Anti-fibrotic microRNA compositions

JP2025532680A5Pending Publication Date: 2026-09-18COUNCIL OF THE QUEENSLAND INST OF MEDICAL RES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025517437
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-09-20
Filing Date
2023-09-20
Publication Date
2026-09-18

AI Technical Summary

Technical Problem

Existing miR-25 mimetics show limited efficacy in inhibiting TGF-β-induced fibrous collagen expression in hepatic stellate cells, hindering effective attenuation of liver fibrosis progression.

Method used

Development of phosphorothioate-linked and 2'-O-methyl-modified miR-25 mimetics that enhance the downregulation of target genes FKBP14 and ADAM-17, inhibiting TGF-βRI and collagen type 1a1 expression, thereby inhibiting fibrous collagen production.

Benefits of technology

The modified miR-25 mimetics significantly increase the suppression of target genes and collagen expression, providing a more potent anti-fibrotic therapeutic agent to attenuate liver fibrosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2024059904000001
    Figure 2024059904000001
  • Figure 2024059904000002
    Figure 2024059904000002
Patent Text Reader

Abstract

Provided herein are compositions and methods for the treatment of fibrosis using miR-25 mimics.More particularly, disclosed herein are novel miR-25 mimics and methods for attenuating the progression of fibrosis, particularly liver fibrosis, in subjects.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Related Applications This application claims priority to Australian Provisional Application No. 2022902721, entitled "Anti-fibrotic microRNA Compositions," filed on September 20, 2022, the contents of which are incorporated herein by reference in their entirety.

[0002] FIELD OF THE INVENTION The present invention relates generally to compositions and methods for the treatment of fibrosis. More particularly, the present invention relates to novel miR-25 mimetics and methods for attenuating the progression of fibrosis in a subject. [Background technology]

[0003] Background of the Invention Reference herein to any prior publication (or information derived therefrom) or publicly known matter is not an acknowledgement, admission, or in any way suggestion that the prior publication (or information derived therefrom) or publicly known matter forms part of the common general knowledge in the field of endeavor to which this specification pertains.

[0004] Hepatic stellate cells (HSCs) are part of the nonparenchymal compartment of the liver and, together with macrophages (Kupffer cells), other nonparenchymal hepatocytes, and hepatocytes, support liver function. In healthy organs, HSCs are quiescent cells that store vitamin A in their cytoplasm, regulate sinusoidal blood flow, and possess immune cell functions (Geerts 2001). Upon tissue injury, cells, including Kupffer cells and HSCs, release profibrotic factors such as transforming growth factor-β (TGF-β), leading to HSC activation and subsequent transdifferentiation into myofibroblast-like cells (Friedman 2008). In contrast to their quiescent state, activated HSCs express excessive levels of extracellular matrix (ECM) proteins and are highly contractile (via α-smooth muscle actin (αSMA) expression), proliferative, inflammatory, and profibrotic. HSCs migrate toward the injury site following a chemokine gradient, where they secrete types I, III, and IV fibrous collagens and regulate ECM degradation by altering the expression of matrix metalloproteinases (MMPs) and their inhibitors (tissue inhibitors of metalloproteinases (TIMPs)) (Bataller and Brenner 2005). Therefore, HSC activation (via increased collagen expression) is considered a key event in liver fibrosis (Mederacke et al., 2013). The TGF-β signaling pathway, dysregulated in pathological conditions, plays a major role in the progression of liver fibrosis, inducing HSC proliferation and excessive collagen expression (Dooley et al., 2001). Constitutively active Notch signaling has also been linked to HSC activation ( Villanueva et al., 2012 ; Xie et al., 2013 ), and crosstalk between the TGF-β and Notch signaling pathways has been highlighted as a key mechanism in the progression of liver fibrosis ( Bansal et al., 2015 ; Wang et al., 2017 ).

[0005] MicroRNAs (miRNAs) are important regulators of various cellular processes, including proliferation (le Sage et al., 2007), differentiation (Yu et al., 2008), and protein and gene expression (Eichhorn et al., 2014; Guo et al., 2010). miRNAs interact with the RNA-induced silencing complex (RISC) and bind to target messenger RNAs (mRNAs) through complementary base pairing, either suppressing mRNA translation or promoting its degradation (Bartel 2009; Ha and Kim 2014). Due to their stability and availability in biological fluids (e.g., serum), miRNAs have been explored as novel therapeutic agents (Krauskopf et al., 2017). Importantly, miRNAs have been linked to post-transcriptional gene regulation of the TGF-β and Notch signaling pathways ( Ichimura et al., 2011 ; Inui et al., 2010 ) and may therefore play an important role in fibrosis.

[0006] We previously demonstrated that miR-25-3p (miR-25) was downregulated in the serum of children with cystic fibrosis with liver disease, including hepatic fibrosis (CFLD), compared with children with cystic fibrosis but without liver disease, suggesting a protective role for miR-25 in preventing the development of liver fibrosis (Cooke et al., 2015). More recently, we found that miR-25 is endogenously expressed in human and mouse HSCs and is upregulated during HSC activation in vitro and in vivo (Genz et al., 2019). Using pull-down experiments and target gene sequencing, we identified ADAM-17 and FKBP14 (essential mediators of Notch signaling) as direct targets of miR-25. Overexpression of miR-25 in activated HSCs suppressed the expression of ADAM-17 and FKBP14 target genes and inhibited the cleavage and nuclear translocation of the Notch-1 receptor signaling-active intracellular domain (NICD1). Furthermore, miR-25 prevented the expression of TGF-β receptor I (TGF-βRI) as a target of the Notch signaling pathway, thereby inhibiting TGF-β-induced collagen I expression (Genz et al., 2019). These results highlighted the potential of miR-25 as an antifibrotic agent, but transient transfection of commercially available miR-25 mimetics into HSCs was only modestly effective, with limited target gene suppression efficiency (up to 25%) (Genz et al., 2019). This led us to design our own miR-25 mimetics to further explore the effects of miR-25 on HSC phenotype. Summary of the Invention

[0007] Summary of the Invention The present invention is based in part on the discovery that phosphorothioate-linked and 2'-O-methyl-modified miR-25 mimetics significantly enhanced the protective, anti-fibrotic effects of miR-25 in activated human HSCs. Specifically, downregulation of the target genes FKBP14 and ADAM-17 was significantly increased compared to commercially available mimetics, resulting in inhibition of TGF-βRI and TGFβ-induced collagen type 1a1 (COL1A1) expression. Furthermore, mRNA expression of type I (COL1A1, COL1A2) and type III (COL3A1) fibrous collagens was significantly downregulated. Therefore, we hypothesized that the improved efficacy of miR-25 mimetics in inhibiting TGF-β-induced fibrous collagen expression could be used as a potential novel anti-fibrotic therapeutic agent to attenuate liver fibrosis progression.

[0008] In some embodiments, the first strand corresponds to nucleotide residues 52-73 of the mature miR-25 sequence set forth in SEQ ID NO:1 conjugated to two uracil residues at its 3' end and has at least one modified nucleotide. In some embodiments, the second strand hybridizes to the first strand under at least low stringency conditions and has at least one modified nucleotide.

[0009] In some embodiments, the modified nucleotides comprise nucleotides having a backbone modification and / or a sugar residue. In some such embodiments, the backbone modification comprises one or more phosphorothioate, morpholino, methylphosphonate, amide, or phosphonocarboxylate linkages. In some preferred embodiments, the first two nucleotides at the 5' end of the first strand are linked together by a phosphorothioate linkage. In some preferred embodiments, the last four or five nucleotides at the 3' end of the first strand are linked together by a phosphorothioate linkage. In another embodiment, at least one of the 3' nucleotides of the first strand is a 2'-O-methyl modified nucleotide. In another embodiment, at least one nucleotide of the first strand is a 2'-fluoro nucleotide. In some embodiments, the first strand does not have a modified sugar residue at the second position of either the 5' or 3' end.

[0010] In some embodiments, the backbone modification of the second strand comprises one or more of a phosphorothioate bond, a morpholino bond, a methylphosphonate bond, an amide bond, or a phosphonocarboxylate bond. In some preferred embodiments, the first two nucleotides at the 5' end of the second strand are linked by a phosphorothioate bond. In another embodiment, the last seven nucleotides at the 3' end of the second strand are linked by a phosphorothioate bond. In another embodiment, the first nucleotide at the 5' end of the second strand is a 2'-O-methyl modified nucleotide. In another embodiment, the first seven nucleotides at the 3' end of the second strand are 2'-O-methyl modified nucleotides.

[0011] In another aspect of the invention, miR-25 mimetic compounds are set forth in Table 1. In some embodiments, the first strand comprises a sequence selected from SEQ ID NOs: 2, 4, 9, 11, 12, 13, or 14, and the second strand comprises the sequence set forth in SEQ ID NO: 5. In a preferred embodiment, the first strand comprises the sequence of SEQ ID NO: 2, and the second strand comprises the sequence of SEQ ID NO: 5. In another preferred embodiment, the first strand comprises the sequence of SEQ ID NO: 11, and the second strand comprises the sequence of SEQ ID NO: 5. In yet another preferred embodiment, the first strand comprises the sequence of SEQ ID NO: 13, and the second strand comprises the sequence of SEQ ID NO: 5.

[0012] In another aspect, the present invention provides a pharmaceutical composition comprising a miR-25 mimetic compound comprising, consisting of, or consisting essentially of a first strand comprising a sequence selected from Table 1 or Table 2, and a second strand comprising the sequence set forth in SEQ ID NO:5, and a pharmaceutically acceptable carrier, excipient, and / or diluent.

[0013] In yet another aspect, the present invention provides a method for treating or preventing fibrosis in a subject. In a specific example, the fibrosis is liver fibrosis.

[0014] In some embodiments, the miR-25 compound reduces the expression of COL1A1, COL1A2, COL3A1, COL4A3, COL5A2, COL11A1, FN1, MMP2, CTGF, TGFB2, and / or TGFB3.

[0015] In some embodiments, the mir-25 mimetic compound is for the manufacture of a medicament for the therapeutic treatment of fibrosis (eg, liver fibrosis).

[0016] The following figures form part of the present specification and are included to further demonstrate certain aspects of the present disclosure. The present disclosure may be better understood by reference to one or more of these figures in combination with the detailed description of specific embodiments presented herein. [Brief explanation of the drawings]

