Universal natural killer cells derived from human pluripotent stem cells and methods of use

Abstract

Provided are populations of universal natural killer (NK) cells derived from human pluripotent stem cells (hPSCs) and engineered to overexpress the transcription factors ID2, NFIL3, and / or SPI1, optionally with an anti-programmed death-ligand 1 (PD-L1) chimeric antigen receptor (CAR) and an anti-fluorescein isothiocyanate CAR. Also provided are methods of treating cancer in a subject using the populations of universal NK cells.

Description

[Technical Field]

[0001] priorities This application is related to and claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 398,781, filed August 17, 2022, the contents of which are hereby incorporated by reference in their entirety into this disclosure.

[0002] Array List The sequences herein (SEQ ID NOS: 1-4) are also provided in computer-readable form encoded in a file submitted herewith and are incorporated herein by reference. The information recorded in computer-readable form is identical to the written sequence listing presented herein (e.g., pursuant to 37 CFR §1.821(f)).

[0003] The present disclosure relates to human pluripotent stem cells (hPSCs), natural killer (NK) cells derived from hPSCs, NK cells derived from engineered hPSCs, and methods of using NK cells (e.g., engineered NK cells), such as in the treatment of cancer. [Background technology]

[0004] Natural killer (NK) cells are a type of lymphocyte that differentiate from hematopoietic stem cells (HSCs) in the bone marrow and mature in lymph nodes. Rohaan et al., Adoptive cellular therapies: the current landscape, Virchows Archiv 474: 449-461 (2019); Hinrichs & Rosenberg, Exploiting the curative potential of adoptive T-cell therapy for cancer, Immunological Reviews 257(1): 56-71 (2014). NK cells exhibit characteristics of both innate and adaptive lymphoid cells and demonstrate a remarkable ability to attack tumor cells and suppress their proliferation in vivo. Hinrichs & Rosenberg (2014), supra; Redeker & Arens, Improving adoptive T cell therapy: The particular role of T cell costimulation, cytokines, and post-transfer vaccination, Frontiers Immunology 7 (2016); Zhu et al., Metabolic Reprogramming via Deletion of CISH in Human iPSC-Derived NK Cells Promotes In Vivo Persistence and Enhances Anti-tumor Activity, Cell Stem Cell 27(2): 224-237 (2020); Goldenson et al., Umbilical Cord Blood and iPSC-Derived Natural Killer Cells Demonstrate Key Differences in Cytotoxic Activity and KIR Profiles, Frontiers Immunology 11 (2020). Unlike T cells, NK cells do not require prior sensitization or antigen exposure.Cichocki et al., iPSC-derived NK cells maintain high cytotoxicity and enhance in vivo tumor control in concert with T cell and anti-PD-1 therapy, Science Translational Medicine 12(568) (2020); Zhu et al., Pluripotent stem cell-derived NK cells with high-affinity noncleavable CD16a mediate improved antitumor activity, Blood 135(6): 399-410 (2020). Activating receptors (e.g., CD16 (FcγRIII) and NK group 2D (NKG2D)) and inhibitory receptors expressed on NK cells act synergistically to distinguish normal cells from tumor cells and trigger cytolytic programs and cytokine release against abnormal cells. Chang & Bao, Adoptive natural killer cell therapy: a human pluripotent stem cell perspective, Current Opinions Chemical Engineering 30: 69-76 (2020). Importantly, allogeneic NK cells are free from graft-versus-host disease (GvHD), a condition commonly associated with allogeneic T cell-based cancer therapies. Handgretinger et al., Exploitation of natural killer cells for the treatment of acute leukemia, Blood 127(26): 3341-3349 (2016). This unique property offers the possibility of developing universal NK cells that can be used to treat any patient without human leukocyte antigen matching.

[0005] Given their unique ability to self-renew and differentiate into all types of somatic cells, human pluripotent stem cells (hPSCs) have emerged as a promising cell source suitable for the large-scale production of NK cells. Compared with primary NK cells or the NK-92 cell line, hPSCs are easier to genetically modify (e.g., engineer chimeric antigen receptors) to produce genetically enhanced NK cells for cancer immunotherapy that may be available off-the-shelf. Romee et al., Cytokine-induced memory-like natural killer cells exhibit enhanced responses against myeloid leukemia, Science Translational Med 8(357) (2016); Cerwenka & Lanier, Natural killer cell memory in infection, inflammation, and cancer, Nature Reviews Immunology 16: 112-123 (2016).

[0006] However, several obstacles must be overcome before the full potential of hPSC-NK cells can be realized. Paust & Von Andrian, Natural killer cell memory, Nature Immunology 12: 500-508 (2011). First, many established differentiation protocols require embryoid body formation, feeder cells, and / or stromal cells, limiting the reproducibility and standardization of generating large numbers of NK cells from hPSCs. O'Sullivan et al., Natural Killer Cell Memory, Immunity 43(4): 634-645 (2015);Sun et al., Adaptive immune features of natural killer cells, Nature 457: 557-561 (2009);Berrien-Elliott et al., Human Cytokine-Induced Memory-Like Natural Killer Cells, J Innate Immunology 7(6): 563-671 (2015);Cooper et al., Cytokine-induced memory-like natural killer cells, PNAS USA 106(6): 1915-1919 (2009);Ma et al., An oncolytic virus expressing il15 / il15ra combined with off-the-shelf egfr-car nk cells targets glioblastoma, Cancer Research 81(13): 3635-3648 (2021);Liu et al., Cord blood NK cells engineered to express IL-15 and a CD19-targeted CAR show long-term persistence and potent antitumor activity, Leukemia 32: 520-531 (2018).Second, current protocols make extensive use of expensive growth factors and animal-derived components, which limit the production of NK cells at clinically useful dosages (i.e., 10 per kg of patient body weight). 7 Because this approach may limit the ability to achieve a high level of specificity (e.g., individual NK cells), more cost-effective protocols are needed. (Du et al., "PiggyBac System to Co-Express NKG2D CAR and IL-15 to Augment the In Vivo Persistence and Anti-AML Activity of Human Peripheral Blood NK Cells," Molecular Therapy - Methods & Clinical Development 23: 582-596 (2021)). Notably, when NK cells are differentiated from hPSCs, a long induction period of 7 weeks or more is required, complicating cell preparation and increasing the risk of contamination. In light of the above, the objective of this disclosure is to provide a novel platform for efficiently producing universal NK cells that can be used in various therapies (e.g., targeted cancer immunotherapy) to treat any patient, without the need for human leukocyte antigen matching.

[0007] Furthermore, although adoptive chimeric antigen receptor (CAR)-engineered NK cells show some promise in the treatment of various cancers, their limited immune memory and limited access to sufficient numbers of allogeneic donor cells have hindered their wider preclinical and clinical application. The inability of transduced NK cells to express classical immune memory is primarily due to the lack of receptor gene rearrangements in NK cells and their exhaustion in the immunosuppressive tumor microenvironment (TME). Cerwenka et al. (2016), supra; Paust (2011), supra; O'Sullivan et al. (2015), supra; Sun et al. (2009), supra. Therefore, engineering NK cells in combination with TME-responsive CARs offers great hope for achieving immune memory-like activity in NK cells during tumor resection.

[0008] Stimulation of specific receptors promotes significant NK cell proliferation even in diseased microenvironments, and these self-renewing memory NK cells rapidly degranulate and, upon reactivation, produce cytokines, providing robust protective immunity. Berrien-Elliott et al. (2015), supra; Cooper et al. (2009), supra. While various tumor-targeting NK cell-intracellular CARs have been effectively stimulated by specific tumor antigens, their therapeutic efficacy has thus far been limited by poor in vivo proliferation and persistence of NK cells after infusion. It has been widely reported that the employment of cytokines (e.g., IL-15, IL-18, IL-21, etc.) can enhance the persistence and / or memory of various NK cells in vivo. Ma et al. (2021), supra; Liu et al. (2018); Romee et al. (2016), supra; Cooper et al. (2009), supra; Romee et al., Cytokine activation induces human memory-like NK cells, Blood 120(24): 4751-4760 (2012); Gang et al., CAR-modified memory-like NK cells exhibit potent responses to NK-resistant lymphomas, Blood 136(20): 2308-2318 (2020);Lopez-Verges et al., CD57 defines a functionally distinct population of mature NK cells in the human CD56dimCD16+ NK-cell subset, Blood 116(19): 3865-3874 (2010);Skak et al., Interleukin-21 activates human natural killer cells and modulates their surface receptor expression, Immunology 123(4): 575-583 (2008);Heinze et al., The Synergistic Use of IL-15 and IL-21 for the Generation of NK Cells From CD3 / CD19-Depleted Grafts Improves Their Ex Vivo Expansion and Cytotoxic Potential Against Neuroblastoma: Perspective for Optimized Immunotherapy Post Haploidentical Stem Cell Transplantation, Frontiers Immunology 10 (2019); Ma et al., Natural Killer (NK) and CAR-NK Cell Expansion Method using Membrane-Bound-IL-21-Modified B Cell Line, JoVE J (2022). However, cytokine stimulation can induce spontaneous NK cell proliferation or even leukemic transformation. Mishra et al., Aberrant Overexpression of IL-15 Initiates Large Granular Lymphocyte Leukemia through Chromosomal Instability and DNA Hypermethylation, Cancer Cell 22(5): 645-655 (2012). .

[0009] To generate superior memory-like NK cells in a robust, safe, and controllable manner, CAR structures should be designed to effectively and specifically recognize immunosuppressive signals within the TME and rapidly activate intracellular proliferation signaling pathways within NK cells, thereby enabling the proliferation of tumor-responsive cells and preventing NK cell exhaustion. (Liu et al. (2018), supra; Du et al. (2021), supra.) Among these immunosuppressive signals, programmed cell death ligand 1 (PD-L1) is expressed on various solid tumor cells and inhibits immunotherapy by interacting with PD-1 on immune cells. However, blocking PD-L1 / PD-1 has been widely used in CAR design because it has provided significant clinical benefits. Chen et al., Exosomal PD-L1 contributes to immunosuppression and is associated with anti-PD-1 response, Nature 560: 382-386 (2018); Jiang et al., Role of the tumor microenvironment in PD-L1 / PD-1-mediated tumor immune escape, Molecular Cancer 18: 10 (2019). In addition to enhanced in vivo persistence, these memory-like NK cells should have superior tumor-killing ability. It has been reported that CAR constructs containing the transmembrane and / or costimulatory domains of NKG2D, 2B4, and 41BB effectively activate intracellular cytotoxic signaling pathways in NK cells, but continuous exposure to antigen can cause NK cell exhaustion, potentially preventing the acquisition of a memory-like phenotype in engineered NK cells.Li et al., Human iPSC-Derived Natural Killer Cells Engineered with Chimeric Antigen Receptors Enhance Anti-tumor Activity, Cell Stem Cell 23(2): 181-192 (2018);Seo et al., IL-21-mediated reversal of NK cell exhaustion facilitates anti-Tumour immunity in MHC class I-deficient tumours, Nature Communications 8: 15776 (2017);Judge et al., Characterizing the Dysfunctional NK Cell: Assessing the Clinical Relevance of Exhaustion, Anergy, and Senescence, Frontiers in Cellular & Infection Microbiology 10 (2020)。

[0010] To avoid T cell exhaustion and cytokine storm, anti-fluorescein isothiocyanate (FITC) single-chain variable fragment (scFv)-based CARs have been used in T cells, hoping to eradicate tumor cells only in the presence of low molecular weight adaptors. Luo et al., Targeted Rejuvenation of Exhausted Chimeric Antigen Receptor T-cells Regresses Refractory Solid Tumors, Molecular Cancer Research 20(5): 823-833 (2022);Tamada et al., Redirecting gene-modified T cells toward various cancer types using tagged antibodies, Clinical Cancer Research 18(23): 6436-6445 (2012);Ma et al., Versatile strategy for controlling the specificity and activity of engineered T cells, PNAS USA 113(4): E450-E458 (2016);Lee et al., Regulation of CAR T cell-mediated cytokine release syndrome-like toxicity using low molecular weight adapters, Nature Communications 10: 2681 (2019);Lee et al., Use of a single CAR T cell and several bispecific adapters facilitate eradication of multiple antigenically different solid tumors, Cancer Research 79(2): 387-396 (2019). This fluorescein-cancer crosslinking small molecule has a short circulatory half-life (e.g., less than 90 minutes) and can readily penetrate solid tumors.Lee et al. (2019), supra. Such bispecific adapter strategies can also be used to prevent NK cell depletion and reduce off-target toxicity in non-target organs. However, limitations in obtaining sufficient donor cells for multiple transplants have hindered the widespread application of adoptive NK cell therapy to date. Zhu et al., Concise Review: Human Pluripotent Stem Cells to Produce Cell-Based Cancer Immunotherapy, Stem Cells 36(2): 134-145 (2018). Additionally, genetic modification of primary NK cells is technically challenging and laborious, potentially resulting in heterogeneous CAR-NK cells. Carlsten & Childs, Genetic manipulation of NK cells for cancer immunotherapy: Techniques and clinical implications, Frontiers Immunology 6 (2015).

[0011] In light of the above, it is another object of the present disclosure to provide NK cells with enhanced antigen-specific proliferation and anti-tumor toxicity, thereby providing universal NK cells with an immune memory-like phenotype for targeted immunotherapy. These and other objects, advantages, and attributes of the invention will be apparent from the description provided. Summary of the Invention

[0012] A population of universal natural killer (NK) cells is provided that are derived from human pluripotent stem cells (hPSCs) and engineered to overexpress the transcription factors ID2, NFIL3, and / or SPI1. Expression of the transcription factor(s) can be inducible. The majority of NK cells express CD45 + CD56 +The NK cells may express at least one NK cell-specific marker. The at least one NK cell-specific marker may be NKp44, NKp46, KIR3DL1, NKG2D, or any combination thereof. The general NK cell population may be further engineered to express an anti-programmed death-ligand 1 (PD-L1) chimeric antigen receptor (CAR) and an anti-fluorescein isothiocyanate (FITC) CAR. The anti-PD-L1 CAR or anti-FITC CAR may contain a truncated cytoplasmic domain derived from the interleukin-2 (IL-2) receptor beta chain, a STAT3-binding tyrosine-XX-glutamine (YXXQ) motif, or both.

[0013] In certain embodiments, a population of NK cells is derived from hPSCs and engineered to overexpress transcription factors ID2, NFIL3, and / or SPI1, and to express an anti-PD-L1 CAR and an anti-FITC CAR. For example, NK cells can be engineered to overexpress transcription factor ID2. The anti-PD-L1 CAR and / or anti-FITC CAR can contain a truncated cytoplasmic domain derived from the IL-2 receptor beta chain, a STAT3-binding tyrosine-XX-glutamine (YXXQ) motif, or both.

[0014] In certain embodiments, the anti-PD-L1 CAR and / or anti-FITC CAR comprises an NK cell Fc receptor transmembrane domain and an intracellular signaling domain. The NK cell Fc receptor transmembrane domain and intracellular signaling domain may comprise a gamma chain derived from CD32a or a gamma chain derived from CD16. Overexpression of the transcription factor(s) may be inducible. The majority of NK cells express CD45 + CD56 + The NK cells may express at least one NK cell-specific marker. In certain embodiments, the at least one NK cell-specific marker may be NKp44, NKp46, KIR3DL1, NKG2D, or any combination thereof.

[0015] hPSCs may include human embryonic stem cells (hESCs) and / or induced pluripotent stem cells (iPSCs).

[0016] Also provided is a population of hPSCs engineered to express an anti-PD-L1 CAR and an anti-FITC CAR. The population of hPSCs can be further modified to overexpress the transcription factors ID2, NFIL3, and / or SPI1. The hPSCs can include hESCs and / or iPSCs. In certain embodiments, the population of hPSCs is engineered to overexpress the transcription factor ID2. In certain embodiments, the overexpression of the transcription factor(s) is inducible.

[0017] In certain embodiments, the anti-PD-L1 CAR and / or anti-FITC CAR in the population of hPSCs comprises a truncated cytoplasmic domain derived from the IL-2 receptor beta chain, a STAT3-binding tyrosine-XX-glutamine (YXXQ) motif, or both. In certain embodiments, the anti-PD-L1 CAR and / or anti-FITC CAR in the population of hPSCs comprises an NK cell Fc receptor transmembrane domain and an intracellular signaling domain. In certain embodiments, the NK cell Fc receptor transmembrane domain and intracellular signaling domain comprise a gamma chain derived from CD32a or a gamma chain derived from CD16.

[0018] CAR constructs are also provided. In certain embodiments, the CAR construct comprises one or more sequences encoding an anti-FITC polypeptide or an anti-PD-L1 polypeptide, an NKG2d transmembrane domain, and a 2B4 costimulatory domain. The CAR construct may further comprise one or more sequences encoding a truncated cytoplasmic domain derived from the IL-2 receptor beta chain, a STAT3-binding tyrosine-XX-glutamine (YXXQ) motif, or both. The CAR construct may further comprise one or more sequences encoding FcγRIII.

[0019] Pharmaceutical compositions are also provided. In certain embodiments, the pharmaceutical compositions herein comprise any of the NK cells herein or any of the general NK cells herein, and a pharmaceutically acceptable carrier and / or diluent. The pharmaceutical composition may further comprise a pharmaceutically acceptable excipient.

[0020] Also provided is the use of the NK cells herein, the constructs herein, the universal NK cells herein, or the pharmaceutical compositions herein in the manufacture of a medicament for treating cancer in a subject.

[0021] Also provided are methods for treating cancer in a subject. The methods include administering to the subject the population of universal NK cells described above. In certain embodiments, the method for treating cancer in a subject includes administering to the subject a first therapy comprising a therapeutically effective amount of any of the populations of NK cells described herein, a population of NK cells expressing one or more constructs described herein, a population of universal NK cells described herein, or a pharmaceutical composition described herein, when the subject is being treated for cancer.

[0022] Administration of the first therapy may comprise a delivery route selected from the group consisting of intravenous, intraperitoneal, intramuscular, intradermal, subcutaneous, intrathecal, intraosseous, and any combination of the above.

[0023] The method may further include administering a conjugate to a subject. The conjugate may include FITC linked to a ligand that binds to folate receptor alpha (FRα). Alternatively, the conjugate may include FITC linked to a ligand that binds to prostate-specific membrane antigen (PSMA). The ligand that binds to PSMA may be DUPA. Alternatively, the conjugate may include FITC linked to a ligand that binds to carbonic anhydrase IX (CAIX).

