Salmonella strains with integrated landing pads on the chromosome

JP2025531378A5Pending Publication Date: 2026-09-14PROKARIUM LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025517240
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-09-21
Filing Date
2023-09-14
Publication Date
2026-09-14

AI Technical Summary

Technical Problem

Current methods for integrating heterologous cargo into bacterial chromosomes, such as those using plasmid-based systems, suffer from cell-to-cell variability, metabolic burden, reliance on antibiotic resistance genes, and unpredictable effects on bacterial physiology, leading to unreliable cargo production and potential side effects.

Method used

A Salmonella strain with a chromosomally integrated synthetic polynucleotide sequence at predetermined pseudogenomic locations, using defined recombination sites to introduce heterologous cargo, minimizing impact on bacterial physiology and ensuring controlled delivery.

Benefits of technology

Enables efficient, controlled delivery of heterologous cargo with reduced metabolic burden and cell-to-cell variability, preserving bacterial strain efficacy and avoiding side effects on surrounding genes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

The present invention relates to a modified live attenuated strain of Salmonella, said strain comprising a synthetic polynucleotide sequence integrated on at least one chromosome inserted at a predetermined pseudogenomic location. The sequence contains at least one defined recombination site for introducing a heterologous polynucleotide sequence encoding a polypeptide, and the integrated synthetic polynucleotide on the chromosome The octide sequence is located within at least one locus defined by any one of SEQ ID NOs: 1 to 30, or a sequence comprising at least 70% identity to any one of SEQ ID NOs: 1 to 30. The present invention also relates to vaccine compositions comprising the modified strains, and various uses and methods thereof.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Technical field to which the invention belongs The present invention relates to the use of modified Salmonella to deliver heterologous cargo and methods thereof. [Background technology]

[0002] background Microorganisms such as bacteria can be genetically engineered to carry and deliver heterologous cargo. Many current technologies for regulating gene expression are plasmid-based. However, plasmid-based systems have many drawbacks, including the introduction of cell-to-cell variability, increased metabolic burden, and reliance on antibiotic resistance genes, which can be removed from the resulting therapeutic strain.

[0003] One way to overcome these problems is to introduce the desired cargo into the chromosome of the host organism. Kuhlman and Cox (Nucleic Acids Research, 2010, 38:6, e92) have described a system in which the helper plasmid TKRED catalyzes the introduction of a "landing pad" at any position on the Escherichia coli chromosome, allowing the insertion of heterologous cargo. Such an approach has been described by Snoeck et al. (Biotechnology and It has also been used by (Bioengineering, 2019, 116:364-374), who used serine recombinase to integrate cargo into the E. coli chromosome at landing pads with cognate att sites placed at random locations throughout the genome. Furthermore, US2014 / 127816A1 discloses introducing recombinase recognition sites into intergenic regions upstream and downstream of a gene to effectively excise the gene.

[0004] However, genome integration also presents many challenges. For example, chromosomal integration of cargo is laborious and difficult for very large constructs. Furthermore, genome modification / integration can affect the physiology of the strain in unpredictable ways, thereby altering its effectiveness as a potential therapeutic strain. In particular, when genes are modified at intergenic sites (US 2014 / 127816 A1 Such integration may result in potential side effects, such as deleting or affecting surrounding active genes. Finally, the amount of transcript that an introduced circuit can produce depends on its location in the genome. Therefore, random integration may result in uncontrollable and unreliable production of the desired cargo. Therefore, the field needs to improve methods for introducing cargo into the chromosomes of host organisms. Summary of the Invention

[0005] The inventors of the present invention have surprisingly found that at least one The present inventors have found that by creating a Salmonella strain containing a chromosomally integrated synthetic polynucleotide sequence, it is possible to efficiently and rapidly introduce any desired cargo into the strain, as well as to introduce the cargo into a genomic location of known transcriptional strength, thereby enabling more controlled delivery of various cargoes. Furthermore, the present inventors have identified specific pseudogenomic locations containing regions of inactive DNA for insertion of these chromosomally integrated sequences. The researchers identified a "landing pattern" that minimized the impact on normal bacterial cell physiology and on the bacterial strain's therapeutic potential. By introducing "ads," the inventors have found a way to introduce new genes and functionality into Salmonella strains without affecting surrounding genes, thereby preserving normal bacterial cell physiology and minimizing the impact on the therapeutic potential of the bacterial strain. do.

[0006] Thus, in a first aspect, the present invention discloses a modified live attenuated strain of Salmonella, said strain comprising at least one chromosomally integrated synthetic polynucleotide inserted at a predetermined pseudogenomic location. a nucleotide sequence, said sequence comprising at least one defined recombination site for introducing a heterologous polynucleotide sequence encoding a polypeptide, and integrated onto said chromosome; The synthesized synthetic polynucleotide sequence is any one of SEQ ID NOs: 1 to 30, or Located in at least one locus defined by a sequence having at least 70% identity to any one of SEQ ID NOs. 1 to 30.

[0007] In a second aspect, the present invention discloses a vaccine composition comprising the modified live attenuated bacterial strain disclosed herein.

[0008] In a third aspect, the present invention discloses the modified live attenuated bacterial strain disclosed herein for use in the treatment of cancer.

[0009] In a fourth aspect, the present invention discloses the modified live attenuated bacterial strain disclosed herein for use in the treatment of an infectious disease.

[0010] In a fifth aspect, the present invention discloses a modified live attenuated bacterial strain as disclosed herein for use in the treatment of an autoimmune disease or disorder.

[0011] In a sixth aspect, the present invention discloses a method of treating, inhibiting or controlling a neoplastic or infectious disease in a subject, the method comprising administering to the subject a live attenuated modified strain of Salmonella, said strain comprising at least one chromosome inserted at a predetermined pseudogenomic location. a synthetic polynucleotide sequence integrated onto a chromosome, said sequence comprising at least one defined recombination site for introducing a heterologous polynucleotide sequence encoding a polypeptide. The synthetic polynucleotide sequence integrated on the chromosome is any one of SEQ ID NOs: 1 to 30. The method is characterized in that the nucleic acid sequence is located in at least one locus defined by any one of the sequences set forth in SEQ ID NOs: 1 to 30, or a sequence comprising at least 70% identity to any one of SEQ ID NOs: 1 to 30.

[0012] In a seventh aspect, the present invention discloses a method for modifying a live attenuated strain of Salmonella, said method comprising inserting a synthetic polynucleotide sequence into a predetermined pseudogenomic location of a live attenuated strain of Salmonella, said sequence comprising at least one defined recombination site for introducing a heterologous polynucleotide sequence encoding a polypeptide, The synthetic polynucleotide sequence integrated onto the chromosome is any one of the sequences of SEQ ID NOs: 1 to 30. The method is characterized in that the nucleic acid sequence is located in at least one locus defined by a sequence comprising at least 70% identity to any one of SEQ ID NOs: 1-30. [Brief explanation of the drawings]

[0013] [Figure 1-1] Figure 1 shows the alignment of the sequence of Salmonella strain ZH9 compared to the reference genome of Salmonella strain Ty21a. [Figure 1-2] Figure 1 shows the alignment of the sequence of Salmonella strain ZH9 compared to the reference genome of Salmonella strain Ty21a. [Figure 2] Figure 2 shows the location of the pseudogenes in the genome of strain ZH9. [Figure 3] FIG. 3 shows a possible design for chromosomally introducing the synthetic sequences disclosed herein into a Salmonella strain. [Figure 4] Figure 4 shows the reproducibility of small-scale integration rounds in Salmonella strain ZH9. [Figure 5] FIG. 5 shows the optimization of the conditions required for successful integration of the synthetic sequence into the chromosome of Salmonella strain ZH9. [Figure 6]Figure 6 shows the number of successful integrands in each integration round, verification of integration by ColonyPCT, and the final genomic location of the synthetic sequences in the Salmonella ZH9 genome. [Figure 7] FIG. 7 shows the optimization of the auxiliary plasmid curing conditions. [Figure 8A] FIG. 8 shows the growth curves and doubling times of strains with the synthetic sequence integrated into the chromosome, cultured at 37° C. for 12 hours in complex medium (vegan Lysogeny Broth) or minimal medium (M9 medium). [Figure 8B] FIG. 8 shows the growth curves and doubling times of strains with synthetic sequences integrated into the chromosome, cultured at 37° C. for 12 hours in complex medium (vegan Lysogeny Broth) or minimal medium (M9 medium). [Figure 9] FIG. 9 shows possible shuttle vector designs used to introduce cargo into the chromosomally integrated synthetic sequence. [Figure 10] FIG. 10 shows induction of protein production in Salmonella ZH9 strain using the shuttle vector design of FIG. [Figure 11] FIG. 11 shows the induction effect on strain growth of Salmonella enterica ZH9 using the shuttle vector design of FIG. [Figure 12] Figure 12 shows the expression of the transfected cargo as a function of genomic location as determined by two assays: the chloramphenicol acetyltransferase (CAT) assay and the mScarlet assay. The correlation between these two independent assays is also shown. [Figure 13-1] FIG. 13 shows mScarlet fluorescence at three thresholds (OD600 ∼0.3, 0.5, 1.0) for Salmonella enterica ZH9 strain successfully integrated with the synthetic sequence disclosed herein. [Figure 13-2] FIG. 13 shows mScarlet fluorescence at three thresholds (OD600 ∼0.3, 0.5, 1.0) for Salmonella enterica ZH9 strain successfully integrated with the synthetic sequence disclosed herein. [Figure 13-3]FIG. 13 shows mScarlet fluorescence at three thresholds (OD600 ∼0.3, 0.5, 1.0) for Salmonella enterica ZH9 strain successfully integrated with the synthetic sequence disclosed herein. [Figure 14] FIG. 14 shows various strains that have integrated the synthetic sequences disclosed herein at different genomic locations, ranked by relative transcription strength. [Figure 15] Figures 15 and 16 show the procedure for successively subculturing strains A to C, each containing up to three landing pads, for four days, and the results of genome sequencing at each landing pad position on day 4. No changes were observed in either case. [Figure 16-1] Figures 15 and 16 show the procedure for successively subculturing strains A to C, each containing up to three landing pads, for four days, and the results of genome sequencing at each landing pad position on day 4. No changes were observed in either case. [Figure 16-2] Figures 15 and 16 show the procedure for successively subculturing strains A to C, each containing up to three landing pads, for four days, and the results of genome sequencing at each landing pad position on day 4. No changes were observed in either case. [Figure 16-3] Figures 15 and 16 show the procedure for successively subculturing strains A to C, each containing up to three landing pads, for four days, and the results of genome sequencing at each landing pad position on day 4. No changes were observed in either case. [Figure 17-1] Figures 17 and 18 show the plasmids used to integrate a fluorescent protein (mScarlet) into multi-landing pad strain C (three landing pads) and the removal of each auxiliary plasmid. The remaining strain lacked antibiotic resistance and retained the cargo. [Figure 17-2] Figures 17 and 18 show the plasmids used to integrate a fluorescent protein (mScarlet) into multi-landing pad strain C (three landing pads) and the removal of each auxiliary plasmid. The remaining strain lacked antibiotic resistance and retained the cargo. [Figure 18-1]Figures 17 and 18 show the plasmids used to integrate a fluorescent protein (mScarlet) into multi-landing pad strain C (three landing pads) and the removal of each auxiliary plasmid. The remaining strain lacked antibiotic resistance and retained the cargo. [Figure 18-2] Figures 17 and 18 show the plasmids used to integrate a fluorescent protein (mScarlet) into multi-landing pad strain C (three landing pads) and the removal of each auxiliary plasmid. The remaining strain lacked antibiotic resistance and retained the cargo. DETAILED DESCRIPTION OF THE INVENTION

[0014] Detailed explanation In order that the present invention may be more readily understood, certain terms are first defined. Additional definitions are set forth throughout the detailed description.

[0015] As used herein, the term "attenuated" refers to bacteria that have been genetically modified to prevent disease in human or animal subjects / models. Thus, in the context of the present invention, this term refers to modifications of Salmonella bacteria to reduce their virulence and render them harmless to the host while maintaining their viability. This method is commonly used in vaccine development due to its ability to induce highly specific immune responses while maintaining an acceptable safety profile. Attenuation can be achieved in many ways, including, but not limited to, in vitro subculture of the pathogen until loss of virulence, chemical mutagenesis, and genetic engineering techniques. The attenuated Salmonella strains disclosed herein are live attenuated Salmonella strains.

[0016] As used herein, the terms "chromosomally integrated" and "chromosomal integration" are used interchangeably and refer to the stable integration of a nucleic acid sequence into the chromosome of a host cell, i.e., Salmonella. Nucleic acid sequences can be integrated into chromosomes using a number of methods. In the context of the present invention, the nucleic acid sequence to be integrated into the chromosome of Salmonella is a "chromosomally integrated synthetic polynucleotide sequence" or a "landing pad" sequence. Preferably, the nucleic acid sequence encoding the "chromosomally integrated synthetic polynucleotide sequence" or "landing pad" sequence is integrated into the chromosome using the classical recombination protocol disclosed in Datsenko and Wanner, 2000 (PNAS, 97(12):6640-6645). Briefly, cells are first transformed with a support plasmid, and then transformed with a dsDNA cassette. The transformant is then cured and removed. The antibiotic introduced during recombination is removed using the protein FLP, which recognizes and removes the FRT element. Integration can then be verified by PCR, designed to yield an amplicon (~500 bp) only if recombination is successful.

[0017] As used herein, the terms "pseudogenomic," "pseudogenic," and "pseudogenomic location" are used interchangeably to refer to the location of an inactive gene or DNA sequence within the host genome, i.e., the genome of the Salmonella bacterium. Such an inactive gene is referred to as a "pseudogene." Pseudogenes are also known as "non-functional" or "non-functional" fragments of DNA. are sometimes called "inactive" regions or segments. The inventors have identified pseudogenes, which are regions of DNA that may or may not have once encoded a functional gene but have since been inactivated by a mutation such as a premature stop codon. Pseudogene regions of DNA are in contrast to intergenic regions of DNA, which are locations of DNA that contain active or functional genes. Intergenic The region can be activated by promoters, terminators, and antisense RNA. The present invention introduces new genes and functionality into pseudogene regions of DNA, This is in contrast to integrating a new gene into an intergenic region, which may have unpredictable side effects of disrupting or otherwise affecting or interfering with surrounding active / functional genes. For the avoidance of doubt, the landing pads disclosed herein are inserted into pseudogenomic regions, i.e., between the stop codon and the start codon within a pseudogene.

[0018] As used herein, the terms "polynucleotide" and "polynucleotide sequence" are used interchangeably to refer to a polymeric compound containing covalently linked nucleic acids. The term "nucleic acid" includes both DNA and RNA.

[0019] As used herein, the terms "polypeptide," "peptide," and "protein" are used interchangeably and refer to polymers of amino acids of any length, which may include coded and non-coded amino acids, chemically or biochemically modified and / or derivatized amino acids.

[0020] As used herein, the term "defined recombination sites" refers to the fact that the Salmonella strains disclosed herein contain short, specific DNA sequences (sites) at which genetic recombination can occur, thus allowing the introduction of heterologous polynucleotide sequences.

[0021] As used herein, the term "genomic locus" refers to the location of a particular gene or synthetic sequence within the genome of a Salmonella bacterium.

[0022] As used herein, the term "predetermined genomic location" refers to the introduction of a synthetic polynucleotide sequence into a specific, pre-planned genomic location in the chromosome of a Salmonella strain. The synthetic polynucleotide sequences of the present invention are not randomly integrated into the bacterial chromosome, as is conventionally done in the art.

[0023] As used herein, the terms "sequence homology" and "sequence identity" are used interchangeably and refer to the percentage of residues in the compared sequences that are the same when the sequences are aligned. To calculate the sequence homology / identity (%) of any of the sequences disclosed herein, the default settings of sequence comparison software, such as the BLAST software package (V2.10.1), can be used.