[0017] [Figure 1] Optimization of novel miR-25 mimic concentrations using FKBP14 target gene downregulation. Novel miR-25 mimics were titrated from 5 pmol / mL to 50 pmol / mL (combinations 1–8; A–H). Commercially available miR-25 mimics (CM) and negative control mimics (-ve) were used at 20 pmol / mL as previously described (Genz, B et al. Scientific Reports, 2019). LX-2 cells were transiently transfected with miR-25 mimics or a control (a C. elegans non-specific miRNA mimic) and analyzed 48 hours later using qRT-PCR. Optimal target gene downregulation was assessed using FKBP14 relative mRNA expression, normalized to the expression of GAPDH and the negative control. Data are presented as mean ± SEM. n = 3–4. Data were analyzed using one-way ANOVA with Dunnett's post hoc analysis (* indicates P<0.05). [Figure 2] Optimization of novel miR-25 mimic concentrations using FKBP14 target gene downregulation. Novel miR-25 mimics were titrated from 5 pmol / mL to 40 pmol / mL (combinations 10–16). A negative control mimic (-ve) was used at 20 pmol / mL as previously described (Genz, B et al. Scientific Reports, 2019). LX-2 cells were transiently transfected with miR-25 mimics or a control (a non-C. elegans -specific miRNA mimic) and analyzed 48 hours later using qRT-PCR. Optimal target gene downregulation was assessed using FKBP14 relative mRNA expression, normalized to the expression of GAPDH and the negative control. Data are presented as mean ± SEM. n=3. Data were analyzed using one-way ANOVA with Dunnett's post-hoc analysis (* indicates P<0.05). [Figure 3]Analysis of the effect of C3 miR-25 mimetic on FKBP14 and ADAM-17 mRNA and protein expression. LX-2 cells were transfected with optimized concentrations of combination 3 (C3; 5, 20, and 40 pmol / mL), a commercial miR-25 mimetic (CM; 20 and 40 pmol / mL), and a negative control (-ve; a nonspecific C. elegans miRNA mimetic; 20 pmol / mL). (A-B) mRNA expression of 20 previously described key target genes of miR-25, FKBP14, and ADAM-17, was analyzed 48 hours post-transfection using qRT-PCR. (C-D) Protein expression was analyzed 72 hours post-transfection using Western blot. Data are presented as mean ± SEM. n = 3–12. Data were analyzed using one-way ANOVA with Dunnett's post-hoc analysis (* indicates P < 0.05). [Figure 4] 48-hour protein expression analysis of miRNA-25 targets. Protein expression of miRNA-25 targets FKBP14 (A), ADAM-17 (B), and TGFBR1 (C) was analyzed by Western blot 48 hours after transfection with C3 and CM compared with the negative control. Data are presented as mean ± SEM. n = 7–18. Data were analyzed using one-way ANOVA with Dunnett's post-hoc analysis. [Figure 5] Analysis of the effects of C13 and C15 miR-25 mimics on FKBP14 and ADAM-17 mRNA and protein expression. LX-2 cells were transfected with optimized concentrations of combination 13 (C13) and combination 15 (C15; 5, 20, and 40 pmol / mL), as well as a negative control (-ve; a nonspecific C. elegans miRNA mimic; 20 pmol / mL). The mRNA expression of previously described key miR-25 target genes, FKBP14 (A, C) and ADAM-17 (B, D), was analyzed 48 hours after transfection using qRT-PCR. Data are presented as mean ± SEM. n = 3–5. Data were analyzed using one-way ANOVA with Dunnett's post-hoc analysis (* indicates P < 0.05). [Figure 6]Analysis of the effect of the C3 miR-25 mimetic on type 1α1 collagen secretion, mRNA, and protein expression. LX-2 cells were transfected with optimized concentrations of C3 (5, 20, and 40 pmol / mL), a commercial miR-25 mimetic (CM; 20 and 40 pmol / mL), and a negative control (-ve; a nonspecific C. elegans miRNA mimetic; 20 pmol / mL). (A) Fibrillar collagen 1α1 mRNA expression was analyzed 48 hours post-transfection using qRT-PCR. (B) Fibrillar collagen 1α1 protein expression was analyzed 72 hours post-transfection using Western blot. (C) Cell supernatants were collected from transfected LX-2 cells 72 hours post-transfection. Collagen secretion was analyzed using the Abcam Human Procollagen Iα1 ELISA Kit. (D) TGF-β stimulation assay was performed by stimulating transfected LX-2 cells with recombinant human TGF-β (10 ng / mL) or RNase-free water (control treatment (Ctrl)) for 24 hours after transfection. The relative expression of collagen-1α1 and α-SMA mRNA was analyzed using qRT-PCR. Data are presented as mean ± SEM. n = 3–15. Data were analyzed using one-way ANOVA with Dunnett's post-hoc analysis (* indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001, and **** indicates P < 0.0001). [Figure 7]Analysis of the effects of C13 and C15 miR-25 mimics on the secretion, mRNA, and protein expression of type 1α1 and type 1α2 collagens. LX-2 cells were transfected with optimized concentrations of combinations 13 and 15 (5, 20, and 40 pmol / mL) and a negative control (-ve; a nonspecific C. elegans miRNA mimic; 20 pmol / mL). The mRNA expression of fibrillar collagens 1α1 (A, C) and 1α2 (B, D) was analyzed using qRT-PCR 48 hours after transfection. Data are presented as mean ± SEM. n = 3–5. Data were analyzed using one-way ANOVA with Dunnett's post-hoc analysis (* indicates P<0.05, ** indicates P<0.01, *** indicates P<0.001, and **** indicates P<0.0001). [Figure 8] Effect of C3 miR-25 mimetic on fibrillar collagen (secreted), mRNA, and protein expression. LX-2 cells were transfected with optimized concentrations of C3 (5, 20, and 40 pmol / mL), a commercial miR-25 mimetic (CM; 20 and 40 pmol / mL), and a negative control (-ve; nonspecific C. elegans miRNA mimetic; 20 pmol / mL). (A) mRNA expression of fibrillar collagens 1α2 and 3α1 was analyzed using qRT-PCR 48 hours after transfection. (C-D) Protein expression of fibrillar collagens 1α2 and 3α1 was analyzed using Western blot 72 hours after transfection. Data are presented as mean ± SEM. n = 3–16. Data were analyzed using one-way ANOVA and Dunnett's post hoc analysis (* indicates P<0.05, ** indicates P<0.01, *** indicates P<0.001, and **** indicates P<0.0001). [Figure 9]Target gene analysis of type IV gelatinous collagen using the C3 miR-25 mimetic. LX-2 cells were transfected with optimized concentrations of C3 (5, 20, 40 pmol / mL), a commercial miR-25 mimetic (CM; 20 pmol / mL), and a negative control (-ve; a nonspecific C. elegans miRNA mimetic; 20 pmol / mL). Gelatinous collagen IV mRNA expression was analyzed using qRT-PCR 48 hours after transfection. Data are presented as mean ± SEM. n = 6–15. Data were analyzed using one-way ANOVA with Dunnett's post-hoc analysis (* indicates p < 0.05, ** indicates p < 0.01). [Figure 10] Effect of the C3 miR-25 mimetic on components of the TGF-β signaling pathway. LX-2 cells were transfected with optimized concentrations of C3 (5, 20, and 40 pmol / mL), a commercial miR-25 mimetic (CM; 20 and 40 pmol / mL), and a negative control (-ve; a nonspecific C. elegans miRNA mimetic; 20 pmol / mL). (A) mRNA expression of TGF-β receptor 1 was analyzed using qRT-PCR 48 hours after transfection. (B) Protein expression of TGF-β receptor 1 was analyzed using Western blot 72 hours after transfection. (C-F) mRNA expression of other components of TGF-β signaling was analyzed using qRT-PCR 48 hours after transfection. Data are presented as mean ± SEM. n = 2–15. Data were analyzed using one-way ANOVA and Dunnett's post hoc analysis (* indicates P<0.05, ** indicates P<0.01, *** indicates P<0.001, and **** indicates P<0.0001). [Figure 11]Effects of C13 and C15 miR-25 mimics on fibrillar collagen (secretion) and TGF-β signaling pathway, mRNA, and protein expression. LX-2 cells were transfected with optimized concentrations of C13 and C15 (5, 20, and 40 pmol / mL), as well as a negative control (-ve; a nonspecific C. elegans miRNA mimic; 20 pmol / mL). mRNA expression of type 3α fibrillar collagen and TGF-β receptor 1 was analyzed using qRT-PCR 48 hours after transfection. Data are presented as mean ± SEM. n = 3–5. Data were analyzed using one-way ANOVA with Dunnett's post-hoc analysis (* indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001, and **** indicates P < 0.0001). [Figure 12] Target gene analysis of HSC ECM regulatory factors using C3 miR-25 mimic. LX-2 cells were transfected with optimized concentrations of C3 (5, 20, 40 pmol / mL), a commercial miR-25 mimic (CM; 20 pmol / mL), and a negative control (-ve; nonspecific C. elegans miRNA mimic; 20 pmol / mL). mRNA expression of collagen regulatory factors was analyzed using qRT-PCR 48 hours after transfection. Data are presented as mean ± SEM. n = 6–16. Data were analyzed using one-way ANOVA with Dunnett's post-hoc analysis (* indicates P < 0.05, ** indicates P < 0.01, and *** indicates P < 0.001). [Figure 13]Effect of C3 mimetic on markers of HSC activation. LX-2 cells were transfected with C3 (20 and 40 pmol / mL), a commercial miR-25 mimetic (CM; 20 and 40 pmol / mL), and a nonspecific C. elegans miRNA mimetic (-ve; 40 pmol / mL) as a negative control. (A) Cell migration analysis. A wound was created on a confluent cell layer using a curette. Wound width (μm) was measured every 2 hours for 24 hours using an IncuCyte Zoom Live Cell Analysis System (left panel). Wound width after 24 hours is shown in the right panel. (B) Cell proliferation analysis. Cells were incubated in an IncuCyte Zoom Live Cell Analysis System for up to 7 days, and confluency was measured every 3 hours (left panel). The growth rate over time was calculated as the proliferation constant (K; right panel). (C) Cell contractility analysis. Transfected cells were replated onto collagen lattices, and 48 hours after transfection, endothelin-1 (10 nM) was added to stimulate contraction. Contraction of the collagen matrix was measured 0.5, 1, 2.5, and 6 hours after addition of endothelin-1 (left panel). The collagen area after 6 hours is shown in the right panel. Data are presented as mean ± SEM. n = 5–16. Data were analyzed using one-way ANOVA with Dunnett's post-hoc analysis. DETAILED DESCRIPTION OF THE INVENTION

[0018] Detailed Description of the Invention 1.Definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described. For purposes of the present invention, the following terms are defined as follows:

[0019] As used herein, the indefinite articles "a" and "an" are used to refer to or encompass singular or plural elements or features and should not be construed as meaning or defining "one" or "single" element or feature. For example, "a" protein includes one protein, one or more proteins, or multiple proteins.

[0020] The term "about," as used herein, refers to a normal error range for the respective value, which is readily known to one skilled in the art. As used herein, when "about" is used in reference to a value or parameter, it includes (describes) embodiments directed to the value or parameter itself.

[0021] The term "drug" includes compounds that induce a desired pharmacological and / or physiological effect. The term also encompasses pharmaceutically acceptable and pharmacologically active components of the compounds specifically referred to herein, including, but not limited to, salts, esters, amides, prodrugs, active metabolites, analogs, and the like. When the above term is used, it is understood to include the active agent itself, as well as pharmaceutically acceptable, pharmacologically active salts, esters, amides, prodrugs, metabolites, analogs, and the like. The term "drug" is not intended to be narrowly construed, but extends to small molecules, bicyclic peptidomimetics (e.g., peptides, polypeptides, and proteins) and compositions comprising them, and genetic molecules (e.g., RNA, DNA, and mimetics and chemical analogs thereof), and cellular agents.

[0022] As used herein, "and / or" refers to and includes any and all possible combinations of one or more of the associated listed items, and also refers to and includes no combinations when interpreted as an alternative (or).

[0023] By "coding sequence" is meant any nucleic acid sequence that contributes to encoding the polypeptide product of a gene or the final mRNA product of a gene (e.g., the mRNA product of a gene after splicing). In contrast, the term "non-coding sequence" refers to any nucleic acid sequence that does not contribute to encoding the polypeptide product of a gene or the final mRNA product of a gene.

[0024] Throughout this specification, unless the context requires otherwise, the word "comprise" or "comprises" or "comprising ...

[0025] " Complementary " means that each nucleic acid base of the oligonucleotide can be paired with the nucleic acid base at each corresponding position of the target nucleic acid.In certain embodiments, the oligonucleotide is completely complementary to microRNA, that is, each nucleic acid base of the oligonucleotide is complementary to the nucleic acid base at the corresponding position of the microRNA.In certain embodiments, the oligonucleotide in which each nucleic acid base has complementarity with the nucleic acid base in the region of the microRNA stem-loop sequence is completely complementary to the microRNA stem-loop sequence.

[0026] "Corresponds to" refers to a nucleotide sequence that exhibits substantial sequence similarity or identity with a reference amino acid sequence. Generally, the amino acid sequence exhibits at least about 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 97, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or even up to 100% sequence similarity or identity with at least a portion of the reference amino acid sequence.

[0027] By "derivative" is meant a molecule, such as a nucleotide sequence, derived from a base molecule by, for example, conjugation or complexation with other chemical moieties, or modification by post-translational modification techniques as are understood in the art. The term "derivative" also encompasses alterations made to the parent sequence, including additions or deletions, that provide for functionally equivalent molecules.

[0028] An "effective amount" is at least the minimum amount required to affect measurable improvement or prevention of a particular disorder. The effective amount herein may vary depending on factors such as the patient's condition, age, sex, and weight, as well as the ability of the polynucleotide to elicit a desired response in an individual. An effective amount is also an amount in which the therapeutically beneficial effects outweigh the toxic or adverse effects of treatment. For prophylactic use, beneficial or desired results include eliminating or reducing the risk, reducing the severity, or delaying the onset of disease, including biochemical, histological, and / or behavioral symptoms of the disease, its complications, and intermediate pathological phenotypes exhibited during the course of the disease. For therapeutic use, beneficial or desired results include clinical results such as reducing one or more symptoms caused by the disease, improving the quality of life of a person suffering from the disease, reducing the dose of other drugs required to treat the disease, enhancing the effectiveness of other drugs, such as through targeting, delaying disease progression, and / or prolonging survival. An effective amount can be administered in one or more administrations. For purposes of the present invention, an effective amount of a drug, compound, or pharmaceutical composition is an amount sufficient to directly or indirectly achieve prophylactic or therapeutic treatment. As understood in a clinical context, an effective amount of a drug, compound, or pharmaceutical composition may or may not be achieved in combination with another drug, compound, or pharmaceutical composition. Thus, an "effective amount" can be considered in the context of administering one or more therapeutic agents, and a single agent can be considered to be administered in an effective amount if a desired result can or is achieved in combination with one or more other agents.

[0029] The term "expression" refers to the biosynthesis of a gene product. For example, in the case of a coding sequence, expression includes transcription of the coding sequence into mRNA and translation of the mRNA into one or more polypeptides. Conversely, expression of a non-coding sequence includes only transcription of the non-coding sequence into a transcript. The term "expression" is also used herein to refer to the presence of a protein or molecule in a particular location, and therefore can be used interchangeably with "localization."

[0030] The term "expression" with respect to a gene sequence refers to the transcription of the gene to produce an RNA transcript (e.g., mRNA, antisense RNA, siRNA, shRNA, miRNA, etc.), and, if applicable, the translation of the resulting mRNA transcript into a protein. Thus, as will be clear from the context, expression of a coding sequence results from the transcription and translation of the coding sequence. Conversely, expression of a non-coding sequence results from the transcription of the non-coding sequence.

[0031] "Fibrosis" refers to the formation or development of excess fibrous connective tissue in an organ or tissue. In certain embodiments, fibrosis occurs as a repair or reactive process. In certain embodiments, fibrosis occurs in response to damage or injury. The term "fibrosis" should be understood as the formation or development of excess fibrous connective tissue in an organ or tissue as a repair or reactive process, as opposed to the formation of fibrous tissue as an abnormal component of the organ or tissue.