[0024] The method may further include administering a second treatment to the subject. The second treatment may include a therapeutically effective amount of chemotherapy. The second treatment may include a therapeutically effective amount of radiation therapy. The second treatment may include surgically removing cancerous cells from the subject. The second treatment may include chemotherapy, radiation therapy, or both.

[0025] The method may further include imaging the cancer in the subject before or during administration of the first therapy and / or the second therapy. The first therapy and the second therapy may be administered sequentially and / or alternatingly.

[0026] Also provided are methods for producing a population of NK cells described herein. Such methods include differentiating a population of hPSCs into NK cells, where the population of hPSCs can be engineered to overexpress the transcription factors ID2, NFIL3, and / or SPI1. In certain embodiments, the population of hPSCs can be engineered to express an anti-PD-L1 CAR and an anti-FITC CAR. The hPSCs can include hESCs and / or iPSCs. The population of hPSCs can be engineered to overexpress the transcription factor ID2. The anti-PD-L1 CAR and / or anti-FITC CAR can comprise a truncated cytoplasmic domain derived from the interleukin-2 (IL-2) receptor beta chain, a STAT3-binding tyrosine-XX-glutamine (YXXQ) motif, or both. The anti-PD-L1 CAR and / or anti-FITC CAR can comprise an NK cell Fc receptor transmembrane domain and an intracellular signaling domain. The NK cell Fc receptor transmembrane domain and intracellular signaling domain can comprise a gamma chain from CD32a or a gamma chain from CD16. Overexpression of the transcription factor(s) can be inducible.

[0027] Other features, advantages and aspects of the disclosed embodiments and those contained herein, as well as the means for achieving the same, will become apparent from the following detailed description of various exemplary embodiments of the present disclosure, which will be better understood when considered in conjunction with the accompanying drawings. [Brief explanation of the drawings]

[0028] [Figure 1-1] Figure 1A shows an overview of the all-in-one Tet-on3G inducible system construct. Figure 1B shows an overview of the targeted knock-in strategy at the endogenous AAVS1 safe harbor locus via CRISPR / Cas9-mediated homologous recombination. [Figure 1-2] Figure 1C shows polymerase chain reaction (PCR) genotyping performed on human pluripotent stem cell (hPSC) clones after puromycin selection. The expected PCR product for a correctly targeted AAVS1 site is 991 bp (arrow on the left). Homozygosity assays were performed on knock-in clones; clones lacking the approximately 204 bp PCR product were homozygous (arrow on the right). [Figure 1-3] Figure 1D shows flow cytometry analysis of OCT4 and SSEA4 expression in the indicated hPSC lines, and Figure 1E shows RT-PCR analysis of NFIL3, SPI1, and ID2 expression in the indicated human pluripotent stem cell (hPSC) lines with or without doxycycline (dox) treatment. [Figure 2-1] Figure 2A shows a schematic of hPSC differentiation into natural killer (NK) cells with or without doxycycline (dox) treatment, and Figure 2B shows representative flow cytometry analysis of CD45 and CD56 in NK cell differentiation cultures (day 30) derived from the indicated hPSC lines. [Figure 2-2] Figure 2C shows a bar graph depicting quantification of CD45+CD56+ expression (%) for the indicated hPSC lines, where A represents the non-dox-treated group and B represents the dox-treated group. Three wells per condition; data are presented as the mean ± standard deviation (sd) of three independent replicates, *p<0.05. [Figure 3-1]FIG. 3A is a diagram showing an outline of differentiation of hPSCs into NK cells, in which stage-specific overexpression of ID2 is observed upon dox treatment. [Figure 3-2] Figure 3B shows a representative flow cytometry analysis of CD45 and CD56 expression in the indicated dox-treated NK cell differentiation cultures (day 30). Figure 3C shows a bar graph depicting quantification of CD45+CD56+ expression (%) for the indicated hPSC lines. Three wells per condition; data are presented as the mean ± standard deviation (sd) of three independent replicates, *p<0.05. [Figure 3-3] FIG. 3D shows representative histogram plots of the indicated NK cell markers and corresponding isotype controls (controls are designated as A and stained samples as B). [Figure 4-1] Figure 4A shows the proliferation of the indicated NK cells on days 5 and 15. Figure 4B shows a schematic of the in vitro transwell model for migration studies. [Figure 4-2] Figure 4C shows a bar graph depicting quantification of the percent migration rate for the indicated migrating NK cells. Figure 4D shows representative images of localized F-actin accumulation at the interface between the indicated NK cells and targeted U87MG glioblastoma cells. Scale bar, 25 μm. [Figure 4-3] Figure 4E shows representative flow cytometry analysis of interferon-γ (IFNγ) / CD107a in ID2-hPSC-derived NK cells, wild-type hPSC-derived NK cells, and peripheral blood (PB) NK cells with or without glioblastoma cell stimulation. Figure 4F shows a bar graph depicting quantification of IFNγ+CD107a+ (%) for the indicated cells. Five replicates per condition; data are presented as the mean ± standard deviation (sd) of five independent replicates. [Figure 4-4]Figure 4G shows quantification of ID2-hPSC-derived NK cell cytotoxicity against the indicated tumor cells at ratios of 0:1, 3:1, 5:1, and 10:1. Figure 4H shows quantification of wild-type hPSC-derived NK cell cytotoxicity against the indicated tumor cells at ratios of 0:1, 3:1, 5:1, and 10:1. Figure 4I shows quantification of PB NK cell cytotoxicity against the indicated tumor cells at ratios of 0:1, 3:1, 5:1, and 10:1. [Figure 5-1] FIG. 5A shows a schematic of the all-in-one Tet-on3G inducible system construct. [Figure 5-2] Figure 5B shows fluorescence images depicting the kinetics of eGFP expression with and without dox treatment. Scale bar, 100 μm. [Figure 5-3] FIG. 5C shows quantification of mean fluorescence intensity after normalization for eGFP expression over time with and without dox treatment. [Figure 6] FIG. 6 shows a representative karyotyping analysis of normal ID2-H9 cells. [Figure 7-1] Figure 7A shows a schematic of dox treatment for time-dependent ID2 expression analysis performed on ID2-hPSCs, and Figure 7B shows representative flow cytometry analysis of ID2 at the indicated time points. [Figure 7-2] FIG. 7C shows quantification of ID2 expression (%) over time. [Figure 8-1] FIG. 8A shows a representative flow cytometry analysis of CD45 and CD56 expression on wild-type hPSC-derived NK cells using OP9 stromal feeder cells. [Figure 8-2] FIG. 8B shows quantification of CD45+CD56+ cells for ID2-induced hPSC-NK cells, feeder cell-derived wild-type hPSC-NK cells, and PB NK cells. [Figure 9]Figure 9 shows quantification of cell viability (%) for hPSC-derived NK cells incubated with wild-type H9 hPSCs, hPSC-derived mesoderm, hPSC-derived endoderm, and hPSC-derived ectoderm at an effector-to-target ratio of 10:1. The number of viable cells was quantified. Data are presented as the mean ± standard deviation (sd) of five independent replicates. [Figure 10] FIG. 10 shows an outline of the synergistically enhanced anti-tumor effect of dual-CAR hPSC-NK cells. [Figure 11-1] FIG. 11A shows a schematic of various lentiviral CAR constructs. [Figure 11-2] Figure 11B shows killing of MDA-MB-231 tumor cells by NK-92 cells at different effector-to-target ratios in the absence of 10 nM anti-fluorescein isothiocyanate (FITC)-folate adaptor. Dataset A is NK 92, B is CAR#1 NK 92, C is CAR#2 NK 92, D is CAR#3 NK 92, E is CAR#4 NK 92, F is CAR#5 NK 92, G is CAR#6 NK 92, H is CAR#7 NK 92, and I is CAR#8 NK 92. Data are presented as the mean ± standard deviation (sd) of five independent replicates. *p<0.05. Figure 11C shows the killing of MDA-MB-231 tumor cells by NK-92 cells at different effector-to-target ratios in the presence of 10 nM FITC-folate adapter. Dataset A is NK 92, B is CAR#1 NK 92, C is CAR#2 NK 92, D is CAR#3 NK 92, E is CAR#4 NK 92, F is CAR#5 NK 92, G is CAR#6 NK 92, H is CAR#7 NK 92, and I is CAR#8 NK 92. Data are presented as the mean ± standard deviation (sd) of five independent replicates. *p<0.05. [Figure 11-3]Figure 11D shows enzyme-linked immunosorbent assay (ELISA) analysis of the cytokine IFNγ secreted by various NK-92 cells upon MDA-MB-231 stimulation. Dataset A is without FITC-FA, and dataset B is with FITC-FA. Data are presented as the mean ± standard deviation (sd) of five independent replicates. *p<0.05. Figure 11E shows ELISA analysis of the cytokine tumor necrosis factor alpha (TNFα) secreted by various NK-92 cells upon MDA-MB-231 stimulation. Dataset A is without FITC-FA, and dataset B is with FITC-FA. Data are presented as the mean ± standard deviation (sd) of five independent replicates. *p<0.05. [Figure 11-4] Figure 11F shows representative flow cytometry analysis of phosphorylated STAT3 (pSTAT3) and phosphorylated STAT5 (pSTAT5) in the indicated NK-92 cells upon MDA-MB-231 stimulation. Figure 11G shows quantification of the proliferation of the indicated NK-92 cells at day 7 after coculture with MDA-MB-231 cells. Data are presented as the mean ± standard deviation (sd) of five independent replicates. *p<0.05. Figure 11H shows a schematic of the in vitro MDA-MB-231 tumor rechallenge model and cytotoxicity assay. [Figure 11-5] Figure 11I shows killing of MDA-MB-231 tumor cells by the indicated NK-92 cells at different time points in the presence of 10 nM FITC-folate adapter. Data set A is NK 92, B is CAR#1 NK 92, C is CAR#2 NK 92, D is CAR#3 NK 92, E is CAR#4 NK 92, F is CAR#5 NK 92, G is CAR#6 NK 92, H is CAR#7 NK 92, and I is CAR#8 NK 92. Data are presented as the mean ± standard deviation (sd) of five independent replicates. *p<0.05. [Figure 12-1]Figure 12A shows flow cytometry analysis of NK cells derived from different hPSCs. Plots show histograms of control (A) and the indicated NK cell-specific antibodies (B). [Figure 12-2] Figure 12B shows representative images of immune synapses at the interface between tumor cells and the indicated hPSC-NK cells by F-actin staining, and Figure 12C shows quantification (%) of immune synapses. [Figure 12-3] Figure 12D shows flow cytometry analysis of interferon gamma (INFγ) / CD107a in different NK cells upon MDA-MB-231 cell stimulation, and Figure 12E shows ELISA analysis of the cytokine TNFα secreted by the indicated NK cells in response to MDA-MB-231 cells. [Figure 12-4] Figure 12F shows ELISA analysis of the cytokine INFγ secreted by the indicated NK cells in response to MDA-MB-231 cells. Figure 12G shows killing of MDA-MB-231 tumor cells by the indicated hPSC-NK cells at different effector to target ratios in the presence of 10 nM FITC-folate adapter. [Figure 12-5] Figure 12H shows quantification of phosphorylated STAT3 (pSTAT3) and STAT5 (pSTAT5) expression in the indicated hPSC-NK cells upon MDA-MB-231 stimulation. Figure 12I shows quantification of proliferation in the indicated hPSC-NK cells 7 days after coculture with MDA-MB-231 tumor cells. [Figure 12-6] Figure 12J shows the killing of MDA-MB-231 tumor cells by the indicated hPSC-NK cells at different time points in the presence of 10 nM FITC-folate adapter. Data are presented as the mean ± standard deviation (sd) of five independent replicates. *p<0.05. [Figure 13-1] FIG. 13A shows a schematic diagram of subcutaneous injection of MDA-MB-231 cells for in vivo tumor model establishment and persistence analysis of various hPSC-derived NK cells. [Figure 13-2] Figure 13B shows flow cytometry analysis of CD45+CD56+ hPSC-NK cells in host blood at different time points after intravenous injection of the indicated hPSC-NK cells or phosphate-buffered saline (PBS) control. [Figure 13-3] FIG. 13C shows the quantification of CD45+CD56+ hPSC-NK cells (%) (n=5). [Figure 13-4] FIG. 13D shows the body weights of all experimental mouse groups measured at the indicated time points. [Figure 13-5] FIG. 13E shows hematoxylin and eosin stained (H&E) images of major organs collected at the end of the procedure described in FIG. 13A. [Figure 14-1] Figure 14A shows a schematic diagram of intravenous injection of various hPSC-NK cells for in vivo antitumor cytotoxicity testing. Figure 14B shows the results of an in vivo antitumor cytotoxicity test (5 × 10 MDA-MB-231 cells were subcutaneously implanted into the left dorsum of NRG mice). Seven days later, mice were intravenously treated with PBS or 1 × 10 hPSC-NK cells. [Figure 14-2] FIG. 14C shows the time-dependent tumor burden of experimental groups of mice treated as indicated compared to PBS controls. [Figure 14-3] Figure 14D shows the levels of human TNFα and interleukin-6 (IL-6) released by ELISA in peripheral blood collected from the indicated experimental mice (n=5). Figure 14E shows the levels of human TNFα and interleukin-6 (IL-6) released by ELISA in peripheral blood collected from the indicated experimental mice (n=5). [Figure 15-1] Figure 15A shows a schematic of the in vivo tumor rechallenge model (1 x 10 MDA-MB-231 cells were implanted subcutaneously into the right dorsum of NSG mice on day 37), and Figure 15B shows the time-dependent secondary tumor burden volume for the indicated experimental mouse groups. [Figure 15-2]Figure 15C shows the time-dependent secondary tumor burden volume for the indicated experimental mouse groups. Figure 15D shows Kaplan-Meier curves representing survival rates for the indicated experimental mouse groups (n=5). [Figure 16-1] Figure 16A shows flow cytometry analysis of PD-L1 and folate receptor alpha (FRα) expression in LNCaP and MDA-MB-231 cells, and Figure 16B shows the molecular structure of FITC-folate small molecules. [Figure 16-2] Figure 16C shows the binding affinity of FITC-folate to MDA-MB-231 cells, and Figure 16D shows the binding affinity of FITC-folate to NK-92 cells. [Figure 16-3] Figure 16E shows flow cytometry analysis of anti-PD-L1 and anti-FITC CAR expression in NK-92 cells. [Figure 17-1] Figure 17A shows killing of LNCaP tumor cells by the indicated NK-92 cells at different effector-to-target ratios in the absence of a FITC-folate adaptor. Data are presented as the mean ± standard deviation (sd) of five independent replicates. *p<0.05. Figure 17B shows killing of LNCaP tumor cells by the indicated NK-92 cells at different effector-to-target ratios in the presence of a FITC-folate adaptor. Data are presented as the mean ± standard deviation (sd) of five independent replicates. *p<0.05. [Figure 17-2] Figure 17C shows ELISA analysis of IFNγ and TNFα secreted from various NK-92 cells in response to LNCaP tumor cells. Figure 17D shows ELISA analysis of TNFα secreted from various NK-92 cells in response to LNCaP tumor cells. [Figure 18]Figure 18A shows quantification of phosphorylated pSTAT3 expression in the indicated hPSC-NK cells upon stimulation with MDA-MB-231. Data are presented as the mean ± standard deviation (sd) of five independent replicates. *p<0.05. Figure 18B shows quantification of phosphorylated pSTAT5 expression in the indicated hPSC-NK cells upon stimulation with MDA-MB-231. Data are presented as the mean ± standard deviation (sd) of five independent replicates. *p<0.05. [Figure 19-1] Figure 19A shows an overview of the anti-FITC CAR construct and targeted knock-in strategy at the AAVS1 safe harbor locus. The vertical arrow indicates the AAVS1-targeting sgRNA. The horizontal arrows (B) and (A) represent primers for assaying targeting efficiency and homozygosity, respectively. Figure 19B shows PCR genotyping of single-cell-derived hPSC clones after puromycin selection. The expected PCR product for a correctly targeted AAVS1 site was 991 bp (arrow), with an efficiency of 7 out of 11 clones. Homozygosity assay of knock-in clones revealed that clones lacking the approximately 240 bp PCR product were homozygous (arrow). [Figure 19-2] Figure 19C shows flow cytometry analysis of anti-PD-L1, anti-FITC CAR, OCT-4, and SSEA-4 expression in wild-type and CAR-engineered hPSCs. [Figure 20-1] FIG. 20A shows an outline of hematopoietic and NK cell differentiation from hPSCs. [Figure 20-2] FIG. 20B shows representative flow cytometry analyses of CD34 and CD45 expression in the indicated hPSC differentiation cultures on days 0 and 15. [Figure 20-3] FIG. 20C shows representative flow cytometry analyses of CD56 and CD45 expression in the indicated hPSC differentiation cultures at days 15 and 45. [Figure 21-1]Figure 21A shows the number of immune synapses formed between the indicated NK cells and LNCaP tumor cells, and Figure 21B shows flow cytometry analysis of INFγ / CD107a expression in the indicated hPSC-NK cells in response to LNCaP tumor cells. [Figure 21-2] Figure 21C shows ELISA analysis of TNFα and INFγ secreted from the indicated hPSC-NK cells in response to LNCaP tumor cells. Figure 21D shows ELISA analysis of INFγ secreted from the indicated hPSC-NK cells in response to LNCaP tumor cells. [Figure 21-3] FIG. 21E shows killing of LNCaP tumor cells by the indicated hPSC-NK cells at different effector to target ratios in the presence of 10 nM FITC-folate adapter. [Figure 22-1] FIG. 22A shows a representative flow cytometry analysis of pSTAT3 and pSTAT5 expression in the indicated hPSC-NK cells upon MDA-MB-231 stimulation. [Figure 22-2] Figure 22B shows quantification of cell viability (%) for hPSC-NK cells incubated with normal H9 hPSCs, hPSC-derived mesoderm, hPSC-derived endoderm, and hPSC-derived ectoderm at an effector-to-target ratio of 10:1. Data are presented as the mean ± standard deviation (sd) of five independent replicates. [Figure 23-1] FIG. 23A shows flow cytometry analysis of CD45+CD56+ hPSC-NK cells in host blood at different time points after intravenous injection of the indicated hPSC-NK cells or a PBS control. [Figure 23-2] Figure 23B shows quantification of CD45+CD56+ hPSC-NK cells (n=5), and Figure 23C shows body weights of all experimental mouse groups at the indicated time points. DETAILED DESCRIPTION OF THE INVENTION

[0029] While the present disclosure is susceptible to various modifications and alternative forms, exemplary embodiments thereof have been shown by way of example in the drawings and will herein be described in detail.

