuates mRNA expression by at least 50%, and the double-stranded region is selected from the group consisting of: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5'UCAAAAAAAAUGCUGUUCAGCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 71 (5'CUGAACAGCAUUUUUUUUGA3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5'UCACUUUUUUGUUUCACAAACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 85 (5'UUUGUGAAACAAAAAAGUGA3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5'UGGAACACUUUUUUGUUUCACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5'UGAAACAAAAAAGUGUUCCA3'); iv) SEQ ID NO: 3 (5'UUUGAAAAGGGAACACUUUUUU3'). and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5'AAAAGUGUUCCCUUUUCAAA3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'UCAAUUUUUGUUCUCAACUUGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 90 (5'AAGUUGAGAACAAAAAUUGA3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5'UAAAACCCAAUUUUUGUUCUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 110 (5'AGAACAAAAAUUGGGUUUUA3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5'UAUUUUAAAACCCAAUUUUUGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 92 (5'AAAAAUUGGGUUUUAAAAUA3');viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 40 (5'UAUACUUUAAUUUUAAAACCCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 95 (5'GGUUUUAAAAUUAAAGUAUA3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 41 (5'UUAUACUUUAAUUUUAAAACCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 96 (5'GUUUUAAAAUUAAAGUAUAA3'); or x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5'UGUACUCUCAUUGUGGAUGACG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 99 (5'UCAUCCACAAUGAGAGUACA3');

[0183] In some embodiments, the isolated oligonucleotides of the present disclosure can include a linker, sometimes referred to as a loop. siRNAs containing a linker or loop are sometimes referred to as short hairpin RNAs (shRNAs). In some embodiments, both the sense and antisense regions of an siRNA are encoded by single-stranded RNA. In these embodiments, the antisense and sense regions hybridize to form a duplex region. The sense and antisense regions are connected by a linker sequence to form a "hairpin" or "stem-loop" structure. An siRNA can have complementary sense and antisense regions at opposite ends of a single-stranded molecule, such that the molecule can form a duplex region with the complementary sequence portion, and the strands are connected at one end of the duplex region by a linker. The linker can be a nucleotide linker, a non-nucleotide linker, or a combination thereof. The linker can interact with the first strand and optionally the second strand through covalent or non-covalent interactions.

[0184] Any suitable nucleotide linker sequence is considered to be within the scope of the present disclosure.The siRNA of the present disclosure can comprise nucleotide, non-nucleotide or mixed nucleotide / non-nucleotide linker that connects the sense region of nucleic acid to the antisense region of nucleic acid.Nucleotide linker can be 2 nucleotides or more in length, for example, about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 nucleotides in length.

[0185] Examples of non-nucleotide linkers include abasic nucleotides, polyethers, polyamines, polyamides, peptides, carbohydrates, lipids, polyhydrocarbons, or other polymeric agents, such as polyethylene glycols, such as those having 2 to 100 ethylene glycol units. Some examples are described in Seela et al., Nucleic Acids Research, 1987, Vol. 15, pp. 3113-3129; Cload et al., J. Am. Chem. Soc., 1991, Vol. 113, pp. 6324-6326; Jaeschke et al., Tetrahedron Lett., 1993, Vol. 34, pp. 301; Arnold et al., WO 1989 / 002439; Usman et al., WO 1995 / 006731; Dudycz et al., WO 1995 / 011910; and Ferentz et al., J. Am. Chem. Soc., 1991, Vol. 113, pp. 4000-4002.

[0186] Examples of nucleotide linker sequences include, but are not limited to, AUG, CCC, UUCG, CCACC, AAGCAA, CCACACC, and UUCAAGAGA.

[0187] In some embodiments, the isolated oligonucleotide of the present disclosure is siRNA, and can be processed to produce RISC active siRNA molecule, and can be the dsRNA of suitable length as Dicer substrate.See, for example, Rossi et al. US Patent Application Publication No. 2005 / 0244858.

[0188] The Dicer substrate double-stranded RNA (dsRNA) can be of sufficient length that it can be processed by Dicer to generate active siRNA, and can further comprise one or more of the following properties: (i) the Dicer substrate dsRNA can be asymmetric, e.g., have a 3' overhang on the antisense strand; (ii) the Dicer substrate dsRNA can have a modified 3' end, e.g., incorporation of one or more DNA nucleotides, on the sense strand to direct the orientation of Dicer binding and processing of the dsRNA into active siRNA; and (iii) the first and second strands of the Dicer substrate dsRNA can be 19-30 bp in length.

[0189] In some embodiments, the isolated oligonucleotide of the present disclosure comprises at least one modified nucleotide. In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand, the antisense strand, or both comprise one or more modified nucleotides. In some embodiments, only the sense strand comprises one or more modified nucleotides. In some embodiments, only the antisense strand comprises one or more modified nucleotides. In some embodiments, both the sense strand and the antisense strand comprise one or more modified nucleotides. In some embodiments, the isolated oligonucleotide is partially chemically modified. In some embodiments, the isolated oligonucleotide is fully chemically modified.

[0190] In some embodiments, the isolated oligonucleotide comprises at least two modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least three modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least four modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least five modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least six modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least seven modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least eight modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least nine modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least ten modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least eleven modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least twelve modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least thirteen modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least fourteen modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least fifteen modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least sixteen modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least seventeen modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least 18 modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least 19 modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least 20 modified nucleotides. In some embodiments, the isolated oligonucleotide comprises more than 20 modified nucleotides. In some embodiments, the isolated oligonucleotide comprises between 20 and 30 modified nucleotides.In some embodiments, the isolated oligonucleotide comprises between 30 and 40 modified nucleotides, hi some embodiments, the isolated oligonucleotide comprises between 40 and 50 modified nucleotides.

[0191] In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least one modified nucleotide. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least two modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least three modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least four modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least five modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least six modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least seven modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least eight modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least nine modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least ten modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 11 modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 12 modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 13 modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 14 modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 15 modified nucleotides.In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 16 modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 17 modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 18 modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 19 modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 20 modified nucleotides.

[0192] In some embodiments, the isolated oligonucleotide comprises two or more modified nucleotides, wherein at least a first nucleotide comprises a first modification and at least a second nucleotide comprises a second modification. In some embodiments, the first modification and the second modification are different. In some embodiments, the at least first nucleotide and the at least second nucleotide are located on different strands of the isolated oligonucleotide. In some embodiments, the at least first nucleotide and the at least second nucleotide are located on the same strand of the isolated oligonucleotide.

[0193] In some embodiments of the isolated oligonucleotide, the isolated oligonucleotide comprises two or more modified nucleotides, wherein at least a first modified nucleotide comprises a first modification, and at least a second modified nucleotide comprises a second modification, and at least a third nucleotide comprises a third modification. In some embodiments, the isolated oligonucleotide comprises a first, a second, a third, and a fourth modification. In some embodiments, the isolated oligonucleotide comprises more than four modifications. In some embodiments, all modifications are on the sense strand. In some embodiments, all modifications are on the antisense strand. Any combination of modification positions between the sense strand and the antisense strand is contemplated within the isolated oligonucleotide of the present disclosure.

[0194] In some embodiments, the modified nucleotides are contiguous in the sense strand, the antisense strand, or both. In some embodiments, some, but not all, of the modified nucleotides are contiguous in the sense strand, the antisense strand, or both. In some embodiments, the modified nucleotides in the sense strand, the antisense strand, or both are not contiguous.

[0195] The present disclosure encompasses isolated oligonucleotides in which any nucleotide on the sense strand or antisense strand can be modified. In some embodiments, any nucleotide on the antisense strand can be modified. In some embodiments, any nucleotide on the antisense strand can be modified.

[0196] In some embodiments, the isolated oligonucleotide of the present disclosure comprises at least one modified nucleotide. In some embodiments, the one or more modified nucleotides increase the stability or efficacy, or both, of the isolated oligonucleotide. In some embodiments, the one or more modified nucleotides increase the stability of the RNA duplex and the siRNA.

[0197] Modifications that increase RNA stability include, but are not limited to, locked nucleic acids. As used herein, the term "locked nucleic acid" or "LNA" includes, but is not limited to, modified RNA nucleotides containing a methylene bridge connecting the 2' oxygen and 4' carbon of the ribose moiety. This methylene bridge locks the ribose in the 3' end confirmation, also known as the north confirmation, found in A-form RNA duplexes. The term "inaccessible RNA" can be used interchangeably with LNA. LNA has a 2'-4' cyclic linkage, as described in International Patent Applications WO 99 / 14226, WO 00 / 56746, WO 00 / 56748, and WO 00 / 66604, the contents of which are incorporated herein by reference.

[0198] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand, the antisense strand, or both contain at least one nucleotide with a modified phosphate backbone. In some embodiments, the sense strand of the isolated oligonucleotide contains at least one nucleotide with a modified phosphate backbone. In some embodiments, the antisense strand of the isolated oligonucleotide contains at least one nucleotide with a modified phosphate backbone. In some embodiments, the isolated oligonucleotide of the present disclosure contains a modified phosphate backbone, the modified phosphate backbone contains a modified phosphodiester linkage. In some embodiments, the modified phosphodiester linkage is modified by replacing one or more oxygen atoms with a moiety, where the moiety is attached to the phosphorus atom in the phosphodiester linkage through a carbon, nitrogen, or sulfur atom in the moiety, or by forming a 2'-5' linkage. In some embodiments, the modified phosphodiester linkage contains phosphorothioate, phosphorodithioate, methylphosphonate, phosphoramidate diester, mesyl phosphoramidate, or phosphonoacetate.

