Expression of regenerative factors in aged / senescent cells

Abstract

Materials and methods for rejuvenating senescent cells are provided. Senescent cells are transduced with viral vectors to express Oct4, Sox2, and Klf4 proteins for partial cellular reprogramming, and a dominant-negative NFκBIA protein to suppress the senescence-associated secretory phenotype. The materials and methods provided can be used to treat signs and symptoms of progeria syndromes, premature aging, or natural aging, or to rejuvenate tissues in subjects experiencing premature aging or with age-related diseases.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 63 / 377,509, filed September 28, 2022, and U.S. Provisional Application No. 63 / 493,913, filed April 3, 2023, which are incorporated by reference in their entireties.

[0002] Reference to an electronically submitted sequence listing The contents of the Sequence Listing, submitted electronically in an ASCII text file (Name: 4967_020PC02_SequenceListing_ST26.xml, Size: 98,303 bytes, Created: August 31, 2023) submitted with this application, are hereby incorporated by reference in their entirety. [Background technology]

[0003] Aging is a complex process associated with genomic and epigenomic changes. Mouse genetic studies have shown that disruption of genes involved in genome maintenance can shorten lifespan in multiple mouse models, and that genetic or pharmacological intervention of, for example, the insulin signaling pathway can extend lifespan (Folgueras, A.R., Freitas-Rodriguez, S., Velasco, G. & Lopez-Otin, C. Mouse Models to Disentangle the Hallmarks of Human Aging. Circ Res 123, 905-924, 2018; Grunewald, M. et al. Counteracting age-related VEGF signaling insufficiency promotes healthy aging and extends lifespan. Science 373, 2021). Other methods, including caloric restriction and heterochronic parabiosis, have shown the potential to improve healthspan in mice and monkeys (Harrison, DE et al. Rapamycin fed late in life extends lifespan in genetically heterogeneous mice. Nature 460, 392-395, 2009; Colman, RJ et al. Caloric restriction delays disease onset and mortality in rhesus monkeys. Science 325, 201-204, 2009).

[0004] In addition to the permanent growth-arrested phenotype of senescent cells, chronic DNA damage signaling can promote the expression and secretion of several cytokines, chemokines, growth factors, and proteases; collectively, these characteristics are referred to as the senescence-associated secretory phenotype (SASP), which has detrimental effects on the tissue microenvironment (Coppe, JP, Desprez, PY, Krtolica, A. & Campisi, J. The senescence-associated secretory phenotype: the dark side of tumor suppression. Annu Rev Pathol 5, 99-118, 2010; Kang, C. et al. The DNA damage response induces inflammation and senescence by inhibiting autophagy of GATA4. Science 349, 2015; Gorgoulis, V. et al. Cellular Senescence: Defining a Path Forward. Cell 179, 813-827, 2019; Herranz, N. & Gil, J. Mechanisms and functions of cellular senescence. J Clin Invest 128, 1238-1246, 2018). SASP may also result in a decline in the functional capacity of stem cells, thus compromising their role in tissue regeneration (Lopez-Otin, C., Blasco, MA, Partridge, L., Serrano, M. & Kroemer, G. The hallmarks of aging. Cell 153, 1194-1217, 2013).

[0005] A major limitation in developing clinical applications of rejuvenation treatments is the lack of understanding of the appropriate cell types or cell states to target. Furthermore, it is unknown whether young cells can be expanded at the expense of old cells to obtain a functional rejuvenated phenotype at the organ and organism level without simply depleting the organ and organism of senescent cells, thereby jeopardizing their structural integrity. Summary of the Invention

[0006] A polynucleotide is provided that includes a senescent cell-specific promoter operably linked to a nucleic acid sequence encoding an Oct4 protein, a nucleic acid sequence encoding a Sox2 protein, and / or a nucleic acid sequence encoding a Klf4 protein.

[0007] In some embodiments, the senescent cell-specific promoter is the CDKN2A(p16) promoter.

[0008] In some embodiments, the polynucleotide comprises at least one p16 promoter operably linked to a nucleic acid sequence encoding an Oct4 protein, and / or a nucleic acid sequence encoding a Sox2 protein, and / or a nucleic acid sequence encoding a Klf4 protein.

[0009] In some embodiments, the p16 promoter is operably linked to a nucleic acid sequence encoding an Oct4 protein, a Sox2 protein, and a Klf4 protein.

[0010] In some embodiments, the p16 promoter is a human or mouse p16 promoter.

[0011] In some embodiments, the human p16 promoter has a nucleotide sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:1.

[0012] In some embodiments, the mouse p16 promoter has a nucleotide sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:2.

[0013] In some embodiments, the polynucleotide encodes a human Oct4 protein, and / or a human Sox2 protein, and / or a human Klf4 protein.

[0014] In some embodiments, the nucleic acid sequence encoding Oct4 comprises SEQ ID NO:3, the nucleic acid sequence encoding Sox2 comprises SEQ ID NO:4, and the nucleic acid encoding Klf4 comprises SEQ ID NO:5.

[0015] In some embodiments, the polynucleotide further comprises at least one woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) sequence and at least one polyadenylation signal sequence.

[0016] In some embodiments, the at least one polyadenylation signal sequence is an SV40 polyadenylation signal sequence, a human growth hormone polyadenylation signal sequence, or a bovine growth hormone polyadenylation signal sequence.

[0017] In some embodiments, the polynucleotide further comprises at least one internal ribosome entry site (IRES).

[0018] In some embodiments, the polynucleotide further comprises at least one proteolytic cleavage site.

[0019] In some embodiments, the at least one proteolytic cleavage site is a self-processing cleavage site or a furin cleavage site.

[0020] In some embodiments, the self-processing cleavage site is a P2A, E2A, F2A, or T2A peptide.

[0021] In some embodiments, the furin cleavage site comprises the consensus sequence RXK(R)R of SEQ ID NO:6.

[0022] In some embodiments, the polynucleotide further comprises a second p16 promoter.

[0023] In some embodiments, the first and second promoters initiate transcription in the same direction.

[0024] In some embodiments, the first and second promoters initiate transcription in different directions.

[0025] In some embodiments, the polynucleotide comprises the nucleic acid sequence of SEQ ID NO:10.

[0026] In some embodiments, the polynucleotide comprises a p16 promoter operably linked to a nucleic acid sequence encoding a dominant-negative nuclear factor kappa BIA (dnNKκBIA) protein.

[0027] In some embodiments, the p16 promoter of the polynucleotide is a human or mouse p16 promoter.

[0028] In some embodiments, the human p16 promoter of the polynucleotide has a nucleotide sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:1.

[0029] In some embodiments, the mouse p16 promoter of the polynucleotide has a nucleotide sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:2.

[0030] In some embodiments, the nucleic acid sequence of the polynucleotide encodes a human dnNKκBIA protein.

[0031] In some embodiments, the nucleic acid sequence of the polynucleotide encodes a dnNKκBIA protein comprising SEQ ID NO:7.

[0032] In some embodiments, the polynucleotide further comprises a WPRE sequence and a polyadenylation signal sequence.

[0033] In some embodiments, the polyadenylation signal sequence is the SV40 polyadenylation signal sequence, the human growth hormone polyadenylation signal sequence, or the bovine growth hormone polyadenylation signal sequence.

[0034] In some embodiments, the polynucleotide further comprises an IRES.

[0035] In some embodiments, the polynucleotide further comprises a proteolytic cleavage site.

[0036] In some aspects, the proteolytic cleavage site is selected from the group consisting of a self-processing cleavage site and a furin cleavage site.

[0037] In some embodiments, the self-processing cleavage site is a P2A, E2A, F2A, or T2A peptide.

[0038] In some embodiments, the furin cleavage site comprises the consensus sequence RXK(R)R of SEQ ID NO:6.

[0039] In some aspects, the polynucleotides described herein further comprise a reporter gene.

[0040] In some embodiments, the polynucleotide comprises the nucleic acid sequence of SEQ ID NO:11.

[0041] In some embodiments, the polynucleotide comprises the nucleic acid sequence of SEQ ID NO:12.

[0042] In some aspects, a vector is provided that comprises a polynucleotide described herein.

[0043] In some embodiments, the vector is a viral vector, a non-viral vector, or a polymer.

[0044] In some embodiments, the viral vector is an adeno-associated viral (AAV) vector, an adenoviral vector, a lentiviral vector, or a retroviral vector.

[0045] In some embodiments, the AAV vector is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVRH8, AAVrh9, AAV9, AAVrh10, AAV10, AAVRH10, AAV11, AAV12, or AAV-DJ vector.