[0030] Although the concepts of the present disclosure have been illustrated and described in detail herein, the results in the description are to be considered exemplary and not limiting in nature. It is understood that the embodiments shown and described are illustrative only, and all changes and modifications that come within the spirit of the disclosure are desired to be protected.

[0031] The present disclosure is based, at least in part, on the use of a transcription factor (TF)-mediated cell fate engineering approach to develop a robust and rapid platform for the large-scale production of natural killer (NK) cells from human pluripotent stem cells (hPSCs).

[0032] "Natural killer" and "NK" are used to refer to a subset of peripheral blood lymphocytes defined by their expression of CD56 or CD16 and lack of the T cell receptor (CD3). The majority of NK cells express CD45 + CD56 + The NK cells may express at least one NK cell-specific marker. The at least one NK cell-specific marker may be NKp44, NKp46, KIR3DL1, NKG2D, or any combination thereof.

[0033] When used to describe stem cells, "pluripotency" refers to the ability of a cell to form all cell lineages of an organism, in this case, all human cell lineages. Characteristics of pluripotency include, but are not limited to, morphology (e.g., small size, round shape, high nuclear-to-cytoplasmic ratio, the presence of prominent nucleoli, and intercellular spacing), the ability to self-renew indefinitely, expression of pluripotent stem cell markers (e.g., SSEA3 / 4, SSEA5, TRA1-60 / 81, TRA1-85, TRA2-54, GCTM-2, TG343, TG30, CD9, CD29, CD133 / prominin, CD140a, CD56, CD73, CD90, CD105, OCT4, NANOG, SOX2, CD30, and / or CD50), the ability to differentiate into ectoderm, mesoderm, and endoderm, teratoma formation, and embryoid body formation.

[0034] The hPSCs herein are genetically modified (e.g., using CRISPR / Cas9-mediated gene knock-in technology) to introduce an inducible DNA-binding factor inhibitor 2 (ID2) construct, a nuclear factor interleukin-3-regulated (NFIL3) construct, and / or an Spi-1 proto-oncogene (SPI1) construct into the adeno-associated virus site 1 (AAVS1) safe harbor locus. Heinze et al. (2019), supra. Thus, a population of universal NK cells derived from hPSCs and engineered to overexpress the transcription factors ID2, NFIL3, and / or SPI1 is provided. As used herein, "universal" means that the population of NK cells can be administered to any human. Thus, the universal NK cell population can be used as an "off-the-shelf" product in various therapies, such as targeted cancer immunotherapy. The resulting hPSC-derived NK cells express various mature NK-specific markers and can exhibit effective tumor-killing ability across various cancer cell lines in vitro. Therefore, the present disclosure provides a novel platform for efficiently producing universal NK cells that can be used in various therapies (e.g., targeted cancer immunotherapy) to treat any patient without human leukocyte antigen matching.

[0035] The present disclosure further relies on the use of chimeric antigen receptor (CAR) constructs to promote hPSC-NK cell proliferation and antitumor cytotoxicity, for example, through antigen-dependent activation of the phosphorylated STAT3 (pSTAT3) and phosphorylated STAT5 (pSTAT5) signaling pathways via an intracellular truncated IL-2 receptor β chain (ΔIL-2Rβ) and STAT3-binding tyrosine-XX-glutamine (YXXQ) motif. To develop versatile, potent, yet safer CAR-NK cell therapies, certain embodiments of the NK cells herein utilize a stable anti-fluorescein isothiocyanate (FITC)-CAR. When administered to a subject, the anti-FITC-folate adapter crosslinks the programmable anti-FITC-CAR with folate receptor α (FRα)-expressing tumor cells (e.g., breast tumors), thereby further enhancing the antitumor activity of programmed cell death ligand (PD-L1)-induced memory-like hPSC-NK cells. Thus, the present disclosure further provides NK cells with enhanced antigen-specific proliferation and anti-tumor toxicity, thereby providing universal NK cells with an immune memory-like phenotype for use in targeted immunotherapy. Indeed, the hPSC-derived CAR-NK and CAR-NK-92 cells herein demonstrated controllable and potent anti-tumor activity.

[0036] To achieve greater efficacy and potency in NK cells, the NK cells herein can be further engineered to express a second anti-PD-L1 CAR to leverage the impressive clinical efficacy of checkpoint inhibitors targeting PD-1 or PD-L1. Targeting PD-L1 allows for selective targeting of solid tumor cells, with a predictable side effect profile based on PD-1 / L1 immune checkpoint blockade. Robbins et al., Tumor control via targeting PD-L1 with chimeric antigen receptor-modified NK cells, eLife (2020).

[0037] Due to their innate immunity against all kinds of pathogens and their unique property of not causing graft-versus-host disease in allogeneic transplants, adoptive CAR-NK cell therapy holds great promise in the treatment of various cancers. To date, most efforts have been focused on treating hematological malignancies with FDA-approved anti-CD19 or anti-CD33 CAR-NK cells. Liu et al. (2018), supra; Roex et al., Two for one: targeting BCMA and CD19 in B-cell malignancies with off-the-shelf dual-CAR NK-92 cells, J Translational Medicine 20: 124 (2022); Ingegnere et al., Human CAR NK cells: A new non-viral method allowing high efficient transfection and strong tumor cell killing, Frontiers in Immunology 10 (2019); Liu et al., Use of CAR-Transduced Natural Killer Cells in CD19-Positive Lymphoid Tumors, New England J Medicine 382: 545-553 (2020).

[0038] hPSCs and NK cells Provided is a universal NK cell (or a population of universal NK cells) derived from hPSCs. In certain embodiments, the population of universal NK cells is derived from hPSCs and engineered to overexpress the transcription factors ID2, NFIL3, and / or SPI1. The expression of the transcription factor(s) can be inducible.

[0039] Universal NK cells or populations thereof can be differentiated from hPSCs using methods known in the art and / or exemplified herein. hPSCs (e.g., populations of hPSCs) can include human embryonic stem cells (hESCs) and / or induced pluripotent stem cells (iPSCs). In one embodiment, the hPSCs can be autologous, although xenogeneic cells can also be used, such as when the patient undergoes high-dose chemotherapy or radiation treatment to destroy the patient's immune system. In one embodiment, allogeneic cells can be used. If desired, hPSCs can be obtained from the subject by means well known in the art.

[0040] hPSCs can be engineered to express an anti-PD-L1 CAR and an anti-FITC CAR. hPSCs can be further engineered to overexpress the transcription factors ID2, NFIL3, and / or SPI1. In certain embodiments, hPSCs are engineered to express an anti-PD-L1 CAR and an anti-FITC CAR, and to overexpress at least the transcription factor ID2.

[0041] Overexpression of one or more of the transcription factors ID2, NFIL3, and / or SPI1 promotes the generation of NK cells under chemically defined, feeder-free culture conditions. "Feeder-free" refers to culture conditions that are substantially free of feeder cells or stromal cells and / or that have not been preconditioned by culturing feeder cells. "Preconditioned" refers to medium that has been collected after feeder cells have been cultured in the medium for a period of time, e.g., at least one day. Preconditioned medium contains many mediator substances, including growth factors and cytokines, secreted by feeder cells cultured in the medium.

[0042] Expression of a transcription factor can be controlled by operably linking it to a promoter. Selection of a promoter and operably linking it to a sequence encoding a protein (e.g., ID2) is within the capabilities of one of ordinary skill in the art. In various embodiments, the promoter is inducible.

[0043] In certain embodiments, populations of hPSCs and / or universal NK cells are engineered to overexpress the transcription factor ID2 (e.g., by engineering a population of hSPCs from which universal NK cells differentiate to overexpress the transcription factor ID2, or by using a vector or other method). Desirably, the ID2 sequence is a human sequence, and is conserved in chimpanzee, rhesus monkey, cow, mouse, rat, chicken, zebrafish, and frog. The ID2 sequence is available in GenBank (Gene Identification Number: 3398). The gene encoding ID2 is also known as BHLHb26, differentiation factor inhibitor 2, GIG8, DNA-binding factor inhibitor 2, dominant-negative helix-loop-helix protein, class B basic helix-loop-helix protein 26, DNA-binding protein inhibitor ID-2, cell proliferation inhibitory gene 8, DNA-binding factor inhibitor 2, HLH protein, DNA-binding protein inhibitor ID2, helix-loop-helix protein ID2, BHLHB26, ID2A, and ID2H. The protein encoded by the gene belongs to the DNA-binding factor inhibitor family, whose members are transcriptional regulators that contain a helix-loop-helix (HLH) domain but not a basic domain. Family members inhibit the function of basic HLH transcription factors in a dominant-negative manner by suppressing their heterodimerization partners through the HLH domain. See GeneCards®: The Human Gene Database (publicly available via the internet).

[0044] In certain embodiments, populations of hPSCs and / or universal NK cells are engineered to overexpress the transcription factor NFIL3. Desirably, the NFIL3 sequence is a human sequence. The NFIL3 sequence is available in GenBank (gene identification number: 4783). Expression of the NFIL3 sequence can be controlled by operably linking it to a promoter. Selection of a promoter and operably linking it to a sequence encoding a protein (e.g., NFIL3) is within the capabilities of one of ordinary skill in the art. In various embodiments, the promoter is inducible.

[0045] The gene encoding NFIL3 is also known as E4BP4, NF-IL3A, NFIL3A, IL3BP1, interleukin-3 promoter transcriptional activator, nuclear factor interleukin-3-regulated protein, adenovirus E4 promoter region binding protein, transcriptional activator NF-IL3A, interleukin-3 binding protein, E4 promoter binding protein 4, interleukin-3 binding protein 1, and E4 promoter binding protein. The protein encoded by the gene is a transcriptional regulator that binds as a homodimer to activating transcription factor (ATF) sites in many cellular and viral promoters. The encoded protein represses the expression of PER1 and PER2, thus playing a role in the control of circadian rhythms. See, for example, GeneCards®: The Human Gene Database (publicly available via the Internet).

[0046] In certain embodiments, a population of hPSCs and / or a population of universal NK cells are engineered to overexpress the transcription factor SPI1. Desirably, the SPI1 sequence is a human sequence. The SPI1 sequence is available in GenBank (gene identification number: 6688). Expression of the SPI1 sequence can be controlled by operably linking it to a promoter. Selection of a promoter and operably linking it to a sequence encoding a protein (e.g., SPI1) is within the capabilities of one of ordinary skill in the art. In various embodiments, the promoter is inducible.

[0047] The gene encoding SPI1 is also known as SPI-A, SFPI1, SPI-1, PU.1, OF, hematopoietic transcription factor PU.1, 31-kDa transforming protein, transcription factor PU.1, spleen focus-forming virus (SFFV) proviral integration oncogene Spi1, SFFV proviral integration oncogene, 31-kDa transforming protein, and AGM10. The gene encodes an ETS domain transcription factor that activates gene expression during myeloid and B-lymphoid cell development. The nuclear protein binds to purine-rich sequences known as PU boxes found near the promoters of target genes and regulates their expression in cooperation with other transcription factors and cofactors. The protein may also regulate alternative splicing of target genes. See, for example, GeneCards®: The Human Gene Database (publicly available via the internet).

[0048] As described above, CAR-expressing hPSCs are also provided, as are populations of universal NK cells derived therefrom. In certain embodiments, the population of universal NK cells expresses a PD-L1 CAR (i.e., the CAR-expressing hPSCs from which such populations are derived comprise a PD-L1 CAR). In certain embodiments, the population of universal NK cells expresses an anti-FITC CAR (i.e., the CAR-expressing hPSCs from which such populations are derived comprise a PD-L1 CAR). In certain embodiments, the population of universal NK cells expresses a dual CAR construct comprising a PD-L1 CAR and an anti-FITC CAR (i.e., the CAR-expressing hPSCs from which such populations are derived comprise a dual CAR construct comprising a PD-L1 CAR and an anti-FITC CAR).

[0049] CARs are engineered receptors that confer desired specificity to immune effector cells (e.g., hPSCs herein or NK cells derived from hPSCs herein, etc.). See, e.g., Sadelain et al., "The Basic Principles of Chimeric Antigen Receptor Design," Cancer Discovery OF1-11 (2013). Non-limiting examples of complementarity-determining regions (CDRs) include those derived from CD19 (U.S. Pat. No. 7,446,190 and U.S. Patent Application Publication No. 2013 / 0071414), HER2 (Ahmen et al., HER2-specific T cells target primary glioblastoma stem cells and induce regression of autologous experimental tumors, Clinical Cancer Research 16(2): 474-485 (2010)), MUC16 (Chekmasova et al., Successful eradication of established peritoneal ovarian tumors in SCID-Beige mice following adoptive transfer of T cells genetically targeted to the MUC16 antigen, Clinical Cancer Research 16(14): 3594-3606 (2011)), and prostate-specific membrane antigen (PSMA) (Zhong et al., Chimeric antigen receptors combining 4-1BB and CD28 signaling domains augmented PI3kinase / AKT / Bc1-XL activation and CD8+ T cell-mediated tumor eradication, Molecular Therapy 18(2): 413-420 (2010)).

[0050] CAR-NK cells have been engineered from various NK cells, including the NK-92 cell line, hPSC-derived NK cells, umbilical cord blood NK cells, and peripheral blood NK cells; however, NK-92-derived CAR-NK cells have prevailed in clinical trials due to their superior in vitro proliferation capacity. Although no obvious toxicity has been observed in clinical trials using NK-92 cells, concerns remain that they may still survive and proliferate in vivo after irradiation treatment during cell preparation for infusion. (Li et al. (2018), supra; Biederstadt & Rezvani, Engineering the next generation of CAR-NK immunotherapies, Int. J. Hematol. (2021).

[0051] Engineering CAR-NK cells from hPSCs allows for an unlimited cell source of versatile, "off-the-shelf" cell products. Furthermore, the relative ease of genome editing in hPSCs allows for the mass production of homogeneous, stable CAR-expressing NK cells at clinical scale, providing a more standardized product. Both CRISPR / Cas9-mediated knock-in and lentiviral transduction strategies can be used to introduce CAR constructs into hPSCs and produce functional CAR-NK cells.

[0052] The CAR can be a fusion protein comprising an extracellular domain, a transmembrane domain, and an intracellular domain. In certain embodiments, the CAR herein binds with high specificity to a cell surface antigen on an immunosuppressive cell or cancer cell.

[0053] Furthermore, "binding with specificity," "binding with high specificity," or "selectively" binding, when used in reference to a ligand / receptor, recognition region / targeting moiety, nucleic acid / complementary nucleic acid, antibody / antigen, or other binding pair, refers to a binding reaction that can determine the presence of a protein in a heterogeneous population of proteins and other biological materials. Thus, under given conditions, a particular ligand or recognition region will bind to a particular receptor (e.g., one present on cancer cells) or targeting moiety, respectively, but will not bind in significant amounts to other proteins present in the sample (e.g., those associated with normal, healthy cells). Specific binding or high-affinity binding can also mean, for example, that a binding compound, ligand, antibody, or binding composition derived from an antibody antigen-binding site of a contemplated method binds to its target with an affinity that is often at least 25% higher, more often at least 50% higher, most often at least 100% (2-fold) higher, typically at least 10-fold higher, more typically at least 20-fold higher, and most typically at least 100-fold higher than that of any other binding compound.

[0054] In a typical embodiment, a molecule that specifically binds to a target has a specificity of at least about 10, as determined, for example, by Scatchard analysis. 6 liters / mol (K O =10 ~6 M), preferably at least about 10 liters / mol. It will be appreciated by those skilled in the art that some binding compounds can specifically bind to more than one target; for example, an antibody can not only specifically bind to its antigen, but can also bind to a lectin via the antibody's oligosaccharides and / or to an Fc receptor via the antibody's Fc region.

[0055] The extracellular domain of the CAR can comprise an antigen-binding / recognition region / domain. The antigen-binding domain of the CAR can bind to a specific antigen (such as a cancer / tumor antigen (e.g., for treating cancer)), a pathogen antigen (such as a viral antigen (e.g., for treating viral infection)), or a CD antigen. The cancer / tumor antigen can be a cell surface antigen of a cancer cell, including a biomolecule that is specifically expressed or has an increased expression level (compared to normal cells) in cancer cells and their precursor cells. Examples of tumor antigens include carbonic anhydrase IX (CAIX), carcinoembryonic antigen (CEA), CD5, CD7, CD10, CD19, CD20, CD22, CD30, CD33, CD34, CD38, CD41, CD44, CD49f, CD56, CD74, CD123, CD133, CD138, antigens of cytomegalovirus-infected cells (e.g., cell surface antigens), epithelial glycoprotein 2 (EGP2), epithelial glycoprotein 40 (EGP40), epithelial cell adhesion molecule (EpCAM), receptor tyrosine-protein kinase erb-B2, erb-B3, or erb-B4, folate binding protein (FBP), FITC, fetal acetylcholine receptor (AChR), FRα, folate receptor β (FRβ), ganglioside G2 (GD2), ganglioside G3 (GD3), human leukocyte antigen (HER2), and leukocyte antigen (LEA). Examples of CARs include, but are not limited to, epidermal growth factor receptor 2 (HER2), human telomerase reverse transcriptase (hTERT), interleukin-13 (IL-13) receptor subunit alpha 2 (IL-13Rα2), kappa light chain, kinase insert domain receptor (IDR), Lewis A (CA19.9), Lewis Y (LeY), L1 cell adhesion molecule (L1CAM), melanoma antigen family A1 (MAGE-A1), mucin 16 (Muc-16), mucin 1 (Muc-1), mesothelin (MSLN), NKG2D ligand, cancer-testis antigen NY-ESO-1, oncofetal antigen (h5T4), prostate stem cell antigen (PSCA), PSMA, tumor-associated glycoprotein 72 (TAG-72), vascular endothelial growth factor receptor (VEGF-R, e.g., R2), and Wilms tumor protein (Wt-1). In certain embodiments, the extracellular domain of the CAR comprises an anti-FITC polypeptide.

[0056] In certain embodiments, the antigen binding / recognition region / domain of the CAR can be an scFv, Fab fragment, etc. of an antibody that binds with specificity (e.g., high specificity) to a cell surface antigen (e.g., cluster of differentiation factors 19 (CD19)). When the recognition region of the CAR comprises an scFv region, the scFv region can be prepared from (i) an antibody known in the art that binds to the target moiety, and / or (ii) a sequence variant derived from the scFv region of such an antibody, e.g., an scFv region having at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.5% sequence identity to the amino acid sequence of the scFv region from which it is derived.