[0032] The term "high" as used herein refers to a measurement value that is greater than a normal measurement value, greater than a standard, such as a predetermined measurement value or a subgroup measurement value, or relatively greater than a measurement value of another subgroup. A normal measurement value can be determined according to any method available to those skilled in the art. The term "high value" can also refer to a measurement value that is equal to or greater than a predetermined measurement value, such as a predetermined cutoff value. If a subject does not have a "high value" for a particular marker, they have a "low value" for that marker. Generally, the cutoff value used to determine whether a subject has a "high value" or a "low value" should be selected so that the classification is clinically relevant.

[0033] "Hybridization" is used herein to refer to the pairing of complementary nucleotide sequences to produce DNA-DNA hybrids, DNA-RNA hybrids, or RNA-RNA hybrids. Complementary base sequences are base sequences related by the rules of base pairing. In DNA, A pairs with T, and C pairs with G. In RNA, U pairs with A, and C pairs with G. In this regard, the terms "match" and "mismatch," as used herein, refer to the possibility of hybridization of paired nucleotides in complementary nucleic acid strands. Matched nucleotides hybridize efficiently, such as the classical AT / U and GC base pairs described above. Mismatches are other nucleotide combinations that do not hybridize efficiently. In the present invention, the preferred mechanism of pairing involves hydrogen bonding, which can be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding between complementary nucleoside or nucleotide bases (nucleobases) of the strands of an oligomeric compound. For example, adenine and thymine are complementary nucleobases that pair through the formation of hydrogen bonds. Hybridization can occur under a variety of circumstances, as known to those skilled in the art.

[0034] The term "inhibitor," as used herein, refers to an agent that reduces or inhibits at least one function or biological activity of a target molecule.

[0035] The term "locked nucleic acid (LNA)" refers to a substituted, conformationally restricted sugar moiety comprising a methylene bridge between the 4' and 2' furanose ring atoms.

[0036] In this disclosure, the term "microRNA mimetic compound" can be used interchangeably with the terms "pro-miR-25," "miR-25 agonist," "microRNA agonist," "microRNA mimic," "miRNA mimic," or "miR-25 mimetic" and refers to an endogenous non-coding RNA of 18 to 25 nucleobases in length that is the product of cleavage of a pre-microRNA by the enzyme Dicer. Mature microRNAs are found in the microRNA database known as miRbase (http: / / microrna.sanger.ac.uk / ). In certain embodiments, microRNAs are abbreviated as "miR." The term "first strand" can be used interchangeably with the terms "antisense strand" or "guide strand," and the term "second strand" can be used interchangeably with the terms "sense strand" or "passenger strand."

[0037] "Nucleobase" means a heterocyclic moiety capable of non-covalent pairing with another nucleobase.

[0038] "Nucleoside" means a nucleobase linked to a sugar moiety.

[0039] "Nucleotide" means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.

[0040] As used herein, the terms "peptide," "polypeptide," and "protein" are used interchangeably to refer to polymers of amino acid residues and their variants and synthetic analogs. Thus, these terms apply to amino acid polymers in which one or more amino acid residues are synthetic non-natural amino acids, such as chemical analogs of the corresponding naturally occurring amino acids, as well as to naturally occurring amino acid polymers. These terms do not exclude modifications such as, for example, glycosylation, acetylation, phosphorylation, etc. Soluble forms of the subject peptides are particularly useful. Included in this definition are peptides containing one or more analogs of amino acids, including, for example, non-natural amino acids or polypeptides with substituted bonds.

[0041] The term "pharmaceutical composition" or "pharmaceutical formulation" refers to a preparation that is in a form that allows the biological activity of the active ingredient to be effective and that does not contain additional ingredients that are toxic and would not be tolerated by the subject to which the composition or formulation is administered. Such formulations are sterile. A "pharmaceutically acceptable" excipient (vehicle, additive) is one that can reasonably be administered to a mammalian subject to provide an effective amount of the active ingredient employed.

[0042] "Pharmaceutically acceptable carrier" means a pharmaceutical vehicle composed of a material that is not biologically or otherwise undesirable, i.e., the material may be administered to a subject together with a selected active agent without causing any or substantial adverse reactions. Carriers may include excipients and other additives, such as diluents, detergents, colorants, wetting or emulsifying agents, pH buffering agents, preservatives, transfection agents, and the like.

[0043] Similarly, a "pharmacologically acceptable" salt, ester, amide, prodrug, or derivative of a compound as provided herein is a salt, ester, amide, prodrug, or derivative that is not biologically or otherwise undesirable.

[0044] The term "phosphorothioate linkage" refers to an internucleoside linkage in which one of the non-bridging oxygen atoms has been replaced with a sulfur atom.

[0045] As used herein, the terms "prevent," "prevented," and "preventing" refer to prophylactic treatments that increase a subject's resistance to developing a disease or condition, or in other words, reduce the likelihood that a subject will develop a disease or condition, as well as treatments to reduce or completely eliminate a disease or condition after it has begun, or to prevent it from worsening. These terms also encompass preventing the onset of a disease or condition in a subject who may be predisposed to the disease or condition but has not yet been diagnosed with it.

[0046] The terms "reduce," "inhibit," "suppress," "diminish," and grammatical equivalents, when used in reference to the level of a substance and / or phenomenon in a first sample relative to a second sample, mean that the amount of the substance and / or phenomenon in the first sample is lower than that in the second sample by any amount that is statistically significant using art-recognized statistical analysis methods. In one embodiment, reduction can be determined subjectively, for example, when a patient mentions subjective perception of disease symptoms such as pain, fatigue, etc. In another embodiment, reduction can be determined objectively. In another embodiment, the amount of a substance and / or phenomenon in the first sample is at least 10% lower than the amount of the same substance and / or phenomenon in the second sample. In another embodiment, the amount of a substance and / or phenomenon in the first sample is at least 25% lower than the amount of the same substance and / or phenomenon in the second sample. In yet another embodiment, the amount of a substance and / or phenomenon in the first sample is at least 50% lower than the amount of the same substance and / or phenomenon in the second sample. In a further embodiment, the amount of a substance and / or phenomenon in a first sample is at least 75% lower than the amount of the same substance and / or phenomenon in a second sample. In yet another embodiment, the amount of a substance and / or phenomenon in a first sample is at least 90% lower than the amount of the same substance and / or phenomenon in a second sample. Alternatively, the difference may be expressed as an "n-fold" difference.

[0047] As used herein, the terms "salt" and "prodrug" include any pharmaceutically acceptable salt, ester, hydrate, or any other compound that, upon administration to a recipient, is capable of providing (directly or indirectly) an miR-25 mimetic of the invention, or an active metabolite or residue thereof. Suitable pharmaceutically acceptable salts include salts of pharmaceutically acceptable inorganic acids such as hydrochloric acid, sulfuric acid, phosphoric acid, nitric acid, carbonic acid, boric acid, sulfamic acid, and hydrobromic acid, or salts of pharmaceutically acceptable organic acids such as acetic acid, propionic acid, butyric acid, tartaric acid, maleic acid, hydroxymaleic acid, fumaric acid, citric acid, lactic acid, mucic acid, gluconic acid, benzoic acid, succinic acid, oxalic acid, phenylacetic acid, methanesulfonic acid, toluenesulfonic acid, benzenesulfonic acid, salicylic acid, sulfanilic acid, aspartic acid, glutamic acid, edetic acid, stearic acid, palmitic acid, oleic acid, lauric acid, pantothenic acid, tannic acid, ascorbic acid, and valeric acid. Base salts include, but are not limited to, those formed with pharmaceutically acceptable cations such as sodium, potassium, lithium, calcium, magnesium, ammonium, and alkylammonium. In addition, basic nitrogen groups may be quaternized with agents such as lower alkyl halides, such as methyl, ethyl, propyl, and butyl chlorides, bromides, and iodides; dialkyl sulfates, such as dimethyl and diethyl sulfate; and the like. However, it will be understood that non-pharmaceutically acceptable salts may also be useful in the preparation of pharmaceutically acceptable salts and are therefore within the scope of the present invention. The preparation of salts and prodrugs can be carried out by methods known in the art. For example, metal salts can be prepared by reacting the compounds of the present invention with metal hydroxides.

[0048] The term "sample," as used herein, includes any biological specimen extracted from a subject, which may be raw, processed, diluted, or concentrated. Samples include, but are not limited to, biological fluids such as whole blood, serum, red blood cells, white blood cells, plasma, saliva, urine, stool (i.e., feces), tears, sweat, sebum, nipple aspirate, ductal lavage, tumor exudate, synovial fluid, ascites, peritoneal fluid, amniotic fluid, cerebrospinal fluid, lymphatic fluid, fine needle aspirate, any other bodily fluid, cell lysate, cell secretory product, inflammatory fluid, semen, and vaginal secretions. Samples may include tissue samples and biopsies, tissue homogenates, and the like. Advantageous samples include those comprising detectable amounts of any one or more biomarkers as taught herein. Preferably, the sample is readily accessible by minimally invasive methods that allow for removal or isolation of the sample from the subject. In certain embodiments, the sample contains blood, particularly peripheral blood, or a fraction or extract thereof. Typically, the sample comprises blood cells, such as mature, immature, or developing leukocytes, including lymphocytes, polymorphonuclear leukocytes, neutrophils, monocytes, reticulocytes, basophils, coelomycetes, hemocytes, eosinophils, megakaryocytes, macrophages, dendritic cells, natural killer cells, or fractions (e.g., nucleic acid or protein fractions) of such cells. In a specific embodiment, the sample comprises leukocytes, including peripheral blood mononuclear cells (PBMCs).

[0049] The term "first strand" can be used interchangeably with the terms "antisense strand" or "guide strand," and the term "second strand" can be used interchangeably with the terms "sense strand" or "passenger strand."

[0050] "Stringency," as used herein, refers to the temperature and ionic strength conditions during hybridization, as well as the presence or absence of particular organic solvents and / or detergents. The higher the stringency, the higher the level of complementarity required between hybridizing nucleotide sequences.

[0051] "Stringent conditions" refer to conditions under which only nucleic acids that have a high frequency of complementary bases will hybridize.

[0052] The terms "subject," "patient," "host," or "individual," as used interchangeably herein, refer to any subject for whom treatment or prevention is desired, particularly a vertebrate subject, and even more particularly a mammalian subject. Suitable vertebrates within the scope of the present invention include, but are not limited to, primates (e.g., humans, monkeys and apes, macaques (e.g., cynomolgus monkeys such as Macaca fascicularis and / or rhesus monkeys (Macaca mulatta) and baboons (Papio ursinus)), and monkey species including marmosets (Callithrix species), squirrel monkeys (Saimiri species), and tamarins (Saguinus species), and chimpanzees (Pan pangolinus). Examples of suitable mammals include any member of the subphylum Chordata, including apes such as primates (e.g., rhesus, troglodytes), rodents (e.g., mice, rats, guinea pigs), lagomorphs (e.g., rabbits, hares), bovines (e.g., cows), ovines (e.g., sheep), caprines (e.g., goats), porcines (e.g., pigs), equines (e.g., horses), canines (e.g., dogs), felines (e.g., cats), birds (e.g., chickens, turkeys, ducks, geese, companion birds such as canaries and budgerigars), marine mammals (e.g., dolphins, whales), reptiles (e.g., snakes, frogs, lizards), and fish. In some embodiments, the subject is a mammal. In other embodiments, the subject is a human.

[0053] As used herein, terms such as "treatment" refer to a clinical intervention designed to alter the natural course of the treated individual or cell during its clinical pathological course. Desirable effects of treatment include, but are not limited to, reducing the rate of disease progression, ameliorating or alleviating the condition, and achieving remission or improving prognosis. For example, an individual is successfully treated if one or more symptoms associated with a fibrotic disorder are alleviated or eliminated, including reducing the proliferation of fibrosis (or destroying fibrosis), reducing symptoms caused by the disease, improving the quality of life of those suffering from the disease, reducing the dose of other medications required to treat the disease, and / or prolonging the survival of the individual.

[0054] The term "2'-O-fluoro" refers to a sugar having a fluoro modification at the 2' position.

[0055] The term "2'-O-methyl" refers to a sugar having an O-methyl modification at the 2' position.

[0056] Each embodiment described in this specification applies mutatis mutandis to all other embodiments unless otherwise specified.

[0057] 2. Composition The present invention is based, in part, on the discovery that phosphorothioate-linked and 2'-O-methyl-modified miR-25 mimetics significantly enhance the protective antifibrotic effects of miR-25 in activated human HSCs. Specifically, downregulation of the target genes FKBP14 and ADAM-17 was significantly increased compared to commercially available mimetics, resulting in the inhibition of TGF-βRI- and TGFβ-induced type 1a1 collagen (COL1A1) expression. Furthermore, mRNA expression of type I (COL1A1, COL1A2) and type III (COL3A1) fibrillar collagens was also significantly downregulated. Thus, the present invention provides novel miR-25 mimetics that can be used as novel antifibrotic therapeutic agents to control the progression of fibrosis due to their improved efficacy in inhibiting TGF-β-induced fibrillar collagen expression.

