Polynucleic acid molecules, pharmaceutical compositions and their use for inhibiting the expression of LP(A)
Patent Information
- Application Number
- JP2025507473
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-03-03
- Filing Date
- 2023-08-10
- Publication Date
- 2026-08-18
AI Technical Summary
There is a need for effective inhibitors of lipoprotein(a) (Lp(a)) to address its role as a heritable causative risk factor for cardiovascular disease, as current therapies are inadequate.
Development of polynucleic acid molecules, including sense and antisense strands with specific nucleic acid sequences, optionally modified with phosphorothioate linkages, to regulate Lp(a) gene expression, potentially conjugated with asialoglycoprotein receptor targeting moieties for enhanced delivery.
The polynucleic acid molecules effectively reduce Lp(a) expression and plasma levels, offering therapeutic potential for treating or preventing cardiovascular diseases and lipid disorders by modulating Lp(a) gene expression.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 63 / 371,167, filed August 11, 2022, and U.S. Provisional Patent Application No. 63 / 449,914, filed March 3, 2023, each of which is incorporated herein by reference in its entirety. [Background technology]
[0002] The discovery of RNA interference (RNAi) as a cellular mechanism for selectively degrading mRNA allows for both the targeted manipulation of cell phenotype in cell culture and the potential for the development of directed therapeutics (Behlke, 2006, Mol. Ther. 13, pp. 644-670; Xie et al., 2006, Drug Discov. Today 11, pp. 67-73).
[0003] Lipoprotein(a) (Lp(a)) is a lipoprotein composed of an LDL (low-density lipoprotein) lipid core, apolipoprotein B (apo B), and a unique apolipoprotein, apo(a). Lp(a) is considered one of the most common independent, heritable causative risk factors for cardiovascular disease (CVD). Thus, there is a need to develop effective Lp(a) inhibitors. The polynucleic acid molecules, conjugates thereof, and methods described herein fulfill this need and provide related advantages.
[0004] Incorporation by Reference All publications, patents, and patent applications mentioned herein are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. To the extent the publications and patents or patent applications incorporated by reference conflict with the disclosure contained herein, the present specification is intended to supersede and / or replace any such conflicting material. Summary of the Invention
[0005] In certain embodiments, the present specification discloses a polynucleic acid molecule for regulating expression of the lipoprotein(a) (Lp(a)) gene, comprising a sense strand and an antisense strand, wherein the antisense strand comprises a nucleic acid sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a nucleic acid sequence selected from SEQ ID NOs: 1 to 154. Optionally, the sense strand comprises a nucleic acid sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a nucleic acid sequence selected from SEQ ID NOs: 309 to 462. Optionally, the antisense strand comprises a nucleic acid sequence comprising at least 14, 15, 16, 17, 18, 19, 20, 21, or 22 contiguous sequences of a nucleic acid sequence selected from SEQ ID NOs: 1-154, with 1, 2, 3, or no more than 4 mismatches. Optionally, the sense strand comprises a nucleic acid sequence comprising at least 14, 15, 16, 17, 18, 19, or 20 contiguous sequences of a nucleic acid sequence selected from SEQ ID NOs: 309-462, with 1, 2, 3, or no more than 4 mismatches. Optionally, the sense strand comprises one of SEQ ID NOs: 309-462, and the antisense strand comprises a nucleic acid sequence selected from SEQ ID NOs: 1-154.
[0006] Optionally, the sense strand comprises at least two consecutive modified internucleotide linkages at the 5'-end. Optionally, the antisense strand comprises at least two consecutive modified internucleotide linkages at the 5'-end and / or 3'-end. Optionally, the modified internucleotide linkages are phosphorothioate linkages. Optionally, the modified internucleotide linkages comprise sterically rich phosphorothioate internucleotide linkages. Optionally, the modified internucleotide linkages are S PThe internucleotide bond is a chiral phosphorothioate internucleotide bond. Optionally, the polynucleic acid comprises a plurality of modified internucleotide bonds, and at least 1, 2, 3, or 4 of the plurality of modified internucleotide bonds are stereochemically rich phosphorothioate internucleotide bonds. Optionally, at least one stereochemically rich phosphorothioate is located between two consecutive nucleosides, which are two of the six 5'- or 3'-terminal nucleosides of the sense strand or antisense strand. Optionally, the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', and the antisense strand comprises 5'-nNfnnnnNfnnnnNfnNfnNfnnnnnnn-3', where n represents a 2'-O-methyl modified nucleotide, and Nf represents a 2'-fluoro modified nucleotide.
[0007] Optionally, the sense or antisense strand is about 19-25 or about 21-23 nucleotides in length.
[0008] Optionally, the sense strand comprises a nucleic acid sequence at least 80%, at least 85%, at least 90%, or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 463-616. Optionally, the antisense strand comprises a nucleic acid sequence at least 80%, at least 85%, at least 90%, or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 155-308. Optionally, the sense strand comprises a sequence selected from the nucleic acid sequences of SEQ ID NOs: 463-616, and the antisense strand comprises a sequence selected from the nucleic acid sequences of SEQ ID NOs: 155-308.
[0009]
[0013] In another aspect herein, there is provided a polynucleic acid molecule for regulating expression of the lipoprotein(a) (Lp(a)) gene, comprising: (a) an antisense strand comprising the nucleotide sequence of UAGAUGACCAAGCUUGGCAGGUC (SEQ ID NO: 4) and a sense strand comprising the nucleotide sequence of CCUGCCAAGCUUGGUCAUCUA (SEQ ID NO: 312); (b) an antisense strand comprising the nucleotide sequence of UAUAGAUGACCAAGCUUGGCAGG (SEQ ID NO: 5) and a sense strand comprising the nucleotide sequence of UGCCAAGCUUGGUCAUCUAUA (SEQ ID NO: 313); (c) an antisense strand comprising the nucleotide sequence UCAUAGAUGACCAAGCUUGGCAG (SEQ ID NO: 6) and a sense strand comprising the nucleotide sequence GCCAAGCUUGGUCAUCUAUGA (SEQ ID NO: 314); (d) an antisense strand comprising the nucleotide sequence UCGACGGCAGUCCCUUCUGCGUC (SEQ ID NO: 11) and a sense strand comprising the nucleotide sequence CGCAGAAGGGACUGCCGUCGA (SEQ ID NO: 319); (e) an antisense strand comprising the nucleotide sequence UUCUAGGCUUGGAACCGGGGUAA (f) an antisense strand comprising the nucleotide sequence of UAGCCUCUAGGCUUGGAACCGGG (SEQ ID NO: 21) and a sense strand comprising the nucleotide sequence of CGGUUCCAAGCCUAGAGGCUA (SEQ ID NO: 329); (g) an antisense strand comprising the nucleotide sequence of UUUACCGUGGUAGCACUCCUGCA (SEQ ID NO: 44) and a sense strand comprising the nucleotide sequence of CAGGAGUG (h) an antisense strand comprising the nucleotide sequence of UUGUCCAUUACCGUGGUAGCACU (SEQ ID NO: 47) and a sense strand comprising the nucleotide sequence of UGCUACCACGGUAAUGGACAA (SEQ ID NO: 355); (i) an antisense strand comprising the nucleotide sequence of UCUCUGUCCAUUACCGUGGUAGC (SEQ ID NO: 49) and a sense strand comprising the nucleotide sequence of UACCACGGUAAUGGACAGAGA (SEQ ID NO: 357);(j) an antisense strand comprising the nucleotide sequence of UAUUGUGUCAGGUUGCAGUACUC (SEQ ID NO: 60) and a sense strand comprising the nucleotide sequence of GUACUGCAACCUGACACAAUA (SEQ ID NO: 368); (k) an antisense strand comprising the nucleotide sequence of UUGCGUCUGAGCAUUGUGUCAGG (SEQ ID NO: 64) and a sense strand comprising the nucleotide sequence of UGACACAAUGCUCAGACGCAA (SEQ ID NO: 372); (l) an antisense strand comprising the nucleotide sequence of UUAACUCUGUCCAUAAUGGUAGU (SEQ ID NO: 88) and a sense strand comprising the nucleotide sequence of UACCAUUAUGGACAGAGUUAA (SEQ ID NO: 396); (m) UCCAAG Polynucleic acid molecules are provided that include an antisense strand comprising the nucleotide sequence CUUGGCAAGUUCUUCCU (SEQ ID NO: 89) and a sense strand comprising the nucleotide sequence GAAGAACUUGCCAAGCUUGGA (SEQ ID NO: 397), (n) an antisense strand comprising the nucleotide sequence UAGAUGACCAAGCUUGGCAAGUU (SEQ ID NO: 90) and a sense strand comprising the nucleotide sequence CUUGCCAAGCUUGGUCAUCUA (SEQ ID NO: 398), or (o) an antisense strand comprising the nucleotide sequence UGGUCCGACUAUGCUGGUGUGGU (SEQ ID NO: 98) and a sense strand comprising the nucleotide sequence CACACCAGCAUAGUCGGACCA (SEQ ID NO: 406).
[0010] In another aspect herein, there is provided a polynucleic acid molecule for regulating expression of the lipoprotein(a) (Lp(a)) gene, comprising: (a) an antisense strand comprising the nucleotide sequence of usAfsgaugAfccaaGfcUfuGfgcaggsusc (SEQ ID NO: 158) and a sense strand comprising the nucleotide sequence of cscsugccAfaGfcUfuggucaucua (SEQ ID NO: 466); (b) an antisense strand comprising the nucleotide sequence of usAfsuagaUfgaccAfaGfcUfuggcasgsg (SEQ ID NO: 159); and usgsccaaGfcUfuGfgucaucuaua (SEQ ID NO: 467), (c) an antisense strand comprising the nucleotide sequence of usCfsauagAfugacCfaAfgCfuuggcsasg (SEQ ID NO: 160), and a sense strand comprising the nucleotide sequence of gscscaagCfuUfgGfucaucuauga (SEQ ID NO: 468), (d) an antisense strand comprising the nucleotide sequence of usCfsgacgGfcaguCfcCfuUfcugcgsusc (SEQ ID NO: 165), and csgscagaAfgGfgAfcugccgucga (SEQ ID NO: 473), (e) an antisense strand comprising the nucleotide sequence of usUfscuagGfcuugGfaAfcCfggggusasa (SEQ ID NO: 172), and a sense strand comprising the nucleotide sequence of ascscccgGfuUfcCfaagccuagaa (SEQ ID NO: 480), (f) an antisense strand comprising the nucleotide sequence of usAfsgccuCfuaggCfuUfgGfaaccgsgsg (SEQ ID NO: 175), and a sense strand comprising the nucleotide sequence of csgsguucCfaAfgCfcuagaggcua (SEQ ID NO: 483), (g) an antisense strand comprising the nucleotide sequence of usUfsuaccGfugguAfgCfaCfuccugscsa (SEQ ID NO: 198), and a sense strand comprising the nucleotide sequence of csasggagUfgCfuAfccacgguaaa (SEQ ID NO: 506), (h) an antisense strand comprising the nucleotide sequence of usUfsguccAfuuacCfgUfgGfuagcascsu (SEQ ID NO: 201),and usgscuacCfaCfgGfuaauggacaa (SEQ ID NO: 509), (i) an antisense strand comprising the nucleotide sequence of usCfsucugUfccauUfaCfcGfugguasgsc (SEQ ID NO: 203), and a sense strand comprising the nucleotide sequence of usasccacGfgUfaAfuggacagaga (SEQ ID NO: 511), (j) an antisense strand comprising the nucleotide sequence of usAfsuuguGfucagGfuUfgCfaguacsusc (SEQ ID NO: 214), and a sense strand comprising the nucleotide sequence of gsusacu (k) a sense strand comprising the nucleotide sequence of usUfsgcguCfugagCfaUfuGfugucasgsg (SEQ ID NO: 218), and a sense strand comprising the nucleotide sequence of usgsacacAfaUfgCfucagacgcaa (SEQ ID NO: 526); (l) an antisense strand comprising the nucleotide sequence of usUfsaacuCfugucCfaUfaAfugguasgsu (SEQ ID NO: 242), and a sense strand comprising the nucleotide sequence of usasccauUfaUfgGfa a sense strand comprising the nucleotide sequence of cagaguuaa (SEQ ID NO: 550), (m) an antisense strand comprising the nucleotide sequence of usCfscaagCfuuggCfaAfgUfucuucscsu (SEQ ID NO: 243), and a sense strand comprising the nucleotide sequence of gsasagaaCfuUfgCfcaagcuugga (SEQ ID NO: 551), (n) an antisense strand comprising the nucleotide sequence of usAfsgaugAfccaaGfcUfuGfgcaagsusu (SEQ ID NO: 244), and a sense strand comprising the nucleotide sequence of csusugccAfaGfcUfuggucaucua ( (o) an antisense strand comprising the nucleotide sequence of usGfsguccGfacuaUfgCfuGfgugugsgsu (SEQ ID NO: 252), or (o) an antisense strand comprising the nucleotide sequence of csascaccAfgCfaUfagucggacca (SEQ ID NO: 560), wherein "A" refers to adenosine-3'-phosphate, "a" refers to 2'-O-methyladenosine-3'-phosphate, "Af" refers to 2'-fluoroadenosine-3'-phosphate, and "C" refers to"Cf" refers to 2'-fluorocytidine-3'-phosphate; "G" refers to guanosine-3'-phosphate; "g" refers to 2'-O-methylguanosine-3'-phosphate; "Gf" refers to 2'-fluoroguanosine-3'-phosphate; "U" refers to uridine-3'-phosphate; and "u" refers to uridine-3'-phosphate. "Uf" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate, "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate, and "s" refers to 3'-phosphorothioate.
[0011] In another aspect of the present specification, there is provided a polynucleic acid molecule conjugate for regulating expression of the lipoprotein(a) gene (Lp(a)), the polynucleic acid molecule conjugate comprising a polynucleic acid molecule described herein and an asialoglycoprotein receptor targeting moiety. Optionally, the asialoglycoprotein receptor targeting moiety comprises N-acetylgalactosamine (GalNAc) or galactose. Optionally, the GalNAc comprises an anomeric carbon attached to a trivalent, tetravalent, pentavalent, or hexavalent linker, wherein the anomeric carbon is part of a hemiaminal group.
[0012] Optionally, the polynucleic acid molecule and the asialoglycoprotein receptor targeting moiety are linked via a linker. Optionally, the linker is a cleavable linker. Optionally, the linker has the following formula (IV):
[0013] [ka] wherein at least one of Y1 and Y2 is a nucleotide in the polynucleic acid molecule. Optionally, Y1 is the last nucleotide on the 3' end of the sense strand of the polynucleic acid molecule.
[0014] Optionally, the linker and the asialoglycoprotein receptor targeting moiety, together with the last nucleotide on the 3' end of the sense strand of the polynucleic acid molecule, have a structure of Formula (V'), Formula (V'''), Formula (V''''), or Formula (V'''')
[0015] [ka] wherein Z in formula (V') is -H, -OH, -O-methyl, -F, or -O-methoxyethyl, and R in formula (V') is adenine, uracil, guanine, cytosine, thymine, abasic, or the like;
[0016] [ka] wherein Z in formula (V'''') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V'''') is adenine, uracil, guanine, cytosine, thymine, an abasic moiety, or other;
[0017] [ka] wherein Z in formula (V''''') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V'''') is adenine, uracil, guanine, cytosine, thymine, an abasic moiety, or other; or
[0018] [ka] (Z in formula (V'''''') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V'''''') is adenine, uracil, guanine, cytosine, thymine, an abasic moiety, or the like.)
[0019] Optionally, the linker and the asialoglycoprotein receptor targeting moiety, together with the last nucleotide on the 3' end of the sense strand of the polynucleic acid molecule, have the formula (V'):
[0020] [ka] (Z in formula (V') is -H, -OH, -O-methyl, -F, or -O-methoxyethyl, and R in formula (V') is adenine, uracil, guanine, cytosine, thymine, an abasic moiety, or the like.)
[0021] In another aspect herein, there is provided a pharmaceutical composition comprising a polynucleic acid molecule described herein or a polynucleic acid molecule conjugate described herein and a pharmaceutically acceptable excipient, optionally formulated for parenteral, oral, intranasal, buccal, rectal, transdermal, intravenous, subcutaneous, or intrathecal administration.
[0022] In another aspect herein, there is provided a method for modulating expression of lipoprotein(a) (Lp(a)) in a subject in need thereof, the method comprising modulating expression of the Lp(a) gene in the subject by administering to the subject a polynucleic acid molecule described herein, a polynucleic acid molecule conjugate described herein, or a pharmaceutical composition described herein.
[0023] In another aspect of the present specification, there is provided a method for treating or preventing cardiovascular disease or lipid disorder, comprising regulating the expression of Lp(a) gene in a subject by administering to the subject a polynucleic acid molecule described herein, a polynucleic acid molecule conjugate described herein, or a pharmaceutical composition described herein.Optionally, the cardiovascular disease is coronary artery disease, acute myocardial infarction, asymptomatic carotid atherosclerosis, stroke, atrial fibrillation, hypercholesterolemia, or peripheral arterial occlusive disease.Optionally, the lipid disorder is hyperlipidemia or hypercholesterolemia.
[0024] Optionally, the polynucleic acid molecule is administered at a dose sufficient to reduce expression of the Lp(a) gene in the subject's cells or to reduce the subject's plasma Lp(a) levels by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% compared to a control. [Brief explanation of the drawings]
[0025] Various aspects of the present disclosure are set forth with particularity in the appended claims. The features and advantages of the present disclosure will be better understood by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure are utilized, and the accompanying drawings, in which:
[0026] [Figure 1A] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1B] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1C] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1D] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1E]FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1F] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1G] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1H] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1I] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1J] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1K] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1L] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1M] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1N] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1O] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1P] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1Q] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1R]FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1S] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1T] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1U] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1V] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1W] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1X] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1Y] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1Z] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1AA] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1BB] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1CC] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1DD] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1EE]FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1FF] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1GG] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1HH] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1II] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1JJ] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1KK] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1LL] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1MM] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1NN] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 100] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1PP] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1QQ] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1RR]FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1SS] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1TT] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1UU] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 1VV] FIG. 1 shows the dose response of siRNA compositions on Lp(a) expression levels in primary human hepatocytes (PHH). [Figure 2] FIG. 1 shows the % change in serum Lp(a) levels from baseline (day −1) in cynomolgus monkeys. [Figure 3] FIG. 1 shows the % change in serum Lp(a) levels from baseline (day −1) in cynomolgus monkeys. DETAILED DESCRIPTION OF THE INVENTION
[0027] The Lp(a) gene (LPA) is located on chromosome 6q26-q27, the major locus for Lp(a) concentrations in all populations (F. Kronenberg et al., J Intern Med, 273(1)(2013)). The LPA gene is one of the strongest single-gene risk factors for CVD (S. Tsimikas, J Am Coll Cardiol, 69(6)(2017)). The LPA gene is highly expressed in the liver, with dramatic decreases and increases in Lp(a) observed after liver transplantation (AA Damluji et al., Journal of clinical lipidology, 10(2)(2016)).
[0028] Lipoprotein(a) (Lp(a)) is a low-density lipoprotein-like particle formed by the association of apolipoprotein(a) (apo(a)) with apolipoprotein B (apo B). The apo(a) protein is covalently linked to apo B via disulfide bonds in assembled Lp(a) particles. Lp(a) carries atherosclerotic cholesterol and, as the preferential carrier of oxidized phospholipids in human plasma, promotes inflammatory responses by binding to atherogenic anti-inflammatory oxidized phospholipids.
[0029] Plasma levels of Lp(a) are primarily determined by the LPA gene encoding apo(a) (S. Tsimikas, J Am Coll Cardiol, 69(6)(2017)). Lp(a) levels vary between individuals and are directly proportional to CVD risk. Elevated plasma levels of Lp(a) are associated with an increased risk of atherosclerosis and its manifestations, which may include hypercholesterolemia (Seed et al., N. Engl. J. Med., 1990, 322, pp. 1494-1499), myocardial infarction (Sandkamp et al., Clin. Chem., 1990, 36, pp. 20-23), and thrombosis (Nowak-Gottl et al., Pediatrics, 1997, 99, E11). Therefore, inhibition of LPA is being explored as a potential therapeutic strategy for treating CVD.
[0030] Described herein is a polynucleic acid molecule for regulating the expression of the Lp(a) gene, the polynucleic acid molecule comprising a nucleic acid sequence selected from Table 1 or Table 2. In some examples, the polynucleic acid molecule is a single-stranded nucleic acid molecule. In some examples, the polynucleic acid molecule is a double-stranded nucleic acid molecule comprising a sense strand and an antisense strand. Thus, provided herein are various target regions of human Lp(a) mRNA to which the polynucleic acid molecules described herein hybridize. The polynucleic acid molecules described herein can be modified polynucleic acid molecules. For example, modified polynucleic acid molecules can contain 2'-fluoro-modified nucleotides, 2'-O-methyl-modified nucleotides, or modified internucleotide linkages such as phosphorothioate linkages. In some aspects herein, provided are polynucleic acids conjugated with the targeting moieties described herein.
[0031] Also described herein are methods for modulating Lp(a) mRNA or protein expression in a subject. Also described herein are methods for modulating LDL and / or cholesterol in a subject in need thereof.
[0032] definition The singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. For example, the term "a cell" includes one or more cells, including mixtures thereof. "A and / or B" is used herein to include all of the following options: "A," "B," "A or B," and "A and B."
[0033] Where a range of values is provided, it is understood that each intervening value, to the nearest tenth of the lower limit, between the upper and lower limits of that range, and any other stated or intervening value in that stated range, is encompassed within the disclosure unless the context clearly dictates otherwise. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where a stated range includes one or both of its limits, ranges excluding either or both of those included limits are also included in the disclosure, unless the context clearly dictates otherwise.
[0034] Certain ranges are presented herein with numerical values preceded by the term "about." The term "about" is used herein to literally support the exact number preceded by the term, as well as a number that is near or approximately the number preceded by the term. When determining whether a number is near or approximately a specifically recited number, the unrecited near or approximate number may be a number that is substantially equivalent to the specifically recited number in the context in which it is presented.
[0035] "Percent sequence identity" or "percent identity" with respect to the nucleic acid sequences identified herein is defined as the percentage of nucleic acids in a candidate sequence that are identical to the nucleic acid sequence to which it is being compared, after aligning the sequences and taking into account any conservative substitutions as part of the sequence identity.
[0036] All ranges disclosed herein also encompass all possible subranges and combinations of subranges. Any recited range can be recognized as fully descriptive and allowing for the range to be divided into at least 2, 3, 4, 5, 10, etc. divisions. As a non-limiting example, each range discussed herein can be readily divided into a lower third, a middle third, and an upper third, etc. As one of ordinary skill in the art would understand, language such as "up to," "at least," "greater than," and "less than" all refer to ranges that are inclusive of the recited numbers and that can be subsequently divided into the subranges discussed above. Finally, as one of ordinary skill in the art would understand, ranges include each individual member. Thus, for example, a group having 1 to 3 items refers to a group having 1, 2, or 3 items. Similarly, a group having 1 to 5 items refers to a group having 1, 2, 3, 4, or 5, etc. items.
[0037] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the polynucleic acid molecules, polynucleic acid molecule conjugates, pharmaceutical compositions, methods, and other aspects belong.
[0038] As used herein, the term "complementary" refers to a sufficient degree of complementarity between two nucleic acid molecules to stably and specifically bind so as to avoid non-specific binding.
[0039] As used herein, the terms "polynucleic acid" and "polynucleotide" are used interchangeably to refer to a chain of nucleotides. The term "nucleotide" includes the sequences "G," "C," "A," "T," and "U," and generally refers to nucleotides containing guanine, cytosine, adenine, thymidine, and uracil as bases, respectively. In some instances, "nucleotide" may refer to modified nucleotides (e.g., with modified sugar moieties, modified bases, modified internucleotide linkages, or combinations thereof, including, but not limited to, 2'-modified nucleotides, LNA, ENA, BNA, UNA, GNA, etc.). In some instances, "nucleotide" may refer to modified nucleotides with non-standard bases (e.g., including, but not limited to, 2-thiouridine, 2-thiothymidine, inosine, 2-aminopurine, 2,6-diaminopurine, dihydrouridine, 4-thiouridine, 4-thiothymidine, 2-thiocytidine).
[0040] As used herein, a "subject" can be any mammal, including humans and non-human primates.
[0041] "Subject in need" refers to a subject who has an Lp(a)-related disorder or a symptom thereof, including but not limited to CVD or lipid disorders, or a subject who has a higher risk of developing an Lp(a)-related disorder or a symptom thereof, including but not limited to CVD or dyslipidemia, compared to the overall population. In some examples, the subject in need has coronary heart disease or atherosclerosis, or a symptom thereof. In some examples, the subject in need has hyperlipidemia or hypercholesterolemia, or a symptom thereof. In some examples, the subject in need is or has been administered a drug other than the polynucleic acid molecule or conjugate disclosed herein to treat or prevent CVD or lipid disorders. For example, the subject in need is or has been administered atorvastatin.
[0042] The term "condition" as used herein includes diseases, disorders, and susceptibilities. Optionally, the condition is an Lp(a)-related disorder, an atherosclerotic vascular disease, or a symptom thereof. Optionally, the condition is hypertriglyceridemia or a symptom thereof.
[0043] The term "atherosclerosis" or "atherosclerotic vascular disease," as used herein, refers to a disease in which the inside of an artery narrows due to a buildup of plaque, which in some cases can lead to coronary artery disease, stroke, peripheral artery disease, or kidney problems.
[0044] The term "cardiovascular disease" or "CVD" refers to any disease affecting the heart or blood vessels, including coronary heart disease (blocked arteries), which can result in heart attack, stroke, congenital heart disease, and peripheral artery disease. CVD or its symptoms can include myocardial infarction, stroke, atrial fibrillation, or calcific aortic stenosis. CVD or its symptoms include cardiac arrest or peripheral artery disease.