[0057] "Percent sequence identity" in reference to a polypeptide sequence is defined as the percentage of amino acid or nucleic acid residues in a candidate sequence that are identical to those in a reference sequence, respectively, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity (although conservative substitutions are not considered part of sequence identity). Alignment to determine percent sequence identity can be accomplished in a variety of ways within the capabilities of those skilled in the art, for example, using publicly available computer software. For example, the percent identity or similarity between sequences can be determined using, for example, the GAP program (Genetics Computer Group, Inc., software, now available through Accelrys online), and alignment can be performed using, for example, the ClustalW algorithm (VNTI software, InforMax Inc.). Furthermore, a sequence database can be searched using the nucleic acid or amino acid sequence of interest. Algorithms for database searching are generally based on BLAST software (Altschul et al., 1990), although one of skill in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. In some embodiments, percent identity can be determined over the full length of a nucleic acid or amino acid sequence.

[0058] In certain embodiments, instead of an scFv, the antigen-binding / recognition region / domain of the CAR may comprise a small anti-PD-L1 nanobody to target tumor antigens. Li et al. (2018), supra; Zhang et al., Structural basis of a novel PD-L1 nanobody for immune checkpoint blockade, Cell Discovery 3: 17004 (2017). In this case, the CAR may further comprise an NK-specific 2B4 costimulatory domain.

[0059] Examples of transmembrane domains include, but are not limited to, CD3ζ polypeptide, CD4 polypeptide, CD8 polypeptide, CD28 polypeptide, 4-1BB polypeptide, OX40 polypeptide, ICOS polypeptide, CTLA-4 polypeptide, PD-1 polypeptide, LAG-3 polypeptide, 2B4 polypeptide, and BTLA polypeptide.

[0060] A clinical trial using anti-PD-L1 CAR-NK cells is currently underway (NCT04847466). Unlike previous studies using the CD28 transmembrane domain and FcεRIγ signaling domain, the CAR construct described herein can contain the NK-specific NKG2D transmembrane domain and the CD3ζ signaling domain, which are essential for the activation of both T and NK cells. Robbins et al. (2020), supra; Fabian et al., PD-L1 targeting high-affinity NK (t-haNK) cells induces direct antitumor effects and targets suppressive MDSC populations, J ImmunoTherapy Cancer 8(1) (2020); Reighard et al., Therapeutic Targeting of Follicular T Cells with Chimeric Antigen Receptor-Expressing Natural Killer Cells, Cell Reports Medicine 1(1): 100003 (2020).

[0061] The intracellular domain may include, for example, a CD3ζ polypeptide, but may also include at least one costimulatory signaling region (including at least one costimulatory molecule). A "costimulatory molecule" refers to a cell surface molecule other than an antigen receptor / ligand that is required for an efficient lymphocyte response to an antigen. The costimulatory signaling region may include a CD28 (cluster of differentiation factors 28) polypeptide, a 4-1BB polypeptide, a CD134 polypeptide (cluster of differentiation factors 134; OX40 polypeptide), a CD278 polypeptide (cluster of differentiation factors 278; ICOS polypeptide), a DAP-10 polypeptide, a PD-1 polypeptide, a LAG-3 polypeptide, a 2B4 polypeptide, a BTLA polypeptide, or a CTLA-4 polypeptide. In certain embodiments, the intracellular domain includes an NK-specific 2B4 costimulatory domain.

[0062] As described above, a population of universal NK cells can be engineered to express a dual CAR construct, i.e., a PD-L1 CAR and a FITC-CAR. PD-L1 is an inhibitory ligand that binds to D-1 and suppresses T cell activation. PD-L1 is constitutively expressed and induced on tumor cells. PD-L1 is also expressed on myeloid-derived suppressor cells (MDSCs) and tumor-associated macrophages (TAMs).

[0063] For a discussion of engineered human NK cells with switchable CARs and their use in treating refractory cancers (hematological and solid tumors) and viral infections, see International Patent Application Publication No. WO 2020 / 198128 (incorporated herein by reference). As discussed therein, example switch targets for hematological malignancies include B-cell maturation antigen (BCMA), CD123, CD138, CD19, CD20, CD22, CD24, CD30, CD33, CD37, CD38, CD4, CD7, CD70, CLL1, CS1, kappa light chain, and receptor tyrosine kinase-like orphan receptor (ROR1). As also discussed therein, examples of switch targets for solid tumors include fetal acetylcholine receptor (AchR), B7-H4, carbonic anhydrase IX (CAIX), CD133, CD44v6, CD47, CD70, carcinoembryonic antigen (CEA), c-mesenchymal epithelial transition factor (c-Met), delta-like 3 (DLL3), epidermal growth factor receptor (EGFR), EGFRvIII, epithelial cell adhesion molecule (EpCAM), erythropoietin-producing hepatocellular carcinoma A2 (EphA2), ErbB2, fibroblast activation protein (FAP), FRα, Frizzled 7 (Fzd7), ganglioside GD2, glypican 3 (GPC3), guanylyl cyclase C (GUCY2C), human epidermal growth factor receptor 1 (HGF), and others. These include, but are not limited to, ER1), HER2, intercellular adhesion molecule 1 (ICAM-1), interleukin-11 receptor alpha (IL-11Rα), interleukin-13 receptor alpha (IL-13Rα2), human L1 cell adhesion molecule (L1-CAM), Lewis Y antigen (LeY), melanoma-associated antigen (MAGE), melanoma cell adhesion molecule (MCAM), mesothelin, mucin 1 (MUC1), mucin 16 (MUC16ecto), natural killer group 2 member D ligand (NKG2DL), cancer / testis antigen 1 (NY-ESO-1), PD-L1, prostate stem cell antigen (PSCA), PSMA, receptor tyrosine kinase-like orphan receptor (ROR1), tumor-associated glycoprotein 72 (TAG72), and vascular endothelial growth factor receptor 1 (VEGF R1).Switch targets for viral infections are also further discussed therein, examples of which include, but are not limited to, HIV glycoprotein 120 (gp120), CD4, HBV surface antigen (HBsAg), EBV latent membrane protein 1 (LMP1), CMV glycoprotein B (gB), and HCV glycoprotein E2.

[0064] The CAR construct(s) herein can be used to promote hPSC-NK cell proliferation and cytotoxicity against tumor cells, for example, through antigen-dependent activation of the phosphorylated STAT3 (pSTAT3) and phosphorylated STAT5 (pSTAT5) signaling pathways via an intracellular truncated IL-2 receptor β chain (ΔIL-2Rβ) and STAT3-binding tyrosine-XX-glutamine (YXXQ) motif. Thus, anti-PD-L1 CARs and / or anti-FITC CARs can comprise a truncated cytoplasmic domain derived from interleukin-2 (IL-2) receptor β chain (ΔIL-2Rβ), a STAT3-binding tyrosine-XX-glutamine (YXXQ) motif, or both. For NK cells expressing PD-L1 CAR, CD16, and IL-2, and their use to reduce tumor cells and other cells (e.g., MDSCs, TAMs, etc.) within the tumor microenvironment, see, e.g., U.S. Patent No. 11,077,143, incorporated herein by reference (also see U.S. Patent Application Publication No. 2016 / 0009813 and U.S. Patent No. 11,141,434, both incorporated herein by reference). In certain embodiments, hPSCs and / or NK cells expressing such CAR constructs comprise a truncated cytoplasmic domain derived from the IL-2 receptor beta chain, a STAT3-binding tyrosine-XX-glutamine (YXXQ) motif, or both.

[0065] For example, inclusion of a truncated cytoplasmic domain derived from the interleukin-2 (IL-2) receptor beta chain can promote the proliferation of antigen-inducible NK cells. Because IL-2 plays a key role in the formation of memory cells, reversing NK cell exhaustion and promoting the expansion of memory-like NK cells, inclusion of both a truncated cytoplasmic domain derived from the interleukin-2 (IL-2) receptor beta chain and the STAT3 signaling activation motif YXXQ (an IL-21-associated motif in the IL-21 receptor) in an anti-PD-L1 CAR construct is advantageous and synergistic. Seo et al. (2017), supra; Kagoya et al. (2018), supra; Kasaian et al., IL-21 limits NK cell responses and promotes antigen-specific T cell activation: A mediator of the transition from innate to adaptive immunity, Immunity 16(4): 559-569 (2002); Venkatasubramanian et al., IL-21-dependent expansion of memory-like NK cells enhances protective immune responses against Mycobacterium tuberculosis, Mucosal Immunology 10(4): 1031-1042 (2017);Granzin et al., Highly efficient IL-21 and feeder cell-driven ex vivo expansion of human NK cells with therapeutic activity in a xenograft mouse model of melanoma, Oncoimmunology 5(9): e1219007 (2016).

[0066] The anti-PD-L1 CAR and / or anti-FITC CAR may also comprise an NK cell Fc receptor transmembrane domain and an intracellular signaling domain (such as the gamma chain from CD32a (or FcγRIIA) or from CD16 (or FcγRIII)).

[0067] These modifications robustly activated the STAT3 and STAT5 signaling pathways in a tumor antigen-responsive manner, resulting in CAR-NK cells with enhanced in vivo persistence and antitumor function compared to single anti-FITC CAR NK cells lacking the anti-PD-L1 CAR. When CAR-NK cells bearing the anti-PD-L1 CAR were cocultured with PD-L1-rare tumor cells, no cell proliferation was observed, further demonstrating that CAR-NK cell persistence is antigen-specific (required for safer and more sustained antitumor immunity). Dual anti-FITC and anti-PD-L1 hPSC CAR-NK cells demonstrated improved versatility, safety, efficacy, and persistence both in vitro and in vivo in an antigen-dependent manner, achieving a memory-like NK cell phenotype.

[0068] While the use of CRISPR / Cas9-mediated gene knock-in technology to introduce an inducible ID2 construct into the AAVS1 safe harbor locus to genetically modify hPSCs is exemplified herein, any suitable method can be used to prepare the CAR constructs herein and deliver CAR-encoding nucleic acids (e.g., plasmids) into hPSCs. Genome editing (also referred to as genomic editing or genetic editing) is a type of genetic engineering in which DNA is inserted, deleted, and / or replaced within the genome of targeted cells. Targeted editing can be achieved through nuclease-independent or nuclease-dependent methods. Nuclease-independent editing can involve homologous recombination induced by homologous sequences flanking the exogenous polynucleotide inserted into the genome. Alternatively, specific endonucleases can be used to introduce double-strand breaks in DNA, followed by repair. CRISPR / Cas9 (clustered regularly interspaced short palindromic repeats-associated protein 9) is an RNA-guided nuclease. Other endonucleases include, but are not limited to, zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs). Another system is DICE (dual integrase cassette exchange), which utilizes phiC31 and Bxb1 integrases for targeted integration. Other examples of genome editing methods include, but are not limited to, nucleofection / electroporation, transfection with Lipofectamine Stem (ThermoFisher, STEM00001) or similar transfection reagents, or lentivirus-, retrovirus-, sleeping beauty-, piggyback- (a transposon / transposase system including a non-viral-mediated CAR gene delivery system), or adeno-associated virus (AAV)-mediated delivery.

[0069] While the AAVS1 safe harbor locus is exemplified herein, other sites for targeted integration include, but are not limited to, other safe harbor loci or genomic safe harbors (GSH), which are intragenic / extragenic regions of the human genome that, in theory, could facilitate predictable expression of newly integrated DNA without adverse effects on the host cell or recipient organism. A useful safe harbor should allow sufficient transgene expression to achieve desired levels of vector-encoded proteins or non-coding RNAs. The safe harbor should also not induce malignant transformation of cells or alter cellular function. Ideally, a safe harbor locus is characterized by the absence of disruption of regulatory elements or genes, is located in an intergenic region within a gene-dense region or at a convergence site between two genes transcribed in opposing directions, maintains a distance that minimizes the possibility of long-range interactions between the vector-encoded transcriptional activator and the promoters of adjacent genes (particularly cancer-related genes and microRNA genes), and has ubiquitous transcriptional activity. The location should also lack repetitive elements and conserved sequences, allowing for easy design of amplification primers. In addition to AAVS1, suitable sites for human genome editing include the chemokine (CC motif) receptor 5 locus, the human orthologue of the mouse ROSA26 locus, the human orthologue of the mouse H11 locus, the collagen locus, and the HTRP locus. The selected site must be verified for specific integration, and in many cases, the insertion strategy, promoter, gene sequence, and construct design require optimization.

[0070] In certain embodiments, the CAR construct comprises one or more sequences encoding an anti-FITC polypeptide or an anti-PD-L1 polypeptide; an NKG2d transmembrane domain; and a 2B4 costimulatory domain. The CAR construct may further comprise one or more sequences encoding a truncated cytoplasmic domain derived from the IL-2 receptor β chain, a STAT3-binding tyrosine-XX-glutamine (YXXQ) motif, or both. The construct may further comprise one or more sequences encoding FcγRIII.

[0071] Constructs encoding CARs can be prepared using genetic engineering techniques, some of which are described in detail in Sambrook et al., "Molecular Cloning: A Laboratory Manual," 3rd Edition, Cold Spring Harbor Laboratory Press, (2001), and Green and Sambrook, "Molecular Cloning: A Laboratory Manual," 4th Edition, Cold Spring Harbor Laboratory Press, (2012), both of which are incorporated herein by reference in their entireties.

[0072] As a non-limiting example, a plasmid or viral expression vector (e.g., lentiviral vector, retroviral vector, sleeping beauty, and piggyback (a transposon / transposase system that includes a non-viral-mediated CAR gene delivery system)) can be prepared that encodes a fusion protein (comprising a recognition region, one or more costimulatory domains, and an activation signaling domain linked in frame in a 5' to 3' direction). Other configurations are also acceptable and include a recognition region, an activation signaling domain, and one or more costimulatory domains.

[0073] A "construct" refers to a polymeric or molecular complex containing a polynucleotide that is delivered to a host cell in vitro or in vivo. A "vector," as used herein, refers to any nucleic acid construct capable of directing the delivery or transfer of foreign genetic material to a target cell, where the foreign genetic material can be replicated and / or expressed. A nucleic acid vector may have a specific function (e.g., expression, packaging, pseudotyping, or transduction). A vector may also have an operational function when configured for use as a cloning or shuttle vector. The term "vector," as used herein, includes the construct being delivered. Vector structures can be tailored for a particular application and can include any desired form desirable for that application. For example, they can include circular forms (e.g., plasmids, phagemids, etc.) as well as linear or branched forms. Nucleic acid vectors can be composed of, for example, DNA or RNA, but can also contain partially or completely nucleotide derivatives, analogs, or mimetics. Such vectors can be obtained from natural sources, recombinantly produced, or chemically synthesized. Vectors can be linear or circular molecules.Vectors can be integrative or non-integrative.Major types of vectors include, but are not limited to, plasmids, episomal vectors, viral vectors, cosmids, and artificial chromosomes.Viral vectors include, but are not limited to, adenovirus vectors, adeno-associated virus vectors, retrovirus vectors, lentivirus vectors, Sendai virus vectors, etc.

[0074] The antigen binding / recognition region / domain within the fusion protein is generally positioned to allow presentation in the extracellular region. If desired, the CAR may also include additional elements, such as a signal peptide (e.g., CD8α signal peptide) to ensure that the fusion protein is properly transported to the cell surface, a transmembrane domain (e.g., CD8α transmembrane domain, CD28 transmembrane domain, or CD3ζ transmembrane domain) to ensure that the fusion protein remains as an integral membrane protein, and a hinge domain (e.g., CD8α hinge) to provide flexibility to the recognition region and allow for tight binding to the target moiety.

[0075] NK cells can be genetically engineered to express a CAR construct through targeted integration and / or using methods known in the art and / or exemplified herein. "Targeted integration" refers to a process involving the insertion of one or more foreign sequences, with or without deletion of endogenous sequences at the insertion site. Targeted insertion can be achieved through either a nuclease-independent approach or a nuclease-dependent approach. In a nuclease-independent targeted integration approach, homologous recombination can be induced by homologous sequences flanking the inserted foreign polynucleotide through the enzymatic machinery of the host cell. For example, nuclease-independent targeted integration can include transfecting a hPSC population with an expression vector encoding a CAR construct. Suitable methods for preparing a transduced population of lymphocytes expressing a selected CAR construct are well known to those skilled in the art. Although the use of CRISPR / Cas9-mediated gene knock-in technology to introduce constructs into the AAVS1 safe harbor locus to genetically modify hPSCs is exemplified herein, any suitable genome editing method can be used.

[0076] Alternatively, NK cells can be genetically engineered to express CAR constructs by introducing double-strand breaks (DSBs) with specific rare-cutting endonucleases. Such nuclease-dependent targeted editing utilizes DNA repair mechanisms, including non-homologous end joining (NHEJ), which occurs in response to DSBs. In the absence of a donor vector containing foreign genetic material, NHEJ can result in the random insertion or deletion of a small number of endogenous nucleotides. However, in the presence of a donor vector containing foreign genetic material flanked by pairs of homologous arms, the foreign genetic material can be introduced into the genome through a homology-dependent repair process via homologous recombination, resulting in targeted integration.

[0077] Available endonucleases capable of introducing specific and targeted DSBs include, but are not limited to, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and RNA-guided CRISPR-Cas9 nucleases (CRISPR / Cas9; clustered regularly interspaced short palindromic repeats-associated protein 9).In addition, the DICE (dual integrase cassette exchange) system, which utilizes phiC31 and Bxb1 integrases, can also be used for targeted integration.In particular, the CRISPR / Cas9 system is widely used today to induce targeted genetic alterations (genomic alterations).Other non-limiting examples of targeted nucleases include naturally occurring nucleases and recombinant nucleases, such as CRISPR / Cas9, restriction endonucleases, meganuclease homing endonucleases, etc.

[0078] CRISPR / Cas9 requires two key components: (1) caspase-9 endonuclease (Casp9) and (2) the crRNA-tracrRNA complex. When coexpressed, the two components form a complex that is recruited to target DNA sequences containing a protospacer adjacent motif (PAM) sequence and a seeding region adjacent to the PAM. The crRNA and tracrRNA combine to form a chimeric guide RNA (gRNA), which can guide Casp9 to target the selected sequence. These two components can then be delivered into mammalian cells by transfection or transduction. Cas proteins other than Cas9, including but not limited to Cas12a and CasX, can also be used.