[0199] In some embodiments, the isolated oligonucleotides of the present disclosure comprise one or more unnatural base-containing nucleotides, locked nucleotides, or abasic nucleotides. In some embodiments, the one or more modified nucleotides comprise phosphorothioate derivatives or acridinine-substituted nucleotides. In some embodiments, the isolated oligonucleotides of the present disclosure comprise a phosphate mimic at the 5'-end of the antisense strand, including, but not limited to, vinyl phosphonate or other phosphate analogs. In some embodiments, the 5'-phosphate mimic is ethyl phosphonate, vinyl phosphonate, or an analog thereof.

[0200] In some embodiments, the modified nucleotides are 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, β-D-galactosylketone, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methyl

[0039] Examples of uracil-5-oxyacetic acid include uracil-5-oxyacetic acid (v), 5-aminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, β-D-mannosylqueosin, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N-isopentenyladenine, uracil-5-oxyacetic acid (v), wibutoxysin, pseudouracil, queosin, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, (acp3)w, and 2,6-diaminopurine.

[0201] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand, the antisense strand, or both comprise terminal or internal nucleotides linked to one or more targeting ligands. In some embodiments, the terminal or internal nucleotides are directly linked to one or more targeting ligands. In some embodiments, the terminal or internal nucleotides are indirectly linked to one or more targeting ligands via a linker. In some embodiments, the one or more targeting ligands directly or indirectly linked to the terminal or internal nucleotides can further comprise a PK modulator. In some embodiments, the PK modulator is a competitive modulator, a positive allosteric modulator, a negative allosteric modulator, or a neutral allosteric modulator. In some embodiments, the targeting ligand is selected from one or more of a carbohydrate, a peptide, a lipid, an antibody or fragment thereof, an aptamer, albumin, fibrinogen, and folate.

[0202] Nucleotide Modifications

[0203] Provided herein are isolated oligonucleotides, the sense strand comprising: (a) an X1 nucleotide, wherein at least one nucleotide is modified with a first modification and each of the remaining nucleotides is independently modified with a second modification, and X1 is an integer selected from 13 to 36, and the first modification and the second modification are different; and (b) an X2 nucleotide, wherein at least one nucleotide is modified with a third modification and each of the remaining nucleotides is independently modified with a fourth modification, and X2 is an integer selected from 18 to 31, and the third modification and the fourth modification are different.

[0204] In some embodiments, the X1 nucleotide in the sense strand of the isolated oligonucleotide of this disclosure is 18-21, and the X2 nucleotide in the antisense strand of the isolated oligonucleotide of this disclosure is 20-23. In some embodiments, the X1 nucleotide in the sense strand of the isolated oligonucleotide of this disclosure is 20 or 21, and the X2 nucleotide in the antisense strand of the isolated oligonucleotide of this disclosure is 22 or 23. In some embodiments, the X2 nucleotide in the antisense strand of the isolated oligonucleotide of this disclosure is equal to the X1 nucleotide in the sense strand of the isolated oligonucleotide of this disclosure + 2. In some embodiments, the X1 nucleotide in the sense strand of the isolated oligonucleotide of this disclosure is 21, and the X2 nucleotide in the antisense strand of the isolated oligonucleotide of this disclosure is 23. In some embodiments, the X1 nucleotide in the sense strand of the isolated oligonucleotide of this disclosure is 20, and the X2 nucleotide in the antisense strand of the isolated oligonucleotide of this disclosure is 22.

[0205] In some embodiments of the isolated oligonucleotides of the present disclosure, the isolated oligonucleotides comprise: (a) a sense strand comprising 20 nucleotides, wherein at least one nucleotide is modified with a first modification and each of the remaining nucleotides is independently modified with a second modification, wherein the first and second modifications are the same or different; and (b) an antisense strand comprising 22 nucleotides, wherein at least one nucleotide is modified with a third modification and each of the remaining nucleotides is independently modified with a fourth modification, wherein the third and fourth modifications are the same or different.

[0206] In some embodiments, the first modification is a modification of the sugar moiety of at least one nucleotide at the 2' position selected from a 2'-F modification, a 2'-CN modification, a 2'-N3 modification, a 2'-deoxy modification, and equivalents thereof, and combinations thereof. In some embodiments, the first modification is a 2'-F modification, a 2'-CN modification, a 2'-N3 modification, or a 2'-deoxy modification, or a stereoisomer thereof. In some embodiments, the first modification is a 2'-F modification, a 2'-CN modification, or a 2'-N3 modification, or a stereoisomer thereof. In some embodiments, the first modification is a 2'-F modification or a stereoisomer thereof.

[0207] In some embodiments, the second modification is a modification of the sugar moiety of one or more of the remaining nucleotides at the 2' position selected from a 2'-C1-C6 alkyl, a 2'-OR modification (where R is a C1-C6 alkyl optionally substituted with a C1-C6 alkoxy, acetamido, phenyl, or heteroaryl containing a 5- or 6-membered ring and one or two heteroatoms selected from N, O, and S, 2'-amino), and a morpholino substitution, and equivalents thereof, and combinations thereof. In some embodiments, the second modification is a 2'-OR modification, or a morpholino substitution, or a combination thereof. In some embodiments, the second modification is a 2'-OR modification. In some embodiments, the second modification is a 2'-O-methyl modification or a 2'-methoxyethoxy modification. In some embodiments, the second modification is a 2'-O-methyl modification. In some embodiments, the second modification is a morpholino substitution.

[0208] In some embodiments, the first modification is a 2'-F modification or a stereoisomer thereof, and the second modification is a 2'-O-methyl modification or a 2'-methoxyethoxy modification. In some embodiments, the first modification is a 2'-F modification or a stereoisomer thereof, and the second modification is a 2'-O-methyl modification.

[0209] In some embodiments, the third modification is a modification of the sugar moiety of at least one nucleotide at the 2' position selected from a 2'-F modification, a 2'-CN modification, a 2'-N3 modification, a 2'-deoxy modification, and equivalents thereof, and combinations thereof. In some embodiments, the third modification is a 2'-F modification, a 2'-CN modification, a 2'-N3 modification, or a 2'-deoxy modification, or a stereoisomer thereof. In some embodiments, the third modification is a 2'-F modification, a 2'-CN modification, or a 2'-N3 modification, or a stereoisomer thereof. In some embodiments, the third modification is a 2'-F modification or a stereoisomer thereof.

[0210] In some embodiments, the fourth modification is a modification of the sugar moiety of one or more of the remaining nucleotides at the 2' position selected from a 2'-C1-C6 alkyl, a 2'-OR modification (where R is a C1-C6 alkyl optionally substituted with a C1-C6 alkoxy, acetamido, phenyl, or heteroaryl containing a 5- or 6-membered ring and one or two heteroatoms selected from N, O, and S, 2'-amino), and a morpholino substitution, and equivalents thereof, and combinations thereof. In some embodiments, the fourth modification is a 2'-OR modification, or a morpholino substitution, or a combination thereof. In some embodiments, the fourth modification is a 2'-OR modification. In some embodiments, the fourth modification is a 2'-O-methyl modification or a 2'-methoxyethoxy modification. In some embodiments, the fourth modification is a 2'-O-methyl modification. In some embodiments, the fourth modification is a morpholino substitution.

[0211] In some embodiments, the third modification is a 2'-F modification or a stereoisomer thereof, and the fourth modification is a 2'-O-methyl modification or a 2'-methoxyethoxy modification. In some embodiments, the third modification is a 2'-F modification or a stereoisomer thereof, and the fourth modification is a 2'-O-methyl modification.

[0212] Sense strand

[0213] In some embodiments of the isolated oligonucleotide of the present disclosure, including a sense strand and an antisense strand, at least three nucleotides in the sense strand of the isolated oligonucleotide of the present disclosure are modified with a first modification.In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, at least two of the at least three nucleotides that are modified with a first modification are located consecutively.In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, at least three of the at least three nucleotides that are modified with a first modification are located consecutively.

[0214] In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, at least four nucleotides are modified with first modification in the sense strand.In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, at least three of the at least four nucleotides that are modified with first modification are located consecutively.In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, at least four of the at least four nucleotides that are modified with first modification are located consecutively.

[0215] In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, at least 5 nucleotides are modified with first modification in the sense strand.In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, at least 3 of the at least 5 nucleotides that are modified with first modification are located consecutively.In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, at least 4 of the at least 5 nucleotides that are modified with first modification are located consecutively.

[0216] In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, at least three nucleotides, at least four nucleotides, or at least five nucleotides modified with a first modification are located between positions 10 and 15 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand.

[0217] In some embodiments, in the sense strand of the isolated oligonucleotide of the disclosure, two of the at least three nucleotides modified with the first modification are located at positions selected from positions 10, 11, 12, and 13 from the nucleotide complementary to the first nucleotide at the 5'-end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotide of the disclosure, three of the at least three nucleotides modified with the first modification are located at positions selected from positions 10, 11, 12, and 13 from the nucleotide complementary to the first nucleotide at the 5'-end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotide of the disclosure, one of the at least three nucleotides modified with the first modification is located at position 11 from the nucleotide complementary to the first nucleotide at the 5'-end of the antisense strand.

[0218] In some embodiments, in the sense strand of the isolated oligonucleotide of the disclosure, three of the at least three nucleotides modified with the first modification are located at positions 11, 12, and 13 from the nucleotide complementary to the first nucleotide at the 5'-end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotide of the disclosure, three of the at least three nucleotides modified with the first modification are located at positions 12, 13, and 14 from the nucleotide complementary to the first nucleotide at the 5'-end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotide of the disclosure, three of the at least three nucleotides modified with the first modification are located at positions 10, 11, and 12 from the nucleotide complementary to the first nucleotide at the 5'-end of the antisense strand.

