Flow cell with swelling resin
Patent Information
- Application Number
- JP2024571915
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-08-26
- Filing Date
- 2023-08-24
- Publication Date
- 2026-08-25
AI Technical Summary
Existing flow cells face challenges in controlling multiple reactions on localized surfaces, particularly in minimizing polyclonality during nucleic acid sequencing and chemical manipulation, due to inefficient capture and release of pre-clustered particles.
Incorporation of a reversibly swelling resin with single-depth or multi-depth recesses that expand and contract in response to stimuli, allowing precise control over particle capture and release, reducing polyclonality by minimizing multiple seeding events.
The reversibly swelling resin effectively captures and releases particles, enhancing the precision of chemical and biochemical manipulations, thereby reducing polyclonality and improving the efficiency of nucleic acid sequencing.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical Field]
[0001] (CROSS-REFERENCE TO RELATED APPLICATIONS) This application claims the benefit of U.S. Provisional Patent Application No. 63 / 373,610, filed August 26, 2022, the contents of which are incorporated herein by reference in their entirety.
[0002] Sequence Listing Reference This application contains a Sequence Listing that has been submitted electronically in XML format, and is incorporated herein by reference in its entirety. The XML copy, created on August 4, 2023, is named ILI246BPCT_IP-2367-PCT_Sequence_Listing.xml and is 15,631 bytes in size. [Background technology]
[0003] Various protocols in biological or chemical research involve conducting multiple controlled reactions on a localized support surface or within a predetermined reaction chamber. The designated reactions can then be observed or detected, and subsequent analysis can help identify or reveal the properties of the chemicals involved in the reactions. In some instances, the controlled reactions produce fluorescence, and therefore optical systems can be used for detection. Summary of the Invention
[0004] The flow cells disclosed herein include a reversibly swelling resin having single-depth or multi-depth recesses separated by interstitial regions defined therein. The reversibly swelling resin responds to stimuli such as liquid and / or pH. Upon exposure to one of these stimuli, the resin swells. Because there is more resin material in the interstitial regions than in the recesses, the interstitial regions expand at a greater rate than the recesses. The expansion of the interstitial regions narrows the opening of each of the recesses. Removal of the stimulus or application of an orthogonal stimulus causes the resin to deswell or shrink.
[0005] In some examples of flow cells, the reversibly swelling resin is swelled to capture pre-clustered or grafted particles for further chemical and / or biochemical manipulation and deswelled to release the particles at a desired time. In other examples of flow cells, the reversibly swelling resin is swelled prior to seeding of nucleic acid templates. Smaller well openings minimize multiple seeding events occurring in a single well, thus reducing polyclonality. [Brief explanation of the drawings]
[0006] Features of examples of the present disclosure will become apparent by reference to the following detailed description and drawings, in which like reference numbers correspond to similar, if not identical, components, and for the sake of brevity, reference numbers or features having a previously mentioned function may or may not be described with reference to other drawings in which they appear. [Figure 1] FIG. 1 is a top view of an exemplary flow cell. [Figure 2A] FIG. 2A is a cross-sectional view taken along line 2A-2A in FIG. 1, showing the architecture within the flow channel of one example of a flow cell disclosed herein, including a single-depth recess defined in a reversibly swelling resin. [Figure 2B] The architecture of Figure 2A is shown after pre-clustered particles have been introduced into the flow channel of the flow cell and the reversibly swelling resin has been exposed to a stimulus. [Figure 3A] FIG. 3A is a cross-sectional view taken along line 3A-3A of FIG. 1, showing the architecture within the flow channel of another example of a flow cell disclosed herein, including a single-depth recess defined within a reversibly swelling resin. [Figure 3B] The architecture of Figure 3A is shown after the template strand has been introduced into the flow cell and the reversibly swelling resin has been exposed to a stimulus. [Figure 4A] FIG. 4A is a cross-sectional view taken along line 4A-4A of FIG. 1, illustrating the architecture within the flow channel of yet another example of a flow cell disclosed herein, including recesses of multiple depths defined within a reversibly swelling resin. [Figure 4B] 4A , which show a schematic representation of the architecture of FIG. 4A at different stages during the fabrication of a patterned structure, together with a flow diagram including the architecture of FIG. 4A , where grafted particles are introduced into the flow cell, the reversibly swelling resin is exposed to a stimulus ( FIG. 4B ), a functionalized layer is incorporated into the flow cell ( FIG. 4C ), and the interstitial region is washed ( FIG. 4D ). [Figure 4C] 4A , which show a schematic representation of the architecture of FIG. 4A at different stages during the fabrication of a patterned structure, together with a flow diagram including the architecture of FIG. 4A , where grafted particles are introduced into the flow cell, the reversibly swelling resin is exposed to a stimulus ( FIG. 4B ), a functionalized layer is incorporated into the flow cell ( FIG. 4C ), and the interstitial region is washed ( FIG. 4D ). [Figure 4D] 4A , which show a schematic representation of the architecture of FIG. 4A at different stages during the fabrication of a patterned structure, together with a flow diagram including the architecture of FIG. 4A , where grafted particles are introduced into the flow cell, the reversibly swelling resin is exposed to a stimulus ( FIG. 4B ), a functionalized layer is incorporated into the flow cell ( FIG. 4C ), and the interstitial region is washed ( FIG. 4D ). [Figure 5A] 1A and 1B show schematic diagrams of different grafted particles and pre-grafted polymers, respectively, that can be used together in an example flow cell. [Figure 5B] 1A and 1B show schematic diagrams of different grafted particles and pre-grafted polymers, respectively, that can be used together in an example flow cell. [Figure 5C] 1A and 1B show schematic diagrams of different grafted particles and pre-grafted polymers, respectively, that can be used together in an example flow cell. [Figure 5D] 1A and 1B show schematic diagrams of different grafted particles and pre-grafted polymers, respectively, that can be used together in an example flow cell. DETAILED DESCRIPTION OF THE INVENTION
[0007] The flow cell disclosed herein includes a reversibly swelling resin. The reversibly swelling resin has single-depth or multi-depth recesses patterned therein. In some examples, each single-depth recess is separated from other single-depth recesses by a gap region, or each multi-depth recess is separated from other multi-depth recesses by a gap region. In other examples, multi-depth recesses are formed adjacent to one another without a gap region separating the recesses. The reversibly swelling resin swells when exposed to a stimulus and deswells or shrinks upon removal of the stimulus or application of an orthogonal stimulus. In some examples of flow cells, the reversibly swelling resin swells to capture pre-clustered particles for synthesis and deswells to release sequenced particles. In other examples of flow cells, the reversibly swelling resin swells prior to seeding of nucleic acid templates. Smaller recess openings minimize multiple seeding events occurring in a single recess, thus reducing polyclonality.
[0008] definition Terms used herein should be understood to have their ordinary meaning in the relevant art unless otherwise specified. Some terms used herein and their meanings are described below.
[0009] The singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.
[0010] The terms comprising, including, containing, and the various forms of these terms are synonymous and intended to be equally broad.
[0011] Terms such as top, bottom, lower, upper, on, etc. are used herein to describe the flow cell and / or various components of the flow cell. It should be understood that these directional terms are not meant to indicate a specific orientation, but are used to designate the relative orientation between components. The use of directional terms should not be construed to limit the examples disclosed herein to any specific orientation.
[0012] The terms first, second, etc. are also not meant to indicate a particular orientation or order, but rather are used to distinguish one component from another.
[0013] Ranges provided herein should be understood to include the stated range and any value or subrange within that stated range, as if such value or subrange were explicitly recited. For example, a range of about 400 nm to about 1 μm (1000 nm) should be interpreted to include not only the explicitly recited limits of about 400 nm to about 1 μm, but also individual values, such as about 708 nm, about 945.5 nm, etc., and subranges, such as about 425 nm to about 825 nm, about 550 nm to about 940 nm, etc. Furthermore, when "about" and / or "substantially" are used to describe values, these are meant to encompass small variations (up to ±10%) of the stated value.
[0014] "Acrylamide monomer" has the structure
[0015] [ka] or a monomer containing an acrylamide group. An example of a monomer containing an acrylamide group is azidoacetamidopentylacrylamide:
[0016] [ka] and N-isopropylacrylamide.
[0017] [ka] Other acrylamide monomers may also be used.
[0018] As used herein, the term "activation" refers to a process of creating reactive groups on the surface of a base support or on the outermost layer of a multilayer structure. Activation can be achieved using silanization and / or plasma ashing. By way of example, the surface can have a silane (e.g., norbornene silane) added to it. Alternatively, the surface can be plasma ashed to create hydroxyl groups. Alternatively, the surface can be plasma ashed and then silanized. While the figures do not show a separate silanized layer or hydroxyl (-OH) groups from plasma ashing, it is understood that activation creates a silanized layer or -OH groups on the surface of the activated support or layer, covalently bonding the functionalized layer to the underlying support or layer.
[0019] An aldehyde, as used herein, is an organic compound containing a functional group having the structure -CHO, which includes a carbonyl center (i.e., a carbon double-bonded to oxygen) with a carbon atom also bonded to a hydrogen and an R group, such as an alkyl or other side chain. The general structure of an aldehyde is:
[0020] [ka] is.
[0021] As used herein, "alkyl" refers to a straight or branched hydrocarbon chain that is fully saturated (i.e., contains no double or triple bonds). The alkyl group can have 1 to 20 carbon atoms. Exemplary alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tertiary butyl, pentyl, hexyl, and the like. As an example, the designation "C1-4 alkyl" indicates that there are 1 to 4 carbon atoms in the alkyl chain, i.e., the alkyl chain is selected from the group consisting of methyl, ethyl, propyl, isopropyl, n-butyl, isobutyl, sec-butyl, and t-butyl.
[0022] As used herein, "alkenyl" refers to a straight or branched hydrocarbon chain containing one or more double bonds. Alkenyl groups can have 2 to 20 carbon atoms. Exemplary alkenyl groups include ethenyl, propenyl, butenyl, pentenyl, hexenyl, and the like.
[0023] As used herein, "alkyne" or "alkynyl" refers to a straight or branched hydrocarbon chain containing one or more triple bonds. Alkynyl groups can have 2 to 20 carbon atoms.
[0024] As used herein, "aryl" refers to an aromatic ring or ring system (i.e., two or more fused rings that share two adjacent carbon atoms) containing only carbon in the ring backbone. When aryl is a ring system, all rings in the system are aromatic. Aryl groups can have 6 to 18 carbon atoms. Examples of aryl groups include phenyl, naphthyl, azulenyl, and anthracenyl.
[0025] An "amine" or "amino" functional group refers to a -NRaRb group, where Ra and Rb are hydrogen (e.g.,
[0026] [ka] ), C1-6 (or C1-C6) alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-7 carbocycle, C6-10 aryl, 5- to 10-membered heteroaryl, and 5- to 10-membered heterocyclyl.
[0027] As used herein, the term "attached" refers to the state in which two things are joined, fastened, adhered, connected, or bonded to one another, either directly or indirectly. By way of example, the bond formed may be a covalent bond or a non-covalent bond. A covalent bond is characterized by the sharing of electron pairs between atoms. A non-covalent bond is a physical bond that does not involve the sharing of electron pairs, and can include, for example, hydrogen bonds, ionic bonds, van der Waals forces, hydrophilic interactions, and hydrophobic interactions.
[0028] An "azido" or "azido" functional group refers to an --N.
[0029] The term "base support" refers to a structure onto which various components of the flow cell (e.g., a reversibly swelling resin) can be added. The base support may be a wafer, a panel, a rectangular sheet, a die, or any other suitable configuration. The base support is generally rigid and insoluble in aqueous liquids. The base support may be inert to chemicals present in the recesses. For example, the base support may be inert to chemicals used to attach primers, chemicals used in sequencing reactions, etc. The base support may be a single-layer or multi-layer structure.
[0030] As used herein, "carbocycle" refers to a non-aromatic cyclic ring or ring system containing only carbon atoms in the ring system backbone. When a carbocycle is a ring system, two or more rings can be joined together in a fused, bridged, or spiro-connected manner. Carbocycles can have any degree of saturation, provided that at least one ring in the ring system is not aromatic. Thus, carbocycles include cycloalkyl, cycloalkenyl, and cycloalkynyl. Carbocyclic groups can have 3 to 20 carbon atoms. Examples of carbocyclic rings include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclohexenyl, 2,3-dihydro-indene, bicyclo[2.2.2]octanyl, adamantyl, and spiro[4.4]nonanyl.
[0031] As used herein, the term "carboxylic acid" or "carboxyl" as used herein refers to --COOH.
[0032] As used herein, "cycloalkylene" means a fully saturated carbocyclic ring or ring system attached to the rest of the molecule through two points of attachment.
[0033] As used herein, "cycloalkenyl" or "cycloalkene" means a carbocyclic ring or ring system having at least one double bond, wherein none of the rings within the ring system are aromatic. Examples include cyclohexenyl or cyclohexene and norbornenyl or norbornene. Also, as used herein, "heterocycloalkenyl" or "heterocycloalkene" means a carbocyclic ring or ring system having at least one double bond and at least one heteroatom within the ring backbone, wherein none of the rings within the ring system are aromatic.
[0034] As used herein, "cycloalkynyl" or "cycloalkyne" means a carbocyclic ring or ring system having at least one triple bond, wherein none of the rings in the ring system is aromatic. An example is cyclooctyne. Another example is bicyclononyne. As used herein, "heterocycloalkynyl" or "heterocycloalkyne" means a carbocyclic ring or ring system having at least one heteroatom in the ring backbone, wherein the ring has at least one triple bond, wherein none of the rings in the ring system is aromatic.