[0079] In one embodiment, the cells used in the methods described herein can be autologous cells, although xenogeneic cells can also be used, for example, if the patient being treated is undergoing high dose chemotherapy or radiation treatment, etc., to destroy the patient's immune system. In one embodiment, allogeneic cells can be used.

[0080] Generally, after the cells to be engineered are obtained, they are cultured. Unlike T cells, NK cells do not require prior sensitization and antigen exposure, so they do not need to be cultured under conditions that promote cell activation, although this can be done if desired.

[0081] In at least one embodiment, the culture conditions are such that the cells can be administered to a subject without concern for reactivity to components of the culture medium. For example, culture media free of animal products (e.g., bovine serum albumin) can be used to culture engineered cells. In another embodiment, tissue culture conditions commonly used by those skilled in the art to avoid contamination with bacteria, fungi, and mycoplasma can be used. In one aspect, activation can be achieved by introducing a known activator, such as an anti-CD3 antibody, into the culture medium in the case of cytotoxic T cells. Other suitable activators are also known, including, for example, an anti-CD28 antibody. The cell population can be cultured under activation-promoting conditions, for example, for about 1 to about 4 days. The appropriate level of activation can be determined by cell type, size, proliferation rate, or activation markers determined by flow cytometry.

[0082] In at least one embodiment, after culturing the population of cells, the cells are transfected with an expression vector encoding a CAR. Suitable vectors and transfection methods for use in various embodiments are known in the art. After transfection, the cells can be administered to a patient immediately, or can be cultured for a period of time to allow the cells to recover from the transfection, for example, at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or more days, or from about 5 to about 12 days, from about 6 to about 13 days, from about 7 to about 14 days, or from about 8 to about 15 days. In one aspect, suitable culture conditions can be similar to those under which the cells were cultured, with or without an agent that promotes activation.

[0083] Thus, as noted above, the methods of use and / or treatment described herein may further comprise the steps of 1) obtaining an autologous or heterologous NK cell population, 2) culturing the cells, and 3) engineering the cells to express one or more CAR constructs through targeted integration. In certain embodiments, the methods of use and / or treatment described herein may comprise the steps of A) obtaining an autologous or heterologous hPSC population, B) engineering the cells to express one or more CAR constructs through targeted integration, and C) differentiating the engineered hPSCs into universal NK cells or CAR-NK cells as described herein.

[0084] composition Pharmaceutical compositions are also provided.The pharmaceutical compositions can comprise a population of isolated universal NK cells and / or CAR-NK cells as described herein or obtained according to the methods herein.The term "isolated" means that a substance is removed from its original environment, for example, from its natural environment if it is natural.For example, natural neutrophils present in a living body are not isolated, but when separated from some or all of the coexisting substances in the natural system, the neutrophils are isolated.

[0085] The pharmaceutical composition may further comprise one or more pharmaceutically acceptable carriers, diluents, and / or other pharmaceutically acceptable components. The term "pharmaceutically acceptable" and grammatical variations thereof, when referring to compositions, carriers, diluents, reagents, etc., are used interchangeably and are art-recognized to denote that such a substance can be administered to a mammal without causing undue toxicity, irritation, allergic response, and / or undesirable physiological effects (e.g., nausea, dizziness, acute gastric peristalsis, etc.) at a reasonable benefit-risk ratio. In other words, a pharmaceutically acceptable substance is one that is not biologically or otherwise objectionable, e.g., such a substance can be administered to an individual together with NK cells without causing any objectionable biological effects or interacting in a significant adverse manner with any of the other components of the pharmaceutical composition.

[0086] The term "pharmaceutically acceptable carrier" is art-recognized and refers to a pharmaceutically acceptable substance, composition, or vehicle (e.g., liquid or solid filler, diluent, excipient, solvent, or encapsulating material, etc.) involved in carrying or transporting a composition or its components. Each carrier must be "acceptable" in the sense of being compatible with the intended composition and its components and not harmful to the patient. Some examples of substances that can serve as pharmaceutically acceptable carriers include: (1) sugars (e.g., lactose, glucose, sucrose, etc.); (2) starches (e.g., corn starch, potato starch, etc.); (3) cellulose and its derivatives (e.g., sodium carboxymethylcellulose, ethyl cellulose, and cellulose acetate, etc.); (4) powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients (e.g., cocoa butter, suppository wax, etc.); and (9) oils (e.g., peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, etc.). (10) glycols (e.g., propylene glycol, etc.); (11) polyols (e.g., glycerin, sorbitol, mannitol, polyethylene glycol, etc.); (12) esters (e.g., ethyl oleate, ethyl laurate, etc.); (13) agar; (14) buffers (e.g., magnesium hydroxide, aluminum hydroxide, etc.); (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethanol; (20) phosphate buffer solution; and (21) other non-toxic, compatible substances employed in pharmaceutical formulations.

[0087] The choice of carrier will depend in part on the specific CAR, CAR-encoding nucleic acid sequence, vector, or CAR-expressing host cell, as well as the specific method used to administer the CAR-encoding nucleic acid sequence, vector, or CAR-expressing host cell. Therefore, there are a variety of suitable formulations of pharmaceutical compositions. For example, the pharmaceutical composition may contain a preservative. Suitable preservatives include, for example, methylparaben, propylparaben, sodium benzoate, and benzalkonium chloride. Optionally, a mixture of two or more preservatives can be used. The preservative or mixture thereof is typically present in an amount of about 0.0001% to about 2% by weight of the total composition.

[0088] Carriers, diluents, and / or other components may be determined in part by the particular route of administration (see, e.g., Remington's Pharmaceutical Sciences, 17 th (See, e.g., J.D., J.M., ed. (1985)). For example, a formulation suitable for systemic administration (e.g., intravenous administration) may differ from a formulation suitable for intracranial administration. In certain embodiments, the components of the composition are of sufficiently high purity and sufficiently low toxicity, e.g., the composition is suitable for administration to humans. The composition is desirably stable. Such modifications are within the capabilities of one of ordinary skill in the art.

[0089] Exemplary compositions comprising engineered CAR-NK cells include those comprising the cells in sterile 290 mOsm saline, infusible cryopreservation medium (comprising Plasma-Lyte A, dextrose, sodium chloride injection, human serum albumin, and DMSO), in 0.9% NaCl with 2% human serum albumin, or other sterile 290 mOsm infusible substance. In certain embodiments, the cells are pelleted, washed, and resuspended in a pharmaceutically acceptable carrier or diluent prior to administration to a patient.

[0090] Methods and Uses The use of any of the CAR-expressing NK cells presented herein, any of the universal NK cells described herein, any of the engineered hPSCs described herein, any of the constructs described herein, or the pharmaceutical composition herein in the treatment of a disease and / or the manufacture of a medicament for treating a disease in a subject is presented. In certain embodiments, the disease is cancer. "Cancer" includes any neoplastic condition, whether malignant, pre-malignant, or non-malignant. Generally, however, neoplastic conditions are malignant. Both solid and non-solid tumors are encompassed, and "cancer cells" can be used interchangeably with "tumor cells."

[0091] Examples of cancer include, but are not limited to, leukemia (e.g., ALL, AML, CLL, and CML), adrenocortical carcinoma, AIDS-related cancer (e.g., Kaposi's sarcoma), lymphoma (e.g., T-cell, Hodgkin's, and non-Hodgkin's), astrocytoma, basal cell carcinoma, bladder cancer, bone cancer, brain cancer, breast cancer, prostate cancer, lung cancer, cervical cancer, colon cancer, colorectal cancer, DCIS, esophageal cancer, gastric cancer, glioma, head and neck cancer, liver cancer, stomach cancer, pancreatic cancer, kidney cancer (e.g., renal cell carcinoma and Wilms' tumor), oral cavity cancer, oropharyngeal cancer, ovarian cancer, testicular cancer, and laryngeal cancer.

[0092] A method for producing a population of NK cells is presented. In certain embodiments, the method includes differentiating a population of hPSCs into NK cells, wherein the population of hPSCs is engineered to overexpress the transcription factors ID2, NFIL3, and / or SPI1. In certain embodiments, the population of hPSCs is engineered to overexpress the transcription factor ID2. The population of hPSCs can be engineered to express an anti-PD-L1 CAR and an anti-FITC CAR. The hPSCs can include hESCs and / or iPSCs. Overexpression of the transcription factor(s) can be inducible.

[0093] The anti-PD-L1 CAR and / or anti-FITC CAR may comprise a truncated cytoplasmic domain derived from the IL-2 receptor beta chain, a STAT3-binding tyrosine-XX-glutamine (YXXQ) motif, or both. The anti-PD-L1 CAR and / or anti-FITC CAR may comprise an NK cell Fc receptor transmembrane domain and an intracellular signaling domain. The NK cell Fc receptor transmembrane domain and intracellular signaling domain may comprise a gamma chain derived from CD32a or a gamma chain derived from CD16.

[0094] Also provided are methods of treating cancer in a subject (e.g., a subject in need of treatment). The method may include administering to the subject a first therapy comprising a therapeutically effective amount of any population of universal NK cells described herein, any population of NK cells expressing one or more constructs described herein, any population of CAR-expressing NK cells described herein, and / or a pharmaceutical composition described herein, and a pharmaceutically acceptable carrier and / or diluent.

[0095] The method for treating cancer in a subject may further comprise administering a conjugate (for example, a therapeutically effective amount of the conjugate) to the subject.The conjugate may comprise FITC linked to a ligand that binds to FRα.In certain embodiments, the conjugate comprising FITC linked to a ligand that binds to FRα has the following structure:

[0096] [ka] or a pharmaceutically acceptable salt thereof.

[0097] The conjugate may comprise FITC linked to a ligand that binds to PSMA. In certain embodiments, the ligand that binds to PSMA is DUPA. In certain embodiments, the conjugate comprising FITC linked to a ligand that binds to PSMA has the following structure:

[0098] [ka] or a pharmaceutically acceptable salt thereof.

[0099] The conjugate may comprise FITC linked to a ligand that binds to carbonic anhydrase IX (CAIX). In certain embodiments, the conjugate has the following structure:

[0100] [ka] or a pharmaceutically acceptable salt thereof. Such conjugates can be synthesized according to methods known in the art.

[0101] The method may further include administering a second therapy to the subject. The second therapy may include surgical removal of one or more cancerous cells from the subject, chemotherapy, and / or radiation therapy (e.g., a therapeutically effective amount thereof). In certain embodiments, the method further includes administering a therapeutically effective amount of chemotherapy to the subject. In certain embodiments, the method further includes administering a therapeutically effective amount of radiation therapy to the subject. In certain embodiments, the method further includes administering therapeutically effective amounts of both chemotherapy and radiation therapy to the subject.

[0102] The second therapy may alternatively or additionally involve surgical removal of cancerous cells from the subject.

[0103] The second therapy may additionally or alternatively include imaging the targeted location within the subject (e.g., the cancer (e.g., the tumor microenvironment)) prior to or during administration of the first and / or second therapy.

[0104] In some embodiments, the targeted location is additionally imaged before administering the universal NK cells, CAR-NK cells, or NK cell composition to a subject. The cancer can be imaged during or after administration, for example, to assess metastasis and the effectiveness of treatment. In some embodiments, the imaging occurs by positron emission tomography (PET) imaging, magnetic resonance imaging (MRI), or single-photon emission computed tomography (SPECT) / computed tomography (CT) imaging. The imaging method can be any suitable imaging method known in the art.

[0105] In certain embodiments, the first therapy and the second therapy are administered sequentially and / or alternatingly. In some embodiments, the method further comprises imaging the cancer in the subject prior to or during administration of the universal NK cells, CAR-NK cells, the composition comprising NK cells, and / or the second therapy.

[0106] The terms "treat," "treating," "treated," and "treatment" (with respect to a disease or condition, such as cancer) are used to describe a method for obtaining a beneficial or desired result (e.g., a clinical result, etc.), which may include, but is not limited to, one or more of: amelioration of the conditions associated with the disease, curing the disease, reducing the severity of the disease, improving the quality of life of those afflicted with the disease, prolonging survival, and / or preventative treatment. In the context of cancer, in particular, the terms "treat," "treating," "treated," or "treatment" may further refer to a reduction in tumor size, complete or partial removal of the tumor (e.g., a complete or partial response), stabilization of the disease, prevention of cancer progression (e.g., progression-free survival), or any other effect on cancer (considered by a physician to be therapeutic or preventative in the treatment of cancer). More specifically, curative treatment refers to either alleviating, improving and / or eliminating, slowing and / or stabilizing (e.g., preventing progression to a more advanced stage) signs / symptoms, or delaying the progression of signs / symptoms in a particular disorder. Prophylactic treatment refers to either halting the onset, reducing the risk of onset, reducing the incidence, delaying onset, reducing onset, or increasing the time to symptom onset in a particular disorder. Desired effects of treatment can include, but are not limited to, preventing the onset or recurrence of disease, alleviating symptoms, attenuating any direct or indirect pathological consequences of disease, preventing metastasis, reducing the rate of disease progression, improving or palliating the disease state, and achieving remission or improving prognosis. In some embodiments, the compositions are used to delay the onset of disease and / or tumors or slow (or stop) the progression of disease and / or tumor growth.

[0107] The term "patient" or "subject" includes humans and non-human animals, such as companion animals (such as dogs and cats) and livestock animals. Livestock animals are animals used in food production. The subject to be treated is preferably a mammal, particularly a human.

[0108] In various embodiments, the generic NK cells and / or CAR-NK cells of the present invention (collectively referred to herein as "the NK cells of the present invention") and the pharmaceutical compositions of the present invention can be administered to a subject via any suitable route (e.g., parenteral administration, e.g., intradermal, subcutaneous, intramuscular, intraperitoneal, intravenous, or intrathecal administration, etc.). As used herein, the term "administering" includes all means of introducing the NK cells of the present invention, or pharmaceutical compositions comprising same, into a patient. Examples include, but are not limited to, oral (po), parenteral, systemic / intravenous (iv), intramuscular (im), subcutaneous (sc), transdermal, intrasternal, intraarterial, intraperitoneal, epidural, intraurethral, ​​intranasal, buccal, ocular, sublingual, vaginal, rectal, etc. Routes of administration to the brain include, but are not limited to, intraparenchymal, intraventricular, intracranial, etc.

[0109] Formulating compositions suitable for administration of the NK cells herein, including compositions suitable for administration by intravenous and intratumoral routes, is within the ability of one of ordinary skill in the art.

[0110] Illustrative means of parenteral administration include needle (including microneedle) injection devices, needleless injection devices, and infusion techniques, as well as any other means of parenteral administration recognized in the art. Parenteral formulations are generally aqueous solutions and may contain excipients such as salts, carbohydrates, and buffers (preferably at a pH of about 3 to about 9). The preparation of parenteral formulations under sterile conditions can be readily accomplished using standard pharmaceutical techniques well known to those skilled in the art.

[0111] The NK cells of the present invention can be formulated as pharmaceutical compositions and administered to a mammalian host (e.g., a human patient) in a variety of forms adapted to the selected route of administration. For example, pharmaceutical compositions can be formulated for and administered via oral or parenteral, intravenous, intraarterial, intraperitoneal, intrathecal, epidural, intracerebroventricular, intraurethral, ​​intrasternal, intracranial, intratumor, intramuscular, topical, inhalation, and / or subcutaneous routes. Indeed, the NK cells of the present invention or compositions comprising the NK cells of the present invention can be administered directly into the bloodstream, muscle, or internal organs.

[0112] The NK cells and related compositions herein can be administered via infusion or injection (e.g., using needle (including microneedle) and / or needleless injection devices). Solutions of the compositions can be aqueous, optionally mixed with a nontoxic surfactant, and / or contain carriers or excipients (e.g., salts, carbohydrates, and buffers (preferably pH 3-9)).

[0113] The percentage of NK cells herein in compositions and preparations can vary and can be about 1 to about 99% by weight of the active ingredient(s) and binders, excipients, disintegrants, lubricants, and / or sweeteners (as known in the art). The amount of NK cells herein included in such therapeutically useful compositions is, for example, an amount that provides an effective dosage level. The total number of NK cells herein and the concentration of cells included in the composition administered to a patient can vary depending on several factors, including, but not limited to, the binding specificity of the CAR (if applicable), the identity of the cancer, the location of the cancer within the patient, the means used to administer the composition to the patient, and the health, age, and weight of the patient being treated. In various embodiments, suitable compositions containing engineered cells include those having volumes of about 0.1 ml to about 200 ml and about 0.1 ml to about 125 ml.

[0114] The term "therapeutically effective amount," as used herein, refers to an amount of NK cells herein that elicits the biological or medical response (e.g., desired therapeutic effect) sought by a researcher, veterinarian, physician, or other clinician in a tissue system, animal, or human, including alleviation of symptoms of the cancer being treated. In one embodiment, a therapeutically effective amount is an amount that can treat or alleviate cancer or its symptoms, at a reasonable benefit-risk ratio applicable to any medical treatment. However, it will be understood that the total daily dose of NK cells herein may be determined by the attending physician within the scope of sound medical judgment. In the treatment of cancer, a desired therapeutic effect will extend to the progression of the cancer, e.g., inhibition of the proliferation of cancerous cells and / or inhibition of their metastasis. Desirably, administration of a therapeutically effective amount results in the death of cancerous cells, e.g., reduction in the number of cancerous cells, desirably to the point of eradication.

[0115] The exact amount of NK cells herein required will vary from subject to subject, depending on factors including the type of cancer being treated and the state / severity of the cancer; the particular composition employed; the patient's age, weight, general health, sex, and dietary habits; the time and route of administration; the duration of treatment; drugs and / or other therapies used in combination with or concurrently with the NK cells herein; and factors well known to researchers, veterinarians, physicians, or other clinicians of ordinary skill. By way of example, a dose of NK cells herein may be administered per m2 of the patient's body surface area. 2 per kg or 10 per kg of patient weight 5 ~10 12 In certain embodiments, a therapeutically sufficient amount may range from at or about 10 per kg of patient body weight. 7 cells (e.g., 10 cells) 7 Thus, the absolute amount of NK cells herein contained in a given unit dosage form can vary widely and will depend on multiple factors (e.g., the age, weight, and physical condition of the subject, etc.) and the method of administration.

[0116] Depending on the route of administration, a wide range of acceptable dosages is contemplated herein. Dosages can be single or divided, and can be administered according to a variety of protocols, including qd (once a day), bid (twice a day), tid (three times a day), or once every two days, once a week, once a month, once a quarter, etc. In each of these cases, the therapeutically effective amount described herein will be understood to correspond to the total daily, weekly, monthly, or quarterly dose, as determined by the administration example or dosing protocol.