[0046] In some embodiments, the AAV vector is an AAV-DJ vector.

[0047] In some embodiments, the non-viral vector is a plasmid.

[0048] In some embodiments, the polymer is a cationic polymer comprising a polyethyleneimine (PEI) backbone linked to a lipid or polyethylene glycol (PEG).

[0049] In some aspects, a cell is provided that comprises a polynucleotide described herein or a vector described herein.

[0050] In some embodiments, the cell is a bacterial cell, an insect cell, or an animal cell.

[0051] In some embodiments, the animal cell is a mammalian cell.

[0052] In some aspects, a composition is provided comprising a polynucleotide described herein or a vector described herein and a carrier.

[0053] In some aspects, a recombinant adeno-associated vector (rAAV) virus is provided comprising a polynucleotide described herein and an AAV capsid protein.

[0054] In some embodiments, the rAAV comprises an AAV-DJ capsid.

[0055] In some aspects, a pharmaceutical composition is provided comprising a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, or an rAAV described herein, and a pharmaceutically acceptable carrier.

[0056] In some aspects, a kit is provided that includes a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, or an rAAV described herein.

[0057] In some embodiments, methods for producing rAAV are provided.

[0058] In some aspects, the methods include providing to a cell an adeno-associated virus (AAV) rep gene, an AAV cap gene, a nucleic acid comprising a polynucleotide described herein, a vector described herein, and at least one AAV serotype 2 inverted terminal repeat sequence.

[0059] In some embodiments, the methods further include providing helper functions for generating a productive AAV infection.

[0060] In some embodiments, the method further comprises allowing the AAV to assemble and harvesting the rAAV.

[0061] In some embodiments, the AAV rep gene and the AAV cap gene are provided by a plasmid.

[0062] In some embodiments, the AAV rep gene and the AAV cap gene are stably integrated into the genome of the cell.

[0063] In some embodiments, the helper functions are provided by a plasmid.

[0064] In some embodiments, helper functions are provided by the adenoviral vector.

[0065] In some aspects, provided is an rAAV produced by the methods described herein.

[0066] In some aspects, methods of reprogramming senescent cells to a non-senescent phenotype are provided, hi some aspects, the method comprises contacting the senescent cell with a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein in an amount effective to partially reprogram the senescent cell to a non-senescent phenotype.

[0067] In some aspects, methods are provided for reprogramming senescent cells in a subject to a non-senescent phenotype. In some aspects, the method comprises administering a therapeutically effective amount of a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein to a subject in need thereof, and partially reprogramming the subject's senescent cells to a non-senescent phenotype. In some aspects, the administration is systemic. In some aspects, methods are provided for fully or partially reversing immunosenescence in a subject, the method comprising administering to a subject in need thereof an amount of a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein effective to fully or partially reverse immunosenescence in the subject. In some aspects, the administration is systemic.

[0068] In some embodiments, immunosenescence is characterized by a decrease in the homing capacity of hematopoietic stem cells (HSCs), and an amount effective to partially or completely reverse immunosenescence in a subject is an amount effective to increase the homing capacity of HSCs to the level of HSC homing capacity found in HSCs of a non-senescent subject.

[0069] In some embodiments, immunosenescence is characterized by a decrease in the per cell repopulating self-renewal activity of HSCs, and an amount effective to partially or completely reverse immunosenescence in a subject is an amount effective to increase the per cell repopulating self-renewal activity of HSCs to the level of per cell repopulating self-renewal activity of HSCs found in the HSCs of a non-senescent subject.

[0070] In some embodiments, immunosenescence is characterized by a bias of HSCs towards myeloid differentiation, and an amount effective to partially or completely reverse immunosenescence in a subject is an amount effective to reduce the bias of HSCs towards myeloid differentiation to the level of bias towards myeloid differentiation found in HSCs of a non-senescent subject.

[0071] In some embodiments, immunosenescence is characterized by increased apoptosis of HSCs upon a stress stimulus, and an amount effective to partially or completely reverse immunosenescence in a subject is an amount effective to reduce apoptosis of said HSCs upon a stress stimulus to the level of apoptosis upon a stress stimulus found in HSCs of a non-senescent subject.

[0072] In some aspects, methods are provided for reducing the number of senescent cells in a subject, the methods comprising administering to a subject in need thereof a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein in an amount effective to reduce the number of senescent cells in the subject. In some aspects, the administration is by systemic administration.

[0073] In some aspects, methods are provided for extending the biological lifespan of a subject, the methods comprising administering to a subject in need thereof a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein in an amount effective to extend the biological lifespan of the subject. In some aspects, the administration is by systemic administration.

[0074] In some aspects, methods are provided for reducing progressive weight loss in an aging subject, the methods comprising administering to an aging subject in need thereof a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein in an amount effective to reduce progressive weight loss in the aging subject. In some aspects, the administration is by systemic administration.

[0075] In some aspects, methods are provided for increasing the physical fitness of an aging subject, the methods comprising administering to an aging subject in need thereof a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein in an amount effective to increase the physical fitness of the aging subject. In some aspects, the administration is by systemic administration.

[0076] In some aspects, methods are provided for reducing an inflammatory response in a subject, the method comprising administering to a subject in need thereof a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein in an amount effective to reduce an inflammatory response in the subject.

[0077] In some aspects, methods are provided for reducing replicative senescence in a subject, the methods comprising administering to a subject in need thereof a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein in an amount effective to reduce replicative senescence in the subject. In some aspects, the administration is by systemic administration.

[0078] In some embodiments, methods are provided for reducing DNA damage-induced senescence in a subject, the methods comprising administering to a subject in need thereof a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein in an amount effective to reduce DNA damage-induced senescence in the subject. In some embodiments, the administration is by systemic administration.

[0079] In some aspects, methods of reducing oncogene-induced senescence in a subject are provided, the methods comprising administering to a subject in need thereof a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein in an amount effective to reduce oncogene-induced senescence in the subject. In some aspects, the administration is by systemic administration.

[0080] In some aspects, methods are provided for inhibiting senescence-associated secretory phenotype (SASP) activity in a cell. In some aspects, the method comprises contacting a cell with a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein in an amount effective to inhibit SASP activity in the cell.

[0081] In some embodiments, methods are provided for rejuvenating senescent cells to a non-senescent phenotype. In some embodiments, the method comprises contacting the senescent cells with a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein in an amount effective to partially reprogram the senescent cells. In some embodiments, the method further comprises contacting the senescent cells with a polynucleotide described herein or a vector described herein in an amount effective to inhibit SASP activity in the senescent cells.

[0082] In some embodiments, methods are provided for rejuvenating senescent cells in a subject to a non-senescent phenotype. In some embodiments, the method comprises administering to a subject in need thereof a therapeutically effective amount of a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein to partially reprogram the senescent cells, and administering to the subject a therapeutically effective amount of a polynucleotide described herein or a vector described herein to inhibit SASP activity. In some embodiments, the administration is systemic.

[0083] In some embodiments, methods are provided for increasing age-related survival rates in a subject. In some embodiments, the method comprises administering a therapeutically effective amount of a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein to a subject in need thereof, and reprogramming senescent cells in the subject, thereby increasing age-related survival rates in the subject. In some embodiments, the administration is by systemic administration.

[0084] In some embodiments, methods are provided for treating cellular senescence-associated aging in a subject in need thereof. In some embodiments, the method comprises administering to the subject a therapeutically effective amount of a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein. In some embodiments, the administration is by systemic administration.

[0085] In some embodiments, methods are provided for treating Hutchinson-Gilford Progeria Syndrome in a subject in need thereof. In some embodiments, the method comprises administering to the subject a therapeutically effective amount of a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein. In some embodiments, the administration is systemic.

[0086] In some embodiments, the subject is a human.

[0087] In some aspects, administration induces an increase in epidermal thickness, a decrease in mesangial area in the kidney, an increase in structural arrangement of hepatocytes in the liver, reversal of lymphocyte depletion in germinal centers of the spleen, a decrease in the levels of inflammatory markers, an increase in the number of hematopoietic stem cells, restoration of bone marrow tissue, and / or an increase in activation of DNA repair pathways in the subject.

[0088] In some embodiments, the reduction in the level of inflammatory markers includes a reduction in neutrophil infiltration in the liver and a reduction in inflammatory signatures in the spleen.