[0058] 2.1 miR-25 mimetics MicroRNAs (miRNAs) are a class of non-coding RNAs found in plants and animals that control gene expression by binding to complementary sites on target messenger RNA (mRNA) transcripts. miRNAs are generated from larger RNA precursors (called pri-miRNAs) and processed in the nucleus to form approximately 70-nucleotide pre-mRNAs that fold into an incomplete stem-loop structure. The pre-miRNAs undergo further processing in the cytoplasm, where the RNase III enzyme Dicer excises mature miRNAs, 18–25 nucleotides long, from either side of the pre-miRNA hairpin.

[0059] miRNAs have been shown to regulate gene expression in two ways. First, miRNAs that bind to protein-coding mRNA sequences that are exactly complementary to the miRNA induce the RNA-mediated interference (RNAi) pathway, where the messenger RNA target is cleaved by ribonucleases in the RISC complex. In the second mechanism, miRNAs that bind to imperfectly complementary sites on messenger RNA transcripts regulate genes at the post-transcriptional level but do not cleave their mRNA targets. miRNAs identified in both plants and animals use this mechanism to control the translation of gene targets.

[0060] As used herein, "microRNA" (miRNA or miR) includes mature single-stranded miRNA precursor miRNA (pre-miR) and their naturally occurring variants.In some cases, the term "miRNA" also includes primary miRNA transcripts and double-stranded miRNA.Unless otherwise specified, when used herein, the name of a specific miRNA refers to the mature miRNA of precursor miRNA.For example, miR-25 refers to the mature miRNA sequence derived from pre-miR-25.

[0061] The native mature pri-miR-25 sequence (hsa-miR-25-3p miRBase accession number MIMAT0000081) is shown below. [ka]

[0062] The miR-25 mimetics of the present invention comprise a first strand and a second strand, wherein the first strand comprises, consists of, or consists essentially of the mature miR-25 sequence (i.e., CAUUGCACUUGUCUCGGUCUGA [SEQ ID NO: 3]), and the second strand comprises a sequence substantially complementary to the first strand and has at least one modified nucleotide.

[0063] In some embodiments, the nucleotide sequence set forth in SEQ ID NO:3, or a fragment, variant, or derivative thereof, has a two nucleotide residue overhang at the 3'-end and does not contain a modification at the second position of the nucleotide at both the 5'-end and the 3'-end, and the second strand comprises a sequence substantially complementary to the first strand, contains a modification at the first residue at the 3'-end, and has a modified linker between each of the last seven nucleotides at the 5'-end. The term "modified nucleotide" refers to a nucleotide in which the nucleobase and / or sugar moiety is modified relative to an unmodified nucleotide.

[0064] In some embodiments, the first strand of the microRNA mimetic compound comprises about 24 nucleotides comprising the sequence of mature miR-25, and the second strand comprises around 24 nucleotides comprising a sequence that is partially, substantially, or fully complementary to the first strand. In various embodiments, the first strand can comprise about 22, 23, 24, 25, or 26 nucleotides, and the second strand can comprise about 22, 23, 24, 25, or 26 nucleotides.

[0065] The nucleotides that form the first strand of the microRNA mimetic compound can comprise ribonucleotides, deoxyribonucleotides, modified nucleotides, and combinations thereof. In certain embodiments, the first and second strands of the microRNA mimetic comprise ribonucleotides and / or modified ribonucleotides. The term "modified nucleotide" refers to a nucleotide in which the nucleobase and / or sugar moiety is modified relative to an unmodified nucleotide.

[0066] In certain embodiments, a microRNA mimetic compound has a first or antisense strand (whose sequence is identical to all or a portion of the mature miR-25 sequence) and a second or sense strand (whose sequence is about 70% to about 100% complementary to that of the first strand). In some embodiments, the first strand of the miRNA mimetic compound is at least about 75, 80, 85, 90, 95, or 100% identical to the entire sequence of a mature, native miR-25 sequence (including all integers therebetween). In certain embodiments, the first strand is about, or at least about 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identical to the sequence of a mature, native miRNA, such as a human, mouse, or rat miR-25 sequence. Alternatively, the first strand may comprise 20, 21, 22, or 23 nucleotide positions in common with a mature, native miRNA when compared using sequence alignment algorithms and methods well known in the art.

[0067] It is understood that the sequence of the first strand is considered identical to the sequence of mature miR-25 even if the first strand contains modified nucleotides instead of natural nucleotides. For example, if the mature native miRNA sequence contains a cytidine nucleotide at a specific position, the first strand of the mimetic compound may contain a modified cytidine nucleotide, such as 2'-fluoro-cytidine, at the corresponding position. Alternatively, if the mature native miRNA sequence contains a uridine nucleotide at a specific position, the miRNA region of the first strand of the mimetic compound may contain a modified uridine nucleotide, such as 2'-fluoro-uridine, 2'-O-methyl-uridine, 5'-fluorouracil, or 4-thiouracil, at the corresponding position. Thus, as long as the modified nucleotide has the same base pairing ability as the nucleotide present in the mature native miRNA sequence, the sequence of the first strand is considered identical to the mature native miRNA sequence. In some embodiments, the first strand may have a 5'-terminal monophosphate. In some other embodiments, the first strand does not contain a 5'-terminal monophosphate.

[0068] In some embodiments, the second strand of the microRNA mimetic compound is partially complementary to the sequence of the first strand. For example, the sequence of the second strand is at least about 70, 75, 80, 85, 90, 95, or 99% complementary to the sequence of the first strand (including all integers therebetween). In yet some other embodiments, the sequence of the second strand can be completely complementary to the first strand. In certain embodiments, a complementary region of about 19, 20, 21, 22, or 23 nucleotides of the second strand can be complementary to the first strand.

[0069] In some embodiments, the second strand comprises about 1, 2, 3, 4, 5, or 6 mismatches with respect to the first strand. That is, 1, 2, 3, 4, 5, or up to 6 nucleotides between the first and second strands may not be complementary. In one embodiment, the mismatches are not contiguous but are distributed throughout the second strand. In another embodiment, the mismatches may be contiguous and form bulges. In some embodiments, the second strand comprises 1, 2, or 3 mismatches with respect to the first strand.

[0070] In some embodiments, the first and / or second strands of the mimetic compound may comprise an overhang at the 5' or 3' end of the strand. In certain embodiments, the first strand comprises a 3' overhang, i.e., a single-stranded region extending beyond the duplex region relative to the second strand. The 3' overhang of the first strand may range from about 1 nucleotide to about 4 nucleotides. In certain embodiments, the 3' overhang of the first strand may comprise one or two nucleotides. In some embodiments, the nucleotides comprising the 3' overhang of the first strand are linked by phosphorothioate bonds. The nucleotides comprising the 3' overhang of the first strand may comprise ribonucleotides, deoxyribonucleotides, modified nucleotides, or a combination thereof. In certain embodiments, the 3' overhang of the first strand comprises two uridine nucleotides linked by phosphorothioate bonds. In some embodiments, the first strand may not comprise an overhang.

[0071] In certain embodiments, the second strand comprises a 3' overhang, i.e., a single-stranded region extending beyond the duplex region relative to the first strand. The 3' overhang of the second strand can range from about 1 nucleotide to about 4 nucleotides. In certain embodiments, the 3' overhang of the second strand can comprise 1 or 2 nucleotides. In some embodiments, the nucleotides comprising the second strand 3' overhang are linked by phosphorothioate bonds. The nucleotides comprising the second strand 3' overhang can comprise ribonucleotides, deoxyribonucleotides, modified nucleotides, or combinations thereof. In certain embodiments, the 3' overhang of the second strand comprises two 2'-O-methyl-uridine nucleotides linked by phosphorothioate bonds. In some embodiments, the second strand may not comprise an overhang.

[0072] In some embodiments, the nucleotides of the second / sense strand of the miR-25 mimetic of the invention are linked by phosphodiester bonds, except for the last five nucleotides at the 3' end, which are linked to each other by phosphorothioate bonds. In some embodiments, the nucleotides of the first / antisense strand of the miR-25 mimetic of the invention are linked by phosphodiester bonds, except for the last two or three nucleotides at the 3' end, which are linked to each other by phosphorothioate bonds.

[0073] In various embodiments, the miR-25 mimic of the present invention comprises modified nucleotides.For example, in some embodiments, the first strand of the mimic comprises one or more 2'-O-methyl modified nucleotides.In some of the same embodiments and in some other embodiments, the first strand comprises one or more 2'-fluoro nucleotides.In some preferred embodiments, the first strand may not comprise modified nucleotides.

[0074] In some embodiments, the second strand comprises one or more 2'-O-methyl modified nucleotides. In some preferred embodiments of this type, the last seven nucleotides at the 3' end are 2'-O-methyl modified nucleotides.

[0075] In some embodiments, the first strand does not include a modified nucleotide at the second position of either the 5' or 3' terminus. In this regard, the first strand may comprise a modified nucleotide at the second position penultimate to the 5' terminus. Alternatively, the first strand may comprise a modified nucleotide at the second position penultimate to the 3' terminus.

[0076] In various embodiments, miR-25 mimetics according to the invention comprise a first strand and a second strand listed in Tables 1 and 2 below. Modification definitions are presented in Table 3. These miR-25 mimetic compounds are useful for regulating extracellular matrix gene expression in cells and for treating related pathologies such as fibrosis.

[0077] [Table 1]

[0078] [Table 2]

[0079] [Table 3]

[0080] In certain embodiments, the miR-25 mimetic comprises a first strand comprising SEQ ID NO: 2 and a second strand comprising SEQ ID NO: 5. In other embodiments, the miR-25 mimetic comprises a first strand comprising SEQ ID NO: 14 and a second strand comprising SEQ ID NO: 5. In yet other embodiments, the miR-25 mimetic comprises a first strand comprising SEQ ID NO: 16 and a second strand comprising SEQ ID NO: 5.

[0081] In some other embodiments, the miR-25 mimetic comprises a first strand comprising SEQ ID NO:4 and a second strand comprising SEQ ID NO:5. In still other embodiments, the miR-25 mimetic may comprise a first strand comprising SEQ ID NO:11 and a second strand comprising SEQ ID NO:5. In still other embodiments, the miR-25 mimetic may comprise a first strand comprising SEQ ID NO:12 and a second strand comprising SEQ ID NO:5. In still yet other embodiments, the miR-25 mimetic comprises a first strand comprising SEQ ID NO:15 and a second strand comprising SEQ ID NO:5. In still other embodiments, the miR-25 mimetic comprises a first strand comprising SEQ ID NO:17 and a second strand comprising SEQ ID NO:5.

[0082] Modifications that can be used in the miR-25 mimicking compounds of the present disclosure can include nucleotides with base modifications or substitutions. Natural or unmodified bases in RNA are adenine (A) and guanine (G) as purine bases, and cytosine (C) and uracil (U) as pyrimidine bases (DNA has thymine (T)). In contrast, modified bases, also called heterocyclic base moieties, include 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and other alkynyl derivatives of cytosine and pyrimidine bases, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 5-isopropyl ... and other synthetic and natural nucleobases such as 8-substituted adenines and guanines, 5-halo (5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines), 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, and 3-deazaguanine and 3-deazaadenine.

[0083] In other embodiments, the modification comprises one or more backbone alterations, such as a 2'-fluororibose structure, a C5-halogenated pyrimidine, a phosphorothioate group, or a pyrimidine comprising a 2'-O-methylribose structure. In a preferred embodiment, the modification comprises a 2'-fluororibose structure modification. In an even more preferred embodiment, the modification comprises a 2'-O-methylribose structure modification.

[0084] In some embodiments, modifications can include nucleotides with modified sugar moieties. Exemplary modified sugars include carbocyclic or acyclic sugars, sugars with a substituent at one or more of their 2', 3', or 4' positions, and sugars with a substituent in place of one or more hydrogen atoms of the sugar. In certain embodiments, the sugar is modified by having a substituent at the 2' position. In further embodiments, the sugar is modified by having a substituent at the 3' position. In other embodiments, the sugar is modified by having a substituent at the 4' position. It is also contemplated that sugars may have modifications at more than one of these positions, or that an RNA molecule may have one or more nucleotides with a sugar modification at one position and one or more nucleotides with a sugar modification at a different position.

[0085] Sugar modifications contemplated in miRNA mimetic compounds include, but are not limited to, a substituent selected from OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-, or N-alkynyl; or O-alkyl-O-alkyl, where alkyl, alkenyl, and alkynyl are substituted or unsubstituted C1-C6 10 Alkyl or C2-C 10 It can be alkenyl and alkynyl.

[0086] In some embodiments, the miRNA mimetic compounds are: C1 to C2 10The sugar substituents are selected from lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, CI, Br, CN, OCN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, or similar substituents. In one embodiment, the modification includes 2'-methoxyethoxy (2'-O-CH2CHOCH3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE), i.e., an alkoxyalkoxy group. Alternative modifications include the group O(CH)ON(CH), also known as 2'-dimethylaminooxyethoxy, i.e., 2'-DMAOE, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethyl-amino-ethoxy-ethyl or 2'-DMAEOE), i.e., 2'-O-CH-O-CH-N(CH).

[0087] The sugar substituent at the 2'-position (2'-) can be either an arabino (up) or ribo (down) position. One 2'-arabino modification is 2'-F. Other similar modifications can be made at other positions on the sugar moiety, particularly the 3' position of the sugar on the 3'-terminal nucleoside or in 2'-5' linked oligonucleotides and the 5' position of the 5'-terminal nucleotide.