[0117] Multiple infusions may be required to effectively treat a subject. For example, two, three, four, five, six, or more separate infusions may be administered to a patient at intervals of about 24 hours to about 48 hours, or every 3, 4, 5, 6, or 7 days. Infusions may be administered weekly, every two weeks, or monthly. Monthly administrations may be repeated for 2 to 6 months or longer (e.g., 9 months to 1 year, etc.).

[0118] When treating cancer, the dosages for NK cells herein are based on dosing and scheduling regimens practiced by those skilled in the art. Generally, the cells are administered in a dose of 100 mg / kg / day. 9 More than one dose per patient may be administered to patients undergoing adoptive cell transfer therapy. The determination of an effective amount or dose is well within the capabilities of those skilled in the art, especially in light of the detailed disclosure provided herein.

[0119] The NK cells herein administered to a subject may be, for example, about 1 x 10 5 ~Approx. 1×10 15 pieces, or 1 x 10 6 ~Approx. 1×10 15 In various embodiments, the number of transduced cells may be about 1 x 10. 5 ~Approx. 1×10 10 , about 1×10 6 ~Approx. 1×10 10 , about 1×10 6 ~Approx. 1×10 9 , about 1×10 6 ~Approx. 1×10 8, about 1×10 6 ~about 2×10 7 , about 1×10 6 ~Approx. 3×10 7 , about 1×10 6 ~Approx. 1.5×10 7 , about 1×10 6 ~Approx. 1×10 7 , about 1×10 6 ~Approx. 9×10 6 , about 1×10 6 ~Approx. 8×10 6 , about 1×10 6 ~Approx. 7×10 6 , about 1×10 6 ~about 6×10 6 , about 1×10 6 ~Approx. 5×10 6 , about 1×10 6 ~Approx. 4×10 6 , about 1×10 6 ~Approx. 3×10 6 , about 1×10 6 ~about 2×10 6 , about 2×10 6 ~about 6×10 6 , about 2×10 6 ~Approx. 5×10 6 , about 3×10 6 ~about 6×10 6 , about 4×10 6 ~about 6×10 6 , about 4×10 6 ~Approx. 1×10 7 , about 1×10 6 ~Approx. 1×10 7 , about 1×10 6 ~Approx. 1.5×10 7 , about 1×10 6 ~about 2×10 7 , about 0.2×10 6 ~Approx. 1×10 7 , about 0.2×10 6 ~Approx. 1.5×10 7 , about 0.2×10 6 ~about 2×10 7 , or about 5 × 10 6 Individual cells.

[0120] The NK cells herein administered to a subject can comprise about 1 million, about 2 million, about 3 million, about 4 million, about 5 million, about 6 million, about 7 million, about 8 million, about 9 million, about 10 million, about 11 million, about 12 million, about 12.5 million, about 13 million, about 14 million, or about 15 million cells. The cells can be administered as a single dose or multiple doses. The NK cells herein can be administered at several NK cell numbers per kg of the subject's body weight.

[0121] General All patents, published patent applications, journal articles, textbooks, and other published materials mentioned in this specification are indicative of the levels of those skilled in the art to which this disclosure pertains.

[0122] In the above description, numerous specific details are presented to provide a thorough understanding of the present disclosure. It is understood that particular examples may be practiced without some or all of these specific details, and that the present disclosure is not limited to a particular biological system, a particular cancer, or a particular organ or tissue, which may, of course, vary in light of the data presented herein, but still be applicable.

[0123] Additionally, various techniques and mechanisms of this disclosure may describe a connection or link between two components. Unless a distinction is specifically stated or otherwise apparent from context, words (e.g., “attached,” “linked,” “coupled,” “connected,” etc.) and similar terms, including their inflectional morphemes, are used interchangeably. These words and expressions do not necessarily imply a direct connection, but also include connections through intermediate components. Note that a connection between two components does not necessarily imply a direct and uninterrupted connection, as various other components may exist between the two components of interest. Thus, unless otherwise stated, “connection” does not necessarily imply a direct and uninterrupted connection.

[0124] Furthermore, it is understood that the present disclosure is presented for illustrative purposes only, and that the principles and embodiments described herein may be applied to compounds and / or composition components having configurations other than those specifically described herein. Indeed, it is expressly contemplated that the components of the compositions and compounds of the present disclosure may be further tailored to suit their desired use.

[0125] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the chemical and biological arts. The terms and phrases employed are used as terms of description and not as terms of limitation. In this regard, if a particular term is defined, explained, or discussed anywhere in the Detailed Description, all such definition, explanation, and discussion are intended to be ascribed to such term. Furthermore, the use of such terms and phrases does not intend to exclude all equivalents of the features shown and described, or portions thereof. Furthermore, while a subheading such as "Certain Definitions" is used in the Detailed Description, such use is solely for ease of reference and is not intended to limit the disclosure made in one section to that section; rather, any disclosure made under one subheading is intended to constitute a disclosure made under each and every other subheading.

[0126] Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the subject matter of this application, the preferred methods and materials are described herein.

[0127] When ranges are used herein for physical properties (e.g., molecular weight, etc.) or chemical properties (e.g., chemical formula, etc.), all combinations and subcombinations of ranges, and specific embodiments therein, are intended to be included.

[0128] It is recognized that various modifications are possible within the scope of the present disclosure. Thus, while the present disclosure has been particularly disclosed in the context of preferred embodiments and optional features, those skilled in the art may make modifications and variations to the concepts disclosed herein. Such modifications and variations are deemed to be within the scope of the disclosure as claimed herein.

[0129] Accordingly, it is intended that this description and the appended claims encompass all modifications and variations that would be apparent to one of ordinary skill in the art based on this disclosure. For example, when a method or therapy of treatment includes administering to a subject two or more treatments, compounds, or compositions, it is understood that the order, timing, number, concentrations, and volumes of administration are limited only by medical requirements and treatment constraints (i.e., the two treatments can be administered to a subject, for example, simultaneously, sequentially, sequentially, alternating, or according to any other regimen).

[0130] Additionally, in describing exemplary embodiments, the present disclosure may present methods and / or processes as a particular order of steps. To the extent that the method or process does not rely on the particular order of steps described herein, the method or process is not intended to be limited to the particular order of steps described. As one of ordinary skill in the art will understand, other orders of steps are possible. Thus, the particular order of steps disclosed herein should not be construed as a limitation on the claims. Additionally, claims related to methods and processes are not limited to the performance of their steps in the order described, and one of ordinary skill in the art will readily recognize that the order can be varied and still remain within the spirit and scope of the present disclosure.

[0131] Although this disclosure has been made with respect to humans and human cells and genes, it is contemplated that hPSCs and NK cells can be generated from other species (e.g., other mammalian species) using cells and genes derived from those species. Such hPSCs and NK cells can then be used to treat members of those species based on the teachings presented herein.

[0132] Given definition The term "about," when used in connection with a number or numerical value or numerical range (e.g., including integers, fractions, and percentages), means that the stated number or numerical range is approximate within experimental variation (or within statistical experimental error), and thus means that a number or numerical range can vary by 1% to 15% of the stated number or numerical range (e.g., ±5% to 15% of the stated numerical value) that one of ordinary skill in the art would consider equivalent to the stated number (e.g., having the same function or result).

[0133] The present disclosure may suitably be practiced in the absence of any element(s) or limitation(ies) not specifically disclosed herein. Thus, for example, the terms "comprising," "consisting essentially of," and "consisting of" (and related terms, e.g., "comprise" or "comprises" or "having" or "including," etc.) are all interchangeable with other described terms in each instance herein. Similarly, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Thus, for example, reference to "the method" includes one or more such methods, and / or steps as described and / or that will become apparent to those of ordinary skill in the art upon reading this disclosure. The term "substantially" can allow for some variation in a value or range, e.g., within 90%, 95%, or 99% of a stated value or limit of a stated range.

[0134] The term "receptor" refers to a chemical structure within a biological system that receives and transmits signals.

[0135] As used herein, the term "encoding" refers to the inherent property of a particular sequence of nucleotides within a polynucleotide (e.g., a gene, cDNA, or mRNA) to serve as a template for the synthesis of other polymers or macromolecules in biological processes and to have either a defined sequence of nucleotides (i.e., rRNA, tRNA, and mRNA) or a defined sequence of amino acids, and the biological properties resulting therefrom. Thus, a gene encodes a protein when its corresponding mRNA is transcribed and translated to produce the protein in a cell or other biological system. Both the coding strand (whose nucleotide sequence is identical to the mRNA sequence and is usually provided in a sequence listing) and the non-coding strand (used as a template to transcribe the gene or cDNA) can be said to encode the protein or other product of the gene or cDNA.

[0136] As used herein, " integration " refers to the stable insertion of one or more nucleotides of construct into cell genome, i.e., covalently linked with the nucleic acid sequence in cell chromosomal DNA.As used herein, the term " integration " also refers to the process involved in the insertion of one or more exogenous sequences or nucleotides of construct, regardless of whether or not the endogenous sequence or nucleotide at the integration site is deleted.If there is a deletion at the insertion site, " integration " can also include the replacement of the deleted endogenous sequence or nucleotide with one or more inserted nucleotides.

[0137] As used herein, the term "exogenous" means that the described molecule or described activity is introduced into a host cell. The molecule can be introduced, for example, by introducing an encoding nucleic acid into the host genetic material, such as by integration into a host chromosome, or by integration as non-chromosomal genetic material (e.g., a plasmid, etc.). Thus, when the term is used in reference to expression of an encoding nucleic acid, it refers to introducing the encoding nucleic acid into a cell in an expressible form. The term "endogenous" refers to the presence of the described molecule or activity within the host cell. Similarly, when used in reference to expression of an encoding nucleic acid, it refers to expression of an encoding nucleic acid contained within the cell and not exogenously introduced.

[0138] As used herein, the terms "peptide," "polypeptide," and "protein" are used interchangeably and refer to molecules having amino acid residues covalently linked by peptide bonds. A polypeptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids in a polypeptide. As used herein, the term refers to both short chains, commonly referred to in the art as peptides, oligopeptides, and oligomers, and longer chains, commonly referred to in the art as polypeptides or proteins. "Polypeptides" include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, polypeptide variants, modified polypeptides, derivatives, analogs, and fusion proteins, among others. Polypeptides include natural polypeptides, recombinant polypeptides, synthetic polypeptides, or combinations thereof. [Example]

[0139] The following examples serve to illustrate the present disclosure, to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the embodiments herein. The examples are not intended to limit the scope of the claimed invention in any way, nor are they intended to represent that the experiments below are all or the only experiments performed. While efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperatures, etc.), some experimental error and deviation should be accounted for. Unless otherwise indicated, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Celsius, and pressure is at or near atmospheric.

[0140] material and method Donor Plasmid Construction. To construct the adeno-associated virus site 1 (AAVS1)-Puro XLone-NFIL3, spi-1 proto-oncogene (SPI1), and inducible DNA-binding inhibitor 2 (ID2) plasmids, fragments of the human nuclear factor interleukin-3-regulated (NFIL3) gene, SPI1 gene, and ID2 gene were amplified from Addgene plasmids (#82985, 97039, and 98394, respectively) and used to replace the enhanced green fluorescent protein (eGFP) in the AAVS1-Puro XLone-eGFP donor plasmid (Addgene, #136936).

[0141] Maintenance and differentiation of hPSCs. H9 human pluripotent stem cells (hPSCs) were obtained from WiCell and maintained on Matrigel- or iMatrix-511-coated plates in mTeSR plus or E8 medium (WiCell Research Institute, Inc., Madison, WI). For differentiation into natural killer (NK) cells, hPSCs were dissociated using 0.5 mM ethylenediaminetetraacetic acid (EDTA) and plated at 10,000–80,000 cells / cm on iMatrix-511-coated 24-well plates in mTeSR plus medium containing 5 μM Y27632. 2The cells were seeded at a density of 100 μg / ml for 24 hours (day -1). NK cell differentiation was then performed as previously reported, with modifications, as shown in Figures 2A and 3A. Romee et al. (2016), supra.

[0142] Briefly, mesoderm differentiation was induced in LaSR basal medium from day 0 to day 2 using 6 μM CHIR99021, followed by treatment with 10 μM SB431542, 50 ng / mL stem cell factor (SCF), and vascular endothelial growth factor (VEGF) from day 2 to day 4. Tamada et al. (2012), supra. To induce hematopoiesis, 50 ng / mL SCF and FMS-like tyrosine kinase 3 ligand (FLT3L) were used in Stemline-II medium from day 4 to day 12. Ma et al., Versatile strategy for controlling the specificity and activity of engineered T cells, PNAS USA 113(4): E450-458 (2016). Day 12 floating hematopoietic stem progenitor cells (HSPCs) were collected and treated with 50 ng / mL SCF, FLT3L, interleukin-3 (IL-3), interleukin-7 (IL-7), and interleukin-15 (IL-15) from days 15 to 23. From days 23 to 30, post-differentiation cultures were treated with 50 ng / mL SCF, FLT3L, IL-7, and IL-15, and 5 μg / mL heparin. For feeder-layer-based NK cell differentiation, day 12 HSPCs were collected and transferred onto OP9 interstitial feeder cells cultured in α-MEM medium (containing 20% ​​fetal bovine serum (FBS), 10 ng / mL SCF, 10 ng / mL FLT3L, 5 ng / mL IL-7, and 10 ng / mL IL-15). Ma et al. (2021), supra. After 7 days of co-culture, the differentiated cells were collected and transferred onto fresh OP9 feeder cells, and NK cell differentiation was continued under the same conditions for 4 weeks.

[0143] Purification of hPSC-NK cells. hPSC-derived NK cells were purified using the EasySep™ FITC Positive Selection Kit (StemCell Technologies, Vancouver, Canada) according to the manufacturer's instructions. Briefly, differentiated NK cells were centrifuged at 200 × g for 5 minutes, washed twice with 10 mL of PBS- / - solution (FlowBuffer-1) containing 1% bovine serum albumin (BSA), and then pelleted by centrifugation. After aspirating the supernatant, the cell pellet was collected at a concentration of 1 × 10 cells. 8 Cells were resuspended at a cell concentration of 100 μL / mL with a 1:50 CD56-FITC antibody in 100 μL of FlowBuffer-1 and incubated at room temperature in the dark for 30 minutes. The cell and antibody mixture was then washed once with 2 mL of FlowBuffer-1 and incubated with 10 μL of EasySep™ FITC Selection Cocktail dissolved in 100 μL of FlowBuffer-1 for 15 minutes at room temperature. Next, 5 μL of well-mixed magnetic nanoparticles were added to the 100 μL cell mixture, and the mixture was incubated for an additional 10 minutes at room temperature. The resulting cell suspension was brought to a final volume of 2.5 mL with FlowBuffer-1 in a flow tube, and the tube was placed, uncapped, in a magnet for 5 minutes. The magnet was then inverted in one continuous motion to discard the supernatant and then returned to the upright position. The flow tube was removed from the magnet and washed with 2.5 mL of FlowBuffer-1. The cells on the wall of the flow tube were resuspended by gently pipetting up and down 2-3 times. The magnet treatment was repeated 2-3 times, and the enriched NK cells were then resuspended in the appropriate amount of desired medium for further use.

[0144] Nucleofection and hPSC genotyping. To enhance cell viability, hPSCs were treated with 10 μM Y27632 for 3–4 h prior to nucleofection or overnight. Singled hPSCs (1–2.5 × 10 cells / ml) were nucleofected in 100 μL of human stem cell nucleofection solution (Lonza; #VAPH-5012) using program B-016 in the Nucleofector 2b. 6 6 μg of AAVS1 XLone donor plasmid was co-nucleofected with 6 μg of SpCas9 AAVS1 gRNA T2 (Addgene; #79888). The nucleofected hPSCs were then seeded into one well of a Matrigel-coated 6-well plate in 3 ml of pre-warmed mTeSR plus medium containing 10 μM Y27632. After 24 hours, the medium was replaced with mTeSR plus medium containing 5 μM Y27632, and the medium was changed daily thereafter. When the cells reached approximately 80% confluency, 1 μg / ml puromycin (Puro) was applied for approximately 1 week for drug selection. Individual clones were then picked and grown in individual wells of Matrigel-coated 96-well plates for 2-5 days, followed by PCR genotyping using QuickExtract™ DNA Extraction Solution (Epicentre; #QE09050) and 2x GoTaq Green Master Mix (Promega; #7123). For positive genotyping, the following primer pair was used: CTGTTTCCCCTTCCCAGGCAGGTCC (SEQ ID NO: 1) and TCGTCGCGGGTGGCGAGGCGCACCG (SEQ ID NO: 2) (T m = 65°C). For homozygous genotyping, the following primer sequences were used: CGGTTAATGTGGCTCTGGTT (SEQ ID NO: 3) and GAGAGAGATGGCTCCAGGAA (SEQ ID NO: 4) (T m =60℃).

[0145] Tumor cell line culture. U87MG, A549, LNCaP, and MDA-MB-231 tumor cells were kindly provided and cultured by the laboratories of Drs. Sandro Matosevic, Chang-Deng Hu, and Philip Low at Purdue University. U87MG, A549, LNCaP, and MDA-MB-231 cells were cultured in Eagle's minimum essential medium (EMEM) (containing 10% FBS, 100 units / mL penicillin, and 100 mg / mL streptomycin), Kaighn's modification of Ham's F-12 medium (F-12K) (containing 10% FBS, 100 units / mL penicillin, and 100 mg / mL streptomycin), RPMI-1640 medium (containing 10% FBS, 100 units / mL penicillin, and 100 mg / mL streptomycin), and Leibovitz's L-15 medium (containing 10% FBS, 100 units / mL penicillin, and 100 mg / mL streptomycin). All tumor cell lines were incubated at 37°C in a humidified atmosphere containing 5% CO2. The medium was changed every two days, and the cells were passaged at 70% to 80% confluency.

[0146] NK cell expansion. Peripheral blood mononuclear cells (PBMCs) were isolated by Lymphoprep™ (StemCell Technology, Inc., 07851) gradient centrifugation in SepMate™ (StemCell Technology, Inc., 85450) tubes. Primary human cells were isolated from PBMCs by magnetic bead-based CD3 depletion (Miltenyi Biotec, Inc., 130-050-101) followed by CD56 (Miltenyi Biotec, Inc., 130-111-553) isolation. Purified NK cells were cultured at 1 × 10 cells in AIM-V (Invitrogen) medium containing 500 U / mL IL-2 (PEPROTECH, 200-02), 2 ng / mL IL-15 (PEPROTECH, 200-15), and 100 ng / mL OKT3 (Ortho Pharmaceuticals, Raritan, NJ). 6The cells were cultured at a concentration of 1000 cells / mL in a humidified atmosphere containing 5% CO at 37°C for 24 hours. For further analysis, cells were cultured in AIM-V medium supplemented with interleukin-2 (IL-2) and IL-15 in a humidified atmosphere containing 5% CO at 37°C.