[0089] In some aspects, methods of treatment are provided, the methods comprising contacting a cell with a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein in an amount effective to partially reprogram the cell. In some embodiments, the method further comprises administering the partially reprogrammed cell to a subject in need thereof. In some aspects, the cell is a fibroblast. In some aspects, the fibroblast is a mammalian fibroblast. In some aspects, the fibroblast is a human fibroblast.

[0090] In some aspects, there is provided a use of a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein to treat cellular senescence-associated senescence.

[0091] In some aspects, there is provided a use of a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein in the manufacture of a medicament for treating cellular senescence-associated aging.

[0092] In some aspects, an article of manufacture is provided that includes a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein. [Brief explanation of the drawings]

[0093] [Figure 1A] Senescent cell-specific cellular reprogramming improves health and lifespan in LAKI- / - mice. Figure 1A: Graphical representation of constructs for expression of mOct4, mSox2, mKlf4 (OSK), or human dominant-negative NFκBIA and GFP. All constructs are in an AAV plasmid backbone. [Figure 1B]Senescent cell-specific cellular reprogramming improves health and longevity in LAKI- / - mice. Figure 1B: Graphical representation of mouse experiments to assess the impact of CDKN2A promoter-OSK and CDKN2A promoter-NFKBIA expression on mouse health and longevity. [Figure 1C] Senescent cell-specific cellular reprogramming improves health and lifespan in LAKI- / - mice. Figure 1C: Survival curves for LAKI- / - mice injected with control CAG-GFP (green line), m-CDKN2A promoter-OSK (blue line), or m-CDKN2A promoter-NFκBIA(dn) (red line) AAV DJ particles compared with untreated mice (gray line). (GFP, n = 15; m-CDKN2A promoter-OSK, n = 18; m-CDKN2A promoter-NFκBIA(dn), n = 18; no treatment, n = 18). [Figure 1D] Senescent cell-specific cellular reprogramming improves health and lifespan in LAKI- / - mice. (Figure 1D: Histological analysis of skin and spleen from 135-day-old wild-type mice or LAKI- / - mice transduced with CAG-GFP or m-CDKN2A promoter-OSK AAVs at day 60 as shown in Figure 1B. Yellow and white arrows in spleen sections indicate splenic nodules and red pulp, respectively. Scale bar indicates 100 μm.) [Figure 1E] Senescent cell-specific cellular reprogramming improves health and lifespan in LAKI- / - mice. Figure 1E: Frequencies of multipotent hematopoietic stem cells (pHSCs), lymphoid-primed multipotent progenitors (LMPPs), and multipotent progenitors (MPPs) in the hematopoietic stem cell multipotent progenitor compartment (HSC-MMP) in mice expressing m-CDKN2A promoter-OSK compared with CAG-GFP. [Figure 1F] Senescent cell-specific cellular reprogramming improves health and lifespan in LAKI- / - mice. Figure 1F: Frequency of HSC compartment subpopulations in mice expressing m-CDKN2A promoter-OSK compared to CAG-GFP. [Figure 1G-1]Senescent cell-specific cellular reprogramming improves health and lifespan in LAKI- / - mice. Figure 1G: RT-PCR measurement of CDKN2A and key inflammatory marker gene levels in various organs of mice treated with CAG-GFP or m-CDKN2A promoter-OSK; mRNA levels are shown relative to Gapdh. [Figure 1G-2] Senescent cell-specific cellular reprogramming improves health and lifespan in LAKI- / - mice. Figure 1G: RT-PCR measurement of CDKN2A and key inflammatory marker gene levels in various organs of mice treated with CAG-GFP or m-CDKN2A promoter-OSK; mRNA levels are shown relative to Gapdh. [Figure 1H-1] Senescent cell-specific cellular reprogramming improves health and lifespan in LAKI- / - mice. Figure 1H: GSEA analysis of genes significantly deregulated upon CDKN2A promoter-OSK induction in skin, liver, spleen, and bone marrow, respectively. [Figure 1H-2] Senescent cell-specific cellular reprogramming improves health and lifespan in LAKI- / - mice. Figure 1H: GSEA analysis of genes significantly deregulated upon CDKN2A promoter-OSK induction in skin, liver, spleen, and bone marrow, respectively. [Figure 2A-1] Optimization of senescent cell-specific rejuvenation strategies. Figure 2A: Single-cell RNA sequencing analysis of multiple human organs derived from different individuals across various age groups reveals four major cell clusters: epithelial, endothelial, stromal, and immune cell clusters (left); high CDKN2A expression (center) and the identity of high CDKN2A-expressing cells color-coded based on individual age (right). Data were obtained from the Tabula Sapiens consortium. [Figure 2A-2]Optimization of senescent cell-specific rejuvenation strategies. Figure 2A: Single-cell RNA sequencing analysis of multiple human organs derived from different individuals across various age groups reveals four major cell clusters: epithelial, endothelial, stromal, and immune cell clusters (left); high CDKN2A expression (center) and the identity of high CDKN2A-expressing cells color-coded based on individual age (right). Data were obtained from the Tabula Sapiens consortium. [Figure 2A-3] Optimization of senescent cell-specific rejuvenation strategies. Figure 2A: Single-cell RNA sequencing analysis of multiple human organs derived from different individuals across various age groups reveals four major cell clusters: epithelial, endothelial, stromal, and immune cell clusters (left); high CDKN2A expression (center) and the identity of high CDKN2A-expressing cells color-coded based on individual age (right). Data were obtained from the Tabula Sapiens consortium. [Figure 2B] Optimization of senescent cell-specific rejuvenation strategies. Figure 2B: Graphical representation of NFκBIA protein domains and key serine residues for post-translational regulation. Amino acid sequences of wild-type and dominant-negative isoforms of NFκBIA in which two key serine residues are replaced by alanine residues. [Figure 2C] Optimization of senescent cell-specific rejuvenation strategies. Figure 2C: Representative immunofluorescence images showing the localization of NFKB and actin proteins in healthy and senescent cells (3T3 mouse fibroblasts) transfected with AAV carrying either GFP or a dominant-negative isoform of NFKBIA. [Figure 2D] Optimization of senescent cell-specific rejuvenation strategies. Figure 2D: Schematic of cell culture experiments in mouse embryonic fibroblasts (MEFs) to test the specificity of AAV-mediated CDKN2A promoter-driven expression of target genes during senescence induced via the DNA-damaging agent etoposide (top); RT-PCR measurement of CDKN2A, Oct4, and Sox2 levels during senescence. mRNA levels are shown relative to TATA-binding protein (Tbp) (bottom). [Figure 2E]Optimization of senescent cell-specific rejuvenation strategies. Figure 2E: Graphical representation of mouse experiments in CDKN2A 3MR mice to assess organs receiving AAV-DJ carrying the m-CDKN2A-GFP transgene. [Figure 2F] Optimization of senescent cell-specific rejuvenation strategies. Figure 2F: Representative immunofluorescence images showing expression of AAV m-CDKN2A promoter-GFP in p16-3MR mice in major organs, including the spleen, liver, and skin. p16-3MR mice express a tripartite reporter consisting of the functional domains of LUC (Renilla luciferase), mRFP (monomeric red fluorescent protein), and HSV-TK (truncated herpes simplex virus 1 thymidine kinase) under the control of the p16-INK4a and p19-Arf promoters. Scale bars indicate 100 or 20 µm. [Figure 3A] AAV-mediated senescent cell-specific transgene expression. Figure 3A: Graphical representation of experiments to assess AAV-DJ organ tropism and retention over time in young and aged mice. [Figure 3B] AAV-mediated senescent cell-specific transgene expression. Figure 3B: RT-qPCR measurement of AAV viral particle levels using primers specific for the WPRE region of the recombinant AAV genome in DNA isolated from different organs. DNA amounts normalized to the mouse intergenic region. The y-axis indicates relative AAV genomic DNA. [Figure 3C] AAV-mediated senescent cell-specific transgene expression. (C) Relative levels of p16 expression in various organs of 4.5-month-old LAKI- / - and wild-type B6 mice measured by RT-qPCR. mRNA levels shown on the y-axis are relative to Gapdh levels. [Figure 3D] AAV-mediated senescent cell-specific transgene expression. Figure 3D: Graphical representation of mouse experiments to assess AAV-DJ-mediated transgene expression in LAKI- / - mice. [Figure 3E]AAV-mediated senescent cell-specific transgene expression. (Figure 3E) RT-qPCR measurement of Oct4 levels in various organs of LAKI- / - mice injected with AAV DJ control-GFP or CDKN2A promoter-OSK. mRNA levels are shown relative to Gapdh levels. [Figure 3F] AAV-mediated senescent cell-specific transgene expression. (Figure 3F) Genome browser tracks derived from ChIP assays for the H3K27 acetylation mark performed in proliferative and senescent IMR90 cells show its enrichment in the promoters of the CDKN2A and MIR146A genes. [Figure 3G] AAV-mediated senescent cell-specific transgene expression. (Figure 3G) Survival curves of LAKI- / - mice injected with control-GFP (green line), CDKN2A promoter-OSK (blue line), or mir146-OSK (magenta line) carrying AAV DJ particles. The x-axis indicates days, and the y-axis indicates % survival. [Figure 4A] Senescent cell-specific OSK expression improves healthspan. Figure 4A: Body weight of LAKI- / - mice at various time points after a single injection of control CAG-GFP or m-CDKN2A promoter-OSK AAV-DJ particles. [Figure 4B] Senescent cell-specific OSK expression improves healthspan. (B) Bar plots showing quantification of various activities based on open field maze experiments in LAKI- / - mice injected with control CAG-GFP and m-CDKN2A promoter-OSK at day 135. [Figure 4C] Senescent cell-specific OSK expression improves healthspan. Figure 4C: Autopsy analysis of 135-day-old LAKI- / - mice injected with control CAG-GFP or m-CDKN2A promoter-OSK AAV-DJ particles. White arrows indicate megacolon / megacecum, an abnormal gastrointestinal phenotype observed in control CAG-GFP mice but rescued in LAKI- / - mice injected with m-CDKN2A promoter-OSK. [Figure 4D]Senescent cell-specific OSK expression improves healthspan. Figure 4D: Images of the spleen at day 135 from LAKI- / - mice injected with control CAG-GFP or m-CDKN2A promoter-OSK AAV-DJ particles. [Figure 4E] Senescent cell-specific OSK expression improves healthspan. Figure 4E: Histological analysis of kidneys from 135-day-old wild-type or LAKI- / - mice transduced with CAG-GFP or m-CDKN2A promoter-OSK AAV-DJ particles at day 60 as shown in Figure 1C. [Figure 4F] Senescent cell-specific OSK expression improves healthspan. 4F: Histological analysis of kidney and liver sections from 135-day-old wild-type or LAKI- / - mice transduced with CAG-GFP or m-CDKN2A promoter-OSK AAVs at day 60 as shown in Figure 1C; yellow arrows in kidney sections indicate the glomerular capsule; green arrows in kidney sections indicate the mesangial region of the glomerular capsule; scale bars indicate 100 or 20 μm. [Figure 4G] Senescent cell-specific OSK expression improves healthspan. Figure 4G: Bar plot showing RNA-sequencing data for expression levels of Oct4, Sox2, and Klf4 in various organs of CDKN2A promoter-OSK. [Figure 5A-1] Bone marrow compartments rejuvenated to a young stage upon CDKN2A promoter-OSK induction. Figure 5A: Gating strategy and representative plots for young and aged wild-type mouse bone marrow compartments used for characterization of hematopoietic stem cells (HSCs) and various progenitors; the area delineated by the black box in the scatter plot indicates the gated population of cells; lineage markers (Lin) included a cocktail of antibodies recognizing CD3ε, B220, CD11b, Ly-6G, and TER-119. [Figure 5A-2]Bone marrow compartments rejuvenated to a young stage upon CDKN2A promoter-OSK induction. Figure 5A: Gating strategy and representative plots for young and aged wild-type mouse bone marrow compartments used for characterization of hematopoietic stem cells (HSCs) and various progenitors; the area delineated by the black box in the scatter plot indicates the gated population of cells; lineage markers (Lin) included a cocktail of antibodies recognizing CD3ε, B220, CD11b, Ly-6G, and TER-119. [Figure 5B-1] The bone marrow compartment rejuvenated to a young stage upon CDKN2A promoter-OSK induction. Figure 5B: CD135 and CD34 markers were used on the KSL population (Kit(+), Sca-1(+), and Lin(-)) to characterize the HSC-MMP compartment in young and aged wild-type mice. CD150 and CD41 markers were used on the KSL CD34(-) population to characterize the HSC compartment. MPP: multipotent progenitors, LMPP: lymphoid-primed multipotent progenitors, pHSC: multipotent hematopoietic stem cells. [Figure 5B-2] The bone marrow compartment rejuvenated to a young stage upon CDKN2A promoter-OSK induction. Figure 5B: CD135 and CD34 markers were used on the KSL population (Kit(+), Sca-1(+), and Lin(-)) to characterize the HSC-MMP compartment in young and aged wild-type mice. CD150 and CD41 markers were used on the KSL CD34(-) population to characterize the HSC compartment. MPP: multipotent progenitors, LMPP: lymphoid-primed multipotent progenitors, pHSC: multipotent hematopoietic stem cells. [Figure 5C]Bone marrow compartment rejuvenated to a young stage upon CDKN2A promoter-OSK induction. Figure 5C: Representative flow cytometry data of the hematopoietic stem cell compartment in bone marrow from LAKI- / - young and LAKI- / - aged mice injected with either control CAG-GFP or CDKN2A promoter-OSK AAV DJ, showing the distribution of cells in the HSC-MMP compartment; the areas delineated by the black boxes in the scatter plots indicate the gated MPP, LMPP, and pHSC populations, respectively. [Figure 5D] Bone marrow compartment rejuvenated to a young stage upon CDKN2A promoter-OSK induction. (Figure 5D) Representative flow cytometry data of bone marrow from LAKI- / - young and LAKI- / - old mice injected with either control GFP or CDKN2A promoter-OSK AAV DJ showing the distribution of cells in the HSC compartment. [Figure 5E-1] Bone marrow compartment rejuvenated to a young stage upon CDKN2A promoter-OSK induction. Figure 5E: Representative immunofluorescence images of bone marrow from LAKI- / - aged mice injected with AAV-DJ carrying either control-GFP or CDKN2A promoter-OSK, showing the abundance of Ki67, Hes1, and CD45 positive cells. [Figure 5E-2] Bone marrow compartment rejuvenated to a young stage upon CDKN2A promoter-OSK induction. Figure 5E: Representative immunofluorescence images of bone marrow from LAKI- / - aged mice injected with AAV-DJ carrying either control-GFP or CDKN2A promoter-OSK, showing the abundance of Ki67, Hes1, and CD45 positive cells. [Figure 5F] The bone marrow compartment rejuvenated to a younger stage upon CDKN2A promoter-OSK induction. Figure 5F: Graphical representation of in vitro expansion of SLAM (signaling lymphocyte activation molecule) HSCs from LAKI- / - mice. Fifty E-SLAM (EPCR, endothelial protein C receptor) HSCs from bone marrow were sorted and placed into each well of a 96-well plate containing differentiation medium. After 12 days of culture, cell proliferation and differentiation were monitored by microscopy and FACS analysis. [Figure 5G] Bone marrow compartment rejuvenated to a young stage upon CDKN2A promoter-OSK induction. Figure 5G: Representative images showing various random groups of expanded HSC colonies after 12 days in differentiation medium. [Figure 5H] The bone marrow compartment rejuvenated to a young stage upon CDKN2A promoter-OSK induction. Figure 5H: Stacked bar plot showing the distribution of HSC colony size in CDKN2A promoter-OSK treated and control HSCs. [Figure 5I] The bone marrow compartment rejuvenated to a younger stage upon CDKN2A promoter-OSK induction. Figure 5I: Frequency of the HSC-MMP subpopulation in cultured cells from LAKI- / - mice treated with CDKN2A promoter-OSK compared to controls. Dots indicate individual experimental sets from independent mice, and horizontal lines indicate SEM. [Figure 6A-1] Organ-specific transcriptional changes upon CDKN2A promoter-OSK induction. Figure 6A: Volcano plot representation of RNA-seq results showing the number of genes with significantly altered expression in skin upon AAV DJ CDKN2A promoter-OSK compared to control mice injected with AAV-DJ CAG-GFP. Tissues were harvested from the same LAKI- / - mice used in Figure 1B on day 135. The right side of the volcano plot shows the GSEA of genes significantly deregulated by AAV DJ CDKN2A promoter-OSK in skin. [Figure 6A-2] Organ-specific transcriptional changes upon CDKN2A promoter-OSK induction. Figure 6A: Volcano plot representation of RNA-seq results showing the number of genes with significantly altered expression in skin upon AAV DJ CDKN2A promoter-OSK compared to control mice injected with AAV-DJ CAG-GFP. Tissues were harvested from the same LAKI- / - mice used in Figure 1B on day 135. The right side of the volcano plot shows the GSEA of genes significantly deregulated by AAV DJ CDKN2A promoter-OSK in skin. [Figure 6B-1]Organ-specific transcriptional changes upon CDKN2A promoter-OSK induction. Figure 6B: Volcano plot representation of RNA-seq results shows the number of genes with significantly altered expression in liver on AAV DJ CDKN2A promoter-OSK compared to control mice injected with AAV-DJ CAG-GFP and GSEA. [Figure 6B-2] Organ-specific transcriptional changes upon CDKN2A promoter-OSK induction. Figure 6B: Volcano plot representation of RNA-seq results shows the number of genes with significantly altered expression in liver on AAV DJ CDKN2A promoter-OSK compared to control mice injected with AAV-DJ CAG-GFP and GSEA. [Figure 6C-1] Organ-specific transcriptional changes upon CDKN2A promoter-OSK induction. Figure 6C: Volcano plot representation of RNA-seq results shows the number of genes with significantly altered expression in the spleen on AAV DJ CDKN2A promoter-OSK compared to control mice injected with AAV-DJ CAG-GFP and GSEA. [Figure 6C-2] Organ-specific transcriptional changes upon CDKN2A promoter-OSK induction. Figure 6C: Volcano plot representation of RNA-seq results shows the number of genes with significantly altered expression in the spleen on AAV DJ CDKN2A promoter-OSK compared to control mice injected with AAV-DJ CAG-GFP and GSEA. [Figure 6D-1]Organ-specific transcriptional changes upon CDKN2A promoter-OSK induction. Figure 6D: Volcano plot representation