[0088] In certain embodiments, sugar modifications are 2'-O-alkyl (e.g., 2'-O-methyl, 2'-O-methoxyethyl), 2'-halo (e.g., 2'-fluoro, 2'-chloro, 2'-bromo), and 4'-thio modifications. For example, in some embodiments, the first strand of the miR-25 mimetic compound comprises one or more 2'-fluoro nucleotides. In other embodiments, the first strand of the miR-25 mimetic compound has unmodified nucleotides. In yet other embodiments, the second strand of the miR-25 mimetic compound comprises one or more 2'-O-methyl modified nucleotides.

[0089] The first and second strands of the microRNA mimetic compounds of the present invention may also contain backbone modifications such as one or more phosphorothioate, morpholino, or phosphonocarboxylate bonds (see, e.g., U.S. Patent Nos. 6,693,187 and 7,067,641, which are incorporated herein by reference in their entireties). For example, in some embodiments, the nucleotides comprising the 3' overhang in the first and / or second strand are linked by phosphorothioate bonds. A phosphorothioate bond replaces a non-bridging oxygen in the phosphate backbone of the oligo with a sulfur atom. This modification makes the internucleotide bond less susceptible to degradation by nucleases. In some preferred embodiments, the first two nucleotides at the 5' end of the second strand are linked by phosphorothioate bonds.

[0090] In some embodiments, the microRNA mimetic compound is conjugated to a carrier molecule, such as a steroid (cholesterol), vitamin, fatty acid, carbohydrate or glycoside, peptide, or other small molecule ligand, to facilitate in vivo delivery and stability. Preferably, the carrier molecule is attached to the second strand of the microRNA mimetic compound at its 3' or 5' end via a linker or spacer group. In various embodiments, the carrier molecule is cholesterol, a cholesterol derivative, cholic acid, or a cholic acid derivative. The use of carrier molecules is also contemplated, for example, as disclosed in U.S. Patent No. 7,202,227, incorporated herein by reference in its entirety. In certain embodiments, the carrier molecule is cholesterol, attached to the 3' or 5' end of the second strand via a linker of at least six carbon atoms. In some embodiments, the linker is a cleavable linker. In various embodiments, the linker comprises a substantially linear hydrocarbon moiety. The hydrocarbon moiety may comprise from about 3 to about 15 carbon atoms. In certain embodiments, the hydrocarbon linker / spacer comprises an optionally substituted C2-C15 saturated or unsaturated hydrocarbon chain (e.g., alkylene or alkenylene). A variety of linker / spacer groups described in U.S. Pat. No. 9,012,225, the entire contents of which are incorporated herein by reference, can be used in the present invention.

[0091] 3. Pharmaceutical Compositions The present disclosure also provides pharmaceutical compositions comprising a therapeutically effective amount of one or more miR-25 mimetic compounds described above and / or elsewhere herein and a pharmaceutically acceptable carrier or excipient. In accordance with the present invention, the first strand of the mimetic compound generally comprises the mature miR-25-3p sequence, and the second strand is substantially complementary to the first strand.

[0092] The present invention also encompasses embodiments in which an additional therapeutic agent can be administered together with the miR-25 mimetic compound. In one embodiment, the additional therapeutic agent is a second antifibrotic agent. The additional therapeutic agent can be administered simultaneously in separate formulations or sequentially. In other embodiments, the additional therapeutic agent can be administered at different times, before or after administration of the miR-25 mimetic compound. When clinical applications are intended, pharmaceutical compositions are prepared in a form appropriate for the intended application. Generally, this requires preparing compositions that are essentially free of pyrogens and other impurities that may be harmful to humans or animals.

[0093] Colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems, including oil-in-water emulsions, micelles, mixed micelles, liposomes, and exosomes, can be used as delivery vehicles for miR-25 mimetic compounds. In some embodiments, the miR-25 mimetics of the present invention can be formulated as liposomal particles, which can then be aerosolized for inhalation delivery.

[0094] Commercially available lipid emulsions suitable for delivering the nucleic acid of the present invention to target tissues include Intralipid®, Liposyn®, Liposyn® II, Liposyn® III, Nutrilipid, and other similar lipid emulsions. A preferred colloidal system for use as a delivery vehicle in vivo is a liposome (i.e., an artificial membrane vesicle). The preparation and use of such systems are well known in the art. Exemplary formulations are also disclosed in U.S. Pat. Nos. 5,981,505; 6,217,900; 6,383,512; 5,783,565; 7,202,227; 6,379,965; 6,127,170; 5,837,533; and 6,747,014; and WO 03 / 093449, which are incorporated by reference in their entireties.

[0095] In certain embodiments, the liposomes used for delivery are amphoteric liposomes, such as SMARTICLES® (Marina Biotech, Inc.), which are described in detail in U.S. Patent Application Publication No. 2011 / 0076322. The surface charge on SMARTICLES® is fully reversible, making them particularly suitable for delivery of nucleic acids. SMARTICLES® can be delivered by injection, remain stable, and deliver nucleic acids across cell membranes without aggregation.

[0096] Generally, it is desirable to employ appropriate salts and buffers to stabilize the delivery vehicle and enable uptake by target cells. Aqueous compositions of the present invention contain an effective amount of a delivery vehicle (e.g., a liposome or other complex) comprising a miR-25 mimic dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium. The phrases "pharmaceutically acceptable" or "pharmacologically acceptable" refer to molecular entities and compositions that do not produce harmful, allergic, or other untoward reactions when administered to animals or humans. As used herein, "pharmaceutically acceptable carrier" includes solvents, buffers, solutions, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, that are acceptable for use in formulating pharmaceuticals, e.g., pharmaceuticals suitable for administration to humans. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as conventional media or agents are incompatible with the active ingredients of the present invention, their use in therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions, as long as they do not inactivate the polynucleotides of the composition.

[0097] In one embodiment, the pharmaceutical compositions of the present invention are prepared for pulmonary, nasal, intranasal, or ocular delivery and may be in the form of powders, aqueous solutions, aqueous aerosols, nasal drops, aerosols, and / or eye drops. Solid formulations for nasal / intranasal administration may contain excipients such as lactose or dextran. Liquid formulations for nasal / intranasal administration may be aqueous or oily solutions for use in the form of aerosols, nasal drops, or metered-dose sprays. Formulations for pulmonary / intranasal administration may also include surfactants such as glycocholic acid, cholic acid, taurocholic acid, ethocholic acid, deoxycholic acid, chenodeoxycholic acid, dehydrocholic acid, glycodeoxycholic acid, salts of these acids, and cyclodextrins.

[0098] In some embodiments, formulations for pulmonary / nasal / intranasal administration by inhalation include, but are not limited to, dry powder, liposomal, nanosuspension, or microsuspension formulations.

[0099] In some embodiments, pharmaceutical compositions for pulmonary / nasal / intranasal delivery are administered using an inhalation device. The term "inhalation device" refers to any device capable of administering a miR-25 mimicking composition to a subject's respiratory tract. Inhalation devices include devices such as metered-dose inhalers (MDIs), dry-powder inhalers (DPIs), jet nebulizers, ultrasonic nebulizers, thermal vaporizers, soft-mist inhalers, thermal aerosol inhalers, and electrohydrodynamic solution mist inhalers. Inhalation devices also include high-efficiency nebulizers. In some embodiments, the nebulizer is a jet nebulizer, ultrasonic nebulizer, pulsating membrane nebulizer, nebulizer comprising a vibrating mesh or plate with multiple openings, nebulizer comprising a vibration generator and an aqueous chamber, or nebulizer that uses controlled device functions to assist the inspiratory flow of aerosolized aqueous solutions into the subject's lungs. Nebulizers, metered-dose inhalers, and soft-mist inhalers deliver medicaments by forming an aerosol containing droplets of easily inhalable size.

[0100] In some embodiments, compositions administered with a high-efficiency nebulizer comprise one or more miR-25 mimetics and a pharmaceutically acceptable excipient or carrier, such as purified water, mannitol, surfactants, and salts such as sodium chloride and sodium EDTA.

[0101] The active compositions of the present invention may include classic pharmaceutical preparations. Administration of these compositions according to the present invention may be via any common route, as long as the target tissue is accessible via that route. This includes oral, nasal (e.g., inhalation), ocular, or buccal. Alternatively, administration may be via intravenous, intradermal, subcutaneous, intraocular, or intramuscular injection, or via direct injection into lung, heart, liver, pancreas, kidney, tumor, or skin tissue. Pharmaceutical compositions comprising miRNA mimics may also be administered via a catheter system for delivering therapeutic agents to the heart or a system that isolates the coronary circulation. Various catheter systems for delivering therapeutic agents to the heart and coronary vasculature are known in the art.

[0102] Some non-limiting examples of catheter-based delivery methods or coronary artery isolation methods suitable for use in the present invention are disclosed in U.S. Patent No. 6,416,510; U.S. Patent No. 6,716,196; and U.S. Patent No. 6,953,466, International Publication No. 2005 / 082440 and International Publication No. 2006 / 089340, and U.S. Patent Application Publication No. 2007 / 0203445; U.S. Patent No. 2006 / 0148742 and U.S. Patent No. 2007 / 0060907, which are incorporated herein by reference in their entirety.Such compositions are usually administered as pharmaceutically acceptable compositions as described herein.

[0103] In other embodiments of the present invention, compositions comprising miR-25 mimetics as described herein can be formulated as coatings for medical devices such as stents, balloons, or catheters. Particularly useful in methods for treating cardiac fibrosis in subjects, miR-25 mimetics can be used to coat metal stents to create drug-eluting stents. Drug-eluting stents are scaffolds that open narrowed or diseased arteries and release compounds to prevent cell proliferation and / or inflammation. The mimetic compounds are applied to metal stents embedded in a thin polymer, releasing agonists or inhibitors over time. As with drug-eluting stents and other implantable devices, device-based delivery methods and device coating methods are well known in the art. See, e.g., U.S. Pat. Nos. 7,294,329; 7,273,493; 7,247,313; 7,236,821; 7,232,573; 7,156,869; 7,144,422; 7,105,018; 7,087,263; 7,083,642; 7,055,237; 7,041,127; 6,716,242; and 6,589,286, as well as WO 2004 / 004602, which are incorporated herein by reference in their entireties. Thus, the present invention includes medical devices such as balloons, catheters, or stents coated with miR-25 mimetics.

[0104] Sterile injectable solutions can be prepared by incorporating the active compounds in the appropriate amount in a solvent with, if desired, other ingredients (e.g., as enumerated above), followed by filtration and sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the desired other ingredients (e.g., as enumerated above).

[0105] The composition of the present invention can generally be formulated in neutral or salt form.Pharmaceutically acceptable salts include, for example, acid addition salts (formed with the free amino group of protein) derived from inorganic acid (for example, hydrochloric acid or phosphoric acid) or organic acid (for example, acetic acid, oxalic acid, tartaric acid, mandelic acid, etc.).The salts formed with the free carboxyl group of protein can also be derived from inorganic bases (for example, sodium, potassium, ammonium, calcium, or ferric hydroxide) or organic bases (for example, isopropylamine, trimethylamine, histidine, procaine, etc.).

[0106] When formulated, the solution is preferably administered in a manner compatible with the dosage form and in a therapeutically effective amount.The formulation can be easily administered in a variety of dosage forms, such as injections, drug-releasing capsules, drug-eluting stents or other coated vascular devices.For example, when administered parenterally in aqueous solution, the solution is generally suitably buffered, and the liquid diluent is first rendered isotonic with, for example, sufficient saline or glucose.Such aqueous solutions can be used, for example, for intravenous, intramuscular, subcutaneous, intradermal, intraocular, and intraperitoneal administration.

[0107] The pharmaceutical composition of the present invention can be easily formulated into a suitable dosage by using pharmaceutically acceptable carriers well known in the art.Such carriers allow the compound of the present invention to be formulated into dosage forms such as tablets, pills, capsules, liquids, gels, syrups, slurries, suspensions, etc., for administration to the subject to be treated.For example, the pharmaceutical composition formulated for oral ingestion contains suitable carriers selected from, for example, sugar, starch, cellulose and its derivatives, malt, gelatin, talc, calcium sulfate, vegetable oil, synthetic oil, polyol, alginic acid, phosphate buffer, emulsifier, isotonic saline and pyrogen-free water.

[0108] Pharmaceutical compositions suitable for use in the present invention include compositions containing an active ingredient in an amount effective to achieve its intended purpose. The dosage of the drug administered to a patient should be sufficient to induce a beneficial response in the patient over time, such as a reduction in symptoms associated with the condition. The dosage of the therapeutic / prophylactic agent may vary depending on the subject being treated, including age, sex, weight, and general health. In this regard, the precise amount of therapeutic / prophylactic agent to be administered is at the discretion of the physician. In determining the effective amount of drug to be administered in treating or preventing a condition, one skilled in the art can assess tissue levels of polypeptide antigens and the progression of the disease or condition. In any event, one skilled in the art can easily determine the appropriate dosage of the therapeutic and / or prophylactic agent of the present invention.

[0109] Pharmaceutical preparations for parenteral administration include aqueous solutions of water-soluble active compounds.In addition, suspensions of active compounds can be prepared as oily injection suspensions if applicable.Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters such as ethyl oleate or triglycerides, or liposomes.Aqueous injection suspensions can contain substances that increase the viscosity of suspensions, such as sodium carboxymethylcellulose, sorbitol, or dextran.In some cases, suspensions can also contain suitable stabilizers or agents that increase the solubility of compounds, so as to allow the preparation of highly concentrated solutions.