[0035] As used herein, the terms "deep portion" and "shallow portion" refer to three-dimensional (3D) space within a multi-depth recess, where the deep portion has a greater depth than the shallow portion, e.g., as measured from the opening of the multi-depth recess.
[0036] As used herein, the term "deposition" refers to any suitable application technique, which may be manual or automated, and which, in some cases, results in the modification of surface properties. Generally, deposition may be carried out using evaporation techniques, coating techniques, grafting techniques, etc. Some specific examples include chemical vapor deposition (CVD), spray coating (e.g., ultrasonic spray coating), spin coating, dunk or dip coating, doctor blade coating, puddle dispensing, flow-through coating, aerosol printing, screen printing, microcontact printing, inkjet printing, etc.
[0037] As used herein, the term "recess" refers to a discrete, concave feature in a substrate having a surface opening that may be at least partially surrounded by a gap region of the substrate. Recesses can take a variety of shapes at the surface opening, such as, for example, a circle, an ellipse, a square, a polygon, a star (with any number of vertices), etc. A cross section of a recess taken perpendicular to the surface can be curved, square, polygonal, hyperbolic, conical, angular, etc.
[0038] The term "each," when used in reference to a collection of items, is intended to identify each individual item in the set, but does not necessarily refer to every item in the set. Exceptions may occur where express disclosure or context clearly dictates otherwise.
[0039] As used herein, the term "epoxy" (also referred to as a glycidyl or oxirane group) refers to
[0040] [ka] Refers to...
[0041] As used herein, the term "flow cell" is intended to mean a vessel having a flow channel in which a reaction can occur, an inlet for delivering reagents to the flow channel, and an outlet for removing reagents from the flow channel. In some instances, the flow cell allows for detection of reactions occurring within the chamber. For example, the flow cell may include one or more transparent surfaces that allow for optical detection of arrays, optically labeled molecules, etc., within the flow channel.
[0042] As used herein, a "flow channel" or "channel" can be an area defined between two bonded components that can selectively receive a liquid sample. In some examples, a flow channel may be defined between a substrate and a lid and thus may be in fluid communication with one or more recesses defined in the substrate. A flow channel can also be defined between two substrate surfaces bonded together.
[0043] As used herein, "heteroaryl" refers to an aromatic ring or ring system (i.e., two or more fused rings that share two adjacent atoms) containing one or more heteroatoms, i.e., elements other than carbon, including, but not limited to, nitrogen, oxygen, and sulfur, in the ring backbone. When a heteroaryl is a ring system, all rings in the system are aromatic. Heteroaryl groups can have 5 to 18 ring members.
[0044] As used herein, "heterocycle" means a non-aromatic ring or ring system containing at least one heteroatom in the ring backbone. The heterocycles may be joined together in fused, bridged, or spiro-linked fashion.
[0045] Heterocyclic rings may have any degree of saturation, provided that at least one ring in the ring system is not aromatic. Within the ring system, heteroatoms may be present in either the non-aromatic or aromatic ring. Heterocyclic groups may have 3 to 20 ring members (i.e., the number of atoms forming the ring backbone, including carbon atoms and heteroatoms).
[0046] As used herein, the term "hydrazine" or "hydrazinyl" refers to the group -NHNH2.
[0047] As used herein, the term "hydrazone" or "hydrazonyl" as used herein means
[0048] [ka] R a and R b are each independently selected from hydrogen, C alkyl, C alkenyl, C alkynyl, C carbocyclyl, C aryl, 5-10 membered heteroaryl, and 5-10 membered heterocyclyl, as defined herein.
[0049] As used herein, "hydroxy" or "hydroxyl" refers to an --OH group.
[0050] As used herein, an "initiator" is a molecule that undergoes a reaction upon absorption of radiation or heat or upon exposure to free radicals, thereby generating reactive species. Initiators can initiate or catalyze chemical reactions that result in changes in the solubility and / or physical properties of a formulation. A "cationic initiator" or "photoacid generator" (PAG) is a molecule that becomes acidic upon exposure to radiation or free radicals. PAGs generally undergo irreversible photodissociation of protons. A "free radical initiator" is a molecule that generates radical species upon exposure to radiation or heat, facilitating a radical reaction.
[0051] As used herein, the term "gap region" refers to an area of a substrate that separates, for example, recesses. For example, a gap region can separate one recess of an array from another recess of the array. Two recesses that are separated from each other can be distinct, i.e., not in physical contact with each other. In many instances, the gap region is continuous, but the recesses are discontinuous, such as in the case of multiple recesses defined in an otherwise continuous surface. The separation provided by the gap region can be partial or complete.
[0052] "Lid" refers to a cover that can be attached to a patterned structure to form a flow cell.
[0053] The term "polymer hydrogel" refers to a semi-rigid polymer that is permeable to liquids and gases. Polymer hydrogels can swell when liquid (e.g., water) is absorbed and shrink when the liquid is removed, for example, by drying. Although hydrogels can absorb water, they are not water-soluble.
[0054] "Nitrile oxide" as used herein means "R a C≡N + O - " means a group, wherein R ais defined herein. Examples of preparation of nitrile oxides include in situ generation from aldoximes by treatment with chloramide-T, or by the action of base on imidoyl chloride [RC(Cl)=NOH], or by reaction of hydroxylamine with an aldehyde.
[0055] As used herein, "nitrone" refers to
[0056] [ka] means a group, wherein R 3 except that it is not hydrogen (H). 1 , R 2 , and R 3 is R as defined herein a and R b It can be any of the groups.
[0057] As used herein, a "nucleotide" comprises a nitrogen-containing heterocyclic base, a sugar, and one or more phosphate groups. Nucleotides are the monomeric units of nucleic acid sequences. In ribonucleic acid (RNA), the sugar is ribose, and in deoxyribonucleic acid (DNA), the sugar is deoxyribose, i.e., a sugar lacking the hydroxyl group at the 2' position of the ribose. The nitrogen-containing heterocyclic base (i.e., nucleobase) can be a purine or pyrimidine base. Purine bases include adenine (A) and guanine (G), as well as modified derivatives or analogs thereof. Pyrimidine bases include cytosine (C), thymine (T), and uracil (U), as well as modified derivatives or analogs thereof. The C-1 atom of deoxyribose is linked to the N-1 atom of a pyrimidine or the N-9 atom of a purine. Nucleic acid analogs may have alterations in the phosphate backbone, sugar, or nucleobase. Examples of nucleic acid analogs include universal base or phosphate-sugar backbone analogs, such as peptide nucleic acids (PNAs).
[0058] The term "orthogonal," when used to describe two stimuli, means that the stimuli are different from one another and have different effects on the reversibly swelling resin. One stimulus may be used to induce swelling, while the other stimulus may be used to reduce swelling, i.e., induce non-swelling.
[0059] In some instances, the term "over" can mean that one component or material is positioned directly on top of another component or material. In other instances, the term "over" can mean that one component or material is positioned indirectly on top of another component or material. Indirectly means that a gap or additional component or material may be positioned between the two components or materials.
[0060] As used herein, the term "polyhedral oligomeric silsesquioxane" refers to a hybrid intermediate between silica (SiO) and silicone (RSiO) (e.g., RSiO 1.5 An example of a polyhedral oligomeric silsesquioxane may be that described in Kehagias et al., Microelectronic Engineering 86 (2009), pp. 776-778, which is incorporated by reference in its entirety. In one example, the composition may have the chemical formula [RSiO 3 / 2 ] n where the R groups can be the same or different. Exemplary R groups of the polyhedral oligomeric silsesquioxanes include epoxy, azide / azido, thiol, poly(ethylene glycol), norbornene, tetrazine, acrylate, and / or methacrylate, or further, for example, alkyl, aryl, alkoxy, and / or haloalkyl groups.
[0061] As used herein, the term "primer" is defined as a single-stranded nucleic acid sequence (e.g., single-stranded DNA). Some primers are part of a primer set that function as initiation points for template amplification and cluster generation. Other primers, referred to herein as sequencing primers, function as initiation points for DNA synthesis. The 5' end of each primer in a primer set can be modified to allow for a coupling reaction with a functional group on a polymer chain. Primers can be any number of bases long and can contain a variety of non-naturally occurring nucleotides. In one example, sequencing primers are short, ranging from 10 to 60 bases or 20 to 40 bases.
[0062] The term "primer set" refers to a pair of primers that together allow amplification of a template nucleic acid strand (also referred to herein as a library template). Opposite ends of the template strand contain adapters that hybridize to each primer in the set.
[0063] A "thiol" functional group refers to -SH.
[0064] As used herein, the terms "tetrazine" and "tetrazinyl" refer to a six-membered heteroaryl group containing four nitrogen atoms. The tetrazine can be optionally substituted.
[0065] As used herein, "tetrazole" refers to a five-membered heterocyclic group containing four nitrogen atoms. The tetrazole can be optionally substituted.
[0066] The term "transparent" refers to a material, e.g., in the form of a layer, that can transmit a specific wavelength or range of wavelengths. For example, the material may be transparent to the wavelengths used in sequencing operations. Transparency can be quantified using transmittance, i.e., the ratio of light energy incident on an object to light energy transmitted through the object. The transmittance of a transparent layer depends on the thickness of the layer, the wavelength of light, and the exposure dose. In the examples disclosed herein, the transmittance of the transparent metal layer can range from 0.1 (10%) to 1 (100%). The material of the transparent metal layer can be a pure material, a material containing some impurities, or a mix of materials, as long as the resulting layer allows for the desired transmittance.
[0067] Reversibly Swelling Resin A reversibly swellable resin is a UV-curable resin that can swell in the presence of a particular stimulus and deswell, and therefore shrink, when the stimulus is removed or when the resin is exposed to another orthogonal stimulus. The monomer units of the composition used to form the cured resin impart desirable properties to the cured resin, including its swellability.
[0068] At least one hydrophilic monomer is included to increase the hydrophilicity of the cured resin surface, which in turn increases the swellability of the cured resin. In one example, the hydrophilic monomer is selected from the group consisting of poly(ethylene glycol)-based monomers, poly(propylene glycol)-based monomers, acid-containing monomers, and combinations thereof.
[0069] The poly(ethylene glycol)-based monomer is a monomer or macromonomer having 2 to about 1,000 ethylene glycol units. In other words, the poly(ethylene glycol) has a number-average molecular weight in the range of about 300 to about 20,000. In one example, the number-average molecular weight is in the range of about 300 to about 5,000. Specific examples of suitable poly(ethylene glycol)-based monomers include ethylene glycol diglycidyl ether, poly(ethylene glycol) (400) diglycidyl ether, and poly(ethylene glycol) (1000) diglycidyl ether. The poly(propylene glycol)-based monomer is a monomer or macromonomer having 2 to about 1,000 ethylene glycol units. In other words, the poly(propylene glycol) has a number-average molecular weight in the range of about 300 to about 20,000, and in some examples, about 300 to about 5,000. Some specific examples of suitable poly(propylene glycol)-based monomers include propylene glycol diglycidyl ether, poly(propylene glycol) (600) diglycidyl ether, or poly(propylene glycol) (1000) diglycidyl ether. The number-average molecular weight of poly(ethylene glycol) and / or poly(propylene glycol) can be adjusted to control the hydrophilicity and / or swelling properties of the resin. When used in combination, the weight ratio of poly(ethylene glycol) (poly(ethylene glycol) (PEG)) and poly(propylene glycol) (poly(propylene glycol) (PPG)) can be adjusted to control the hydrophilicity and / or swelling properties of the resin. Since more PEG increases swelling, a higher molecular weight PEG should increase the degree of swelling. In contrast, the solubility of PPG in water decreases as molecular weight increases. Therefore, the swelling properties can be adjusted by changing the ratio and / or molecular weight.
[0070] An acid-containing monomer is a monomer that contains one or more carboxylic acid / carboxylate or sulfonic acid / sulfonate groups that are deprotonated at high pH (eg, about 9 to about 10), making it anionic and swellable.
[0071] In one example, the monomers used to form the reversibly swelling resin consist of hydrophilic monomers. In this example, 100% (by weight) of the monomers polymerized to form the resin composition are hydrophilic monomers. In another example, the hydrophilic monomer is copolymerized with another monomer or polymer, which may be selected to introduce attachment functionality or to improve the imprintability of the resin. When other monomers or polymers are used with the hydrophilic monomer, the resin may contain about 0.5% (by weight) to 50% (by weight) of the hydrophilic monomer, based on the total solids content of the resin composition. In some examples, the resin composition may contain about 0.5% (by weight) to 20% (by weight) of the hydrophilic monomer, based on the total solids content of the resin composition. A higher percentage of hydrophilic monomer (e.g., about 20% to about 50%) may be particularly appropriate when polishing is not involved in the application of the polymer hydrogel.
[0072] In some examples, additional monomers are included in the resin composition to introduce functional groups into the cured resin that can attach to the polymer hydrogel or primer. When the polymer hydrogel or primer is covalently bonded to the reversibly swelling resin (see FIG. 2A), the additional monomer copolymerized with the hydrophilic monomer contains a functional group for covalently bonding to the polymer hydrogel or primer. In one particular example, the functional group is selected from the group consisting of alkynes, dienes (e.g., in the form of ring-strained alkenes), azides, and amines. Examples of monomers that can be used to introduce covalently bondable functional groups include glycidyl propargyl ether:
[0073] [ka] Methyl-5-norbornene-2,3-dicarboxylic anhydride:
[0074] [ka] Bicyclo[2.2.1]hept-5-ene-2,3-dicarboxylic anhydride:
[0075] [ka] 3-Azido-1-propanol:
[0076] [ka] 11-Azido-3,6,9-trioxaundecan-1-amine:
[0077] [ka] Propiolic Acid:
[0078] [ka] and combinations thereof.