of RNA-seq results shows the number of genes with significantly altered expression in bone marrow on AAV DJ CDKN2A promoter-OSK compared to control mice injected with AAV-DJ CAG-GFP and GSEA. [Figure 6D-2] Organ-specific transcriptional changes upon CDKN2A promoter-OSK induction. Figure 6D: Volcano plot representation of RNA-seq results shows the number of genes with significantly altered expression in bone marrow on AAV DJ CDKN2A promoter-OSK compared to control mice injected with AAV-DJ CAG-GFP and GSEA. [Figure 6E-1] Organ-specific transcriptional changes upon CDKN2A promoter-OSK induction. Figure 6E: Bar plot showing the expression levels of a set of tissue-specific marker genes in various organs (skin, liver, spleen, and bone marrow) on AAV DJ CDKN2A promoter-OSK. The y-axis shows normalized readout. [Figure 6E-2] Organ-specific transcriptional changes upon CDKN2A promoter-OSK induction. Figure 6E: Bar plot showing the expression levels of a set of tissue-specific marker genes in various organs (skin, liver, spleen, and bone marrow) on AAV DJ CDKN2A promoter-OSK. The y-axis shows normalized readout. [Figure 7A] Transcriptional rejuvenation in human primary cells (IMR90). Figure 7A: Bar plot showing mRNA levels for the CDKN2A promoter and pluripotency factors Oct4, Sox2, and Klf4 in IMR90 cells transduced with AAV carrying the CDKN2A promoter-OSK at various stages of replicative senescence. Day 20 represents healthy young cells, day 125 represents the fully senescent stage, and days 50 and 85 represent intermediate stages. The y-axis shows normalized tag counts. [Figure 7B]Transcriptional rejuvenation in human primary cells (IMR90) Figure 7B: Principal component analysis (PCA) plot of control- and CDKN2A promoter-OSK-treated IMR90 cells at different stages of replicative senescence. [Figure 7C-1] Transcriptional rejuvenation in human primary cells (IMR90). Figure 7C: Heatmap showing expression of inflammation-related genes on CDKN2A promoter-OSK AAV-DJ during replicative senescence. [Figure 7C-2] Transcriptional rejuvenation in human primary cells (IMR90). Figure 7C: Heatmap showing expression of inflammation-related genes on CDKN2A promoter-OSK AAV-DJ during replicative senescence. [Figure 7D-1] Transcriptional rejuvenation in human primary cells (IMR90). Figure 7D: Heatmap showing expression of cell cycle-related genes on CDKN2A promoter-OSK AAV-DJ during replicative senescence. [Figure 7D-2] Transcriptional rejuvenation in human primary cells (IMR90). Figure 7D: Heatmap showing expression of cell cycle-related genes on CDKN2A promoter-OSK AAV-DJ during replicative senescence. [Figure 7E] Transcriptional rejuvenation in human primary cells (IMR90). Figure 7E: Heatmap showing expression of inflammation-related genes on the CDKN2A promoter-OSK during induced DNA damage (via etoposide or bleomycin treatment) and oncogenic RAS-induced senescence. [Figure 7F] Transcriptional rejuvenation in human primary cells (IMR90). Figure 7F: Bioluminescence images showing the abundance of senescent cells in 24-month-old CDKN2A promoter-3MR mice 2 months after injection of a single dose of either control or CDKN2A promoter-OSK AAV particles. [Figure 8A-1] CDKN2A promoter-OSK rejuvenates senescent human fibroblasts. Figure 8A: Representative brightfield image of IMR90 cells after 12 days of AAV DJ human CDKN2A promoter-human OSK (H-CDKN2Ap-hOSK) treatment. [Figure 8A-2]CDKN2A promoter-OSK rejuvenates senescent human fibroblasts. Figure 8A: Representative brightfield image of IMR90 cells after 12 days of AAV DJ human CDKN2A promoter-human OSK (H-CDKN2Ap-hOSK) treatment. [Figure 8B] CDKN2A promoter-OSK rejuvenates senescent human fibroblasts. (Figure 8B) Gating strategy and representative plots for apoptosis analysis of young and senescent human fibroblasts. The area delineated by the black box in the scatter plot indicates the gated population of cells. [Figure 8C] CDKN2A promoter-OSK rejuvenates senescent human fibroblasts. (Figure 8C) Gating strategy and representative plots for cell cycle analysis of young and senescent human fibroblasts. The area delineated by the black oval in the scatter plot indicates the gated population of cells. [Figure 8D] CDKN2A promoter-OSK rejuvenates senescent human fibroblasts. (Figure 8D) Bar plot showing the frequency of cells in various stages of the cell cycle on H-CDKN2Ap-hOSK AAV-DJ in IMR90 cells. The y-axis indicates the % of cells. [Figure 8E] CDKN2A promoter-hOSK rejuvenates senescent human fibroblasts. Figure 8E: Bar plot showing the expression levels of fibroblast-specific marker genes in IMR90 on h-CDKN2Ap-hOSK AAV-DJ. The y-axis shows the normalized readout. [Figure 8F] CDKN2A promoter-OSK rejuvenates senescent human fibroblasts. (Figure 8F) Bar plot showing mRNA levels of the senescence-associated genes IFIH1 and OAS2 on H-CDKN2Ap-hOSK AAV-DJ in IMR90 cells. The y-axis shows normalized read counts. [Figure 9A] Transcriptional rejuvenation in the CDKN2A promoter-OSK in human fibroblasts. Figure 9A: KEGG pathway enrichment analysis of deregulated genes during aging. [Figure 9B]Transcriptional rejuvenation of the CDKN2A promoter-hOSK in human fibroblasts. Figure 9B: KEGG pathway enrichment analysis of deregulated genes on the H-CDKN2A promoter-hOSK. [Figure 9C] Transcriptional rejuvenation of the CDKN2A promoter-hOSK in human fibroblasts. (Figure 9C) Box plots showing expression levels of IFN-responsive and cell cycle-related genes on the h-CDKN2A promoter-hOSK during replicative senescence in IMR90 cells. The y-axis shows normalized readout. [Figure 9D] Transcriptional rejuvenation of the CDKN2A promoter-hOSK in human fibroblasts. (Figure 9D) Bar plot showing mRNA levels of the ECM-related genes elastin and COL1A1 on the h-CDKN2A promoter-hOSK in IMR90 cells. The y-axis shows normalized read counts. [Figure 9E-1] Transcriptional rejuvenation at the CDKN2A promoter-OSK in human fibroblasts. Figure 9E: Heatmap showing expression of extracellular matrix (ECM)-related genes at the H-CDKN2A promoter-OSK during replicative senescence. [Figure 9E-2] Transcriptional rejuvenation at the CDKN2A promoter-OSK in human fibroblasts. Figure 9E: Heatmap showing expression of extracellular matrix (ECM)-related genes at the H-CDKN2A promoter-OSK during replicative senescence. [Figure 9F] Transcriptional rejuvenation at the CDKN2A promoter-OSK in human fibroblasts. Figure 9F: Bar plot showing RNA levels of CDKN2A, POU5F1 (Oct4), SOX2, and KLF4 in IMR90 cells untreated or treated with belomycin, etoposide, or oncogenic RAS. [Figure 9G] Transcriptional rejuvenation of CDKN2A promoter-hOSK in human fibroblasts. Figure 9G: Principal component analysis (PCA) plot of control and H-CDKN2A promoter-hOSK-treated IMR90 cells subjected to DNA damage (via etoposide or bleomycin treatment) or RAS-induced oncogene-induced senescence. [Figure 9H] Transcriptional rejuvenation of CDKN2A promoter-OSK in human fibroblasts. Figure 9H: Graphical representation of p16-3MR mouse experiments to assess the effect of H-CDKN2A promoter-OSK on senescent cell populations. [Figure 9I] Transcriptional rejuvenation of CDKN2A promoter-OSK in human fibroblasts. Figure 9I: Bioluminescence images showing the abundance of senescent cells in 26-month-old p16(CDKN2A) promoter-3MR mice 4 months after injection of a single dose of either control or m-CDKN2A promoter-OSK AAV particles. [Figure 10A] Rejuvenation of wild-type mice with senescent cell-specific reprogramming. Figure 10A: Graphical representation of mouse experiments to assess the long-term effects of m-CDKN2A(p16) promoter-OSK expression in young wild-type mice (top), and survival curves of mice injected with control m-CDKN2A(p16) promoter-GFP (green line) or m-CDKN2A(p16) promoter-OSK (red line) AAV-DJ particles (bottom). GFP, (n=6); m-CDKN2A promoter-OSK (n=6). The x-axis indicates days, and the y-axis indicates % survival. [Figure 10B] Rejuvenation of wild-type mice with senescent cell-specific reprogramming. (Figure 10B) Graphical representation of a mouse experiment to assess the effect of m-CDKN2A(p16) promoter-OSK on health and lifespan in physiologically aged wild-type mice (top); mouse weights at various time points upon a single injection of control m-CDKN2A(p16) promoter-GFP or AAV-DJ carrying the m-CDKN2A(p16) promoter-OSK transgene (bottom). The y-axis indicates total body weight in grams, and the x-axis indicates age in days. [Figure 10C] Senescent cell-specific reprogramming rejuvenates wild-type mice. (Figure 10C) Survival curves of wild-type mice injected with control m-CDKN2A promoter-GFP (green line) or m-CDKN2A promoter-OSK (red line) AAV-DJ particles. (GFP, n=20; m-CDKN2A promoter-OSK, n=24). The x-axis indicates days, and the y-axis indicates % survival. [Figure 11A] Senescent cell-specific reprogramming improves the resilience of wild-type mice. Figure 11A: Tabular representation of tumor incidence in control and m-CDKN2A promoter-OSK mice used in different experiments. Evidence of tumors was established during necropsy. [Figure 11B] Senescent cell-specific reprogramming improves resilience in wild-type mice. Figure 11B: Bar plot showing quantification of various activities based on the treadmill test in control and m-CDKN2A promoter-OSK AAV-DJ injected aged wild-type mice. DETAILED DESCRIPTION OF THE INVENTION