[0024] As used herein, the term "genetically engineered" refers to bacteria, such as Salmonella, that have been genetically modified or "engineered" to impart changes to naturally occurring cells. Such genetic modifications can be, for example, the incorporation of additional genetic information into the cell, the modification of existing genetic information, or the deletion of existing genetic information. This can be accomplished, for example, by transfecting the cell with a recombinant plasmid or by directly modifying the bacterial genome.

[0025] "Inactivating mutation" refers to a modification of the natural genetic code of a particular gene or the gene promoter associated with that gene, such as a modification by a change in the nucleotide code, deletion of a portion of a nucleotide, or addition of a non-coding or non-natural nucleotide, such that the particular gene is not properly transcribed or translated, or is expressed as an inactive protein, and the original function of the gene is lost or reduced to an unmeasurable extent. Thus, such a mutation in the gene inactivates the function of the gene or the function of the protein encoded by that gene.

[0026] As used herein, the term "transcription strength" refers to the strength of a gene at a particular genomic location in DNA. In the context of the present invention, the term "gene" refers to the extent to which a gene is integrated into a chromosome and is transcribed into RNA. The heterologous polynucleotide sequence is newly introduced into the combined sequence. The transcription intensity can be described as having low or high transcription intensity. Those skilled in the art will readily recognize that the desired transcription intensity depends on the cargo delivered to the subject. For example, there may be situations where it is highly desirable to strictly control the cargo delivered, such as when the cargo delivered is toxic.

[0027] The modified Salmonella strains disclosed herein are designed to allow heterologous genetic material to be easily introduced into the Salmonella strain and then delivered to a target subject in a reliable and efficient manner. In this manner, the strains disclosed herein can function as carrier strains for delivering a variety of different "cargos." Thus, when the strains disclosed herein contain heterologous genetic material, the strains are said to be "recombinant." Accordingly, in one embodiment of the present invention, the modified live-attenuated strains of Salmonella disclosed herein are recombinant strains of Salmonella.

[0028] As used herein, the term "immunogenic" refers to a substance that induces an immune response in a subject. The term "immune response" refers to the action of, for example, lymphocytes, antigen-presenting cells, phagocytes, granulocytes, and soluble macromolecules (including antibodies, cytokines, and complement) produced by the above cells or the liver, resulting in selective damage to, destruction of, or elimination from the body of undesirable cells, such as cancer cells and / or microorganisms associated with infectious diseases.

[0029] The terms "tumor," "cancer," and "neoplasia" are used interchangeably and refer to a cell or population of cells whose growth, proliferation, or survival exceeds that of corresponding normal cells (e.g., a cell proliferative or differentiative disorder). The growth is usually uncontrolled. The term "malignant" refers to invasion of nearby tissues. The term "metastasis" refers to the spread or dissemination of a tumor, cancer, or neoplasia to other sites, locations, or regions within a subject that are distinct from the primary tumor or cancer.

[0030] The term "effective amount" or "pharmaceutically effective amount" refers to an amount of an agent sufficient to provide a desired biological or therapeutic result, i.e., the amount of Salmonella bacteria described herein to achieve a desired effect. The result is the reduction or alleviation of one or more of the signs, symptoms, or causes of disease. The effective amount may be a reduction, amelioration, remission, delay, and / or alleviation of a disease, or other desired change in a biological system. With respect to cancer, an effective amount may include an amount sufficient to shrink a tumor and / or an amount sufficient to reduce the rate of tumor growth (such as an amount sufficient to inhibit tumor growth), or an amount sufficient to prevent or slow the growth of other undesirable cells. In some embodiments, an effective amount is an amount sufficient to delay the onset, prolong survival, or induce stabilization of cancer or a tumor. With respect to infectious diseases, an effective amount may include an amount sufficient to reduce the viral or bacterial load of a subject.

[0031] In some embodiments, a therapeutically effective amount is an amount sufficient to prevent or delay recurrence, which may be particularly advantageous in cancer patients. A therapeutically effective amount is a single dose. or may be administered in multiple doses. In the case of cancer, a therapeutically effective amount of a drug or combination may result in one or more of the following: (i) a reduction in the number of cancer cells; (ii) a reduction in tumor size; (iii) an inhibition, delay, or other adverse events in the invasion of cancer cells into peripheral organs; (iv) inhibiting (i.e., slowing to some extent, and preferably stopping) tumor metastasis; (v) inhibiting tumor growth; (vi) preventing tumor initiation and and / or preventing or delaying recurrence; and / or (vii) alleviating to some extent one or more symptoms associated with the cancer.

[0032] For example, in the case of treating tumors, a "therapeutically effective dose" is one that induces tumor shrinkage of at least about 5%, e.g., at least about 10%, about 20%, about 60%, or more, relative to baseline measurements. A baseline measurement may be obtained from an untreated subject.

[0033] A therapeutically effective amount of a therapeutic compound can reduce or otherwise completely ameliorate symptoms in a subject. One of ordinary skill in the art would be able to determine such an amount based on factors such as the subject's size, the severity of the subject's symptoms, and the particular composition or route of administration selected.

[0034] The terms "vaccine composition" and "vaccine" are used interchangeably and refer to a biological preparation that provides active adaptive immunity against a specific infectious disease. Vaccines typically contain an agent similar to the microorganism that causes the infectious disease, i.e., a "foreign" agent. Such a foreign agent is recognized by the recipient's immune system, which subsequently destroys the agent, developing "memory" against the virus and inducing a level of sustained protection against future viral infections with the same or similar subspecies. It is anticipated that if a vaccinated subject encounters the same microorganism again through a vaccination route involving the vaccine composition of the present invention, the individual's immune system will thereby recognize the microbial isolate and provide more effective protection against infection. The active adaptive immunity induced in a subject as a result of a vaccine may be humoral and / or cellular. In the context of the present invention, a "foreign" agent may be part of a virus, bacterium, fungus, or parasite. Alternatively, a "foreign" agent may be a cancer antigen, e.g., a tumor-associated antigen.

[0035] As used herein, the term "subject" is intended to include humans and non-human animals. The present method is particularly suitable for treating human patients with disorders that can be treated by enhancing the immune response. In certain embodiments, the present method is particularly suitable for treating cancer in vivo.

[0036] The use of alternative statements (e.g., "or") should be understood to mean either one, both, or any combination of the alternative statements. As used herein, the indefinite article "a" or "an" should be understood to refer to "one or more" of any stated or listed components.

[0037] As used herein, "about" means within an acceptable error range for a particular value, as determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, "about" may mean within one standard deviation or more, according to the practice of one of ordinary skill in the art. "About" can mean within or more than one standard deviation. Alternatively, "about" can mean a range of up to 20%. When a specific value is described in the specification and claims, unless otherwise specified, the meaning of "about" should be assumed to be within an acceptable error range for that particular value.

[0038] The present inventors have developed a standardized methodology that allows the introduction of various cargos into specific chromosomal regions of various Salmonella strains. These chromosomal regions have known transcriptional strengths, while at the same time minimizing or eliminating any effect on the viability and / or therapeutic efficacy of the strain. Thus, the engineered strains disclosed herein allow the introduction of cargos with different transcriptional requirements, thereby enabling the use of the strains disclosed herein for a variety of therapeutic applications. Compared to plasmid-based expression systems, this approach offers several advantages, including reduced cell-to-cell variability, reduced metabolic burden, reduced reliance on antibiotic resistance genes, and persistent expression within the strain.

[0039] Thus, in a first aspect, the present invention discloses a modified live attenuated strain of Salmonella, said The strains were integrated onto at least one chromosome inserted at a predetermined pseudogenomic location. a synthetic polynucleotide sequence comprising at least one defined recombination site for introducing a heterologous polynucleotide sequence encoding a polypeptide, The synthetic polynucleotide sequence integrated on the chromosome is any one of SEQ ID NOs: 1 to 30. or at least one locus defined by a sequence comprising at least 70% identity to any one of SEQ ID NOs: 1-30. These loci are detailed in Table 1. .

[0040] The locations of the pseudogenomes of the present invention are provided in Table 1. In one embodiment, the pseudogenomes of the present invention The genomic location comprises 70% sequence identity with the genomic location provided in Table 1. In one embodiment In this case, the pseudogenomic locations of the present invention are 75% aligned with the genomic locations provided in Table 1. In one embodiment, a pseudogenomic location of the present invention comprises 80% sequence identity with a genomic location provided in Table 1. In one embodiment, a pseudogenomic location of the present invention comprises 85% sequence identity with a genomic location provided in Table 1. In one embodiment, a pseudogenomic location of the present invention comprises 80% sequence identity with a genomic location provided in Table 1. In this case, the location of the pseudogenome of the present invention is 90% identical to the location of the genome provided in Table 1. In one embodiment, the location of the pseudogenome of the present invention is provided in Table 1. In one embodiment, a pseudogenomic location of the present invention comprises 95% sequence identity with a genomic location provided in Table 1. In one embodiment, a pseudogenomic location of the present invention comprises 96% sequence identity with a genomic location provided in Table 1. The pseudogenomic locations of the present invention have 97% sequence identity with the genomic locations provided in Table 1. In one embodiment, the location of the pseudogenome of the present invention is provided in Table 1. In one embodiment, a pseudogenomic location of the invention comprises 99% sequence identity with a genomic location provided in Table 1.

[0041] Thus, in one embodiment, a chromosomally integrated synthetic polynucleotide sequence The sequence is any one of SEQ ID NOs: 1 to 30, or at least 75% identity to any one of SEQ ID NOs: 1 to 30; at least 80% identity to any one of SEQ ID NOs: 1 to 30; at least 85% identity to any one of SEQ ID NOs: 1 to 30; at least 90% identity to any one of SEQ ID NOs: 1 to 30; at least 91% identity to any one of SEQ ID NOs: 1 to 30; at least 92% identity to any one of SEQ ID NOs: 1 to 30; at least 93% identity to any one of SEQ ID NOs: 1 to 30; at least 94% identity to any one of SEQ ID NOs: 1 to 30; at least 95% identity to any one of SEQ ID NOs: 1 to 30; at least 96% identity to any one of SEQ ID NOs: 1 to 30 at least 97% identity to any one of SEQ ID NOs: 1 to 30; Located within at least one locus defined by a sequence having at least 98% identity; or at least 99% identity to any one of SEQ ID NOs: 1-30. The synthetic polynucleotide sequence integrated onto the color body comprises at least one sequence defined by any one of SEQ ID NOs: 1 to 30 (i.e., one, more than one, or any combination thereof). It will be understood that the gene may be located within one locus.

[0042] As used herein, the terms "sequence homology" and "sequence identity" are used interchangeably and refer to the number of identical residues over a defined length in a given alignment of DNA, RNA, or amino acid sequences. To calculate the percent sequence identity of any of the sequences disclosed herein, sequence comparison software, such as the BLAST software package, can be used. You can use the default settings of the cage (V2.10.1).

[0043] The "chromosomally integrated synthetic polynucleotide sequence", also called a "landing pad (LP)", allows for the rapid and efficient integration of a desired cargo into a region of known transcriptional strength in the Salmonella genome, thereby enabling controlled delivery of said cargo. The synthetic polynucleotide sequence is inserted into a predetermined pseudogenomic location. As mentioned above, knowing where the sequence will be inserted allows for the precise integration of the introduced cargo. This allows for a high degree of control over subsequent transcription levels, avoiding the unpredictable nature of traditional chromosomal integration methods. Problems with traditional chromosomal integration methods include the possibility that random integration may interfere with host physiology in unpredictable ways, thereby altering the effectiveness of potential therapeutic strains. The sequences of the present invention are directed to at least one The gene is inserted into one pseudogenomic locus, a location in the Salmonella genome where a stretch of DNA previously containing a coding region is present but has been lost due to a mutation, thus silencing the expression of that particular gene.

[0044] The "chromosomally integrated synthetic polynucleotide sequence" or "landing pad" can be integrated into the Salmonella chromosome by any suitable method known to those skilled in the art. In one specific embodiment, the "chromosomally integrated synthetic polynucleotide sequence" or "landing pad" sequence is integrated into the Salmonella chromosome using the classical recombination protocol disclosed in Datsenko and Wanner, 2000 (PNAS, 97(12):6640-6645), in which cells are first transformed with a complementary plasmid and then with a dsDNA cassette. The complementary plasmid is then removed by curing. The recombinantly introduced antibiotic recognizes and removes the FRT element. The FLP-expressing plasmid is then cured and removed.

[0045] For example, a "chromosomally integrated synthetic polynucleotide sequence" or "landing pad" sequence can be introduced into the chromosome of Salmonella by the following method: A support plasmid containing genes beta, gam, and exo can be introduced into Salmonella ZH9 strain by electroporation. LB medium supplemented with appropriate antibiotics and aromatic amino acids can be used. Single clones may be grown overnight in LB medium. Samples may be diluted 1:500 in fresh LB supplemented with antibiotics, amino acids, and arabinose to induce expression of the auxiliary genes. Samples are grown to mid-exponential phase and made electrocompetent. Samples may be electroporated with the double-stranded DNA cassette. Integration may be confirmed by colony PCR using primers outside the integration region. Successful recombinants are characterized by the presence of the plasmid To induce curing, the cells were grown at 43°C without antibiotic selection. This was verified by replica plating single clones on antibiotic-supplemented and antibiotic-free media. Transformation with the plasmid pCP20 (containing FLP) eliminated the final antibiotic resistance gene in the chromosome, resulting in plasmid curing.

[0046] It should be noted that in the context of the present invention, a plasmid is required for both the initial introduction of a "chromosomally integrated synthetic polynucleotide sequence" or "landing pad" sequence into the genome and the initial introduction of the desired cargo into the chromosome. However, the present invention avoids the need to use a plasmid for the Salmonella strain containing the final therapeutic cargo (e.g., a cargo expressing a therapeutic protein). In this latter context, expression is affected by the number of plasmids (which varies within the population), can introduce cellular burden, and typically requires an antibiotic resistance marker. The strains disclosed herein overcome the above drawbacks by having the cargo in the chromosome, since all auxiliary plasmids are cured from the chromosome.

[0047] In one embodiment, the synthetic polynucleotide sequence integrated onto the chromosome is shown in Table 1. It may be located within the sequence of a known gene, which may be selected from the list including ratB, mglA, pbpG, wcaD, wcaK, treA, hvaA, astA, eha, dbpA, Fhue, yceJ, hpcC, fepE, ybbW, ushA, riC, proV, steA, or torA.

[0048] The loci in Table 1 are from Salmonella enterica serovar ) strains, particularly the ZH9 Salmonella strain, although it will be understood that the present invention is not limited by the particular pseudogenes present at these genomic locations in the ZH9 strain. Thus, the present invention also relates to any one of SEQ ID NOS: 1-30, or to any one of SEQ ID NOS: 1-30 at least partially. The present invention provides synthetic polynucleotide sequences that map to at least one locus on a chromosome defined by a sequence that contains at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity. Those skilled in the art will appreciate that while the specific pseudogenes present in Salmonella strains may differ, the genomic regions associated with these regions of inactive DNA will be consistent between different strains. Therefore, each Salmonella strain has the following characteristics: There will be a genomic region containing one of these specific loci, and inactive DNA regions on either side of the locus.

[0049] Jacobsen et al., 2011 (Microb Ecol, 62:487-504) reported the pan-genome sequence of a Salmonella enterica strain. They defined the Salmonella serovar sequences and showed that not only is there high homology between Salmonella strains, but that variation between different strains is primarily found in Salmonella Pathogenicity Islands. Furthermore, the same study went further and showed genes unique to each serovar (see S2 Supplementary Material). None of these identified genes are present in Table 1, demonstrating that the invention disclosed herein can be used to identify various Salmonella serovars. This indicates that the method is applicable to bacterial strains.