[0219] In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, one of the at least four nucleotides modified with the first modification is located at position 10 from the nucleotide complementary to the first nucleotide at the 5'-end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, one of the at least four nucleotides modified with the first modification is located at position 11 from the nucleotide complementary to the first nucleotide at the 5'-end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, one of the at least four nucleotides modified with the first modification is located at position 12 from the nucleotide complementary to the first nucleotide at the 5'-end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, one of the at least four nucleotides modified with the first modification is located at position 13 from the nucleotide complementary to the first nucleotide at the 5'-end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, one of the at least four nucleotides modified with the first modification is located at position 14 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, one of the at least four nucleotides modified with the first modification is located at position 15 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand.

[0220] In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, the at least four nucleotides modified with the first modification are located at positions 10, 11, 12, and 13 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand.

[0221] In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, the at least five nucleotides modified with the first modification are located at positions 10, 11, 12, 13, and 15 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand.

[0222] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises five nucleotides modified with a first modification, and the five nucleotides modified with the first modification are located at positions 10, 11, 12, 13, and 15 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand.

[0223] In some embodiments, not all of the at least three, at least four, or at least five nucleotides modified with the first modification are located consecutively in the sense strand of the isolated oligonucleotide of the present disclosure, hi some embodiments, at least three, at least four, or at least five nucleotides in the sense strand of the isolated oligonucleotide of the present disclosure are modified with a 2'-F modification.

[0224] In some embodiments, the sense strand of the isolated oligonucleotide of the present disclosure has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', comprising nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93'.

[0225] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a3', comprising nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93'.

[0226] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3' comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), where M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', wherein the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 57, 58, 71, 85, 90, 92, 95, 96, 99, or 110.

[0227] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a3' comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', wherein the sense strand comprises a nucleotide sequence according to SEQ ID NO: 71.

[0228] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', comprising nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 71 and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 16.

[0229] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a3' comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', wherein the sense strand comprises a nucleotide sequence according to SEQ ID NO: 85.

[0230] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', comprising nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 85 and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 30.

[0231] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a3' comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', wherein the sense strand comprises a nucleotide sequence according to SEQ ID NO: 57.

[0232] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', comprising nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 57 and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 2.

[0233] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a3' comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', wherein the sense strand comprises a nucleotide sequence according to SEQ ID NO: 58.

[0234] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', comprising nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 58 and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 3.

[0235] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a3' comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', wherein the sense strand comprises a nucleotide sequence according to SEQ ID NO: 90.

[0236] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', comprising nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 90 and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 35.

[0237] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a3' comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', wherein the sense strand comprises a nucleotide sequence according to SEQ ID NO: 110.

[0238] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', comprising nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 110 and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 55.

[0239] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a3' comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', wherein the sense strand comprises a nucleotide sequence according to SEQ ID NO: 92.

[0240] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', comprising nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 92 and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 37.

[0241] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a3' comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', wherein the sense strand comprises a nucleotide sequence according to SEQ ID NO: 95.

[0242] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', comprising nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 95 and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 40.

[0243] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a3' comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', wherein the sense strand comprises a nucleotide sequence according to SEQ ID NO: 96.

[0244] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', comprising nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 96 and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 41.

[0245] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a3' comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', wherein the sense strand comprises a nucleotide sequence according to SEQ ID NO:99.

[0246] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', comprising nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises a nucleotide sequence according to SEQ ID NO:99 and the antisense strand comprises a nucleotide sequence according to SEQ ID NO:44.

[0247] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1311 and 1331 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5'UCAAAAAAAAUGCUGUUCAGCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 71 (5'CUGAACAGCAUUUUUUUUGA3').

[0248] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1825 and 1845 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5'UCACUUUUUUGUUUCACAAACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 85 (5'UUUGUGAAACAAAAAAGUGA3').

[0249] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1829 and 1849 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5'UGGAACACUUUUUUGUUUCACA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5'UGAAACAAAAAAGUGUUCCA3').

[0250] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1837 and 1857 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5'UUUGAAAAGGGAACACUUUUUU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5'AAAAGUGUUCCCUUUUCAAA3').

[0251] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1854 and 1874 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'UCAAUUUUUGUUCUCAACUUGA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 90 (5'AAGUUGAGAACAAAAAUUGA3').

[0252] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1860 and 1880 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5'UAAAACCCAAUUUUUGUUCUCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 110 (5'AGAACAAAAAUUGGGUUUUA3').

[0253] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1865 and 1885 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5'UAUUUUAAAACCCAAUUUUUGU3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 92 (5'AAAAAUUGGGUUUUAAAAUA3').

[0254] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1873 and 1893 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 40 (5'UAUACUUUAAUUUUAAAACCCA3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 95 (5'GGUUUUAAAAUUAAAGUAUA3').

[0255] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1874 and 1894 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 41 (5'UUAUACUUUAAUUUUAAAACCC3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 96 (5'GUUUUAAAAUUAAAGUAUAA3').

[0256] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 169 and 189 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5'UGUACUCUCAUUGUGGAUGACG3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 99 (5'UCAUCCACAAUGAGAGUACA3').

[0257] antisense strand

[0258] In some embodiments, up to seven nucleotides in the antisense strand of the isolated oligonucleotide of the disclosure are modified with a third modification.

[0259] In some embodiments, in the antisense strand of an isolated oligonucleotide of the disclosure, up to four of the up to seven nucleotides modified with a tertiary modification are located at positions 2-8 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the disclosure, at least one of the up to seven nucleotides modified with a tertiary modification is located at position 2 from the first nucleotide at the 5' end of the antisense strand.

[0260] In some embodiments, in the antisense strand of the isolated oligonucleotide of the present disclosure, up to two of the up to seven nucleotides modified with a tertiary modification are located consecutively. In some embodiments, in the antisense strand of the isolated oligonucleotide of the present disclosure, up to two of the up to seven nucleotides modified with a tertiary modification that are located consecutively are located at positions 2 and 3 from the first nucleotide at the 5' end of the antisense strand.

[0261] In some embodiments, in the antisense strand of the isolated oligonucleotide of this disclosure, at least one of the up to seven nucleotides modified with a tertiary modification is located at position 14 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotide of this disclosure, two or three of the up to seven nucleotides modified with a tertiary modification are located at a position selected from positions 2, 3, 5, and 6 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotide of this disclosure, three of the up to seven nucleotides modified with a tertiary modification are located at a position selected from positions 2, 3, 5, and 6 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotide of this disclosure, two of the up to seven nucleotides modified with a tertiary modification are located at positions 2 and 5 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotide of the present disclosure, two of the up to seven nucleotides modified with a third modification are located at positions 2 and 3 from the first nucleotide at the 5' end of the antisense strand.

[0262] In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, three of the up to seven nucleotides modified with a third modification are located at positions 2, 3, and 5 from the first nucleotide at the 5' end of the antisense strand.

[0263] In some embodiments, in the antisense strand of the isolated oligonucleotide of this disclosure, one or two of the up to seven nucleotides modified with a tertiary modification are located at positions selected from positions 14 and 16 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotide of this disclosure, two of the up to seven nucleotides modified with a tertiary modification are located at positions 14 and 16 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotide of this disclosure, up to seven nucleotides are modified with a 2'-F modification. In some embodiments, in the antisense strand of the isolated oligonucleotide of this disclosure, one of the up to seven nucleotides modified with a tertiary modification is located at position 14 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotide of this disclosure, two of the up to seven nucleotides modified with a tertiary modification are located at positions 14 and 16 from the first nucleotide at the 5' end of the antisense strand.

[0264] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand comprises up to seven nucleotides modified with a third modification, and up to seven nucleotides are modified with a 2'-F modification. In some embodiments, in the antisense strand of the isolated oligonucleotide of the present disclosure, one of the up to seven nucleotides modified with a third modification is located at position 2 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotide of the present disclosure, one of the up to seven nucleotides modified with a third modification is located at position 3 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotide of the present disclosure, one of the up to seven nucleotides modified with a third modification is located at position 5 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotide of the present disclosure, one of the up to seven nucleotides modified with a third modification is located at position 7 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of this disclosure, one of the up to seven nucleotides modified with a tertiary modification is located at position 10 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of this disclosure, one of the up to seven nucleotides modified with a tertiary modification is located at position 14 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of this disclosure, one of the up to seven nucleotides modified with a tertiary modification is located at position 16 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of this disclosure, the up to seven nucleotides modified with a tertiary modification are located at positions 2, 3, 5, 7, 10, 14, and 16 from the first nucleotide at the 5' end of the antisense strand.

[0265] In some embodiments, in the antisense strand of the isolated oligonucleotide of the present disclosure, the antisense strand has the formula: 3'(M)a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o The antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15'.

[0266] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) oand a, b, c, d, e, f, g, h, i, j, k, l, m, n, and o are any one of 0 to 16, and the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 2, 3, 16, 30, 35, 37, 40, 41, 44, or 55.

[0267] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o and a, b, c, d, e, f, g, h, i, j, k, l, m, n, and o are any one of 0 to 16, and the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 16.

[0268] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M)a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o and wherein the antisense strand is one of: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 16, and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 71.

[0269] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) oand the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 30.

[0270] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o and wherein the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 30, and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 85.

[0271] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M)a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o and the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 2.

[0272] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) oand wherein the antisense strand is one of: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 2, and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 57.

[0273] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o and the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 3.

[0274] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M)a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o and wherein the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 3, and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 58.

[0275] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) oand the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 35.

[0276] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o and wherein the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 35, and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 90.