[0094] Materials and methods are provided for rejuvenating senescent cells by expressing rejuvenating factors, such as Oct4, Sox2, and Klf4 (OSK) proteins and / or dominant-negative nuclear factor kappa BIA (dnNFκBIA) in senescent cells. In some aspects, expression of OSK results in partial reprogramming in senescent cells. In some aspects, expression of OSK results in complete or partial reversal of senescence in senescent cells. In some aspects, expression of dnNFκBIA protein results in suppression of the senescence-associated secretory phenotype (SASP) in senescent cells. In some aspects, polynucleotides and vectors are provided comprising OSK under the control of the CDKN2A (p16) promoter. The polynucleotides and vectors enable specific expression of OSK and / or dnNFκBIA in senescent cells for targeted phenotypic changes in senescent cells while avoiding systemic changes in non-senescent cells. The polynucleotides and vectors also allow for specific expression of OSK and / or dnNFκBIA in aged and / or senescent cells for targeted phenotypic changes, while avoiding systemic changes in non-senescent cells.

[0095] Without being bound by theory, Applicant believes that expression of reprogramming factors, e.g., OSK, driven by the CDKN2A(p16) promoter is reduced or attenuated when senescent cells are rejuvenated and / or partially reprogrammed. Without being bound by theory, Applicant believes that expression of reprogramming factors, e.g., OSK, driven by the CDKN2A(p16) promoter reduces or attenuates senescence in senescent cells. Senescent cells can be naturally senescent cells or prematurely senescent cells.

[0096] Without being bound by theory, expression of reprogramming factors, such as OSK, driven by the CDKN2A(p16) promoter should decrease when senescent cells are rejuvenated and / or partially reprogrammed, such that OSK expression may serve as a marker of rejuvenation and / or partial reprogramming. Other markers of rejuvenation and / or partial reprogramming are disclosed herein, such as downregulation of inflammation / SASP / stress response / DNA damage / reactive oxygen species (ROS) genes.

[0097] I. Definition In order that this disclosure may be more readily understood, certain terms are first defined. Further definitions are set forth throughout the detailed disclosure.

[0098] It should be noted that the term "a" or "an" refers to one or more of that entity; for example, unless otherwise specified, "a nucleic acid sequence" is understood to refer to one or more nucleic acid sequences. Thus, the terms "a" (or "an"), "one or more," and "at least one" are used interchangeably herein.

[0099] Furthermore, as used herein, "and / or" should be understood as a specific disclosure of each of two particular features or components, with or without the other. Thus, the term "and / or" used herein in phrases such as "A and / or B" is intended to include "A and B," "A or B," "A" (alone), and "B" (alone). Similarly, the term "and / or" used in expressions such as "A, B, and / or C" is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0100] Where an embodiment is described herein using the word "comprising," it is understood that otherwise similar embodiments described using the phrases "consisting of" and / or "consisting essentially of" are also provided.

[0101] The term "about" is used herein to mean approximately, roughly, roughly, or within a range. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the stated numerical values. In general, the term "about" can modify a numerical value to be above and below the stated value, for example, by a variance of up to or below 10 percent (higher or lower).

[0102] The term "at least" preceding a number or series of numbers is understood to include the number adjacent to the term "at least" and all subsequent numbers or integers that are logically included from the context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 18 nucleotides of a 21-nucleotide nucleic acid molecule" means that 18, 19, 20, or 21 nucleotides have the specified property. When "at least" precedes a series of numbers or ranges, it is understood that "at least" can modify each number in the series or range. "At least" is not limited to integers (e.g., "at least 5%" includes 5.0%, 5.1%, and 5.18%, regardless of the number of significant digits).

[0103] As used herein, "less than" or "below" shall be understood as the value adjacent to the term and any logically lower value or integer up to zero where the context makes sense. When "less than" precedes a series of numbers or ranges, it is understood that the "less than" may modify each number in the series or range.

[0104] The terms "polynucleotide," "nucleic acid," and "polynucleotide" are used interchangeably in this application. These terms refer only to the primary structure of the molecule. Thus, these terms include double- and single-stranded DNA, as well as double- and single-stranded RNA. As used herein, the terms "nucleic acid," "polynucleotide," and "polynucleotide" are defined as a molecule comprising two or more covalently linked nucleosides, as commonly understood by those of skill in the art. Such covalently linked nucleosides may also be referred to as nucleic acid molecules or oligomers. Polynucleotides can be produced recombinantly, enzymatically, or synthetically, for example, by solid-phase chemical synthesis followed by purification. Reference to the sequence of a polynucleotide or nucleic acid refers to the sequence or order of the nucleobase moieties or modifications thereof of the covalently linked nucleotides or nucleosides.

[0105] The term "polypeptide," as used herein, is intended to encompass the singular form "polypeptide" and the plural form "polypeptides," and includes any chain or chains of two or more amino acids. Thus, as used herein, "peptide," "peptide subunit," "protein," "amino acid chain," "amino acid sequence," or any other term used to refer to a chain or chains of two or more amino acids is included in the definition of "polypeptide," even though each of these terms may have a more specific meaning. The term "polypeptide" may be used in place of or interchangeably with any of these terms. This term further includes polypeptides that have undergone post-translational or post-synthetic modifications, such as conjugation of palmitoyl groups, glycosylation, acetylation, phosphorylation, amidation, derivatization with known protecting / blocking groups, proteolytic cleavage, or modifications with non-naturally occurring amino acids. The term "peptide," as used herein, encompasses full-length peptides as well as fragments, variants, or derivatives thereof. The "peptides" disclosed herein may be part of a fusion polypeptide that includes additional components to increase half-life, such as albumin or a PEG moiety. The peptides described herein may also be derivatized in several different ways. The peptides described herein can include modifications including, for example, the conjugation of a palmitoyl group.