[0079] The polymer hydrogel can non-covalently interact with an example of a reversibly swelling resin containing less than 20% by weight of hydrophilic monomers without any additional functional groups being added to the polymer hydrogel.
[0080] Each monomer that introduces a binding functional group can be included in an amount ranging from about 2% (mass) to about 50% (mass) based on the total solid content of the resin composition.
[0081] Examples of monomers or polymers that can improve the imprintability of the resin composition are hydrophobic monomers or polymers that contain epoxy or acrylate groups.
[0082] Examples of suitable hydrophobic monomers include epoxy-substituted silsesquioxane monomers, such as epoxycyclohexylethylpolysilsesquioxane:
[0083] [ka] Glycidyl polysilsesquioxane:
[0084] [ka] and combinations thereof. One example of a resin composition includes both epoxycyclohexylethylpolysilsesquioxane and glycidylpolysilsesquioxane present in a weight ratio ranging from about 3:7 to about 7:3. In one specific example, the weight ratio of epoxycyclohexylethylpolysilsesquioxane to glycidylpolysilsesquioxane is 1.5:1.
[0085] Examples of suitable hydrophobic polymers include acrylate-substituted polyhedral oligomeric silsesquioxane polymers, such as poly[(propylmethacryl-heptaisobutyl-polyhedral oligomeric silsesquioxane)-co-(t-butyl methacrylate)].
[0086] [ka]
[0087] Each monomer or polymer that improves the imprintability can be included in an amount ranging from about 2% (mass) to about 50% (mass) based on the total solid content of the resin composition.
[0088] Yet another exemplary monomer that can be copolymerized with the hydrophilic monomer allows the cured resin to adhere, for example, covalently, to the underlying base substrate. An example of this monomer is a reactive silane (e.g., epoxy silane), which can bond to the base substrate via an oxygen bond. This type of monomer may be desirable in acrylonitrile-based resin formulations.
[0089] Each monomer that enables adhesion to the base substrate can be included in an amount ranging from about 2% (by weight) to about 50% (by weight) based on the total solids content of the resin composition.
[0090] The resin composition used to form the reversibly swellable resin may also include a photoinitiator, a surface additive, and a solvent.
[0091] The photoinitiator is selected from the group consisting of free radical photoinitiators, cationic photoinitiators, and combinations thereof. An example of a free radical initiator is 1,1,2,2-tetraphenyl-1,2-ethanediol:
[0092] [ka] Ethyl pyruvate:
[0093] [ka] Thiol; Ethyl-3-methyl-2-oxobutanoate:
[0094] [ka] and combinations thereof. An example of a cationic initiator is bis-(4-methylphenyl)iodonium hexafluorophosphate:
[0095] [ka] Bis[4-(tert-butyl)phenyl]iodonium tetra(nonafluoro-tert-butoxy)aluminate:
[0096] [ka] Tris(4-((4-acetylphenyl)thio)phenyl)sulfonium tetrakis(perfluorophenyl)borate (PAG290):
[0097] [ka] (Wherein, R is
[0098] [ka] ) and combinations thereof.
[0099] In one example of the resin composition, the photoinitiator (or each photoinitiator if a combination is used) is present in an amount ranging from about 0.05% to about 10% by weight, based on the total solids content of the resin composition. In another example, the photoinitiator is present in an amount ranging from about 0.2% to about 8% by weight.
[0100] The surface additive can adjust the surface tension of the resin composition, thereby improving the coatability of the resin composition, promoting thin film stability, and / or improving leveling. Examples of surface additives include polyacrylate polymers (such as BYK®-350 available from BYK). The amount of the surface additive can be 5% by weight or less, based on the total weight of the resin composition.
[0101] The resin compositions disclosed herein may also include a solvent. The solvent can be added to the resin composition to achieve a desired viscosity for the deposition technique used to apply the resin composition and obtain a desired resin layer thickness. Examples of suitable solvents include propylene glycol monomethyl ether acetate (PGMEA), toluene, dimethyl sulfoxide (DMSO), tetrahydrofuran (THF), and the like. In some examples, the solvent is PGMEA.
[0102] When the solvent is added, the total solids concentration of the resin composition can range from about 15% to about 60% by weight (based on the total weight of the resin composition), and the amount of solvent can range from about 40% to about 85% by weight (based on the weight of the resin composition). The upper limit of the total solids content can be higher depending on the solubility of each solid component in the selected solvent. In some examples, the solids content is about 30% or less.
[0103] The various components can be mixed together in any desired order to produce the resin composition. One example of a method for making any example of the resin composition disclosed herein includes mixing monomers (e.g., at least hydrophilic monomers) with initiators and surface additives, and dissolving the mix in a solvent.
[0104] The resin composition is UV curable. In one example, a 365 nm UV light source can be used to cure the resin composition to form a reversibly swellable resin.
[0105] Flow cell and method The reversibly swelling resins disclosed herein may be incorporated into patterned structures used to form flow cells. Different examples of patterned structures are shown and described with reference to Figures 2A and 2B, 3A and 3B, and 4A-4D.
[0106] A top view of each exemplary flow cell 10 is shown in FIG. 1. The flow cell 10 may be an open wafer (i.e., without a lid or second patterned structure), may include two patterned structures bonded together, or may include one patterned structure bonded to a lid. The two patterned structures, or one patterned structure and the lid, may be attached to one another via a spacer layer (not shown). The spacer layer may be any material that seals portions of the patterned structures together, or portions of the patterned structure and the lid. By way of example, the spacer layer may be an adhesive, a radiation-absorbing material that aids bonding, or the like. In some examples, the spacer layer is a radiation-absorbing material, such as KAPTON® Black. The patterned structures or the patterned structures and the lid may be bonded using any suitable technique, such as laser bonding, diffusion bonding, anodic bonding, eutectic bonding, plasma-activated bonding, glass frit bonding, or other methods known in the art.
[0107] If a lid is used, the lid can be any material that is transparent to the excitation light used in sequencing. In optical detection systems, the lid can also be transparent to the luminescence generated from the reaction occurring within the flow cell 10. By way of example, the lid can comprise glass (e.g., borosilicate, fused silica, etc.) or a transparent polymer. A commercially available example of a suitable borosilicate glass is D 263® available from Schott North America, Inc. Commercially available examples of suitable polymeric materials, i.e., cycloolefin polymers, are ZEONOR® products available from Zeon Chemicals LP.
[0108] Between two patterned structures, or between one patterned structure and a lid, is a flow channel 12. In an example having an open wafer, the flow channel 12 may be defined in a base support 16, and a patterned resin (e.g., resin 18) may be positioned within the flow channel. In this example, the flow channel 12 is not enclosed, but rather open. The example shown in FIG. 1 includes eight flow channels 12. While eight flow channels 12 are shown, it should be understood that any number of flow channels 12 may be included in the flow cell 10 (e.g., a single flow channel 12, four flow channels 12, etc.). When multiple flow channels 12 are included, each flow channel 12 may be isolated from each of the other flow channels 12 so that fluids introduced into one flow channel 12 do not flow into adjacent flow channels 12. Some examples of fluids introduced into the flow channels 12 may introduce reaction components (e.g., DNA sample, polymerase, sequencing primers, nucleotides, etc.), wash solutions, deprotection agents, etc.
[0109] The flow channels 12 can have any desired shape. In one example, the flow channels 12 have a substantially rectangular configuration. The length of the flow channels 12 depends in part on the size of the base support of the patterned structure. The width of the flow channels 12 depends in part on the size of the base support of the patterned structure, the desired number of flow channels 12, the desired spacing between adjacent channels 12, and the desired spacing around the perimeter of the patterned structure.
[0110] The height of flow channel 12 can be as small as a monolayer thickness when microcontact, aerosol, or inkjet printing is used to deposit the separate materials defining the walls of flow channel 12. As another example, the height of flow channel 12 can be about 1 μm, about 10 μm, about 50 μm, about 100 μm, or greater. In one example, the height can range from about 10 μm to about 100 μm. In another example, the height can range from about 10 μm to about 30 μm. In yet another example, the height is about 5 μm or less. It should be understood that the height of flow channel 12 can be greater than, less than, or between the values specified above.
[0111] Each flow channel 12 is in fluid communication with an inlet and an outlet (not shown). The inlet and outlet of each flow channel 12 may be located at opposite ends of the flow cell 10. Alternatively, the inlet and outlet of each flow channel 12 may be located anywhere along the length and width of the flow channel 12 that allows for the desired fluid flow.
[0112] The inlets allow fluid to be introduced into the flow channel 12, and the outlets allow fluid to be extracted from the flow channel 12. Each of the inlets and outlets is fluidly connected to a fluid control system (e.g., including reservoirs, pumps, valves, waste containers, etc.) that controls the introduction and removal of fluid.
[0113] 2A, 3A, and 4D show different examples of patterned structures 14, 14', 14'' and therefore different example architectures within flow channel 12 of flow cell 10. FIG.
[0114] First Exemplary Flow Cell and Method The patterned structure 14 in the first example of the flow cell 10 includes a base support 16, a reversibly swellable resin 18 positioned on the base support, and a recess 20 defined in the reversibly swellable resin 18, the recess 20 having a first opening dimension D1 when the reversibly swellable resin 18 is in a non-swelled state (Figure 2A) and a second opening dimension D2 smaller than the first opening dimension D1 when the reversibly swellable resin 18 is in a swollen state (Figure 2Bb).
[0115] Examples of base support 16 include epoxy siloxane, glass, modified or functionalized glass, plastics (acrylic, polystyrene and copolymers of styrene with other materials, polypropylene, polyethylene, polybutylene, polyurethane, polytetrafluoroethylene (e.g., TEFLON® from Chemours), cycloolefin / cycloolefin polymer (COP) (e.g., ZEONOR® from Zeon), polyimide, nylon (polyamide), etc.), ceramic / ceramic oxide, silica, fused silica, or silica-based materials, aluminum silicate, silicon and modified silicon (e.g., boron-doped p+ silicon), silicon nitride (Si3N4), silicon oxide (SiO2), tantalum pentoxide (Ta2O5), or other tantalum oxides (TaO x ), hafnium oxide (HfO2), carbon, metals, inorganic glass, etc.
[0116] Any example of the resin composition disclosed herein is deposited on base support 16 and patterned to form reversibly swellable resin 18. The resin composition may be deposited on base support 16 using any suitable application technique, which may be manual or automated. By way of example, deposition of the resin composition can be carried out using vapor deposition techniques, coating techniques, grafting techniques, etc. Some specific examples include chemical vapor deposition (CVD), spray coating (e.g., ultrasonic spray coating), spin coating, dunk or dip coating, doctor blade coating, droplet dispensing, aerosol printing, screen printing, microcontact printing, inkjet printing, etc. In one example, spin coating is used.
[0117] After the resin composition is deposited, it can be soft-baked to remove excess solvent and / or improve resin layer / substrate adhesion. If performed, the soft-bake can be performed at a relatively low temperature in the range of about 50°C to about 150°C for more than 0 seconds to about 3 minutes after the resin composition is deposited and before an imprinting device (e.g., a working stamp or other mold) is positioned therein. In one example, the soft-bake time ranges from about 30 seconds to about 2.5 minutes.
[0118] The deposited resin composition is then patterned using any suitable patterning technique. In one example, nanoimprint lithography is used to pattern the resin composition. In nanoimprint lithography, an imprinting device is pressed or rolled against a layer of the resin composition to create an imprint on the resin composition. The imprinting device contains a mold of the desired pattern that is transferred to the resin composition.
[0119] To generate the pattern shown in Figure 2A, the imprinting device includes protrusions that are negative replicas of the recesses 20 formed in the resin composition.
[0120] Many different patterns of recesses 20 are possible, including regular, repeating, and irregular patterns. In one example, recesses 20 are arranged in a hexagonal grid to provide close packing and improve density. Other layouts may include, for example, rectangular layouts, triangular layouts, etc. In some examples, the layout or pattern may be an xy format of recesses 20 in rows and columns. In some other examples, the layout or pattern may be a repeating arrangement of recesses 20 separated by gap regions 28.
[0121] The layout or pattern of the recesses 20 may be characterized in terms of the density of the recesses 20 (e.g., the number of recesses 20) within a defined area. For example, the recesses 20 may be arranged so that they are spaced apart from each other by 1 mm 2 For example, they may be present at a density of about 2 million per mm 2 Approximately 100, 1mm per 2 Approximately 1,000 per 1mm 2 Approximately 100,000 per 1mm 2 Approximately 1 million per 1mm 2 Approximately 2 million per 1mm 2 Approximately 5 million per 1mm 2 Approximately 10 million per mm 2 The density of the recesses 20 can be adjusted to different densities, including densities of about 50 million per recess, or more or less. It should be further understood that the density of the recesses 20 can be between one of the lower limit values and one of the upper limit values selected from the ranges above. By way of example, a high-density array can be characterized as having recesses 20 separated by less than about 100 nm, a medium-density array can be characterized as having recesses 20 separated by about 400 nm to about 1 μm, and a low-density array can be characterized as having recesses 20 separated by more than about 1 μm. While several example densities are provided, it should be understood that any suitable density can be used. In some cases, it may be desirable for the spacing between the recesses 20 to be even greater than the examples listed herein.
[0122] The layout or pattern of recesses 20 may be characterized in terms of an average pitch, or the spacing from the center of one recess 20 to the center of an adjacent recess 20 (center-to-center spacing), or the spacing from the left edge of one recess 20 to the right edge of an adjacent recess 20 (edge-to-edge spacing). The pattern may be regular, such that the coefficient of variation around the average pitch is small, or the pattern may be irregular, in which case the coefficient of variation may be relatively large. In either case, the average pitch may be, for example, about 50 nm, about 0.1 μm, about 0.5 μm, about 1 μm, about 5 μm, about 10 μm, about 100 μm, or more or less. The average pitch for a particular pattern of recesses 20 may be between one of the lower and upper limits selected from the ranges above. In one example, the recesses 20 have a pitch (center-to-center spacing) of about 1.5 μm. While example average pitch values have been provided, it should be understood that other average pitch values may also be used.