[0277] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M)a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o and the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 55.

[0278] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) oand wherein the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 55, and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 110.

[0279] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o and the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 37.

[0280] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M)a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o and wherein the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 37, and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 92.

[0281] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) oand the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 40.

[0282] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o and wherein the antisense strand is one of: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 40, and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 95.

[0283] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M)a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o and the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 41.

[0284] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) oand wherein the antisense strand is one of: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 41, and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 96.

[0285] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o and the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 44.

[0286] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M)a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o and wherein the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 44, and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 99.

[0287] Targeting Ligands

[0288] In some embodiments, the sense strand or antisense strand, or both, of the isolated oligonucleotide of the present disclosure are linked to a targeting ligand at a terminal or internal nucleotide. In some embodiments, the targeting ligand is linked to one or more nucleotides at the 5' end of the sense strand of the isolated oligonucleotide of the present disclosure. In some embodiments, the targeting ligand is linked to one or more nucleotides at the 3' end of the sense strand of the isolated oligonucleotide of the present disclosure. In some embodiments, the targeting ligand is linked to one or more nucleotides at the 5' end of the antisense strand of the isolated oligonucleotide of the present disclosure. In some embodiments, the targeting ligand is linked to one or more nucleotides at the 3' end of the antisense strand of the isolated oligonucleotide of the present disclosure. In some embodiments, the targeting ligand is linked to one or more nucleotides of the at least two single-stranded nucleotides at the 3' end of the antisense strand of the isolated oligonucleotide of the present disclosure.

[0289] In some embodiments, the targeting ligand is selected from one or more of a carbohydrate, a peptide, a lipid, an antibody or fragment thereof, an aptamer, albumin, fibrinogen, and folate. In some embodiments, the targeting ligand binds to a surface protein on a cell expressing the target mRNA of the isolated oligonucleotide of the present disclosure. In some embodiments, the targeting ligand mediates the entry of the isolated oligonucleotide of the present disclosure into a cell expressing the target mRNA of the isolated oligonucleotide of the present disclosure.

[0290] In some embodiments, the targeting ligand is a therapeutic ligand. In some embodiments, the targeting ligand is a therapeutic antibody.

[0291] In some embodiments, the targeting ligand is linked to the isolated oligonucleotide of the present disclosure by a linker. In some embodiments, the linker is any one of a protein, DNA, RNA, or chemical compound. In some embodiments, the isolated oligonucleotide of the present disclosure, the linker, and the targeting ligand form a scaffold. As used herein, the term "scaffold" refers to a compound or complex comprising a linker of the present disclosure, wherein the linker is covalently bound to the ligand or the isolated oligonucleotide, or both.

[0292] In some embodiments, the isolated oligonucleotide of the present disclosure, the linker, and the targeting ligand form a conjugate. As used herein, the term "conjugate" refers to a compound or complex comprising an isolated oligonucleotide covalently attached to a ligand via a linker of the present disclosure.

[0293] As used herein, the term "targeting ligand" or "ligand" refers to a moiety that, when covalently attached to an oligonucleotide, GalNAc, can mediate its entry into, or facilitate or enable its delivery to, a target site (e.g., a target cell or tissue). In some embodiments, the targeting ligand comprises a sugar ligand moiety (e.g., N-acetylgalactosamine (GalNAc)) that can direct uptake of the oligonucleotide to the liver.

[0294] In some embodiments, the targeting ligand binds to the asialoglycoprotein receptor (ASGPR). In some embodiments, the targeting ligand binds to the liver, e.g., to liver parenchymal cells (e.g., via ASGPR).

[0295] Suitable targeting ligands include, but are not limited to, those described in Winkler (Ther. Deliv., 2013, 4(7):791-809), PCT Patent Application Publications WO 2016 / 100401, WO 2012 / 089352, and WO 2009 / 082607, and U.S. Patent Application Publications WO 2009 / 0239814, WO 2012 / 0136042, WO 2013 / 0158824, and WO 2009 / 0247608.

[0296] In some embodiments, the targeting ligand comprises a carbohydrate moiety.

[0297] As used herein, a "carbohydrate moiety" refers to a moiety comprising one or more monosaccharide units, each having at least six carbon atoms (which may be linear, branched, or cyclic), with an oxygen, nitrogen, or sulfur atom attached to each carbon atom. In some embodiments, the carbohydrate moiety comprises a monosaccharide, disaccharide, trisaccharide, or tetrasaccharide. In some embodiments, the carbohydrate moiety comprises an oligosaccharide containing about 4-9 monosaccharide units. In some embodiments, the carbohydrate moiety comprises a polysaccharide (e.g., starch, glycogen, cellulose, or a polysaccharide gum).

[0298] In some embodiments, the carbohydrate moiety comprises a monosaccharide, disaccharide, trisaccharide, or tetrasaccharide. In some embodiments, the carbohydrate moiety comprises an oligosaccharide (e.g., containing about 4 to about 9 monosaccharide units). In some embodiments, the carbohydrate moiety comprises a polysaccharide (e.g., starch, glycogen, cellulose, or a polysaccharide gum).

[0299] In some embodiments, the ligand is capable of binding to a human asialoglycoprotein receptor (ASGPR), such as human asialoglycoprotein receptor 2 (ASGPR2).

[0300] In some embodiments, the carbohydrate moiety comprises a sugar (e.g., 1, 2, or 3 sugars). In some embodiments, the carbohydrate moiety comprises galactose or a derivative thereof (e.g., 1, 2, or 3 galactose or a derivative thereof). In some embodiments, the carbohydrate moiety comprises N-acetylgalactosamine or a derivative thereof (e.g., 1, 2, or 3 N-acetylgalactosamine or a derivative thereof). In some embodiments, the carbohydrate moiety comprises N-acetyl-D-galactosylamine or a derivative thereof (e.g., 1, 2, or 3 N-acetyl-D-galactosylamine or a derivative thereof).

[0301] In some embodiments, the carbohydrate moiety comprises an N-acetylgalactosamine (e.g., one, two, or three N-acetylgalactosamines). In some embodiments, the carbohydrate moiety comprises an N-acetyl-D-galactosylamine (e.g., one, two, or three N-acetyl-D-galactosylamines).

[0302] In some embodiments, the carbohydrate moiety comprises mannose or a derivative thereof (e.g., mannose-6-phosphate). In some embodiments, the carbohydrate moiety further comprises a linking moiety that connects one or more sugars (e.g., N-acetyl-D-galactosylamine) to a linker.

[0303] In some embodiments, the linker comprises a thioether (e.g., thiosuccinimide, or its hydrolyzed analog), a disulfide, a triazole, a phosphorothioate, a phosphodiester, an ester, an amide, or any combination thereof. In some embodiments, the linker is a three-branched linking moiety. Suitable targeting ligands include, but are not limited to, those described in PCT Publication Nos. WO 2015 / 006740, WO 2016 / 100401, WO 2017 / 214112, WO 2018 / 039364, and WO 2018 / 045317 (each of which is incorporated herein by reference).

[0304] In some embodiments, the targeting ligand comprises a lipid or lipid moiety (e.g., one, two, or three lipid moieties). In some embodiments, the lipid moiety comprises a C8-C24 fatty acid, cholesterol, a vitamin, a sterol, a phospholipid, or any combination thereof (e.g., one, two, or three of these).

[0305] In some embodiments, the targeting ligand comprises a peptide or peptide moiety (e.g., one, two, or three peptide moieties). In some embodiments, the peptide moiety comprises an integrin, insulin, glucagon-like peptide, or any combination thereof (e.g., one, two, or three of these). In some embodiments, the targeting ligand comprises an antibody or antibody moiety (e.g., transferrin). In some embodiments, the targeting ligand comprises one, two, or three antibody moieties (e.g., transferrin).

[0306] In some embodiments, the targeting ligand comprises an oligonucleotide (e.g., an aptamer or CpG). In some embodiments, the targeting ligand comprises one, two, or three oligonucleotides (e.g., an aptamer or CpG).

[0307] In some embodiments, the ligand comprises one, two, or three sugars (e.g., N-acetyl-D-galactosylamine); one, two, or three lipid moieties; one, two, or three peptide moieties; one, two, or three antibody moieties; one, two, or three oligonucleotides; or any combination thereof.

[0308] In some embodiments, the linker is attached to the isolated oligonucleotide of the present disclosure via a phosphate group or an analog of a phosphate group in the isolated oligonucleotide.

[0309] In some embodiments, the ligand comprises a sugar ligand moiety (eg, N-acetylgalactosamine (GalNAc)) that can direct uptake of the oligonucleotide into the liver.

[0310] In some embodiments, the ligand comprises GalNAc or a derivative thereof, hi some embodiments, the ligand comprises the GalNAc G1b structure shown below: [ka]

[0311] In some embodiments, the ligand comprises three GalNAc moieties or three derivatives thereof. In some embodiments, the ligand comprises three GalNAc G1b moieties. In some embodiments, the ligand comprises three GalNAc G1b moieties, the GalNAc G1b moieties are positioned consecutively. In some embodiments, the consecutively positioned GalNAc G1b moieties are positioned at the 3'-end of the sense strand. In some embodiments, the ligand comprises three consecutively positioned GalNAc G1b ("G1b") moieties, the first G1b moiety is linked to the second G1b moiety, and the second G1b is linked to the third G1b moiety. In some embodiments, the first GalNAc G1b moiety is linked to the sense strand of an isolated oligonucleotide of the present disclosure.