[0045] The term "lipid disorder" refers to a disorder or condition that increases levels of LDL, triglycerides, or both. For example, the lipid disorder can be hyperlipidemia or hypercholesterolemia.
[0046] The term "low-density lipoprotein (LDL)," as used herein, refers to a microscopic mass composed of an outer rim of lipoproteins and a cholesterol core. LDL may have a highly hydrophobic core composed of a polyunsaturated fatty acid known as linoleate and hundreds to thousands of esterified and unesterified cholesterol molecules. The LDL core may also carry triglycerides and other fats and may be surrounded by a shell of phospholipids and unesterified cholesterol.
[0047] As used herein, the terms "treat," "treating," or "treatment" with respect to any disease or disorder refer, in one example, to ameliorating the disease or disorder (i.e., slowing, arresting, or reducing the progression of the disease or at least one of its clinical symptoms). In another example, "treat," "treating," or "treatment" refers to alleviating or ameliorating at least one physical parameter, including one that may not be discernible by the patient. In yet another example, "treat," "treating," or "treatment" refers to modulating the disease or disorder physically (e.g., stabilizing a discernible symptom), physiologically (e.g., stabilizing a physical parameter), or both.
[0048] The terms "prevent," "preventing," or "prevention," as used herein, refer to reducing the occurrence of symptoms of a condition in a subject who does not have the disease or condition but is at risk of or suspected of developing it. Prevention can be the complete, e.g., total, absence of symptoms of the condition in the subject. Prevention can also be partial, such that the occurrence of symptoms of the condition in the subject is less than would have occurred without the present disclosure.
[0049] "Administering" and its grammatical equivalents, as used herein, may refer to providing a subject or patient with a pharmaceutical composition described herein. Conventional methods known to those skilled in the pharmaceutical arts can be used to administer the composition to a subject, depending on the type of disease or site of disease being treated. For example, the composition can be administered, for example, orally, parenterally, by inhalation spray, topically, rectally, nasally, bucally, vaginally, via an implanted reservoir, or via injection. One or more such routes can be utilized.
[0050] The term "pharmaceutical composition," and its grammatical equivalents, as used herein, may refer to a mixture or solution containing a therapeutically effective amount of an active pharmaceutical ingredient together with one or more pharmaceutically acceptable excipients, carriers, and / or therapeutic agents to be administered to a subject, e.g., a human being in need thereof.
[0051] The term "pharmaceutically acceptable," and its grammatical equivalents, as used herein, may refer to attributes of a material that is generally safe, non-toxic, biologically or otherwise desirable, and useful in preparing pharmaceutical compositions that are acceptable for animal or human pharmaceutical use. "Pharmaceutically acceptable" refers to a material, such as a carrier or diluent, that does not abolish the biological activity or properties of the compound and is relatively non-toxic, i.e., the material may be administered to a subject without producing undesired biological effects or adversely interacting with any of the components of the pharmaceutical composition in which the compound is included.
[0052] A "pharmaceutically acceptable excipient" refers to an excipient that can be administered to a subject together with a drug, does not destroy its pharmacological activity, and is non-toxic when administered in a dose sufficient to deliver a therapeutic amount of the drug.
[0053] The term "therapeutic agent" may refer to an agent that provides a therapeutic, diagnostic, and / or prophylactic effect and / or induces a desired biological and / or pharmacological effect when administered to a subject. Therapeutic agents may also be referred to as "actives" or "active agents." Such agents include, but are not limited to, cytotoxins, radioactive ions, chemotherapeutic agents, small molecule drugs, proteins, and nucleic acids.
[0054] Certain features of polynucleic acid molecules and / or polynucleic acid molecule conjugates, pharmaceutical compositions comprising polynucleic acid molecules or polynucleic acid molecule conjugates, methods, and other aspects are described in the context of separate embodiments for clarity, but it is understood that they may also be provided in combination in a single embodiment. Conversely, various features of polynucleic acid molecules and / or polynucleic acid molecule conjugates, pharmaceutical compositions comprising polynucleic acid molecules or polynucleic acid molecule conjugates, methods, and other aspects are described in the context of a single embodiment for brevity, but may also be provided separately or in any suitable subcombination. All combinations of embodiments are specifically encompassed by the present disclosure and are disclosed herein as if each and every combination were individually and explicitly disclosed, to the extent that such combinations encompass viable processes and / or compositions. Furthermore, all subcombinations listed in embodiments describing such variables are also specifically encompassed by the polynucleic acid molecules and / or polynucleic acid molecule conjugates, pharmaceutical compositions comprising polynucleic acid molecules or polynucleic acid molecule conjugates of the present invention, methods, and other aspects, and are disclosed herein as if each and every such subcombination were individually and explicitly disclosed herein.
[0055] Polynucleic acid molecule Target region of the polynucleic acid molecule The present specification describes a polynucleic acid molecule for regulating the expression of Lp(a) gene.In some examples, the polynucleic acid molecule is a single-stranded nucleic acid molecule.In some examples, the polynucleic acid molecule is a double-stranded nucleic acid molecule.
[0056] In some embodiments, the polynucleic acid molecules described herein hybridize to a specific human Lp(a) mRNA region.In some cases, the polynucleic acid molecule comprises a sense strand and an antisense strand, and the antisense strand hybridizes to a specific Lp(a) mRNA region.As used herein, the term "sense strand" can be used interchangeably with the term "passenger strand", and the term "antisense strand" can be used interchangeably with the term "guide strand".
[0057] In some embodiments, the polynucleic acid molecules described herein hybridize to the 5'UTR region of human Lp(a) mRNA. In some embodiments, the polynucleic acid molecules described herein hybridize to the coding region of human Lp(a) mRNA. In some embodiments, the polynucleic acid molecules described herein hybridize to the 3'UTR region of human Lp(a) mRNA. In some embodiments, the polynucleic acid molecules described herein hybridize to exon 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, or 39 of human Lp(a) mRNA. In some embodiments, the polynucleic acid molecules described herein hybridize to the coding region of human Lp(a) mRNA (NCBI Reference Sequence: NM_005577.4).
[0058] In some embodiments, the starting position of the binding site for a polynucleic acid molecule described herein on human Lp(a) mRNA (NCBI Reference Sequence: NM_005577.4) is between 190-210, 250-270, 360-390, 400-450, 460-520, 530-550, 1100-1200, 2600-2700, 2700-2800, 2800-2900, 3000-3300, 3300-3600, 3600-4000, 4000-4200, 4400-4700, 4700-5000, 5000-5200, or 5500-6000.
[0059] The starting position of the binding site for the polynucleic acid molecule described herein on human Lp(a) mRNA (NCBI Reference Sequence: NM_005577.4) can be at positions 200-210, 380-390, 410-420, 1100-1200, 2700-2800, 3200-3300, or 3300-3400.
[0060] The starting positions of the binding sites of the polynucleic acid molecules described herein on human Lp(a) mRNA (NCBI Reference Sequence: NM_005577.4) are: 200-210, 250-260, 380-390, 410-430, 430-440, 460-470, 490-500, 500-510, 540-550, 1150-1180, 2650-270 It can be in rank 0, 2700-2750, 2760-2770, 2850-2900, 3200-3250, 3250-3300, 3300-3310, 3700-3750, 3750-3800, 3950-4000, 4800-4850, 5100-5150, 5500-5550, 5850-5900, or 2750-2800.
[0061] Polynucleic acid molecule structure The present specification describes a polynucleic acid molecule for regulating the expression of Lp(a) gene.In some cases, the polynucleic acid molecule is a single-stranded nucleic acid molecule, and the single-stranded nucleic acid molecule is reverse complementary to the target region of Lp(a) mRNA.
[0062] In some embodiments, the polynucleic acid molecules described herein are not 100% complementary to the target region of Lp(a) mRNA. Thus, in some examples, the polynucleic acid molecules described herein are about 95% complementary to the target region of Lp(a) mRNA. In some examples, the polynucleic acid molecules described herein are about 90% complementary to the target region of Lp(a) mRNA. In some examples, the polynucleic acid molecules described herein are about 85% complementary to the target region of Lp(a) mRNA. In some examples, the polynucleic acid molecules described herein are about 80% complementary to the target region of Lp(a) mRNA. In some examples, the polynucleic acid molecules described herein are about 75% complementary to the target region of Lp(a) mRNA. In some examples, the polynucleic acid molecules described herein are about 70% complementary to the target region of Lp(a) mRNA.
[0063] In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence in Table 1, Table 2, or Table 5. In some examples, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% complementary to a sequence in Table 1, Table 2, or Table 5. In some examples, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% complementary to a nucleic acid sequence selected from SEQ ID NOs: 309-462. In some examples, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% complementary to a nucleic acid sequence selected from SEQ ID NOs: 1-154.
[0064] In some examples, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% complementary to a sequence in Table 1, Table 2, and Table 5, excluding overhangs. In some examples, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% complementary to a nucleic acid sequence selected from SEQ ID NOs: 309-462, excluding overhangs. In some examples, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% complementary to a nucleic acid sequence selected from SEQ ID NOs: 1-154, excluding overhangs.
[0065] In yet other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 14 contiguous nucleotides complementary to a sequence in Table 1, Table 2, and Table 5, with one, two, three, or no more than four mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 14 contiguous nucleotides complementary to a nucleic acid sequence in SEQ ID NOs: 309-462, with one, two, three, or no more than four mismatches. In still other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 15 contiguous nucleotides complementary to a sequence in Table 1, Table 2, and Table 5, with one, two, three, or no more than four mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 15 contiguous nucleotides complementary to a nucleic acid sequence in SEQ ID NOs: 309-462, with one, two, three, or no more than four mismatches. In yet other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 16 contiguous nucleotides complementary to a sequence in Table 1, Table 2, and Table 5, with one, two, three, or no more than four mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 16 contiguous nucleotides complementary to a nucleic acid sequence in SEQ ID NOs: 309-462, with one, two, three, or no more than four mismatches. In still other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 17 contiguous nucleotides complementary to a sequence in Table 1, Table 2, and Table 5, with one, two, three, or no more than four mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 17 contiguous nucleotides complementary to a nucleic acid sequence in SEQ ID NOs: 309-462, with one, two, three, or no more than four mismatches. In yet other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 18 contiguous nucleotides complementary to a sequence in Table 1, Table 2, and Table 5, with 1, 2, 3, or no more than 4 mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 18 contiguous nucleotides complementary to a nucleic acid sequence in SEQ ID NOs: 309-462, with 1, 2, 3, or no more than 4 mismatches.In yet other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 19 contiguous nucleotides complementary to a sequence in Table 1, Table 2, and Table 5, with one, two, three, or no more than four mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 19 contiguous nucleotides complementary to a nucleic acid sequence in SEQ ID NOs: 309-462, with one, two, three, or no more than four mismatches. In still other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 20 contiguous nucleotides complementary to a sequence in Table 1, Table 2, and Table 5, with one, two, three, or no more than four mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 20 contiguous nucleotides complementary to a nucleic acid sequence in SEQ ID NOs: 309-462, with one, two, three, or no more than four mismatches. In yet other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 21 contiguous nucleotides complementary to a sequence in Table 1, Table 2, and Table 5, with one, two, three, or no more than four mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 21 contiguous nucleotides complementary to a nucleic acid sequence in SEQ ID NOs: 309-462, with one, two, three, or no more than four mismatches. In still other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 22 contiguous nucleotides complementary to a sequence in Table 1, Table 2, and Table 5, with one, two, three, or no more than four mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 22 contiguous nucleotides complementary to a nucleic acid sequence in SEQ ID NOs: 309-462, with one, two, three, or no more than four mismatches.
[0066] In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 14 contiguous nucleotides complementary to a nucleic acid sequence of SEQ ID NOs: 1-154 with one, two, three, or no more than four mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 15 contiguous nucleotides complementary to a nucleic acid sequence of SEQ ID NOs: 1-154 with one, two, three, or no more than four mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 16 contiguous nucleotides complementary to a nucleic acid sequence of SEQ ID NOs: 1-154 with one, two, three, or no more than four mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 17 contiguous nucleotides complementary to a nucleic acid sequence of SEQ ID NOs: 1-154 with one, two, three, or no more than four mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 18 contiguous nucleotides complementary to a nucleic acid sequence of SEQ ID NOs: 1-154 with one, two, three, or no more than four mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 19 contiguous nucleotides complementary to a nucleic acid sequence of SEQ ID NOs: 1-154 with one, two, three, or no more than four mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 20 contiguous nucleotides complementary to a nucleic acid sequence of SEQ ID NOs: 1-154 with one, two, three, or no more than four mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 21 contiguous nucleotides complementary to a nucleic acid sequence of SEQ ID NOs: 1-154 with one, two, three, or no more than four mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 22 contiguous nucleotides complementary to a nucleic acid sequence of SEQ ID NOs: 1-154, with 1, 2, 3, or no more than 4 mismatches.
[0067] In yet other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 14, 15, 16, 17, 18, 19, 20, 21, or 22 contiguous nucleotides complementary to a sequence in Table 1, Table 2, and Table 5, with no overhangs and no more than 1, 2, 3, or 4 mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 14, 15, 16, 17, 18, 19, 20, 21, or 22 contiguous nucleotides complementary to a nucleic acid sequence in SEQ ID NOs: 309-462, with no overhangs and no more than 1, 2, 3, or 4 mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 14, 15, 16, 17, 18, 19, 20, 21, or 22 contiguous nucleotides complementary to a nucleic acid sequence of SEQ ID NOs: 1-154, with no overhangs and with 1, 2, 3, or no more than 4 mismatches.
[0068] In some embodiments, the polynucleic acid molecules described herein comprise strands of at least 10, 11, 12, 13, 14, or 15 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise strands of about 15-40, 16-30, 17-30, 18-30, 18-27, 18-25, 18-23, 19-23, 20-23, or 21-23 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise strands of about 15, 16, 17, 18, 19, or 20 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise strands of about 21, 22, 23, 24, or 25 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise strands of about 26, 27, 28, 29, or 30 nucleotides in length.
[0069] In some embodiments, the polynucleic acid molecules described herein comprise single-stranded nucleic acids at least 10, 11, 12, 13, 14, or 15 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise single-stranded nucleic acids about 15-30, 16-30, 17-30, 18-30, 18-27, 18-25, 18-23, 19-23, 20-23, or 21-23 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise single-stranded nucleic acids about 15, 16, 17, 18, 19, or 20 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise single-stranded nucleic acids about 21, 22, 23, 24, or 25 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise single-stranded nucleic acids about 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise single-stranded nucleic acids about 21 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise a single-stranded nucleic acid about 23 nucleotides in length.
[0070] In some instances, the polynucleic acid molecule is a double-stranded nucleic acid molecule comprising a sense strand and an antisense strand, wherein the antisense strand is at least partially reverse complementary to a target region of Lp(a) mRNA.
[0071] In some embodiments, the antisense strands described herein are not 100% complementary to the target region of Lp(a) mRNA. Thus, in some examples, the antisense strands described herein are 100% complementary to the target region of Lp(a) mRNA. In some embodiments, the antisense strands described herein are about 95% complementary to the target region of Lp(a) mRNA. In some embodiments, the antisense strands described herein are about 90% complementary to the target region of Lp(a) mRNA. In some embodiments, the antisense strands described herein are about 85% complementary to the target region of Lp(a) mRNA. In some embodiments, the antisense strands described herein are about 80% complementary to the target region of Lp(a) mRNA. In some embodiments, the antisense strands described herein are about 75% complementary to the target region of Lp(a) mRNA. In some embodiments, the antisense strands described herein are about 70% complementary to the target region of Lp(a) mRNA.
[0072] In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence in Table 1 or Table 2. In other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence at least 80%, at least 85%, at least 90%, or at least 95% identical to a sequence in Table 1 or Table 2. In some examples, the sense strand described herein comprises a nucleic acid sequence at least 80%, at least 85%, at least 90%, or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 309-462. In some examples, the antisense strand described herein comprises a nucleic acid sequence at least 80%, at least 85%, at least 90%, or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 1-154. In some examples, the sense strand described herein comprises a nucleic acid sequence at least 80%, at least 85%, at least 90%, or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 312-314, 319, 326, 329, 352, 355, 357, 368, 372, 396-398, and 406. In some examples, the antisense strand described herein comprises a nucleic acid sequence at least 80%, at least 85%, at least 90%, or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 4-6, 11, 18, 21, 44, 47, 49, 60, 64, 88-90, and 98.
[0073] In yet another embodiment, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 15 contiguous sequences from a sequence in Table 1 or Table 2, with 1, 2, 3, or no more than 4 mismatches. In a specific embodiment, the sense strand described herein comprises a nucleic acid sequence comprising at least 15 contiguous sequences from SEQ ID NOs: 309-462, with 1, 2, 3, or no more than 4 mismatches. In a specific embodiment, the antisense strand described herein comprises a nucleic acid sequence comprising at least 15 contiguous sequences from SEQ ID NOs: 1-154, with 1, 2, 3, or no more than 4 mismatches. In yet another embodiment, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising at least 16 contiguous sequences from a sequence in Table 1 or Table 2, with 1, 2, 3, or no more than 4 mismatches. In specific embodiments, the sense strand described herein comprises a nucleic acid sequence comprising at least 16 contiguous sequences from SEQ ID NOs: 309-462 with 1, 2, 3, or no more than 4 mismatches. In specific embodiments, the antisense strand described herein comprises a nucleic acid sequence comprising at least 16 contiguous sequences from SEQ ID NOs: 1-154 with 1, 2, 3, or no more than 4 mismatches. In yet other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising at least 17 contiguous sequences from a sequence in Table 1 or Table 2 with 1, 2, 3, or no more than 4 mismatches. In specific embodiments, the sense strand described herein comprises a nucleic acid sequence comprising at least 17 contiguous sequences from SEQ ID NOs: 309-462 with 1, 2, 3, or no more than 4 mismatches. In specific embodiments, the antisense strands described herein comprise a nucleic acid sequence comprising at least 17 contiguous sequences from SEQ ID NOs: 1-154, with 1, 2, 3, or no more than 4 mismatches. In yet other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising at least 18 contiguous sequences from the sequences of Table 1 or Table 2, with 1, 2, 3, or no more than 4 mismatches.In specific embodiments, the sense strand described herein comprises a nucleic acid sequence comprising at least 18 contiguous sequences from SEQ ID NOs: 309-462 with 1, 2, 3, or no more than 4 mismatches. In specific embodiments, the antisense strand described herein comprises a nucleic acid sequence comprising at least 18 contiguous sequences from SEQ ID NOs: 1-154 with 1, 2, 3, or no more than 4 mismatches. In yet other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising at least 19 contiguous sequences from a sequence in Table 1 or Table 2 with 1, 2, 3, or no more than 4 mismatches. In specific embodiments, the sense strand described herein comprises a nucleic acid sequence comprising at least 19 contiguous sequences from SEQ ID NOs: 309-462 with 1, 2, 3, or no more than 4 mismatches. In specific embodiments, the antisense strand described herein comprises a nucleic acid sequence comprising at least 19 contiguous sequences from SEQ ID NOs: 1-154 with 1, 2, 3, or no more than 4 mismatches. In yet other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising at least 20 contiguous sequences from the sequences of Table 1 or Table 2 with 1, 2, 3, or no more than 4 mismatches. In specific embodiments, the sense strand described herein comprises a nucleic acid sequence comprising at least 20 contiguous sequences from SEQ ID NOs: 309-462 with 1, 2, 3, or no more than 4 mismatches. In specific embodiments, the antisense strand described herein comprises a nucleic acid sequence comprising at least 20 contiguous sequences from SEQ ID NOs: 1-154 with 1, 2, 3, or no more than 4 mismatches. In still other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising at least 21 contiguous sequences from the sequences of Table 1 or Table 2, with 1, 2, 3, or no more than 4 mismatches. In specific embodiments, the sense strand described herein comprises a nucleic acid sequence comprising at least 21 contiguous sequences from SEQ ID NOs: 309-462, with 1, 2, 3, or no more than 4 mismatches.In specific embodiments, the antisense strands described herein comprise a nucleic acid sequence comprising at least 21 contiguous sequences from SEQ ID NOs: 1-154 with 1, 2, 3, or no more than 4 mismatches. In yet other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising at least 22 contiguous sequences from the sequences of Table 1 or Table 2 with 1, 2, 3, or no more than 4 mismatches. In specific embodiments, the antisense strands described herein comprise a nucleic acid sequence comprising at least 22 contiguous sequences from SEQ ID NOs: 1-154 with 1, 2, 3, or no more than 4 mismatches. In specific embodiments, the antisense strands described herein comprise a nucleic acid sequence comprising at least 23 contiguous sequences from SEQ ID NOs: 1-154 with 1, 2, 3, or no more than 4 mismatches. In yet another embodiment, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising at least 23 contiguous sequences from the sequences of Table 1 or Table 2, with 1, 2, 3, or no more than 4 mismatches. As used herein, the term "contiguous sequence" refers to a sequence that contains several contiguous nucleotides from a reference sequence. For example, if the reference sequence is N1N2N3N4N5N6N7, the contiguous sequence can be N1N2N3N4 or N3N4N5N6, but the sequence N1N3N4N5 or N3N4N7 cannot be a contiguous sequence.
[0074] In some embodiments, the sense strand described herein comprises a nucleic acid sequence comprising at least 15 consecutive sequences of SEQ ID NOs: 312-314, 319, 326, 329, 352, 355, 357, 368, 372, 396-398, and 406, with 1, 2, 3, or no more than 4 mismatches. In some embodiments, the antisense strand described herein comprises a nucleic acid sequence comprising at least 15 consecutive sequences of SEQ ID NOs: 4-6, 11, 18, 21, 44, 47, 49, 60, 64, 88-90, and 98, with 1, 2, 3, or no more than 4 mismatches. In some embodiments, the sense strand described herein comprises a nucleic acid sequence comprising at least 16 contiguous sequences of SEQ ID NOs: 312-314, 319, 326, 329, 352, 355, 357, 368, 372, 396-398, and 406, with 1, 2, 3, or no more than 4 mismatches. In some embodiments, the antisense strand described herein comprises a nucleic acid sequence comprising at least 16 contiguous sequences of SEQ ID NOs: 4-6, 11, 18, 21, 44, 47, 49, 60, 64, 88-90, and 98, with 1, 2, 3, or no more than 4 mismatches. In some embodiments, the sense strand described herein comprises a nucleic acid sequence comprising at least 17 contiguous sequences of SEQ ID NOs: 312-314, 319, 326, 329, 352, 355, 357, 368, 372, 396-398, and 406, with 1, 2, 3, or no more than 4 mismatches. In some embodiments, the antisense strand described herein comprises a nucleic acid sequence comprising at least 17 contiguous sequences of SEQ ID NOs: 4-6, 11, 18, 21, 44, 47, 49, 60, 64, 88-90, and 98, with 1, 2, 3, or no more than 4 mismatches. In some embodiments, the sense strand described herein comprises a nucleic acid sequence comprising at least 18 consecutive sequences of SEQ ID NOs: 312-314, 319, 326, 329, 352, 355, 357, 368, 372, 396-398, and 406, with 1, 2, or no more than 3 mismatches.In some embodiments, the antisense strand described herein comprises a nucleic acid sequence comprising at least 18 contiguous sequences of SEQ ID NOs: 4-6, 11, 18, 21, 44, 47, 49, 60, 64, 88-90, and 98, with 1, 2, 3, or no more than 4 mismatches. In some embodiments, the sense strand described herein comprises a nucleic acid sequence comprising at least 19 contiguous sequences of SEQ ID NOs: 312-314, 319, 326, 329, 352, 355, 357, 368, 372, 396-398, and 406, with 1, 2, or no more than 3 mismatches. In some embodiments, the antisense strand described herein comprises a nucleic acid sequence comprising at least 19 contiguous sequences from SEQ ID NOs: 4-6, 11, 18, 21, 44, 47, 49, 60, 64, 88-90, and 98, with one, two, or three or fewer mismatches. In some embodiments, the sense strand described herein comprises a nucleic acid sequence comprising at least 20 contiguous sequences from SEQ ID NOs: 312-314, 319, 326, 329, 352, 355, 357, 368, 372, 396-398, and 406, with one, two, or three or fewer mismatches. In some embodiments, the antisense strand described herein comprises a nucleic acid sequence comprising at least 20 contiguous sequences from SEQ ID NOs: 4-6, 11, 18, 21, 44, 47, 49, 60, 64, 88-90, and 98, with one, two, or three or fewer mismatches. In some embodiments, the sense strand described herein comprises a nucleic acid sequence comprising at least 21 contiguous sequences of SEQ ID NOs: 312-314, 319, 326, 329, 352, 355, 357, 368, 372, 396-398, and 406, with one, two, or no more than three mismatches. In some embodiments, the antisense strand described herein comprises a nucleic acid sequence comprising at least 21 contiguous sequences of SEQ ID NOs: 4-6, 11, 18, 21, 44, 47, 49, 60, 64, 88-90, and 98, with one, two, or no more than three mismatches. In some embodiments, the antisense strand described herein comprises a nucleic acid sequence comprising at least 22 contiguous sequences of SEQ ID NOs: 4-6, 11, 18, 21, 44, 47, 49, 60, 64, 88-90, and 98, with one, two, or no more than three mismatches.In some embodiments, the antisense strand described herein comprises a nucleic acid sequence comprising at least 23 consecutive sequences of SEQ ID NOs: 4-6, 11, 18, 21, 44, 47, 49, 60, 64, 88-90, and 98, with 1, 2, or no more than 3 mismatches.