[0110] Pharmaceutical preparations for oral use can be obtained by combining the active compound with a solid excipient, optionally grinding the resulting mixture, optionally adding suitable auxiliary agents, and then processing the granular mixture to obtain tablets or dragee cores. Suitable excipients are, in particular, sugars including lactose, sucrose, mannitol, or sorbitol; fillers such as corn starch, wheat starch, rice starch, potato starch, gelatin, tragacanth gum, methylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, and / or cellulose preparations such as polyvinylpyrrolidone (PVP). If desired, disintegrants such as cross-linked polyvinylpyrrolidone, agar, or alginic acid or a salt thereof, such as sodium alginate, can be added. Such compositions can be prepared by any method of pharmacy, but all methods include the step of bringing one or more therapeutic agents, as described above, into association with a carrier that constitutes one or more necessary ingredients. In general, the pharmaceutical compositions of the present invention may be manufactured in a manner that is itself known, for example, by means of conventional mixing, dissolving, granulating, dragee-making, pulverizing, emulsifying, encapsulating, entrapping, or lyophilizing processes.

[0111] Dosage forms of the therapeutic agents of the present invention also include injection or implantation of controlled-release devices specifically designed for this purpose or other forms of implants modified to additionally act in this manner. For example, controlled release of the agents of the present invention can be affected by coating them with hydrophobic polymers, including acrylic resins, waxes, higher aliphatic alcohols, polylactic and polyglycolic acids, and certain cellulose derivatives, such as hydroxypropylmethylcellulose. Additionally, controlled release can be affected by using other polymer matrices, liposomes, and / or microspheres.

[0112] The therapeutic agents of the present invention can be provided as salts with pharmaceutically compatible counterions. Pharmaceutically compatible salts can be formed with many acids, including, but not limited to, hydrochloric acid, sulfuric acid, acetic acid, lactic acid, tartaric acid, malic acid, succinic acid, etc. Salts tend to be more soluble in aqueous or other protic solvents than the corresponding free base form.

[0113] Sterile injectable solutions can be prepared by incorporating the active compounds in the appropriate amount in a solvent with, if desired, other ingredients (e.g., as enumerated above), followed by filtration and sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the desired other ingredients (e.g., as enumerated above).

[0114] The compositions of the present invention are preferably pharmaceutical compositions. Pharmaceutical compositions often comprise one or more "pharmaceutically acceptable carriers." These include any carriers that do not themselves induce the production of antibodies harmful to the individual receiving the composition. Suitable carriers are generally large, slowly metabolized macromolecules, such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, and lipid aggregates (such as oil droplets or liposomes). Such carriers are well known to those skilled in the art. The composition may also contain diluents, such as water, saline, or glycerol. Additionally, auxiliary substances, such as wetting or emulsifying agents, pH buffering substances, and the like, may be present. A thorough discussion of pharmaceutically acceptable ingredients is available in Gennaro (2000) Remington: The Science and Practice of Pharmacy, 20th Edition, ISBN: 0683306472.

[0115] The compositions of the present disclosure can generally be formulated in neutral or salt form.Pharmaceutically acceptable salts include, for example, acid addition salts (formed with the free amino group of protein) derived from inorganic acids (for example, hydrochloric acid or phosphoric acid) or organic acids (for example, acetic acid, oxalic acid, tartaric acid, mandelic acid, etc.).Salts formed with the free carboxyl group of protein can also be derived from inorganic bases (for example, sodium, potassium, ammonium, calcium, or ferric hydroxide) or organic bases (for example, isopropylamine, trimethylamine, histidine, procaine, etc.).

[0116] When formulated, the solution is preferably administered in a manner compatible with the dosage form and in a therapeutically effective amount.The formulation can be easily administered in various dosage forms, such as injections, topical solutions, drug-eluting devices or other coated vascular devices.In certain embodiments, the miR-25 mimetic compound is formulated for administration by intravenous injection, intramuscular injection, subcutaneous injection, intranasal spray / inhalation, iontophoresis, subconjunctival injection, subtendon injection, intravitreal injection, intracameral injection, or topical administration.

[0117] Colloidal dispersion systems, such as macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems, such as oil-in-water emulsions, micelles, mixed micelles, liposomes, and exosomes, can be used as delivery vehicles for miR-25 mimicking compounds. In some embodiments, the miR-25 mimics of the present disclosure can be formulated as liposomal particles.

[0118] In some embodiments, pharmaceutical compositions of the present disclosure comprise two, three, four, five, six, seven, eight, nine, ten, or more miR-25 mimetics of the present disclosure. In some embodiments, pharmaceutical compositions comprise one or more miR-25 mimetics of the present disclosure and one or more other microRNAs or microRNA mimetics, including, but not limited to, miR-25 mimetics other than those disclosed herein.

[0119] 4.Dose The present invention generally relates to therapeutic and preventive compositions.The composition comprises an effective amount of the composition defined herein, so that the amount of miR-25 mimics that can be produced in vivo in the individual to which it is administered is such that it produces a therapeutic effect.The exact amount required varies depending on the subject to be treated; the age and general condition of the subject to be treated; the ability of the subject's immune system to synthesize antibodies; the desired degree of protection; the severity of the pathology to be treated; and its mode of administration etc.The appropriate effective amount can be easily determined by those skilled in the art.Therefore, the effective amount is in a relatively broad range that can be determined by routine testing.

[0120] Dosage and administration intervals can be adjusted individually to provide plasma levels of the active compound sufficient to maintain target antigen reduction or disease or condition amelioration. Typical patient doses for systemic administration range from about 1 μg to 500 μg, 0.5 mg to 200 mg, and generally about 20 μg to 500 μg.

[0121] In some embodiments, the pharmaceutical composition comprises a therapeutically effective amount of a miR-25 mimetic compound and a pharmaceutically acceptable carrier, wherein the pharmaceutically acceptable carrier is selected from water for injection (WFI), 0.9% (w / v) sodium chloride, 5 mM phosphate buffer, 10 mM phosphate buffer, 25 mM phosphate buffer, 50 mM phosphate buffer, 85 mM phosphate buffer, and 100 mM phosphate buffer.

[0122] In some embodiments, the pharmaceutical composition comprises 0.2 mg / mL to 200 mg / mL of a miR-25 mimetic. In some embodiments, the pharmaceutical composition comprises 0.2 mg / mL to 10 mg / mL, 10 mg / mL to 50 mg / mL, 50 mg / mL to 90 mg / mL, or 90 mg / mL to 120 mg / mL of a miR-25 mimetic. In some embodiments, the pharmaceutical composition comprises 0.2 mg / mL to 1 mg / mL, 1 mg / mL to 5 mg / mL, 5 mg / mL to 10 mg / mL, 10 mg / mL to 20 mg / mL, 20 mg / mL to 30 mg / mL, 30 mg / mL to 40 mg / mL, 40 mg / mL to 50 mg / mL, 50 mg / mL to 60 mg / mL, 60 mg / mL to 70 mg / mL, 70 mg / mL to 90 mg / mL, or 90 mg / mL to 120 mg / mL of a miR-25 mimetic. In some embodiments, the pharmaceutical composition comprises at least about 0.1 mg / ml, at least about 0.2 mg / ml, at least about 0.3 mg / mL, at least about 0.5 mg / mL, at least about 1 mg / mL, at least about 2 mg / mL, at least about 3 mg / mL, at least about 4 mg / mL, at least about 5 mg / mL, at least about 7 mg / mL, at least about 10 mg / mL, at least about 20 mg / mL, at least about 30 mg / mL, at least about 40 mg / mL, at least about 50 mg / mL, at least about 60 mg / mL, at least about 70 mg / mL, at least about 80 mg / mL, at least about 90 mg / mL, or at least about 100 mg / mL of a miR-25 mimetic.

[0123] In some embodiments, the pharmaceutical composition comprises about 100 mg / mL, about 70 mg / mL, about 35 mg / mL, about 7 mg / mL, about 3.5 mg / mL, about 0.7 mg / mL, or about 0.35 mg / mL of the miR-25 mimetic. In some embodiments, the pharmaceutical composition comprises about 70 mg / mL and the miR-25 mimetic. In some embodiments, the pharmaceutical composition comprises about 35 mg / mL of the miR-25 mimetic.

[0124] In some embodiments, the pharmaceutical composition has a pH of 4 to 9. In some embodiments, the pharmaceutical composition has a pH of about 4, about 4.5, about 5, about 5.5, about 6, about 6.5, about 7, about 7.5, about 8, about 8.5, or about 9.

[0125] Alternatively, drugs can be administered locally rather than systemically, for example, by injecting the compound directly into the tissue, often in a depot or sustained-release formulation. Furthermore, drugs can be administered in targeted drug delivery systems, such as liposomes coated with tissue-specific antibodies, which are targeted to and taken up selectively by the tissue.

[0126] For any compound used in the method of the present invention, effective dose can be estimated first from cell culture assay.For example, the dose can be adjusted in animal model to achieve a circulating concentration range that includes the IC50 (for example, the concentration of test agent that achieves half-life of target antigen) determined in cell culture.This information can be used to more accurately determine the useful dose in mammals.

[0127] The toxicity and therapeutic efficacy of compounds of the invention can be determined by standard pharmaceutical procedures in cell cultures or experimental animals to determine, for example, the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index, which can be expressed as the ratio LD50 / ED50. Compounds that exhibit large therapeutic indices are preferred. Data obtained from these cell culture assays and animal studies can be used to refine a range of dosages for use in subjects. The dosage of such compounds preferably lies within a range of circulating concentrations that includes the ED50 with little or no toxicity. Dosages can vary within this range depending on the dosage form employed and the route of administration utilized. The exact formulation, route of administration, and dosage can be selected by the individual physician in view of the subject's condition. (See, e.g., Fingl et al., 1975, in "The Pharmacological Basis of Therapeutics," Ch. 1, p. 1.)

[0128] The compositions of the present invention can be formulated for injection. The compositions can be prepared in unit dosage form in ampoules or in multi-dose containers. The polynucleotide can be in a form such as a suspension, solution, or emulsion in an oily or, preferably, aqueous vehicle. Alternatively, the polynucleotide salt can be in a lyophilized form for reconstitution with a suitable vehicle, such as sterile, pyrogen-free water, at the time of delivery. Both the liquid and lyophilized forms for reconstitution contain an amount of agent, preferably a buffer, necessary to appropriately adjust the pH of the injection. For parenteral use, particularly when the formulation is for intravenous administration, the total concentration of solutes must be controlled to render the formulation isotonic, hypotonic, or weakly hypertonic. Nonionic substances such as sugars are preferred for adjusting tonicity, with sucrose being particularly preferred. All of these forms can further comprise suitable formulating agents, such as starch or sugar, glycerol, or saline. The composition per unit dosage, whether liquid or solid, can contain 0.1% to 99% polynucleotide material.

[0129] The unit-dose ampoules or multi-dose containers in which the polynucleotides are packaged prior to use may comprise a quantity of the polynucleotide or polynucleotide-containing solution appropriate for a pharmaceutically effective dose thereof, or a sealed container enclosing a multiple effective dose. The polynucleotides are packaged as a sterile formulation, and the sealed container is designed to preserve the sterility of the formulation until use.

[0130] The dose administered depends largely on the condition and size of the subject being treated, as well as the frequency and route of administration. The regimen for continued treatment, including the dose and frequency of administration, is guided by the initial response and clinical judgment. Although the parenteral route of injection into the interstitial space of tissue is preferred, certain administrations, such as administration into the mucous membranes of the nose, throat, bronchial tissues, or lungs, may require other parenteral routes, such as inhalation of aerosol formulations.

[0131] 5.Treatment method In various embodiments, the present disclosure provides methods for treating, ameliorating, or preventing a fibrotic condition in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a miR-25 mimetic described herein.

[0132] Fibrotic conditions treatable using the miR-25 mimetics of the present disclosure include, but are not limited to, liver fibrosis, kidney fibrosis, pulmonary fibrosis, cardiac fibrosis, skin fibrosis, age-related fibrosis, spleen fibrosis, scleroderma, and / or post-transplant fibrosis.

[0133] In certain embodiments, the fibrosis is liver fibrosis and is present in a subject having a disease selected from chronic liver damage, hepatitis infection (such as hepatitis B infection and / or hepatitis C infection), non-alcoholic steatohepatitis, alcoholic liver disease, liver damage following exposure to environmental toxins and / or natural products, and cirrhosis.

[0134] In certain embodiments, the pulmonary fibrosis is idiopathic pulmonary fibrosis or the subject has chronic obstructive pulmonary disease.

[0135] In some embodiments, the fibrosis is renal fibrosis and is present in subjects with a disease or condition selected from glomerulosclerosis, tubulointerstitial fibrosis, IgA nephropathy, intestinal fibrosis / tubular atrophy, chronic kidney injury, chronic kidney disease, glomerular disease, glomerulonephritis, diabetes, idiopathic focal segmental glomerulosclerosis, membranous nephropathy, destructive glomerulopathy, chronic recurrent renal infection, chronic kidney disease after acute kidney injury (AKI), kidney damage after exposure to environmental toxins and / or natural products, and end-stage renal disease. In certain embodiments, the renal fibrosis is caused by acute or repeated trauma to the kidney.