[0312] In some embodiments of the isolated oligonucleotide of the present disclosure, the ligand comprises three GalNAc Glb ("Glb") moieties, wherein a first GalNAc Glb moiety is linked to the sense strand of the isolated oligonucleotide, the first GalNAc Glb moiety is also linked to a second GalNAc Glb moiety, and the second Glb moiety is linked to a third Glb moiety. In some embodiments where the ligand comprises three GalNAc Glb moieties, the three GalNAc Glb moieties are located consecutively at the 3'-end of the sense strand.

[0313] In some embodiments of the isolated oligonucleotide of the present disclosure, the isolated oligonucleotide is linked to a ligand (e.g., GalNAc G1b or three GalNAc G1b moieties). In some embodiments, the isolated oligonucleotide is linked to the ligand via an internal or terminal nucleotide of the isolated oligonucleotide. In some embodiments, the isolated oligonucleotide is linked to the ligand via a ligand linker. In some embodiments,

[0314] In some embodiments of the isolated oligonucleotide of the present disclosure, the isolated oligonucleotide comprises a sense strand and an antisense strand, and the ligand comprises three GalNAc G1b moieties, and the three GalNAc G1b moieties are located consecutively at the 3'-end of the sense strand, and the ligand is linked to the terminal nucleotide on the sense strand of the isolated oligonucleotide. In some embodiments, the ligand is linked to the terminal nucleotide on the sense strand via a ligand linker. In some embodiments, the ligand linker is a monovalent linker. In some embodiments, the ligand linker is a bivalent linker. In some embodiments, the ligand linker is a trivalent linker.

[0315] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1 and any one of nucleotide positions selected from a) 169-189; b) 1311-1331; and c) 1825-1894, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, and a targeting ligand is attached to the 3' end of the sense strand. In some embodiments, the targeting ligand comprises three GalNAc G1b moieties.

[0316] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 169-189; b) 1311-1331; and c) 1825-1894 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the targeting ligand comprises three GalNAc residues attached to the 3' end of the sense strand. G1b portion, wherein the sense strand comprises a nucleic acid sequence according to SEQ ID NO:71 (5'CUGAACAGCAUUUUUUUUGA3'); SEQ ID NO:85 (5'UUUGUGAAACAAAAAAGUGA3'); SEQ ID NO:57 (5'UGAAACAAAAAAGUGUUCCA3'); SEQ ID NO:58 (5'AAAAGUGUUCCCUUUUCAAA3'); SEQ ID NO:90 (5'AAGUUGAGAACAAAAAUUGA3'); SEQ ID NO:110 (5'AGAACAAAAAUUGGGUUUUA3'); SEQ ID NO:92 (5'AAAAAUUGGGUUUUAAAAUA3'); SEQ ID NO:95 (5'GGUUUUAAAAUUAAAGUAUA3'); SEQ ID NO:96 (5'GUUUUAAAAUUAAAGUAUAA3'); or SEQ ID NO:99 (5'UCAUCCACAAUGAGAGUACA3').

[0317] Linkage at the 3' end of the isolated oligonucleotides of the present disclosure may utilize either the 2' or 3' hydroxyl position of the nucleoside, either directly via the 5', 3', or 2' hydroxyl group, or indirectly via a non-nucleotidic linker or nucleoside. Linkage may also utilize a functionalized sugar or nucleobase of the 3'-terminal nucleotide. In some embodiments, the ligands described herein may be attached to the isolated oligonucleotides of the present disclosure using a variety of ligand linkers, which may be cleavable or non-cleavable.

[0318] Modification of phosphate groups

[0319] Modified terminal phosphate groups

[0320] The present disclosure further provides oligonucleotides and conjugates containing modified phosphate groups (also called phosphate mimetics or phosphate derivatives) for nucleic acid delivery. The present disclosure also relates to the use of oligonucleotides and conjugates containing modified phosphate groups, for example, in the delivery of nucleic acids and / or the treatment or prevention of disease.

[0321] In some embodiments, the present disclosure provides phosphate mimetics of the 5'-terminal nucleotide. Without wishing to be bound by theory, it is understood that when incorporated into an oligonucleotide (e.g., at the 5'-end of the antisense strand), the phosphate mimetics can improve Ago2 binding / loading and enhance the metabolic stability of the oligonucleotide, thus enhancing the potency and duration of the isolated oligonucleotide (e.g., dsRNA or siRNA).

[0322] In some embodiments of the isolated oligonucleotides of the present disclosure, the oligonucleotides comprise 5'-terminal nucleotide modifications. In some embodiments, the 5'-terminal modifications provide the functional effects of a phosphate group, but are more stable in the environmental conditions to which the oligonucleotides are exposed when administered to a subject. In some embodiments, the isolated oligonucleotides comprise phosphate mimics that are more resistant to phosphatases and other enzymes, while minimizing adverse effects on the function of the oligonucleotides (e.g., minimizing reduction in gene target knockdown when used as RNAi inhibitor molecules).

[0323] In some embodiments, the 5'-end modification is a chemical modification, hi some embodiments, the chemical modification enhances stability against nucleases or other enzymes that degrade or interfere with the structure or activity of the isolated oligonucleotide.

[0324] In some embodiments, the sense strand or antisense strand of an isolated oligonucleotide of the present disclosure comprises a 5'-terminal phosphate group. In some embodiments, the 5'-terminal phosphate group comprises an unmodified phosphate having the formula: -OP(=O)(OH)OH. In some embodiments, the 5'-terminal phosphate group comprises a modified phosphate. In some embodiments, the 5'-terminal phosphate group comprises a modified phosphate having the formula: -CH2-P(=X)(OR 1 ) OR 2 (wherein X is O or S, and R 1 is H or C1-C6 alkyl, and R 2 is H or C1-C6 alkyl). In some embodiments, the modified phosphates are referred to as "phosphate mimetics."

[0325] The term "halo" or "halogen" as used herein refers to fluoro, chloro, bromo and iodo.

[0326] As used herein, the term "aryl" includes groups with aromatic character, including "conjugated" or polycyclic systems having one or more aromatic rings, and does not include heteroatoms in the ring structure. The term aryl includes both monovalent and divalent species. Examples of aryl groups include, but are not limited to, phenyl, biphenyl, naphthyl, and the like. Conveniently, the aryl is phenyl.

[0327] As used herein, the term "alkyl" or "C1-C6 alkyl" is intended to include C1, C2, C3, C4, C5, or C6 straight-chain (linear) saturated aliphatic hydrocarbon groups and C3, C4, C5, or C6 branched saturated aliphatic hydrocarbon groups. For example, C1-C6 alkyl is intended to include C1, C2, C3, C4, C5, and C6 alkyl groups. Examples of alkyl include, but are not limited to, moieties having 1 to 6 carbon atoms, such as methyl, ethyl, n-propyl, i-propyl, n-butyl, s-butyl, t-butyl, n-pentyl, i-pentyl, or n-hexyl. In some embodiments, a straight-chain or branched alkyl has 6 or fewer carbon atoms (e.g., C1-C6 for straight chain, C3-C6 for branched chain), and in other embodiments, a straight-chain or branched alkyl has 4 or fewer carbon atoms. In some embodiments, a straight-chain alkyl has 1 carbon atom. In some embodiments, a straight-chain alkyl has 2 carbon atoms.

[0328] In some embodiments, the phosphate mimetic is linked to the 5' end of an isolated oligonucleotide (e.g., siRNA) as shown in the following formula: [ka] During the ceremony, B is H or a nucleobase moiety; X is O or S; R 1 is H or C1-C6 alkyl, R 2 is H or C1-C6 alkyl, Y 1 is O or S, Y 2 is O or S, Z is H, halogen or -OR Z and R Z is H, C1-C6 alkyl, or -(C1-C6 alkyl)-(C6-C 10 aryl), where C1-C6 alkyl or -(C1-C6 alkyl)-(C6-C 10aryl) can be one or more R Za and optionally substituted with Each R Za are independently halogen, C1-C6 alkyl, or —O—(C1-C6 alkyl), where C1-C6 alkyl or —O—(C1-C6 alkyl) is optionally substituted with one or more halogens; and [ka] indicates the attachment of an isolated oligonucleotide (eg, siRNA) to a nucleotide.

[0329] In some embodiments, the phosphate mimetic is linked to the 5' end of an isolated oligonucleotide (e.g., siRNA) as shown in the following formula: [ka] During the ceremony, B is H or a nucleobase moiety; X is O or S; R 1 is H or C1-C6 alkyl, R 2 is H or C1-C6 alkyl, Y 1 is O or S, Y 2 is O or S, and [ka] indicates the attachment of an isolated oligonucleotide (eg, siRNA) to a nucleotide.

[0330] In some embodiments, the phosphate mimetic is linked to the 5' end of an isolated oligonucleotide (e.g., siRNA) as shown in the following formula: [ka] During the ceremony, B is H or a nucleobase moiety; X is O or S; R 1 is H or C1-C6 alkyl, R 2 is H or C1-C6 alkyl, and [ka] indicates the attachment of an isolated oligonucleotide (eg, siRNA) to a nucleotide.

[0331] In some embodiments, X is O.

[0332] In some embodiments, X is S.

[0333] In some embodiments, R 1 is H.

[0334] In some embodiments, R 1 is C1-C6 alkyl (for example, methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl or hexyl).

[0335] In some embodiments, R 1 is methyl.

[0336] In some embodiments, R 2 is H.

[0337] In some embodiments, R 2 is C1-C6 alkyl (for example, methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl or hexyl).

[0338] In some embodiments, R 2 is methyl.

[0339] In some embodiments, Y 1 is O.

[0340] In some embodiments, Y 1 is S.

[0341] In some embodiments, Y 2 is O.

[0342] In some embodiments, Y 2 is S.

[0343] In some embodiments, Z is H.