[0075] In some embodiments, the polynucleic acid molecules described herein comprise sense and antisense strands that are at least 10, 11, 12, 13, 14, or 15 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise sense and antisense strands that are about 15-40, 16-30, 17-30, 18-30, 18-27, 18-25, 18-23, 19-23, 20-23, or 21-23 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise sense and antisense strands that are about 15, 16, 17, 18, 19, or 20 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise sense and antisense strands that are about 21, 22, 23, 24, or 25 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise sense and antisense strands that are about 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise a sense strand about 19 nucleotides in length and an antisense strand about 21 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise a sense strand about 21 nucleotides in length and an antisense strand about 23 nucleotides in length.
[0076] In some embodiments, the sense strand and the antisense strand described herein are reverse complementary to each other and form a duplex with a 3' overhang on the antisense strand.In some embodiments, the sense strand and the antisense strand described herein are reverse complementary to each other and form a duplex with a 5' overhang on the antisense strand.In some embodiments, the sense strand and the antisense strand described herein are reverse complementary to each other and form a duplex with a 3' overhang on the sense strand.In some embodiments, the sense strand and the antisense strand described herein are reverse complementary to each other and form a duplex with a 5' overhang on the sense strand.
[0077] Modification of polynucleic acid molecules In some aspects of the present specification, polynucleic acid molecules described herein are described with modifications. In some aspects, the modifications described herein occur in one or more different structures of the polynucleic acid molecules described herein (e.g., modifications to the sugar ring, backbone, or base). In some aspects, the modifications described herein include substitutions of one or more nucleotides in the polynucleic acid molecules described herein. In some aspects, different percentages of the polynucleic acid molecules described herein include the modifications described herein. In some aspects, different positions of the polynucleic acid molecules described herein include the modifications described herein. WO 2018 / 035380 is incorporated herein by reference in its entirety.
[0078] Modification Type In some embodiments, the polynucleic acid molecules described herein comprise one or more sugar-modified nucleotides. In some examples, the sugar-modified nucleotide comprises a modification at the 2' hydroxyl group of the ribose moiety. In some examples, the sugar-modified nucleotide comprises a modification at H, OR, R, halo, SH, SR, NH2, NHR, NR2, or CN, where R is an alkyl moiety. In some embodiments, the sugar-modified nucleotide is a 2'-fluoro-modified nucleotide. In some embodiments, the sugar-modified nucleotide is a 2'-O-methyl-modified nucleotide or a 2'-alkoxy-modified nucleotide (e.g., a 2'-methoxy-modified nucleotide). In some examples, the 2'-hydroxyl group modification includes 2'-deoxy, 2'-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamide (2'-O-NMA). In some examples, the alkyl moiety includes heterosubstitution. In some examples, the carbon of the heterocyclic group is replaced by nitrogen, oxygen, or sulfur. In some examples, the heterocyclic substitution includes morpholino, imidazole, and pyrrolidino.
[0079] In some examples, the hydroxyl group of the 2' ribose moiety comprises a locked or bridged ribose modification (eg, LNA), an unlocked ribose modification (eg, UNA), or an ethylene nucleic acid (ENA).
[0080] In some embodiments, the sugar-modified nucleotide is a 2'-amino-modified nucleotide. In some embodiments, the sugar-modified nucleotide is a 2'-azido-modified nucleotide. In some embodiments, the sugar-modified nucleotide is a 2'-deoxy-modified nucleotide. In some embodiments, the sugar-modified nucleotide is a 2'-O-methoxythyl (2'-MOE). In some embodiments, the sugar-modified nucleotide is a locked nucleic acid (LNA). In some embodiments, the sugar-modified nucleotide is an ethylene-bridged nucleic acid (ENA). In some embodiments, the sugar-modified nucleotide is an (S)-constrained ethyl (cEt). In some embodiments, the sugar-modified nucleotide is a tricyclo-DNA (tcDNA). In some embodiments, the sugar-modified nucleotide is a 2'-NH2 nucleic acid.
[0081] In some embodiments, the polynucleotide molecules described herein comprise one or more sugar phosphate-modified nucleotides. In some embodiments, the modified sugar phosphate is a phosphorodiamidate morpholino (PMO). In some embodiments, the modified sugar phosphate is a phosphoramidate. In some embodiments, the modified sugar phosphate is a thiophosphoramidate. In some embodiments, the modified sugar phosphate is a peptide nucleic acid (PNA).
[0082] In some embodiments, the polynucleic acid molecules described herein contain one or more backbone-modified nucleotides. In some embodiments, the modified backbone is phosphorothioate. In some embodiments, the modified backbone is methylphosphonate. In some embodiments, the modified backbone is guanidinopropyl phosphoramidate. In some embodiments, the modified backbone is a mesyl-phosphoramidate (MsPA) linkage. In some examples, the modified backbone includes one or more of phosphorodithioate, methylphosphonate, 5'-alkylenephosphonate, 5'-methylphosphonate, 3'-alkylenephosphonate, boron trifluoridate, 3'-5'-linked or 2'-5'-linked boranophosphate ester and selenophosphate, phosphotriester, thionoalkylphosphotriester, phosphonic acid hydrogen bond, alkylphosphonate, alkylphosphonothioate, arylphosphonothioate, phosphoroselenoate, and phosphoramidate.
[0083] In some embodiments, the modified nucleotides include one or more modified guanines (eg, inosine), or any type of non-naturally occurring nucleic acid.
[0084] In some embodiments, the modified backbone is a phosphorothioate, and the phosphorothioate is a stereochemically enriched phosphorothioate. In certain embodiments, the chain comprises at least one stereochemically enriched phosphorothioate. In some embodiments, the chain comprises at least one, two, and three stereochemically enriched phosphorothioates. In some embodiments, the chain comprises only one, two, three, or four stereochemically enriched phosphorothioates. In further embodiments, at least one (e.g., one or two) stereochemically enriched phosphorothioate is disposed between two consecutive nucleosides that are two of the six 5'-terminal nucleosides in the chain. In yet further embodiments, at least one (e.g., one or two) stereochemically enriched phosphorothioate is disposed between two consecutive nucleosides that are two of the six 3'-terminal nucleosides in the chain. In still further embodiments, one stereochemically enriched phosphorothioate is covalently linked from the 5' end to the first and second nucleosides in the chain. In some embodiments, one stereochemically enriched phosphorothioate is covalently linked from the 5' end to the 21st and 22nd nucleosides in the chain. In certain embodiments, one stereochemically enriched phosphorothioate is covalently linked from the 5' end to the 22nd and 23rd nucleosides in the chain. In certain embodiments, the stereochemically enriched phosphorothioate has RP stereochemical identity. In certain embodiments, the stereochemically enriched phosphorothioate has SP stereochemical identity.
[0085] In some embodiments, the polynucleotide molecules described herein contain one or more (e.g., 1-20, 1-10, or 1-5) stereochemically enriched (e.g., internucleoside) phosphorothioates (e.g., at P-stereocenters, the diastereomeric excess is at least 10%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%, e.g., up to about 99%). The polynucleotide molecules described herein contain one or more (e.g., 1-20, 1-10, or 1-5, e.g., internucleoside) phosphorothioates. The phosphorothioates may be non-P-stereomeric in the polynucleotide molecules described herein. Phosphorothioates and phosphorodithioates may improve the stability of the polynucleotide molecules described herein against serum exonuclease activity. Non-P-stereomeric phosphorothioates may simplify the synthesis of the polynucleotide molecules described herein by reducing the number of possible diastereomers. Typically, phosphorothioates or phosphorodithioates can connect two consecutive nucleosides within the six 3'-terminal nucleosides and six 5'-terminal nucleosides in the polynucleotide molecules described herein. In some embodiments, stereochemically enriched phosphorothioates (e.g., R P Stereochemically enriched phosphorothioates (e.g., S) can be covalently linked from the 5' end of the antisense strand to a first nucleoside (e.g., the 3' carbon atom of the first nucleoside) and a second nucleoside (e.g., the 5' carbon atom of the second nucleoside). Additionally or alternatively, stereochemically enriched phosphorothioates (e.g., S P Stereochemically enriched phosphorothioates (e.g., S) can be covalently linked to the 21st nucleoside (e.g., the 3' carbon atom of the 21st nucleoside) and the 22nd nucleoside (e.g., the 5' carbon atom of the 22nd nucleoside) from the 5' end of the antisense strand. P phosphorothioate or R PThe 22nd nucleoside (e.g., the 3' carbon atom of the 22nd nucleoside) and the 23rd nucleoside (e.g., the 5' carbon atom of the 23rd nucleoside) from the 5' end of the antisense strand can be covalently linked.
[0086] 5'R from the 5' end of the antisense strand P R is covalently linked to a first nucleoside (e.g., the 3' carbon atom of the first nucleoside) and a second nucleoside (e.g., the 5' carbon atom of the second nucleoside). P phosphorothioates) and 3'S P a phosphorothioate (e.g., S) covalently linked to the 21st nucleoside (e.g., the 3' carbon atom of the 21st nucleoside) and the 22nd nucleoside (e.g., the 5' carbon atom of the 22nd nucleoside) P The combination of 5'R with 5'R-rich phosphorothioates is P is rich in phosphorothioates and 3'S P is rich in phosphorothioates, or 5'R P Rich in phosphorothioates and 3'Sp and R P In some embodiments, the stereochemically enriched phosphorothioates can provide superior efficacy and / or duration of action as measured by reduced target activity compared to a reference guide strand lacking the R p R p S p S p (R at positions 1 and 2 of the guide strand p R p , and S at positions 21 and 22 of the guide strand p S p ) or R p R p S p R p (R at positions 1 and 2 of the guide strand p R p , and S at positions 21 and 22 of the guide strand p R pIn some embodiments, the polynucleotide molecules described herein may comprise four stereochemically enriched phosphorothioates: (1) R covalently linked from the 5' end of the antisense strand to a first nucleoside (e.g., the 3' carbon atom of the first nucleoside) and a second nucleoside (e.g., the 5' carbon atom of the second nucleoside). P (2) R covalently linked from the 5' end of the antisense strand to a second nucleoside (e.g., the 3' carbon atom of the second nucleoside) and a third nucleoside (e.g., the 5' carbon atom of the third nucleoside). P (3) S covalently linked to the 21st nucleoside (e.g., the 3' carbon atom of the 21st nucleoside) and the 22nd nucleoside (e.g., the 5' carbon atom of the 22nd nucleoside) from the 5' end of the antisense strand. P and (4) S covalently linked to the 22nd nucleoside (e.g., the 3' carbon atom of the 22nd nucleoside) and the 23rd nucleoside (e.g., the 5' carbon atom of the 23rd nucleoside) from the 5' end of the antisense strand. P In some embodiments, the polynucleotide molecules described herein comprise four stereochemically enriched phosphorothioates: (1) R covalently linked from the 5' end of the antisense strand to a first nucleoside (e.g., the 3' carbon atom of the first nucleoside) and a second nucleoside (e.g., the 5' carbon atom of the second nucleoside). P (2) R covalently linked from the 5' end of the antisense strand to a second nucleoside (e.g., the 3' carbon atom of the second nucleoside) and a third nucleoside (e.g., the 5' carbon atom of the third nucleoside). P (3) S covalently linked to the 21st nucleoside (e.g., the 3' carbon atom of the 21st nucleoside) and the 22nd nucleoside (e.g., the 5' carbon atom of the 22nd nucleoside) from the 5' end of the antisense strand. Pand (4) R covalently linked to the 22nd nucleoside (e.g., the 3' carbon atom of the 22nd nucleoside) and the 23rd nucleoside (e.g., the 5' carbon atom of the 23rd nucleoside) from the 5' end of the antisense strand. P Contains abundant phosphorothioates.
[0087] In some embodiments, the polynucleotide molecules described herein contain one or more purine modifications. In some embodiments, the purine modification described herein is 2,6-diaminopurine. In some embodiments, the purine modification described herein is 3-deaza-adenine. In some embodiments, the purine modification described herein is 7-deaza-guanine. In some embodiments, the purine modification described herein is 8-azido-adenine.
[0088] In some embodiments, the polynucleotide molecules described herein comprise one or more pyrimidine modifications. In some embodiments, the pyrimidine modification described herein is 2-thio-thymidine. In some embodiments, the pyrimidine modification described herein is 5-carboxamido-uracil. In some embodiments, the pyrimidine modification described herein is 5-methyl-cytosine. In some embodiments, the pyrimidine modification described herein is 5-ethynyluracil.
[0089] In some cases, the polynucleic acid molecules described herein contain abasic substitutions. When the hybridized polynucleotide construct is intended for use as siRNA, it is desirable to reduce miRNA-like off-target effects. By including one or more (for example, one or two) abasic substitutions in the hybridized polynucleotide construct, the miRNA-like off-target effects can be reduced or even eliminated, since the abasic substitutions lack a nucleic acid base that can engage in base-pairing interactions and relieve steric hindrance. Therefore, the polynucleotide molecules disclosed herein may contain one or more (for example, one or two) abasic substitutions. In some embodiments, the abasic substitution is located at the fifth nucleotide from the 5' end of the antisense strand described herein. In some embodiments, the abasic substitution is located at the seventh nucleotide from the 5' end of the antisense strand described herein.
[0090] When a polynucleotide molecule disclosed herein contains two or more abasic substitutions, their structures may be the same or different. In certain embodiments, the sense strand contains one abasic substitution (e.g., the antisense strand may not contain an abasic substitution). In other embodiments, the antisense strand contains one abasic substitution (e.g., the sense strand may not contain an abasic substitution). In still other embodiments, the antisense strand contains one abasic substitution and the sense strand contains one abasic substitution. In a further embodiment, the sense strand contains an abasic substitution between nucleoside number (x) and nucleoside number (x+1), where x is an integer from 2 to 7. In a further embodiment, the antisense strand contains an abasic substitution between nucleoside number (x) and nucleoside number (x+1), where x is an integer from 2 to 7.
[0091] The abasic substitution is represented by formula (III):
[0092] [ka] wherein L is a sugar analog or substituted with a heteroaryl from A, U, C, G, or any other substituted nucleic acid (e.g., locked or unlocked nucleic acid, glycol nucleic acid, etc.); X 4 are each independently O or S, X 5 are each independently O, S, NH, or a bond; R 9 are each independently H, optionally substituted C 1-6 Alkyl, optionally substituted C 2-6 Alkenyl, optionally substituted C 2-6 Alkynyl, optionally substituted (C 1-9 Heterocyclyl)-C 1-6 -alkyl, optionally substituted (C 6-10 Aryl)-C 1-6 -alkyl, optionally substituted (C 3-8 Cycloalkyl)-C 1-6 -Alkyl, -LinkA(-T) p or a conjugation moiety, each LinkA is independently a polyvalent linker (e.g., comprising -C(O)-N(H)-); T are each independently an auxiliary moiety; R 10 is the bond to the 3' carbon atom of the nucleoside (x) in the chain, R 11 is the bond to the 5' oxygen atom of nucleoside (x+1) in the chain, p is an integer from 1 to 6, t is an integer of 1 to 6.
[0093] In some embodiments, the abasic substitutions described herein are attached to the antisense strand of the polynucleic acid molecule described herein. In certain embodiments, the abasic substitutions (e.g., the internucleotide abasic spacer of formula (III) where t is 1) can be included in the antisense strand described herein (e.g., in the seed region of the guide strand). In some embodiments, the abasic substitutions (e.g., the internucleotide abasic spacer of formula (III) where t is 1) can be attached to the 3' carbon atom of the second, third, fourth, or fifth nucleoside from the 5' end of the antisense strand described herein. In certain embodiments, the abasic substitutions (e.g., the internucleotide abasic spacer of formula (III) where t is 1) can be attached to the 3' carbon atom of the thirteenth, fourteenth, fifteenth, or sixteenth nucleoside from the 5' end of the antisense strand described herein. In some embodiments, the abasic substitution is at the 4th, 5th, 6th, 7th, 8th, and / or 9th nucleoside from the 5' end of the antisense strand described herein.
[0094] The polynucleotide molecules described herein can contain strands that include seed regions that include nucleosides (eg, inosine) that contain hypoxanthine nucleobases.
[0095] In certain embodiments, the nucleoside containing the hypoxanthine nucleobase is the second nucleoside from the 5'-end of the chain. In further embodiments, the nucleoside containing the hypoxanthine nucleobase is the third nucleoside from the 5'-end of the chain. In even further embodiments, the nucleoside containing the hypoxanthine nucleobase is the fourth nucleoside from the 5'-end of the chain. In even further embodiments, the nucleoside containing the hypoxanthine nucleobase is the fifth nucleoside from the 5'-end of the chain. In certain embodiments, the nucleoside containing the hypoxanthine nucleobase is the sixth nucleoside of the chain. In certain embodiments, the nucleoside containing the hypoxanthine nucleobase is the seventh nucleoside of the chain.
[0096] Amount and position of modification
[0097] In some embodiments, the polynucleotide molecules described herein comprise one or more types of modifications described above. Thus, in some embodiments, about 10% of the nucleotides from the polynucleotide molecules described herein are modified with one or more types of modifications described above. In other embodiments, about 20% of the nucleotides from the polynucleotide molecules described herein are modified with one or more types of modifications described above. In other embodiments, about 30% of the nucleotides from the polynucleotide molecules described herein are modified with one or more types of modifications described above. In other embodiments, about 40% of the nucleotides from the polynucleotide molecules described herein are modified with one or more types of modifications described above. In other embodiments, about 50% of the nucleotides from the polynucleotide molecules described herein are modified with one or more types of modifications described above. In other embodiments, about 60% of the nucleotides from the polynucleotide molecules described herein are modified with one or more types of modifications described above. In other embodiments, about 70% of the nucleotides from the polynucleotide molecules described herein are modified with one or more types of modifications described above. In other embodiments, about 80% of the nucleotides from the polynucleotide molecules described herein are modified with one or more types of modifications described above. In other embodiments, about 90% of the nucleotides from the polynucleotide molecules described herein are modified with one or more types of modifications described above. In other embodiments, 100% of the nucleotides from the polynucleotide molecules described herein are modified with one or more types of modifications described above.
[0098] In some embodiments, one or more types of modifications described herein occur in the seed region within the polynucleotide molecules described herein. In some embodiments, one or more types of modifications described herein occur at different positions within the polynucleotide molecules described herein. In specific embodiments, one or more types of modifications described herein occur at the 3' end of the polynucleotide molecules described herein. In specific embodiments, one or more types of modifications described herein occur at the 5' end of the polynucleotide molecules described herein. In specific embodiments, one or more types of modifications described herein occur dispersedly within the polynucleotide molecules described herein. In specific embodiments, one or more types of modifications described herein occur in clusters within the polynucleotide molecules described herein.
[0099] Specific modification patterns In some embodiments herein, specific modification patterns are described, where the sense strand contains about 3 2'-fluoro modified nucleotides and about 18 2'-O-methyl modified nucleotides, and the antisense strand contains about 5 2'-fluoro modified nucleotides and about 18 2'-O-methyl modified nucleotides.
[0100] In some embodiments, described herein are polynucleic acids modified with specific modification patterns, wherein the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnnNfnnnnNfnNfnNfnNfnnnnnn-3', where n represents a 2'-O-methyl modified nucleotide and Nf represents a 2'-fluoro modified nucleotide. In some embodiments, the sense strand comprises '5-NfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNf-3' and the antisense strand comprises '5-nNfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNfn-3', where Nf represents a 2'-fluoro modified nucleotide and n represents a 2'-O-methyl modified nucleotide. In some embodiments, the sense strand comprises '5-nnnnnnNfnNfNfNfnnnnnnnnnn-3' and the antisense strand comprises '5-nNfnnnNfnNfNfnnnnNfnNfnnnnnn-3', where Nf represents a 2'-fluoro modified nucleotide and n represents a 2'-O-methyl modified nucleotide. In some embodiments, the sense strand comprises '5-nnnnnnnnNfnNfnnnnnnnnnn-3' and the antisense strand comprises '5-nNfnnnnnnnnnNfnNfnnnnnnnn-3', where Nf represents a 2'-fluoro modified nucleotide and n represents a 2'-O-methyl modified nucleotide. In some embodiments, the sense strand comprises '5-nnnnnnNfnNfnNfnnnnnnnnnn-3' and the antisense strand comprises '5-nNfnnnnnnnnnNfnNfnNfnnnnnnn-3', where Nf represents a 2'-fluoro-modified nucleotide and n represents a 2'-O-methyl-modified nucleotide. In some examples, each modification pattern comprises one or more phosphorothioate internucleotide linkages at locations such as between the first and second nucleotides on the 5' end, between the second and third nucleotides on the 5' end, between the first and second nucleotides on the 3' end, and / or between the second and third nucleotides on the 3' end.
[0101] In some embodiments, the antisense strand comprises 5'-nNfnnnNfNfnnnnNfnNfnnnnnn-3', where Nf represents a 2'-fluoro modified nucleotide and n represents a 2'-O-methyl modified nucleotide. In some embodiments, the antisense strand comprises 5'-nNfnnnNfnnnnnnnNfnNfnnnnnnn-3', where Nf represents a 2'-fluoro modified nucleotide and n represents a 2'-O-methyl modified nucleotide. In some embodiments, the antisense strand comprises 5'-nNfnnnnNfnnnnNfnNfnnnnnnnnn-3', where Nf represents a 2'-fluoro modified nucleotide and n represents a 2'-O-methyl modified nucleotide. In some embodiments, the antisense strand comprises 5'-nNfnnnnNfnnnnNfnNfnnnnnnnnn-3', where Nf represents a 2'-fluoro modified nucleotide and n represents a 2'-O-methyl modified nucleotide. In some embodiments, the antisense strand comprises or consists of two 2'-fluoro modified nucleotides at positions 2 and 14, respectively. In some embodiments, the antisense strand comprises or consists of three 2'-fluoro modified nucleotides at positions 2, 12, and 14, respectively. In some embodiments, the antisense strand comprises or consists of three 2'-fluoro modified nucleotides at positions 2, 14, and 16, respectively. In some embodiments, the antisense strand comprises or consists of four 2'-fluoro modified nucleotides at positions 2, 12, 14, and 16, respectively. In some embodiments, the antisense strand comprises a 2'-fluoro modified nucleotide at position 6, 7, 8, or 9. In some embodiments, the antisense strand comprises a 2'-fluoro modified nucleotide at position 4. In some embodiments, the antisense strand does not contain a 2'-fluoro modified nucleotide at position 4.
[0102] In some embodiments, the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', where Nf represents a 2'-fluoro modified nucleotide and n represents a 2'-O-methyl modified nucleotide. In some embodiments, the sense strand comprises 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3', where Nf represents a 2'-fluoro modified nucleotide and n represents a 2'-O-methyl modified nucleotide. In some embodiments, the sense strand comprises 5'-nnnnnnnnNfNfNfnnnnnnnnnn-3', where Nf represents a 2'-fluoro modified nucleotide and n represents a 2'-O-methyl modified nucleotide. In some embodiments, the sense strand comprises or consists of two 2'-fluoro modified nucleotides at positions 9 and 11, respectively. In some embodiments, the sense strand comprises or consists of three 2'-fluoro modified nucleotides at positions 7, 9, and 11, respectively. In some embodiments, the sense strand comprises or consists of three 2'-fluoro modified nucleotides at positions 9, 10, and 11, respectively. In some embodiments, the sense strand comprises or consists of four 2'-fluoro modified nucleotides at positions 7, 9, 10, and 11, respectively. In some embodiments, the sense strand comprises a 2'-fluoro modified nucleotide at position 8, 12, or 16. In some embodiments, the sense strand does not contain a 2'-fluoro modified nucleotide at position 8, 12, or 16.
[0103] In some embodiments, the present specification describes specific modification patterns for polynucleic acid molecules that are double-stranded nucleic acid molecules comprising a sense strand and an antisense strand. In some embodiments, the antisense strand comprises a 2'-fluoro modified nucleotide at position 2 from the 5' end. In some embodiments, the antisense strand comprises a 2'-fluoro modified nucleotide at position 14 from the 5' end. In some embodiments, the antisense strand comprises a 2'-fluoro modified nucleotide at positions 2 and 14 from the 5' end. In some embodiments, the antisense strand comprises a 2'-fluoro modified nucleotide at position 12 from the 5' end. In some embodiments, the antisense strand comprises a 2'-fluoro modified nucleotide at position 16 from the 5' end. In other embodiments, the antisense strand comprises a 2'-fluoro modified nucleotide at position 6 from the 5' end. In other embodiments, the antisense strand comprises a 2'-fluoro modified nucleotide at position 7 from the 5' end. In other embodiments, the antisense strand comprises a 2'-fluoro modified nucleotide at position 8 from the 5' end. In other embodiments, the antisense strand comprises a 2'-fluoro modified nucleotide at position 9 from the 5' end. In other embodiments, the antisense strand comprises a 2'-fluoro modified nucleotide at position 4 from the 5' end.
[0104] In some embodiments, the present specification describes specific modification patterns for polynucleic acid molecules that are double-stranded nucleic acid molecules comprising a sense strand and an antisense strand. In some embodiments, the sense strand comprises a 2'-fluoro modified nucleotide at position 9 from the 5' end. In some embodiments, the sense strand comprises a 2'-fluoro modified nucleotide at position 11 from the 5' end. In some embodiments, the sense strand comprises a 2'-fluoro modified nucleotide at positions 9 and 11 from the 5' end. In some embodiments, the sense strand comprises a 2'-fluoro modified nucleotide at position 7 from the 5' end. In some embodiments, the sense strand comprises a 2'-fluoro modified nucleotide at position 10 from the 5' end. In some embodiments, the sense strand comprises a 2'-fluoro modified nucleotide at positions 9, 11, and 7 from the 5' end. The sense strand comprises a 2'-fluoro modified nucleotide at positions 9, 11, and 10 from the 5' end. The sense strand comprises a 2'-fluoro modified nucleotide at positions 9 and 7 from the 5' end. The sense strand comprises 2'-fluoro modified nucleotides at positions 9 and 10 from the 5' end. The sense strand comprises 2'-fluoro modified nucleotides at positions 9, 11, 7, and 10 from the 5' end. In other embodiments, the sense strand comprises a 2'-fluoro modified nucleotide at position 8 from the 5' end. In other embodiments, the sense strand comprises a 2'-fluoro modified nucleotide at position 12 from the 5' end. In other embodiments, the sense strand comprises a 2'-fluoro modified nucleotide at position 16 from the 5' end.