[0136] In certain embodiments, the disease is an inflammatory disease.

[0137] In some embodiments, administration of a miR-25 mimetic of the present disclosure reduces the expression or activity of one or more extracellular matrix genes in cells of a subject. In another embodiment, administration of a miR-25 mimetic of the present disclosure reduces the expression or activity of one or more collagen synthesis genes in cells of a subject. Subject cells whose gene expression or activity is regulated by a miR-25 mimetic of the present disclosure include fibroblasts, keratocytes, epidermal, epithelial, endothelial cells, and hepatic stellate cells. In some embodiments, administration of a miR-25 mimetic reduces the expression of COL1A1, COL1A2, COL3A1, COL4A3, COL5A2, COL11A1, FN1, MMP2, CTGF, TGFB2, and / or TGFB3. In some embodiments, administration of a miR-25 mimetic down-regulated inflammatory responses (e.g., MCP1) associated with fibrosis. In some embodiments, administration of a miR-25 mimetic reduces the infiltration of immune effector cells, such as neutrophils, lymphocytes, monocytes, and macrophages, in fibrotic tissues or organs. In some embodiments, administration of a miR-25 mimetic reduces or inhibits epithelial-mesenchymal transition. In some embodiments, administration of a miR-25 mimetic reduces or inhibits myofibroblast differentiation.

[0138] In certain embodiments, the present disclosure provides methods for regulating extracellular matrix genes in hepatic stellate cells, comprising contacting the cells with a miR-25 mimetic of the present disclosure. In some embodiments, the present disclosure provides methods for regulating collagen synthesis genes in hepatic stellate cells, comprising contacting the hepatic stellate cells with a miR-25 mimetic of the present disclosure. Upon treatment or contact, the miR-25 mimetic reduces the expression or activity of extracellular matrix genes or collagen synthesis genes.

[0139] In some embodiments, the present disclosure provides methods for treating, preventing, reducing, or ameliorating fibrosis secondary to treatment of an organ with an antibody, a small molecule drug, a biologic drug, an aptamer, or a virus (e.g., a viral vector).

[0140] The present disclosure also provides methods for assessing the effectiveness of fibrosis treatment with miR-25 agonists (e.g., drugs or miR-25 mimetics). For example, in some embodiments, a method for assessing the effectiveness of a treatment comprises determining the expression level of one or more genes in a subject's hepatic stellate cells before treatment with a miR-25 mimetic (the one or more genes are selected from a set of genes regulated by miR-25), determining the expression level of the same one or more genes in the subject's cells / fibrotic tissue after treatment with a miR-25 mimetic, and determining whether the treatment is effective, less effective, or ineffective based on the expression levels before and after treatment. In another embodiment, a difference of at least 1-fold, 1.5-fold, 2-fold, 2.5-fold, 3-fold, 3.5-fold, or 4-fold between pre-treatment and post-treatment gene expression indicates that the treatment is effective.

[0141] 6. Kit The invention also provides kits comprising miR-25 mimetics as broadly described above and elsewhere herein. Such kits may further comprise an optional immunogenic agent for use concomitantly with the immunostimulatory compositions of the invention.

[0142] In some embodiments, in addition to the immunostimulatory compositions of the invention, the kits can include components suitable for carrying out the prime-boost regimen described above. For example, the kits can include separately packaged priming and boosting doses of at least one polypeptide antigen.

[0143] The kits may comprise additional components to aid in the practice of the methods of the invention, such as, for example, administration devices, buffers, and / or diluents, etc. The kits may also include containers for housing the various components, and instructions for using the kit components in the methods of the invention.

[0144] In order that the present invention may be readily understood and put into practice, certain preferred embodiments will now be described by way of the following non-limiting examples. [Example]

[0145] Example 1 A novel miR-25 mimetic efficiently downregulates target genes FKBP14 and ADAM-17 We previously demonstrated that the Notch signaling regulators FKBP14 and ADAM-17 are direct targets of miR-25 and are downregulated by overexpression of miR-25 in HSCs using commercially available miR-25 mimetics (Genz, B et al., Scientific Reports, 2019). Seeking to improve the efficiency of target gene downregulation, we designed 15 unique mimetics (Table 4; Combinations 1-16, C1-16) based on the mature miR-25 sequence (SEQ ID NO: 1). Of the 15 mimetics, C2, C3, C13, and C15 demonstrated concentration-dependent downregulation of FKBP14 using mimetics at concentrations between 5 and 40 pmol / mL, with C3 demonstrating the highest target gene downregulation, up to 50% (p<0.05 at 40 pmol / mL; Figures 1 and 2). Therefore, in further experiments, C3, C13 and C15 were used at 5 pmol / mL, 20 pmol / mL and 40 pmol / mL to evaluate the effects of low and high concentrations of miR-25 on target genes.

[0146] [Table 4]

[0147] Both FKBP14 and ADAM-17 mRNA expression was downregulated with C3 compared to the negative control and the commercial mimetic. The downregulation of FKBP14 was statistically significant with 20 and 40 pmol / mL C3 compared to the negative control (p<0.05; Figure 3A), with an additional ~30% reduction in mRNA compared to the commercial mimetic. The downregulation of ADAM-17 was statistically significant with the commercial mimetic, 5, 20, and 40 pmol / mL C3 (p<0.05; Figure 3B). Initial analysis of protein expression 48 hours after transfection with miR-25 mimics showed no significant reduction in either FKBP14 or ADAM-17 (Figure 4). FKBP14 protein expression was significantly downregulated after 72 hours with 40 pmol / mL of commercially available miR-25 (p<0.05) and both 20 pmol / mL (p<0.05) and 40 pmol / mL (p<0.001) of C3 (Figure 3B). ADAM-17 protein expression was downregulated after 72 hours with C3 compared to both the negative control and the commercially available mimetic, although the results did not reach statistical significance (Figure 3B).

[0148] C13 and C15 downregulated both FKBP14 and ADAM-17 mRNA expression when compared to the negative control. Downregulation of FKBP14 was statistically significant with both C13 and C15 at 5, 20, and 40 pmol / mL compared to the negative control (p<0.05; Figures 5A and 5C). Downregulation of ADAM-17 was statistically significant only with C15 at 20 pmol / mL compared to the negative control (p<0.05; Figure 5D). ADAM-17 protein expression was downregulated after 72 hours with C13 compared to the negative control, but the results did not reach statistical significance (Figure 5B).

[0149] Example 2 A novel miR-25 mimetic inhibits collagen expression In extrahepatic cell types, miR-25 has been shown to downregulate the expression of fibrillar collagens. Of particular interest in this study was the significant downregulation of type I and type III fibrillar collagen mRNA expression with C3. COL1A1 mRNA was significantly downregulated with C3 at 5 pmol / mL (p<0.01), 20 pmol / mL, and 40 pmol / mL (p<0.001) compared to the negative control. Compared to commercially available mimetics, COL1A1 mRNA downregulation was significantly improved by approximately 35% with C3 at 20 pmol / mL and 40 pmol / mL (p<0.05; Figure 6A). Accordingly, COL1A1 protein expression was significantly downregulated after 72 hours with C3 at 20 pmol / mL and 40 pmol / mL compared to the negative control (p<0.001; Figure 6B). Compared to 40 pmol / mL of commercially available miR-25, C3 further downregulated COL1A1 protein expression by approximately 43% at both 20 pmol / mL and 40 pmol / mL (p<0.05; Figure 6B). Similarly, procollagen 1α1 expression in LX-2 cell culture supernatants was significantly reduced after 72 hours with C3 at 20 pmol / mL (p<0.05) and 40 pmol / mL (p<0.01) compared to the negative control (Figure 6C).

[0150] TGF-β stimulation significantly upregulated COL1A1 mRNA expression in LX-2 cells transfected with the negative control mimetic (p<0.01; Figure 6D; left panel). This TGF-β-dependent COL1A1 induction was inhibited in cells transfected with C3, reaching statistical significance at 40 pmol / mL (p<0.05; Figure 6D; left panel). Compared with the commercially available miR-25 mimetic, C3 further reduced TGF-β-induced COL1A1 expression by approximately 20%, but this did not reach statistical significance (Figure 6D; left panel). Overexpression of miR-25 had no apparent effect on TGF-β-induced ACTA2 mRNA expression (Figure 6D; right panel).

[0151] C13 and C15 downregulated both COL1A1 and COL1A2 mRNA expression when compared to the negative control. COL1A1 downregulation was statistically significant with both C13 at 40 pmol / mL and C15 at 5, 20, and 40 pmol / mL when compared to the negative control (p<0.05; Figures 7A and 7C). COL1A2 downregulation was only statistically significant with C13 at 5, 20, and 40 pmol / mL when compared to the negative control (p<0.05; Figure 5B). COL1A2 protein expression was downregulated after 72 hours with C15 compared to the negative control, but the results did not reach statistical significance (Figure 7D).

[0152] COL1A2 mRNA was also significantly downregulated with all three concentrations of C3 compared to the negative control (p<0.001) (Figure 8A). Similarly, COL1A2 protein expression was significantly downregulated with 20 pmol / mL and 40 pmol / mL C3 after 72 hours compared to the negative control (p<0.01; Figure 8B). COL3A1 mRNA was also significantly downregulated with 20 pmol / mL and 40 pmol / mL C3 after 72 hours compared to the negative control (p<0.05; Figure 8C). Furthermore, COL3A1 protein expression was significantly downregulated with 20 pmol / mL C3 compared to the negative control (p<0.05), with 40 pmol / mL compared to the negative control (p<0.001), and with 40 pmol / mL of the commercial mimetic (p<0.05; Figure 8D).

[0153] Example 3 C3 has minimal effect on nonfibrillar collagen expression COL4A1 mRNA expression was significantly downregulated using the commercial mimetic C3 at 20 pmol / mL (p<0.05) and 40 pmol / mL (p<0.01) compared to the negative control (Figure 9A). COL4A2 mRNA expression was downregulated by approximately 60%, 25%, and 30% using C3 at 5, 20, and 40 pmol / mL compared to the negative control and commercial mimetic, respectively, but this did not reach statistical significance (Figure 9B). Overexpression of miR-25 did not significantly downregulate COL4A5 mRNA (Figure 9B).

[0154] Example 4 A novel mir-25 mimetic selectively downregulates TGF-βR1 We further investigated the effect of miR-25 overexpression on TGF-β signaling genes. TGF-βR1 mRNA was significantly downregulated in a concentration-dependent manner when C3 was used at 5 pmol / mL (p<0.01), 20 pmol / mL (p<0.001), and 40 pmol / mL (p<0.0001) compared to the negative control (Figure 10A). TGF-βR1 mRNA was also significantly downregulated when C3 was used at 40 pmol / mL compared to the commercial mimetic (20 pmol / mL; p<0.05; Figure 10A). This same effect was reflected in TGF-βR1 protein expression after 72 hours, where 40 pmol / mL of C3 downregulated expression by approximately 55% compared to the negative control (p<0.05; Figure 10). TGF-βR2, TGF-βR3, TGF-β1, and TGF-β2 mRNA expression was not affected by miR-25 overexpression ( Figures 10C–F ).

[0155] COL3A1 mRNA was significantly downregulated compared to the negative control using 20 pmol / mL and 40 pmol / mL C13 (p<0.05; Figure 11A). We further investigated the effect of miR-25 overexpression on TGF-β signaling genes. TGF-βR1 mRNA was significantly downregulated in a concentration-dependent manner using C13 and C15 at 5 pmol / mL (p<0.01), 20 pmol / mL (p<0.001), and 40 pmol / mL (p<0.0001) compared to the negative control (Figures 11B and D).

[0156] Example 5 C3 specifically downregulates collagen regulatory factors via TGF-β signaling To broaden our understanding of the function of miR-25 in HSCs, we analyzed its effect on the expression of collagen regulatory factors, which increase during HSC activation and fibrosis. miR-25 did not affect MMP1 expression (Figure 12A). MMP2 mRNA was significantly downregulated with C3 at 5 and 20 pmol / mL (p<0.01) and 40 pmol / mL (p<0.05) compared with the negative control (Figure 12B). TIMP-1 and TIMP-3 mRNA expression were downregulated by miR-25 overexpression, but the effect was not statistically significant (Figure 12C-D).

[0157] Example 6 C3 reduces cell proliferation but does not affect cell migration or contractility Cell proliferation, migration, and contraction increase upon HSC activation. We investigated whether overexpression of miR-25 affects this phenotype. The wound width closure rate (μm) was not significantly upregulated with C3 compared with the commercial mimic and negative control (Figure 13A). The cell proliferation rate was significantly reduced with C3 at 20 pmol / mL and 40 pmol / mL compared with the negative control (p<0.0001), and significantly reduced compared with both concentrations of the commercial miR-25 mimic (p<0.0001; Figure 13B). Commercial miR-25 also significantly reduced cell proliferation compared with the negative control, but to a lesser extent compared with C3 (p<0.001 at 20 pmol / mL and p<0.001 at 40 pmol / mL; Figure 13B). Cell contraction was not significantly affected with C3 compared to the commercial mimetic and negative control (FIG. 13C).