[0050] [Table 1]

[0051] The synthetic sequence integrated onto the chromosome contains at least one The recombinant Salmonella strains described herein comprise a recombinant vector containing defined recombination sites. Methods by which this may be achieved are well known to those skilled in the art and can be done, for example, via shuttle plasmids or via split plasmid (shuttle and auxiliary) methodology. Recombination sites are well known in the art and, in the context of the present invention, involve the integration of two different molecules (i.e., a chromosomally integrated recombinant vector in the Salmonella genome) to allow for the integration of heterologous cargo into the modified Salmonella strains described herein. The "cargo" comprises a defined sequence on the heterologous DNA (the vector carrying the heterologous DNA and the synthetic sequence). Alternatively, it may be heterologous RNA.

[0052] The defined recombination sites may be any recombination site suitable for the purposes disclosed herein. Preferably, however, the defined recombination sites are attB recombination sites. Each attB site contains a cleavage region, typically comprising 2 bp, which determines the specificity of the site. For example, the cleavage site may be TT, GC, CT, TA, AT, or CC, all of which are orthogonal in nature. Shuttle vectors containing heterologous cargo to be introduced into the Salmonella genome further contain cognate attP sites flanking the cargo, allowing for insertion in a polar fashion (i.e., attB_TT only reacts with attP_TT) of synthetic sequences inserted into a chromosome within the Salmonella genome.

[0053] Enzymes known as recombinases are required to mediate the recognition of sites on the synthetic sequence integrated on the chromosome with the shuttle vector carrying the cargo. Those skilled in the art will readily appreciate that the recombinase selected will depend on the recombination sites selected. The recombinase selected may be inducible or constitutively expressed. In a preferred embodiment, at least one defined recombination site is an attB recombination site, and the recombinase The recombinase is a serine recombinase. In one embodiment, the serine recombinase is selected from the list comprising PhiC31, Bxbl, TG1, TP901, A118, SPBc, Wβ, PhiBT1, Phi370.1, BL3, FC1, K38, R4, PhiRV or MR11. In a preferred embodiment, the serine recombinase is PhiC31 or Bxb1. In a more preferred embodiment, the serine recombinase is PhiC31. Thus, in one preferred embodiment, the attB recombination site is located at the site of the sequence Another preferred PhiC31 attB recombination site is any one of the PhiC31 attB recombination sites in rows 31 to 36. In an embodiment, the attB recombination site is Bxbl attB of any one of SEQ ID NOs: 37 to 42. As outlined above, shuttle vectors containing heterologous cargo to be introduced into the Salmonella genome further contain cognate attP sites flanking the cargo, allowing for polar insertion of the chromosomally inserted synthetic sequence within the Salmonella genome (i.e., attB_TT only reacts with attP_TT, and attB_GC only reacts with attP_GC).

[0054] The expression of the serine recombinase should be tightly controlled to prevent leaky expression of the recombinase, while also being robust enough to allow reproducible high-throughput loading of cargo into strains. Any expression system that can achieve the above can be used in the present invention. For example, the expression system can be selected from the group including the LacI expression system, the TetR expression system, the BetI expression system, or the PhIF expression system (Meyer et al., Nature Chemical Biology, 15:196-204, 2019). In a preferred embodiment, the expression system is the TetR expression system.

[0055] The synthetic polynucleotide sequence integrated onto the inserted chromosome may further comprise insulator regions flanking (i.e., located on either side of) the defined recombination site. Insulator regions are strong bidirectional terminators and are therefore important for preventing transcription machinery from interfering with the introduced synthetic sequence, and vice versa. As used herein, the term "bidirectional terminator" refers to a polynucleotide sequence that can terminate transcription of RNA polymerase in either the sense or antisense direction. Any insulator region that can achieve the above may be used. Preferably, the insulator region is any one of the sequences of SEQ ID NOs: 43 to 59, or The synthetic sequence integrated onto a chromosome may have a sequence comprising at least 70% identity to the sequence. More preferably, the insulator region may have the sequence of SEQ ID NO: 44 (DT5), SEQ ID NO: 57 (DT101), SEQ ID NO: 56 (DT100), SEQ ID NO: 48 (DT42), or SEQ ID NO: 49 (DT54). In a further preferred embodiment, the synthetic sequence integrated onto a chromosome may be flanked by the insulator regions of SEQ ID NO: 44 (DT5) and SEQ ID NO: 57 (DT101), or sequences comprising at least 70% identity to said sequences. Alternatively, the synthetic sequence integrated onto a chromosome may be flanked by the insulator regions of SEQ ID NO: 56 (DT100) and SEQ ID NO: 44 (DT5), or sequences comprising at least 70% identity to said sequences. Alternatively, the synthetic sequence integrated onto a chromosome may be flanked by the insulator regions of SEQ ID NO: 48 (DT42) and SEQ ID NO: 49 (DT54), or sequences comprising at least 70% identity to said sequences. The insulator region is at least 70%, at least 75%, or both of the sequences of SEQ ID NOs: 43 to 59. , may have a sequence that has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity.

[0056] It should be noted that during preclinical testing and experiments, the synthetic sequence integrated onto the chromosome may also contain an antibiotic marker to select clones that have been successfully integrated. Therefore, two FRT sites located on either side of the antibiotic marker are also present as a way to remove the antibiotic marker upon clone confirmation. In one embodiment, the antibiotic marker is located at the FRT site. The remaining sequence is called the "scar" sequence. The antibiotic marker may be selected from the list including CmR, CarbR or KanR. Thus, in one embodiment, the present invention provides a modified live attenuated strain of Salmonella, said strain comprising a synthetic polynucleotide sequence integrated on at least one chromosome inserted at a predetermined pseudogenomic location, said synthetic polynucleotide sequence being a marker for the Salmonella typhimurium. The nucleotide sequence includes an FRT site, a first attB attachment site located upstream of the FRT site, and a second attB attachment site located downstream of the FRT site, The attB attachment site is located adjacent to the 5' terminator region and the second attB attachment site is located adjacent to the 3' terminator region. The modified live attenuated strain of Salmonella may further comprise an insulator region, as described above.

[0057] To integrate the synthetic sequence into the Salmonella genome, two standardized amplification sites were used. In this method, recombinant overhangs can be added to the 5' and 3' ends of the base sequences specific to each desired location.

[0058] The modified strains disclosed herein contain synthetic polynucleotides integrated on more than one chromosome. The engineered strains disclosed herein may contain two integrated synthetic polypeptides. The modified strains disclosed herein may contain three integrated The modified strains disclosed herein may comprise four integrated The modified strains disclosed herein may comprise five synthetic polynucleotide sequences. The modified strains disclosed herein may comprise six integrated synthetic polynucleotide sequences. In the present disclosure, the engineered strains are derived from three integrated synthetic polynucleotide sequences. Different synthetic polynucleotide sequences may be used to introduce the same type of cargo into different genomic locations (e.g., genomic locations with different transcription strengths) or may be used to introduce multiple types of cargo into the same strain.

[0059] The modified strains disclosed herein may comprise a synthetic polynucleotide sequence integrated onto a single chromosome. In a preferred embodiment, the modified strains disclosed herein may comprise a synthetic polynucleotide sequence of SEQ ID NO: 60 integrated onto a single chromosome. Alternatively, The modified strains disclosed herein may contain multiple synthetic polynucleotide sequences integrated onto a chromosome. To minimize internal recombination events, when the modified strain contains multiple synthetic polynucleotide sequences integrated onto a chromosome, the synthetic sequences may contain different attB sites and / or terminator regions. In a preferred embodiment, the modified strains disclosed herein may contain multiple synthetic polynucleotide sequences integrated onto a chromosome of SEQ ID NO: 60, 61, 62, or any combination thereof.

[0060] Thus, in one embodiment, the synthetic polynucleotide sequence integrated into a chromosome may comprise the sequence of SEQ ID NO: 60, 61, 62, or a sequence comprising at least 70% identity to SEQ ID NO: 60, 61, 62, or any combination thereof. For example, the synthetic polynucleotide sequence integrated onto a chromosome may comprise the sequence of SEQ ID NO: 60, 61, 62, or a sequence comprising at least 75% identity to SEQ ID NO: 60, 61, 62; the synthetic polynucleotide sequence integrated into a chromosome may comprise the sequence of SEQ ID NO: 60, 61, 62, or a sequence comprising at least 80% identity to SEQ ID NO: 60, 61, 62; the synthetic polynucleotide sequence integrated into a chromosome may comprise the sequence of SEQ ID NO: 60, 61, 62, or a sequence comprising at least 85% identity to SEQ ID NO: 60, 61, 62; the synthetic polynucleotide sequence integrated into a chromosome may comprise the sequence of SEQ ID NO: 60, 61, 62, or a sequence comprising at least 90% identity to SEQ ID NO: 60, 61, 62. The synthetic polynucleotide sequence integrated into the chromosome may comprise a sequence of SEQ ID NO: 60, 61, 62, or a sequence having at least 91% identity to SEQ ID NO: 60, 61, 62. The chromosomally integrated synthetic polynucleotide sequence may comprise the sequence of SEQ ID NO: 60, 61, 62, or a sequence comprising at least 92% identity to SEQ ID NO: 60, 61, 62; the chromosomally integrated synthetic polynucleotide sequence may comprise the sequence of SEQ ID NO: 60, 61, 62, or a sequence comprising at least 93% identity to SEQ ID NO: 60, 61, 62; The synthetic polynucleotide sequence integrated into the organism may comprise the sequence of SEQ ID NO: 60, 61, 62, or a sequence comprising at least 94% identity to SEQ ID NO: 60, 61, 62; integrated into the chromosome The synthesized polynucleotide sequence may comprise the sequence of SEQ ID NO: 60, 61, 62, or a sequence comprising at least 95% identity to SEQ ID NO: 60, 61, 62; The synthetic polynucleotide sequence may comprise the sequence of SEQ ID NO: 60, 61, 62, or a sequence comprising at least 96% identity to SEQ ID NO: 60, 61, 62; a synthetic polynucleotide integrated into a chromosome may comprise the sequence of SEQ ID NO: 60, 61, 62. The nucleotide sequence may comprise the sequence of SEQ ID NO: 60, 61, 62, or a sequence comprising at least 97% identity to SEQ ID NO: 60, 61, 62; the synthetic polynucleotide sequence integrated into the chromosome may comprise the sequence of SEQ ID NO: 60, 61, 62, or a sequence comprising at least 98% identity to SEQ ID NO: 60, 61, 62; or the synthetic polynucleotide sequence integrated into the chromosome may comprise the sequence of SEQ ID NO: 60, 61, 62, or a sequence comprising at least 99% identity to SEQ ID NO: 60, 61, 62.

[0061] The engineered strains disclosed herein may comprise the synthetic sequence of SEQ ID NO: 60. The engineered strains disclosed herein may comprise the synthetic sequence of SEQ ID NO: 60 flanked by insulator regions of SEQ ID NOs: 44 and 57. The engineered strains disclosed herein may comprise the synthetic sequence of SEQ ID NO: 61. The engineered strains disclosed herein may comprise the synthetic sequence of SEQ ID NO: 61 flanked by insulator regions of SEQ ID NOs: 56 and 44. The engineered strains disclosed herein may comprise the synthetic sequence of SEQ ID NO: 62. The engineered strains disclosed herein may comprise the synthetic sequence of SEQ ID NO: 62 flanked by insulator regions of SEQ ID NOs: 48 and 49.

[0062] The modified strains disclosed herein may comprise the synthetic sequence of SEQ ID NO: 60 and the synthetic sequence of SEQ ID NO: 61. The modified strains disclosed herein may comprise the synthetic sequence of SEQ ID NO: 60 and the synthetic sequence of SEQ ID NO: 62. The modified strains disclosed herein may comprise the synthetic sequence of SEQ ID NO: 61 and the synthetic sequence of SEQ ID NO: 62. The modified strains disclosed herein may comprise the synthetic sequence of SEQ ID NO: 60, the synthetic sequence of SEQ ID NO: 61 and the synthetic sequence of SEQ ID NO: 62. It may contain columns.

[0063] SEQ ID NOs: 60, 61 and 62 may further comprise an antibiotic marker, as described above. Thus, the modified strains disclosed herein may comprise the synthetic sequence of SEQ ID NOs: 63, 64 or 65.

[0064] As mentioned above, the modified live attenuated strain is Salmonella enterica In a preferred embodiment, the live attenuated strain is a Salmonella enterica serovar Typhi strain. Alternatively, the live attenuated strain may be a Salmonella enterica serovar Typhimurium strain. In one embodiment, the live attenuated strain is Ty21a, CVD 908-htrA, CVD 909, Ty800, M01ZH09 ("ZH9"), x9633, x639, x9640, x8444, ZH9PA, DTY88, MD58, WT05, ZH26, SL7838, SL7207, VNP20009, A1-R, or a combination thereof. In a preferred embodiment, the live attenuated strain is M01ZH09. Attenuated strains are readily available, easily identifiable, and commonly used by those skilled in the art. For example, EP 2 801 364 A1 discloses Ty21a, CVD 908-htrA, CVD 909, Ty800, M01ZH09, χ9633, χ9640, and χ8444. Furthermore, EP 3 917 565 A1 discloses in detail ZH9 strains and their derivatives, including ZH9PA. Further references to these strains can be found in the literature, in particular Petrovska 2004, Hindle 2002, Lehouritis 2017, and Kimura 2010. Furthermore, the use of these strains, including genetically engineered and modified strains, has been described. This also includes derivatives and mutant strains of the strain.

[0065] The Salmonella strains disclosed herein may be genetically engineered, non-naturally occurring bacteria. For example, live attenuated strains may contain an attenuation in the Salmonella pathogenicity island 2 (SPI-2) gene. The vector may contain a virulence-destroying mutation in the first gene, and / or an attenuating mutation in the second gene. Suitable genes and details of such modified strains are as described in WO 2000 / 68261. , the entirety of which is incorporated herein by reference.

[0066] In one embodiment, the SPI-2 gene is an ssa gene. For example, the present invention includes attenuating mutations in one or more of ssaV, ssaJ, ssaU, ssaK, ssaL, ssaM, ssaO, ssaP, ssaQ, ssaR, ssaS, ssaT, ssaD, ssaE, ssaG, ssaI, ssaC, and ssaH. Preferably, the attenuating mutations is in the ssaV or ssaJ gene. More preferably, the attenuating mutation is in the ssaV gene.

[0067] The genetically engineered non-naturally occurring bacterium may also contain an attenuating mutation in a second gene that may or may not be in the SPI-2 region. This mutation may be outside the SPI-2 region, The present invention provides a method for the detection of a gene that is involved in the biosynthesis of aromatic compounds. In a preferred embodiment, the aro gene is aroA or aroC. Most preferably, the aro gene is aroC.

[0068] In yet another embodiment, the genetically engineered non-naturally occurring bacterium may be from a Salmonella species and may comprise an inactivation in one or more genes selected from pltA, pltB, cdtB, and ttsA. and a genotyping mutation, wherein the genotyping mutation is one selected from aroA and / or aroC and / or ssaV. The vector may further comprise attenuating mutations in the above genes, details of which are described in WO2019 / 110819, the entire contents of which are incorporated herein by reference.

[0069] It is contemplated that inactivating mutations (e.g., deletions) in the genes pltA, pltB, and cdtB prevent Salmonella species from producing typhoid toxin, and that inactivating mutations (e.g., deletions) in ttsA prevent Salmonella species from secreting typhoid toxin. It is contemplated that the non-naturally occurring bacteria are particularly derived from Salmonella enterica.