[0106] The term "in vitro," as used herein, refers to events that occur not in a living organism (e.g., an animal, plant, or microorganism), but in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, in a Petri dish, etc.

[0107] The term "in vivo," as used herein, refers to events that take place within an organism (e.g., an animal, plant, or microorganism, and cells or tissues thereof).

[0108] The term "transfection" as used herein refers to a method for introducing exogenous nucleic acid into cells.Transfection methods include, but are not limited to, chemical methods, physical treatments, and cationic lipids or mixtures.The list of agents that can be transfected into cells is long, including, for example, siRNA, shRNA, sense and / or antisense sequences, DNA encoding one or more genes and organized into expression plasmids, e.g., vectors.

[0109] The term "percent sequence identity (%)" as used herein with respect to a reference polynucleotide or polypeptide sequence is defined as the percentage of nucleic acids or amino acids in a candidate sequence that are identical to those in the reference polynucleotide or polypeptide sequence after aligning the sequences and, if necessary, introducing gaps to achieve the maximum percent sequence identity. Alignment for the purpose of determining percent nucleic acid or amino acid sequence identity can be achieved in a variety of ways within the capabilities of those skilled in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms required to achieve maximum alignment across the full length of the sequences being compared. For example, percent sequence identity values ​​can be generated using the sequence comparison computer program BLAST.

[0110] The term "level" as used herein refers to the amount or activity of a protein or mRNA encoding a protein, optionally compared to a reference. The reference may be any useful reference as defined herein. A "decreased level" or "increased level" of a protein or RNA refers to a decrease or increase in the level of the protein or RNA compared to the reference. The level of a protein or RNA may be expressed as a mass / volume (e.g., g / dL, mg / mL, μg / mL, ng / mL) or percentage of the total protein or RNA in the sample.

[0111] The term "promoter," as used herein, refers to a DNA sequence recognized by cellular or introduced synthetic machinery required to initiate specific transcription of a gene. The term "promoter" is also intended to encompass nucleic acid elements sufficient for promoter-dependent gene expression that is controllable for cell-type-specific, tissue-specific, or inducible expression by external signals or agents; such elements may be located in the 5' or 3' regions of the native gene. In some embodiments, the promoter may be a constitutively active promoter, a cell-type-specific promoter, or an inducible promoter.

[0112] The term "senescent cell-specific promoter," as used herein, refers to a promoter that is expressed in senescent cells but not expressed or significantly less expressed in non-senescent cells. Examples of senescent cell-specific promoters include, but are not limited to, the CDKN2A promoter (also known as the p16 promoter) or the mir146a promoter. The terms p16 promoter and CDKN2A promoter are used interchangeably herein.

[0113] The term "CDKN2A promoter" or "p16 promoter," as used herein, refers to the promoter of the human or mouse cyclin-dependent kinase inhibitor 2A (CDKN2A) gene. The human CDKN2A(p16) promoter is shown in SEQ ID NO: 1. The mouse CDKN2A(p16) promoter is shown in SEQ ID NO: 2.

[0114] The term "WPRE," as used herein, refers to the woodchuck hepatitis virus post-translational regulatory element, a DNA sequence that, when transcribed, creates a tertiary structure that enhances expression of the viral vector's genes.

[0115] The term "IRES" as used herein refers to an element that promotes direct internal ribosome entry to an initiation codon, such as ATG, of a cistron (protein-coding region), thereby resulting in cap-independent translation of the gene. See, for example, Jackson RJ et al., Trends Biochem Sci 15(12):477-83(199); Jackson RJ and Kaminski, A. RNA 1(10):985-1000(1995). Under the translational control of an IRES, translation proceeds in a cap-independent manner.

[0116] The terms "operably linked," "operably inserted," "operably positioned," "under control," or "under transcriptional control" mean that a promoter is in the correct location and orientation with respect to the nucleic acid to control RNA polymerase initiation and expression of a gene. The term "operably linked" means that a DNA sequence and a regulatory sequence(s) are linked in a manner that allows for gene expression when the appropriate molecules (e.g., transcriptional activator proteins) are bound to the regulatory sequence(s). The term "operably inserted" means that a DNA of interest introduced into a cell is positioned adjacent to a DNA sequence that directs the transcription and translation of the introduced DNA (i.e., promotes, for example, the production of a polypeptide encoded by the DNA of interest).

[0117] The term "proteolytic cleavable site," as used herein, refers to a polynucleotide that encodes an amino acid sequence that can be proteolytically cleaved, including, but not limited to, self-processing cleavage sites and furin cleavage sites.

[0118] The term "self-processing cleavage site," as used herein, refers to a post- or co-translational processing cleavage site or sequence, which may be a DNA or amino acid sequence, and is exemplified herein by a 2A site, sequence, or domain, or a 2A-like site, sequence, or domain. A self-processing peptide is a peptide expression product of a DNA sequence encoding the self-processing cleavage site or sequence, which, upon translation, mediates rapid intramolecular (cis) cleavage of a protein or polypeptide containing the self-processing cleavage site, resulting in a distinct mature protein or polypeptide product.

[0119] The term "furin cleavage site," as used herein, refers to a nucleic acid encoding an amino acid sequence that can be cleaved by endogenous subtilisin-like proteases, such as furin and other serine proteases in the protein secretory pathway. In some embodiments, the furin cleavage site comprises the consensus sequence RXK(R)R of SEQ ID NO:6.

[0120] The term "dominant-negative nuclear factor kappa BIA" or "dnNFκBIA," as used herein, refers to a dominant-negative isoform of NFκBIA that is effective in blocking the nuclear translocation of NFκB, the master transcriptional inducer of the SASP.

[0121] The term "termination signal sequence," as used herein, may be any genetic element that causes RNA polymerase to terminate transcription, such as a polyadenylation signal sequence. A polyadenylation signal sequence is a recognition region required for endonuclease cleavage of an RNA transcript, followed by the polyadenylation consensus sequence AATAAA. A polyadenylation signal sequence provides a "poly A site," i.e., a site on an RNA transcript where adenine residues are added by post-transcriptional polyadenylation.

[0122] "LAK - / - The term "mouse" as used herein refers to a premature aging mouse model that harbors a point mutation in the Lmn gene, and this mouse model exhibits symptoms reminiscent of accelerated aging in patients with Hutchinson-Gilford Progeria Syndrome (HGPS).

[0123] The term "senescent cell," as used herein, refers to a cell that undergoes a complex process involving genomic and epigenomic changes that ultimately lead to permanent growth arrest of the cell.

[0124] The term "senescence," as used herein, refers to the gradual deterioration of the functional characteristics of a cell or organism.

[0125] The term "cellular senescence," as used herein, refers to a cellular permanent growth arrest phenotype and chronic DNA damage signaling, both of which can promote, among other things, the expression and secretion of several cytokines, chemokines, growth factors, and proteases, genomic instability, telomere attrition, epigenetic changes, and mitochondrial dysfunction.

[0126] The term "senescence-associated secretory phenotype (SASP)," as used herein, refers to the expression and secretion of cytokines, chemokines, growth factors, and proteases by senescent cells, which may, among other things, result in a reduced functional capacity of stem cells, thereby compromising their role in tissue regeneration.

[0127] The term "organismal aging," as used herein, refers to the aging of the entire organism, including a decreased ability to respond to stress, a decreased ability to rejuvenate, stem cell exhaustion, an increased homeostatic imbalance, a loss of proteostasis, and an increase in aging-related diseases.

[0128] The term "immunosenescence," as used herein, refers to age-related immune dysfunction, including, inter alia, thymic involution, increased numbers of memory T cells, loss of adaptive diversity, loss of ability to respond to antigens, and prolonged low-grade levels of inflammation.

[0129] The term "replicative senescence," as used herein, refers to cellular senescence induced by excessive cell replication.

[0130] The term "DNA damage-induced senescence," as used herein, refers to senescence induced by DNA damage.

[0131] The term "oncogene-induced senescence," as used herein, refers to senescence induced by oncogenic signaling resulting from activating mutations in oncogenes or inactivation of tumor suppressor genes. The oncogene may be, for example, Ras GTPase (RAS).