[0105] In some embodiments, the sense and antisense strands of the polynucleic acid molecule comprise any combination of two or more 2'-fluoro modified nucleotides at the positions described in the above two paragraphs.
[0106] In some embodiments, the antisense strand comprises 5'-nNfnnnNfNfnnnnNfnNfnnnnnn-3'. In some embodiments, the antisense strand comprises 5'-nNfnnnNfnnnnnnnNfnNfnnnnnnn-3'. In some embodiments, the antisense strand comprises 5'-nNfnnnnNfnnnnnnNfnNfnnnnnnn-3'. In some embodiments, the antisense strand comprises 5'-nNfnnnnNfnnnnNfnNfnnnnnnnnn-3'. In the above modification patterns, "Nf" represents a 2'-fluoro modified nucleotide and "n" represents a 2'-O-methyl modified nucleotide.
[0107] In some embodiments, the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3'. In some embodiments, the sense strand comprises 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3'. In some embodiments, the sense strand comprises 5'-nnnnnnnnNfNfNfnnnnnnnnnn-3'. In some embodiments, the sense strand comprises 5'-nnnnnnnnNfNfNfnnnnnnnnnn-3'. In the above modification patterns, "Nf" represents a 2'-fluoro modified nucleotide and "n" represents a 2'-O-methyl modified nucleotide.
[0108] In some aspects herein, specific modification patterns are described for polynucleic acid molecules that are double-stranded nucleic acid molecules comprising a sense strand and an antisense strand, where the sense strand comprises about 12 2'-fluoro modified nucleotides and about 9 2'-O-methyl modified nucleotides, and the antisense strand comprises about 9 2'-fluoro modified nucleotides and about 14 2'-O-methyl modified nucleotides.
[0109] In some embodiments herein, specific modification patterns are described, where the sense strand is fully modified and contains 12 2'-fluoro modified nucleotides, 9 2'-O-methyl modified nucleotides, and the antisense strand is fully modified and contains 9 2'-fluoro modified nucleotides and 14 2'-O-methyl modified nucleotides.
[0110] In some embodiments herein, specific modification patterns are described, where the sense strand comprises 5'-NfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNf-3' and the antisense strand comprises 5'-nNfnNfnNfnNfnNfnNfnnnNfnNfnNfnNfn-3', where "Nf" represents a 2'-fluoro modified nucleotide and "n" represents a 2'-O-methyl modified nucleotide.
[0111] In some embodiments herein, specific modification patterns are described, where the sense strand comprises 5'-NfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNf-3' and the antisense strand comprises 5'-nNfnNfnNfnNfnNfnNfnNfnnNfnNfnNfnNfn-3', wherein the sense strand and / or antisense strand comprise one or more phosphorothioate linkages, where "Nf" represents a 2'-fluoro modified nucleotide, and "n" represents a 2'-O-methyl modified nucleotide. In other aspects herein, specific modification patterns are described, where the sense strand comprises 5'-NfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNf-3' and the antisense strand comprises 5'-nNfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNfn-3', where the sense strand comprises two phosphorothioate linkages and the antisense strand comprises four phosphorothioate linkages, where "Nf" represents a 2'-fluoro modified nucleotide and "n" represents a 2'-O-methyl modified nucleotide.
[0112] In some embodiments herein, specific modification patterns are described, where the sense and / or antisense strands are modified as Type I in Table 8.
[0113] [Table 1]
[0114] In some embodiments, the polynucleotide molecules provided herein comprise a sense strand comprising a nucleic acid sequence of SEQ ID NO: 309-462, and an antisense strand comprising a nucleic acid sequence of SEQ ID NO: 1-154, wherein the sense strand and / or the antisense strand are modified with a Type I modification pattern described in Table 8.
[0115] In some embodiments herein, specific modification patterns are described, where the sense strand contains about 4 2'-fluoro modified nucleotides and about 17 2'-O-methyl modified nucleotides, and the antisense strand contains about 6 2'-fluoro modified nucleotides and about 17 2'-O-methyl modified nucleotides.
[0116] In some embodiments herein, specific modification patterns are described, where the sense strand is fully modified and contains 4 2'-fluoro modified nucleotides, 17 2'-O-methyl modified nucleotides, and the antisense strand is fully modified and contains 6 2'-fluoro modified nucleotides and 17 2'-O-methyl modified nucleotides.
[0117] In some embodiments herein, specific modification patterns are described, where the sense strand comprises 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnNfnNfNfnnnnNfnNfnnnnnn-3', where "Nf" represents a 2'-fluoro modified nucleotide and "n" represents a 2'-O-methyl modified nucleotide.
[0118] In some embodiments herein, specific modification patterns are described, where the sense strand comprises 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnNfnNfNfnnnnNfnNfnnnnnn-3', wherein the sense strand and / or antisense strand comprise one or more phosphorothioate linkages, where "Nf" represents a 2'-fluoro modified nucleotide, and "n" represents a 2'-O-methyl modified nucleotide. In other aspects herein, specific modification patterns are described, where the sense strand comprises 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnNfnNfNfnnnnNfnNfnnnnnn-3', where the sense strand comprises two phosphorothioate linkages and the antisense strand comprises four phosphorothioate linkages, where "Nf" represents a 2'-fluoro modified nucleotide and "n" represents a 2'-O-methyl modified nucleotide.
[0119] In some embodiments herein, specific modification patterns are described, where the sense and / or antisense strands are modified as Type II in Table 8.
[0120] In some embodiments, the polynucleotide molecules provided herein comprise a sense strand comprising a nucleic acid sequence of SEQ ID NOs: 309-462 and / or an antisense strand comprising a nucleic acid sequence of SEQ ID NOs: 1-154, wherein the sense strand and / or the antisense strand are modified with a Type II modification pattern described in Table 8.
[0121] In some embodiments herein, specific modification patterns are described, where the sense strand contains about 2 2'-fluoro modified nucleotides and about 19 2'-O-methyl modified nucleotides, and the antisense strand contains about 3 2'-fluoro modified nucleotides and about 20 2'-O-methyl modified nucleotides.
[0122] In some embodiments herein, specific modification patterns are described where the sense strand is fully modified and contains 2 2'-fluoro modified nucleotides and 19 2'-O-methyl modified nucleotides, and the antisense strand is fully modified and contains 3 2'-fluoro modified nucleotides and 20 2'-O-methyl modified nucleotides.
[0123] In some embodiments herein, specific modification patterns are described, where the sense strand comprises 5'-nnnnnnnnNfnNfnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnnnnnnnnnn-3', where "Nf" represents a 2'-fluoro modified nucleotide and "n" represents a 2'-O-methyl modified nucleotide.
[0124] In some embodiments herein, specific modification patterns are described, where the sense strand comprises 5'-nnnnnnnnNfnNfnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnnnnnnnn-3', where the sense strand and / or the antisense strand comprise one or more phosphorothioate linkages, "Nf" represents a 2'-fluoro modified nucleotide, and "n" represents a 2'-O-methyl modified nucleotide. In other embodiments herein, specific modification patterns are described, where the sense strand comprises 5'-nnnnnnnnNfnNfnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnnnnnnnnnn-3', where the sense strand comprises two phosphorothioate linkages and the antisense strand comprises four phosphorothioate linkages, "Nf" represents a 2'-fluoro modified nucleotide, and "n" represents a 2'-O-methyl modified nucleotide.
[0125] In some embodiments herein, specific modification patterns are described, where the sense and / or antisense strands are modified as Type III in Table 8.
[0126] In some embodiments, the polynucleotide molecules provided herein comprise a sense strand comprising a nucleic acid sequence of SEQ ID NO: 309-462 and / or an antisense strand comprising a nucleic acid sequence of SEQ ID NO: 1-154, wherein the sense strand and / or the antisense strand are modified with a Type III modification pattern described in Table 8.
[0127] In some embodiments herein, specific modification patterns are described, where the sense strand contains about 3 2'-fluoro modified nucleotides and about 18 2'-O-methyl modified nucleotides, and the antisense strand contains about 4 2'-fluoro modified nucleotides and about 19 2'-O-methyl modified nucleotides.
[0128] In some embodiments herein, specific modification patterns are described, where the sense strand is fully modified and contains 3 2'-fluoro modified nucleotides and 18 2'-O-methyl modified nucleotides, and the antisense strand is fully modified and contains 4 2'-fluoro modified nucleotides and 19 2'-O-methyl modified nucleotides.
[0129] In some embodiments herein, specific modification patterns are described, where the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnNfnnnnnn-3', where "Nf" represents a 2'-fluoro modified nucleotide and "n" represents a 2'-O-methyl modified nucleotide.
[0130] In some embodiments herein, specific modification patterns are described, where the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnNfnnnnnn-3', wherein the sense strand and / or antisense strand comprise one or more phosphorothioate linkages, where "Nf" represents a 2'-fluoro modified nucleotide, and "n" represents a 2'-O-methyl modified nucleotide. In other aspects herein, specific modification patterns are described, where the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnNfnnnnnn-3', where the sense strand comprises two phosphorothioate linkages and the antisense strand comprises four phosphorothioate linkages, where "Nf" represents a 2'-fluoro modified nucleotide and "n" represents a 2'-O-methyl modified nucleotide.
[0131] In some embodiments herein, specific modification patterns are described, where the sense and / or antisense strands are modified as Type IV in Table 8.
[0132] In some embodiments, the polynucleotide molecules provided herein comprise a sense strand comprising a nucleic acid sequence of SEQ ID NO: 309-462 and / or an antisense strand comprising a nucleic acid sequence of SEQ ID NO: 1-154, wherein the sense strand and / or the antisense strand are modified with a Type IV modification pattern described in Table 8.
[0133] In some embodiments herein, specific modification patterns are described, where the sense strand contains about 3 2'-fluoro modified nucleotides and about 18 2'-O-methyl modified nucleotides, and the antisense strand contains about 5 2'-fluoro modified nucleotides and about 18 2'-O-methyl modified nucleotides.
[0134] In some embodiments herein, specific modification patterns are described, where the sense strand is fully modified and contains 3 2'-fluoro modified nucleotides and 18 2'-O-methyl modified nucleotides, and the antisense strand is fully modified and contains 5 2'-fluoro modified nucleotides and 18 2'-O-methyl modified nucleotides.
[0135] In some embodiments herein, specific modification patterns are described, where the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnnNfnnnnNfnNfnNfnnnnnn-3', where "Nf" represents a 2'-fluoro modified nucleotide and "n" represents a 2'-O-methyl modified nucleotide.
[0136] In some embodiments herein, specific modification patterns are described, where the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnnNfnnnnNfnNfnNfnnnnnn-3', wherein the sense strand and / or antisense strand comprise one or more phosphorothioate linkages, where "Nf" represents a 2'-fluoro modified nucleotide, and "n" represents a 2'-O-methyl modified nucleotide. In other aspects herein, specific modification patterns are described, where the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnnNfnnnnNfnNfnNfnnnnnn-3', where the sense strand comprises two phosphorothioate linkages and the antisense strand comprises four phosphorothioate linkages, where "Nf" represents a 2'-fluoro modified nucleotide and "n" represents a 2'-O-methyl modified nucleotide.
[0137] In some embodiments herein, specific modification patterns are described, where the sense and / or antisense strands are modified as Type V in Table 8.
[0138] In some embodiments, the polynucleotide molecules provided herein comprise a sense strand comprising a nucleic acid sequence of SEQ ID NO: 309-462 and / or an antisense strand comprising a nucleic acid sequence of SEQ ID NO: 1-154, wherein the sense strand and / or the antisense strand are modified with a Type V modification pattern described in Table 8.
[0139] In some embodiments herein, a specific modification pattern is described in which the sense strand contains about 3 2'-fluoro modified nucleotides and about 18 2'-O-methyl modified nucleotides, with one or more inverted deoxy-nucleotides present as an overhang at the 3' end.
[0140] In some embodiments herein, a specific modification pattern is described in which the sense strand is fully modified and contains three 2'-fluoro modified nucleotides and eighteen 2'-O-methyl modified nucleotides, with two inverted deoxy-nucleotides as an overhang at the 3' end.
[0141] In some embodiments herein, specific modification patterns are described, where the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-invdN-invdN-3', where "Nf" represents a 2'-fluoro modified nucleotide, "n" represents a 2'-O-methyl modified nucleotide, and "invdN" represents an inverted deoxy-nucleotide. In some examples, invdN is inverted deoxyl-thymine. In some embodiments, a linker conjugated with one or more targeting moieties shown in formula (IV" or IV'") is attached to the first nucleic acid on the 5' end. In some embodiments, a linker conjugated with one or more targeting moieties shown in formula (V") or (V'") is attached to the first nucleic acid on the 5' end. In some embodiments, the modification pattern comprises one or more phosphorothioate linkages. In some embodiments, the modification pattern is shown in formula (VII). In some embodiments, a 5' end modification known in the art is applied to one or more inverted nucleotides.
[0142] [ka] wherein R is a moiety corresponding to a sugar modification described herein, and in some instances, R is -O-methyl, R' is thymine, abasic, or other, A is -O or -S, and A' is -O or -S.
[0143] In some embodiments, the polynucleotide molecules provided herein comprise a sense strand comprising a nucleic acid sequence of SEQ ID NO: 309-462 and / or an antisense strand comprising a nucleic acid sequence of SEQ ID NO: 1-154, wherein the sense strand and / or the antisense strand are modified with a Type VI modification pattern described in Table 8.
[0144] In some embodiments, the polynucleotide molecules provided herein comprise a single-stranded nucleic acid comprising a nucleic acid sequence selected from one of SEQ ID NOs: 1-154. In some embodiments, the polynucleotide molecules provided herein comprise a single-stranded nucleic acid comprising a nucleic acid sequence selected from one of SEQ ID NOs: 309-462.
[0145] In some embodiments, the polynucleotide molecules provided herein comprise a sense strand comprising a nucleic acid sequence selected from one of SEQ ID NOs: 309-462 and an antisense strand comprising a nucleic acid sequence selected from one of SEQ ID NOs: 1-154. In other embodiments, the polynucleotide molecules provided herein comprise a sense strand comprising a nucleic acid sequence selected from one of SEQ ID NOs: 309-462 and an antisense strand comprising a nucleic acid sequence selected from one of SEQ ID NOs: 1-154, wherein the sense strand and / or the antisense strand are modified with a modification pattern described herein.
[0146] In some embodiments, the polynucleotide molecules provided herein comprise a sense strand comprising a nucleic acid sequence selected from one of SEQ ID NOs: 309-462, and an antisense strand comprising a nucleic acid sequence selected from one of SEQ ID NOs: 1-154.
[0147] Further provided herein is a polynucleic acid molecule for modulating expression of the lipoprotein(a) (Lp(a)) gene, the polynucleic acid molecule comprising an antisense strand comprising the nucleotide sequence of usAfsgaugAfccaaGfcUfuGfgcaggsusc (SEQ ID NO: 158) and a sense strand comprising the nucleotide sequence of cscsugccAfaGfcUfuggucaucua (SEQ ID NO: 466), wherein "A" refers to adenosine-3'-phosphate, "a" refers to 2'-O-methyladenosine-3'-phosphate, "Af" refers to 2'-fluoroadenosine-3'-phosphate, "C" refers to cytidine-3'-phosphate, and "c" refers to 2'-O-methylcytidine-3'-phosphate. "Cf" refers to 2'-fluorocytidine-3'-phosphate, "G" refers to guanosine-3'-phosphate, "g" refers to 2'-O-methylguanosine-3'-phosphate, "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "U" refers to uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate, "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate, and "s" refers to 3'-phosphorothioate.
[0148] Further provided herein is a polynucleic acid molecule for modulating expression of the lipoprotein(a) (Lp(a)) gene, the polynucleic acid molecule comprising an antisense strand comprising the nucleotide sequence of usAfsuagaUfgaccAfaGfcUfuggcasgsg (SEQ ID NO: 159) and a sense strand comprising the nucleotide sequence of usgsccaaGfcUfuGfgucaucuaua (SEQ ID NO: 467), wherein "A" refers to adenosine-3'-phosphate, "a" refers to 2'-O-methyladenosine-3'-phosphate, "Af" refers to 2'-fluoroadenosine-3'-phosphate, "C" refers to cytidine-3'-phosphate, and "c" refers to 2'-O-methylcytidine-3'-phosphate. "Cf" refers to 2'-fluorocytidine-3'-phosphate, "G" refers to guanosine-3'-phosphate, "g" refers to 2'-O-methylguanosine-3'-phosphate, "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "U" refers to uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate, "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate, and "s" refers to 3'-phosphorothioate.
[0149] Further provided herein is a polynucleic acid molecule for modulating expression of the lipoprotein(a) (Lp(a)) gene, the polynucleic acid molecule comprising an antisense strand comprising the nucleotide sequence of usCfsauagAfugacCfaAfgCfuuggcsasg (SEQ ID NO: 160) and a sense strand comprising the nucleotide sequence of gscscaagCfuUfgGfucaucuauga (SEQ ID NO: 468), wherein "A" refers to adenosine-3'-phosphate, "a" refers to 2'-O-methyladenosine-3'-phosphate, "Af" refers to 2'-fluoroadenosine-3'-phosphate, "C" refers to cytidine-3'-phosphate, and "c" refers to 2'-O-methylcytidine-3'-phosphate. "Cf" refers to 2'-fluorocytidine-3'-phosphate, "G" refers to guanosine-3'-phosphate, "g" refers to 2'-O-methylguanosine-3'-phosphate, "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "U" refers to uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate, "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate, and "s" refers to 3'-phosphorothioate.
[0150] Further provided herein is a polynucleic acid molecule for modulating expression of the lipoprotein(a) (Lp(a)) gene, the polynucleic acid molecule comprising an antisense strand comprising the nucleotide sequence of usCfsgacgGfcaguCfcCfuUfcugcgsusc (SEQ ID NO: 165), and a sense strand comprising the nucleotide sequence of csgscagaAfgGfgAfcugccgucga (SEQ ID NO: 473), wherein "A" refers to adenosine-3'-phosphate, "a" refers to 2'-O-methyladenosine-3'-phosphate, "Af" refers to 2'-fluoroadenosine-3'-phosphate, "C" refers to cytidine-3'-phosphate, and "c" refers to 2'-O-methylcytidine-3'-phosphate. "Cf" refers to 2'-fluorocytidine-3'-phosphate, "G" refers to guanosine-3'-phosphate, "g" refers to 2'-O-methylguanosine-3'-phosphate, "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "U" refers to uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate, "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate, and "s" refers to 3'-phosphorothioate.
[0151] Further provided herein is a polynucleic acid molecule for modulating expression of the lipoprotein(a) (Lp(a)) gene, the polynucleic acid molecule comprising an antisense strand comprising the nucleotide sequence of usUfscuagGfcuugGfaAfcCfggggusasa (SEQ ID NO: 172) and a sense strand comprising the nucleotide sequence of ascscccgGfuUfcCfaagccuagaa (SEQ ID NO: 480), wherein "A" refers to adenosine-3'-phosphate, "a" refers to 2'-O-methyladenosine-3'-phosphate, "Af" refers to 2'-fluoroadenosine-3'-phosphate, "C" refers to cytidine-3'-phosphate, and "c" refers to 2'-O-methylcytidine-3'-phosphate. "Cf" refers to 2'-fluorocytidine-3'-phosphate, "G" refers to guanosine-3'-phosphate, "g" refers to 2'-O-methylguanosine-3'-phosphate, "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "U" refers to uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate, "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate, and "s" refers to 3'-phosphorothioate.
[0152] Further provided herein is a polynucleic acid molecule for modulating expression of the lipoprotein(a) (Lp(a)) gene, the polynucleic acid molecule comprising an antisense strand comprising the nucleotide sequence of usAfsgccuCfuaggCfuUfgGfaaccgsgsg (SEQ ID NO: 175) and a sense strand comprising the nucleotide sequence of csgsguucCfaAfgCfcuagaggcua (SEQ ID NO: 483), wherein "A" refers to adenosine-3'-phosphate, "a" refers to 2'-O-methyladenosine-3'-phosphate, "Af" refers to 2'-fluoroadenosine-3'-phosphate, "C" refers to cytidine-3'-phosphate, and "c" refers to 2'-O-methylcytidine-3'-phosphate. "Cf" refers to 2'-fluorocytidine-3'-phosphate, "G" refers to guanosine-3'-phosphate, "g" refers to 2'-O-methylguanosine-3'-phosphate, "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "U" refers to uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate, "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate, and "s" refers to 3'-phosphorothioate.
[0153] Further provided herein is a polynucleic acid molecule for regulating expression of the lipoprotein(a) (Lp(a)) gene, the polynucleic acid molecule comprising an antisense strand comprising the nucleotide sequence of usUfsuaccGfugguAfgCfaCfuccugscsa (SEQ ID NO: 198) and a sense strand comprising the nucleotide sequence of csasggagUfgCfuAfccacgguaaa (SEQ ID NO: 506), wherein "A" refers to adenosine-3'-phosphate, "a" refers to 2'-O-methyladenosine-3'-phosphate, "Af" refers to 2'-fluoroadenosine-3'-phosphate, "C" refers to cytidine-3'-phosphate, and "c" refers to 2'-O-methylcytidine-3'-phosphate. "Cf" refers to 2'-fluorocytidine-3'-phosphate, "G" refers to guanosine-3'-phosphate, "g" refers to 2'-O-methylguanosine-3'-phosphate, "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "U" refers to uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate, "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate, and "s" refers to 3'-phosphorothioate.
[0154] Further provided herein is a polynucleic acid molecule for modulating expression of the lipoprotein(a) (Lp(a)) gene, the polynucleic acid molecule comprising an antisense strand comprising the nucleotide sequence of usUfsguccAfuuacCfgUfgGfuagcascsu (SEQ ID NO: 201), and a sense strand comprising the nucleotide sequence of usgscuacCfaCfgGfuaauggacaa (SEQ ID NO: 509), wherein "A" refers to adenosine-3'-phosphate, "a" refers to 2'-O-methyladenosine-3'-phosphate, "Af" refers to 2'-fluoroadenosine-3'-phosphate, "C" refers to cytidine-3'-phosphate, and "c" refers to 2'-O-methylcytidine-3'-phosphate. "Cf" refers to 2'-fluorocytidine-3'-phosphate, "G" refers to guanosine-3'-phosphate, "g" refers to 2'-O-methylguanosine-3'-phosphate, "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "U" refers to uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate, "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate, and "s" refers to 3'-phosphorothioate.
[0155] Further provided herein is a polynucleic acid molecule for modulating expression of the lipoprotein(a) (Lp(a)) gene, the polynucleic acid molecule comprising an antisense strand comprising the nucleotide sequence of usCfsucugUfccauUfaCfcGfugguasgsc (SEQ ID NO: 203) and a sense strand comprising the nucleotide sequence of usasccacGfgUfaAfuggacagaga (SEQ ID NO: 511), wherein "A" refers to adenosine-3'-phosphate, "a" refers to 2'-O-methyladenosine-3'-phosphate, "Af" refers to 2'-fluoroadenosine-3'-phosphate, "C" refers to cytidine-3'-phosphate, and "c" refers to 2'-O-methylcytidine-3'-phosphate. "Cf" refers to 2'-fluorocytidine-3'-phosphate, "G" refers to guanosine-3'-phosphate, "g" refers to 2'-O-methylguanosine-3'-phosphate, "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "U" refers to uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate, "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate, and "s" refers to 3'-phosphorothioate.
[0156] Further provided herein is a polynucleic acid molecule for modulating expression of the lipoprotein(a) (Lp(a)) gene, the polynucleic acid molecule comprising an antisense strand comprising the nucleotide sequence of usAfsuuguGfucagGfuUfgCfaguacsusc (SEQ ID NO: 214) and a sense strand comprising the nucleotide sequence of gsusacugCfaAfcCfugacacaaua (SEQ ID NO: 522), wherein "A" refers to adenosine-3'-phosphate, "a" refers to 2'-O-methyladenosine-3'-phosphate, "Af" refers to 2'-fluoroadenosine-3'-phosphate, "C" refers to cytidine-3'-phosphate, and "c" refers to 2'-O-methylcytidine-3'-phosphate. "Cf" refers to 2'-fluorocytidine-3'-phosphate, "G" refers to guanosine-3'-phosphate, "g" refers to 2'-O-methylguanosine-3'-phosphate, "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "U" refers to uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate, "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate, and "s" refers to 3'-phosphorothioate.
[0157] Further provided herein is a polynucleic acid molecule for regulating expression of the lipoprotein(a) (Lp(a)) gene, the polynucleic acid molecule comprising an antisense strand comprising the nucleotide sequence of usUfsgcguCfugagCfaUfuGfugucasgsg (SEQ ID NO: 218) and a sense strand comprising the nucleotide sequence of usgsacacAfaUfgCfucagacgcaa (SEQ ID NO: 526), wherein "A" refers to adenosine-3'-phosphate, "a" refers to 2'-O-methyladenosine-3'-phosphate, "Af" refers to 2'-fluoroadenosine-3'-phosphate, "C" refers to cytidine-3'-phosphate, and "c" refers to 2'-O-methylcytidine-3'-phosphate. "Cf" refers to 2'-fluorocytidine-3'-phosphate, "G" refers to guanosine-3'-phosphate, "g" refers to 2'-O-methylguanosine-3'-phosphate, "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "U" refers to uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate, "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate, and "s" refers to 3'-phosphorothioate.