[0070] As will be understood by those skilled in the art, genes can be mutated by many methods well known in the art, such as homologous recombination using a recombinant plasmid targeting the gene of interest. In this case, an engineered gene homologous to the target gene is incorporated into an appropriate nucleic acid vector (such as a plasmid or bacteriophage) and transfected into a target cell. The homologous engineered gene is then recombined with the native gene to replace or mutate it to achieve the desired inactivation mutation. Such modifications may be in the coding portion of the gene or in a regulatory portion such as the promoter region. As will be understood by those skilled in the art, any suitable genetic modification technology can be used to mutate a gene of interest, such as a CRISPR / Cas system, for example, CRISPR / Cas9, TALENS, etc.

[0071] Thus, numerous methods and techniques for genetically engineering bacterial strains will be familiar to those skilled in the art. These techniques include those necessary for introducing heterologous genes into bacteria via chromosomal integration or through the introduction of stable, autosomal, self-replicating genetic elements. Exemplary methods for genetically modifying (also referred to as "transformation" or "engineering") bacterial cells include bacteriophage infection, transduction, conjugation, lipofection, or electroporation. A general discussion of these and other methods in molecular and cellular biochemistry can be found in Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., Harvard Laboratory Press 2001); Short Protocols in Molecular Biology, 4th Ed. (Ausubel et al., 2001); al. eds., John Wiley & Sons 1999); Protein Methods (Bollag et al., John Wiley & Sons 1999); Sons 1996).

[0072] The predetermined genomic location into which the chromosomally integrated synthetic polynucleotide sequence is inserted may be a genomic location with low or high transcription intensity. In some embodiments, the predetermined genomic location is a genomic location with low transcription intensity. In some embodiments, the predetermined genomic location is a genomic location with high transcription intensity. One skilled in the art will readily recognize that the location of transcription intensity depends on the cargo being delivered. For example, if the cargo being delivered may be inherently toxic, it may be desirable to insert it into a region of the genome with low transcription intensity in order to more tightly control its delivery. On the other hand, if the cargo being delivered requires high levels of expression to be effective and / or has minimal associated adverse effects, it may be more desirable to insert it into a region of the genome with high transcription intensity.

[0073] The present invention allows for the integration of a cargo of interest into the genome of Salmonella bacteria and its delivery to a subject in need thereof. Therefore, the cargo can be a variety of different molecules or compounds, depending on the needs of the subject. The cargo can be therapeutic or non-therapeutic. For example, the heterologous polynucleotide sequence can be a DNA or RNA sequence encoding an immunogenic or therapeutic compound, such as a cancer therapeutic. Alternatively, the heterologous polynucleotide sequence can be a DNA or RNA sequence encoding a protein associated with bacterial function or the ability of the bacterium to act as a delivery vehicle. For example, the heterologous polynucleotide sequence can encode a protein required for normal transduction. The heterologous polynucleotide sequence can be an RNA molecule intended for delivery to a target cell, where it is translated into a protein via the cellular machinery of the host cell, e.g., a mammalian cell. The heterologous polynucleotide sequence can encode a protein associated with lysis of the bacterial cell to release either the RNA molecule or the desired protein. When the heterologous polynucleotide sequence is an RNA sequence, the RNA molecule can be an mRNA molecule. When the heterologous polynucleotide sequence is an RNA sequence, the RNA molecule can be an siRNA molecule. When the heterologous polynucleotide sequence is an RNA sequence, the RNA molecule can be an RNA sequence. The molecule may be an shRNA molecule. When the heterologous polynucleotide sequence is an RNA sequence, the RNA The molecule may be an miRNA molecule.

[0074] In a preferred embodiment, the heterologous polynucleotide sequence may encode an immunogenic compound or a cancer therapeutic agent. The term "immunogenic compound" refers to any compound that induces an immune response in a subject in need thereof. For example, the immunogenic compound may be an antigen derived from bacteria, viruses, fungi, or parasites, which initiates an immune response in the subject against that specific antigen. Alternatively, the immunogenic compound may be a tumor-associated antigen. A tumor-associated antigen is an antigenic substance produced by tumor cells that induces an immune response in the subject. Thus, the present invention may be a cancer vaccine, which comprises the modified strain disclosed herein, wherein the modified strain comprises a polynucleotide sequence encoding the tumor-associated antigen.

[0075] Tumor-associated antigens include CD133, CD138, BCMA (B cell maturation antigen), and EGFR (epidermal growth factor receptor). ), EpCAM (epithelial cell adhesion molecule), GD2, GPC3, HER2, HerinCAR-PD1, MSLN (mesothelin), MG7, MUC1, LMP1, PSMA (prostate-specific membrane antigen), PSCA (prostate stem cell antigen), Alf afetoprotein (AFP), carcinoembryonic antigen (CEA), CA-125, epithelial tumor antigen (ETA), It may be selected from the list including tyrosinase, melanoma associated antigen (MAGE) and p53. Alternatively, the heterologous polynucleotide sequence may encode a cancer therapeutic agent.

[0076] Those skilled in the art will readily recognize that the particular cancer therapeutic to be encoded will depend on the specific needs of the subject being treated. For example, the cancer therapeutic can encode a therapeutic antibody. As used herein, the term "therapeutic antibody" includes whole antibodies and any antigen-binding fragments (i.e., antigen-binding portions) or single chains thereof that provide a therapeutic effect. In one embodiment, the therapeutic antibody can be a monoclonal antibody. As used herein, the term "monoclonal antibody" refers to a preparation of antibody molecules of single molecular composition. A monoclonal antibody composition exhibits a single binding specificity and affinity for a particular epitope. The monoclonal antibody can be a human or humanized antibody. Alternatively, the cancer therapeutic can be a cytokine or chemokine intended to modulate the immune system of a subject in need thereof.

[0077] Larger DNA / RNA constructs can be introduced into the Salmonella chromosome using synthetic polynucleotide sequences that are chromosomally integrated into the genome of Salmonella strains. The polynucleotide can have a size ranging from 1 Kbp to 10 Kbp. The heterologous polynucleotides can have a size range of 1 Kbp to 2 Kbp, the heterologous polynucleotides can have a size range of 1 Kbp to 3 Kbp, and the heterologous polynucleotides can have a size range of 1 Kbp to 4 Kbp. The heterologous polynucleotides can have a size range of 1 Kbp to 5 Kbp, the heterologous polynucleotides can have a size range of 1 Kbp to 6 Kbp, and the heterologous polynucleotides can have a size range of 1 Kbp to 7 Kbp. The heterologous polynucleotides can have a size range of 1 Kbp to 8 Kbp, the heterologous polynucleotides can have a size range of 1 Kbp to 9 Kbp, and the heterologous polynucleotides can have a size range of 2 Kbp to 3 Kbp. The heterologous polynucleotides can have a size range of 2 Kbp to 4 Kbp, the heterologous polynucleotides can have a size range of 2 Kbp to 5 Kbp, and the heterologous polynucleotides can have a size range of 2 Kbp to 6 Kbp. The heterologous polynucleotide can have a size ranging from 2 Kbp to 7 Kbp, the heterologous polynucleotide can have a size ranging from 2 Kbp to 8 Kbp, the heterologous polynucleotide can have a size ranging from 2 Kbp to 9 Kbp, the heterologous polynucleotide can have a size ranging from 2 Kbp to 10 Kbp, 3 Kbp to 4 Kbp. The heterologous polynucleotide may have a size ranging from 3 Kbp to 5 Kb. and the heterologous polynucleotide may have a size in the range of 3 Kbp to 6 Kbp. The heterologous polynucleotide can have a size ranging from 3 Kbp to 7 Kbp, the heterologous polynucleotide can have a size ranging from 3 Kbp to 8 Kbp. The heterologous polynucleotide can have a size ranging from 3 Kbp to 9 Kbp, the heterologous polynucleotide can have a size ranging from 3 Kbp to 10 Kbp, and the heterologous polynucleotide can have a size ranging from 4 Kbp to 5 Kbp. The heterologous polynucleotide can have a size ranging from 4 Kbp to 6 Kbp, the heterologous polynucleotide can have a size ranging from 4 Kbp to 7 Kbp, the heterologous polynucleotide can have a size ranging from 4 Kbp to 8 Kbp. The heterologous polynucleotide can have a size ranging from 4 Kbp to 9 Kbp, the heterologous polynucleotide can have a size ranging from 4 Kbp to 10 Kbp, the heterologous polynucleotide can have a size ranging from 5 Kbp to 6 Kbp. The heterologous polynucleotide can have a size ranging from 5 Kbp to 7 Kbp, the heterologous polynucleotide can have a size ranging from 5 Kbp to 8 Kbp, and the heterologous polynucleotide can have a size ranging from 5 Kbp to 9 Kbp. The heterologous polynucleotide can have a size ranging from 5 Kbp to 10 Kbp, the heterologous polynucleotide can have a size ranging from 6 Kbp to 7 Kbp, and the heterologous polynucleotide can have a size ranging from 6 Kbp to 8 Kbp. The heterologous polynucleotide can have a size ranging from 6 Kbp to 9 Kbp, and the heterologous polynucleotide can have a size ranging from 6 Kbp to 10 Kbp. The heterologous polynucleotide can have a size ranging from 7 Kbp to 8 Kbp, the heterologous polynucleotide can have a size ranging from 7 Kbp to 9 Kbp, the heterologous polynucleotide can have a size ranging from 7 Kbp to 10 Kbp, the heterologous polynucleotide can have a size ranging from 8 Kbp to 9 Kbp. The heterologous polynucleotide can have a size ranging from 8 Kbp to 10 Kbp. or the heterologous polynucleotide may have a size in the range of 9 Kbp to 10 Kbp. In a preferred embodiment, the heterologous polynucleotide may have a size in the range of 1 Kbp to 2 Kbp.

[0078] In a second aspect, the present invention provides a vaccine composition comprising the modified live attenuated bacterial strain disclosed herein. The vaccine composition may be a cancer vaccine. The vaccine composition may be a viral vaccine or a bacterial vaccine.

[0079] The vaccine composition may further comprise a pharmaceutically acceptable carrier, excipient, or adjuvant. The phrase "pharmaceutically or pharmacologically acceptable" refers to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when appropriately administered to an animal, e.g., a human. Such preparations will be known to those skilled in the art. Furthermore, it will be understood that for administration to an animal (e.g., a human), preparations should meet sterility, pyrogenicity, general safety, and purity standards, as applicable.

[0080] As used herein, "pharmaceutically acceptable carriers, excipients, or adjuvants" includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents, etc.), isotonicity agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegrants, lubricants, sweeteners, flavoring agents, dyes, and the like, as well as combinations thereof, as known to those skilled in the art (see, e.g., Remington's Pharmaceutical Sciences, 18th Ed., Mack Printing Company, 1990, pp. 1289-1329). Examples include, but are not limited to, disodium hydrogen phosphate, soybean peptone, potassium dihydrogen phosphate, ammonium chloride, sodium chloride, magnesium sulfate, calcium chloride, sucrose, borate buffer, sterile saline (0.9% NaCl), and sterile water.

[0081] In a third aspect, the present invention provides a modified live attenuated bacterial strain as disclosed herein for use in the prevention or treatment of cancer.

[0082] The modified live attenuated bacterial strains disclosed herein can be used to prevent, treat, or delay recurrence of neoplastic diseases associated with solid tumors or hematological malignancies. Such diseases include sarcoma, carcinoma, adenocarcinoma, melanoma, myeloma, blastoma, glioma, lymphoma, or leukemia. In a preferred embodiment, the neoplastic disease is associated with a solid tumor. In a specific aspect, the neoplastic disease is prostate cancer, liver cancer, kidney cancer, lung cancer, breast cancer, colorectal cancer, bladder cancer, pancreatic cancer, brain cancer, liver cancer, lymphoma, leukemia, gastric cancer, cervical cancer, or The disease is associated with a cancer selected from: ovarian cancer, thyroid cancer, melanoma, carcinoma, head and neck cancer, skin cancer, or sarcoma.

[0083] Neoplasms, tumors, and cancers include benign, malignant, metastatic, and non-metastatic types, and neoplasms of any stage (I, II, III, IV, or V) or grade (G1, G2, G3, etc.); This includes tumors, or cancers, or neoplasms, tumors, cancers, or metastases that are progressing, worsening, stabilized, or in remission. In one embodiment, the neoplastic disease is benign. In another embodiment, the neoplastic disease is malignant. In another embodiment, the neoplastic disease is metastatic. In another embodiment, the neoplastic disease is non-metastatic.

[0084] Cancers that may be treated according to the present invention include, but are not limited to, bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, gastrointestinal, gingival, head, kidney, liver, lung, nasopharynx, cervix, ovary, prostate, skin, stomach, testis, tongue, or uterine cells or neoplasms. Additionally, the cancer may be of the following histological types, among others, but is not limited to: neoplasm, malignant; carcinoma; undifferentiated; giant cell and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilonidal carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrinoma; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma; cavernous adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in adenomatous polyps; familial polyposis coli adenocarcinoma; solid tumors; malignant carcinoma. Lutinoid tumor; Bronchoalveolar adenocarcinoma; Papillary adenocarcinoma; Chromocell carcinoma; Eosinophilic carcinoma; Eosinophilic adenocarcinoma; Basophilic carcinoma; Clear cell adenocarcinoma; Granular cell carcinoma; Follicular adenocarcinoma; Papillary and follicular adenocarcinoma; Non-encapsulated sclerosing carcinoma; Adrenal cortical carcinoma; Endometrial carcinoma; Skin adnexal carcinoma; Apocrine adenocarcinoma; Sebaceous gland carcinoma; Ear adenocarcinoma; Mucoepidermoid carcinoma; Bladder adenocarcinoma; Papillary bladder adenocarcinoma; Papillary serous bladder adenocarcinoma; Mucinous bladder adenocarcinoma; Mucinous adenocarcinoma; Signet ring cell carcinoma; Invasive ductal carcinoma; Medullary carcinoma; Lobular carcinoma; Inflammatory carcinoma; Paget's disease of the breast; Apical Squamous cell carcinoma; Adenocarcinoma with squamous metaplasia; Thymoma (malignant); Ovarian stromal tumor (malignant); Sarcoma (malignant); Granulosa cell tumor (malignant); Androblastoma (malignant); Sertoli cell carcinoma; Leydig cell tumor (malignant); Lipid cell tumor (malignant); Paraganglioma (malignant); Malignant extramammary paraganglioma; Pheochromocytoma; Angiosarcoma; Malignant melanoma; Amelanotic melanoma; Superficial spreading melanoma; Malignant melanoma in giant pigmented nevus; Epithelioid cell melanoma; Malignant blue nevus; Sarcoma; Fibrosarcoma; Malignant fibrous histiocytoma; Myxosarcoma;Liposarcoma;Leiomyosarcoma;Rhabdomyosarcoma;Embryonic rhabdomyosarcoma;Alveolar rhabdomyosarcoma;Stromatous sarcoma;Mixed tumor;Müllerian mixed tumor;Nephroblastoma;Hepatoblastoma;Carcinosarcoma;Mesenchymoma (malignant);Brenner tumor (malignant);Philodes tumor (malignant);Synovial sarcoma;Mesothelioma (malignant);Embryonic carcinoma;Teratoma (malignant);Ovarian adenoma (malignant);Choriocarcinoma;Malignant mesostosis;Angiosarcoma;Malignant hemangioendothelioma;Kaposi's sarcoma;Malignant hemangiopericytoma;Lymphangiosarcoma;Osteosarcoma;Paddy cortical osteosarcoma;Chondrosarcoma;Malignant chondroblastoma;Mesenchymal chondrosarcoma;Giant cell tumor of bone;Ewing's sarcoma; Odontogenic tumor (malignant); Ablastic odontogenic tumor; Ablastic fibrosarcoma; Pinealoma (malignant); Chordoma; Glioma (malignant); Ependymoma; Astrocytoma; Protoplasmic astrocytoma; Fibrous astrocytoma; Astrocytoblastoma; Glioblastoma; Oligodendroglioma; Oligodendroglioma; Primitive neuroectodermal; Cerebellar sarcoma; Ganglioneuroblastoma; Neuroblastoma; Retinoblastoma; Olfactory neurogenic tumor; Meningioma, malignant; Neurofibrosarcoma; Schwannoma, malignant; Granular cell tumor, malignant; Malignant lymphoma; Hodgkin's disease; Hodgkin's ;paragranulomatous;malignant lymphoma, small lymphocytic;malignant lymphoma, large cell, diffuse;malignant lymphoma, follicular;mycosis fungoides;other specified non-Hodgkin's lymphoma;malignant histiocytosis;multiple myeloma;mast cell sarcoma;immunoproliferative small intestinal disease;leukemia;lymphocytic leukemia;plasma cell leukemia;erythroid leukemia;lymphosarcomatous cell leukemia;myeloid leukemia;basophilic leukemia;eosinophilic leukemia;monocytic leukemia;mast cell leukemia;megakaryoblastic leukemia;myeloid sarcoma;and hairy cell leukemia.;

[0085] In a preferred embodiment, the cancer is prostate cancer, liver cancer, kidney cancer, lung cancer, breast cancer, colorectal cancer, bladder cancer, pancreatic cancer, brain tumor, hepatocellular carcinoma (liver cancer), lymphoma, leukemia, gastric cancer, cervical cancer, ovarian cancer, thyroid cancer, melanoma, carcinoma, head and neck cancer, skin cancer, In a more preferred embodiment, the cancer is selected from lung cancer, renal cancer, bladder cancer, ovarian cancer, liver cancer, gastric cancer, colorectal cancer, head and neck cancer, or breast cancer.