[0344] In some embodiments, Z is not H.

[0345] In some embodiments, Z is halogen (eg, F, Cl, Br, or I).

[0346] In some embodiments, Z is F or Cl.

[0347] In some embodiments, Z is F.

[0348] In some embodiments, Z is -OR Z is.

[0349] In some embodiments, Z is —OH.

[0350] In some embodiments, Z is not —OH.

[0351] In some embodiments, Z is -O-(C1-C6 alkyl) (e.g., C1-C6 alkyl is methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl).

[0352] In some embodiments, Z is —OCH 3 .

[0353] In some embodiments, Z is -O-(C1-C6 alkyl)-O-(C1-C6 alkyl) (e.g., C1-C6 alkyl is methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl).

[0354] In some embodiments, Z is —OCH 2 CH 2 OCH 3 .

[0355] In some embodiments, Z is one or more R Za -O-(C1-C6 alkyl)-(C6-C 10 aryl).

[0356] In some embodiments, Z is —O—(C1-C6 alkyl)-(C6-C 10 aryl).

[0357] In some embodiments, Z is [ka] is.

[0358] In some embodiments, Z is one or more R Za optionally replaced with [ka] is.

[0359] In some embodiments, Z is optionally substituted with one or more halogens. [ka] is.

[0360] In some embodiments, Z is optionally substituted with one or more C1-C6 alkyl or -O-(C1-C6 alkyl). [ka] wherein the C1-C6 alkyl or -O-(C1-C6 alkyl) is optionally substituted with one or more halogens.

[0361] In some embodiments, R Z is H.

[0362] In some embodiments, R Z is not H.

[0363] In some embodiments, R Z is one or more R Za and C1-C6 alkyl (for example, methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl or hexyl) optionally substituted with.

[0364] In some embodiments, R Z is C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl or hexyl) optionally substituted with one or more halogens (e.g., F, Cl, Br or I) or —O—(C1-C6 alkyl) optionally substituted with one or more halogens (e.g., C1-C6 alkyl is methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl or hexyl).

[0365] In some embodiments, R Z is C1-C6 alkyl (for example, methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl or hexyl).

[0366] In some embodiments, R Z is methyl, ethyl or propyl.

[0367] In some embodiments, R Z is methyl.

[0368] In some embodiments, R Z is C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl) substituted with one or more halogens (e.g., F, Cl, Br, or I).

[0369] In some embodiments, R Z is C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl or hexyl) substituted with one or more —O—(C1-C6 alkyl) (e.g., C1-C6 alkyl is methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl or hexyl), where —O—(C1-C6 alkyl) is optionally substituted with one or more halogens.

[0370] In some embodiments, R Z is one or more R Za optionally substituted with -(C1-C6 alkyl)-(C6-C 10 aryl).

[0371] In some embodiments, R Z is -(C1-C6 alkyl)-(C6-C6 alkyl) optionally substituted with one or more halogens (e.g., F, Cl, Br, or I); 10 aryl), C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl), or —O—(C1-C6 alkyl) (e.g., C1-C6 alkyl is methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl), where C1-C6 alkyl or —O—(C1-C6 alkyl) is optionally substituted with one or more halogens.

[0372] In some embodiments, R Zis -(C1-C6 alkyl)-(C6-C 10 aryl).

[0373] In some embodiments, at least one R Za is a halogen (e.g., F, Cl, Br, or I).

[0374] In some embodiments, at least one R Za is F or Cl.

[0375] In some embodiments, at least one R Za is C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl or hexyl) optionally substituted with one or more halogens (e.g., F, Cl, Br or I).

[0376] In some embodiments, at least one R Za is C1-C6 alkyl (for example, methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl or hexyl).

[0377] In some embodiments, at least one R Za is C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl) substituted with one or more halogens (e.g., F, Cl, Br, or I).

[0378] In some embodiments, at least one R Za is —O—(C1-C6 alkyl) optionally substituted with one or more halogens (e.g., F, Cl, Br, or I).

[0379] In some embodiments, at least one R Za is —O—(C1-C6 alkyl).

[0380] In some embodiments, at least one R Za is —O—(C1-C6 alkyl) substituted with one or more halogens (e.g., F, Cl, Br, or I).

[0381] In some embodiments, B is H.

[0382] In some embodiments, B is a nucleobase moiety.

[0383] As used herein, the term "nucleobase moiety" refers to a nucleobase that is attached to the remainder of an isolated oligonucleotide (e.g., a dsRNA or siRNA) of the disclosure, e.g., via an atom of the nucleobase or a functional group thereof.

[0384] In some embodiments, the nucleobase moiety is adenine (A), cytosine (C), guanine (G), thymine (T), or uracil (U).

[0385] In some embodiments, the nucleobase moiety is uracil (U).

[0386] In some embodiments, the phosphate mimetic is linked to the 5' end of the isolated oligonucleotide, as shown in the following formula: [ka] During the ceremony, B is a nucleobase moiety, the nucleobase moiety is uracil (U), the uracil is at position 1 from the 5' end of the sense strand or position 1 from the 5' end of the antisense strand; X is O, R 1 is a C1 alkyl, R 2 is H, and [ka] indicates the attachment of an isolated oligonucleotide (eg, siRNA) to a nucleotide.

[0387] In some embodiments of the isolated oligonucleotide of the present disclosure, a phosphate mimetic is attached to the 5' end of the antisense strand of the isolated oligonucleotide.

[0388] In some embodiments, the phosphate mimetic is attached to the 5'-terminal uridine of the antisense strand of an isolated oligonucleotide having the following structure: 5'-MeEPmU. [ka] where "mU" is a 2'-O-methyl modified uridine nucleotide and "MeEP" is a monomethyl protected phosphate mimic.

[0389] In some embodiments, the phosphate mimetic is attached to the 5'-terminal uridine of the antisense strand of an isolated oligonucleotide having the following structure: (5'-MeEPmUs). [ka] where "mU" is a 2'-O-methyl modified uridine nucleotide, "MeEP" is a monomethyl protected phosphate mimic, and "s" is a phosphorothioate internucleotide linkage.

[0390] In some embodiments, the phosphate mimetic is attached to the 5'-terminal uridine of the antisense strand of an isolated oligonucleotide having the following structure: (5'-EPmUs): [ka] where "mU" is a 2'-O-methyl modified uridine nucleotide, "EP" is a phosphate mimetic, and "s" is a phosphorothioate internucleotide linkage.

[0391] The terms "5'-MeEP", "5'-MeEP", and "5'MeEP" are used interchangeably herein.

[0392] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1 and any one of nucleotide positions selected from a) 169-189; b) 1311-1331; and c) 1825-1894, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, and the antisense strand comprises a monomethyl-protected phosphate mimic (MeEP). In some embodiments, MeEP is linked to the 5' end of the antisense strand (5'-MeEP).

[0393] In some embodiments in which MeEP is linked to the 5' end of the antisense strand, a phosphate mimetic is attached to the 5' terminal uridine of the antisense strand.

[0394] In some embodiments, the 5'-terminal uridine is a 2'-O-methyl modified nucleotide.

[0395] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 169-189; b) 1311-1331; and c) 1825-1894 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, the antisense strand comprises 5'-MeEP linked to the 5' end of the antisense strand, and the antisense strand is substantially complementary to a nucleotide sequence of SEQ ID NO: 16 (5'UCAAAAAAAAUGCUGUUCAGCA3'); SEQ ID NO: 30 (5'UCACUUUUUUGUUUCACAAACA3'); SEQ ID NO: 2 (5'UCAAAAAAAAUGCUGUUCAGCA3'); SEQ ID NO:35 (5'UCAAUUUUUGUUCUCAACUUGA3'); SEQ ID NO:55 (5'UAAAACCCAAUUUUUGUUCUCA3'); SEQ ID NO:37 (5'UAUUUUAAAACCCAAUUUUUGU3'); SEQ ID NO:40 (5'UAUACUUUAAUUUUAAAACCCA3'); SEQ ID NO:41 (5'UUAUACUUUAAUUUUAAAACCC3'); or SEQ ID NO:44 (5'UGUACUCUCAUUGUGGAUGACG3').

[0396] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 169-189; b) 1311-1331; and c) 1825-1894 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, wherein the antisense strand comprises 5'-MeEP linked to the 5' end of the antisense strand, and the sense strand comprises a targeting ligand comprising three GalNAc G1b moieties attached to the 3' end of the sense strand.

[0397] Modified backbone phosphate / phosphodiester linkages

[0398] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand, the antisense strand, or both, comprise at least one nucleotide with a modified phosphate backbone. In some embodiments, the sense strand of the isolated oligonucleotide comprises at least one nucleotide with a modified phosphate backbone. In some embodiments, the antisense strand of the isolated oligonucleotide comprises at least one nucleotide with a modified phosphate backbone. In some embodiments, the isolated oligonucleotide of the present disclosure comprises a modified phosphate backbone, the modified phosphate backbone comprises a modified phosphodiester bond. The phosphodiester bond is represented by the formula: [ka] (In the formula, [ka] represents the bond to the 3' carbon of the first nucleotide in the isolated oligonucleotide of the disclosure, and [ka] In some embodiments, the phosphodiester bond is unmodified and Z 1 is O and Z 2 is OH or O - In some embodiments, the phosphodiester bond is modified and Z 1 is O, S, NH, or N(C1-C6 alkyl), and Z 2 OH, SH, NH2, NH(C1-C6 alkyl), O - , S - , H.N. - , or (C1-C6 alkyl)N - and Z 1 If is O, then Z 2 is OH or O - isn't it.

[0399] In some embodiments, Z 1 is O.