[0158] Further provided herein is a polynucleic acid molecule for modulating expression of the lipoprotein(a) (Lp(a)) gene, the polynucleic acid molecule comprising an antisense strand comprising the nucleotide sequence of usUfsaacuCfugucCfaUfaAfugguasgsu (SEQ ID NO: 242) and a sense strand comprising the nucleotide sequence of usasccauUfaUfgGfacagaguuaa (SEQ ID NO: 550), wherein "A" refers to adenosine-3'-phosphate, "a" refers to 2'-O-methyladenosine-3'-phosphate, "Af" refers to 2'-fluoroadenosine-3'-phosphate, "C" refers to cytidine-3'-phosphate, and "c" refers to 2'-O-methylcytidine-3'-phosphate. "Cf" refers to 2'-fluorocytidine-3'-phosphate, "G" refers to guanosine-3'-phosphate, "g" refers to 2'-O-methylguanosine-3'-phosphate, "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "U" refers to uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate, "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate, and "s" refers to 3'-phosphorothioate.
[0159] Further provided herein is a polynucleic acid molecule for modulating expression of the lipoprotein(a) (Lp(a)) gene, the polynucleic acid molecule comprising an antisense strand comprising the nucleotide sequence usCfscaagCfuuggCfaAfgUfucuucscsu (SEQ ID NO: 243) and a sense strand comprising the nucleotide sequence gsasagaaCfuUfgCfcaagcuugga (SEQ ID NO: 551), wherein "A" refers to adenosine-3'-phosphate, "a" refers to 2'-O-methyladenosine-3'-phosphate, "Af" refers to 2'-fluoroadenosine-3'-phosphate, "C" refers to cytidine-3'-phosphate, and "c" refers to 2'-O-methylcytidine-3'-phosphate. "Cf" refers to 2'-fluorocytidine-3'-phosphate, "G" refers to guanosine-3'-phosphate, "g" refers to 2'-O-methylguanosine-3'-phosphate, "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "U" refers to uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate, "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate, and "s" refers to 3'-phosphorothioate.
[0160] Further provided herein is a polynucleic acid molecule for modulating expression of the lipoprotein(a) (Lp(a)) gene, the polynucleic acid molecule comprising an antisense strand comprising the nucleotide sequence of usAfsgaugAfccaaGfcUfuGfgcaagsusu (SEQ ID NO: 244) and a sense strand comprising the nucleotide sequence of csusugccAfaGfcUfuggucaucua (SEQ ID NO: 552), wherein "A" refers to adenosine-3'-phosphate, "a" refers to 2'-O-methyladenosine-3'-phosphate, "Af" refers to 2'-fluoroadenosine-3'-phosphate, "C" refers to cytidine-3'-phosphate, and "c" refers to 2'-O-methylcytidine-3'-phosphate. "Cf" refers to 2'-fluorocytidine-3'-phosphate, "G" refers to guanosine-3'-phosphate, "g" refers to 2'-O-methylguanosine-3'-phosphate, "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "U" refers to uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate, "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate, and "s" refers to 3'-phosphorothioate.
[0161] Further provided herein is a polynucleic acid molecule for modulating expression of the lipoprotein(a) (Lp(a)) gene, the polynucleic acid molecule comprising an antisense strand comprising the nucleotide sequence of usGfsguccGfacuaUfgCfuGfgugugsgsu (SEQ ID NO: 252) and a sense strand comprising the nucleotide sequence of csascaccAfgCfaUfagucggacca (SEQ ID NO: 560), wherein "A" refers to adenosine-3'-phosphate, "a" refers to 2'-O-methyladenosine-3'-phosphate, "Af" refers to 2'-fluoroadenosine-3'-phosphate, "C" refers to cytidine-3'-phosphate, and "c" refers to 2'-O-methylcytidine-3'-phosphate. "Cf" refers to 2'-fluorocytidine-3'-phosphate, "G" refers to guanosine-3'-phosphate, "g" refers to 2'-O-methylguanosine-3'-phosphate, "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "U" refers to uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate, "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate, and "s" refers to 3'-phosphorothioate.
[0162] Further provided herein is a polynucleic acid molecule for modulating expression of the lipoprotein(a) (Lp(a)) gene, the polynucleic acid molecule comprising an antisense strand comprising the nucleotide sequence of usAfsgccuCfuaggCfuUfgGfaaccgsgsg (SEQ ID NO: 175) and a sense strand comprising the nucleotide sequence of csgsguucCfaAfgCfcuagaggcua (SEQ ID NO: 483), wherein "A" refers to adenosine-3'-phosphate, "a" refers to 2'-O-methyladenosine-3'-phosphate, "Af" refers to 2'-fluoroadenosine-3'-phosphate, "C" refers to cytidine-3'-phosphate, and "c" refers to 2'-O-methylcytidine-3'-phosphate. "Cf" refers to 2'-fluorocytidine-3'-phosphate, "G" refers to guanosine-3'-phosphate, "g" refers to 2'-O-methylguanosine-3'-phosphate, "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "U" refers to uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate, "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate, and "s" refers to 3'-phosphorothioate.
[0163] Further provided herein is a polynucleic acid molecule for modulating expression of the lipoprotein(a) (Lp(a)) gene, the polynucleic acid molecule comprising an antisense strand comprising the nucleotide sequence of usAfsuuguGfucagGfuUfgCfaguacsusc (SEQ ID NO: 214) and a sense strand comprising the nucleotide sequence of gsusacugCfaAfcCfugacacaaua (SEQ ID NO: 522), wherein "A" refers to adenosine-3'-phosphate, "a" refers to 2'-O-methyladenosine-3'-phosphate, "Af" refers to 2'-fluoroadenosine-3'-phosphate, "C" refers to cytidine-3'-phosphate, and "c" refers to 2'-O-methylcytidine-3'-phosphate. "Cf" refers to 2'-fluorocytidine-3'-phosphate, "G" refers to guanosine-3'-phosphate, "g" refers to 2'-O-methylguanosine-3'-phosphate, "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "U" refers to uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate, "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate, and "s" refers to 3'-phosphorothioate.
[0164] [Table 2-1]
[0165] [Table 2-2]
[0166] [Table 2-3]
[0167] [Table 2-4]
[0168] [Table 2-5]
[0169] [Table 2-6]
[0170] [Table 2-7]
[0171] [Table 2-8]
[0172] Conjugation targeting part In certain embodiments, the polynucleotide molecules described herein are linked or conjugated with one or more targeting moieties to form polynucleotide-targeting moiety conjugate molecules. In some examples, the targeting moiety is selected based on its ability to selectively or preferentially target the conjugate molecules described herein to a desired cell population, tissue, or organ. In some examples, the targeting moiety targets cells, tissues, or organs that express the targeting moiety's corresponding binding partner (e.g., either the corresponding receptor or ligand). For example, the polynucleotide molecules described herein can be targeted to hepatocytes expressing asialoglycoprotein (ASGP-R) by selecting a targeting moiety containing N-acetylgalactosamine (GalNAc) as the targeting moiety. Any suitable GalNAc molecule known in the art to be used as a targeting moiety is contemplated. An exemplary GalNAc molecule includes a triantennary GalNAc (e.g., L96). Another example of a targeting moiety is galactose. The targeting moiety can also be a lipid, peptide, or small molecule.
[0173] A targeting moiety (i.e., an intracellular targeting moiety) that targets a desired site within a cell (e.g., the endoplasmic reticulum, Golgi apparatus, nucleus, or mitochondria) may be included in the hybridized polynucleotide constructs disclosed herein. Non-limiting examples of intracellular targeting moieties are provided in WO 2015 / 069932 and WO 2015 / 188197, and the disclosures of intracellular targeting moieties in WO 2015 / 069932 and WO 2015 / 188197 are incorporated herein by reference.
[0174] Therefore, the polynucleotide molecules described herein can contain one or more targeting moieties selected from the group consisting of intracellular targeting moieties, extracellular targeting moieties, and combinations thereof.Therefore, one or more targeting moieties (e.g., extracellular targeting moieties comprising targeting moieties independently selected from the group consisting of folate, mannose, N-acetylgalactosamine, and prostate-specific membrane antigen) and one or more intracellular targeting moieties (e.g., moieties targeting the endoplasmic reticulum, Golgi apparatus, nucleus, or mitochondria) can be included in the polynucleotide molecules described herein to facilitate the delivery of polynucleotides to specific sites in specific cell populations.In some embodiments, the targeting moiety contains one or more mannose hydrocarbons.Mannose targets the mannose receptor, which is a 175KDa cell membrane-associated receptor expressed on sinusoidal hepatocytes and antigen-presenting cells (e.g., macrophages and dendritic cells). It is a highly efficient endocytic / circulating receptor that binds and internalizes mannosylated pathogens and proteins (Lennartz et al., J. Biol. Chem. 262:9942-9944, 1987; Taylor et al., J. Biol. Chem. 265:12156-62, 1990).
[0175] Some targeting moieties are described herein. In some embodiments, the targeting moiety is selected from the group consisting of insulin, insulin-like growth factor receptor 1 (IGF1R), IGF2R, insulin-like growth factor (IGF, e.g., IGF1 or 2), mesenchymal epithelial transition factor receptor (c-met, also known as hepatocyte growth factor receptor (HGFR)), hepatocyte growth factor (HGF), epidermal growth factor receptor (EGFR), epidermal growth factor (EGF), heregulin, fibroblast growth factor receptor (FGFR), platelet-derived growth factor receptor (PDGFR), platelet-derived growth factor (PDGF), vascular endothelial growth factor (VEGF), and VEGF receptors. Factor receptor (VEGFR), vascular endothelial growth factor (VEGF), tumor necrosis factor receptor (TNFR), tumor necrosis factor alpha (TNF-α), TNF-β, folate receptor (FOLR), folate, transferrin, transferrin receptor (TfR), mesothelin, Fc receptor, c-kit receptor, c-kit, integrin (e.g., α4 integrin or β-1 integrin), P-selectin, sphingosine-1-phosphate receptor-1 (S1PR), hyaluronate receptor, leukocyte function antigen-1 (LFA) -1), CD4, CD11, CD18, CD20, CD25, CD27, CD52, CD70, CD80, CD85, CD95 (Fas receptor), CD106 (vascular cell adhesion molecule-1 (VCAM1), CD166 (activated leukocyte cell adhesion molecule (ALCAM)), CD178 (Fas ligand), CD253 (TNF-related apoptosis-inducing ligand (TRAIL)), ICOS ligand, CCR2, CXCR3, CCR5, CXCL12 (stromal cell-derived factor 1 (SDF-1)), interleukin 1 (IL-1), The antibody contains or specifically binds to a protein selected from the group including IL-1ra, IL-2, IL-3, IL-4, IL-6, IL-7, IL-8, CTLA-4, MART-1, gp100, MAGE-1, ephrin (Eph) receptor, mucosal addressin cell adhesion molecule-1 (MAdCAM-1), carcinoembryonic antigen (CEA), LewisY, MUC-1 epithelial cell adhesion molecule (EpCAM), cancer antigen 125 (CA125), prostate-specific membrane antigen (PSMA), TAG-72 antigen, and fragments thereof.In further embodiments, the targeting moiety contains an erythroblastic leukemia viral oncogene homolog (ErbB) receptor (e.g., ErbB1 receptor, ErbB2 receptor, ErbB3 receptor, and ErbB4 receptor). In some embodiments, the targeting moiety contains one or more (e.g., 1-6) N-acetylgalactosamine (GalNAc). In some embodiments, the targeting moiety contains one or more (e.g., 1-6) galactose. In some embodiments, the targeting moiety contains one or more (e.g., 1-6) mannose. In other embodiments, the targeting moiety contains a folate ligand. The folate ligand is:
[0176] [ka] Specific targeting moieties may include bombesin, gastrin, gastrin-releasing peptide, transforming growth factor (TGF) (e.g., TGF-α or TGF-β), or vaccinia virus growth factor (VVGF). Non-peptidyl targeting moieties may also be used for the targeting moiety, including, for example, steroids, carbohydrates, vitamins, and lectins. Some targeting moieties may include polypeptides, such as somatostatin or somatostatin analogs (e.g., octreotide or lanreotide), bombesin, or antibodies or antigen-binding fragments thereof. The antibodies may be of any recognized class or subclass, e.g., IgG, IgA, IgM, IgD, IgE. Typical are antibodies within the IgG class. The antibodies may be derived from any species according to techniques known in the art. However, typically, the antibodies are of human, murine, or rabbit origin. Furthermore, antibodies may be polyclonal or monoclonal, but are typically monoclonal. Human or chimeric (e.g., humanized) antibodies may be used as targeting moieties. The targeting moiety may comprise an antigen-binding fragment of an antibody. Such antibody fragments may include, for example, Fab', F(ab')2, Fv, Fab fragments, single-domain antibodies, ScFv, or other antigen-binding fragments. Fc fragments may also be used as targeting moieties. Such antibody fragments can be prepared, for example, by proteolytic enzyme digestion, e.g., pepsin or papain digestion, reductive alkylation, or recombinant techniques. Materials and methods for preparing antibody fragments are well known to those skilled in the art. See, for example, Parham, J. Immunology, 131:2895, 1983; Lamoyi et al., J. Immunological Methods, 56:235, 1983.
[0177] Other peptides that may be used as targeting aid moieties in the polynucleotide molecules described herein include KiSS peptides and analogs, urotensin II peptides and analogs, GnRH I and II peptides and analogs, depreotide, vapreotide, vasoactive intestinal peptide (VIP), cholecystokinin (CCK), RGD-containing peptides, melanocyte-stimulating hormone (MSH) peptides, neurotensin, calcitonin, glutathione, YIGSR (platelet factor 4 (PF-4)), and leukocyte-binding peptide (leukocyte-avid peptide) containing a heparin-binding domain of a lysine-rich sequence. peptides, e.g., P483H), atrial natriuretic peptide (ANP), β-amyloid peptide, δ-opioid antagonists (such as ITIPP(psi)), annexin-V, endothelin, leukotriene B4 (LTB4), chemotactic peptides (e.g., N-formyl-methionyl-leucyl-phenylalanine-lysine (fMLFK)), GP IIb / IIIa receptor antagonists (e.g., DMP444), human neutrophil elastase inhibitors (EPI-HNE-2 and EPI-HNE-4), plasmin inhibitors, antimicrobial peptides, apticides (P280 and P274), thrombospondin receptors (including analogs such as TP-1300), bitistatin, pituitary adenylyl cyclase type I receptor (PAC1), fibrin α-chain, peptides derived from a phage display library, and conservative substitutions thereof.
[0178] One or more (e.g., 1 to 6) targeting moieties can be attached to MOIETY or X2 in formula (V', V'', V''', V'''', V''''', V'''''') by -LinkA-.
[0179] In some embodiments, the targeting moiety comprises one or more (e.g., 1-6 or 1-3) asialoglycoprotein receptor ligands (e.g., GalNAc). In some embodiments, the asialoglycoprotein receptor ligands (e.g., GalNAc) are linked to -LinkA- via the anomeric carbon (e.g., the anomeric carbon is the carbon atom in an acetal or hemiaminal). An asialoglycoprotein receptor ligand (e.g., GalNAc) linked to a linker via a hemiaminal can produce a hybridized polynucleotide construct with superior gene silencing efficacy compared to a hybridized polynucleotide construct having an asialoglycoprotein receptor ligand (e.g., GalNAc) linked to a linker via an acetal.
[0180] In some embodiments, the linker and three asialoglycoprotein receptor targeting moieties, each comprising GalNAc, are as shown in formula (V). In some examples, the conjugates described herein include only one asialoglycoprotein receptor targeting moiety, and thus the conjugates include the structure of formula (V) with any two of the targeting moieties removed. In some examples, the conjugates described herein include only two asialoglycoprotein receptor targeting moieties, and thus the conjugates described herein include the structure of formula (V) with any one of the targeting moieties removed.
[0181] [ka] (One of Y1 and Y2 is a nucleotide, or both Y1 and Y2 are nucleotides, and Y1 and Y2 are consecutive or adjacent nucleotides from a polynucleic acid molecule described herein).
[0182] In some embodiments, the linkers and targeting moieties described herein are conjugated to the 3'-end of the sense strand (e.g., as shown in formula (V', V'''', V''''', V''''''). In some embodiments, the linkers and targeting moieties described herein are conjugated to the 5'-end of the sense strand (e.g., as shown in formula (V'') or (V'''). In some embodiments, the linkers and targeting moieties described herein are conjugated to the 3'-end of the antisense strand (e.g., as shown in formula (V'), (V'''', (V''''', (V''''''). In some embodiments, the linkers and targeting moieties described herein are conjugated to the 5'-end of the antisense strand (e.g., as shown in formula (V'') or (V''').
[0183] [ka] wherein Z in formula (V') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V') is adenine, uracil, guanine, cytosine, thymine, an abasic moiety, or other;
[0184] [ka] (Z in formula (V'') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V'') is adenine, uracil, guanine, cytosine, thymine, an abasic moiety, or the like.)
[0185] [ka] (Z in formula (V''') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V''') is adenine, uracil, guanine, cytosine, thymine, an abasic moiety, or other.)
[0186] [ka] (Z in formula (V'''') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V'''') is adenine, uracil, guanine, cytosine, thymine, an abasic moiety, or other.)
[0187] [ka] (Z in formula (V''''') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V''''') is adenine, uracil, guanine, cytosine, thymine, an abasic moiety, or other.)
[0188] [ka] (Z in formula (V'''''') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V'''''') is adenine, uracil, guanine, cytosine, thymine, an abasic moiety, or other.)
[0189] In some examples, the 3' end of the passenger / sense strand of Table 1, Table 2, or Table 5 is conjugated with X2-GalNAc (see formula (V), (V'), (V''"), (V'''"), (V''''")). In some examples, the 5' end of the passenger / sense strand of Table 1, Table 2, or Table 5 is conjugated with X2-GalNAc (see formula (V), (V''), or (V''')). In some examples, a nucleic acid within (not at the 5' or 3' end of) the passenger / sense strand of Table 1, Table 2, or Table 5 is conjugated with X2-GalNAc (see formula (V)). In some examples, the 3' end of the guide / antisense strand of Table 1, Table 2, or Table 5 is conjugated with X2-GalNAc (see formula (V), (V'), (V'''), (V''''), (V''''')). In some examples, the 5' end of the guide / antisense strand of Table 1, Table 2, or Table 5 is conjugated with X2-GalNAc (see formula (V), (V''), or (V''')). In some examples, a nucleic acid within (not at the 5' or 3' end of) the guide / antisense strand of Table 1, Table 2, or Table 5 is conjugated with X2-GalNAc (see formula (V)).
[0190] In some examples, one or more endosomal escape moieties (e.g., 1-6 or 1-3) can be attached as auxiliary moieties to the polynucleotide constructs or hybridized polynucleotide constructs disclosed herein. Exemplary endosomal escape moieties include chemotherapeutic drugs (e.g., quinolones such as chloroquine), fusogenic lipids (e.g., dioleoylphosphatidyl-ethanolamine (DOPE)), and polymers such as polyethyleneimine (PEI), poly(β-amino esters), polypeptides such as polyarginine (e.g., octaarginine) and polylysine (e.g., octalysine), proton sponges described herein, viral capsids, and peptide transduction domains. For example, lytic peptides can be derived from the influenza A virus M2 protein, peptide analogs of influenza virus hemagglutinin, influenza C virus HEF protein, filovirus transmembrane glycoproteins, rabies virus transmembrane glycoproteins, vesicular stomatitis virus transmembrane glycoprotein (G), Sendai virus fusion protein, Semliki Forest virus transmembrane glycoprotein, human respiratory syncytial virus (RSV) fusion protein, measles virus fusion protein, Newcastle disease virus fusion protein, Visna virus fusion protein, murine leukemia virus fusion protein, HTL virus fusion protein, and simian immunodeficiency virus (SIV) fusion protein. Other moieties that can be used to promote endosomal escape are described in Dominska et al., Journal of Cell Science, 123(8):1183-1189, 2010. Specific examples of endosomal escape moieties, including moieties suitable for conjugation to the hybridized polynucleotides disclosed herein, are provided, for example, in WO 2015 / 188197, the disclosure of which is incorporated herein by reference.
[0191] One or more endosomal escape moieties (e.g., 1-6 or 1-3) can be attached to MOIETY or X2 in formula (V', V'', V''', V'''', V''''', or V'''''') by -LinkA-, as described herein.
[0192] One or more cell-penetrating peptides (CPPs) (e.g., 1-6 or 1-3) can be attached as auxiliary moieties to the polynucleotide constructs or hybridized polynucleotide constructs disclosed herein. The CPPs, as disclosed herein, can be bioreversibly attached to the hybridized polynucleotides via disulfide bonds. Thus, upon delivery to a cell, the CPPs can be cleaved intracellularly by, for example, an intracellular enzyme (e.g., protein disulfide isomerase, thioredoxin, or thioesterase), thereby releasing the polynucleotide.
[0193] CPPs are known in the art (e.g., TAT or Arg8) (Snyder and Dowdy, 2005, Expert Opin. Drug Deliv. 2, pp. 43-51). Specific examples of CPPs containing moieties suitable for conjugation to the hybridized polynucleotides disclosed herein are provided, for example, in WO 2015 / 188197, the disclosures of which are incorporated herein by reference.
[0194] CPPs are positively charged peptides that can facilitate the delivery of biological cargo to cells. The cationic charge of CPPs is thought to be essential for their function. Furthermore, transduction of these proteins is not thought to be affected by cell type; they can efficiently transduce nearly all cells in culture without apparent toxicity (Nagahara et al., Nat. Med. 4:1449-52, 1998). In addition to full-length proteins, CPPs have also been shown to transduce DNA (Abu-Amer, as mentioned above), antisense polynucleotides (Astriab-Fisher et al., Pharm. Res. 19:744-54, 2002), small molecules (Polyakov et al., Bioconjug. Chem. 11:762-71, 2000), and even inorganic 40 nm iron particles (Dodd et al., J. Immunol. Methods 1998). 256:89-105, 2001; Wunderbaldinger et al., Bioconjug. Chem. 13:264-8, 2002; Lewin et al., Nat. Biotechnol. 18:410-4, 2000; Josephson et al., Bioconjug. Chem. 10:186-91, 1999), and there is considerable flexibility in particle size in this process.
[0195] In one example, the CPP useful in the methods and compositions described herein comprises a peptide characterized by an intrinsic alpha helicity. It has been discovered that transfection is optimized when the CPP exhibits substantial alpha helicity. In another example, the CPP comprises a sequence containing basic amino acid residues substantially aligned along at least one face of the peptide. The CPP described herein may be a naturally occurring peptide or a synthetic peptide.
[0196] One or more cell penetrating peptides (eg, 1-6 or 1-3) can be linked to MOIETY or X2 in formula (I) by -LinkA-, as described herein.
[0197] The polynucleotide constructs and hybridized polynucleotide constructs disclosed herein can also include covalently attached neutral polymeric auxiliary moieties. The neutral polymer can be poly(C 1-6 alkylene oxides), such as poly(ethylene glycol) and poly(propylene glycol), and copolymers thereof, such as di- and triblock copolymers. Examples of other polymers include esterified poly(acrylic acid), esterified poly(glutamic acid), esterified poly(aspartic acid), poly(vinyl alcohol), poly(ethylene-co-vinyl alcohol), poly(N-vinylpyrrolidone), poly(ethyloxazoline), poly(alkyl acrylate), poly(acrylamide), poly(N-alkylacrylamide), poly(N-acryloylmorpholine), poly(lactic acid), poly(glycolic acid), poly(dioxane), poly(caprolactone), styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolide) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyurethane, N-isopropylacrylamide polymer, and poly(N,N-dialkylacrylamide). Exemplary polymeric auxiliary moieties can have molecular weights of less than 100, 300, 500, 1000, or 5000 Da (e.g., greater than 100 Da). Other polymers are known in the art.
[0198] One or more polymers (e.g., 1-6 or 1-3) can be attached to MOIETY or X2 in formula (V', V'', V''', V'''', V''''', or V'''''') by -LinkA-, as described herein.
[0199] Conjugation Linker In some aspects, the polynucleic acid molecules described herein have the formula (I):
[0200] [ka] or a salt thereof, or a stereoisomer thereof, X 1 are each independently O or S, X 2 are each independently O, S, NH, or a bond; MOIETY is an optionally substituted C 2-10 Alkane-tetrayl or group -M 1 -M 2 -M 3 - and each M 1 and each M 3 is independently absent or optionally substituted C 1-6 alkylene, and M 2 is an optionally substituted C 3-9 Heterocycle-tetrayl, optionally substituted C 6-10 arene-tetrayl, or optionally substituted C 3-8 is a cycloalkane-tetrayl; Each R 1 and each R 2 are independently H, optionally substituted C 1-16 Alkyl, optionally substituted C 2-16 Heteroalkyl, conjugation moiety, or -LinkA(-T) p but at least one R 1 or at least one R 2 is the conjugation moiety or -LinkA(-T) p It is assumed that R 3 are each independently H, optionally substituted C 1-16 Alkyl, optionally substituted C 2-16 Heteroalkyl, optionally substituted C 2-16 Alkenyl, optionally substituted C 2-16 Alkynyl, optionally substituted (C 1-9 Heterocyclyl)-C 1-6 -alkyl, optionally substituted (C 6-10 Aryl)-C 1-6-alkyl, optionally substituted (C 3-8 Cycloalkyl)-C 1-6 -Alkyl, conjugation moiety, or -LinkA(-T) p and R 4 is H, optionally substituted C 1-6 Alkyl, -LinkA(-T) p , or -Sol, LinkA are each independently a polyvalent linker (e.g., comprising —C(O)—N(H)— (e.g., at least one polyvalent linker comprising —C(O)—N(H)— attached to T)); T are each independently an auxiliary moiety; Sol is a solid support, m is an integer from 1 to 6; n is independently 0 or 1, p's are each independently an integer of 1 to 6, q is an integer of 0 to 3. At least one group of formula (I) can be attached to the 5'-terminus, 3'-terminus, internucleoside phosphate, internucleoside phosphorothioate, or internucleoside phosphorodithioate of the polynucleotide. At least one group of formula (I) is attached to the internucleoside phosphate, internucleoside phosphorothioate, or internucleoside phosphorodithioate, and q is 0. The polynucleotide construct contains no more than one Sol.