[0123] The size of each recess 20 can be characterized by its volume, open area, depth, and / or diameter or length and width. By way of example, the volume can be approximately 1×10 -3 μm 3 ~Approx. 1×104μm 3 The area of each recess opening can be in the range of about 1×10 -3 μm 2 ~Approx. 1×10 3 μm 2 The depth of each recess 20 can be in the range of about 0.1 μm to about 1×10 3 The diameter or length and width of each recess 20 can be in the range of about 50 nm to about 1×10 3 It can be in the μm range.
[0124] Referring back to the method for forming the reversibly swellable resin 18, the deposited resin composition may then be cured with the imprinting device in place, forming the reversibly swellable resin 18 with the recesses 20 defined therein. Curing may be achieved by exposing the resin composition (with the imprinting device pressed therein) to incident light at a suitable energy dose (e.g., in the range of about 0.5 J to about 10 J) for 60 seconds or less. The incident light may be actinic radiation, such as ultraviolet (UV) radiation. In one example, the majority of the emitted UV radiation may have a wavelength of about 365 nm. In this example, curing may be carried out using a 365 nm ultraviolet (UV) light source, and the deposited resin composition is exposed to the UV light for a time ranging from about 3 seconds to about 30 seconds. In this example, the 365 nm UV light source has an output of 330 mW / cm. 2 The light emitting diode (LED) may be a light emitting diode (LED) having a power output (measured at sample level) of 1000 W / m.p.m.
[0125] In the examples disclosed herein, light energy exposure initiates polymerization and crosslinking of monomers in the resin composition. The curing process can include a single UV exposure step or a single heating event.
[0126] After curing, the imprinting device can be removed. Upon release of the imprinting device, topographical features, such as recesses 20, are defined in the cured reversibly swellable resin 18.
[0127] The patterned structure 14 shown in FIG. 2A may be used as an open wafer or may be bonded to a second patterned structure 14 or a lid (not shown) to form a flow cell 10 having the architecture represented by FIG. 2A within each flow channel 12.
[0128] This exemplary flow cell 10 is used with pre-clustered particles 22 (FIG. 2B), which are described below.
[0129] Each of the pre-clustered particles 22 comprises a particle core 24 and a plurality of amplicons 26 attached to the particle core 24. To generate the pre-clustered particles 22, grafted particles are used in off-flow cell amplification techniques. The grafted particles comprise a particle core 24 and a primer set attached to the core 24 (an example of a grafted particle 36 is shown in FIG. 4B).
[0130] In some examples, particle core 24 is formed from a polymer hydrogel. By way of example, the polymer hydrogel material can be poly(N-(5-azidoacetamidylpentyl)acrylamide-co-acrylamide) (PAZAM) or another acrylamide copolymer disclosed herein, PEG-acrylate, PEG-diacrylate, PEG-amine, PEG-carboxylate, PEG-dithiol, PEG-epoxide, PEG-isocyanate, PEG-maleimide, cross-linked poly(methyl methacrylate) (PMMA), polyvinylpyrrolidone (PVPON), polyvinyl alcohol (PVA), polyethylene oxide-polypropylene oxide block copolymer (PEO-PPO), poly(hydroxyethyl methacrylate ... The hydrogel may be based on one or more of: poly(N-isopropylacrylamide) (PHEMA), poly(N-isopropylacrylamide) (PNIPAAm), poly(lactic acid)-poly(ethylene glycol) block copolymer, poly(ethylene glycol)-poly(lactic acid-co-glycolic acid) block copolymer, poly(acrylic-co-vinylsulfonic acid), poly(acrylamide-co-vinylsulfonic acid), poly(L-aspartic acid), poly(aspartamide), adipic acid dihydrazide- or aldehyde-modified poly(L-glutamic acid), bisacrylamide, or polylysine, starch, agar, agarose, heparin, alginate, alginate sulfate, dextran sulfate, hyaluronan, pectin, carrageenan, gelatin, chitosan, cellulose, and collagen, or a combination or mix thereof.
[0131] In some of the examples disclosed herein, the polymer hydrogel is a copolymer that includes at least one acrylamide monomer unit and is a linear polymer hydrogel or a branched polymer hydrogel (eg, a dendrimer).
[0132] The linear or branched polymer hydrogel has the formula (I):
[0133] [ka] A first repeat unit of the formula: R 1 is selected from the group consisting of -H, halogen, alkyl, alkoxy, alkenyl, alkynyl, cycloalkyl, aryl, heteroaryl, heterocycle, and optionally substituted variants thereof; R 2 is selected from the group consisting of azide, optionally substituted amino, optionally substituted alkenyl, optionally substituted alkyne, halogen, optionally substituted hydrazone, optionally substituted hydrazine, carboxyl, hydroxy, optionally substituted tetrazole, optionally substituted tetrazine, nitrile oxide, nitrone, sulfate, and thiol, each (CH) p may be optionally substituted, and p is an integer from 1 to 50; Formula (II):
[0134] [ka] a second repeat unit of formula (wherein R 3 , R 3’ , R 4 , R 4’ each independently represents -H, R 5 , -OR 5 , -C(O)OR 5 , -C(O)R 5 , -OC(O)R 5 , -C(O)NR 6 R 7 , and -NR 6 R 7 and R 5 is selected from the group consisting of -H, -OH, alkyl, cycloalkyl, hydroxyalkyl, aryl, heteroaryl, heterocycle, and optionally substituted variants thereof; R6 and R 7 each of which is independently selected from the group consisting of —H and alkyl.
[0135] An example of a polymer hydrogel is R 1 is -H and R 2 is an azide and R 3’ , R 4 , and R 4’ Each of is -H and R 3 is -C(O)NR 6 R 7 [wherein R 6 and R 7 each of R is -H], and p is 5. The polymer hydrogel is poly(N-(5-azidoacetamidylpentyl)acrylamide-co-acrylamide), or PAZAM. In one variation of PAZAM, R 1 is -H, and R 2 is an azide and R 3’ , R 4 , and R 4’ Each of is -H and R 3 is -C(O)NR 6 R 7 [wherein R 6 and R 7 each is C1-C6 alkyl (e.g., -CH3)], and p is 5.
[0136] In some instances, some R of the repeating units of formula (I) 2 is substituted with tetramethylethylenediamine (TEMED). TEMED is a reaction accelerator that can be introduced during copolymerization. As a result of side reactions, TEMED can form azide (N3) groups or other R groups. 2 This reaction replaces some of the azide (or other R groups) in the copolymer chain. 2 Although this reduces the content of methyl groups (e.g., methyl groups), the reaction also introduces branching sites, which may provide locations where copolymer chains can branch off from one another.
[0137] In another example, a third repeat unit of formula (II) may be included, provided that the second repeat unit and the third repeat unit are different from each other. For example, in the second repeat unit, R 3’ , R 4 , and R 4’ Each of is -H and R 3 is -C(O)NR 6 R 7 [wherein R 6 and R 7 each of which is -H], in the third repeat unit, R 3’ , R 4 , and R 4’ Each of is -H and R 3 is -C(O)NR 6 R 7 [Wherein, R 6 and R 7 each of which is a C1-C6 alkyl.
[0138] The number of first repeat units (Formula (I)) can be an integer ranging from 2 to 50,000, and the number of second repeat units (Formula (II)) can be an integer ranging from 2 to 100,000. If a third repeat unit is included, the number of repeat units can be an integer ranging from 1 to 100,000. It should be understood that the incorporation of individual units can be statistical, random, or block-wise and can depend on the method used to synthesize the polymer hydrogel.
[0139] In another example of a polymer hydrogel, the first repeat unit of formula (I) may be substituted with a heterocyclic azide group of formula (III):
[0140] [ka] In the formula, R 8 is H or C1-C6 alkyl, and R 9is H or C1-C6 alkyl; L is a linker comprising a linear chain of 2-20 atoms selected from the group consisting of carbon, oxygen, and nitrogen, and including 10 optional substituents on the carbon and any nitrogen atoms in the chain; E is a linear chain of 1-4 atoms selected from the group consisting of carbon, oxygen, and nitrogen, and including optional substituents on the carbon and any nitrogen atoms in the chain; A is an N-substituted amide with H or C1-C4 alkyl attached to the N; and Z is a nitrogen-containing heterocycle. Examples of Z include 5-10 carbon-containing ring members present as single ring structures or fused structures. Some specific examples of Z include pyrrolidinyl, pyridinyl, or pyrimidinyl.
[0141] In one example of a polymer hydrogel, Formula (III) is the first repeat unit and Formula (II) is the second repeat unit. In another example, Formula (III) is the first repeat unit, one example of Formula (II) is the second repeat unit, and a different example of Formula (III) is the third repeat unit.
[0142] It should be understood that other hydrogel materials can be used for the polymer hydrogel of particle core 24, so long as they are functionalized to graft the oligonucleotide primers of the primer set.
[0143] Other examples of suitable polymeric hydrogels include functionalized polysilanes (e.g., norbornene silanes, azido silanes, alkyne-functionalized silanes, amine-functionalized silanes, maleimide silanes, or any other polysilanes with functional groups capable of binding oligonucleotide primers). Other examples of suitable polymeric hydrogels include those with colloidal structures, such as agarose; polymer mesh structures, such as gelatin; or crosslinked polymer structures, such as polyacrylamide polymers and copolymers, silane-free acrylamide (SFA), or azide-decomposed versions of SFA. Examples of suitable polyacrylamide polymers can be synthesized from acrylamide and acrylic acid or vinyl-containing acrylic acid, or from monomers that form a [2+2] photocycloaddition reaction. Still other examples of suitable polymeric hydrogel materials include mixed copolymers of acrylamide and acrylate. Various polymer architectures containing acrylic monomers (e.g., acrylamide, acrylate, etc.) may be utilized in the examples disclosed herein, including highly branched polymers such as dendrimers. For example, monomers (such as acrylamide) can be incorporated into the branches (arms) of the dendrimer either randomly or in blocks.
[0144] Examples of dendrimeric polymer hydrogel materials include a dendritic core having repeating units of formulas (II) and (III) in arms extending from the core. The dendritic core can have anywhere from 3 to 30 arms.
[0145] The dendritic core may be any multifunctional entity that allows for a controlled polymerization mechanism, resulting in defined arm lengths in the polymer structure and at least substantially uniform arm lengths between polymer structures. In one example, the arms of the dendritic core are identical to each other.
[0146] The central molecule / compound of the dendritic core may be any polyfunctional molecule, such as a macrocycle (e.g., cyclodextrin, porphyrin, etc.), an extended π system (e.g., perylene, fullerene, etc.), a metal-ligand complex, a polymer core, etc. Some specific examples of the central molecule / compound of the dendritic core include a phenyl group, benzoic acid, pentraerythritol, a phosphazene group, etc.
[0147] The dendritic core comprises arms extending from a central molecule / compound. Each arm may comprise a group that allows for the incorporation of monomers of formulas (II) and (III). In one example, a thiocarbonylthio group is contained in each arm, thus comprising a reversible addition-fragmentation chain transfer agent (RAFT agent). In another example, the dendritic core comprises an atom transfer radical polymerization (ATRP) initiator in each arm. In yet another example, the dendritic core comprises a nitroxide (aminooxyl)-mediated polymerization (NMP) initiator in each arm.
[0148] It should be understood that functional groups in one or more of the repeating units of the polymer hydrogel of particle core 24 can bind primers (not shown in FIG. 2B). These functional groups (e.g., R 2 , NH2, N3, etc.) can be located in the side chains of linear or branched polymer hydrogel materials. As mentioned above, one example of a branched polymer hydrogel is a dendrimer, and in one example, the primer grafting functional group is located on each arm of the dendrimer. These functional groups may be introduced as part of the monomers used in copolymerization. To control the number of primer anchoring points, the amount of monomers bearing the functional groups can be increased or decreased. These functional groups may also be introduced after copolymerization.
[0149] In other examples, the particle core 24 is a multilayer particle comprising a core material coated with any of the examples of polymer hydrogels disclosed herein. In these examples, the core material is generally hard and insoluble in aqueous liquids. Examples of suitable core materials include magnetic materials (e.g., magnetic FeO x , silica-coated FeO x Examples of suitable polymeric materials include plastics (e.g., polytetrafluoroethylene (PTFE), some polyacrylics, polypropylene, polyethylene, polybutylene, polyurethane, polystyrene and other styrene copolymers, nylon (i.e., polyamide), etc.), polycaprolactone (PCL), nitrocellulose, silica (SiO2), silica-based materials (e.g., functionalized SiO2), carbon, or metal. In these examples, the polymer hydrogel coats the core material. The thickness of the polymer hydrogel on the core material ranges from about 10 nm to about 200 nm.
[0150] As described above, the grafted particles used to generate the pre-clustered particles 22 include a primer set attached to a core particle 24. In this example, the primer set includes two different primers used in sequential paired-end sequencing, in which each forward strand generated is sequenced and removed, and then each reverse strand generated, sequenced, and removed.