[0147] Flow cytometry analysis. Differentiated cells were subjected to gentle pipetting and filtration through a 70 or 100 μm strainer placed on a 50 mL tube. Cells were then pelleted by centrifugation and washed twice with 1% BSA in PBS. Cells were stained with the appropriate conjugated antibodies (Table 1) for 25 minutes at room temperature in the dark and washed with BSA-containing PBS before analysis in an Accuri C6 plus cytometer (Beckton Dickinson, Franklin Lakes, NJ). FlowJo software was used to process the flow data.

[0148] [Table 1]

[0149] Transwell migration assay. For the transwell assay, 600 μL of serum-free medium was placed in the lower chamber of a 24-well transwell plate (Corning Incorporated, Corning, NY). NK cells (2.5 × 10) in serum-free medium were cultured at 100 μL / well. 5 ) were added to the upper chamber (5 μm pore size), and the plate was incubated at 37°C with 5% CO for 5 hours. The number of NK cells that migrated to the lower chamber was determined by flow analysis (Accuri C6 plus cytometer; Beckton Dickinson, Franklin Lakes, NJ). Data are presented as the percentage of migration based on total cell input.

[0150] NK cell-mediated in vitro cytotoxicity assay. Cell viability was analyzed by flow cytometry according to the previous protocol described by Lee et al., Regulation of CAR T cell-mediated cytokine release syndrome-like toxicity using low molecular weight adapters, Nature Communications 10: 2681 (2019). Briefly, tumor cells were stained with MEM medium containing 2 μM calcein-AM at 37°C in the dark for 10 minutes, followed by treatment with 10% FBS at room temperature in the dark for 10 minutes. Labeled tumor cells were pelleted at 300 × g for 7 minutes and resuspended at a density of 50,000 cells / mL in culture medium containing 10% FBS. Tumor cells (100 μL) were then mixed with NK cells (100 μL) at 150,000, 250,000, and 500,000 cells / mL in 96-well plates and incubated at 37° C., 5% CO 2 for 12 hours.

[0151] To harvest all cells, the cell-containing medium was transferred to a new round-bottom 96-well plate, and 50 μL of trypsin-EDTA was added to the empty wells to dissociate the adherent cells. After 5 minutes of incubation at 37°C, the dissociated cells were transferred to the same wells of the round-bottom 96-well plate containing the floating cells. All cells were pelleted by centrifugation (300 × g, 4°C, 5 minutes) and washed with 200 μL of PBS- / - solution containing 0.5% BSA. The pelleted cells were stained with propidium iodide (PI) for 15 minutes at room temperature and analyzed in an Accuri C6 plus cytometer (Beckton Dickinson, Franklin Lakes, NJ).

[0152] Conjugate formation assay. To visualize the immune synapse, 100 μL of tumor cells (50,000 cells / mL) were seeded into wells of a 96-well plate and incubated at 37°C for 12 hours to allow attachment. NK cells (100 μL; 500,000 cells / mL) were then added to the target tumor cells, incubated for 6 hours, and then fixed with 4% paraformaldehyde in PBS. Cytoskeleton staining was then performed using the F-actin Visualization Biochem Kit (Cytoskeleton Inc., Denver, CO).

[0153] Enzyme-linked immunosorbent assay (ELISA) analysis. To analyze cytokine production by ELISA assay, 100 μL of tumor cells (50,000 cells / mL) were seeded into wells of a 96-well plate and incubated at 37°C for 12 hours to allow attachment. NK cells (100 μL; 500,000 cells / mL) were then added to the target tumor cells with or without fluorescein isothiocyanate (FITC)-folate (10 nmol / L) and incubated for 6 hours. The plate was then centrifuged at 350 × g for 10 minutes to spin down cell debris, and the top 10 μL of the supernatant was collected to measure TNFα and IL-6 production using ELISA kits (ThermoFisher Scientific, USA).

[0154] Statistical analysis. Three to five samples per group were analyzed, and data are presented as the mean ± standard deviation (SD). Statistical significance was determined by Student's t-test (two-tailed) between two groups, and by one-way analysis of variance (ANOVA) for three or more groups. P < 0.05 was considered statistically significant.

[0155] [Example 1] Targeted gene knock-in in hPSCs achieved inducible expression of NFIL3, SPI1, and ID2 To transiently activate key transcription factors (TFs) in a manner similar to that seen in natural NK cell development, we employed an all-in-one Tet-On 3G doxycycline-inducible expression system (containing two promoters: the Tet-On 3G transactivator protein driven by the constitutive EF1α promoter, and the transgene of interest driven by the TRE3G promoter) (Figure 1A and Figure 5A). This all-in-one inducible system effectively expressed eGFP in H9 hPSCs under doxycycline (dox) treatment (Figure 5B-C). Next, we replaced eGFP with NFIL3, SPI1, and ID2, each of which was knocked into the endogenous AAVS1 safe-harbor locus in H9 hPSCs via CRISPR / Cas9-mediated homologous sequence-dependent repair (HDR) (Figure 1B). After nucleofection, puromycin-resistant single-cell-derived hPSC clones were isolated and subjected to PCR genotyping. Targeted knock-in was successful, achieving efficiencies of 87.5% (7 of 8 clones), 87.5% (7 of 8 clones), and 83.3% (10 of 12 clones) for NFIL3, SPI1, and ID2, respectively (Figure 1C). Successful targeted clones were then subjected to homozygosity assays. 28.5% (2 of 7 clones), 14.3% (1 of 7 clones), and 40% (4 of 10 clones) were homozygous for NFIL3, SPI1, and ID2 knock-in clones, respectively (Figure 1C). Heterozygous NFIL3, SPI1, and ID2 knock-in hPSC clones C7, C8, and C6 were selected for differentiation into NK cells. Genetically modified hPSCs showed strong expression of the pluripotency markers stage-specific embryonic antigen 4 (SSEA-4) and octamer-binding transcription factor 4 (OCT4) (Figure 1D). Importantly, these hPSCs retained a normal karyotype even after CRISPR / Cas9-mediated genome editing (Figure 6). Similar to inducible eGFP expression, the resulting knock-in hPSCs expressed high levels of NFIL3, SPI1, and ID2 in response to dox treatment (Figure 1E and Figures 7A-7C).

[0156] [Example 2] Overexpression of ID2 promoted the differentiation of hPSCs into NK cells To investigate the functions of NFIL3, SPI1, and ID2 during in vitro NK cell development, we adapted and modified a previous chemically defined NK cell differentiation protocol (Figure 2A) (Romee et al. (2016), supra). When treated with dox throughout differentiation, approximately 0.6%, 14.6%, 9.0%, and 65.1% of CD45 expression was observed in wild-type hPSCs, NFIL3-hPSCs, SPI1-hPSCs, and ID2-hPSCs, respectively. + CD56 + These results suggest that overexpression of NK-specific TFs improves in vitro differentiation of hPSCs into NK cells (Figure 2B). In particular, forced expression of ID2 resulted in the highest percentage of CD45 NK cells under chemically defined, feeder-free monolayer culture conditions. + CD56 + This is consistent with the enhanced expression of ID2 during the differentiation of hPSCs into NK cells. Ma et al. (2022), supra; Mishra et al. (2012), supra. Overall, this result supports the use of forced TF expression to enhance the differentiation of hPSCs into NK cells.

[0157] ID2 plays stage-specific functions during the in vivo development and maturation of NK cells. Chen et al. (2018), supra; Jiang et al. (2019), supra; Li et al. (2018), supra. Therefore, to develop an optimized differentiation protocol, we investigated the stage-specific effects of forced ID2 expression during the generation of NK cells from hPSCs (Figure 3A). Transient treatment with dox suppressed the CD45 + CD56 + ID2 significantly affected the generation of NK cells (Figures 3B-3C), confirming the stage-specific role of ID2 in NK cell development. Among all conditions tested, dox treatment from days 12 to 22 (Group #2) resulted in the highest percentage (approximately 73.7%) of CD45+ CD56 + The cells obtained from the optimized conditions were further characterized and showed high levels of typical NK cell surface markers, including CD16, KIR3DL1, NKp46, NKG2D, and NKp44 (Figure 3D), consistent with previously reported hPSC-derived NK cells (Figure 8). Romee et al. (2016), supra; Cerwenka & Lanier (2016), supra; Cooper et al. (2009), supra; Liu et al. (2018), supra. Collectively, these results demonstrate a stage-specific role for ID2 overexpression in enhancing hPSC differentiation into NK cells.

[0158] [Example 3] hPSC-derived NK cells exhibited cytotoxicity against cancer cells The proliferation and migration capacities of hPSC-derived NK cells were investigated. In the presence of IL-2, IL-15, and OKT3, similar proliferation folds were observed in hPSC-derived NK cells and primary NK cells (Figure 4A). Seo et al. (2017), supra. Furthermore, ID2-overexpression-induced hPSC-NK cells exhibited similar migration capacities to wild-type hPSC-derived NK cells and primary NK cells (Figure 4B-C). To further explore their potential in cancer immunotherapy, ID2-overexpression-induced NK cells were cocultured with different cancer cells and subjected to tumor killing assays. Two hours after coculture with U87MG glioblastoma cells, an immune synapse was formed between the NK cells and tumor cells (Figure 4D), promoting the cytotoxic activity of NK cells against tumor cells. As expected, hPSC-derived NK cells derived from ID2 overexpression or feeder layer coculture expressed IFN-γ and CD107a in response to tumor cells (Figure 4E-F), suggesting the release of cytotoxic granules. The tumor-killing ability of hPSC-derived NK cells against different tumor cells, including LNCaP, A549, U87MG, and MDA-MB-231, was similar to that of their peripheral blood counterparts. hPSC-derived NK cells demonstrated broad antitumor cytotoxicity at various effector-to-target ratios (Figure 4G-I). Notably, hPSC-derived NK cells did not kill normal H9-derived somatic cells (Figure 9). These data support their safety in future clinical applications.

[0159] Adoptive NK cell-based immunotherapy holds great promise for clinical cancer treatment, given their unique innate tumor-killing ability and safety in allogeneic transplantation. Clinical needs (10 cells per patient) 7To meet the clinical needs of cancer immunotherapy (cells / kg), several human NK cell sources, including peripheral blood (PB) and umbilical cord blood (UCB), have been investigated for cancer immunotherapy. Du et al. (2021), supra. However, primary NK cells isolated from PB and UCB sources are heterogeneous, and such cells are insufficient to treat many patients. Ibid.; Judge et al. (2020), supra; Jiang et al. (2019), supra. In contrast, hPSCs can proliferate indefinitely and differentiate into NK cells, fulfilling clinical needs and providing a viable and versatile cell source for various therapies (e.g., targeted cancer immunotherapy). Sun et al. (2009), supra; Ma et al. (2022), supra.

[0160] TF-mediated forward programming approaches have been used recently to efficiently differentiate hPSCs into neurons, glia, hepatocytes, skeletal cells, and cardiomyocytes. Luo et al. (2022), supra. However, such approaches have not yet been applied to NK cell induction. Here, hPSCs were genetically engineered with doxycycline-inducible expression of NFIL3, SPI1, and ID2, and TF-mediated forward programming enhanced NK cell differentiation, with the highest percentage of CD45+ cells induced by inducible ID2 expression. + CD56 + NK cells were generated. This result is consistent with the enhanced expression of ID2 during differentiation of hPSCs into NK cells. Ma et al. (2022), supra; Mishra et al. (2012), supra. The resulting hPSC-derived NK cells also displayed NK-specific surface markers and exhibited cytotoxic activity against various tumor cells in vitro.

[0161] In summary, our all-in-one inducible expression system can serve as a modular strategy for screening more transcription factors to reliably induce NK or T cells from hPSCs. Engineered ID2-expressing hPSCs can be used to generate universal NK cells, which could serve as a standardized cell product for clinical applications in cancer treatment.

[0162] [Example 4] Screening for CAR constructs with enhanced NK cell-mediated tumor killing activity Based on previous CAR constructs used in T and NK cells, we designed and evaluated eight different CARs optimized for antitumor cytotoxicity and proliferation in NK-92 cells (Figure 2A).

[0163] Construction of CAR Plasmids. Generally, to construct anti-PD-L1 lentiviral vectors, DNA sequences encoding the CD8α signal peptide, anti-PD-L1 nanobody, CD28 extracellular domain, CD28 or NKG2D transmembrane domain, CD28 or 2B4 intracellular costimulatory domain, ΔIL-2Rβ, and CD3ζ-YXXQ were directly synthesized and, after BamHI and MluI digestion, cloned into the lenti-luciferase-P2A-NeoR (Addgene #105621) backbone via NEBuilder HiFi DNA Assembly. Zhang et al., Structural basis of a novel PD-L1 nanobody for immune checkpoint blockade, Cell Discovery 3: 17004 (2017).

[0164] For lentivirus production, 293TN cells were typically incubated in DMEM medium (containing 10% FBS, 1% sodium pyruvate, and 0.5% GlutaMAX) until 95-100% confluence. 4.5 μg of lentiviral CAR plasmid, 3.0 μg of psPAX2, and 1.5 μg of pMD2.G were added to 450 μL of Opti-MEM medium and incubated at room temperature for 5 minutes. Next, FuGENE HD Reagent (27 μL) was added to the mixture and incubated at room temperature for an additional 15 minutes. The resulting 450 μL of plasmid mixture was added to 3 mL of culture medium, and after aspirating the old medium, it was evenly distributed into three wells of a 6-well plate containing 293TN cells. 18 hours after plasmid addition, the medium from each well was aspirated and replaced with 3 mL of fresh culture medium, followed by an additional 24 hours of incubation. The virus-containing supernatant was then collected daily, followed by a medium change with fresh warmed medium for 2–3 days, transferred to a 50 mL conical tube, and stored at 4°C. The resulting virus supernatant was then centrifuged at 2,000 g for 5 min at 4°C or filtered through a 0.45 μm filter to remove cellular debris.

[0165] The resulting anti-PD-L1 plasmids were then sequenced and digested with MluI to further incorporate the IRES-NeoR or IRES-GFP sequence. An anti-FITC CAR plasmid containing the CD8α signal peptide, anti-fluorescein single-chain variable fragment (scFv), CD8α extracellular and intracellular domains, 4-1BB costimulatory domain, and CD3ζ signaling domain was previously constructed by the present researchers and cloned into the AAVS1-Puro CAG FUCCI donor plasmid (Addgene #136934). Lee et al. (2019), supra; Chang et al., Fluorescent indicators for continuous and lineage-specific reporting of cell-cycle phases in human pluripotent stem cells, Biotechnology & Bioengineering 117(7): 2177-2186 (2020).

[0166] The resulting AAVS1-Puro CAG anti-FITC-CAR plasmid was digested with SgrDI and MluI and ligated to the lentiviral anti-PD-L1 CAR backbone to construct the lentiviral anti-FITC CAR vector. To generate the anti-FITC CAR plasmid with the NKG2D transmembrane domain and the 2B4 costimulatory domain, the anti-FITC scFv sequence and a chimeric sequence consisting of NKG2D, 2B4, and CD3ζ were PCR-amplified from the lentiviral anti-FITC CAR vector and the AAVS1-Puro CAG CLTX-NKG2D-2B4-CD3z CAR (Addgene #157744), respectively, and cloned into the AAVS1-Puro CAG FUCCI plasmid via NEBuilder HiFi DNA Assembly to generate the AAVS1-Puro CAG anti-FITC-NKG2D-2B4-CD3z CAR. This was digested with SgrDI and MluI and ligated to the lentiviral anti-PD-L1 CAR backbone to construct the lentiviral anti-FITC-NKG2D-2B4-CD3z CAR.

[0167] CARs #1–#4 were single-antigen-targeting CARs targeting either PD-L1 or FITC using NK cell- or T cell-specific signaling domains, while CARs #5–#8 were hybridized dual-antigen-targeting CARs. For the switchable anti-FITC scFv CARs, CARs #1, #5, and #7 employed the NK-specific transmembrane domain NKG2D, the costimulatory domain 2B4, and the intracellular domain CD3ζ, whereas CARs #2, #6, and #8 differed in the transmembrane domain CD8 and the costimulatory domain 4-1BB. For the tumor microenvironment-responsive anti-PD-L1 nanobody CARs, CAR#3, CAR#5, and CAR#7 utilized the NK-specific transmembrane domain NKG2D, the costimulatory domain 2B4, the truncated IL-2 receptor beta chain (Delta IL-2RB), the intracellular domain CD3ζ, and the STAT3-binding tyrosine-XX-glutamine (YXXQ) motif, while CAR#4, CAR#6, and CAR#8 differed in the transmembrane domain CD28.

[0168] These CAR constructs were expressed as FRα + and PD-L1 + Its ability to enhance antitumor activity against tumor cells was first tested in NK-92 cells. Human breast cancer MDA-MB-231 cells express high levels of FRα and PD-L1, whereas human prostate adenocarcinoma LNCaP cells express neither FRα nor PD-L1 (Figure 16A). Martin et al., Paucity of PD-L1 expression in prostate cancer: Innate and adaptive immune resistance, Prostate Cancer & Prostatic Diseases 18: 325-332 (2015). These two tumor lines were used to analyze the antitumor cytotoxicity of our engineered CAR NK-92 cells.

[0169] Regarding NK-92 cells and lentiviral transduction, NK-92 cells were generally cultured in MyeloCult H5100 medium containing 100 units / mL of human recombinant IL-2. For lentiviral transduction, NK-92 cells were first stimulated with IL-2 and IL-15. Briefly, NK-92 cells were counted and cultured at 1 x 10 cells in the appropriate medium (RPMI 1640, 10% FBS, 2 nM L-glutamine, 20 ng / mL IL-2, 50 ng / mL IL-15, and 100 ng / mL IL-12). 6 These NK-92 cells were stimulated for 2 hours and then subjected to lentiviral transduction.