[0201] The group -LinkA- is selected from 0 to 3 polyvalent monomers (e.g., optionally substituted C 1-6 Alkane-triyl and optionally substituted C 1-6 alkane-tetrayl, or trivalent nitrogen atom), and one or more divalent monomers (e.g., 1-40), where each divalent monomer is independently an optionally substituted C 1-6 Alkylene; optionally substituted C 2-6 Alkenylene; optionally substituted C 2-6 Alkynylene; optionally substituted C3-8 Cycloalkylene; optionally substituted C 3-8 Cycloalkenylene; optionally substituted C 6-14 arylene; optionally substituted C having 1 to 4 heteroatoms selected from N, O, and S; 1-9 Heteroarylene; optionally substituted C having 1 to 4 heteroatoms selected from N, O, and S 1-9 In some embodiments, the monomers are each independently an optionally substituted C 1-6 Alkylene; optionally substituted C 3-8 Cycloalkylene; optionally substituted C 3-8 Cycloalkenylene; optionally substituted C 6-14 arylene; optionally substituted C having 1 to 4 heteroatoms selected from N, O, and S; 1-9 Heteroarylene; optionally substituted C having 1 to 4 heteroatoms selected from N, O, and S 1-9 heterocyclylene; imino; optionally substituted N; O; or S(O)m, where m is 0, 1, or 2 (e.g., m is 2). In certain embodiments, the monomers are each independently an optionally substituted C 1-6 Alkylene; optionally substituted C 3-8 Cycloalkylene; optionally substituted C 3-8 Cycloalkenylene; optionally substituted C 6-14 arylene; optionally substituted C having 1 to 4 heteroatoms selected from N, O, and S; 1-9 Heteroarylene; optionally substituted C having 1 to 4 heteroatoms selected from N, O, and S 1-9or S(O)m, where m is 0, 1, or 2 (e.g., m is 2). The non-bioreversible linker connecting the auxiliary moiety to the conjugate moiety or its reaction product can comprise 2 to 500 (e.g., 2 to 300 or 2 to 200) such monomers. The group -LinkA- can include poly(alkylene oxide) (e.g., polyethylene oxide, polypropylene oxide, poly(trimethylene) oxide), polybutylene oxide, poly(tetramethylene) oxide, and diblock or triblock copolymers thereof. In some embodiments, the non-bioreversible linker comprises polyethylene oxide (e.g., poly(ethylene oxide) having a molecular weight of less than 1 kDa).
[0202] The group -LinkA(-T) of formula (I) p may be prepared by the processes described in the section below. In some examples, -LinkA(-T) p is represented by formula (II) -Q 1 -Q 2 ([-Q 3 -Q 4 -Q 5 ] s -Q 6 -T) p (II) wherein: each s is independently an integer from 0 to 20 (e.g., 0 to 10), and the repeat units are the same or different; Q 1 is a conjugation linker (e.g., [-Q 3 -Q 4 -Q 5 ] s -Q C -, in this case, Q C is optionally replaced by C 2-12 Heteroalkylene (e.g., heteroalkylene containing -C(O)-N(H)-, -N(H)-C(O)-, -S(O)-N(H)-, or -N(H)-S(O)-), optionally substituted C 1-12 Thioheterocyclylenes (e.g.,
[0203] [ka] ), optionally replaced by C 1-12 Heterocyclylene (e.g., 1,2,3-triazole-1,4-diyl or
[0204] [ka] ), cyclobut-3-ene-1,2-dione-3,4-diyl, or pyrid-2-ylhydrazone), Q 2 is a linear group (e.g., [-Q 3 -Q 4 -Q 5 ] s -), or a branched group when p is an integer from 2 to 6 (e.g., [-Q 3 -Q 4 -Q 5 ] s -Q 7 ([-Q 3 -Q 4 -Q 5 ] s -(Q 7 ) p1 ) p2 , p1 is 0 or 1, and p2 is 0, 1, 2, or 3), Each Q 3 and each Q 6 are independently absent, —CO—, —NH—, —O—, —S—, —SO—, —OC(O)—, —COO—, —NHC(O)—, —C(O)NH—, —CH—, —CHNH—, —NHCH—, —CHO—, or —OCH—; Q 4 are each independently absent or optionally substituted C 1-12 Alkylene, optionally substituted C 2-12 Alkenylene, optionally substituted C 2-12 Alkynylene, optionally substituted C 2-12 Heteroalkylene, optionally substituted C 6-10Arylene, optionally substituted C 1-9 heteroarylene, or optionally substituted C 1-9 is heterocyclylene, Q 5 are each independently absent, -CO-, -NH-, -O-, -S-, -SO2-, -CH2-, -C(O)O-, -OC(O)-, -C(O)NH-, -NH-C(O)-, -NH-CH(R a )-C(O)-, or -C(O)-CH(R a )-NH-, Q 7 each independently represents an optionally substituted C 1-6 Alkane-triyl, optionally substituted C 1-6 Alkane-tetrayl, optionally substituted C 2-6 Heteroalkane-triyl or optionally substituted C 2-6 heteroalkane-tetrayl, R a are each independently H or an amino acid side chain, However, Q 3 , Q 4 , and Q 5 It is assumed that at least one of the following exists:
[0205] In some embodiments, Q 4 are each independently absent or optionally substituted C 1-12 Alkylene, optionally substituted C 2-12 Alkenylene, optionally substituted C 2-12 Alkynylene, optionally substituted C 2-12 heteroalkylene, or optionally substituted C 1-9 In certain examples, s is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.
[0206] Thus, in formula (II), LinkA can contain a single branch point when each p1 is 0, or multiple branch points when at least one p1 is 1.
[0207] In formula (II), Q 1 Ha-OQ L -Q C -, wherein Q L is optionally replaced by C 2-12 Heteroalkylene, optionally substituted C 1-12 alkylene, or -(optionally substituted C 1-6 alkylene)-(optionally substituted C 6-10 In some embodiments, Q is L is an optionally substituted C 2-12 Heteroalkylene or optionally substituted C 1-12 In formula (II), Q is an alkylene. C teeth,
[0208] [ka] may be.
[0209] In formula (II), Q 2 is the formula [-Q 3 -Q 4 -Q 5 ] s -, where Q 3 , Q 4 , and Q 5 is as defined in formula (II). Alternatively, Q 2 is a branched group [-Q 3 -Q 4 -Q 5 ] s -Q 7 ([-Q 3 -Q 4 -Q 5 ] s -(Q 7 ) p1 ) p2 wherein Q 7each independently represents an optionally substituted C 1-6 Alkane-triyl, optionally substituted C 1-6 Alkane-tetrayl, optionally substituted C 2-6 Heteroalkane-triyl or optionally substituted C 2-6 heteroalkane-tetrayl, where: p1 is 0 or 1, p2 is 0, 1, 2, or 3; where: when p1 is 0, LinkA is a trivalent or tetravalent linker; When p1 is 1, LinkA is a tetravalent, pentavalent, or hexavalent linker. In certain embodiments, p1 is 0. In some embodiments, Q 7 teeth,
[0210] [ka] is.
[0211] Compounds that can be used to prepare the group -LinkA(-T)p in formula (I) are described herein as well as in WO 2015 / 188197. Non-limiting examples of -LinkA include:
[0212] [ka]
[0213] [ka]
[0214] [ka] In the formula: R 18 is the bond to the MOIETY, R 19are each independently a bond to an auxiliary moiety, m5 each independently represents an integer of 1 to 20; m6 each independently represents an integer of 1 to 10, m7 is an integer from 1 to 6, X 6 are each independently O or S. In formula (II), the conjugation linker has the formula [-Q 3 -Q 4 -Q 5 ] s -Q C -When -Q 2 ([-Q 3 -Q 4 -Q 5 ] s -Q 6 -T) p teeth,
[0215] [ka]
[0216] [ka] wherein R 20 Q 1 Q in C is a bond to R 19 are each independently a bond to an auxiliary moiety, m5 each independently represents an integer of 1 to 20; m6 each independently represents an integer of 1 to 10, m7 is an integer from 1 to 6, X 6 are each independently O or S.
[0217] In some aspects, the linkers described herein are cleavable. In some aspects, the linkers described herein are non-cleavable.
[0218] In some aspects, the polynucleic acid molecules described herein have the formula (IV):
[0219] [ka] wherein at least one of Y1 and Y2 is a nucleotide from a polynucleic acid molecule.
[0220] In some examples, Y1 is the last nucleotide on the 3' end or the first nucleotide on the 5' end of one of the strands of the polynucleic acid molecule. In some examples, Y1 is the last nucleotide on the 3' end or the first nucleotide on the 5' end of the sense strand of the polynucleic acid molecule. In some examples, Y1 is the last nucleotide on the 3' end or the first nucleotide on the 5' end of the sense strand of the polynucleic acid molecule, and Y2 is a 3-hydroxy-propoxy group. In some examples, Y2 is the first nucleotide on the 5' end or the last nucleotide on the 3' end of one of the strands of the polynucleic acid molecule. In some examples, Y2 is the first nucleotide on the 5' end or the last nucleotide on the 3' end of the sense strand of the polynucleic acid molecule. In some examples, Y2 is the first nucleotide on the 5' end or the last nucleotide on the 3' end of the sense strand of the polynucleic acid molecule, and Y1 is a 3-hydroxy-propoxy group. In other examples, Y1 and Y2 are two consecutive nucleotides in one of the strands of the polynucleic acid molecule.
[0221] In some embodiments, a targeting moiety described herein is conjugated to the 3' end of the sense strand (e.g., Formula (IV') or (IV'''')). In some embodiments, a targeting moiety described herein is conjugated to the 5' end of the sense strand (e.g., Formula (IV') or (IV'''')). In some embodiments, a targeting moiety described herein is conjugated to the 3' end of the antisense strand (e.g., Formula (IV') or (IV'''')). In some embodiments, a targeting moiety described herein is conjugated to the 5' end of the antisense strand (e.g., Formula (IV') or (IV'''')).
[0222] [ka] (Z in formula (IV') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (IV') is adenine, uracil, guanine, cytosine, thymine, an abasic moiety, or other.)
[0223] [ka] (Z in formula (IV'') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (IV'') is adenine, uracil, guanine, cytosine, thymine, an abasic moiety, or the like.)
[0224] [ka] (Z in formula (IV''') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (IV') is adenine, uracil, guanine, cytosine, thymine, an abasic moiety, or other.)
[0225] [ka] (Z in formula (IV'''') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (IV'''') is adenine, uracil, guanine, cytosine, thymine, an abasic moiety, or other.)
[0226] Pharmaceutical Composition Delivery of the polynucleotide molecules described herein can be achieved by contacting cells with the polynucleotide molecules using a variety of methods, hi certain aspects, the polynucleotide molecules described herein are formulated with various excipients, vehicles, and carriers, as described in more detail elsewhere herein.
[0227] The pharmaceutical compositions described herein can be prepared by incorporating the hybridized polynucleotide constructs disclosed herein into a form suitable for administration to a subject using carriers, excipients, and vehicles. Frequently used excipients include magnesium carbonate, titanium dioxide, lactose, mannitol, and other sugars, talc, milk protein, gelatin, starch, vitamins, cellulose and its derivatives, animal and vegetable oils, polyethylene glycol, and solvents such as sterile water, alcohol, glycerol, and polyhydric alcohols. Intravenous vehicles include fluid and nutritional supplements. Preservatives include antibacterial agents, antioxidants, chelating agents, and inert gases. Other pharmaceutically acceptable vehicles include aqueous solutions, non-toxic additives containing salts, preservatives, buffers, etc., as described, for example, in Remington: The Science and Practice of Pharmacy, 21st Ed., Gennaro, Ed., Lippencott Williams & Wilkins (2005) and The United States Pharmacopeia: The National Formulary (USP 36 NF31), published in 2013. The pH and exact concentration of the various components of the pharmaceutical composition are adjusted according to routine techniques in the art. See Goodman and Gilman's, The Pharmacological Basis for Therapeutics.
[0228] The pharmaceutical composition described herein can be administered locally or systemically.The therapeutically effective amount will vary depending on factors such as the degree of infection of the subject, the age, sex and weight of the individual.Dosage regimen can be adjusted to achieve optimal therapeutic response.For example, several divided doses can be administered daily, or the dose can be reduced proportionally as indicated by the exigencies of the treatment situation.
[0229] Pharmaceutical compositions can be conventionally administered by injection (e.g., subcutaneous, intravenous, intraorbital, etc.), oral administration, ocular application, inhalation, topical application, or rectal administration. Depending on the route of administration, pharmaceutical compositions can be coated with a material to protect them from the action of enzymes, acids, and other natural conditions that may inactivate them. Pharmaceutical compositions can also be administered parenterally or intraperitoneally. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof, as well as in oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms.
[0230] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Compositions will typically be sterile and fluid to the extent that easy syringability exists. Typically, compositions will be stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms such as bacteria and fungi. The vehicle can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. Prevention of microbial action can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride, are used in the composition. Prolonged absorption of the injectable compositions can be achieved by including in the composition an agent that delays absorption, for example, aluminum monostearate and gelatin.
[0231] Sterile injectable solutions can be prepared by incorporating the required amount of the pharmaceutical composition in an appropriate solvent with one or a combination of the ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the pharmaceutical composition into a sterile vehicle containing a basic dispersion medium and the required other ingredients enumerated above.
[0232] For ease of administration and uniformity of dosage, it is particularly convenient to formulate parenteral compositions into unit dosage forms.As used herein, unit dosage form refers to a physically discrete unit suitable as a single dosage for a subject to be treated, each unit containing a predetermined amount of pharmaceutical composition produced to produce a desired therapeutic effect in association with a necessary pharmaceutical vehicle.The specifications for unit dosage form relate to the characteristics of the pharmaceutical composition and the specific therapeutic effect to be achieved.The main pharmaceutical composition is formulated with a suitable and pharmaceutically acceptable vehicle in an acceptable dosage unit for convenient and effective administration in an effective amount.For compositions containing additional active ingredients, the dosage is determined by referring to the usual dosage and administration method of the ingredients.
[0233] The pharmaceutical composition can be orally administered in a unit dosage form with a carrier, for example, an enteric coating. The pharmaceutical composition and other ingredients can also be enclosed in a hard or soft shell gelatin capsule or compressed into a tablet. For oral therapeutic administration, the pharmaceutical composition can be incorporated with excipients and used in the form of ingestible tablets, troches, capsules, pills, wafers, etc. Such compositions and preparations should contain at least 1% by weight of the active compound. The percentage of the compositions and preparations can, of course, be varied and may preferably be between about 5% and about 80% by weight of the unit dosage form. Tablets, troches, pills, capsules, etc. may also contain binders such as tragacanth gum, acacia, corn starch, or gelatin; excipients such as calcium phosphate; disintegrating agents such as corn starch, potato starch, or alginic acid; lubricants such as magnesium stearate; and sweeteners such as sucrose, lactose, or saccharin, or flavorings such as peppermint, wintergreen oil, or cherry flavoring. When the unit dosage form is a capsule, it may contain a liquid carrier in addition to the above-mentioned types of materials. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For example, tablets, pills, or capsules may be coated with shellac, sugar, or both. Syrup or elixir may contain the drug, sucrose as a sweetener, methyl and propylparabens as preservatives, a dye, and a flavoring such as cherry or orange flavor. All materials used in preparing any unit dosage form should be of pharmaceutically acceptable purity and substantially non-toxic in the amounts employed. Moreover, pharmaceutical compositions can be incorporated into sustained-release preparations and formulations.
[0234] The pharmaceutical compositions described herein may include one or more penetration enhancers to enhance the bioavailability of the polynucleotide molecules described herein. International Publication No. WO 2000 / 67798, Muranishi, 1990, Crit. Rev. Ther. Drug Carrier Systems, 7, 1, and Lee et al., 1991, Crit. Rev. Ther. Drug Carrier Systems, 8, 91 are incorporated herein by reference in their entirety. In some embodiments, the penetration enhancer is for enteral use. In some embodiments, the penetration enhancer is for transdermal use. In some embodiments, the penetration enhancer is for promoting crossing of the blood-brain barrier. In some embodiments, the penetration enhancer improves permeability in oral, nasal, buccal, pulmonary, vaginal, or corneal delivery models. In some embodiments, the penetration enhancer is a fatty acid or a derivative thereof. In some embodiments, the penetration enhancer is a surfactant or a derivative thereof. In some embodiments, the penetration enhancer is a bile salt or a derivative thereof. In some embodiments, the penetration enhancer is a chelating agent or a derivative thereof. In some embodiments, the penetration enhancer is a non-chelating non-surfactant or a derivative thereof. In some embodiments, the penetration enhancer is an ester or a derivative thereof. In some embodiments, the penetration enhancer is an ether or a derivative thereof. In some embodiments, the penetration enhancer is arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitine, acylcholine, or a monoglyceride, diglyceride, or a pharmaceutically acceptable salt thereof. In one specific embodiment, the penetration enhancer is sodium caprate (C10).In some embodiments, the penetration enhancer is chenodeoxycholic acid (CDCA), ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glucholic acid, glycolic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, sodium tauro-24,25-dihydro-fusidate, or sodium glycodihydrofusidate. In some embodiments, the penetration enhancer is polyoxyethylene-9-lauryl ether or polyoxyethylene-20-cetyl ether.
[0235] With respect to the polynucleotide molecules described herein, suitable pharmaceutically acceptable salts include (i) salts formed with cations, e.g., sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, (ii) acid addition salts formed with inorganic acids, e.g., hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, and (iii) salts formed with organic acids, e.g., acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid, and the like.
[0236] Although the hybridized polynucleotide constructs described herein do not require the use of an excipient for delivery to target cells, the use of an excipient can be advantageous in some embodiments. Thus, for delivery to target cells, the hybridized polynucleotide molecules described herein can be non-covalently bound to an excipient to form a complex. The excipient can be used to modify biodistribution after delivery, improve uptake, increase the half-life or stability of the strands in the hybridized polynucleotide construct (e.g., improve nuclease resistance), and / or increase targeting to specific cell or tissue types.
[0237] Exemplary excipients include condensing agents (e.g., agents capable of attraction to or binding to nucleic acids via ionic or electrostatic interactions), fusogenic agents (e.g., agents capable of fusion and / or transport across cell membranes), proteins that target specific cell or tissue types (e.g., thyrotropin, melanotropin, lectins, glycoproteins, surfactant protein A, or other proteins), lipids, lipopolysaccharides, lipid micelles or liposomes (e.g., formed from phospholipids such as phosphotidylcholine, fatty acids, glycolipids, ceramides, glycerides, cholesterol, or any combination thereof), nanoparticles (e.g., silica, lipid, hydrocarbon, or other pharmaceutically acceptable polymer nanoparticles), polyplexes formed from cationic polymers and anionic agents (e.g., CROs) (typical cationic polymers include polyamines, e.g., polylysine, polyarginine, polyamidoamine, and polyethyleneimine), cholesterol, dendrimers (e.g., polyamidoamine (PAMAM) dendrimers), serum proteins (e.g., human serum albumin (HSA) or low density liposomes), and the like. lipoprotein (LDL)), carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid), lipids, synthetic polymers (e.g., polylysine (PLL), polyethyleneimine, poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolic acid) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide) copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, pseudopeptide-polyamine, peptidomimetic polyamine, or polyamine), cationic moiety (e.g., cationic lipid, cationic porphyrin, polyamine quaternary salt, or alpha helical peptide), polyvalent sugar (e.g., polyvalent lactose, polyvalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, polyvalent mannose, or polyvalent fucose), vitamin (e.g., vitamin A, vitamin E, vitamin K,These include vitamin B, folate, vitamin B12, riboflavin, biotin, or pyridoxal), cofactors, or drugs that disrupt the cytoskeleton and increase uptake (e.g., taxol, vincristine, vinblastine, cytochalasin, nocodazole, jasplakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin).
[0238] Other therapeutic agents described herein may be included in the pharmaceutical compositions described herein in combination with the polynucleotide molecules described herein.
[0239] Treatment method In some aspects, the present specification describes a method for regulating expression of the Lp(a) gene in a subject, the method comprising regulating expression of the Lp(a) gene in the subject by administering to the subject a polynucleic acid molecule described herein, a polynucleic acid molecule conjugate described herein, or a pharmaceutical composition described herein.
[0240] In some embodiments, the methods described herein reduce the expression of the Lp(a) gene (e.g., expression of Lp(a) mRNA) in a subject by about or at least 10% compared to a control. As used herein, the term "control" refers to a subject or cell that receives neither treatment nor a placebo. In some embodiments, the methods described herein reduce the expression of the Lp(a) gene in a subject by about or at least 20% compared to a control. In some embodiments, the methods described herein reduce the expression of the Lp(a) gene in a subject by about or at least 30% compared to a control. In some embodiments, the methods described herein reduce the expression of the Lp(a) gene in a subject by about or at least 40% compared to a control. In some embodiments, the methods described herein reduce the expression of the Lp(a) gene in a subject by about or at least 50% compared to a control. In some embodiments, the methods described herein reduce the expression of the Lp(a) gene in a subject by about or at least 60% compared to a control. In some embodiments, the methods described herein reduce the expression of the Lp(a) gene in a subject by about or at least 70% compared to a control. In some embodiments, the methods described herein reduce the expression of the Lp(a) gene in a subject by about or at least 80% compared to a control.In some embodiments, the methods described herein reduce the expression of the Lp(a) gene in a subject by about or at least 90% compared to a control.In some embodiments, the methods described herein reduce the expression of the Lp(a) gene in a subject by about 100% compared to a control.
[0241] In some embodiments, the methods described herein achieve an IC50 value of about 5 nM. In some embodiments, the methods described herein achieve an IC50 value of about 10 nM. In some embodiments, the methods described herein achieve an IC50 value of about 15 nM. In some embodiments, the methods described herein achieve an IC50 value of about 20 nM. In some embodiments, the methods described herein achieve an IC50 value of about 25 nM. In some embodiments, the methods described herein achieve an IC50 value of about 30 nM. In some embodiments, the methods described herein achieve an IC50 value of about 35 nM. In some embodiments, the methods described herein achieve an IC50 value of about 40 nM. In some embodiments, the methods described herein achieve an IC50 value of about 45 nM. In some embodiments, the methods described herein achieve an IC50 value of about 50 nM. In some embodiments, the methods described herein achieve an IC50 value of about 55 nM. In some embodiments, the methods described herein achieve an IC50 value of about 60 nM. In some embodiments, the methods described herein achieve an IC50 value of about 65 nM. In some embodiments, the methods described herein achieve an IC50 value of about 70 nM. In some embodiments, the methods described herein achieve an IC50 value of about 75 nM. In some embodiments, the methods described herein achieve an IC50 value of about 80 nM. In some embodiments, the methods described herein achieve an IC50 value of about 85 nM. In some embodiments, the methods described herein achieve an IC50 value of about 90 nM. In some embodiments, the methods described herein achieve an IC50 value of about 95 nM. In some embodiments, the methods described herein achieve an IC50 value of about 100 nM.
[0242] In some embodiments, the methods described herein achieve an IC50 value of about 1 μM. In some embodiments, the methods described herein achieve an IC50 value of about 1.1 μM. In some embodiments, the methods described herein achieve an IC50 value of about 1.2 μM. In some embodiments, the methods described herein achieve an IC50 value of about 1.3 μM. In some embodiments, the methods described herein achieve an IC50 value of about 1.4 μM. In some embodiments, the methods described herein achieve an IC50 value of about 1.5 μM. In some embodiments, the methods described herein achieve an IC50 value of about 2 μM. In some embodiments, the methods described herein achieve an IC50 value of about 4 μM. In some embodiments, the methods described herein achieve an IC50 value of about 6 μM. In some embodiments, the methods described herein achieve an IC50 value of about 8 μM. In some embodiments, the methods described herein achieve an IC50 value of about 10 μM. In some embodiments, the methods described herein achieve an IC50 value of about 12 μM. In some embodiments, the methods described herein achieve an IC50 value of about 13 μM. In some embodiments, the methods described herein achieve an IC50 value of about 14 μM. In some embodiments, the methods described herein achieve an IC50 value of about 15 μM. In some embodiments, the methods described herein achieve an IC50 value of about 30 μM. In some embodiments, the methods described herein achieve an IC50 value of about 35 μM. In some embodiments, the methods described herein achieve an IC50 value of about 40 μM. In some embodiments, the methods described herein achieve an IC50 value of about 50 μM. In some embodiments, the methods described herein achieve an IC50 value of about 60 μM. In some embodiments, the methods described herein achieve an IC50 value of about 80 μM. In some embodiments, the methods described herein achieve an IC50 value of about 100 μM. In some embodiments, the methods described herein achieve an IC50 value of about 120 μM. In some embodiments, the methods described herein achieve an IC50 value of about 160 μM.
[0243] In some aspects, the present specification describes a method for regulating plasma Lp(a) levels in a subject in need thereof, the method comprising administering to the subject a polynucleic acid molecule described herein, a polynucleic acid molecule conjugate described herein, or a pharmaceutical composition described herein, wherein the polynucleic acid molecule described herein, the polynucleic acid molecule conjugate described herein, or the pharmaceutical composition described herein reduces plasma Lp(a) levels in the subject.