[0151] For example, the primer set may include P5 and P7 primers, P15 and P7 primers, or any combination of PA, PB, PC, and PD primers described herein. For example, the primer set may include any two PA, PB, PC, and PD primers, or any combination of one PA primer and one PB, PC, or PD primer, or any combination of one PB primer and one PC or PD primer, or any combination of one PC primer and one PD primer. Examples of P5 and P7 primers are used on the surface of commercially available flow cells sold by Illumina Inc. for sequencing on, for example, HISEQ™, HISEQX™, MISEQ™, MISEQDX™, MINISEQ™, NEXTSEQ™, NEXTSEQDX™, NOVASEQ™, ISEQ™, GENOME ANALYZER™, and other instrument platforms. The P5 and P7 primers have universal sequences for seeding and / or amplification purposes.
[0152] The P5 primer is as follows: P5: 5'→3' AATGATACGGCGACCACCGAGAUCTACAC (SEQ ID NO: 1)
[0153] The P7 primer can be either: P7#1:5'→3' CAAGCAGAAGACGGCATACGAnAT (SEQ ID NO: 2) P7#2:5'→3' CAAGCAGAAGACGGCATACnAGAT (SEQ ID NO: 3) P7#3:5'→3' CAAGCAGAAGACGGCATACnAnAT (SEQ ID NO: 4) where "n" is 8-oxoguanine in each of the sequences.
[0154] The P15 primer is as follows: P15:5'→3' AATGATACGGCGACCACCGAGAnCTACAC (SEQ ID NO: 5) where "n" is allyl-T.
[0155] Other primers (PA-PD) mentioned above include: PA5'→3' GCTGGCACGTCCGAACGCTTCGTTAATCCGTTGAG (SEQ ID NO: 6) cPA(PA')5'→3' CTCAACGGATTAACGAAGCGTTCGGACGTGCCAGC (SEQ ID NO: 7) PB5'→3' CGTCGTCTGCCATGGCGCTTCGGTGGATATGAACT (SEQ ID NO: 8) cPB(PB')5'→3' AGTTCATATCCACCGAAGCGCCATGGCAGACGACG (SEQ ID NO: 9) PC5'→3' ACGGCCGCTAATATCAACGCGTCGAATCCGCAACT (SEQ ID NO: 10) cPC(PC')5'→3' AGTTGCGGATTCGACGCGTTGATATTAGCGGCCGT (SEQ ID NO: 11) PD5'→3' GCCGCGTTACGTTAGCCGGACTATTCGATGCAGC (SEQ ID NO: 12) cPD(PD')5'→3' GCTGCATCGAATAGTCCGGCTAACGTAACGCGGC (SEQ ID NO: 13)
[0156] Although not shown in the exemplary sequence of PA-PD, it is understood that any of these primers may contain cleavage sites such as uracil, 8-oxoguanine, allyl-T, diol, etc. at any point in the strand.
[0157] It should be understood that the cleavage sites of the primers in the primer set of the grafted particle are orthogonal to each other (i.e., one cleavage site is not sensitive to the cleavage agent used for the other cleavage site), so that after amplification, either the forward strand or the reverse strand can be cleaved, leaving the other of the reverse strand or the forward strand for sequencing.
[0158] Each of the primers disclosed herein may also include a poly-T sequence at the 5' end of the primer sequence. In some examples, the poly-T region includes 2 to 20 T bases. As specific examples, the poly-T region may include 3, 4, 5, 6, 7, or 10 T bases.
[0159] The 5' end of each primer may also include a linker. Any linker containing a terminal alkyne group or another suitable terminal functional group capable of binding to the surface functional group of the polymer hydrogel (of particle core 24) can be used. In one example, the primer is 5'-terminated with hexynyl.
[0160] Immobilization of the primer may be by a single-point covalent bond at the 5' end of the primer. In this example, attachment relies in part on functional groups in the polymer hydrogel of particle core 24. Examples of terminal primers that can be used include alkyne-terminated primers, tetrazine-terminated primers, azide-terminated primers, amino-terminated primers, epoxy- or glycidyl-terminated primers, thiophosphate-terminated primers, thiol-terminated primers, aldehyde-terminated primers, hydrazine-terminated primers, phosphoramidite-terminated primers, and triazolinedione-terminated primers. In some specific examples, a succinimidyl (NHS) ester-terminated primer may be reacted with an amine of the polymer hydrogel, an aldehyde-terminated primer may be reacted with a hydrazine of the polymer hydrogel, an alkyne-terminated primer may be reacted with an azide of the polymer hydrogel, an azide-terminated primer may be reacted with an alkyne or DBCO (dibenzocyclooctyne, dibenzocyclooctyne, or bicyclononyne, BCN) of the polymer hydrogel, an amino-terminated primer may be reacted with an activated carboxylate group or NHS ester of the polymer hydrogel, a thiol-terminated primer may be reacted with an alkylating reactant (e.g., iodoacetamide or maleimide) of the polymer hydrogel, or a phosphoramidite-terminated primer may be reacted with a thioether of the polymer hydrogel. While several examples have been provided, it should be understood that any functional group that can be attached to the primer and to a functional group of the polymer hydrogel can be used.
[0161] The grafted particles disclosed herein are used in an off-flow cell amplification process to generate amplicons 26 (i.e., template nucleic acid strands) that are attached to particle cores 24. This forms pre-clustered particles 22 that can be used in a first exemplary flow cell 10 that includes the patterned structures 14 of FIG.
[0162] At the beginning of amplicon 26 formation, library templates can be prepared from any nucleic acid sample (e.g., a DNA sample or an RNA sample). DNA nucleic acid samples can be fragmented into similarly sized (e.g., less than 1000 bp) single-stranded DNA fragments. RNA nucleic acid samples can be used to synthesize complementary DNA (cDNA), and the cDNA can be fragmented into similarly sized (e.g., less than 1000 bp) single-stranded cDNA fragments. During preparation, adapters can be added to either end of the fragments. Through reduced cycle amplification, different motifs (e.g., sequencing primer binding sites, indexes, and regions complementary to primers on grafted particles) can be introduced into the adapters. In some examples, fragments from a single nucleic acid sample have the same adapters added to them. The final library template includes DNA or cDNA fragments and adapters at both ends. The DNA or cDNA fragments represent a portion of the final library template to be sequenced.
[0163] The library templates can be introduced into a suspension containing a liquid carrier and grafted particles. Examples of liquid carriers include water or buffers (e.g., Tris-HCl buffer or 0.5x saline sodium citrate (SSC) buffer). A surfactant / dispersant such as sodium dodecyl sulfate (SDS) or (CTAB) can also be included.
[0164] In suspension, one or more library templates are hybridized to one of two types of primers of a primer set immobilized on, for example, grafted particles.
[0165] Amplification of template nucleic acid strands on the grafted particles can be initiated to form clusters of template strands (i.e., amplicons 26) across the particle surface, resulting in pre-clustered particles 22 (Figure 2B). In one example, amplification involves cluster generation. In one example of cluster generation, library templates are copied from hybridized primers by 3' extension using a high-fidelity DNA polymerase. The original library templates are denatured, leaving immobilized copies around the entire periphery of the grafted particles. Isothermal bridge amplification or some other form of amplification can be used to amplify the immobilized copies. For example, the copied template loops over and hybridizes to adjacent complementary primers, and the polymerase copies the copied template to form a double-stranded bridge, which is denatured to form two single strands. These two strands then loop over and hybridize to adjacent complementary primers and are extended again to form two new double-stranded loops. This process is repeated for each template copy through cycles of isothermal denaturation and amplification to create dense clonal clusters on the grafted particle. Each cluster of double-stranded bridge structures is denatured. In the example, the reverse strand is removed by specific base cleavage, leaving the forward template strand. Clustering results in the formation of pre-clustered particles 22 containing multiple template strands / amplicons 26 immobilized on a particle core 24. This example of clustering is referred to as bridge amplification, and is one example of amplification that can be performed. It should be understood that other amplification techniques, such as exclusion amplification, can be used.
[0166] The pre-clustered particles 22 can be washed to remove unreacted library templates, etc., and suspended in a new liquid carrier to form a pre-clustered particle solution. Any of the examples of liquid carriers can be used.
[0167] An exemplary method includes introducing a pre-clustered particle solution into a flow cell 10 including patterned structures 14, allowing the pre-clustered particle solution to incubate within the flow cell 10, thereby causing the pre-clustered particles 22 to settle within the recesses 20, exposing the reversibly swelling resin 18 to a stimulus, thereby reducing the first opening dimension D1 to a second opening dimension D2 and trapping the pre-clustered particles 22 within the recesses 20, washing away any untrapped pre-clustered particles 22, and maintaining the stimulus exposure until an analysis involving at least the trapped pre-clustered particles 22 is performed.
[0168] The pre-clustered particles 22 can be used in sequencing on a flow cell 10 containing patterned structures 14. After off-board amplification and cluster generation, a pre-clustered particle solution is introduced into the flow cell 10. The solution can be incubated in the flow cell 10 for a predetermined time to allow the pre-clustered particles 22 to settle into their respective recesses 20. In one example, the incubation period can range from about 0.1 seconds to about 30 minutes.
[0169] During or after the incubation period, the reversibly swelling resin 18 can be exposed to a stimulus that swells the resin, thus reducing the first opening dimension D1 to the second opening dimension D2 and trapping each pre-clustered particle 22 in at least some of the recesses 20. The stimulus can be selected from the group consisting of a predetermined liquid or a liquid having a predetermined pH. Examples of predetermined liquids for swelling the resin 18 include water, alcohols (e.g., methanol, ethanol, propanol, ethylene glycol, propylene glycol, etc.), ionic liquids, etc. The predetermined pH that can act as a stimulus for swelling the resin 18 can range from about 4 to about 12. The liquid having the desired pH can be a buffer solution such as KPi, any phosphate buffer, or any other buffer solution with a pH suitable for eliciting a response from the reversibly swelling resin. Salt (e.g., NaCl, KCl, etc.) can be added to further increase the ionic strength of the buffer solution.
[0170] After incubation, a wash cycle can be performed to remove any untrapped pre-clustered particles 22 and the liquid carrier of the suspension.
[0171] Sequencing primers can then be introduced into flow cell 10. The sequencing primers hybridize to complementary portions of the sequences of amplicons 26 attached to pre-clustered particles 22 (now captured within recesses 20). These sequencing primers prepare amplicons 26 for sequencing.
[0172] An incorporation mix containing labeled nucleotides can then be introduced into flow cell 10, for example, via an input port. In addition to labeled nucleotides, the incorporation mix can include water, buffer, and a polymerase capable of nucleotide incorporation. Once the incorporation mix is introduced into flow cell 10, the mix enters flow channel 12 and contacts pre-clustered particles 22, which are captured and ready for sequencing.
[0173] The incorporation mix is incubated in the flow cell 20, and the labeled nucleotides (including optical labels) are incorporated by the respective polymerases into nascent strands along the amplicons 26 on each of the pre-clustered particles 22. During incorporation, one of the labeled nucleotides extends one sequencing primer by the respective polymerase and is incorporated into one nascent strand that is complementary to one of the amplicons 26. Incorporation is performed in a template strand-dependent manner, such that detection of the order and type of labeled nucleotides added to the nascent strand can be used to determine the sequence of the amplicon 26. Incorporation occurs in at least some of the amplicons 26 across the pre-clustered particles 22 during a single sequencing cycle.
[0174] The incorporated labeled nucleotides may contain reversible termination properties due to the presence of a 3'OH blocking group, which terminates further sequencing primer extension once the labeled nucleotide is added. After the desired time for incubation and incorporation, the incorporation mix, including unincorporated labeled nucleotides, may be removed from the flow cell 10 during a wash cycle. The wash cycle may involve a flow-through technique in which a wash solution (e.g., a buffer) is directed through and then out of the flow channel 12, for example, by a pump or other suitable mechanism.
[0175] Without further incorporation, the most recently incorporated labeled nucleotide can be detected by an imaging event.
[0176] During an imaging event, an illumination system may provide excitation light to flow cell 10. The optical labels of the incorporated labeled nucleotides emit optical signals in response to the excitation light.
[0177] After imaging, a cleavage mix can then be introduced into the flow cell 10. In one example, the cleavage mix can (i) remove the 3'OH blocking group from the incorporated nucleotide and (ii) cleave the optical label from the incorporated nucleotide. Examples of 3'OH blocking groups and suitable deblocking agents / components in the cleavage mix can include ester moieties that can be removed by base hydrolysis; allyl moieties that can be removed with NaI, chlorotrimethylsilane, and NaSO or with Hg(II) in acetone / water; azidomethyls that can be cleaved with phosphines such as tris(2-carboxyethyl)phosphine (TCEP) or tri(hydroxypropyl)phosphine (THP); acetals such as tert-butoxy-ethoxys that can be cleaved under acidic conditions; MOM (-CHOCH) moieties that can be cleaved with LiBF and CHCN / HO; 2,4-dinitrobenzenesulfenyl that can be cleaved with nucleophiles such as thiophenol and thiosulfate; tetrahydrofuranyl ethers that can be cleaved with Ag(I) or Hg(II); and 3' phosphates that can be cleaved by phosphatase enzymes (e.g., polynucleotide kinase). Examples of suitable optically labeled cleaving agents / components in the cleavage mix may include sodium periodate, which can cleave vicinal diols; phosphines such as tris(2-carboxyethyl)phosphine (TCEP) or tris(hydroxypropyl)phosphine (THP), which can cleave azidomethyl bonds; palladium and THP, which can cleave allyls; bases, which can cleave ester moieties; or any other suitable cleaving agent.
[0178] Further sequencing cycles can then be performed until amplicon 26 is sequenced.
[0179] Throughout the analysis (e.g., all of the sequencing cycles), the stimulus is applied so that the reversibly swelling resin 18 remains in a swollen state, so that the opening size remains in a narrower or smaller position. As an example, if water is the stimulus, the wash solution, sequencing primer solution, uptake mix, and cleavage mix can each contain water so that the reversibly swelling resin 18 is consistently exposed to the aqueous stimulus. As another example, if pH is the stimulus, the pH of the wash solution, the pH of the sequencing primer solution, the pH of the uptake mix, and the pH of the cleavage mix can each be appropriate so that the reversibly swelling resin 18 is consistently exposed to the pH stimulus.