[0086] In a fourth aspect, the present invention provides a modified live attenuated bacterial strain as disclosed herein for use in the treatment of an infectious disease, which may be caused by a virus, bacteria, fungus, or parasite.

[0087] In a fifth aspect, the present invention provides a modified live attenuated bacterial strain as disclosed herein for use in the treatment of an autoimmune disease or disorder.

[0088] Thus, the present invention can be used to achieve therapeutic benefit in a subject in need thereof. A therapeutic benefit or beneficial effect is an objective or subjective, transient, temporary, or long-term improvement in a condition or pathology associated with or resulting from cell proliferation or a cell hyperproliferative disorder, such as a neoplasm, tumor, or cancer, or metastasis, infectious disease, or autoimmune disease / disorder, or a reduction in the onset, severity, duration, or frequency of adverse symptoms, which may lead to improved survival. A satisfactory clinical endpoint of a therapeutic method according to the present invention can be, for example, the reduction of one or more associated pathologies, adverse symptoms, or complications. Achieving a therapeutic effect is achieved when there is an incremental or partial reduction in the severity, duration, or frequency of a disease or when there is an inhibition or reversal of one or more physiological, biochemical, or cytological symptoms or characteristics of a cell proliferation or cell hyperproliferative disorder such as a neoplasm, tumor, or cancer, or metastasis, or a characteristic of an infectious disease, or a characteristic of an autoimmune disease / disorder. Thus, a therapeutic benefit or improvement in the context of cancer includes, but is not limited to, the destruction of target proliferating cells (e.g., neoplasm, tumor, or cancer, or metastasis), or the elimination of one or more of most or all pathologies, adverse symptoms, or complications associated with or resulting from cell proliferation or a cellular hyperproliferative disorder, such as a neoplasm, tumor, or cancer, or metastasis. However, a therapeutic benefit or improvement need not be a cure or complete destruction of all target proliferating cells (e.g., neoplasm, tumor, or cancer, or metastasis), or the elimination of all pathologies, adverse symptoms, or complications associated with or resulting from cell proliferation or a cellular hyperproliferative disorder, such as a neoplasm, tumor, or cancer, or metastasis. For example, partial destruction of a tumor or cancer cell mass, or stabilization of tumor or cancer cell mass, size, or cell number by inhibiting tumor or cancer progression or progression, can reduce mortality and extend lifespan, even if only for a few days, weeks, or months, even if some or most of the tumor or cancer cell mass, size, or cells remain. A therapeutic benefit or improvement in the context of an infectious disease may be, but is not limited to, a reduction in viral, bacterial, fungal or parasitic load. A therapeutic benefit or improvement in the context of an autoimmune disease / disorder may be, but is not limited to, a reduction in inflammatory markers or a reduction in autoantibody titers.

[0089] The live attenuated Gram-negative bacteria can be administered orally. As used herein, the terms "oral" or "orally administered" are used interchangeably and mean that the Salmonella bacteria are administered through the mouth of a subject in need thereof. However, it is contemplated that other methods of administration may be used in some cases. Thus, in certain embodiments, the live modified attenuated Salmonella bacteria of the present invention are administered by injection, infusion, continuous infusion, intravenously, intradermally, intraarterially, intravaginally, intrarectally, intramuscularly, intraperitoneally, subcutaneously, subconjunctivally, intramucosally, intrapericardially, intraumbilically, intraocularly, intracranially, intraarticularly, intravesically, intrathoracically, intratracheally, intranasally, via a catheter, via lavage, or by any other method or any combination thereof that would be known to one of skill in the art (e.g., Remington's Pharmaceuticals, Inc.). Sciences, 18th Ed. Mack Printing Company, 1990. Alternatively, in the context of treating neoplastic disease, the preferred routes of administration are intratumoral and peritumoral.

[0090] In one embodiment, the engineered strains disclosed herein may be administered in combination with another therapeutic agent, which will depend on the disease being treated. For example, the engineered strains may be administered in combination with immunotherapy, chemotherapy, radiation therapy, antiviral therapy, antibacterial therapy, antifungal therapy, or antiparasitic therapy. Chemotherapeutic agents include, but are not limited to, alkylating agents, plant alkaloids, antitumor antibiotics, antimetabolites, and / or topoisomerase inhibitors, or combinations thereof. In a preferred embodiment, the immunotherapy involves checkpoint inhibitors, antigen-specific T cells, therapeutic antibodies, or cancer vaccines.

[0091] The immunotherapy may be a checkpoint inhibitor, and as used herein, the term "checkpoint inhibitor" refers to a blocker against a checkpoint molecule. The blocker may be an antagonist, inhibitor, or blocking antibody. Thus, the blocker may be a small molecule or a biologic agent, and in certain embodiments, is a monoclonal antibody. In preferred embodiments, the checkpoint inhibitor is directed against CTLA-4, PD-1, PD-L1, LAG-3, TIM-3, BTLA, TIGIT, VISTA, or any combination thereof. .

[0092] A checkpoint inhibitor may be a therapeutic antibody directed against a specific cancer or tumor in a subject in need thereof. In certain embodiments, the therapeutic antibody may be a monoclonal antibody, more preferably a humanized or human monoclonal antibody. Methods for obtaining such monoclonal antibodies are known to those skilled in the art. Therapeutic antibodies may block abnormal proteins in cancer cells, bind to specific proteins on cancer cells, or be conjugated to cytotoxic molecules such as anticancer drugs. The latter flag cancer cells to the immune system, allowing the abnormal cells to be targeted and destroyed by cellular components of the immune system. Examples of monoclonal antibodies that are checkpoint inhibitors include, but are not limited to, ipilimumab (Yervoy®), nivolumab (Opdivo®), and pembrolizumab (Keytruda®).

[0093] In another embodiment, the immunotherapy may be adoptive cell therapy, in which immune cells are transferred into a patient / subject, most commonly for improved functionality or characteristics. The transferred cells may be derived from the subject (autologous) or from another subject (allogeneic). Examples of such adoptive cell therapies include, but are not limited to, engineered or non-engineered macrophages, engineered or non-engineered γδ T cells, engineered or non-engineered natural killer cells, etc. Thus, adoptive cell therapies include tumor infiltrating lymphocyte (TIL) therapy, engineered T cell receptor (TCR) therapy, and These include, but are not limited to, erythropoietin and / or natural killer (NK) cell therapy, details of which will be known to those skilled in the art (Adoptive cellular therapies: the current landscape, Rohaan et al. 2019, Virchows Arch. 474(4):449-461).

[0094] The immunotherapy may be CAR T cell therapy. CAR T cell therapy may be allogeneic or autologous. In one embodiment, CAR T cell therapy may be directed against the antigen CD19 present in cancers of B-cell origin. Thus, such therapy may be used to treat acute lymphoblastic leukemia (ALL) and other cancers. This may be particularly suitable for B-cell derived cancers such as de novo large B-cell lymphoma (DLBCL). In other embodiments, the CAR T cell therapy is directed against a tumor-associated antigen (TAA) and is therefore more suitable for the treatment of solid tumors. Examples of such antigens include, but are not limited to, CD133, CD138, BCMA, CEA, EGFR, EpCAM, GD2, GPC3, HER2, HerinCAR-PD1, MSLN, MG7, MUC1, LMP1, PSMA, and PSCA. Such techniques are known to those skilled in the art, and for further information, the reader is directed to the review article entitled "Adoptive cellular therapies: the current landscape" (Rohaan et al. 474(4):449-461).

[0095] The additional therapeutic agent may be administered before the modified Salmonella strains disclosed herein. The additional therapeutic agent may be administered after the modified Salmonella strains disclosed herein. The additional therapeutic agent may be administered substantially simultaneously with the modified Salmonella strains disclosed herein. When the modified Salmonella strains disclosed herein are intended to be administered to activate a subject's immune system, the strain is preferably administered before the administration of the additional therapeutic agent. Thus, the modified Salmonella strain may act as a priming agent. The modified Salmonella strain and the additional therapeutic agent may act in an additive or synergistic manner to improve clinical outcomes in subjects in need thereof.

[0096] In a sixth aspect, the present invention provides a method of treating, inhibiting or controlling a neoplastic or infectious disease in a subject, the method comprising administering to the subject a live, attenuated modified strain of Salmonella, said strain comprising at least one nucleotide sequence inserted at a predetermined pseudogenomic location. a synthetic polynucleotide sequence integrated onto a chromosome, said sequence having at least one defined recombination site for introducing a heterologous polynucleotide sequence encoding a polypeptide; The synthetic polynucleotide sequences which contain the insertion site and are integrated onto the chromosome are SEQ ID NOs: 1 to 30. or located within at least one locus defined by a sequence comprising at least 70% identity to any one of SEQ ID NOs: 1 to 30.

[0097] In one embodiment, the synthetic polynucleotide sequence integrated onto the chromosome is any one of SEQ ID NOs: 1 to 30, or at least 75% identity to any one of SEQ ID NOs: 1 to 30; at least 80% identity to any one of SEQ ID NOs: 1 to 30; At least 85% identity to any one of SEQ ID NOs: 1 to 30; at least 90% identity; at least 91% identity to any one of SEQ ID NOs: 1 to 30; at least 92% identity to any one of SEQ ID NOs: 1 to 30; at least 93% identity to any one of SEQ ID NOs: 1 to 30; at least 94% identity to any one of SEQ ID NOs: 1 to 30; at least 95% identity to any one of SEQ ID NOs: 1 at least 96% identity to any one of SEQ ID NOs: 1 to 30; at least 96% identity to any one of SEQ ID NOs: 1 to 30; at least 97% identity to any one of SEQ ID NOs: 1 to 30; at least 98% identity to any one of SEQ ID NOs: 1 to 30; or 1. A minority group defined by a sequence containing at least 99% identity to any one of 1 to 30 Located within at least one genomic locus.

[0098] In a seventh aspect, the present invention provides a method for modifying a live attenuated strain of Salmonella, said method comprising inserting a synthetic polynucleotide sequence into a predetermined pseudogenomic location of a live attenuated strain of Salmonella, said sequence comprising at least one defined recombination site for introducing a heterologous polynucleotide sequence encoding a polypeptide, said sequence comprising at least one defined recombination site for introducing a heterologous polynucleotide sequence encoding a polypeptide, The synthetic polynucleotide sequence incorporated into the vector is any one of SEQ ID NOs: 1 to 30, or is located within at least one locus defined by a sequence containing at least 70% identity to any one of SEQ ID NOs: 1-30 (Table 1).

[0099] In one embodiment, the chromosomally integrated synthetic polynucleotide sequence is located within at least one genomic locus defined by any one of SEQ ID NOs: 1-30. or at least 75% identity to any one of SEQ ID NOs: 1 to 30; SEQ ID NOs: 1 to 30 at least 80% identity to any one of SEQ ID NOs: 1 to 30; At least 85% identity; at least 90% identity to any one of SEQ ID NOs: 1 to 30; at least 91% identity to any one of SEQ ID NOs: 1 to 30 At least 92% identity to any one of SEQ ID NOs: 1 to 30; at least 93% identity to any one of SEQ ID NOs: 1 to 30; at least 94% identity to any one of SEQ ID NOs: 1 to 30; at least 95% identity to any one of SEQ ID NOs: 1 to 30 at least 96% identity to any one of SEQ ID NOs: 1 to 30; at least 96% identity to any one of SEQ ID NOs: 1 to 30; at least 97% identity to any one of SEQ ID NOs: 1 to 30; at least 98% identity to any one of SEQ ID NOs: 1 to 30; or The sequences are located within at least one genomic locus defined by a sequence comprising at least 99% identity to one of the sequences.

[0100] Defined recombination sites are present in the synthetic polynucleotide sequence. The appropriate recombination sites are present to allow the introduction of cargo into the landing pad after integration onto the chromosome. The landing pad of the present invention may contain a specific attB recombination site previously introduced into the genome at a pseudogenomic location. The payload may be surrounded by attP recombination sites that specifically react with specific attB sequences in the genome. Two or more attB sequences in the genome If present, the payload will only be inserted into the matching attB sequence.

[0101] The present inventors have surprisingly found that a method for the preparation of Salmonella strains is to introduce at least one chromosomally integrated synthetic polynucleotide inserted into a predetermined pseudogenomic location in the Salmonella strain. We found that by using this method, we could efficiently and easily integrate desired cargoes of interest into the chromosome of Salmonella strains in regions where gene expression has been previously characterized (allowing for control of transcriptional intensity). Furthermore, we demonstrated that modifying Salmonella strains in this manner does not affect their growth, viability, or potential downstream therapeutic effects. [Example]

[0102] The invention will now be further described with reference to the following non-limiting examples.

[0103] Example 1: Validation of the ZH9 strain genome and computational selection of landing pad locations The ZH9 Salmonella strain obtained from Glycerol Master Stock was grown in vLBaro medium at 37°C and 200 rpm for 8 consecutive days, with subculture every 12 hours. Aliquots were taken on days 1 and 8, and the genome was subsequently sequenced. This allows for the evaluation of the genome sequence of strain ZH9 with or without the landing pad sequence. A working protocol was established.

[0104] The genome sequence of ZH9 was aligned with the reference genome (Ty21a Salmonella strain) and the differences were analyzed (see Figure 1). As expected, major differences were found in the aroC and ssaV genes. Other minor differences were also identified, but these did not affect known / characterized genetic elements.

[0105] Following the establishment of the reference genome, the locations of 218 pseudogenomes in the chromosome were identified (see Figure 2). Specific pseudogenomes were then identified that had known transcription strengths and were therefore particularly useful for the insertion of heterologous cargo.

[0106] Example 2: Design of landing pad sequences and integration into the Salmonella chromosome The landing pad DNA sequence contains an antibiotic marker for selecting clones that have successfully integrated. Car (CmR), two FRT sites for marker removal during clone confirmation, integrated into chromosome Two PhiC31 attB sites (containing unique TT and TC cleavage sites) used to integrate any cargo into the designated landing pad, and two insets containing strong terminators to avoid transcriptional readthrough from the genome affecting the integrated cargo. The recombinant overhangs were added specifically to the desired locations using two standardized amplification sites (5' and 3') (see Figure 3).