[0158] material and method 6.1 Proprietary miR-25-3p Mimetic Synthesis and Annealing Chemically modified single-stranded RNA sequences were synthesized based on the mature miR-25-3p sequence. The RNA sequences were annealed in 1 mL of 1x annealing buffer (10 mM UltraPure Tris, 50 mM NaCl, 1 mM EDTA in ultrapure water) by heating to 85°C and then cooling to room temperature. Different sequence combinations were annealed to create unique miRNA mimics (Table 4). The unique mimics included conventional phosphate and phosphorothioate ( * ) linkage (rA / rG / rC / rU), as well as 2'-O-methyl-RNA nucleotides (mA / mg / mC / mU) or 2'-fluoro-RNA nucleotides (fA / fG / fC / fU) (Table 3).

[0159] 6.2 Cell culture and miRNA mimic transfection All experiments were performed in vitro on cultured LX-2 cells, an immortalized human HSC line (provided by Professor Scott L. Friedman, Mount Sinai School of Medicine, NY, USA). LX-2 cells were cultured at 37°C and 5% CO2 in Dulbecco's modified Eagle's medium (DMEM, high glucose; Sigma Aldrich, St. Louis, MO, USA) containing 2% fetal calf serum (FCS), 1% glutamine, and 1% penicillin / streptomycin. Cells were grown in 6-well tissue culture plates (2 × 10 for RNA isolation). 5 cells / well) or 10 cm cell culture dish (for protein extraction, 5 × 10 5 Cells were cultured in 1000 wells (100 cells / dish) until 80% confluent. 24 hours after cell seeding, cells were transiently transfected with C3, a commercially available miR-25 mimic, or a negative control (MISSION microRNA, Sigma) at 5, 20, or 40 pmol / mL using Lipofectamine LTX (Life Technologies, Carlsbad, CA, USA) according to the manufacturer's protocol. The negative control used was a nonspecific miRNA mimic derived from a Caenorhabditis elegans sequence (MISSION microRNA mimic negative control 2; Sigma). Cells were harvested 48 h after transfection in 350 μl of RLT buffer (Qiagen, Hilden, Germany) for RNA isolation or 100 μl of RIPA buffer (2% NP-40, 0.05% Na deoxycholate, 0.1% sodium dodecyl sulfate (SDS), protease and phosphatase inhibitors in 1× PBS) for protein isolation and stored at −20°C until further use.

[0160] 6.3 RNA isolation and qRT-PCR analysis RNA was isolated from transfected LX-2 cells using the RNeasy Mini Kit (Qiagen) according to the manufacturer's protocol. RNA concentration was quantified using a NanoDrop™ spectrophotometer (ThermoFisher Scientific, Waltham, MA, USA). 100 ng of isolated RNA was transcribed to obtain complementary DNA (cDNA) using the SensiFAST™ cDNA Synthesis Kit (Bioline, Luckenwalde, Germany) under the following conditions: priming at 25°C for 10 minutes, reverse transcription at 42°C for 15 minutes, and inactivation at 85°C for 5 minutes. The cDNA was diluted 1:2 with nuclease-free water and stored at -20°C. Quantitative real-time polymerase chain reaction (qRT-PCR) was performed using the custom primer sequences listed in Table 5. qPCR was performed in a CFX384 Touch™ Thermal Cycler (BioRad) using Platinum SYBR Green qPCR SuperMix-UDG (Life Technologies) with a standard protocol (UDG incubation at 50°C for 2 minutes, hold at 95°C for 2 minutes, 40 cycles of 95°C for 15 seconds and 60°C for 30 seconds). Target gene mRNA expression was normalized to the relative expression of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and analyzed using the 2ΔCT method. Relative expression values ​​for each treatment were normalized to the mean value of the negative control samples, and fold changes were calculated.

[0161] [Table 5]

[0162] 6.4 TGF-β stimulation assay Twenty-four hours after cell transfection with Combination 3 (5, 20, and 40 pmol / mL), commercial miR-25, or negative control mimic (20 pmol / mL), cells were stimulated with TGF-β (10 ng / mL in DMEM) or control (RNase-free water). After an additional 24 hours, cells were harvested, and the relative expression of COL1A1 and ACTA2 mRNA was analyzed using RT-PCR as described above.

[0163] 6.5 SDS-PAGE and Western Blot Protein lysates were quantified using the BCA assay (ThermoFisher Scientific). Ten micrograms of protein per sample was separated using SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and then wet-transferred to a low-fluorescence PVFC membrane (Merck Millipore, Burlington, MA, USA) at 90 V for 2 hours. The membrane was blocked in Odyssey® TBS blocking buffer for 1 hour at room temperature and then incubated overnight at 4°C with primary antibodies in Odyssey® TBS blocking buffer containing 0.2% Tween-20 (antibodies and dilutions are listed in Table 5). The membrane was then washed and incubated with IRDye secondary antibodies (Table 6) in Odyssey® TBS blocking buffer containing 0.2% Tween-20 and 0.01% SDS for 1 hour at room temperature. Membranes were scanned using an Odyssey® CLX infrared imaging system (Li-Cor Biosciences, Nebraska, USA) and analyzed using Image Studio Lite software version 5.2.5 (Li-Cor Biosciences). Protein expression of target genes was normalized to the relative protein expression of β-actin.

[0164] [Table 6]

[0165] 6.6 Enzyme-linked immunosorbent assay (ELISA) LX-2 cells were seeded and transfected in 10 cm dishes with the proprietary mimic C3 or commercial miR-25 mimics (20 pmol / mL and 40 pmol / mL), or a negative control mimic (40 pmol / mL), as described above. After 24 h, cells were washed with 1x PBS and the medium was replaced with fresh DMEM. At 48 h post-transfection, the cell culture medium was collected and centrifuged at 2,000 x g for 10 min to remove debris. The supernatant was stored at -80°C. Cells were washed again, and the cell culture medium was replaced. At 72 h post-transfection, the cell culture medium was collected as before and stored at -80°C. To analyze changes in COL1A1 secretion after miR-25 transfection, a human procollagen Iα1 SimpleStep ELISA® kit (Abcam, Cambridge, UK) was used. Samples were diluted 1:64 and analyzed according to the manufacturer's protocol.

[0166] 6.7 Cell migration analysis Twenty-four hours after transfection of LX-2 cells with the proprietary mimic C3 or commercial miR-25 mimics (20 pmol / mL and 40 pmol / mL), or a negative control mimic (40 pmol / mL), 4.5 × 10 cells were plated in 96-well cell culture plates. 4 Cells were replated at 1000 cells / well. After 24 hours, when cells reached confluence, wounds were created using a curette (Essen Bioscience, Ann Arbor, MI, USA), and the plates were incubated for 24 hours in an IncuCyte Zoom live cell analysis system (Essen Bioscience). Wound closure over time was measured as wound width (μm). Data were normalized using GraphPad Prism (version 8.4.3; GraphPad Software, San Diego, CA, USA).

[0167] 6.8 Cell proliferation assays Cell proliferation assays to analyze changes in HSC proliferation were performed as described. LX-2 cells were transfected with the proprietary mimetic C3 or commercial miR-25 (20 pmol / mL and 40 pmol / mL), or with a negative control mimetic (40 pmol / mL). After 24 hours, transfected cells were plated in triplicate in 2-well plates at 2 × 10 5 Cells were replated at 1000 x g / well, and plates were incubated for up to 7 days using an IncuCyte Zoom live cell analysis system (Essen Bioscience). Cell proliferation was measured over time as % cell confluence. Data were normalized to baseline in GraphPad Prism, and a one-phase association nonlinear regression was performed to calculate the growth constant (K) as a measure of cell proliferation rate.

[0168] 6.9 Cell contraction assay Collagen contraction assays to analyze changes in HSC contraction were performed as previously described. LX-2 cells were transfected with the proprietary mimetic C3 or commercial miR-25 (20 pmol / mL and 40 pmol / mL), or with a negative control mimetic (40 pmol / mL). Type I collagen solution derived from bovine skin (Sigma) was adjusted to physiological pH and consistency according to the manufacturer's instructions. 900 μl / well of a 24-well cell culture plate was incubated overnight at 37°C to allow collagen lattice formation. 24 hours after transfection, cells were cultured at 1 × 10 in 1 mL of serum-free DMEM (1% glutamine and 1% penicillin / streptomycin). 5 Cells were replated onto the collagen grid at 1000 x g / well. After an additional 24 h, endothelin-1 (10 nM, Sigma) was added to stimulate cell contraction. Photographs of the culture plates were taken at 0.5, 1, 2.5, and 6 h using a gel imager (Vilber Lourmat, Collégien, France). Contraction of the collagen matrix over time was measured using ImageJ software (version 1.5j8, National Institutes of Health, USA). Data were normalized using GraphPad Prism.

[0169] 6.10 Statistical analysis All data are expressed as mean ± standard error of the mean (SEM). Statistical analysis of the data was performed using GraphPad Prism (version 8.4.3). Data were tested for normality using the Shapiro-Wilk normality test. All results were analyzed using one-way analysis of variance with Dunnett's multiple comparison post-hoc analysis. Significant differences were defined as P < 0.05.

[0170] The disclosures of all patents, patent applications, and publications cited herein are hereby incorporated by reference in their entirety.

[0171] The citation of any reference herein should not be construed as an admission that such reference is available as "Prior Art" to the instant application.

[0172] Throughout this specification, it has been the intent to describe preferred embodiments of the present invention without limiting the invention to any one embodiment or particular collection of features. Accordingly, those skilled in the art will appreciate in light of this disclosure that various modifications and changes can be made in the particular embodiments exemplified without departing from the scope of the present invention. All such modifications and changes are intended to be included within the scope of the appended claims.

[0173] References [Table 7]

Claims

1. A composition comprising a miR-25 mimic compound, wherein the miR-25 mimic compound is a. A first chain comprising a nucleotide sequence corresponding to residues 52-73 of the mature miR-25 sequence shown in SEQ ID NO: 1, conjugated at the 3' end to two uracil residues, and having at least one modified nucleotide; and b. A second chain that hybridizes with the first chain under at least low stringency conditions and has at least one modified nucleotide. Consists of, composition.

2. The composition according to claim 1, wherein the modified nucleotide comprises a nucleotide having a skeletal modification and / or a modified sugar residue.

3. The composition according to claim 2, wherein the skeletal modification comprises one or more phosphorothioate bonds, morpholino bonds, or phosphonocarboxylate bonds.

4. The composition according to claim 3, wherein the first two nucleotides at the 5' end of the first chain are linked to each other by a phosphorothioate bond.

5. The composition according to claim 3, wherein the last four or five nucleotides at the 3' end of the first chain are linked to one another by phosphorothioate bonds.

6. The composition according to claim 1, wherein at least one of the 3' nucleotides of the first chain is a 2'-O-methyl modified nucleotide.

7. The composition according to claim 1, wherein at least one nucleotide of the first chain is a 2'-fluoronucleotide.

8. The composition according to claim 1, wherein the first chain does not have a modified sugar residue at the second position of both the 5' and 3' ends.

9. The composition according to claim 1, wherein the skeletal modification of the second chain comprises one or more of the following: phosphorothioate bonds, morpholino bonds, or phosphonocarboxylate bonds.

10. The composition according to claim 9, wherein the first two nucleotides at the 5' end of the second chain are linked by a phosphorothioate bond.

11. The composition according to claim 9, wherein the last seven nucleotides at the 3' end of the second chain are linked by phosphorothioate bonds.

12. The composition according to claim 1, wherein the first nucleotide at the 5' end of the second chain is a 2'-O-methyl modified nucleotide.

13. The composition according to claim 1, wherein the first seven nucleotides at the 3' end of the second chain are 2'-O-methyl modified nucleotides.

14. The aforementioned miR-25 mimicry compounds are shown in Table 1 or 2: Table 1 Table 2 The composition according to claim 1, as shown in [reference].

15. The composition according to claim 1, wherein the first chain comprises a sequence selected from sequence numbers 2, 4, 9, 11, 12, 13, or 14, and the second chain comprises the sequence indicated by sequence number 5.

16. The composition according to claim 1, wherein the first chain comprises the sequence of sequence number 2 and the second chain comprises the sequence of sequence number 5.

17. The composition according to claim 1, wherein the first chain comprises the sequence of sequence number 14 and the second chain comprises the sequence of sequence number 5.

18. The composition according to claim 1, wherein the first chain comprises the sequence of sequence number 16 and the second chain comprises the sequence of sequence number 5.

19. The composition according to claim 1, wherein the first chain comprises the sequence of Sequence ID No. 2 and the second chain comprises the sequence of Sequence ID No.

5.

20. The composition according to claim 1, wherein the first chain comprises the sequence of sequence number 11 and the second chain comprises the sequence of sequence number 5.

21. The composition according to claim 1, wherein the first chain comprises the sequence of sequence number 13 and the second chain comprises the sequence of sequence number 5.

22. A pharmaceutical composition comprising the composition according to any one of claims 1 to 21 together with a pharmaceutically acceptable carrier, excipient, or diluent.

23. A pharmaceutical composition according to claim 22 for treating fibrosis in a subject.

24. The pharmaceutical composition according to claim 23, wherein the fibrosis is hepatic fibrosis.

25. The pharmaceutical composition according to claim 22 for reducing the expression of COL1A1, COL1A2, COL3A1, COL4A3, COL5A2, COL11A1, FN1, MMP2, CTGF, TGFB2, and / or TGFB3.

26. The pharmaceutical composition according to claim 22, wherein the subject is a human.