[0180] After analysis, the stimulus can be removed or an orthogonal stimulus applied to cause the reversibly swelling resin 18 to deswell and thus shrink. Removal of the stimulus or application of the orthogonal stimulus returns the reversibly swelling resin 18 to a non-swelling state, and the recess 20 has the first (larger) opening dimension D1. That is, removal of the stimulus or application of the orthogonal stimulus after analysis causes the reversibly swelling resin 18 to shrink and the second opening dimension D2 to expand to the first opening dimension D1. This releases the now-sequenced particles, allowing them to be washed from the flow cell 10. This example flow cell can be used again with new pre-clustered particles 22.
[0181] In another particular example of the method, the stimulus is a liquid having a predetermined pH, exposing the reversibly swelling resin 18 to the stimulus occurs when the pre-clustered particle solution is introduced into the flow cell 10, and maintaining the stimulus exposure includes introducing at least one aqueous reagent having the predetermined pH during the analysis.
[0182] Second Exemplary Flow Cell and Method The patterned structure 14' in the second example of the flow cell 10 includes a base support 16, a reversibly swelling resin 18 positioned on the base support 16, recesses 20 defined in the reversibly swelling resin 18, the recesses 20 having a first opening dimension D1 when the reversibly swelling resin 18 is in a non-swelling state (Figure 3A) and a second opening dimension D2 smaller than the first opening dimension D1 when the reversibly swelling resin 18 is in a swollen state (Figure 3B), a polymer hydrogel 30 attached to the reversibly swelling resin 18 in each of the recesses 20, and a single primer set (including primers 32A and 32B) grafted to the polymer hydrogel 30.
[0183] In this patterned structure 14', the base support 16 may be any of the examples described herein.
[0184] Any example of a resin composition disclosed herein that forms a reversibly swellable resin 18 that is swellable upon exposure to water, an alcohol, an ionic liquid, or another liquid at a predetermined pH can be used in this example. The resin composition is deposited on a base support 16 and patterned to form a reversibly swellable resin 18 having recesses 20 defined therein. The curing and formation of the patterned reversibly swellable resin 18 can be accomplished as described with reference to Figures 2A and 2B.
[0185] In this example of patterned structure 14', any example of polymer hydrogel 30 can be deposited on reversibly swelling resin 18, including within recesses 20 and over interstitial regions 28. It should be understood that any of the examples of polymer hydrogels described herein for pre-clustered particles 22 can be used in patterned structure 14'.
[0186] To introduce the polymer hydrogel 30 into the recesses 20, a mix of the polymer hydrogel 30 can be created and then applied to the reversibly swelling resin 18. In one example, any example of the polymer hydrogel 30 disclosed herein can be present in a mix (e.g., with water, or with ethanol and water). The mix can then be applied to the surface of the reversibly swelling resin 18 using spin coating, or dipping or dip coating, or flow of material under positive or negative pressure, or another suitable technique. These types of techniques blanket deposit the polymer hydrogel 30 within the recesses 20 and over the void regions 28. Other selective deposition techniques (including, e.g., masks, controlled printing techniques, etc.) can be used to specifically deposit the polymer hydrogel 30 within the recesses 20 but not over the void regions 28.
[0187] In some examples, the reversibly swelling resin 18 can include functional groups that can be covalently or non-covalently bonded to the polymer hydrogel 30. For example, an azide of the polymer hydrogel 30 can react with an alkyne, DBCO (dibenzocyclooctyne), or bicyclononyne (BCN) of the reversibly swelling resin 18, an amino of the reversibly swelling resin 18 can react with an activated carboxylate group or N-hydroxysuccinimide (NHS) ester of the polymer hydrogel 30, or an aldehyde of the polymer hydrogel 30 can react with an aldehyde of the reversibly swelling resin 18.
[0188] Alternatively, the surface of the reversibly swelling resin 18 (including within the recesses 20) may be activated, and then the mix (including the polymer hydrogel 30) may be applied thereto. In one example, a silane or silane derivative (e.g., norbornene silane) may be deposited onto the surface of the reversibly swelling resin 18 using vapor deposition, spin coating, or other deposition methods. In another example, the surface of the reversibly swelling resin 18 may be exposed to plasma ashing to generate surface-activating agents (e.g., —OH groups) that can attach to the polymer hydrogel 30. In yet another example, ashing followed by silanization is used to activate the reversibly swelling resin 18.
[0189] Depending on the chemical nature of the polymer hydrogel 30, the applied mix may be subjected to a curing process. In one example, curing may occur at temperatures ranging from room temperature (e.g., about 25° C.) to about 95° C. for times ranging from about 1 millisecond to about several days.
[0190] If a blanket deposition technique is used, polishing may be performed to remove the polymer hydrogel 30 from the gap regions 28 while leaving the polymer hydrogel 30 on the surfaces within the recesses 20 at least substantially intact.
[0191] The polishing process can be carried out with a chemical slurry (e.g., containing abrasives, buffers, chelating agents, surfactants, and / or dispersants) that can remove the polymer hydrogel 30 from the interstitial regions 28 without adversely affecting the underlying reversibly swelling resin 18 in the interstitial regions 28. Alternatively, polishing can be carried out with a solution that does not contain abrasive particles.
[0192] The chemical slurry may be used in a chemical mechanical polishing system to polish the surface of the gap region 28. The polishing head / pad or other polishing tool may polish away the polymer hydrogel 30 that may be present on the gap region 28 while leaving the polymer hydrogel 30 within the recess 20 at least substantially intact. By way of example, the polishing head may be a Strasbaugh ViPRR II polishing head.
[0193] A cleaning and drying process may be performed after polishing. The cleaning process may utilize a water bath and ultrasonic treatment. The water bath may be maintained at a relatively low temperature, ranging from about 22° C. to about 30° C. The drying process may involve drying via spin drying or another suitable technique.
[0194] In this example of a patterned structure 14', a primer set is grafted onto a polymer hydrogel 30. The primer set includes two different primers 32A, 32B used in sequential paired-end sequencing. Primers 32A, 32B can be any of the examples described herein with reference to Figures 2A and 2B, such as P5 and P7 primers, P15 and P7 primers, or any combination of PA, PB, PC, and PD primers.
[0195] The primers 32A, 32B may be grafted to the polymer hydrogel 30 before or after the polymer hydrogel 30 is introduced into the recess 20. Grafting may be accomplished by flow-through deposition (e.g., using a temporarily or permanently attached lid), dunk coating, spray coating, puddle dispensing, or another suitable method. Each of these exemplary techniques may utilize a primer solution or mix that may include the primers 32A, 32B, water, a buffer, and a catalyst. With either grafting method, the primers 32A, 32B attach to reactive groups on the polymer hydrogel 30 and do not react with the interstitial regions 28.
[0196] The patterned structure 14' shown in Figure 3A can be used as an open wafer or can be bonded to a second patterned structure 14' or a lid (not shown) to form a flow cell having the architecture represented by Figure 3A within each flow channel 12.
[0197] In this exemplary flow cell 10, amplicons (not shown in FIG. 3A or 3B) are generated in wells 20 and then analyzed (e.g., sequenced). In this example, a reversibly swelling resin 18 is used to minimize or prevent multiple seeding events from occurring within a single well 20, thus reducing or eliminating polyclonality (i.e., two or more different template strands are seeded and amplified within a single well 20).
[0198] An exemplary method includes introducing a predetermined liquid into a flow cell 10 containing a patterned structure 14′, allowing the predetermined liquid to incubate within the flow cell 10, thereby causing the reversibly swelling resin 18 to swell and reduce the first opening dimension D1 to the second opening dimension D2, and introducing a template strand solution into the flow cell 10 while the reversibly swelling resin 18 is in a swollen state.
[0199] At the beginning of the method, a predetermined liquid is introduced into the flow cell 10 and incubated therein to induce swelling of the reversibly swelling resin 18. An example of the predetermined liquid is an aqueous solution containing water alone or as part of a buffer solution (e.g., Tris-HCl buffer or 0.5x saline sodium citrate (SSC) buffer). Other examples of the predetermined liquid include alcohols or ionic liquids. Yet another example is a liquid having a pH ranging from about 4 to about 12. The predetermined liquid serves as a stimulus to swell the reversibly swelling resin 18, causing the first opening dimension D1 to contract to the second opening dimension D2. In one example, the predetermined liquid may be incubated for a period ranging from about 5 seconds to about 5 minutes before the template strand solution is introduced into the flow cell.
[0200] The template strand solution contains the library template dispersed in a liquid carrier. Any of the liquid carriers described herein can be used in the template strand solution. The template strand (library template) present in the template strand solution can be prepared from any of the nucleic acid samples (e.g., DNA samples or RNA samples) described herein.
[0201] A template strand solution is introduced into the flow cell. As shown in Figure 3B, the template strand hybridizes to one of two primers 32A, 32B immobilized in recess 20. Seeded template strands are designated by reference numerals 33, 33' in Figure 3B. The narrower opening of recess 20 and the rate of amplification help reduce the occurrence of hybridization of more than one template strand 33, 33' within a single recess 20 (i.e., seeding).
[0202] Amplification of the seeded template nucleic acid strands 33, 33′ within the recesses 20 can be initiated to form respective clusters of seeded template strands 33, 33′ across the recesses 20. In one example, the amplification includes cluster generation. In one example of cluster generation, the seeded library templates 33, 33′ are copied from the hybridized primers by 3′ extension using a high-fidelity DNA polymerase. The original seeded library templates 33, 33′ are denatured, leaving immobilized copies in the recesses 20. Isothermal bridge amplification or some other form of amplification can be used to amplify the immobilized copies. For example, the copied template loops over and hybridizes to an adjacent complementary primer, and the polymerase copies the copied template to form a double-stranded bridge, which is denatured to form two single strands. These two strands loop over and hybridize to adjacent complementary primers and are extended again to form two new double-stranded loops. This process is repeated for each template copy through cycles of isothermal denaturation and amplification, creating dense clonal clusters on the functionalized particles. Each cluster of double-stranded bridge structures is denatured. In the example, the reverse strand is removed by specific base cleavage, leaving the forward template strand. Clustering primarily results in the formation of clusters of specific template strands 33, 33' containing multiple template strand copies / amplicons immobilized in each recess 20. This example of clustering is referred to as bridge amplification, and is one example of amplification that can be performed. It should be understood that other amplification techniques (e.g., exclusion amplification) can be used.
[0203] The flow cell 10 can be washed to remove unreacted library template. Sequencing analysis can then be performed as described with reference to Figure 2B.
[0204] It should be understood that throughout this method, the template strand solution, wash solutions, and sequencing reagents (e.g., sequencing primer solution, incorporation mix, and cleavage mix) maintain aqueous conditions within the flow cell 10, thus keeping the reversibly swelling resin 18 in a swollen state throughout the analysis.
[0205] After analysis, the aqueous fluid, and therefore the stimulus, can be removed, allowing the reversibly swelling resin 18 to deswell and therefore shrink.
[0206] While a polymer hydrogel 30 is shown in the example of Figures 3A and 3B, it should be understood that the patterned structure 14' may not include the polymer hydrogel 30 if the reversibly swelling resin 18 includes surface functional groups that can directly bind to the 5' ends of the primers 32A, 32B. In this particular example, the interstitial regions 28 may be masked during primer grafting so that they remain free of the primers 32A, 32B. This example may allow for smaller recesses and brighter signals.
[0207] Third Exemplary Flow Cell and Method 4A-4D illustrate one example of a method for fabricating another example of patterned structure 14″ shown in FIG. 4D. This patterned structure 14″ may be used in a third example of flow cell 10, which includes a base support 16, a reversibly swelling resin 18 positioned on base support 16, and a plurality of depth recesses 20′ defined in reversibly swelling resin 18, wherein the plurality of depth recesses 20′ includes a deep portion 52 and a shallow portion 54 adjacent to deep portion 52, and wherein deep portion 52 has a first opening dimension D1 when reversibly swelling resin 18 is in a non-swelled state ( FIG. 4A ) and a first opening dimension D2 when reversibly swelling resin 18 is in a swollen state ( FIG. 4B ). The recess 20' has a plurality of depths and a second opening dimension D2 smaller than the dimension D1; grafted particles 50 confined within the deep portion 52, the grafted particles 50 having a first set of primers grafted to the core particle 24 (including primers 34, 36 or 34', 36' as shown in Figures 5A-5D); and pre-grafted polymer 56 positioned on the surface 58 of the shallow portion 54, the pre-grafted polymer 56 having a second set of primers grafted to the polymer hydrogel 30, perpendicular to the first set of primers (including primers 38, 40 or 38', 40' as shown in Figures 5A-5D).
[0208] In this patterned structure 14'', the base support 16 can be any of the examples described herein.
[0209] Any of the examples of resin compositions disclosed herein that form a reversibly swelling resin 18 that is swellable upon exposure to water can be used in this example. The resin composition is deposited on a base support 16 and patterned to form a reversibly swelling resin 18 having multiple depth recesses 20′ defined therein. Formation of the cured, patterned reversibly swelling resin 18 can be achieved as described with reference to FIGS. 2A and 2B, except that the imprinting apparatus has a negative replica of the multiple depth recesses 20′.
[0210] It should be understood that for each of the multiple depth recesses 20′, the depth of the deep portions 52 and the depth of the shallow portions 54 are each within the ranges provided herein for the depth of the recesses 20, except that the depth of the deep portions 52 is greater than the depth of the shallow portions 54. It should be understood that the height of the interior walls 60 varies according to the different depths of the deep portions 52 and shallow portions 54.