[0107] On positions t0483, t0889, t1243, t1607, t2152, t2560, t3159, t3720, and t3930 Small-scale experiments were performed using landing pad amplicons with overhangs. Integration was verified by PCR reactions designed to yield amplicons (~500 bp) only if recombination was successful (see Figure 4). Optimization of integration conditions using landing pad amplicons with overhangs at the t2560 position. To evaluate optimal integration conditions, OD 600 Cells were concentrated from ~0.6 to 100- or 300-fold and electroporated with 250 ng or 500 ng of DNA. The successful integration was assessed using primers that matched the primers. The best conditions were found to be 500 ng of DNA for 100x cells (see Figure 5).

[0108] Seventy-two ZH9 mutant strains were generated, each containing one nucleotide at the pseudogene location verified by colony PCR. The landing pad sequence was found on the ZH9 chromosome. They were scattered (see Figure 6).

[0109] To remove the auxiliary plasmid after recombination, cells were grown at 42°C for 16 hours and then replica-plated onto antibiotic (kanamycin) or non-selective media. Cells that had successfully removed the auxiliary plasmid were shown to grow only on "no antibiotic" plates (see Figure 7).

[0110] Example 3: Effect of landing pads on Salmonella growth Samples were cultured in either complex (vegan lysogeny broth) or minimal (M9) media at 37°C for 12 hours. No significant differences were observed in the growth curves of all strains in either rich or minimal media. Growth rates and maximum cell densities were comparable for all strains, including those with landing pads (Figures 8A and 8B).

[0111] Example 4: Shuttle vectors that deliver cargo to chromosomally integrated landing pads Creating a target A shuttle vector containing a serine recombinase (such as PhiC31) was used to target cargo to the landing pad (see Figure 9). It has been removed from therapeutic strains. Expression of PhiC31 must be tightly controlled to prevent leaky expression of the recombinase and must be robust to allow reproducible high-throughput strain loading. To this end, four different expression systems were developed: Three expression systems were tested: LacI, TetR, BetI, and PhlF. The best expression system was found to be TetR, which tightly represses expression while minimizing its effect on strain growth upon induction (see Figures 10 and 11).

[0112] Example 5: Cargo expression as a function of genomic location Expression of cargoes as a function of genomic location, each containing one landing pad A total of 70 different ZH9 strains were evaluated in two independent assays.

[0113] The first assay was performed using the chloramphenicol acetyltransferase (CAT) gene, an antibiotic resistance gene for chloramphenicol. Strains containing β-glucan were challenged with antibiotics and the OD during exponential growth was 600 was measured. Higher expressing samples have higher CAT copy numbers and therefore faster proliferation.

[0114] The second assay was performed using a bright red fluorescent protein called mScarlet. Strains containing landing pads were cultured in rich medium and analyzed at different growth stages (here, OD). 600 The fluorescence output was measured at a 1000 kJ / min (~0.5). The higher the expression level, the higher the fluorescence level.

[0115] For landing pad characterization with mScarlet, samples were diluted with 5 nM pShutTeR Positive clones (determined by color PCR) were electroporated with The plasmid was resuspended in 100% lysed vLB four times (2x single clones per round). The incubation was carried out in medium supplemented with kanamycin (or without, 12x clones of each strain). It was decided to use pre-coated plating.

[0116] Final clones were isolated and stored as glycerol stocks. Cells were then grown overnight in vLBaro and subcultured in triplicate. Growth measurements were monitored every 15 minutes and measured at the following thresholds: mScarlet fluorescence was measured at OD600 ~ 0.3, 0.5, and 1.0. Fluorescence was normalized per cell unit and samples were compared (normalization was performed using the GraphPad built-in algorithm, where samples are normalized as (x-xmin) / xmax*100).

[0117] A total of 70 different ZH9 strains, each containing one landing pad, were placed in the two This was verified using an independent assay (see Figures 12 and 13).

[0118] The above experiments allowed us to rank several landing pad strains by relative transcription intensity (see Figure 14), and samples LP19 (t0687) and LP23 (t0771) had high relative expression levels and were considered to be the best candidates for cargo integration.

[0119] Example 6: Creation of multi-landing pad strains 1 landing pad, 2 landing pads, or 3 landing pads The S. enterica ZH9 strain containing the nucleotide sequence was constructed using successive integration rounds by recombination.

[0120] First, the t0687 locus (SEQ ID NO: 5) was integrated with landing pad LP1 (SEQ ID NO: 63). The ZH9 strain containing the nucleotide sequence was constructed. The antibiotic resistance cassette was removed using FLP. The expressing accessory plasmid pCP20 was cured from the resulting strain (strain A).

[0121] Using strain A as a template, LP2 (SEQ ID NO: 64) was integrated into the t0771 locus (strain B1), generated a strain with a landing pad containing LP3 (SEQ ID NO: 65) integrated at the t1716 locus (strain B2). As previously done, the antibiotic resistance marker was removed using FLP to generate the final strain Finally, the 3′-C ... A single strain containing two landing pads was generated (e.g., when using strain B2 as a template, LP2 is integrated at the t0771 locus). The final strain was cured of the antibiotic resistance marker and accessory plasmid (strain C). All four strains were confirmed by genome sequencing.

[0122] Example 7: Evaluation of genomic stability of strains containing up to three landing pads S. enterica ZH9 strains containing one, two, or three landing pads were cultured overnight in 10 mL of vLB medium from a glycerol stock. The samples were then diluted 1:100 into 10 mL of fresh vLB medium and growth resumed. This procedure was repeated for up to four days.

[0123] On both days 1 and 4, aliquots were taken and genomic DNA from each sample was extracted and sequenced. The samples were compared on both days and screened for mutations and rearrangements at the landing pad location. After 4 days of continuous growth in rich medium, the results showed that the landing pad No instability was observed in any of the strains (Fig. 15).

[0124] Example 8: Loading cargo into a strain containing three landing pads The DNA sequence encoding mScarlet (red fluorescent protein) is After introducing the attP site, the vector was integrated into a shuttle vector, which allowed loading of cargo into the LP1 site of strain C. This shuttle vector contains an I-SceI cleavage site, a chloramphenicol resistance marker, and the pSC101 origin of replication.

[0125] The auxiliary plasmid, containing the PhiC31 circuit described in Example 4, was introduced into strain C. This plasmid contains a carbenicillin resistance gene and a p15A origin of replication. Strain C carrying the auxiliary plasmid was then transformed with a shuttle vector containing mScarlet at the TT / TC attachment site (locus t0687).

[0126] The auxiliary plasmid containing the serine recombinase was subcultured overnight at 37°C in vLB medium. However, the shuttle vector only cured after transforming the C-mScarlet strain with an I-SceI expression plasmid, which cuts the shuttle vector and promotes curing. Interestingly, the I-SceI expression plasmids of the two variants were tested. However, placing the lambda repressor upstream of i-scei resulted in more efficient curing. This auxiliary plasmid spontaneously cured after overnight subculture at 37°C. The final strain (C-mScarlet strain) was unable to grow on any antibiotic and contained mScarlet integrated at the LP1 position of the C strain (Fig. 16).

[0127] An array that forms part of the description SEQ ID NO:1:

[0128] sequence number 2: ATGAGTGTGTTGAGAAAACATTACTTGAAAGGGTATACCGCGCGGCAAATTGTACAGCGAGCCATGAAAATTATTCCTTACTCGGTAAACGTCATGGATGAGCATGGCGTCATTATCGCGTCTGGCGAACCTTCGCGGCTTCGCCAGCGTCACGAAGGGGCCATTCTGGCGCTGAAGGAA AACCGTATTGTAGAAATTGATTCCGCTACCGCCAATCAGCTTAAAGGCGTGCGATCCGGCATTAATCTTCCCATCTCTTTTCATGAACAGCTTATCGGCGTGGTCGGCATTACCGGCGAACCGGAGGAGGTTCGGCCGTATGCCGAGCTGGTTAAAATGGCGGCGGAGCTGGTGATCGAG CATATGGTGCTGATCGAACAGTGACAATGGGATAAACGCTATCGGCGAAGAGCTGATCAACCAATTGATTTTGCGAGAAAATTCAACAGAGTCGTTGCGCTCCATGGCGGCCTATCTGGGCATTGATCTGGCGGTTCCCAGATGGTGCTGATTATTGAACTTTCCCAGCGGATCGCGAA GCGCTGCGCAATGTAATGGATTATTTCGAGAATCACGCGCGCAACCATTTGGTGACGTTTACCGAATTTAATGAATTAATCATTATTAAGCCTATCACGTTAAAAAGGGAAAGTGGAATACCCGCCAGGAAATGGGCGAATTGCAGATTTTTAAATCATGGGCTGCATCATCGGGCTTT AGCCGTATTTTGGTTGGGGGCTTATTTTGCCGGCGAGACGGGATTGCACCGATCTTTGCTCACAGCGAGAGCCAGCAGGCGATGGCGAAAAAGACAAAAGCTGCGCAGCCAGTACATTTTTTATCATGACCACGCGCTTCCCGGCCTGCTAAGCGGGCTGTCTGAAAGTTGGCAAGTGCAGGAGTTATCGCGTCTGTGGCTGCAACTGGTGCAACATGACGCGAAAGGCGTATTG CAACAGACGCTGCGGACTTGGTTTGAACATAATTGTGACCTGACCGCAAACGGCCAAAGCATTGCATATTCATGTGAATACATTGCGCTATCGCTTCAGCGCTGTGAGGATATTACGCACATAAAAATCAACGAGTTAAAAGTACGCTTTGGCTTATATCGGTATGGAGCTTCAGGCCGAATCTGTATCTGCGACAAGTTACCGCCTGGTCGAATCGAAATTGTTGA sequence number 3: ACCGATAAAAGTCATCCCTGAACTAAAACAGTGGCAACAGAGCCCGCTGGAAGGTTTATCCCGTCGTCTGGCTGGACGCTATTCATTATAAAAAACCGTGAGGATGGCCGTTATCAGAGCAAGGCGGTTTATACCGTTCTGGCACTGAATCTAGAAGGCAAAAAAGAAGTTCTGGGCCTATATCTGTCGGAAGTGAAGGTGCTAACTTTTGGTTA sequence number 4: AGTGCCAGAACGGTATAAACCGCCTTGCTCTGATAACGGCCATCCTCACGGTTTTTATAA sequence number 5:

[0129] sequence number 6: ATGTCTCGTTCTATCAGAATCTGTAGCTATCTGCTGCTGCCGCTGATCTACCTACTGGTCAATGTCAAGATTGCCCAACTGGGGGAAAGCTTTCCCATTACCATCGTCACTTTTTACCGCTGTTGCTGCTGTTATTTGTGGAACGCATTAGCGTAAAAAAAATTGATGATCGCCTTTAGGCATCGGCGCGGGGCTTACGGC ATTTAACTTCCTGTTCGGCCAGTCGCTGAATGCCGGTAAATATGTCACGTCCACGATGCTGTTTGTCTATATTGTGGTCATTATCGGGATGGTCTGGAGTATCCGATTCAAAACCATTTCCGCGCATAACCACCGAAAGATTTTGCGTTTTTTTATCTGGTGGTGGGTATAGTGGTCGCGCTCGCGCGCGGTTGAGATGGC GCAAATTATCCTTACCGGCGGCAGCAGTATCATGGAAGGAATTTCGAAATATCCATTTACAGTAATAGCTAACGTACTGAACTTCATAAATTTGGCGGTAAGCGTACCACTGCGCTTTTATTTGAACCGGCATTTTCGCTTTGGCACTAATCTCAATTTGGCTGAGCATCAAACAGTTTGGTATCAAAATACCGAAAAGCG ATGCTATGATTCTGGCAGGGATAATATTATCAGGATCATTTTCAGGGTAATGACCTTTATCCTTTTTACCTTCTGGAGTGGGCGTTCCAATATTTGAATAAGGATGCGATAAAGAAAAAACTTCCACTGGCGCTGGTATCATTAACCCTGTTTTTGGTTGGGGTAATTATTGCATTTCCTTATATCGCGACACGACTTGGCG ATTTAGGGACGGAAGGATTATCTTCTTATTATCGTATTGTGGGCCCGTTAGTCATGGTCGGATATTCCTTGACCCATATTGATGGTGTAGTCAGATTTGGCTCACTTTATGAATATGTCGCATCATTCGGAATCTTTAACGGTGCGGATGTCGGGAAAACCATAGACAATGGATTGTATCTGCTGATTATTTATTTTTCCTGG TTCGCAGTGCTAATGACGCTGTGGTATATGGGGAAAGTTTTAAAAAATGGCGCTAAATGCGTTTGGCGATAATCGCAATTTTCGGGTGCAGCTCTATCTTTTTACGCCGGTGTCGCTGTTTTTACCGGTTCAATATTTAGCCCGGAATATGCTTTTTTAATCGTCTGTCCGTTCATTTTGCGCAAGGCGTTAAAAATTTCATAA sequence number 7:

[0130] sequence number 8: AAGGCGGGCAACGGCATAGACATGAGTAACCTGTGCATCTTCGTTCTCACCCGGACGGTGTACCAGCTTCTCTTCCAGACCAAACTCGAAGCTGAAATCGTCACCTTCACGGACAACGCGCGCGGAAAGGCTGGCAATCTGTCCGGAACGGCGGGCAAGGTCGATCATTCCCCGGTAGCCA ATAATTAACTGAACGTTTTTTTGCCTGACTTTTCGTTTTTGTTTCCGAACGGCAGCAGATAGGCATGACCGAGCGCGCCGCCGGGTTCCAGCCCAAGCTGGGAAACACTGAACGATGGCGCTGACAAAACTCATGGTGTCACAGTCACCCAGCGCCGGAACTTTTCGGATTTCCGTTGTGGC sequence number 9: TTACTGCGTCGCTGCAGACGGCGTTTTTGTCGGCGTTGCGCCTTAACGATGCCGGACGAGTAGACGGTACGCTATCGCACGGTTTTCCTGCGGGACAAATCAGATCGAGCATTTCAGCGTCACGCCGTTGCTCCAGCCAAAGCCGTCCTGAAGGGGATATTCGCCGCCCACCGCCGGTTCCGGTACTGCTGACGTCATATTTTTCGACCAGTTTTTCTCGCGATCGTAGTGTGCTG CACATTGGTTAAAAGCGCCAGGTGACTTCCATTGCCACGTCATCCTGCCCATAATTTTGCAATCCTTCGGCAGCGACCCATTGTAACGGCGCCCAGCCATTGGCGCATCCCACTGCTGTCCGCTTTTAACCGAGGTGGTAGCCAGCCCGCCAGGCTGTAGCAGATGGCCCTGGGCCGCCGCTGCCACTTTCGCGGCGCGATCTTTCGCGGCGGCTTTACATAGAGCGGAACAGCGC

[0131] SEQ ID NO:10: SEQ ID NO:11:

[0132] sequence number 12: ATGCTGTACAGGGCGCGGCCACGCCCCGTACAGCGGGTACCACAGATAAAACGAGCCTCAGTGAGGAAGGAATATGTTACTCAAAAAACAGGTGTTATTTCCAGCAACCAAAAAAGCGTTTGGTCTTTTCCGTGACCCGTTCGCCGACGAAGCCATGCA GGGTTCTGATGATGTGTCACCACACCAGATTCGCTACGTGCGTGAGGCGTTGTACCAGACAGCCCGTCATGGTGGGTTTATGGCGTCATCGGTGAGTCCGGTGCGGGTAAATCCACGCTGCGCCGTGACCTGACTGAACGTATCAACCGCGAGAATGCGCCAGTGATTGTTATCGAGCCATACATCATCGCTATGGAA GACAACGATGTGAAAGGGAAACTCTGAAGGCAGCAGCGATTGCCGAAGCCATTATCAGTACCATCGCACCACTGGAAAGCATCAGACGCAGTCAGGACGCCCGCTTTCGCCAGTTGCATCGCGTCCTGAAAGACAGCAACCAGGCGGGGTTCAGCCACGTTCTGGTGATTGAGGAGGCTCACAGTTTGCCCATTCCGACACT GAAACACCTCAAACGCTTTTTTGAGCTGGAGTCCGGTTTCAAAAAGCTGCTGTCCATCGTGCTGATTGGCCAGCCGGAACTGGCGACAAAACTCTCTGAACGCAACATGGAAGTCCGCGAAGTCGTTCAGCGCTGTGAGGTGGTCGAACTTCTGCCTCTGGACAATCACCTTGAAGAATTTCTGACGTTCAAACTGCAACGGG CCGGTAAACAACTGACGGACATTATGGACGCCAGCGCAGTGGATGCCATACGTACCCGCCTGAGCAATCCGGAAGTCATCGTAAAAAATGGTCAGCCTGCTGTATCCGCTGGCCGTCAGTAACCTGGTAATAGCCGCCATGAATCTGGCCGCTGAAATCGGGGTTCCAGCGTCAACGCTGACGTTGTCAAAGGGGTTAA sequence number 13: ATGAAAAAAGTAGTGGTGTTATCGCGGTAGCCGCAGCCGTGATGATGGCTGGAGCCGCCAAGCAGCAGAAATCTATAACAAGGATGGCAATAACTGGATTTGTATGGCAAGGTCGACGGCCTGCATATTTTTCCAGTAATCATAGTACGGATGGCGATCAATCTTATATCCGTATGGGTTATTAAAGGCGAGACTCAAATTACCGATCAA CTAACCGGTTTTGGACAGTGGGAGTATCAGGTCAACGCCAATCGTCCGGAAGATGGTGACTCCAGCGGTTCCCCGCAAAGCTGGACGCGTCTCGGTTTTGCTGGTTTGCATTTGCCGATATGGGGTCTGTTGATTATGGTCGTAACTATGGCGTGTTATACGACATTGGTTCATGGACTGACGTACTGCCTGAATTTGGTAATATTACCTGA sequence number 14: sequence number 15: TTCTTTTACGGTTAACGCTTCTGTTTTTTTCTTCTTCTCCAGCACCATCTGGCGACGAGGATCGAGTCCCTCAGTTAACCATGATCTAAAGTACTGACGGCGTTCCCTGCATGAGATAGTGATAATGGTTGGATAATCGCCAATCGTCAGTTGAGCAGCGTTCCCGTTCCAT CTGTATCGGTAAAGAATGTTATACTGCCGGATGTAGAGAGCCTGACATTGAGACCATGAGCGTCTGAGATGACCTTGATTTGGTCTCTTTTTTGCCAGGAGCCTTTCTTAATTTTGTATCGGCAAGCAATGTGTACACTCCATAAGAGGATATACACATCTGTGTATACAT sequence number 16: GTGTCTCAGCCTTGTCCCTGTGGTAGCGCTGACGAGTATAGCCTATGTTGTGGTCGTATTGTGTCCGGAGAACGAGTAGCACCCGATCCGTCACATCTCATGCGCTCTCGTTTACTGCGCTTTGTGATGAAAGACGCAGATTACTTAATTAAGAGCTGGCATCCAACTTGCAATGCGGCCGCGTTTCGTGATGATATCATCGCCGGATTTGCCAATACCAGGTGGCTCG GCCTGACTATTTTTGAACATACCTAGTCAGAAGCAGAAAAATACAGGGTATGTTAGTTTTATCGGCGTTTTTCCGAACAAGGGAAAACGGGGCGATTATCGAACGTTCTCGTTTTATCAAAGAAACGGTCAGTGGTATTATATTGACGGTACCCGCCCGCAGTTGGGTCGAAAATGATCCTGCCCGTGCGGTTCAGGCAAAAAAATTTAAAAAAGTGCTGCGGCCAGTTGA

[0133] sequence number 17:

[0134] sequence number 18: ATGCAATTTAAAAATACTCCACAACGTTATGGCGTAGTTTCGCGCCCTCCCACTGGCTGACCGCCCTAGTGGTCTATGGCATGTTTGCGTTGGGTTTATGGATGGTCACGCTCAGTTATTACGACGCTGGTATCACTAGGGCGCCGGAAATACATAAAAGTATTGGCATGTTACTGATGATGGCGCTGATCGTGCGTATTATCTGGCGCTTTATTCTCCGCCCGCGTTGCGTTGACCAGCTATTCCCGTTAACGCGCATTGGCGCGCGCGGGTCATATCC TTCTGTATCTCCTGCTCTTTGCGATAATCATTAGCGGCTACCTGATTTCCACCGCCGACGGTAAACCGATTAGCGTCTTTGCTGGTTTGAGATTCCGGCCACGCTTACGGACGCGGGCGCGAGGCTGACATCGCCGGAACACTGCATCTGTGGTTTGCCTGGTCGCTGGTCATTATCTCGCTCTCGCATGGGGTTATGGCGCTAAAACACCATTTCATCGATAAAGACGACACACTGAAACGTATGACAGGAATGTCGTCATCTGACTATGGAGCTCAAAAAT sequence number 19: SEQ ID NO:20:

[0135] sequence number 21: TCATAATAATTGCGGTGGCCAAATCGTCGTTGCTGCAAAGAGGAAGTTGCTCCCGCACCTGGTCTATTCGTTCTCTGAATATTTCCGCGACGATCAGCGCCGGACGATCGGCTGCCGCGGCTATCGTTACCCCCAACGGTCGATAATACGACTTTGACCAATATTACGATTACCACACTCCCCGGCCGCAATCAT ATAGCAGGTGGTATCCAGCGCTCTCGCCGCCAGCAGCGTCGACCACTGCTGCTTTCAACGGGCCGCGAACCCAGCCCGTCGGCAGCGCCAATACGTCAGCCCCCTGTAAAGCCAGCGCTAACGCCATATCCGGAAAGCGCAGGTCATAACAGGTCATAAGACCCACCTTAACCCCCTCCACGTCCAGCACAGGCG CGATAACGGTTCCGGCATCAATACTTTGGGATTCTTGCATCGAAAACGCATCATAGAGATGCAGCTTCGCGTAACGCGCGACAATGTGACCCGCCCGTAGCGCCACCAGCATATTAACCGCCCGTCCAGGCGTTGACGGGACAAGGATAGTGAATATCGTCGCATATTATTAGGCCTTTCTTCCAGAAGCCGC GTCATAAACGCGCCATCCAGGCGGCTGCGCGGCGCGAATCGGCAGGTCAAGGTCGATGTCATCTCGGCCTAAATATCCCCTCAGGCAACACCAGAAGCGATACGCCGCGGCCCGCCGCCTGAGCCATTAACGAAACGCAAACTTGCACATTCTCTTCCCATACAGAACTCACCACAAACTGCCCGGCTGCAACGAACAT sequence number 22: SEQ ID NO:23:

[0136] Sequence number 24: CTACAGCCAGTTCACCTCGCCATTTGGCGTAAACGCCGCCGCATCCAACGGTGAATTCTGCTGAATAAACTCTTTCAGCACTTCCGCGTCAATAAACCCGGTATTCACGTAGCCCGGTTTGTTATCGATGCGCGGATAACCATCGCCGCCCGTGGCGTTG sequence number 25: ATGCTGTTACAGACGCTGGAAGAGAAGCTGGCGACGCTACGCCAACGCTGCGCGCCGCTGGCGTAACATGCGACGTTAAGCGCCGCTTTGACCGACACCTTTTCCGTACCCGCAGTACTCTGTTGCAGGATATCTGGAAGAGGCAGACGCCAATCTCGCCGCTTGCGTCAGGCGGTAAAAACATGAGCAACTGCCGCAAGTGCCTGGCTGGCGGAACATCTGGCTTCGCAACTGGAGGCGATATCCGGTGAAACC GCCGCCTGGTCGCTGCGCCAGTGGGATGCCGCCGCACCAGGGCTTGGCCGTTGGCAGCGCAGACGAATACAGCATCAGGAGTTTGAATGTCGACTGCTGGCGATGACACAGGAGCGCAAATTCGTCTGGCGCAGGCGACCGGCCTTGTCGAACAACAAACGCTGCAAAGGAAGTCGAGATCTATGAAGGACGGCTGGCGCGCTGCCGACATGCGCTGGAGAAAATAGAAAACGTACTGGCGCGTTTACCCCGTTAA

[0137] sequence number 26: sequence number 27: ATGAAGTCATCTCATTTTTGTAAACTGGCAGTAACTGCATCTTTAGTTATGGGAATTGTCTCCGGCGCTCAAGCCGGGGGTAGCAACACAGCAAAGGTTACTTTCCTTGGTAATATTGTTGATTCCCCCTGCTCTGTCACATTGGATACGGAAGATCAAACAGTCAATATGGGCTCAAGTATCGGTAATGGCACGCTGAGTAATGGTAAAACGACCATCAACAATGCCCGTACCTTTCATATCGATCTTGAGGTTGTACCTAGGCTACCGAGAAAAAATGAATTGGTATTCACTACAGTAGTGGAACCACAGCGGC TACAGGCGCCACGGATAATCTCGCGCTGATGAAGACTGACGGCACTGGCGCTATTAGCAACATAAGCCTGGCAATCGGCGATGCAGGCAAAAACAATATCAAACTGGGCGATACCTATACACAGGCCATTGCGGACCTGGACAGAGATACCATCCTTGATGAGAAGCAAAGCCTGAATTTCACCGCCTGGCTGGTTGGCGCAGCAACCGGCACCGTAGGCACAGGTGAATTCAGCAGCGCCGCCAACGTCACTATCTCTTACCTGTAA sequence number 28: ATGGGTGAATTTTCGACACTTCTTCAGCAAGGAAACGGCTGGTTCTTCATTCCCAGCGCCATTTTATTAGGTATTTTGCACGGGCTTGAACCAGGGCACTCCAAACCATGATGGCGGCTTTTATCATTGCCATTAAAGGTACGGTTAAACAGGCTGTCATGCTCGGTCTGGCAGCAACGCTTTCTCATACCGGATCGTCTGGTTAATCGCGCTGGG TGGGATGTATCTTAGCCGGGCATTCACCGCACAATCAGTGGAACCATGGCTGCAGTTAATTTCTGCGATCATTATTCTGAGCACCGCGTGCTGGATGTTCTGGCGGACATGACGAGGCGAGCAGTGGCTGGCGGGAAACCACCATCACGACCACCATCACGACCACCATTACGACCATGACCATGACCATGACCATGACCATGACCATGACCATG ACCATGACCATGACCATCATGGTCACATACATCCGGAAGGCGCAACGTCAAAGCGTATCAGGATGCCCATGAACGCGCCCATGCTGCCGATATTCAACGCCGTTTTGATGGTCAAACAGTGAATAATGGACAGATCCTGCTGTTCGGCCTGACCGGAGGGCTTATCCCCTGTCCGGCTCGATCACCGTTTTACTGATTTGTATCCAGCTTAAAGCG TTTACGCTGGGTGCCACGATGGTGCTGAGCTTTAGTCTTGGCCTGGCATTAACGCTGGTGACGGTAGGCGTTGGCGCGGCGATAAGCGTTCAACAGGCAGCAAAGCGCTGGAGTGGTTTTTCGACGCTTGCCCGGCGGGCGCCTATTTTTCGAGCATTCTGATTGGTCTGGTCGGCGGTGTATATGGGATTCATGGCTATACCGGGAATCATGCAGTAA

[0138] sequence number 29: ATGCCGCACTGCCAGGACAACACCAAACGTGAGTTCACACATCTGGTTAGAGTTTCTCTGGCTTACCGCAAAATTGAGTGGGAACACGTTTCAACAGGCACTTCAGGGTGCTGATGACTGACGTGCGCCGCTGGAAGCATAA sequence number 30: TCAATACACCTCCCGAGGCTAAAAAGTAGCCTTCGCCATGCTGTGTGACCAGCAGTTCCGGCGTAATTTATGACGTAAGCGGCGAACCAGGACATCAATCGTGCGGAGATCCGGGGTCTCTACGCGGCGGGCGGAAAGCATTCGCAGCAGACGTTCGCGATGCAGCACTTTGC CTGGGTTGGTCACAAAGGCCAGCAGCAGCTCGTACTCGCGCGCGTAAGCTTAATGGCTTCACCGTTGTGCTCCAGCGTTGATTCATCACGTTCAGGCAGTAGCCGGAAACATATAGCAGTTTTCACTGGCATTTTGCGGCGTGGGGCGGGCCAGATCGATACGCCAAAAA GATTTTTCACCCGCACTACCAGCTCGCGCAGTTCCAGCGGCTTGGTGACGTAGTCGTCCGCGCCATCTCCAGCCCGACGATGCGGTCGATTTGGTCGCAACGCCCCGTACCAGAATAATGCCCACCGTGGAGCGTTCGCGTAGCGCCCTGGTCAGCATCAACCCGTTTTCAT CGGGGAGGTTGATATCCAGCAGGATCAGCGAAACGTGCTCATGCTCCATGATGTCACGCGCAGGCCGCGCCGCTGTCGGTCACCGAACGCGATACCCCTCCTGCTCAAAATAGGCCTGTAACCTGGCCTGAGTAACAGGTTCATCCTCAACAATAACAATGTGATGTGACAT sequence number 31: CCGCGGTGCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCAC sequence number 32: CCGCGGTGCGGGTGCCAGGGCGTGCCCGCGGGCTCCCCGGGCGCGTACTCCAC SEQ ID NO:33: CCGCGGTGCGGGTGCCAGGGCGTGCCCCTGGGCTCCCCGGGCGCGTACTCCAC SEQ ID NO:34: CCGCGGTGCGGGTGCCAGGGCGTGCCCTAGGGCTCCCCGGGCGCGTACTCCAC SEQ ID NO:35: CCGCGGTGCGGGTGCCAGGGCGTGCCCATGGGCTCCCCGGCGCGTACTCCAC SEQ ID NO:36: CCGCGGTGCGGGTGCCAGGGCGTGCCCCCGGGCTCCCCGGGCGCGTACTCCAC SEQ ID NO:37: GGCCGGCTTGTCGACGACGGCGTTCTCCGTCGTCAGGATCAT SEQ ID NO:38: GGCCGGCTTGTCGACGACGGCGGCCTCCGTCGTCAGGATCAT SEQ ID NO:39: GGCCGGCTTGTCGACGACGGCGCTCTCCGTCGTCAGGATCAT SEQ ID NO:40: GGCCGGCTTGTCGACGACGGCGTACTCCGTCGTCAGGATCAT SEQ ID NO:41: GGCCGGCTTGTCGACGACGGCGATCTCCGTCGTCAGGATCAT SEQ ID NO:42: GGCCGGCTTGTCGACGACGGCGCCCTCCGTCGTCAGGATCAT SEQ ID NO:43: CCGGCTTATCGGTCAGTTTCACCTGATTTACGTAAAAACCCGCTTCGGCGGGTTTTTGCTTTTGGAGGGGCAGAAAGATGAATGACTGTCCACGACGCTATACCCAAAAGAAAAAAAAAAAACCCCGCCCTGACAGGGCGGGGTTTTTTTT sequence number 44: TCCGGCAATTAAAAAAGCGGCTAACCACGCCGCTTTTTTACGTCTGCACTCGGTACCAAATTCCAGAAAAGGGCCTCCCGAAAGGGGGGCCTTTTTCGTTTTGGTCC