[0244] In some embodiments, the methods described herein reduce plasma Lp(a) levels in a subject by about or at least 10% compared to a control (e.g., an untreated subject or a subject before treatment). In some embodiments, the methods described herein reduce plasma Lp(a) levels in a subject by about or at least 20% compared to a control. In some embodiments, the methods described herein reduce plasma Lp(a) levels in a subject by about or at least 30% compared to a control. In some embodiments, the methods described herein reduce plasma Lp(a) levels in a subject by about or at least 40% compared to a control. In some embodiments, the methods described herein reduce plasma Lp(a) levels in a subject by about or at least 50% compared to a control. In some embodiments, the methods described herein reduce plasma Lp(a) levels in a subject by about or at least 60% compared to a control. In some embodiments, the methods described herein reduce plasma Lp(a) levels in a subject by about or at least 70% compared to a control. In some embodiments, the methods described herein reduce the plasma Lp(a) level in a subject by about or at least 80% compared to a control. In some embodiments, the methods described herein reduce the plasma Lp(a) level in a subject by about or at least 90% compared to a control. In some embodiments, the methods described herein reduce the plasma Lp(a) level in a subject by about 100% compared to a control.
[0245] In some aspects, the present specification describes a method for treating or preventing an Lp(a)-related disorder or a symptom thereof, a cardiovascular disease, or a lipid disorder, the method comprising administering to a subject a polynucleic acid molecule described herein, a polynucleic acid molecule conjugate described herein, or a pharmaceutical composition described herein.
[0246] In some embodiments, the Lp(a)-related disorder or cardiovascular disease includes coronary artery disease, acute myocardial infarction, silent carotid atherosclerosis, stroke, atrial fibrillation, or peripheral arterial occlusive disease. In some embodiments, the cardiovascular disease is hypercholesterolemia. In some embodiments, the cardiovascular disease is myocardial infarction. In some embodiments, the cardiovascular disease is stroke. In some embodiments, the cardiovascular disease is calcific aortic stenosis. In some embodiments, the cardiovascular disease is cardiac arrest. In some embodiments, the cardiovascular disease is peripheral arterial disease. In some embodiments, the lipid disorder is hyperlipidemia or hypercholesterolemia.
[0247] Combination therapy In some examples, the methods disclosed herein include administering a polynucleic acid molecule disclosed herein, a polynucleic acid molecule conjugate disclosed herein, or a pharmaceutical composition disclosed herein to a subject (e.g., a human patient) undergoing a therapeutic regimen for the treatment of an Lp(a)-associated disorder or CVD, at or immediately prior to administration of a polynucleic acid molecule disclosed herein, a polynucleic acid molecule conjugate disclosed herein, or a pharmaceutical composition disclosed herein. For example, a patient previously diagnosed with atherosclerosis may have been prescribed or be undergoing a stable therapeutic regimen of another drug prior to and / or concurrently with administration of a polynucleic acid molecule disclosed herein, a polynucleic acid molecule conjugate disclosed herein, or a pharmaceutical composition disclosed herein. Prior or concurrent treatment regimens can include, for example, (1) agents that induce intracellular depletion of cholesterol synthesis by inhibiting 3-hydroxy-3-methylglutaryl (HMG)-coenzyme A (CoA) reductase, e.g., statins (e.g., cerivastatin, atorvastatin, simvastatin, pitavastatin, rosuvastatin, fluvastatin, lovastatin, pravastatin, etc.), (2) agents that inhibit cholesterol uptake and / or bile acid reabsorption, (3) agents that increase lipoprotein catabolism (e.g., niacin), and / or (4) activators of LXR transcription factors that play a role in cholesterol excretion, such as 22-hydroxycholesterol.
[0248] Patient population The methods disclosed herein are useful for reducing plasma Lp(a) levels in subjects with elevated plasma Lp(a). The subject can be a human or a non-human primate. In some instances, the subject is otherwise healthy except for elevated serum Lp(a). For example, the subject may not exhibit any other risk factors for cardiovascular, thrombotic, or other diseases or disorders at the time of treatment. However, in other instances, the subject is selected based on having been diagnosed with or being at risk for developing a disease or disorder caused by or correlated with elevated plasma Lp(a). For example, at or before the time of administration of the polynucleic acid molecule disclosed herein, the polynucleic acid molecule conjugate disclosed herein, or the pharmaceutical composition disclosed herein, the subject may be diagnosed with or identified as being at risk for developing a cardiovascular disease or disorder, such as coronary artery disease, acute myocardial infarction, asymptomatic carotid atherosclerosis, stroke, atrial fibrillation, peripheral arterial occlusive disease, etc. In some cases, the cardiovascular disease or disorder is hypercholesterolemia. For example, a subject can be selected for treatment by the methods disclosed herein if the subject is diagnosed with or identified as being at risk of developing a hypercholesterolemia disease, such as heterozygous familial hypercholesterolemia (heFH), homozygous familial hypercholesterolemia (hoFH), or hypercholesterolemia other than familial hypercholesterolemia (nonFH). The subject can be diagnosed with or identified as being at risk of developing a lipid disease or disorder, such as hyperlipidemia or hypercholesterolemia.
[0249] In some examples, at or before the time of administration of the polynucleic acid molecule disclosed herein, the polynucleic acid molecule conjugate disclosed herein, or the pharmaceutical composition disclosed herein, the subject may be diagnosed with, or identified as being at risk for, a thromboembolic disease or disorder, such as pulmonary embolism, central retinal vein occlusion, etc. Patients may be selected based on being diagnosed with, or at risk for, a combination of two or more of the above-mentioned diseases or disorders. For example, at or before the time of administration of the pharmaceutical composition of the present invention, the subject may be diagnosed with, or identified as being at risk for, coronary artery disease and pulmonary embolism. Other combinations of diagnoses (e.g., atherosclerosis with central retinal vein occlusion, heFH, and stroke, etc.) are also included in the definition of the patient population treatable by the methods disclosed herein.
[0250] In some examples, subjects treated with the methods disclosed herein are selected based on one or more factors selected from the group consisting of age (e.g., over 40, 45, 50, 55, 60, 65, 70, 75, or 80 years of age), race, sex (male or female), exercise habits (e.g., regular exercisers or sedentaries), other pre-existing medical conditions (e.g., type II diabetes, hypertension, etc.), and current medication status (e.g., currently taking a statin (e.g., cerivastatin, atorvastatin, simvastatin, pitavastatin, rosuvastatin, fluvastatin, lovastatin, pravastatin, etc.), beta-blockers, niacin, etc.). The present disclosure also provides methods for reducing plasma Lp(a) levels in patients who are intolerant, non-responsive, or inadequately responsive to conventional statin therapy. Candidate patients may be selected / screened (e.g., by questionnaire, diagnostic evaluation, etc.) based on one or more of these factors before being treated with the methods disclosed herein.
[0251] Dosage The amount of a polynucleic acid molecule disclosed herein, a polynucleic acid molecule conjugate disclosed herein, or a pharmaceutical composition disclosed herein that is administered to a patient according to the methods disclosed herein is generally a therapeutically effective amount. As used herein, the term "therapeutically effective amount" refers to the dose of a polynucleic acid molecule disclosed herein, a polynucleic acid molecule conjugate disclosed herein, or a pharmaceutical composition disclosed herein that results in a detectable reduction in plasma Lp(a). For example, a therapeutically effective amount of a polynucleic acid molecule disclosed herein, a polynucleic acid molecule conjugate disclosed herein, or a pharmaceutical composition disclosed herein includes, for example, an amount of a polynucleic acid molecule disclosed herein, a polynucleic acid molecule conjugate disclosed herein, or a pharmaceutical composition disclosed herein that, when administered to a subject, results in a reduction of plasma Lp(a) levels by at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50% or more. In some examples, a therapeutically effective amount of a polynucleic acid molecule disclosed herein can be a dose that, when administered to a subject, can result in at least a 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50% or more reduction in plasma Lp(a) levels.
[0252] Regimen The polynucleic acid molecules disclosed herein, the polynucleic acid molecule conjugates disclosed herein, or the pharmaceutical compositions disclosed herein can be administered to a subject over a predetermined period of time. The methods disclosed herein can include sequentially administering to a subject multiple doses of the polynucleic acid molecules disclosed herein, the polynucleic acid molecule conjugates disclosed herein, or the pharmaceutical compositions disclosed herein. As used herein, "sequential administration" means that each dose of the polynucleic acid molecule, the polynucleic acid molecule conjugate, or the pharmaceutical composition is administered at different times, for example, on different days separated by a predetermined interval (e.g., several hours, days, weeks, or months). The present disclosure provides a method comprising sequentially administering to a patient an initial dose of the polynucleic acid molecule, the polynucleic acid molecule conjugate, or the pharmaceutical composition, followed by one or more secondary doses of the polynucleic acid molecule, the polynucleic acid molecule conjugate, or the pharmaceutical composition, optionally followed by one or more tertiary doses of the polynucleic acid molecule, the polynucleic acid molecule conjugate, or the pharmaceutical composition.
[0253] The terms "initial dose," "secondary dose," and "tertiary dose" refer to the temporal order of administration of a polynucleic acid molecule, polynucleic acid molecule conjugate, or pharmaceutical composition. Thus, a "initial dose" is a dose administered at the start of a treatment regimen (also referred to as a "baseline dose"), a "secondary dose" is a dose administered after the initial dose, and a "tertiary dose" is a dose administered after the secondary dose. The initial dose, secondary dose, and tertiary dose may all contain the same amount of polynucleic acid molecule, polynucleic acid molecule conjugate, or pharmaceutical composition, but generally differ from one another in terms of administration frequency. In some cases, the amount of polynucleic acid molecule, polynucleic acid molecule conjugate, or pharmaceutical composition contained in the initial dose, secondary dose, and / or tertiary dose will vary relative to one another during the course of treatment (e.g., adjusted upward or downward as appropriate).
[0254] In some examples, each of the secondary and / or tertiary doses is administered 1 to 30 days (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 or more days) after the immediately preceding dose. The phrase "the immediately preceding dose," as used herein, refers to, in a multiple-dosing sequence, the dose of a polynucleic acid molecule, polynucleic acid molecule conjugate, or pharmaceutical composition that is administered to a patient prior to administration of the next dose in the sequence, without any intervening administrations.
[0255] The methods disclosed herein may include administering any number of secondary and / or tertiary doses of a polynucleic acid molecule, polynucleic acid molecule conjugate, or pharmaceutical composition to a patient. For example, in some cases, only one secondary dose is administered to a patient. In other cases, two or more (e.g., two, three, four, five, six, seven, eight or more) secondary doses are administered to a patient. In some cases, only one tertiary dose is administered to a patient. In other cases, two or more (e.g., two, three, four, five, six, seven, eight or more) tertiary doses are administered to a patient.
[0256] When multiple secondary doses are administered, each secondary dose can be administered at the same frequency as the other secondary doses. For example, each secondary dose can be administered to the patient 1 to 29 days after the immediately preceding dose. Similarly, when multiple tertiary doses are administered, each tertiary dose can be administered at the same frequency as the other tertiary doses. For example, each tertiary dose can be administered to the patient 1 to 60 days after the immediately preceding dose. Alternatively, the frequency with which the secondary and / or tertiary doses are administered to the patient can vary over the course of the treatment regimen. The administration frequency can also be adjusted by the physician during the course of treatment depending on the individual patient's needs after clinical testing.
[0257] Illustrative Embodiments Embodiment 1. A polynucleic acid molecule for regulating expression of the lipoprotein(a) (Lp(a)) gene, the polynucleic acid molecule comprising a nucleic acid sequence that is at least 80%, at least 85%, at least 90% identical to a nucleic acid sequence selected from Table 1, Table 2, or Table 5.
[0258] Embodiment 2. The polynucleic acid molecule of embodiment 1, wherein the polynucleic acid molecule comprises a nucleic acid sequence selected from Table 1, Table 2, or Table 5.
[0259] Embodiment 3. The polynucleic acid molecule of any one of embodiments 1 to 2, wherein the polynucleic acid molecule is a single-stranded nucleic acid molecule.
[0260] Embodiment 4. The polynucleic acid molecule of embodiment 3, wherein the single-stranded nucleic acid molecule comprises at least 14, 15, 16, 17, 18 contiguous nucleotides complementary to a nucleic acid sequence selected from SEQ ID NOs: 309-462, with 1, 2, 3, or no more than 4 mismatches.
[0261] Embodiment 5. The polynucleic acid molecule of embodiment 3, wherein the single-stranded nucleic acid molecule comprises at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to a nucleic acid sequence selected from SEQ ID NOs: 1-154.
[0262] Embodiment 6. A polynucleic acid molecule according to embodiment
[0220] or 2, wherein the polynucleic acid molecule is a double-stranded nucleic acid molecule comprising a sense strand and an antisense strand.
[0263] Embodiment 7. The polynucleic acid molecule of embodiment 5, wherein the sense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a nucleic acid sequence selected from SEQ ID NOs: 309-462.
[0264] Embodiment 8. The polynucleic acid molecule of embodiment 5 or embodiment 6, wherein the antisense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a nucleic acid sequence selected from SEQ ID NOs: 1-154.
[0265] Embodiment 9. The polynucleic acid molecule of embodiment 5, wherein the sense strand comprises a nucleic acid sequence comprising at least 14, 15, 16, 17, 18, 19, or 20 consecutive sequences of a nucleic acid sequence selected from SEQ ID NOs: 309-462, with 1, 2, 3, or no more than 4 mismatches.
[0266] Embodiment 10. A polynucleic acid molecule described in embodiment
[0225] , wherein the antisense strand comprises a nucleic acid sequence comprising at least 14, 15, 16, 17, 18, 19, 20, 21, or 22 consecutive sequences of a nucleic acid sequence selected from SEQ ID NOs: 1 to 154, with 1, 2, 3, or 4 or less mismatches.
[0267] Embodiment 11. A polynucleic acid molecule according to any one of embodiments
[0225] to
[0229] , wherein the sense strand comprises a nucleic acid sequence selected from SEQ ID NOs: 309 to 462, and the antisense strand comprises a nucleic acid sequence selected from SEQ ID NOs: 1 to 154.
[0268] Embodiment 12. The polynucleic acid molecule of any one of embodiments 1 to 11, wherein the polynucleic acid molecule comprises (1) 2'-fluoro modified nucleotides, (2) 2'-O methyl modified nucleotides, or (3) modified internucleotide linkages.
[0269] Embodiment 13. A polynucleic acid molecule according to any one of embodiments
[0225] to 12, wherein the sense strand comprises at least two consecutive modified internucleotide bonds at the 5' end.
[0270] Embodiment 14. The polynucleic acid molecule of any one of embodiments 6 to 13, wherein the antisense strand comprises at least two consecutive modified internucleotide linkages at the 5'-end and / or the 3'-end.
[0271] Embodiment 15. The polynucleic acid molecule of any one of embodiments 6 to 14, wherein the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnnNfnnnnNfnNfnNfnnnnnnn-3', wherein n represents a 2'-O-methyl modified nucleotide and Nf represents a 2'-fluoro modified nucleotide.
[0272] Embodiment 16. A polynucleic acid molecule according to any one of embodiments
[0231] to
[0234] , wherein the modified internucleotide bond is a phosphorothioate bond.
[0273] Embodiment 17. A polynucleic acid molecule according to embodiment
[0235] , wherein the modified internucleotide linkage is a sterically rich phosphorothioate internucleotide linkage.
[0274] Embodiment 18. The modified internucleotide linkage is S P A polynucleic acid molecule described in any one of claims
[0231] to 17, which has chiral internucleotide phosphorothioate linkages.
[0275] Embodiment 19. A polynucleic acid molecule described in embodiment
[0237] , wherein the polynucleic acid comprises a plurality of modified internucleotide linkages, and at least 1, 2, 3, or 4 of the plurality of modified internucleotide linkages are stereochemically rich phosphorothioate internucleotide linkages.
[0276] Embodiment 20. A polynucleic acid molecule according to embodiment
[0238] , wherein the stereochemically enriched phosphorothioate internucleotide linkages include both R and S isomers.
[0277] Embodiment 21. A polynucleic acid molecule described in embodiment
[0238] or
[0239] , wherein at least one stereochemically rich phosphorothioate is positioned between two consecutive nucleosides that are two of the six 5' or 3' terminal nucleosides of the sense strand or antisense strand.
[0278] Embodiment 22. A polynucleic acid molecule according to any one of embodiments
[0225] to
[0240] , wherein the sense strand or the antisense strand is 19 to 25 or 21 to 23 nucleotides in length.
[0279] Embodiment 23: A polynucleic acid molecule according to any one of embodiments
[0220] to
[0224] , which is 19 to 25 or 21 to 23 nucleotides in length.
[0280] Embodiment 24. The polynucleic acid molecule of any one of embodiments 1 to 23, wherein the sense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 463 to 616.
[0281] Embodiment 25. The polynucleic acid molecule of any one of embodiments 1 to 24, wherein the antisense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 155 to 308.
[0282] Embodiment 26. A polynucleic acid molecule according to any one of embodiments 1 to 25, wherein the sense strand comprises a sequence selected from the nucleic acid sequences of SEQ ID NOs: 463 to 616, and the antisense strand comprises a sequence selected from the nucleic acid sequences of SEQ ID NOs: 155 to 308.
[0283] Embodiment 27. A polynucleic acid molecule for regulating the expression of the lipoprotein(a) (Lp(a)) gene, comprising: (a) an antisense strand comprising the nucleotide sequence UAGAUGACCAAGCUUGGCAGGUC (SEQ ID NO: 4), and a sense strand comprising the nucleotide sequence CCUGCCAAGCUUGGUCAUCUA (SEQ ID NO: 312); (b) an antisense strand comprising the nucleotide sequence UAUAGAUGACCAAGCUUGGCAGG (SEQ ID NO: 5), and a sense strand comprising the nucleotide sequence UGCCAAGCUUGGUCAUCUAUA (SEQ ID NO: 313); (c) an antisense strand comprising the nucleotide sequence UCAUAGAUGACCAAGCUUGGCAG (SEQ ID NO: 6), and a sense strand comprising the nucleotide sequence GCCAAGCUUGGUCAUCUAUGA (SEQ ID NO: 314); (d) an antisense strand comprising the nucleotide sequence UCGACGGCAGUCCCUUCUGCGUC (SEQ ID NO: 11), and a sense strand comprising the nucleotide sequence CGCAGAAGGGACUGCCGUCGA (SEQ ID NO: 319); (e) an antisense strand comprising the nucleotide sequence of UUCUAGGCUUGGAACCGGGGUAA (SEQ ID NO: 18), and a sense strand comprising the nucleotide sequence of ACCCCGGUUCCAAGCCUAGAA (SEQ ID NO: 326); (f) an antisense strand comprising the nucleotide sequence UAGCCUCUAGGCUUGGAACCGGG (SEQ ID NO: 21), and a sense strand comprising the nucleotide sequence CGGUUCCAAGCCUAGAGGCUA (SEQ ID NO: 329); (g) an antisense strand comprising the nucleotide sequence of UUUACCGUGGUAGCACUCCUGCA (SEQ ID NO: 44), and a sense strand comprising the nucleotide sequence of CAGGAGUGCUACCACGGUAAA (SEQ ID NO: 352); (h) an antisense strand comprising the nucleotide sequence of UUGUCCAUUACCGUGGUAGCACU (SEQ ID NO: 47), and a sense strand comprising the nucleotide sequence of UGCUACCACGGUAAUGGACAA (SEQ ID NO: 355); (i) an antisense strand comprising the nucleotide sequence UCUCUGUCCAUUACCGUGGUAGC (SEQ ID NO: 49), and a sense strand comprising the nucleotide sequence UACCACGGUAAUGGACAGAGA (SEQ ID NO: 357); (j) an antisense strand comprising the nucleotide sequence UAUUGUGUCAGGUUGCAGUACUC (SEQ ID NO: 60), and a sense strand comprising the nucleotide sequence GUACUGCAACCUGACACAAUA (SEQ ID NO: 368); (k) an antisense strand comprising the nucleotide sequence UUGCGUCUGAGCAUUGUGUCAGG (SEQ ID NO: 64), and a sense strand comprising the nucleotide sequence UGACACAAUGCUCAGACGCAA (SEQ ID NO: 372); (l) an antisense strand comprising the nucleotide sequence of UUAACUCUGUCCAUAAUGGUAGU (SEQ ID NO: 88), and a sense strand comprising the nucleotide sequence of UACCAUUAUGGACAGAGUUAA (SEQ ID NO: 396); (m) an antisense strand comprising the nucleotide sequence of UCCAAGCUUGGCAAGUUCUUCCU (SEQ ID NO: 89), and a sense strand comprising the nucleotide sequence of GAAGAACUUGCCAAGCUUGGA (SEQ ID NO: 397); (n) an antisense strand comprising the nucleotide sequence UAGAUGACCAAGCUUGGCAAGUU (SEQ ID NO: 90) and a sense strand comprising the nucleotide sequence CUUGCCAAGCUUGGUCAUCUA (SEQ ID NO: 398); or (o) A polynucleic acid molecule comprising an antisense strand comprising the nucleotide sequence UGGUCCGACUAUGCUGGUGUGGU (SEQ ID NO: 98), and a sense strand comprising the nucleotide sequence CACACCAGCAUAGUCGGACCA (SEQ ID NO: 406).
[0284] Embodiment 28. A polynucleic acid molecule for regulating the expression of the lipoprotein(a) (Lp(a)) gene, comprising: (a) an antisense strand comprising the nucleotide sequence of usAfsgaugAfccaaGfcUfuGfgcaggsusc (SEQ ID NO: 158), and a sense strand comprising the nucleotide sequence of cscsugccAfaGfcUfuggucaucua (SEQ ID NO: 466); (b) an antisense strand comprising the nucleotide sequence of usAfsuagaUfgaccAfaGfcUfuggcasgsg (SEQ ID NO: 159), and a sense strand comprising the nucleotide sequence of usgsccaaGfcUfuGfgucaucuaua (SEQ ID NO: 467); (c) an antisense strand comprising the nucleotide sequence of usCfsauagAfugacCfaAfgCfuuggcsasg (SEQ ID NO: 160), and a sense strand comprising the nucleotide sequence of gscscaagCfuUfgGfucaucuauga (SEQ ID NO: 468); (d) an antisense strand comprising the nucleotide sequence of usCfsgacgGfcaguCfcCfuUfcugcgsusc (SEQ ID NO: 165), and a sense strand comprising the nucleotide sequence of csgscagaAfgGfgAfcugccgucga (SEQ ID NO: 473); (e) an antisense strand comprising the nucleotide sequence of usUfscuagGfcuugGfaAfcCfggggusasa (SEQ ID NO: 172), and a sense strand comprising the nucleotide sequence of ascscccgGfuUfcCfaagccuagaa (SEQ ID NO: 480); (f) an antisense strand comprising the nucleotide sequence of usAfsgccuCfuaggCfuUfgGfaaccgsgsg (SEQ ID NO: 175), and a sense strand comprising the nucleotide sequence of csgsguucCfaAfgCfcuagaggcua (SEQ ID NO: 483); (g) an antisense strand comprising the nucleotide sequence of usUfsuaccGfugguAfgCfaCfuccugscsa (SEQ ID NO: 198), and a sense strand comprising the nucleotide sequence of csasggagUfgCfuAfccacgguaaa (SEQ ID NO: 506); (h) an antisense strand comprising the nucleotide sequence of usUfsguccAfuuacCfgUfgGfuagcascsu (SEQ ID NO: 201), and a sense strand comprising the nucleotide sequence of usgscuacCfaCfgGfuaauggacaa (SEQ ID NO: 509); (i) an antisense strand comprising the nucleotide sequence of usCfsucugUfccauUfaCfcGfugguasgsc (SEQ ID NO: 203), and a sense strand comprising the nucleotide sequence of usasccacGfgUfaAfuggacagaga (SEQ ID NO: 511); (j) an antisense strand comprising the nucleotide sequence of usAfsuuguGfucagGfuUfgCfaguacsusc (SEQ ID NO: 214), and a sense strand comprising the nucleotide sequence of gsusacugCfaAfcCfugacacaaua (SEQ ID NO: 522); (k) an antisense strand comprising the nucleotide sequence of usUfsgcguCfugagCfaUfuGfugucasgsg (SEQ ID NO: 218), and a sense strand comprising the nucleotide sequence of usgsacacAfaUfgCfucagacgcaa (SEQ ID NO: 526); (l) an antisense strand comprising the nucleotide sequence of usUfsaacuCfugucCfaUfaAfugguasgsu (SEQ ID NO: 242), and a sense strand comprising the nucleotide sequence of usasccauUfaUfgGfacagaguuaa (SEQ ID NO: 550); (m) an antisense strand comprising the nucleotide sequence of usCfscaagCfuuggCfaAfgUfucuucscsu (SEQ ID NO: 243), and a sense strand comprising the nucleotide sequence of gsasagaaCfuUfgCfcaagcuugga (SEQ ID NO: 551); (n) an antisense strand comprising the nucleotide sequence of usAfsgaugAfccaaGfcUfuGfgcaagsusu (SEQ ID NO: 244), and a sense strand comprising the nucleotide sequence of csusugccAfaGfcUfuggucaucua (SEQ ID NO: 552); or (o) an antisense strand comprising the nucleotide sequence of usGfsguccGfacuaUfgCfuGfgugugsgsu (SEQ ID NO: 252), and a sense strand comprising the nucleotide sequence of csascaccAfgCfaUfagucggacca (SEQ ID NO: 560), wherein "A" refers to adenosine-3'-phosphate, "a" refers to 2'-O-methyladenosine-3'-phosphate, "Af" refers to 2'-fluoroadenosine-3'-phosphate, "C" refers to cytidine-3'-phosphate, "c" refers to 2'-O-methylcytidine-3'-phosphate, "Cf" refers to 2'-fluorocytidine-3'-phosphate, and a polynucleic acid molecule wherein "G" refers to guanosine-3'-phosphate, "g" refers to 2'-O-methylguanosine-3'-phosphate, "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "U" refers to uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate, "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate, and "s" refers to 3'-phosphorothioate.