[0211] This exemplary flow cell 10 is used with grafted particles 50 and pre-grafted polymers 56, examples of which are now described with reference to Figures 5A-5D. The grafted particles 50 include a first set of primers, and the pre-grafted polymers 56 include a second set of primers, with the first and second primer sets enabling simultaneous paired-end sequencing. As described in more detail below, the primer sets can be controlled so that the cleavage (linearization) chemistry of the primers of the grafted particles 50 is orthogonal to the primers of the pre-grafted polymers 56. In these examples, the orthogonal cleavage chemistry may be achieved by the same cleavage site attached to different primers in different sets, or by different cleavage sites attached to different primers in different sets. This allows, for example, to generate clusters of forward strands on the particles 50 and clusters of reverse strands on the polymers 56. The particles 50 and polymers 56 are in different parts of the multi-depth recess 20', and therefore the generated forward and reverse strands are spatially separated, which allows for simultaneous base calling of each read while separating the fluorescent signals from both reads.
[0212] The primer set attached to grafted particles 50A, 50B, 50C, and 50D includes a non-cleavable first primer 34 or 34' and a cleavable second primer 36 or 36'. The primer set attached to pre-grafted polymers 56A, 56B, 56C, and 56D includes a cleavable first primer 38 or 38' and a non-cleavable second primer 40 or 40'.
[0213] The uncleavable first primer 34 or 34' and the cleavable second primer 36 or 36' are, for example, an oligonucleotide pair in which the uncleavable first primer 34 or 34' is a forward amplification primer and the cleavable second primer 36 or 36' is a reverse amplification primer, or the cleavable second primer 36 or 36' is a forward amplification primer and the uncleavable first primer 34 or 34' is a reverse amplification primer. In each example of the primer set attached to grafted particles 50A, 50B, 50C, and 50D, the cleavable second primer 36 or 36' includes a cleavage site 42, while the uncleavable first primer 34 or 34' does not include a cleavage site 42.
[0214] The cleavable first primer 38 or 38' and the non-cleavable second primer 40 or 40' may also be, for example, an oligonucleotide pair in which the cleavable first primer 38 or 38' is a forward amplification primer and the non-cleavable second primer 40 or 40' is a reverse amplification primer, or in which the non-cleavable second primer 40 or 40' is a forward amplification primer and the cleavable first primer 38 or 38' is a reverse amplification primer. In each example of the primer set attached to the pre-grafted polymers 56A, 56B, 56C, and 56D, the cleavable first primer 38 or 38' includes the cleavage site 42' or 44, while the non-cleavable second primer 40 or 40' does not include the cleavage site 42' or 44.
[0215] It should be understood that the non-cleavable first primer 34 or 34' of the primer set attached to the grafted particles 50A, 50B, 50C, and 50D and the cleavable first primer 38 or 38' of the primer set attached to the pre-grafted polymers 56A, 56B, 56C, and 56D have the same nucleotide sequence (e.g., both are forward amplification primers), except that the cleavable first primer 38 or 38' includes a cleavage site 42' or 44 incorporated into the nucleotide sequence or linker 46' attached to the nucleotide sequence. Similarly, the cleavable second primer 36 or 36' of the primer set attached to grafted particles 50A, 50B, 50C, and 50D and the non-cleavable second primer 40 or 40' of the primer set attached to pre-grafted polymers 56A, 56B, 56C, and 56D have the same nucleotide sequence (e.g., both are reverse amplification primers), except that the cleavable second primer 36 or 36' includes a cleavage site 42 incorporated into the nucleotide sequence or a linker 46 attached to the nucleotide sequence.
[0216] It should be understood that if the first primers 34 and 38 or 34' and 38' are forward amplification primers, the second primers 36 and 40 or 36' and 40' are reverse primers, and vice versa.
[0217] The non-cleavable primers 34, 40 or 34', 40' can be any primers with a universal sequence for capture and / or amplification purposes, such as P5 or P15 and P7 primers, or any combination of PA, PB, PC, and PD primers (e.g., PA and PB or PA and PD), provided that the sequence does not include uracil, 8-oxoguanine, or other cleavage sites. These primers 34, 40 or 34', 40' do not include cleavage sites 42, 42', 44 and are therefore non-cleavable primers 34, 40 or 34', 40'.
[0218] Examples of cleavable primers 36, 38, or 36', 38' include P5 or P15 and P7 primers or other universal sequence primers (e.g., PA, PB, PC, PD primers), with the respective cleavage sites 42, 42', 44 incorporated into the respective nucleic acid sequences (e.g., Figures 5A and 5C) or into linkers 46', 46 (Figures 5B and 5D) that attach the cleavable primers 36, 38, or 36', 38' to the core particle 24 or polymer 30. Examples of suitable cleavage sites 42, 42', 44 include enzymatically or chemically cleavable nucleobases, modified nucleobases, or linkers (e.g., between nucleobases), as described herein. Some specific examples of cleavage sites 42, 42', 44 include uracil, 8-oxoguanine, and allyl-T. The cleavage sites 42, 42', 44 can be incorporated at any point along the strand.
[0219] A primer set including primers 34, 36, or 34', 36' is attached to an example of a particle core 24 described herein, and a primer set including primers 38, 40, or 38', 40' is attached to an example of a polymer hydrogel 30 disclosed herein. In this example, particle core 24 includes functional groups capable of binding to the 5' ends of primers 34, 36, or 34', 36', and polymer hydrogel 30 includes functional groups capable of binding to the 5' ends of primers 38, 40, or 38', 40'.
[0220] 5A-5D show different configurations of primer sets attached to particle core 24 and polymer hydrogel 30, respectively. More specifically, FIGS. 5A-5D show different configurations of primers 34, 36 or 34', 36' and 38, 40 or 38', 40' that may be used.
[0221] 5A, the primers 34, 36 and 38, 40 are directly attached to the particle core 24 and the polymer hydrogel 30, respectively, without, for example, linkers 46, 46'. The particle core 24 has surface functional groups capable of immobilizing the 5'-terminal end groups of the primers 34, 36. Similarly, the polymer hydrogel 30 has surface functional groups capable of immobilizing the 5'-terminal end groups of the primers 38, 40. Because the respective primers 34, 36 and 38, 40 are pre-grafted (i.e., grafted before the particle 50 or polymer 56 is incorporated into the flow cell 10), the immobilization chemistry between the particle core 24 and the primers 34, 36 and between the polymer hydrogel 30 and the primers 38, 40 can be the same or different.
[0222] Also, in the example shown in FIG. 5A, the cleavage sites 42, 42' of each of the cleavable primers 36, 38 are incorporated into the primer sequence. In this example, the same type of cleavage site 42, 42' is used in the cleavable primers 36, 38 of each primer set. By way of example, the cleavage sites 42, 42' are uracil bases, and the cleavable primers 36, 38 are P5U and P7U (where uracil is incorporated into any of the P7 sequences shown herein in place of 8-oxoguanine). A uracil base or other cleavage site can also be incorporated into any of the PA, PB, PC, and PD primers to generate the cleavable primers 36, 38. In this example, the uncleavable primer 34 of the oligonucleotide pair 34, 36 can be P7 (no cleavage site, e.g., SEQ ID NO: 2-4, no 8-oxoguanine), and the uncleavable primer 40 of the oligonucleotide pair 38, 40 can be P5 (no cleavage site, e.g., SEQ ID NO: 1, no uracil). Thus, in this example, the primer set for grafted particle 50A includes P7, P5U, and the primer set for pre-grafted polymer 56A includes P5, P7U. The primer sets for grafted particle 50A and pre-grafted polymer 56A have opposite linearization chemistries, which allows for a forward template strand to be formed on particle 50A and a reverse strand to be formed on polymer 56A after amplification, cluster generation, and linearization.
[0223] In the example shown in FIG. 5B , primers 34′, 36′ and 38′, 40′ are attached to particle core 24 and polymer hydrogel 30, respectively, via linkers 46, 46′, for example. Particle core 24 and polymer hydrogel 30 contain respective functional groups, and the ends of each linker 46, 46′ can be covalently bonded to the respective functional groups. Thus, particle core 24 contains surface functional groups at the 5′ ends of primers 34′, 36′ that can immobilize linker 46′. Similarly, polymer hydrogel 30 contains surface functional groups at the 5′ ends of primers 38′, 40′ that can immobilize linker 46′. Because each primer 34, 36 and 38, 40 is pre-grafted, the immobilization chemistry between particle core 24 and linker 46 and between polymer hydrogel 30 and linker 46′ can be the same or different.
[0224] Examples of suitable linkers 46, 46' may include nucleic acid linkers (e.g., 10 nucleotides or less) or non-nucleic acid linkers, such as polyethylene glycol chains, alkyl or carbon chains, aliphatic linkers with vicinal diols, peptide linkers, etc. One example of a nucleic acid linker is a poly-T spacer, although other nucleotides can also be used. In one example, the spacer is a 6T-10T spacer. Below are some examples of nucleotides containing non-nucleic acid linkers (where B is a nucleobase and "oligo" is a primer) with terminal alkyne groups:
[0225] [ka]
[0226] In the example shown in Figure 5B, primers 34' and 38' have the same sequence (e.g., P5 does not contain a uracil base). Primer 34' is non-cleavable (i.e., does not contain any cleavage site), while primer 38' contains a cleavage site 42' incorporated into linker 46'. Also in this example, primers 36' and 40' have the same sequence (e.g., P7 does not contain an 8-oxoguanine). Primer 40' is non-cleavable (i.e., does not contain any cleavage site), while primer 36' contains a cleavage site 42 incorporated into linker 46'. The same type of cleavage site 42, 42' is used in the linkers 46, 46' of each of cleavable primers 36' and 38'. As an example, the cleavage site 42, 42' can be a uracil base incorporated into the nucleic acid linker 46, 46'. The primer sets for particle 50B and polymer 56B have opposite linearization chemistries, which allows, after amplification, cluster generation, and linearization, the forward template strand to be formed on particle 50B and the reverse strand to be formed on polymer 56B.
[0227] The example shown in Figure 5C is similar to the example shown in Figure 5A, except that different types of cleavage sites 42, 44 are used in the cleavable primers 36, 38 of particle 50C and polymer 56C. By way of example, two different enzymatic cleavage sites may be used, two different chemical cleavage sites may be used, or one enzymatic cleavage site and one chemical cleavage site may be used. Examples of different cleavage sites 42, 44 that may be used in each cleavable primer 36, 38 include any combination of vicinal diol, uracil, allyl ether, disulfide, restriction enzyme site, and 8-oxoguanine.
[0228] The example shown in Figure 5D is similar to the example shown in Figure 5B, except that different types of cleavage sites 42, 44 are used in the linkers 46, 46' attached to the cleavable primers 36', 38' of particle 50 C and polymer 56 C. Examples of different cleavage sites 42, 44 that may be used in the respective linkers 46, 46' attached to the cleavable primers 36', 38' include any combination of vicinal diol, uracil, allyl ether, disulfide, restriction enzyme site, and 8-oxoguanine.
[0229] In any of the examples shown in Figures 5A-5D, attachment of primers 34, 36 and 38, 40 or 34', 36' and 38', 40' to particle core 24 and polymer hydrogel 30 frees the template-specific portions of primers 34, 36 and 38, 40 or 34', 36' and 38', 40' to their cognate templates, leaving the 3' hydroxyl groups free for primer extension.
[0230] Referring again to Figures 4A-4D, this exemplary method begins with a precursor structure 62 including a base support 16 and a reversibly swellable resin 18 positioned on the base support 16 and having a plurality of recesses 20' of different depths defined therein. The method includes exposing a precursor structure 62 to a grafted particle solution, allowing the grafted particle solution to incubate within the precursor structure 62, thereby causing the grafted particles 50 (e.g., 50A, 50B, 50C, 50D) to settle within the deep portions 52, introducing a predetermined liquid to swell the reversibly swelling resin 18 and reduce the first opening dimension D1 to a second opening dimension D2 while capturing the grafted particles 50 in the deep portions 52, washing away any uncaptured grafted particles, and selectively introducing a polymer hydrogel (e.g., pre-grafted polymer 56) onto the surface 58 of the shallow portions 54 of the multiple depth recesses 20′ while the grafted particles 50 are present in the deep portions 52.
[0231] The grafted particle solution comprises any example of grafted particles 50 (e.g., 50A, 50B, 50C, or 50D) disclosed herein dispersed or suspended in a liquid carrier that does not swell resin 18. The liquid carrier of the grafted particle solution is any organic solvent in which the grafted particles are inert. In this example, the grafted particle solution is the source of grafted particles 50.
[0232] After the grafted particle solution and the precursor structures 62 are brought into contact with each other, the grafted particle solution is incubated. In one example, the grafted particle solution may be incubated for a period ranging from about 5 seconds to about 5 minutes. During incubation, at least some of the grafted particles 50 settle into the deeper portions 52 of at least some of the multiple-depth recesses 20′.
[0233] A predetermined liquid, such as water, alcohol, an ionic liquid, or a buffer solution with a suitable pH, is then introduced. During this incubation period, the reversibly swellable resin 18 swells, causing the first opening dimension D1 of the deep portion 52 to decrease to a second opening dimension D2. The swollen resin 18 traps the grafted particles 50 that have settled in the deep portion 52.
[0234] It should be understood that the overall opening dimensions of the multiple-depth recesses 20′ may also narrow as a result of swelling. However, because the openings of the multiple-depth recesses 20′ extend across both the deep portions 52 and the shallow portions 54, any grafted particles 50 that are on top of particles 50 trapped in the deep portions 52 or on top of the shallow portions 54 may be removed during a cleaning cycle. In other words, the diameter of the grafted particles 50 is smaller than the narrowed openings of the multiple-depth recesses 20′, and therefore, these particles 50 may be removed. Therefore, a cleaning cycle may be performed to remove untrapped grafted particles 50 from the precursor structure 62. This structure is shown in FIG. 4B.