[0400] In some embodiments, Z 1 is S.

[0401] In some embodiments, Z1 is NH.

[0402] In some embodiments, Z1 is N(C1-C6 alkyl).

[0403] In some embodiments, Z2 is OH.

[0404] In some embodiments, Z2 is SH.

[0405] In some embodiments, Z2 is NH2.

[0406] In some embodiments, Z2 is NH(C1-C6 alkyl).

[0407] In some embodiments, Z2 is SH, NH2, or NH(C1-C6 alkyl).

[0408] In some embodiments, Z2 is O - is.

[0409] In some embodiments, Z2 is S - is.

[0410] In some embodiments, Z2 is HN - is.

[0411] In some embodiments, Z2 is (C1-C6 alkyl)N - is.

[0412] In some embodiments, Z2 is S - , H.N. - or (C1-C6 alkyl)N - is.

[0413] In some embodiments, Z 1 is O and Z 2 is SH.

[0414] In some embodiments, Z1 is O and Z2 is NH2.

[0415] In some embodiments, Z1 is O and Z2 is NH(C1-C6 alkyl).

[0416] In some embodiments, Z1 is S and Z2 is OH.

[0417] In some embodiments, Z1 is S and Z2 is SH.

[0418] In some embodiments, Z1 is S and Z2 is NH2.

[0419] In some embodiments, Z1 is S and Z2 is NH(C1-C6 alkyl).

[0420] In some embodiments, Z1 is NH and Z2 is OH.

[0421] In some embodiments, Z1 is NH and Z2 is SH.

[0422] In some embodiments, Z1 is NH and Z2 is NH2.

[0423] In some embodiments, Z1 is NH and Z2 is NH(C1-C6 alkyl).

[0424] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is OH.

[0425] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is SH.

[0426] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is NH2.

[0427] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is NH(C1-C6 alkyl).

[0428] In some embodiments, Z1 is O and Z2 is S - is.

[0429] In some embodiments, Z1 is O and Z2 is HN - is.

[0430] In some embodiments, Z1 is O and Z2 is (C1-C6 alkyl)N - is.

[0431] In some embodiments, Z1 is S and Z2 is O - is.

[0432] In some embodiments, Z1 is S and Z2 is S - is.

[0433] In some embodiments, Z1 is S and Z2 is HN - is.

[0434] In some embodiments, Z1 is S and Z2 is (C1-C6 alkyl)N - is.

[0435] In some embodiments, Z1 is NH and Z2 is O - is.

[0436] In some embodiments, Z1 is NH and Z2 is S - is.

[0437] In some embodiments, Z1 is NH and Z2 is HN - is.

[0438] In some embodiments, Z1 is NH and Z2 is (C1-C6 alkyl)N - is.

[0439] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is O - is.

[0440] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is S - is.

[0441] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is HN - is.

[0442] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is (C1-C6 alkyl)N - is.

[0443] In some embodiments, the modified phosphodiester linkage comprises a phosphorothioate internucleotide linkage.

[0444] In some embodiments, the modified phosphodiester bond is [ka] or [ka] (In the formula, [ka] indicates the linkage to the 3' carbon of the first nucleotide in the isolated oligonucleotide of the disclosure, and [ka] indicates the linkage to the 5' carbon of the second nucleotide in the isolated oligonucleotide of the disclosure).

[0445] In some embodiments, the modified phosphodiester bond is [ka] (In the formula, [ka] indicates the linkage to the 3' carbon of the first nucleotide in the isolated oligonucleotide of the disclosure, and [ka] indicates the linkage to the 5' carbon of the second nucleotide in the isolated oligonucleotide of the disclosure).

[0446] In some embodiments, the modified phosphodiester bond is [ka] (In the formula, [ka] indicates the linkage to the 3' carbon of the first nucleotide in the isolated oligonucleotide of the disclosure, and [ka] indicates the linkage to the 5' carbon of the second nucleotide in the isolated oligonucleotide of the disclosure).

[0447] In some embodiments, the isolated oligonucleotide of the present disclosure comprises at least one modified phosphodiester bond. In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand, the antisense strand, or both comprise one or more modified phosphodiester bonds. In some embodiments, only the sense strand comprises one or more modified phosphodiester bonds. In some embodiments, only the antisense strand comprises one or more modified phosphodiester bonds. In some embodiments, both the sense strand and the antisense strand comprise one or more modified phosphodiester bonds.

[0448] In some embodiments, the isolated oligonucleotide comprises at least two modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least three modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least four modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least five modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least six modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least seven modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least eight modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least nine modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least ten modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least eleven modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least twelve modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least thirteen modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least four modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least fifteen modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least 16 modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least 17 modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least 18 modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least 19 modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least 20 modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises more than 20 modified phosphodiester linkages.In some embodiments, the isolated oligonucleotide comprises 20 to 30 modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises 30 to 40 modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises 40 to 50 modified phosphodiester linkages.

[0449] In some embodiments, the isolated oligonucleotide comprises at least two phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least three phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least four phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least five phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least six phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least seven phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least eight phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least nine phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least ten phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least eleven phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least twelve phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least thirteen phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least 14 phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least 15 phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least 16 phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least 17 phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least 18 phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least 19 phosphorothioate internucleotide linkages.In some embodiments, the isolated oligonucleotide comprises at least 20 phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises more than 20 phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises 20-30 phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises 30-40 phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises 40-50 phosphorothioate internucleotide linkages.

[0450] In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least one modified phosphodiester bond. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least two modified phosphodiester bond(s). In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least three modified phosphodiester bond(s). In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least four modified phosphodiester bond(s). In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least five modified phosphodiester bond(s). In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least six modified phosphodiester bond(s). In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least seven modified phosphodiester bond(s). In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least eight modified phosphodiester bond(s). In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least nine modified phosphodiester bond(s). In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 10 modified phosphodiester linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 11 modified phosphodiester linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 12 modified phosphodiester linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 13 modified phosphodiester linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 14 modified phosphodiester linkages.In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 15 modified phosphodiester linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 16 modified phosphodiester linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 17 modified phosphodiester linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 18 modified phosphodiester linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 19 modified phosphodiester linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 20 modified phosphodiester linkages.

[0451] In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least one phosphorothioate internucleotide linkage. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least two phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least three phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least four phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least five phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least six phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least seven phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least eight phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 9 phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 10 phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 11 phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 12 phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 13 phosphorothioate internucleotide linkages.In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 14 phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 15 phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 16 phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 17 phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 18 phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 19 phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 20 phosphorothioate internucleotide linkages.

[0452] In some embodiments, the modified phosphodiester linkages are contiguous on the sense strand, the antisense strand, or both. In some embodiments, some, but not all, of the modified phosphodiester linkages are contiguous on the sense strand, the antisense strand, or both. In some embodiments, the modified phosphodiester linkages on the sense strand, the antisense strand, or both are not contiguous.

[0453] The present disclosure provides isolated oligonucleotides in which any phosphodiester bond on the sense strand or antisense strand can be modified. In some embodiments, any phosphodiester bond on the antisense strand can be modified. In some embodiments, any phosphodiester bond on the antisense strand can be modified.

[0454] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand comprises 1 to 20, 1 to 15, 1 to 10, 1 to 5, or fewer than 5 modified phosphodiester linkages. In some embodiments, the 1 to 20, 1 to 15, 1 to 10, 1 to 5, or fewer than 5 modified phosphodiester linkages comprise phosphorothioate internucleotide linkages. In some embodiments, the antisense strand comprises fewer than 5 modified phosphodiester linkages. In some embodiments, the antisense strand comprises 1, 2, 3, or 4 modified phosphodiester linkages. In some embodiments, the antisense strand comprises 1, 2, 3, or 4 modified phosphodiester linkages, and the 1, 2, 3, or 4 modified phosphodiester linkages comprise phosphorothioate internucleotide linkages. In some embodiments, the antisense strand comprises 4 modified phosphodiester linkages. In some embodiments, the antisense strand comprises 4 modified phosphodiester linkages. The modified phosphodiester linkages comprise phosphorothioate.

[0455] In some embodiments, the antisense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, where the phosphorothioate internucleotide linkages link nucleotides at positions 1 and 2 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, the antisense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, where the phosphorothioate internucleotide linkages link nucleotides at positions 2 and 3 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, the antisense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, where the phosphorothioate internucleotide linkages link nucleotides at positions 20 and 21 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, the antisense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, which link nucleotides at positions 21 and 22 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, the antisense strand comprises at least one, at least two, at least three, or at least four modified phosphodiester linkages, which include phosphorothioate internucleotide linkages, which are located between nucleotides 1 and 2, 2 and 3, 20 and 21, and 21 and 22 from the first nucleotide at the 5' end of the antisense strand.

[0456] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages being located between nucleotides 1-3 and 20-22 from the first nucleotide at the 5' end of the antisense strand.

[0457] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand comprises at least four phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages are located between nucleotides 1-3 and 20-22 from the first nucleotide at the 5' end of the antisense strand.

[0458] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand comprises four phosphorothioate internucleotide linkages. In some embodiments, the antisense strand comprises four phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages are located between nucleotides 1-3 and 20-22 from the first nucleotide at the 5' end of the antisense strand.