[0285] Embodiment 29. A polynucleic acid molecule conjugate for regulating the expression of the lipoprotein(a) gene (Lp(a)), comprising a polynucleic acid molecule described in any one of embodiments
[0220] to 23, and an asialoglycoprotein receptor targeting moiety.
[0286] Embodiment 30 The polynucleic acid molecule conjugate of embodiment 29, wherein the asialoglycoprotein receptor targeting moiety comprises N-acetylgalactosamine (GalNAc) or galactose.
[0287] Embodiment 31. The polynucleic acid molecule conjugate of any one of embodiments 29 to 30, wherein the polynucleic acid molecule and the asialoglycoprotein receptor targeting moiety are joined via a linker.
[0288] Embodiment 32. The polynucleic acid molecule conjugate of embodiment 31, wherein the linker is a cleavable linker.
[0289] Embodiment 33. A polynucleic acid molecule conjugate according to any one of embodiments 30-31, wherein the GalNAc comprises an anomeric carbon attached to a trivalent, tetravalent, pentavalent, or hexavalent linker, and wherein the anomeric carbon is part of a hemiaminal group.
[0290] Embodiment 34. The linker has the following formula (IV):
[0291] [ka] 34. The polynucleic acid molecule conjugate of any one of embodiments 31 to 33, comprising:
[0292] Embodiment 35. The polynucleic acid molecule conjugate of embodiment 34, wherein Y1 is the last nucleotide on the 3' end of the sense strand of the polynucleic acid molecule.
[0293] Embodiment 36. The polynucleic acid molecule according to claim 36, wherein the linker and the asialoglycoprotein receptor targeting moiety, together with the last nucleotide on the 3' end of said sense strand, have a structure represented by Formula (V'), Formula (V'"), Formula (V'""), Formula (V'""), or Formula (V""")
[0294] [ka] wherein Z in formula (V') is -H, -OH, -O-methyl, -F, or -O-methoxyethyl, and R in formula (V') is adenine, uracil, guanine, cytosine, thymine, abasic, or the like;
[0295] [ka] (Z in formula (V'''') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V'''') is adenine, uracil, guanine, cytosine, thymine, an abasic moiety, or other.)
[0296] [ka] wherein Z in formula (V''''') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V'''') is adenine, uracil, guanine, cytosine, thymine, an abasic moiety, or other; or
[0297] [ka] 36. The polynucleic acid molecule conjugate of any one of embodiments 31 to 35, as shown in formula (V''''"), wherein Z in formula (V''''") is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V''''") is adenine, uracil, guanine, cytosine, thymine, an abasic moiety, or the like.
[0298] Embodiment 37. The linker and the asialoglycoprotein receptor targeting moiety, together with the last nucleotide on the 3' end of the sense strand of the polynucleic acid molecule, have the formula (V'):
[0299] [ka] 37. The polynucleic acid molecule conjugate of embodiment 36, as shown in formula (V'), wherein Z is -H, -OH, -O-methyl, -F, or -O-methoxyethyl; and R is adenine, uracil, guanine, cytosine, thymine, abasic, or the like.
[0300] Embodiment 38. A pharmaceutical composition comprising a polynucleic acid molecule according to any one of embodiments
[0220] to 29 or a polynucleic acid molecule conjugate according to any one of embodiments 30 to 37, and a pharmaceutically acceptable excipient.
[0301] Embodiment 39. The pharmaceutical composition of embodiment 38, formulated as a nanoparticle formulation.
[0302] Embodiment 40. The pharmaceutical composition of embodiment 38 or embodiment 39, formulated for parenteral, oral, intranasal, buccal, rectal, transdermal, intravenous, subcutaneous, or intrathecal administration.
[0303] Embodiment 41. A method for modulating lipoprotein(a) (Lp(a)) expression in a subject in need of modulation of Lp(a) gene expression, comprising:
[0304] A method comprising the step of regulating expression of the Lp(a) gene in a subject by administering to the subject a polynucleic acid molecule described in any one of embodiments
[0220] to 28, a polynucleic acid molecule conjugate described in any one of embodiments 29 to 37, or a pharmaceutical composition described in any one of embodiments 38 to 40.
[0305] Embodiment 42. A method for treating or preventing a cardiovascular disease or a lipid disorder, comprising:
[0306] A method comprising the step of regulating expression of the Lp(a) gene in a subject by administering to the subject a polynucleic acid molecule described in any one of embodiments
[0238] to 28, a polynucleic acid molecule conjugate described in any one of embodiments 29 to 37, or a pharmaceutical composition described in any one of embodiments 38 to 40.
[0307] Embodiment 43. The method of embodiment 41 or 42, wherein the polynucleic acid molecule is administered at a dose sufficient to reduce expression of the Lp(a) gene in the cells of said subject by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% compared to a control.
[0308] Embodiment 44. The method of embodiment 41 or 42, wherein the polynucleic acid molecule is administered at a dose sufficient to reduce the subject's plasma Lp(a) level by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% compared to a control.
[0309] Embodiment 45. The method of any one of embodiments 41 to 44, wherein the polynucleic acid molecule is administered in at least two doses, including an initial dose and a secondary dose.
[0310] Embodiment 46. The method of embodiment 45, wherein the secondary dose is administered 1 to 30 days after administration of the first dose.
[0311] Embodiment 47. The method of any one of embodiments 42-46, wherein the cardiovascular disease is coronary artery disease, acute myocardial infarction, asymptomatic carotid atherosclerosis, stroke, atrial fibrillation, or peripheral arterial occlusive disease.
[0312] Embodiment 48. The method of any one of embodiments 42-46, wherein the lipid disorder is hyperlipidemia or hypercholesterolemia. [Example]
[0313] These examples are provided for illustrative purposes only and do not limit the scope of the claims provided herein.
[0314] Example 1 - In vitro efficacy of siRNA targeting Lp(a) in primary human hepatocytes (PHH) Thaw primary human hepatocytes and plate 9 x 10 cells per well on a collagen-coated 96-well plate. 4 Hepatocytes were seeded at a density of 1 / 3 cells. Hepatocytes were treated with conjugated siRNA in the absence of transfection reagent (free uptake method). Cells were treated with siRNA at a concentration of 10 μM or 0.5 μM. Untreated PHH was used as a negative control. siRNA targeting an unrelated gene (Ahsa1) was also used as a negative control. Cells were incubated at 37°C, 5% CO2 for 48 hours. At the end of the incubation period, cells were lysed, and the relative expression of the target gene was measured by branched DNA (bDNA) assay and normalized to housekeeping genes using standard protocols.
[0315] The sense and antisense strand modifications of the tested siRNAs are listed in Table 1. Note that each of the sense strand sequences was conjugated to GalNac-L96 at its 3' end. The in vitro potency data of the siRNAs are shown in Table 3.
[0316] Forty-eight Lp(a) siRNAs were selected for dose-response correlation according to standard dose-response curve protocols. Doses tested included 10.0, 3.33, 1.11, 0.37, 0.12, 0.04, 0.01, 0.005, 0.002, and 0.001 μM siRNA. siRNAs were purified to at least approximately 85%.
[0317] A summary of the dose-response curve data is shown in Table 4. The dose-response curves are shown in Figures 1A-1VV.
[0318] Example 2 - Testing of Lp(a) siRNA in non-human primates Fifteen Lp(a) siRNAs (represented as "SRS-000008" to "SRS-000022" in Table 2) were tested in non-human primate studies. In each siRNA, the 3' end of the passenger / sense strand was conjugated to GalNAc via X2 (see formula (V')). The Lp(a) siRNAs had sequences that were cross-reactive with the cynomolgus monkey LPA gene. Male cynomolgus monkeys (n = 4 per treatment group / siRNA) received a single subcutaneous injection of 3 mg / kg of Lp(a) siRNA constructs SRS-000008 to SRS-000022. Animals were fasted overnight, and then blood samples were collected on day -1 (pre-dose) and days 3, 7, 10, 14, 21, 28, 35, 42, 49, 56, 63, 70, 77, and 84. Lp(a) circulating protein levels in all serum samples were analyzed using an Lp(a) ELISA assay (Abcam, catalogue no. ab212165).
[0319] Preparation of formulations siRNA was prepared at room temperature under sterile conditions on the day of administration. The siRNA was dissolved in sodium chloride and rotated or stirred until completely dissolved. The solution was filtered through a 0.22 μM sterile filter and collected in a sterile container. The formulation was stored at 2–8°C. The siRNA was dissolved in an appropriate amount of vehicle to obtain a concentration of 10 mg / mL for each administration formulation. On the day of administration, the siRNA formulation was stored at 2–8°C for administration. The administration procedure was completed within 6 hours.
[0320] animal Cynomolgus monkeys were used in this study. Animals were housed in groups of no more than five at the same dose level in stainless steel cages in an environmentally monitored, well-ventilated room (conventional grade) maintained at a temperature of 18°C to 26°C and a relative humidity of 40% to 70%. Fluorescent lighting was provided for approximately 12 hours per day.
[0321] Experimental design To obtain groups of the same sex and comparable weights, all monkeys were randomly assigned to each treatment group using a computer-generated randomization procedure. Weights required for randomization were obtained on day -5 (5 days before the first dose). After randomization, monkeys were assigned to one of the treatment groups.
[0322] Using suitable disposable syringes and auxiliary needles, the siRNA formulations were subcutaneously injected into the skin of each monkey in each group at a single or multiple sites on the hind limbs and / or neck and back.The hair around the injection site was shaved before administration, and 2 mL or less was administered at each injection site.The dose was calculated based on the most recently scheduled body weight.
[0323] Blood samples for the detection of serum concentrations of lipoprotein A (Lp(a)) were collected from the subcutaneous vein of the forelimb or hind limb. After overnight fasting, the monkeys were given blood samples for the evaluation of serum concentrations of Lp(a).
[0324] Whole blood samples were added to centrifuge tubes coated with separating gel and coagulant for temporary storage and transferred to room temperature. Blood samples were handled within 2 hours and centrifuged at 1500g for 10 minutes at room temperature. After centrifugation, serum was aliquoted into two new tubes and transferred to newly labeled centrifuge tubes. All samples were stored below -20°C, and repeated freeze-thaw cycles were avoided. Samples were maintained using the Watson LIMS 7.5 system. Serum concentrations of Lp(a) were analyzed using an ELISA kit (catalog number: ab212165, manufacturer: Abcam).
[0325] Data analysis Serum concentrations of Lp(a) were determined using an ELISA assay (Abcam, catalog no. ab212165) from serum samples collected on day -1 (pre-dose) and days 3, 7, 10, 14, 21, 28, 35, 42, 49, 56, 63, 70, 77, and 84. Results for each individual animal were expressed as the % change in circulating Lp(a) protein relative to the pre-dose (day -1) time point. The mean % change and standard deviation for each treatment group are shown in Table 6 and plotted in Figure 2.
[0326] Example 3 - Testing of Lp(a) siRNA in non-human primates In a similar experiment to that described in Example 2, four Lp(a) siRNAs, SRS-000013, SRS-000016, SRS-000017, and SRS-000018, were tested in cynomolgus monkeys. In each siRNA, the 3' end of the passenger / sense strand was conjugated to GalNAc via X2 (see formula (V')). The Lp(a) siRNAs had sequences that were cross-reactive with the cynomolgus monkey LPA gene. Male cynomolgus monkeys (n=4 per treatment group / siRNA) received a single subcutaneous injection of 1 mg / kg of each Lp(a) siRNA. After overnight fasting, the animals were given blood samples on day -1 (before administration) and days 3, 7, 10, 14, 21, 28, 35, 42, 49, 56, 63, 70, 77, and 85. Additional blood samples were collected on days 98, 105, 112, 119, 126, 133, and 140 in the SRS-000016 and SRS-000018 treatment groups. Lp(a) circulating protein levels in all serum samples were analyzed using an Lp(a) ELISA assay (Abcam, catalog number ab212165). Results for each individual animal were expressed as the % change in circulating Lp(a) protein relative to the pre-dose (day -1) time point. The mean % change and standard deviation for each treatment group are shown in Table 7 and plotted in Figure 3.
[0327] While preferred embodiments of the present disclosure have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will occur to those skilled in the art without departing from the present disclosure. It is understood that various alternatives to the embodiments of the present disclosure described herein may be employed in practicing the present disclosure. The following claims define the scope of the disclosure, and it is intended that methods and structures within the scope of these claims and their equivalents be covered thereby.
[0328] [Table 3]
[0329] [Table 4-1]
[0330] [Table 4-2]
[0331] [Table 4-3]
[0332] [Table 4-4]
[0333] [Table 5-1]
[0334] [Table 5-2]
[0335] [Table 5-3]
[0336]
Table 5-4
[0337]
Table 5-5
[0338]
Table 5-6
[0339]
Table 5-7
[0340]
Table 5-8
[0341]
Table 5-9
[0342]
Table 5-10
[0343]
Table 5-11
[0344]
Table 6-1
[0345]
Table 6-2
[0346]
Table 7-1
[0347]
Table 7-2
[0348]
Table 8
Claims
1. A polynucleic acid molecule for regulating the expression of a lipoprotein (a) (Lp(a)) gene, comprising a sense strand and an antisense strand, wherein the sense strand is at least 85% identical to a nucleic acid sequence selected from SEQ ID NOs: 357, 312, 313, 314, 319, 326, 329, 352, 355, 368, 372, 396, 397, 398, and 406, or comprises a nucleic acid sequence having at least 19 consecutive nucleotides of the nucleic acid sequence.
2. The polynucleic acid molecule according to claim 1, wherein the antisense strand comprises a nucleic acid sequence comprising at least 14 consecutive nucleotides of a nucleic acid sequence selected from SEQ ID NOs: 49, 4, 5, 6, 11, 18, 21, 44, 47, 60, 64, 88, 89, 90, and 98.
3. The polynucleic acid molecule (a) an antisense strand containing the nucleic acid sequence UCUCUGUCCCAUUACCGUGGUGAGC (SEQ ID NO: 49), and a sense strand containing the nucleic acid sequence UACCACGGUAAUGGGACAGAGA (SEQ ID NO: 357), (b) an antisense strand containing the nucleic acid sequence UAGAUGAACCAAGCUUGGCAGUCUC (SEQ ID NO: 4), and a sense strand containing the nucleic acid sequence CCUGCCAAGCUUGGUCAAUCUA (SEQ ID NO: 312), (c) an antisense strand containing the nucleic acid sequence UAUAGAUGACCAAGCUUGGCAGG (SEQ ID NO: 5), and a sense strand containing the nucleic acid sequence UGCCAAGCUUGGUCAAUCUAUA (SEQ ID NO: 313), (d) an antisense strand containing the nucleic acid sequence UCAUAGAUGAACCCAAGCUUGGCAG (SEQ ID NO: 6), and a sense strand containing the nucleic acid sequence GCCAAGCUUGGUCAAUCUAUGA (SEQ ID NO: 314), (e) an antisense strand containing the nucleic acid sequence UCGACGGCAGUUCCCCUUCUGUCUC (SEQ ID NO: 11), and a sense strand containing the nucleic acid sequence CGCAGAAGGGACUGCCCUGUCGA (SEQ ID NO: 319), (f) An antisense strand containing the nucleic acid sequence UUCUAGCUUGGAACCGGGGGUAA (SEQ ID NO: 18), and a sense strand containing the nucleic acid sequence ACCCCGGUUCCAAGCUAGAA (SEQ ID NO: 326), (g) an antisense strand containing the nucleic acid sequence UAGCCUCCUAGGCUUGGAACCGGG (SEQ ID NO: 21), and a sense strand containing the nucleic acid sequence CGGUUCCAAGCCCUAGAGCUA (SEQ ID NO: 329), (h) an antisense strand containing the nucleic acid sequence UUUACCGUGGUGAGCUCUCUGCA (SEQ ID NO: 44), and a sense strand containing the nucleic acid sequence CAGGAGUGCUACCACGGUAAA (SEQ ID NO: 352), (i) an antisense strand containing the nucleic acid sequence UUGUCCAUUACCGUGGGUAGCACU (SEQ ID NO: 47), and a sense strand containing the nucleic acid sequence UGCUACCACGGUAAUGGGACAA (SEQ ID NO: 355), (j) an antisense strand containing the nucleic acid sequence UAUUGUGUCAGGUUGCAGUACUC (SEQ ID NO: 60), and a sense strand containing the nucleic acid sequence GUACUGCAACCUGACACAAUA (SEQ ID NO: 368), (k) an antisense strand containing the nucleic acid sequence UUGCGGUCUGAGCCAAUUGUGUCAGG (SEQ ID NO: 64), and a sense strand containing the nucleic acid sequence UGACACAAUGCUCAGACGCAA (SEQ ID NO: 372), (l) an antisense strand containing the nucleic acid sequence UUAACUCUGUCCAAUAAUGGGUAGU (SEQ ID NO: 88), and a sense strand containing the nucleic acid sequence UACCAUUAUGGACACAGUUAA (SEQ ID NO: 396), (m)Antisense strand containing the nucleic acid sequence UCCAAGCUUGGCAAGUUCCUUCCU (SEQ ID NO: 89), and sense strand containing the nucleic acid sequence GAAGAACUUGCCCAAGCUUGGA (SEQ ID NO: 397), (n) an antisense strand containing the nucleic acid sequence UAGAUGAACCAAGCUUGGCAAGUU (SEQ ID NO: 90), and a sense strand containing the nucleic acid sequence CUUGCCCAAGCUUGGUCAAUCUA (SEQ ID NO: 398), or (o) The polynucleic acid molecule according to claim 1, comprising an antisense strand containing the nucleic acid sequence UGGUCCGACUAUGCUGUGUGUGUG (SEQ ID NO: 98) and a sense strand containing the nucleic acid sequence CACACCAGCAAUAGUCGGACCA (SEQ ID NO: 406).
4. The polynucleic acid molecule according to claim 1, wherein the sense strand includes at least two consecutive modified nucleotide bonds at its 5' end.
5. The polynucleic acid molecule according to claim 1, wherein the antisense chain comprises at least two consecutive modified nucleotide bonds at its 5' and / or 3' ends.
6. The polynucleic acid molecule according to claim 5, wherein the bond between the modified nucleotides is a phosphorothioate bond.
7. The polynucleic acid molecule according to claim 6, wherein the modified nucleotide bonds include stereochemically abundant phosphorothioate nucleotide bonds.
8. The polynucleic acid molecule according to claim 7, wherein the modified nucleotide bond is an S P chiral nucleotide phosphorothioate bond.
9. The polynucleic acid molecule according to claim 8, wherein the polynucleic acid molecule comprises a plurality of modified nucleotide bonds, and at least one of the plurality of modified nucleotide bonds is a stereochemically rich phosphorothioate nucleotide bond.
10. The polynucleic acid molecule according to claim 7, wherein at least one stereochemically abundant phosphorothioate is positioned between two consecutive nucleosides, which are two of the six 5' or 3' terminal nucleosides of the sense strand or the antisense strand.
11. The polynucleic acid molecule according to claim 1, wherein the antisense chain comprises 5'-nNfnnnnNfnnnnNfnNfnNfnnnnnnn-3', where n represents a 2'-O-methyl modified nucleotide and Nf represents a 2'-fluoro modified nucleotide.
12. The polynucleic acid molecule according to claim 1, wherein the sense chain comprises 5'-nnnnnnnNfnNfnNfnnnnnnnnnnnn-3', where n represents a 2'-O-methyl modified nucleotide and Nf represents a 2'-fluoro modified nucleotide.
13. The polynucleic acid molecule (a) an antisense strand containing the nucleic acid sequence usCfsucugUfccauUfaCfcGfugguasgsc (SEQ ID NO: 203), and a sense strand containing the nucleic acid sequence usasccacGfgUfaAfuggacagaga (SEQ ID NO: 511), (b) an antisense strand containing the nucleic acid sequence usAfsgaugAfccaaGfcUfuGfgcaggsusc (SEQ ID NO: 158), and a sense strand containing the nucleic acid sequence cscsugccAfaGfcUfuggucacaucua (SEQ ID NO: 466), (c) an antisense strand containing the nucleic acid sequence usAfsuagaUfgaccAfaGfcUfuggcasgsg (SEQ ID NO: 159), and a sense strand containing the nucleic acid sequence usgsccaaGfcUfuGfgucaucuaua (SEQ ID NO: 467), (d) an antisense strand containing the nucleic acid sequence usCfsauagAfugacCfaAfgCfuuggcsasg (SEQ ID NO: 160), and a sense strand containing the nucleic acid sequence gscscaagCfuUfgGfucaucuauga (SEQ ID NO: 468), (e) an antisense strand containing the nucleic acid sequence usCfsgacgGfcaguCfcCfuUfcugcgsusc (SEQ ID NO: 165), and a sense strand containing the nucleic acid sequence csgscagaAfgGfgAfcugccgucga (SEQ ID NO: 473), (f) an antisense strand containing the nucleic acid sequence usUfscuagGfcuugGfaAfcCfgggggusasa (SEQ ID NO: 172), and a sense strand containing the nucleic acid sequence ascscccgGfuUfcCfaagccuaagaa (SEQ ID NO: 480), (g) an antisense strand containing the nucleic acid sequence usAfsgccuCfuaggCfuUfgGfaaccggsgsg (SEQ ID NO: 175), and a sense strand containing the nucleic acid sequence csgsguucCfaAfgCfcuagaggcua (SEQ ID NO: 483), (h) an antisense strand containing the nucleic acid sequence usUfsuaccGfuggguAfgCfaCfuccugscsa (SEQ ID NO: 198), and a sense strand containing the nucleic acid sequence csasggagUfgCfuAfccacgguaaa (SEQ ID NO: 506), (i) an antisense strand containing the nucleic acid sequence usUfsguccAfuuacCfgUfgGfuagcascsu (SEQ ID NO: 201), and a sense strand containing the nucleic acid sequence usgscucacCfaCfgGfuaauggacaa (SEQ ID NO: 509), (j) an antisense strand containing the nucleic acid sequence usAfsuuguGfucagGfuUfgCfaguacsusc (SEQ ID NO: 214), and a sense strand containing the nucleic acid sequence gsusacugCfaAfcCfugacacaaua (SEQ ID NO: 522), (k) an antisense strand containing the nucleic acid sequence usUfsgcguCfugagCfaUfuGfugucasgsg (SEQ ID NO: 218), and a sense strand containing the nucleic acid sequence usgsacacAfaUfgCfucagacgcaa (SEQ ID NO: 526), (l) an antisense strand containing the nucleic acid sequence usUfsaacuCfugucCfaUfaAfugguasgsu (SEQ ID NO: 242), and a sense strand containing the nucleic acid sequence usasccauUfaUfgGfacagaguuaa (SEQ ID NO: 550), An antisense strand containing the nucleic acid sequence (m)usCfscaagCfuuggCfaAfgUfucuucscsu (SEQ ID NO: 243), and a sense strand containing the nucleic acid sequence gsasagaaCfuUfgCfcaagcuugga (SEQ ID NO: 551), (n) an antisense strand containing the nucleic acid sequence usAfsgaugAfccaaGfcUfuGfgcaagsusu (SEQ ID NO: 244), and a sense strand containing the nucleic acid sequence csusugccAfaGfcUfuggucacaucua (SEQ ID NO: 552), or (o) comprising an antisense strand containing the nucleic acid sequence usGfsguccGfacuaUfgCfuGfgugugsgsu (SEQ ID NO: 252), and a sense strand containing the nucleic acid sequence csascaccAfgCfaUfagucggacca (SEQ ID NO: 560), The polynucleic acid molecule according to claim 1, wherein "a" refers to 2'-O-methyladenosine-3'-phosphate, "Af" refers to 2'-fluoroadenosine-3'-phosphate, "c" refers to 2'-O-methylcytidine-3'-phosphate, "Cf" refers to 2'-fluorocytidine-3'-phosphate, "g" refers to 2'-O-methylguanosine-3'-phosphate, "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, and "s" refers to 3'-phosphorothioate.
14. A polynucleic acid molecule conjugate for regulating the expression of a lipoprotein (a) gene (Lp(a)), comprising a polynucleic acid molecule according to any one of claims 1 to 13 and an asial glycoprotein receptor targeting moiety.
15. The polynucleic acid molecule conjugate according to claim 14, wherein the asialoclycoprotein receptor targeting portion comprises N-acetylgalactosamine (GalNAc) or galactose.
16. The polynucleic acid molecule conjugate according to claim 15, wherein the polynucleic acid molecule and the asialocryprotein receptor targeting moiety are linked via a linker.
17. The linker and the asialoclycoprotein receptor targeting moiety, together with the last nucleotide on the 3' end of the sense strand of the polynucleic acid molecule, are of formula (V') 【Chemistry 1】 The polynucleic acid molecule conjugate according to claim 16, as shown in formula (V') (wherein Z is -H, -OH, -O-methyl, -F, or -O-methoxyethyl, and wherein formula (V') R is adenine, uracil, guanine, cytosine, thymine, a debase moiety, or the like).
18. A pharmaceutical composition comprising a polynucleic acid molecule according to any one of claims 1 to 13 for regulating the expression of a lipoprotein (a) (Lp(a)) gene in a subject requiring regulation of the expression of a lipoprotein (a) (Lp(a)) gene.
19. The pharmaceutical composition according to claim 18, wherein the subject requiring the composition suffers from cardiovascular disease, dyslipidemia, or both.
20. The pharmaceutical composition according to claim 19, wherein the cardiovascular disease is coronary artery disease, acute myocardial infarction, asymptomatic carotid atherosclerosis, stroke, atrial fibrillation, hypercholesterolemia, or peripheral artery occlusive disease, and the lipid disorder is hyperlipidemia or hypercholesterolemia.