[0235] As shown in FIG. 4C , the method then includes selectively introducing pre-grafted polymer 56 onto surfaces 58 of shallow portions 54 of multiple-depth recesses 20′ while grafted particles 50 are trapped in deep portions 52. In this example, any example pre-grafted polymer 56 (e.g., 56A, 56B, 56C, 56D) can be applied using any suitable deposition technique under high ionic strength conditions (e.g., in the presence of 10×PBS, NaCl, KCl, etc.). A curing process, as described herein, may be performed after deposition. When deposition of pre-grafted polymer 56 is performed under high ionic strength, pre-grafted polymer 56 does not deposit or adhere onto grafted particles 50. Therefore, pre-grafted polymer 56 does not contaminate grafted particles 50.
[0236] The pre-grafted polymer 56 can then be removed from the gap regions 28 using example polishing processes described herein. The resulting patterned structure 14" is shown in FIG. 4D. In some examples, polishing can be performed to remove at least a portion of the pre-grafted polymer 56 from the sidewalls of the multiple-depth recesses 20' without removing the pre-grafted polymer 56 from the surfaces 58 of the shallow portions 54. The patterned structure 14" shown in FIG. 4D can be used in a sequencing operation as shown (e.g., as an open wafer), or it can be bonded to a lid (not shown) to form a flow cell 10 having the architecture represented by FIG. 4D within each flow channel 12. In this example, the patterned structure 14" can be exposed to sufficient aqueous solution or another suitable stimulus during the bonding process to ensure that the particles 50 are not released.
[0237] Through the method shown in Figures 4A-4D, the structure 62, 14'' is exposed to an aqueous stimulus or another suitable stimulus to ensure that the resin 18 remains swollen and the grafted particles 50 remain entrapped.
[0238] 4A-4D are described using a pre-grafted polymer 56 (including any of 56A, 56B, 56C, or 56D), it should be understood that polymer hydrogel 30 (without a grafted primer 38, 40 or 38', 40') can be selectively applied to the gap regions 28 and surfaces 58 of the shallow portion 54 of each multi-well recess 20' and then polished away from the gap regions 28. In this example, the primers 38, 40 or 38', 40' are grafted after the polymer hydrogel 30 is applied and polished away from the gap regions 28. Since the grafted particle 50 is already positioned in the deep portion 52, grafting of the primer 38, 40 or 38', 40' can be performed as long as i) the polymer hydrogel 30 has different functional groups (than the particle core 24) for binding the primer 38, 40 or 38', 40', or ii) any unreacted functional groups of the particle core 24 are quenched using, for example, a Staudinger reduction to generate an amine or a further click reaction with an inert molecule such as a hexynoic acid.
[0239] A flow cell 10 formed with patterned structures 14'' can be used for simultaneous paired-end sequencing.
[0240] For this analysis, a template strand solution containing library templates dispersed in a liquid carrier is introduced into a flow cell. Any example of the liquid carrier described herein can be used in the template strand solution. The template strand (library template) present in the template strand solution can be prepared from any nucleic acid sample (e.g., DNA sample or RNA sample) described herein.
[0241] The template strands hybridize to one of the primers 34, 36, 38, 40 or 34', 36', 38', 40' immobilized in the multiple-depth recesses 20'. Amplification of the seeded template strands in the recesses 20' may be initiated to form clusters of seeded template strands across both the grafted particle 50 and the (pre-)grafted polymer 56. Because the primer sets of the grafted particle 50 and the (pre-)grafted polymer 56 comprise orthogonally cleavable oligonucleotide pairs, amplification can span both the grafted particle 50 and the (pre-)grafted polymer 56. In one example, the grafted particle 50 can have a non-cleavable first template (e.g., forward) strand and a cleavable second template (reverse) strand attached thereto, while the (pre-)grafted polymer 56 can have a cleavable first template (e.g., forward) strand and a non-cleavable second template (reverse) strand attached thereto. The cleavable first and second template strands can then be removed by introducing a chemical or enzymatic cleavage agent, depending on cleavage sites 42 and 42' or 44. After cleavage, the uncleavable first template (e.g., forward) strand remains on particle 50, and the uncleavable second template (e.g., reverse) strand remains on polymer 56. Thus, one type of template strand (e.g., forward strand) is clustered on particle 50, and the other type of template strand (e.g., reverse strand) is clustered on polymer 56. This allows for the simultaneous acquisition of distinguishable Read 1 and Read 2 signals.
[0242] It should be understood that throughout this method, the template strand solution, wash solutions, and sequencing reagents (e.g., sequencing primer solution, incorporation mix, and cleavage mix) maintain aqueous conditions within the flow cell, thus maintaining the reversibly swelling resin 18 in a swollen state throughout the analysis.
[0243] After analysis, the stimulus can be removed or an orthogonal stimulus can be applied to cause the reversibly swelling resin 18 to deswell and thus shrink. Removal of the stimulus or application of an orthogonal stimulus returns the reversibly swelling resin 18 to a non-swelling state, with the deep portions 52 of the multi-depth recesses 20′ having a first (larger) opening dimension D1. That is, removal of the stimulus or application of an orthogonal stimulus after analysis causes the reversibly swelling resin 18 to shrink and expand the second opening dimension D2 to the first opening dimension D1. This releases the now-sequenced particles, allowing them to be washed from the flow cell 10. This exemplary flow cell 10 can be reused, for example, if the polymer 56 contains biotin, since it can release and replenish the streptavidin-bound primers 34, 36, 38, 40 or 34′, 36′, 38′, 40′.
[0244] It should be understood that in any of the examples disclosed herein, the first opening dimension D1 corresponds to any of the recess dimensions described herein (e.g., opening area, depth, or diameter or length and width), and the second opening dimension D2 is smaller than the first opening dimension D1. The second opening dimension D2 can vary from one swelling event to another, depending in part on the stimulus used.
[0245] To further illustrate the present disclosure, examples are presented herein. It should be understood that these examples are provided for illustrative purposes and are not to be construed as limiting the scope of the present disclosure.
[0246] Non-limiting examples Example 1 Examples of reversibly swelling resins were prepared using poly(ethylene glycol) diglycidyl ether, epoxycyclohexylethyl polysilsesquioxane, and glycidyl polysilsesquioxane. Monomers and surface additives were dissolved in a solvent. The resin composition was applied to a glass substrate and imprinted with a working stamp. The resin composition was UV-cured while the working stamp was in place. Several imprinted films were prepared.
[0247] The increased surface energy of the imprinted films was measured by recording the contact angle. The contact angle was approximately 75° for each film, which was reduced when compared to a similar resin composition made without poly(ethylene glycol) diglycidyl ether (contact angle >85°). The imprinted films exhibited a momentary (<1 s) color change upon exposure to either high humidity or water, corresponding to a change in film thickness properties.
[0248] Additional Notes It should be understood that all combinations of the foregoing concepts and additional concepts discussed in more detail below (unless such concepts are mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein. Specifically, all combinations of claimed subject matter appearing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein. It should also be understood that terms used expressly herein, and which may also appear in any disclosures incorporated by reference, should be given the meaning most consistent with the particular concepts disclosed herein.
[0249] References throughout this specification to "one example," "another example," "an example," etc. mean that particular elements (e.g., features, structures, and / or characteristics) described in connection with an example are included in at least one example described herein and may or may not be present in other examples. Additionally, unless the context clearly dictates otherwise, it should be understood that the described elements with respect to any example may be combined in any suitable manner in the various examples.
[0250] Although several embodiments have been described in detail, it should be understood that the disclosed examples may be modified, and therefore the foregoing description should be considered non-limiting.
Claims
1. It is a flow cell, Base support and A reversible swelling resin positioned on the base support, wherein the reversible swelling resin comprises at least one hydrophilic monomer selected from the group consisting of poly(ethylene glycol) monomers, poly(propylene glycol) monomers, acid-containing monomers, and combinations thereof, A flow cell comprising a recess defined within the reversibly swellable resin, the recess having a first opening dimension when the reversibly swellable resin is in a non-swelled state, and a second opening dimension smaller than the first opening dimension when the reversibly swellable resin is in a swollen state.
2. The flow cell according to claim 1, wherein the reversible swelling resin contains 0.5% to 20% of the hydrophilic monomer.
3. The flow cell according to claim 1 or 2, wherein the reversible swelling resin comprises at least one epoxy polyhedral oligomer silsesquioxane monomer copolymerized with the hydrophilic monomer.
4. The flow cell according to claim 1 or 2, further comprising a polymer hydrogel covalently bonded to the reversible swelling resin, wherein the reversible swelling resin comprises at least one additional monomer copolymerized with the hydrophilic monomer, and the at least one additional monomer comprises a functional group covalently bonded to the polymer hydrogel.
5. The flow cell according to claim 4, wherein the functional group is selected from the group consisting of alkynes, dienes, azides, and amines.
6. The flow cell according to claim 4, further comprising a single set of primers grafted onto the polymer hydrogel.
7. The flow cell according to claim 1 or 2, further comprising a polymer hydrogel non-covalently bonded to the reversible swelling resin.
8. A flow cell according to claim 1 or 2, wherein the recess is a plurality of recesses of depth, including a deep portion and a shallow portion adjacent to the deep portion.
9. Grafted particles confined within the deep portion, wherein the grafted particles have a first set of primers grafted onto a core particle, The flow cell according to claim 8, further comprising a pre-grafted polymer positioned on the surface of the shallow portion, wherein the pre-grafted polymer has a second set of primers orthogonal to the first set of primers grafted onto the polymer hydrogel.
10. It is a method, Pre-clustered particle solution, flow cell, Base support and A reversible swelling resin positioned on the base support, wherein the reversible swelling resin comprises at least one hydrophilic monomer selected from the group consisting of poly(ethylene glycol) monomers, poly(propylene glycol) monomers, and combinations thereof, The flow cell includes a recess defined within the reversible swellable resin, the recess having a first opening dimension when the pre-clustered particle solution is introduced. This enables incubation of the pre-clustered particle solution within the flow cell, thereby allowing the pre-clustered particles to settle in the recesses. The reversible swelling resin is exposed to a stimulus, thereby reducing the first opening dimension to the second opening dimension and trapping the pre-clustered particles within the recess. Washing away uncaptured pre-clustered particles, This includes maintaining the stimuli exposure until at least the analysis including the captured pre-clustered particles is performed, The method wherein the stimulus is optionally selected from the group consisting of a predetermined liquid and a liquid having a predetermined pH.
11. i) The stimulus is the predetermined liquid, The aforementioned predetermined liquid is water, alcohol, or an ionic liquid. Exposure of the reversible swelling resin to the stimulus is performed when the pre-clustered particle solution is introduced into the flow cell. Maintaining the aforementioned irritation exposure includes introducing at least one aqueous reagent during the analysis, or ii) The stimulus is the liquid having the predetermined pH, Exposure of the reversible swelling resin to the stimulus is performed when the pre-clustered particle solution is introduced into the flow cell. The method according to claim 10, wherein maintaining the irritation exposure includes introducing at least one aqueous reagent having the predetermined pH during the analysis.
12. The method according to claim 10 or 11, further comprising removing the stimulus after the analysis, thereby causing the reversible swelling resin to shrink and the second opening dimension to increase to the first opening dimension.
13. It is a method, A predetermined liquid is poured into a flow cell, Base support and A reversible swelling resin positioned on the base support, wherein the reversible swelling resin comprises at least one hydrophilic monomer selected from the group consisting of poly(ethylene glycol) monomers, poly(propylene glycol) monomers, and combinations thereof, A recess defined within the reversible swellable resin, wherein the recess has a first opening dimension when the predetermined liquid is introduced, A polymer hydrogel positioned within the recess, The process involves introducing a single primer set attached to the polymer hydrogel into a flow cell, This enables incubation of the predetermined liquid within the flow cell, thereby causing the reversible swelling resin to swell such that the first opening dimension decreases to the second opening dimension. A method comprising introducing a template chain solution into the flow cell while the reversible swelling resin is swollen.
14. It is a method, Exposing a precursor structure to a grafted particle solution, wherein the precursor structure is Base support and A reversible swelling resin positioned on the base support, wherein the reversible swelling resin comprises at least one hydrophilic monomer selected from the group consisting of poly(ethylene glycol) monomers, poly(propylene glycol) monomers, and combinations thereof, A plurality of recesses of depth defined within the reversible swellable resin, wherein each recess includes a deep portion and a shallow portion adjacent to the deep portion, and the deep portion includes a plurality of recesses of depth having a first opening dimension when the grafted particle solution is introduced, to be exposed. This makes it possible to incubate the grafted particle solution in the precursor structure, thereby causing the grafted particles to settle in the deeper portion. The precursor structure is exposed to a predetermined liquid, thereby causing the reversible swellable resin to swell so that the first opening dimension is reduced to a second opening dimension and the grafted particles are trapped in the deeper portion. To wash away grafted particles that have not been captured, A method comprising selectively introducing a polymer hydrogel onto the surface of the shallow portions of the plurality of recesses while the grafted particles are present in the deep portions.
15. The polymer hydrogel is a pre-grafted polymer hydrogel. The method according to claim 14, wherein the first primer set of the grafted particles is orthogonal to the second primer set of the pre-grafted polymer hydrogel.
16. The method according to claim 14, further comprising grafting a first set of primers onto the selectively introduced polymer hydrogel, wherein the first set of primers is orthogonal to a second set of primers of the grafted particles.