[0459] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises 1 to 20, 1 to 15, 1 to 10, 1 to 5, or fewer than 5 modified phosphodiester linkages. In some embodiments, the 1 to 20, 1 to 15, 1 to 10, 1 to 5, or fewer than 5 modified phosphodiester linkages comprise phosphorothioate internucleotide linkages. In some embodiments, the sense strand comprises fewer than 5 modified phosphodiester linkages. In some embodiments, the sense strand comprises 1, 2, 3, or 4 modified phosphodiester linkages. In some embodiments, the sense strand comprises 1, 2, 3, or 4 modified phosphodiester linkages, and the 1, 2, 3, or 4 modified phosphodiester linkages comprise phosphorothioate internucleotide linkages. In some embodiments, the sense strand comprises 4 modified phosphodiester linkages. In some embodiments where the sense strand comprises four modified phosphodiester linkages, the modified phosphodiester linkages comprise phosphorothioate internucleotide linkages.

[0460] In some embodiments where the sense strand comprises at least one, at least two, at least three, or at least four modified phosphodiester linkages, the phosphodiester linkages comprise phosphorothioate internucleotide linkages. In some embodiments where the sense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages link nucleotides at positions 1 and 2 from the first nucleotide at the 5'-end of the sense strand. In some embodiments where the sense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages link nucleotides at positions 2 and 3 from the first nucleotide at the 5'-end of the sense strand. In some embodiments where the sense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages link nucleotides at positions 18 and 19 from the first nucleotide at the 5'-end of the sense strand. In some embodiments where the sense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages link nucleotides at positions 19 and 20 from the first nucleotide at the 5' end of the sense strand. In some embodiments where the sense strand comprises at least one, at least two, at least three, or at least four modified phosphodiester linkages, where the modified phosphodiester linkages comprise phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages are located between nucleotides 1 and 2, 2 and 3, 18 and 19, and 19 and 20 from the first nucleotide at the 5' end of the sense strand.

[0461] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages are located between nucleotides 1-3 and 18-20 from the first nucleotide at the 5' end of the sense strand.

[0462] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises at least four phosphorothioate internucleotide linkages, the at least four phosphorothioate internucleotide linkages are located between nucleotides 1-3 and 18-20 from the first nucleotide at the 5' end of the sense strand.

[0463] In some embodi...

Claims

1. An isolated oligonucleotide comprising a sense strand and an antisense strand, The sense strand contains a nucleotide sequence that is at least 80%, at least 90%, or at least 95% identical to the region between nucleotide positions 1311-1332 from the 5' end of the angiotensinogen (AGT) mRNA sequence according to SEQ ID NO:

1. Furthermore, the antisense chain is substantially complementary to the sense chain such that the sense chain and the antisense chain together form a double-stranded region, and the antisense chain and the sense chain are perfectly complementary, or there are one, two, three, four, or five mismatches between the sense chain and the antisense chain. Isolated oligonucleotides.

2. The isolated oligonucleotide according to claim 1, wherein the sense strand comprises the nucleotide sequence of SEQ ID NO:

71.

3. The isolated oligonucleotide according to claim 1, wherein the antisense chain includes a 3' overhang.

4. The isolated oligonucleotide according to claim 1, wherein the sense strand comprises an RNA sequence of at least 20 nucleotides in length.

5. The isolated oligonucleotide according to claim 1, wherein the antisense strand comprises an RNA sequence of at least 22 nucleotides in length.

6. The isolated oligonucleotide according to claim 1, wherein the double-stranded region has a length of 19 to 21 nucleotides.

7. The isolated oligonucleotide according to claim 6, wherein the double-stranded region is 20 nucleotides long.

8. The isolated oligonucleotide according to claim 1, wherein the antisense strand comprises a 22-nucleotide RNA sequence and the sense strand comprises a 20-nucleotide RNA sequence.

9. The isolated oligonucleotide according to claim 1, wherein the antisense chain and the sense chain are completely complementary to each other.

10. The isolated oligonucleotide according to claim 1, wherein the antisense chain comprises the nucleotide sequence of SEQ ID NO:

16.

11. The isolated oligonucleotide according to claim 1, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 16, and the sense strand comprises the nucleotide sequence of SEQ ID NO:

71.

12. The isolated oligonucleotide according to claim 1, wherein the oligonucleotide comprises an antisense strand of a nucleic acid sequence according to SEQ ID NO: 16 (5'UCAAAAAAAUGCUGUUCAGCA3') and a sense strand of a nucleic acid sequence according to SEQ ID NO: 71 (5'CUGAACAGCAAUUUUUUUUGA3').

13. The isolated oligonucleotide according to claim 1, wherein the isolated oligonucleotide reduces the expression of the AGT mRNA by 20% to 50% at a dose of 0.02 nM.

14. The isolated oligonucleotide according to claim 1, wherein the isolated oligonucleotide attenuates the expression of the AGT mRNA by at least 50% at a dose of 0.02 nM.

15. The isolated oligonucleotide according to claim 1, wherein the isolated oligonucleotide attenuates the expression of the AGT mRNA by at least 50% at a dose of 0.1 nM.

16. The isolated oligonucleotide according to claim 1, wherein the sense strand, the antisense strand, or both contain one or more modified nucleotides.

17. The isolated oligonucleotide according to claim 16, wherein the antisense chain comprises a monomethyl-protected phosphate mimetic (5'-MeEP).

18. The isolated oligonucleotide according to claim 1, wherein the sense strand, the antisense strand, or both have terminal or internal nucleotides linked to a targeted ligand.

19. The isolated oligonucleotide according to claim 18, wherein the targeted ligand comprises at least one GalNAc G1b moiety.

20. The aforementioned antisense chain is given by the formula: 3' (M) ０ (F) ０ (M) ６ (F) １ (M) １ (F) １ (M) ３ (F) １ (M) ２ (F) １ (M) １ (F) １ (M) １ (F) ２ (M) １ The isolated oligonucleotide according to claim 1, comprising nucleotides modified with 2'-F modification by 5', and nucleotides modified with 2'-O-methyl modification.

21. The aforementioned sense chain is given by the formula: 5' (M) ０ (F) ０ (M) ５ (F) １ (M) １ (F) ４ (M) ９ The isolated oligonucleotide according to claim 1, comprising a nucleotide modified by 2'-F modification and a nucleotide modified by 2'-O-methyl modification.

22. The antisense strand includes an antisense strand of nucleic acid sequence according to Sequence ID No. 447 (5'[MeEPmUs][fCs][fA][mA][fA][mA][fA][mA][mA][fA][mU][mG][mC][fU][mG][fU][mU][mC][mA][mGs][mCs][mA]3'), In the formula, "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate nucleotide internucleotide bond, and "MeEP" is a monomethyl protected phosphate mimetic. The isolated oligonucleotide according to claim 1.

23. The sense strand includes a sense strand of nucleic acid sequence according to Sequence ID No. 460 (5'[mCs][mUs][mG][mA][mA][fC][mA][fG][fC][fA][fU][mU][mU][mU][mU][mU][mU][mU][mUs][mGs][mA][G1b][G1b][G1b]3'), In the formula, "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate nucleotide bond, and "G1b" is the GalNaC G1b portion. The isolated oligonucleotide according to claim 1.

24. The sense chain is Includes the sense strand of the nucleic acid sequence by Sequence ID No. 460 (5'[mCs][mUs][mG][mA][mA][fC][mA][fG][fC][fA][fU][mU][mU][mU][mU][mU][mU][mU][mUs][mGs][mA][G1b][G1b][G1b]3'); The aforementioned antisense chain, Includes the antisense strand of the nucleic acid sequence by Sequence ID No. 477 (5'[MeEPmUs][fCs][fA][mA][fA][mA][fA][mA][mA][fA][mU][mG][mC][fU][mG][fU][mU][mC][mA][mGs][mCs][mA]3'); In the formula, "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate nucleotide bond, and "G1b" is the GalNaC G1b portion. The isolated oligonucleotide according to claim 23.

25. A vector encoding an isolated oligonucleotide according to any one of claims 1 to 24.

26. A delivery system comprising an isolated oligonucleotide according to any one of claims 1 to 24 or a vector encoding an isolated oligonucleotide according to any one of claims 1 to 24.

27. A pharmaceutical composition comprising an isolated oligonucleotide according to any one of claims 1 to 24, a vector encoding the isolated oligonucleotide according to any one of claims 1 to 24, and a pharmaceutically acceptable carrier, diluent, or excipient.

28. A kit comprising an isolated oligonucleotide according to any one of claims 1 to 24, a vector encoding the isolated oligonucleotide according to any one of claims 1 to 24, or a pharmaceutical composition comprising an isolated oligonucleotide according to any one of claims 1 to 24, a vector encoding the isolated oligonucleotide according to any one of claims 1 to 24, and a pharmaceutically acceptable carrier, diluent, or excipient.

29. A method for inhibiting or downregulating the expression or level of AGT in cells, comprising contacting the cells with an isolated oligonucleotide according to any one of claims 1 to 24.

30. The pharmaceutical composition according to claim 27 for inhibiting or downregulating the expression or level of AGT in subjects requiring inhibition or downregulation of AGT expression or level.

31. The pharmaceutical composition according to claim 27, for treating or preventing diseases or disorders related to abnormal or increased expression or activity of AGT, or diseases or disorders in which AGT plays a role, in subjects requiring treatment or prevention of such diseases or disorders.

32. The pharmaceutical composition according to claim 27, comprising a first and at least second isolated oligonucleotide according to any one of claims 1 to 24, wherein the first and at least the second oligonucleotides have different sequences.

33. Use of an isolated oligonucleotide according to any one of claims 1 to 24 in the manufacture of a pharmaceutical product for treating or preventing a disease or disorder related to abnormal or increased expression or activity of AGT, or a disease or disorder in which AGT plays a role, in a subject requiring treatment or prevention of such a disease or disorder.

Images