[0170] After cytokine stimulation, 1 × 10 5 NK-92 cells were seeded into each well of a 12-well plate, and the cells were treated overnight with 1 mL of viral supernatant and polybrene (8 μg / mL) at 37°C, 5% CO2. After 24 hours, the virus was removed by centrifugation at 360 × g for 5 minutes, and the resulting NK-92 cells were suspended in 1 mL of MyeloCult H5100 medium containing 100 units / mL of human recombinant IL-2. Five days later, the transduced NK-92 cells were centrifuged at 360 × g for 5 minutes and resuspended in 1 mL of MyeloCult H5100 medium containing 100 units / mL of human recombinant IL-2 and 1 μg / mL of puromycin or 100 μg / mL of G418. Drug screening for at least 8 days is required to enrich for successfully transduced NK-92 cells.

[0171] For the maintenance of MDA-MB-231 and LNCaP cells, LNCaP tumor cells were kindly provided and cultured by Dr. Chang-Deng Hu's laboratory at Purdue University. MDA-MB-231 cells were cultured in Leibovitz's L-15 medium (containing 10% FBS, 100 units / mL penicillin, and 100 mg / mL streptomycin), and LNCaP cells were cultured in RPMI-1640 medium (containing 10% FBS, 100 units / mL penicillin, and 100 mg / mL streptomycin). These two cell lines were incubated at 37°C and 5% CO2. The culture medium was changed every two days, and cells were passaged at 70-80% confluency.

[0172] A bispecific FITC-folate adapter was first synthesized with folate on the left side to bind to FRα on breast tumor cells and fluorescein on the right side to target the anti-FITC CAR (Figure 16B). Lee et al. (2019), supra. The binding affinity (K) of FITC-folate for MDA-MB-231 tumor cells was calculated. d ) was measured as 2.64 nM (Figure 16C), and the binding affinity (K d ) was measured to be approximately 10 nM (Figure 16D). Considering that a very low FITC-folate concentration would result in insufficient intracellular crosslinks, whereas a very high concentration would result in an excess of FITC-folate adaptor, locking intracellular crosslinks due to monovalent saturation of ligand-binding sites on both cell types, 10 nM FITC-folate was used in the following studies.

[0173] The killing ability of various anti-FITC and / or anti-PD-L1 CARs NK-92 cells (Figure 16E) was compared with that of MDA-MB-231 (FRα + PD-L1 + ) and LNCaP cells (FRα - PD-L1 -) were tested. As expected, CAR-expressing NK-92 cells exhibited stronger cytotoxicity against MDA-MB-231 and released more cytotoxic granules than LNCaP cells (Figure 11B and Figures 17A-17D). In the presence of the bispecific FITC-folate adapter, the anti-MDA-MB-231 cytotoxicity of CAR NK-92 cells was significantly increased (Figure 11C), suggesting the specificity of the anti-FITC CAR. Among these CARs, CAR#1, CAR#5, and CAR#6 were shown to inhibit FRα after cross-linking with the FITC-folate adapter. + PD-L1 + The antitumor activity of NK-92 cells against breast cancer cells was significantly increased (Figure 11C), and IFNγ and TNFα release (cytotoxic granules) were significantly enhanced (Figures 11D-11E). As expected, these FITC-folate-crosslinked NK-CARs (#1, #5, and #6) were involved in higher killing of NK-92 cells than T cell-specific CARs (#2, #7, and #8).

[0174] [Example 5] Screening for CAR structures with enhanced NK cell proliferation activity The ability of various CARs to promote antigen-specific NK cell proliferation after co-culture with tumor cells was evaluated. Both the truncated IL-2 receptor β chain (ΔIL-2RB) and the STAT3-binding tyrosine-XX-glutamine (YXXQ) motif in the anti-PD-L1 CAR were designed to enhance cell proliferation and persistence through activation of the JAK, STAT3, and STAT5 signaling pathways. Kagoya et al., A novel chimeric antigen receptor containing a JAK-STAT signaling domain mediates superior antitumor effects, Nature Medicine 24: 352-359 (2018).

[0175] Cell viability was analyzed by flow cytometry according to a previous protocol described in Kandarian et al., "A flow cytometry-based cytotoxicity assay for the assessment of human NK cell activity," JoVE: Immunology & Infection 2017 (2017). Briefly, tumor cells were stained with 2 μM calcein-AM in MEM medium at 37°C in the dark for 10 minutes, followed by treatment with 10% FBS for 10 minutes at room temperature in the dark. Labeled tumor cells were pelleted at 300 × g for 7 minutes and resuspended at a density of 50,000 cells / mL in culture medium containing 10% FBS. Next, 100 μL of tumor cells were mixed with NK cells (100 μL each) at 150,000 cells / mL, 250,000 cells / mL, and 500,000 cells / mL in a 96-well plate with or without the antigen to be tested (e.g., FITC-folate (10 nmol / L)), and incubated at 37°C, 5% CO2 for 12 hours.

[0176] To harvest all cells, the cell-containing medium was first transferred to a new round-bottom 96-well plate, and 50 μL of trypsin-EDTA was added to the empty wells to dissociate the adherent cells. After 5 minutes of incubation at 37°C, the dissociated cells were transferred to the same wells of the round-bottom 96-well plate containing the floating cells. All cells were pelleted by centrifugation (300 × g, 4°C, 5 minutes) and washed with 200 μL of PBS- / - solution containing 0.5% BSA. The pelleted cells were stained with propidium iodide (PI) for 15 minutes at room temperature and analyzed on an Accuri C6 plus cytometer (Beckton Dickinson, Franklin Lakes, NJ).

[0177] PD-L1 +Upon stimulation with MDA-MB-231 cells, CAR NK-92 cells showed upregulation in the levels of phosphorylated STAT3 (pSTAT3) and pSTAT5 (Figure 11F), among which CAR#3, CAR#5, and CAR#7 showed superior ability in upregulating pSTAT3 and pSTAT5 (Figures 18A-B). As expected, CAR#3, CAR#5, and CAR#7 also promoted the greatest proliferation in NK-92 cells (Figure 11G).

[0178] To investigate the persistence and memory-like phenotype of NK-92 cells after CAR engineering, an in vitro continuous tumor cell exposure model was established (Figure 11H). Consistent with previous observations, NK-92 cells engineered with CAR#1, CAR#5, and CAR#6 exhibited a FRα (Figure 11H)-like phenotype under initial antigen exposure on day 1. + PD-L1 + It showed excellent tumor-killing ability against breast cancer cells (Figure 11I).

[0179] As antigen exposure increased (days 8 and 15), a significant decrease in antitumor cytotoxicity was observed in NK-92 cells bearing only the anti-FITC CAR (CAR#1), whereas the dual anti-FITC and anti-PD-L1 CAR NK-92 cells (CAR#5 and CAR#6) still exhibited superior antitumor activity at day 15. Notably, the dual anti-FITC and anti-PD-L1 CAR#5, which contains an NK-specific transmembrane domain and a costimulatory domain, demonstrated superior persistence compared to all other CARs. These results demonstrate that the dual CAR design can synergistically enhance the multiple functions of NK cells under specific tumor antigen stimulation and achieve superior antitumor activity and persistence in the complex tumor microenvironment.

[0180] [Example 6] hPSC transduction hPSCs can be engineered to express CAR construct(s) using a lentiviral transduction strategy to generate functional CAR-NK cells. For hPSC transduction, hPSCs are dissociated using 0.5 mM EDTA and grown at 10,000–80,000 cells / cm in mTesR plus medium containing 5 μM Y27632. 2 The cells were seeded onto iMatrix 511-coated 6-well plates at a cell density of 100 μg / ml. After 24 hours, the stem cell culture medium was aspirated and replaced with 1 mL of mTeSR plus medium containing 5 μM Y27632 and viral supernatant. 24 hours later, these were removed and replaced with 2 mL of fresh mTeSR plus medium. Two to three days after transduction, transduced hPSCs were successfully selected by applying 100 μg / ml G418 or 1 μg / ml puromycin. To further enrich for the desired cells, the transduced hPSCs were dissociated and transferred to 96-well plates at a cell density of 10 cells / mL. After 4 days of culture, the hPSCs were continuously treated with 100 μg / ml G418 or 1 μg / mL puromycin for an additional 8 days.

[0181] [Example 7] Engineering hPSC-derived NK cells with dual CARs to enhance function Given its excellent antitumor activity and persistence in NK-92 cells, dual anti-FITC and PD-L1 CAR#5 was selected for CAR engineering of hPSC-derived NK cells. Single-antigen-targeted anti-FITC CAR#1 and anti-PD-L1 CAR#3 were used as controls for antitumor cytotoxicity and cell proliferation, respectively. hPSCs were engineered with these three CARs to provide a potentially universal source of CAR-expressing NK cells.

[0182] Briefly, the H9 hPSC line was obtained from WiCell and maintained on Matrigel-coated plates in mTeSR plus medium. For NK cell differentiation, hPSCs were dissociated using 0.5 mM EDTA and cultured at 10,000–80,000 cells / cm in mTeSR plus medium containing 5 μM Y27632. 2 Cells were seeded onto iMatrix 511-coated 24-well plates at a cell density of 0.01 μg / mL for 24 hours (day -1). On day 0, cells were treated with 6 μM CHIR99021 (CHIR) in Dulbecco's modified Eagle's medium (DMEM) supplemented with 100 μg / mL ascorbic acid (DMEM / Vc), followed by a medium change with LaSR basal medium from days 1 to 4. VEGF (50 ng / mL) was added to the medium from days 2 to 4. On day 4, the medium was changed to Stemline II medium (Sigma-Aldrich, St. Louis, MO) supplemented with 10 μM SB431542, 25 ng / mL SCF, and FLT3L. On day 6, the SB431542-containing medium was aspirated, and cells were maintained in Stemline II medium containing 50 ng / mL SCF and FLT3L. On days 9 and 12, the top half of the medium was aspirated and replaced with fresh Stemline II medium (0.5 mL) containing 50 ng / mL SCF and FLT3L. On day 15, floating cells were gently harvested, filtered using a cell strainer, and cultured on an OP9-DLL4 (kindly provided by Dr. Igor Slukvin) monolayer (2 × 10 cells) in NK cell differentiation medium (α-MEM medium supplemented with 20% FBS, 5 ng / mL IL-7, 5 ng / mL FTL3L, 25 ng / mL SCF, 5 ng / mL IL-15, and 35 nM UM171). 4 The NK cell differentiation medium was changed every 3 days, and the suspension cells were transferred onto a fresh OP9-DLL4 monolayer every 6 days.

[0183] A generic anti-FITC CAR was knocked into the AAVS1 safe harbor locus via CRISPR / Cas9-mediated homologous recombination (Figures 19A-B), resulting in robust CAR-expressing hPSCs (Figure 19C). Notably, the engineered hPSCs retained high levels of pluripotency markers, including stage-specific embryonic antigen 4 (SSEA-4) and octamer-binding transcription factor 4 (OCT-4) (Figure 19C). To clarify the effect of CAR expression on NK cell differentiation, stage-specific morphogens were used to differentiate the genetically modified hPSCs into hematopoiesis and NK cells (Figure 20A). Highly purified CD45 + CD43 + Hematopoietic stem progenitor cells (HSPCs) (Figure 20B), as well as CD56 + CD45 + NK cells (Figure 20C) were successfully generated from wild-type or CAR-expressing hPSCs. The resulting hPSC-derived NK cells also expressed high levels of typical NK cell surface markers, including CD16, KID3DL1, NKp46, NKG2D, and NKp44 (Figure 12A).

[0184] To confirm their antitumor cytotoxicity, CAR-expressing hPSC-derived NK cells were cocultured with MDA-MB-231 cells in the presence of 10 nM FITC-folate. Compared with wild-type hPSC-NK cells, more immune synapses were formed between CAR-engineered NK cells within 2 h (Figure 12B), and dual CAR-NK cells formed the most immune synapses with tumor cells (Figure 12C). Meanwhile, all hPSC-derived NK cells showed similar, but lesser, immune synapse formation capacity with FRα-PD L1-LNCaP prostate cancer cells (Figure 21A), demonstrating the high specificity of these CARs for their target tumor antigens. In response to MDA-MB-231 tumor cells, CAR-NK cells expressed more IFNγ and CD107a (Figure 12D) and released more cytotoxic granules, TNFα and IFNγ (Figures 12E-F). As expected, dual CAR-NK cells expressed the highest levels of IFNγ and CD107a and released the most cytotoxic granules, whereas all tested NK cells expressed low levels of IFNγ and CD107a and released small amounts of cytotoxic granules upon stimulation with FRα-PD-L1-LNCaP cells (Figures 21B-21D). The tumor-killing capabilities of different hPSC-NK cells were evaluated, demonstrating that dual CAR-NK cells exhibited superior anti-MDA-MB-231 cytotoxicity compared with wild-type, anti-FITC CAR, and anti-PD-L1 CAR NK cells (Figure 12G). All hPSC-derived NK cells exhibited similar, but lower, cytotoxicity against LNCaP tumor cells (Figure 21E).

[0185] The antigen-responsive proliferation capacity of various hPSC-NK cells was investigated. Upon stimulation with PD-L1+MDA-MB-231 cells, hPSC-derived CAR-NK cells upregulated the expression levels of phosphorylated STAT3 (pSTAT3) and pSTAT5 (Figure 22A). Single-antigen-targeted anti-PD-L1 and dual-CAR-NK cells showed the highest levels of pSTAT3 and pSTAT5 expression (Figure 12H) and achieved the highest cell proliferation (Figure 12I). The antitumor cytotoxicity and persistence of CAR-NK cells in a continuous antigen exposure model were investigated. On day 1, similar high initial anti-MDA-MB-231 cytotoxicity was observed in anti-FITC CAR-NK cells and dual-CAR NK cells (Figure 12J). However, as the antigen exposure time increased (days 8 and 15), the tumor-killing ability of anti-FITC CAR-NK cells significantly decreased, whereas dual-CAR-NK cells showed superior antitumor activity and persistence even at day 15. Importantly, all CAR-expressing hPSC-derived NK cells did not kill normal H9 hPSCs or hPSC-derived somatic cells (Figure 22B), demonstrating their safety in future clinical applications.

[0186] [Example 8] Dual CAR-hPSC-NK cells enhanced the durability of antigen responsiveness in vivo Systemic administration or ectopic expression of interleukin-15 (IL-15) has been used to improve the in vivo persistence of CAR-NK cells, but may lead to aberrant cell proliferation or even leukemic transformation. Ma et al. (2021), supra; Liu et al. (2018), supra; Du et al. (2021), supra; Mishra et al. (2012), supra. To clarify the effect of anti-PD-L1 CAR on the proliferation and persistence of hPSC-NK cells, 5 × 10 5 NRG mice implanted with PD-L1-expressing MDA-MB-231 breast cancer cells or rare PD-L1-expressing LNCaP cells (Figure 13A and Figure 23) were treated with 5x10 6Mice were treated by intravenous infusion with 10 different hPSC-derived NK cells or PBS. Host blood was collected for NK cell analysis on days 6, 14, 21, and 28. Significantly higher numbers of NK cells were detected in the anti-PD-L1 CAR NK cell group and the dual-CAR NK cell group in the MDA-MB-231 mouse xenograft tumor model than in the other groups (Figures 13B-C). As expected, low numbers of NK cells were detected in all experimental groups in the LNCaP mouse xenograft model (Figures 23A-B), highlighting the specificity of the anti-PD-L1 CAR and its ability to enhance NK cell persistence in vivo.

[0187] The biocompatibility of hPSC-derived CAR-NK cells was also assessed by monitoring the body weight of the host mice, and no significant weight loss was observed in all experimental groups tested (Figure 13D and Figure 23C), suggesting minimal systemic toxicity and high biocompatibility of hPSC-derived NK cells. At day 30, histological analysis of major organs excised from the host mice revealed that the adoptive NK cells caused no observable abnormalities or damage in the heart, liver, spleen, lungs, and kidneys (Figure 13E), confirming the biocompatibility of hPSC-derived NK cells.

[0188] [Example 9] Dual CAR-hPSC-NK cells improved antitumor activity in a tumor rechallenge model To evaluate the in vivo antitumor activity of different hPSC-NK cells, the cytotoxicity of MDA-MB-231 cells was tested in a mouse xenograft model. All mouse experiments were approved by the Purdue Animal Care and Use Committee (PACUC). Briefly, immunodeficient NOD.Cg-RAG 1tm1Mom IL2rg tm1Wjl / SzJ(NRG) mice were bred and maintained by the Biological Evaluation Core at the Purdue University Center for Cancer Research. MDA-MB-231 cells (5 × 10 tumor cells per mouse) were cultured and maintained at the Biological Evaluation Core at the Purdue University Center for Cancer Research. 5 The tumor size was approximately 100 mm 3 NK cells and FITC-folate were injected intravenously when the tumor size reached 1 × 10 7 A single injection of NK cells was administered (Figure 14A). To reduce folate levels in the mice to physiological levels found in humans, the mice were maintained on a folate-deficient diet (TD.95247, Envigo RMS, LLC, Indianapolis, IN).

[0189] Tumors were measured every 5 days with a caliper and tumor volumes were calculated using the formula: tumor volume = L x W 2 ×½, where L is the longest axis of the tumor and W is the axis perpendicular to L. Mouse blood was also collected for NK cell and cytokine release (TNFα and IL-6) analysis, and systemic toxicity was monitored by measuring weight loss in experimental mice.

[0190] Compared to tumor-bearing mice treated with PBS, administration of hPSC-NK cells significantly reduced tumor burden (Figures 14B-C). As expected, dual-CAR hPSC-NK cells exhibited greater antitumor cytotoxicity than wild-type or other CAR-expressing NK cells. We next measured the amount of human cytokine production released into the plasma of different experimental mouse groups, including TNFα and IL-6. All non-PBS experimental groups released detectable TNFα and IL-6 into the plasma from days 14 to 28, and dual-CAR hPSC-NK cells maintained the highest levels of both cytokines (Figures 14D-E). These cytokines eventually declined in the host mice, suggesting a low risk of cytokine release syndrome.

[0191] Given the promising in vivo performance of our hPSC-derived NK cells, we reinoculated them with MDA-MB-231 tumor cells to establish a tumor rechallenge model and investigate their memory-like behavior (Figure 15A). Compared with other experimental groups, dual-CAR hPSC-NK cells significantly reduced tumor burden (Figures 15B-C) and prolonged the survival of tumor-bearing mice (Figure 15D). The data suggest that combining tumor microenvironment-responsive anti-PD-L1 and programmable anti-FITC CARs significantly enhanced the in vivo persistence and anti-tumor activity of hPSC-derived NK cells, endowing them with memory-like capabilities required for improved immunotherapy.

Claims

[Claim 1] The invention described in the present specification.

Images