[0139] sequence number 45: TTCAGCCAAAAACTTAAGACCGCCGGTCTTGTCCACTACCTTGCAGTAATGCGGTGGACAGGATCGGCGGTTTTCTTTTCTCTTCTCAACTCGGTACCAAAGACGAACAATAAGACGCTGAAAGCGTCTTTTTTCGTTTTGGTCC sequence number 46: GCTGATGCCAGAAAGGGTCCTGAATTTCAGGGCCCTTTTTTACATGGATTGCTCGGTACCAAATTCCAGAAAAGAGACGCTTTCGAGCGTCTTTTTCGTTTTGGTCC sequence number 47: GATCTAACTAAAAAGGCGCCTCTGCGGCCTTTTTTCTTTTCACTGTAACAACGGAAACCGGCCATTGCGCCGGTTTTTTTTGGCCT sequence number 48: AGTTAACCAAAAGGGGGGATTTTATCTCCCCTTTAATTTTTCCTCGCAGATAGCAAAAAAGCGCCTTTAGGGCGCTTTTTTACATTGGTGG sequence number 49: GGAAACACAGAAAAAAGCCCGCACCTGACAGTGCGGGCTTTTTTTTCGACCAAAGGCTCGGTACCAAATTCCAGAAAAGACACCGAAAGGGTGTTTTTTCGTTTTGGTCC sequence number 50: TACCACCGTCAAAAAAAACGGCCTTTTTAGCGCCGTTTTTTTTTCAACCTTCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTC sequence number 51: ACATTTAATAAAAAAAAGGGCGGTCGCAAGATCGCCCTTTTTTACGTATGACACAGTGAAAAAATGGCGCCCATCGGCGCCCATTTTTTTATG sequence number 52: TGCTCGTACCAGGCCCCTGCAATTTCAACAGGGGCCTTTTTTTATCCAATTCCATCGGGTCCGAATTTTCGGACCTTTTCTCCGC sequence number 53: CTTATTCCATAAACAAAGCCGGGTAATTCCCGGCTTTGTTGTATCTGAACAATAATGGATGCCCTGCGTAAGCGGGGCATTTTTCTCCT sequence number 54: AGCGTCAAAAGGCCGGATTTTCCGGCCTTTTTTATTAGGCAGCATGCTGCCAGGTGATCCCCCTGGCCACCTCTTTT sequence number 55: TAATCATTCTTAGCGTGACCGGGAAGTCGGTCACGCTACCTCTTCTGAAGAAACAGCAAACAATCCAAAACGCCGCGTTCAGCGGCGTTTTTCTGCTTTTCT

[0140] sequence number 56: GTGAAGTGAAAAATGGCGCACATTGTGGCCCATTTTTTTTGTCTGCCGTTTACCGCTTCTCTGAAAATCAACGGGCAGGTCACTGACTTGCCCGTTTTTTATCCCTTCTCCACACCG sequence number 57: TCTTTAAAAAGAAACCTCCGCATTGCGGAGGTTTCGCCTTTTGATACTCTGTCTGAAGTAATTCTTGCCGCAGTGAAAAATGGCGCCCATCGGCGCCATTTTTTATGCTTCCATTAGAAAGCAAAAAGCCTGCTAGAAAGCAGGCTTTTTGAATTTGG CTCCTCTGAC sequence number 58: AAAGTTCTGAAAAGGGTCACTTCGGTGGCCCTTTTTTATCGCCACGGTTTGAGCAGTGCACTTGCTTAAAATCCCGCCAGCGGCGGATTTTTTATTGTCCGGTTTAAGACA sequence number 59: GCAGACAAAAAAATGGCGCACAATGTGGCCCATTTTTCACTTCACAGGTACTATTGTTTTGAATTGAAAAGGGCGCTTCGGCGCCCTTTTGCATTTGTTGACGGCATATATTGTATATCGAAGCGCCCTGATGGGCGCTTTTTTTATTTAATCGATAACCAGA sequence number 60: CCAGATCGTTCCTCAGGTGACCTCGAGTCCGGCAATTAAAAAAGCGGCTAACCACGCCGCTTTTTTACGTCTGCACTCGGTACCAAATTCCAGAAAAGAGGCCTCCCGAAGGGGGCCTTTTTTCGTTTTGGTCCCCGGGTGCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACGAAGTTCCTATACTTTCTTAGAGAATAGGAACTTCGGAATAGGAACTACCGCGGT GCGGGTGCCAGGGCGTGCCCTCGGGCTCCCCGGGCGCGTACTCCACGTCAGAGGACCAAATTCAAAAAAAGCCTGCTTTCTAGCAGGCTTTTGCTTTCTAATGGAAGCATAAAAAAATGGCCGATGGGCGCCATTTTTCACTGCGGCAAGAATTACTTCAGACAGAGTATCAAAAGGCGAAACCTCCGCAATGCGGAGGTTTCTTTTTAAAGACTGCAGCAGCGATTGAGACTCAGCGAAC sequence number 61: CCAGATCGTTCCTCAGGTGACCTCGAGGTGAAGTGAAAAATGGCGCACATTGTGGCCCATTTTTTTTGTCTGCCGTTTACCGCTTCTCTGAAAATCAACGGGCAGGTCACTGACTTGCCCGTTTTTTATCCCTTCTCCACACCGCGGTGCGGGTGCCAGGGCGTGCCCGTGGGCTCCCCGGGCGCGTACTCCACGAAGTTCCTATACTTTCTAG AGAATAGGAACTTCGGAATAGGAACTACCGGTGCGGGTGCCAGGGCGTGCCCCAGGGCTCCCCGGGCGCGTCTCCCACGGACCAAAACGAAAAAAGGCCCCCCTTTCGGGAGGCCTTTTCTGGAATTTGGATCGAGTGCAGACGTAAAAAAAGCGGCGTGGTTAGCCGCTTTTTTAATTGCCGGACTGCAGCAGCGATTGAGACTCAGCGAAC

[0141] sequence number 62: CCAGATCGTTCCTCAGGTGACCTCGAGAGTTAACCAAAAAGGGGGATTTTATCTCCCCTTTAATTTTTCCTCGCAGATAGCAAAAAAGCCCTTTAGGGCGCTTTTTTACATGGTGGCGGTGCGGGTGCCAGGGCGTGCCCCTGGGCTCCCCGGGCGCGTACTCCACGAAGTTCCTATACTTTCTAGAGAATAGGAACTTC GGAATAGGAACTTCCGGTGCGGGTGCCAGGGCGTGCCCCCGGGCTCCCGGCGCGGTACTCCACGGACCAAACGAAAAAACACCCTTTCGGGTCTTTTCTGGAATTTGGTACCGAGCCTTTGGTCGAAAAAAAGCCCGCACTGTCAGGTGCGGGCTTTTTTCTGTGTTTCCCTGCAGCAGCGATTGAGACTCAGCGAAC sequence number 63: AATATGGACAACTTCTTCGCCCCCGTTTCCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTTTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCAGGGCGGGGCGTTAATTTGACTTTTGTCGGCTCGACCCACGACTATTGACTGCTCTGAGAAAGTTGATTGTTACGATTAGTCGGCCGGCCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTACCGCG GTGCGGGTGCCAGGGCGTGCCCTCGGGCTCCCCGGGCGCGTACTCCACGTCAGAGGAGCCAAATTCAAAAAAAGCCTGCTTTCTAGCAGGCTTTTGCTTTCTAATGGAAGCATAAAAAAATGGCGCCGATGGGCGCCATTTTTCACTGCGGCAAGAATTACTTCAGACAGAGTATCAAAAGGCGAAACCTCCGCAATGCGGAGGTTTCTTTTAAAGACTGCAGCAGCGATTGAGACTCAGCGAACCAACACCAAAAAGTGATCTATTCGAACACCCGGATCTGGTGCGTCCGATTGCCTCGAT

[0142] sequence number 64: SEQ ID NO:65: TATTCCAACGTATTTTGAGTCCCGCTGGAATCTGGGCGATGCGCTAACGGA

[0143] References Petrovska L, Aspinall RJ, Barber L, Clare S, Simmons CP, Stratford R, Khan SA, Lemoine NR, Frankel G, Holden DW and Dougan G. Salmonella enterica serovar Typhimurium interaction with dendritic cells: impact of the sifA gene. Cellular Microbiology, 2004;6:1071-1084. Hindle Z, Chatfield SN, Phillimore J, Bentley M, Johnson J, Cosgrove CA, Ghaem-Maghami M, Sexton A, Khan M, Brennan FR, Everest P, Wu T, Pickard D, Holden DW, Dougan G, Griffin GE, House D, Santangelo JD, Khan SA, Shea JE, Feldman RG, and Lewis DJ. Characterization of Salmonella enterica derivatives harboring defined aroC and Salmonella pathogenicity island 2 type III secretion system (ssaV) mutations by immunization of healthy volunteers. Infect Immun. 2002;70(7):3457-67. Lehouritis P, Hogan G, and Tangney M. Designer Bacteria as Intratumoural Enzyme Biofactories, Advanced Drug Delivery Reviews. 2017. Kimura H, Zhang L, Zhao M, Hayashi K, Tsuchiya H, Tomita K, Bouvet M, Wessels J, and Hoffman RM. Targeted therapy of spinal cord glioma with a genetically modified Salmonella typhimurium. Cell Proliferation. 2010;43:41-48.

Claims

1. A modified, attenuated live strain of Salmonella, The aforementioned strain is integrated onto at least one chromosome inserted at a predetermined pseudogenomic location. It contains a synthesized polynucleotide sequence, The sequence includes at least one defined recombination site for introducing a heterologous polynucleotide sequence encoding a polypeptide, The synthetic polynucleotide sequence integrated on the aforementioned chromosome is one of the sequence numbers 1 to 30. A modified attenuated live strain of Salmonella located within at least one locus defined by a sequence that has at least 70% identity with any one of sequence numbers 1 to 30.

2. The modified strain according to claim 1, wherein the synthetic polynucleotide sequence integrated on the chromosome is located within at least one locus defined by any one of sequence numbers 1 to 30, or a sequence having at least 75% sequence identity with respect to any one of sequence numbers 1 to 30.

3. The modified strain according to claim 1 or 2, wherein the defined recombinant site is an attB recombinant site.

4. The modified strain according to claim 3, wherein the attB recombinant site is a PhiC31 attB recombinant site and / or a Bxbl attB recombinant site.

5. The modified strain according to claim 1, wherein the synthetic polynucleotide sequence integrated on the chromosome further comprises insulator regions flanking the defined recombination site.

6. Each insulator region contains one of sequence numbers 43-59, or sequence numbers 43-59. A modification according to claim 5, selected from an array containing at least 70% identity with one of the deviations. KK.

7. Each insulator region contains one of sequence numbers 43-59, or sequence numbers 43-59. The sequence is selected from sequences that have at least 75% sequence identity for each of the differences, according to claim 6. The modified strain described.

8. The aforementioned attenuated viable bacterial strain is inserted into a predetermined genome position, such as 2, 3, 4, 5, or 6. A modified strain according to claim 1, comprising synthetic polynucleotides integrated on individual chromosomes.

9. The modified strain according to claim 8, wherein the attenuated viable bacterial strain contains synthetic polynucleotides integrated on three chromosomes.

10. The modified strain according to claim 1, wherein the synthetic polynucleotide sequence integrated on the chromosome has the sequences of sequence numbers 60, 61, and 62, or a sequence having at least 70% identity with those sequences.

11. The synthetic polynucleotide sequence integrated on the chromosome contains at least 75% sequence identity with the sequences of SEQ ID NOs. 60, 61, and 62, or any one of SEQ ID NOs. 60, 61, and 62. A modified strain according to claim 10, having rows.

12. The claim states that the attenuated viable bacterial strain is a Salmonella Enterica strain. The modified strain described in 1.

13. The aforementioned attenuated viable bacterial strain is either Salmonella enterica serovar Typhi or Salmonella enterica serovar Typhimurium. The modified strain according to claim 12, which is the (Salmonella enterica serovar Typhimurium) strain.

14. The aforementioned attenuated viable strains are Ty21a, CVD 908-htrA, CVD 909, Ty800, M01ZH09, x9633, x639, x9640, x8444, ZH9PA, DTY88, MD58, WT05, ZH26, SL7838, SL7207, VNP20009, A1-R, and A modified strain according to claim 13, selected from the group including combinations thereof.

15. The modified strain according to claim 1, wherein the attenuated viable bacterial strain is a genetically modified strain.

16. The aforementioned attenuated live bacterial strain has a weakened mutation in the Salmonella pathogenic island 2 (SPI-2) gene, The modified strain according to claim 12, comprising a weakening mutation in a second gene and / or a second gene.

17. The SPI-2 is the ssaV gene, and the second gene is the aroC gene, in the case of Claim 16. The modified strain described.

18. The modified strain according to claim 1, wherein the predetermined genome location is a genome location with low or high transcriptional intensity.

19. The modified strain according to claim 1, wherein the heterogeneous polynucleotide sequence encodes an immunogenic compound and / or a cancer drug.

20. The modified strain according to claim 1, wherein the heterogeneous polynucleotide has a size in the range of 1 kbp to 10 kbp.

21. The modified strain according to claim 20, wherein the heterogeneous polynucleotide has a size in the range of 1 kbp to 2 kbp.

22. A vaccine composition comprising the modified attenuated live bacterial strain described in claim 1.

23. The vaccine composition according to claim 22, further comprising a pharmaceutically acceptable carrier, excipient, or adjuvant.

24. A vaccine composition according to claim 22 or 23 for use in treatment.

25. The vaccine composition for use according to claim 24, wherein the treatment is the treatment of cancer.

26. The vaccine composition for use according to claim 25, wherein the cancer is selected from prostate cancer, liver cancer, kidney cancer, lung cancer, breast cancer, colorectal cancer, bladder cancer, pancreatic cancer, brain tumor, hepatocellular carcinoma, lymphoma, leukemia, stomach cancer, cervical cancer, ovarian cancer, thyroid cancer, melanoma, carcinoma, head and neck cancer, skin cancer, or sarcoma.

27. ​​The vaccine composition for use according to claim 26, wherein the cancer is selected from lung cancer, kidney cancer, bladder cancer, stomach cancer, colorectal cancer, head and neck cancer, or breast cancer.

28. The vaccine composition for use according to claim 24, wherein the treatment is for the treatment of an infectious disease.

29. The vaccine composition for use according to claim 24, wherein the treatment is the treatment of an autoimmune disease or disorder.

30. The vaccine composition according to claim 22, wherein the modified strain is formulated for oral administration, intratumor administration, peritumor administration, intradermal administration, subcutaneous administration, or intraperitoneal administration.

31. The vaccine composition for use according to claim 24, wherein the modified strain is administered in combination with immunotherapy, chemotherapy, radiotherapy, antiviral therapy, antimicrobial therapy, antifungal therapy, or antiparasitic therapy.

32. The vaccine composition for use according to claim 31, wherein the immunotherapy is a checkpoint inhibitor, antigen-specific T cells, a therapeutic antibody, or a cancer vaccine.

33. A method for modifying a live, attenuated strain of Salmonella, The method described above includes inserting a synthetic polynucleotide sequence into a predetermined pseudogenomic position of a viable, attenuated strain of Salmonella. The sequence includes at least one defined recombination site for introducing a heterologous polynucleotide sequence encoding a polypeptide, The synthetic polynucleotide sequence integrated on the chromosome is sequence numbers 1 to 30, or sequence A method located within at least one gene locus defined by a sequence containing at least 70% identity with any one of the numbers 1 to 30.

34. The method according to claim 33, wherein the synthetic polynucleotide sequence integrated on the chromosome is located within at least one locus defined by any one of sequence numbers 1 to 30, or a sequence having at least 75% sequence identity with respect to any one of sequence numbers 1 to 30.