[0132] The term "vector," as used herein, refers to any vehicle for cloning and / or introducing a nucleic acid into a host cell, e.g., a plasmid, phage, transposon, cosmid, chromosome, artificial chromosome, virus, virion, etc. A vector may be a replicon to which another nucleic acid segment may be attached to bring about replication of the attached segment. A "replicon" refers to any genetic element (e.g., a plasmid, phage, cosmid, chromosome, virus) that functions as an autonomous replication unit in vivo (i.e., capable of replication under its own control). The term "vector" includes viral and non-viral vehicles for introducing nucleic acids into cells in vitro, ex vivo, or in vivo. Numerous vectors, including, for example, plasmids, modified eukaryotic viruses, or modified bacterial viruses, are known and used in the art. In some embodiments, insertion of a polynucleotide into a suitable vector can be accomplished by ligating an appropriate polynucleotide fragment into a selected vector with complementary cohesive termini. Vectors can be engineered to encode selectable markers or reporters that allow for the selection or identification of cells that have incorporated the vector. Expression of a selectable marker or reporter allows for identification and / or selection of host cells that incorporate and express other coding regions contained in the vector. Examples of selectable marker genes known and used in the art include genes that confer resistance to ampicillin, streptomycin, gentamicin, kanamycin, hygromycin, bialaphos herbicides, sulfonamides, etc., as well as genes used as phenotypic markers, i.e., anthocyanin regulatory genes, isopentenyltransferase genes, etc. Examples of reporters known and used in the art include luciferase (Luc), green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), β-galactosidase (LacZ), β-glucuronidase (Gus), etc. Selectable markers can also be considered reporters.In some aspects, the delivery vector is selected from the group consisting of a viral vector (e.g., an AAV vector), a plasmid, a lipid, a cationic polymer, a protein particle, a bacterial vector, and a lysosome. Some aspects of the present disclosure are directed to biological vectors, which may include viruses, particularly attenuated and / or replication-defective viruses. In some aspects, the vector may include a microRNA targeting sequence to increase the specificity of vector-mediated transgene expression. In some aspects, the microRNA targeting sequence is incorporated into the 3'UTR of the polynucleotide or vector. In some aspects, the delivery vector of the present disclosure is a viral vector selected from the group consisting of an adeno-associated viral (AAV) vector, an adenoviral vector, a lentiviral vector, or a retroviral vector.

[0133] The term "adeno-associated viral vector" or "AAV vector," as used herein, refers to any vector that contains or is derived from an adeno-associated vector component and is suitable for infecting mammalian cells, preferably human cells. The term AAV vector typically refers to an AAV-type virus particle or virion that contains a payload. AAV vectors can be derived from various serotypes, including combinations of serotypes (i.e., "pseudotyped" AAV), or can be derived from various genomes (e.g., single-stranded or self-complementary). Furthermore, AAV vectors can be replication-deficient and / or targetable. As used herein, the term "adeno-associated virus" (AAV) includes, but is not limited to, AAV type 1, AAV type 2, AAV type 3 (including types 3A and 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, AAV type 11, AAV type 12, AAV type 13, AAV-DJ, AAVrh8, AAVrh10, AAVrh.74, snake AAV, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, caprine AAV, shrimp AAV, the AAV serotypes and clades disclosed by Gao et al. (J. Virol. 78:6381 (2004)) and Morris et al. (Virol. 33:375 (2004)), and any other AAV now known or later discovered. See, e.g., FIELDS et al. VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers). In some embodiments, "AAV vector" includes derivatives of known AAV vectors. In some embodiments, "AAV vector" includes modified or artificial AAV vectors. The terms "AAV genome" and "AAV vector" may be used interchangeably. In some embodiments, the AAV vector is modified compared to the wild-type AAV serotype sequence.

[0134] The term "AAV particle," as used herein, refers to an AAV virus comprising an AAV vector having at least one payload region (e.g., a polynucleotide encoding a therapeutic protein or peptide) and at least one inverted terminal repeat (ITR) region. In some embodiments, the term "AAV vector" refers to an AAV vector comprising a polynucleotide encoding an Oct4 protein, a Sox2 protein, and / or a Klf4 protein, and / or a dnNFκBIA protein.

[0135] The term "AAV rep gene," as used herein, refers to the large open reading frame (ORF) known as the AAV replication (rep) region of the AAV genome. This ORF encodes the replication gene products Rep78, Rep68, Rep52, and Rep40, named for their apparent molecular weight, and enable replication, assembly, and packaging of complete AAV virions.

[0136] The term "AAV cap gene," as used herein, refers to the large open reading frame (ORF) known as the AAV capsid region of the AAV genome. This ORF encodes at least three capsid proteins: VP1, VP2, and VP3, which enable assembly of the AAV capsid in which the AAV genome is packaged by the AAV Rep proteins to generate the AAV virus.

[0137] The phrase "AAV helper functions for generating productive AAV infection" as used herein refers to AAV rep and AAV cap genes provided by a source other than nucleic acid containing the payload region and at least one ITR, such that AAV capsid production, AAV payload / ITR nucleic acid replication, and AAV payload / ITR insertion into assembled AAV capsids can occur. AAV helper functions can be provided by co-infecting AAV producer cells with wild-type AAV virions, by providing AAV producer cells with one or more plasmids containing the AAV rep and AAV cap genes, or by infecting AAV producer cells with a non-AAV virus harboring the AAV rep and AAV cap genes. AAV particles produced according to the methods described herein lack the AAV rep and AAV cap genes and contain AAV payload / ITR nucleic acids. When administered to a subject's cells, AAV virions are unable to replicate or form more AAV virions within the subject's cells in the absence of the AAV rep and AAV cap genes. Instead, AAV virions release their payload / ITR nucleic acid upon entry into a cell of the subject, and the payload gene is transcribed in the cell of the subject to produce the payload protein.

[0138] The phrase "contacting a cell" (e.g., contacting a cell with an AAV vector, AAV capsid, or pharmaceutical composition of the present disclosure), as used herein, includes directly or indirectly contacting a cell. In some embodiments, contacting a cell with an AAV vector, AAV capsid, or composition includes contacting a cell with the composition, AAV vector, or AAV capsid in vitro, or contacting a cell with the AAV vector, AAV capsid, or composition in vivo. Thus, for example, the AAV vector, AAV capsid, or composition can be physically contacted with the cell by the individual performing the method, or alternatively, the AAV vector, AAV capsid, or composition can be placed in a situation that subsequently allows or results in contact with the cell. In some embodiments, contacting a cell in vitro can be achieved, for example, by incubating the cell with the AAV vector, AAV capsid, or composition. In some embodiments, contacting cells in vivo can be achieved, for example, by injecting the AAV vector, AAV capsid, or composition of the present disclosure into or near the tissue where the target cells reside, or by injecting the AAV vector, AAV capsid, or composition into a region, such as the bloodstream or subcutaneous space, so that the agent will subsequently reach the tissue where the cells to be contacted reside. Furthermore, the AAV vector or AAV virus can be encapsulated and / or coupled to a ligand that directs the AAV vector or AAV virus to the desired site. A combination of in vitro and in vivo contacting methods is also contemplated. For example, cells can be contacted with the AAV vector, AAV capsid, or composition in vitro and then transplanted into a subject.

[0139] In some embodiments, contacting a cell with an AAV vector, AAV capsid, or composition of the present disclosure includes "introducing" or "delivering" (directly or indirectly) the AAV vector, AAV capsid, or composition to the cell by promoting or achieving uptake or absorption into the cell. Introduction of the AAV vector, AAV capsid, or composition into the cell can be performed in vitro and / or in vivo. For example, in the case of in vivo introduction, the AAV vector, AAV capsid, or composition can be injected into a specific tissue site (e.g., a site where a therapeutic effect is desired) or administered systemically (e.g., administration of an AAV vector targeted to a site where a therapeutic effect is desired). In vitro introduction of an AAV genome or payload / ITR polynucleotide into a cell includes methods known in the art, such as electroporation and lipofection.

[0140] For example, the terms "effective amount," "therapeutically effective amount," and "sufficient amount" of an AAV vector, AAV capsid, or composition disclosed herein refer to an amount that is sufficient to produce a beneficial or desired result, including a clinical result, when administered to a subject, including a human; thus, "effective amount" or its synonyms will vary depending on the context in which it is applied. In some embodiments, a therapeutically effective amount of an agent (e.g., an AAV vector, AAV capsid, or composition disclosed herein) is an amount that produces a beneficial or desired result in a subject compared to a control. The amount of a given agent (e.g., an AAV vector, AAV capsid, or composition disclosed herein) will vary depending on various factors, such as the given agent, pharmaceutical formulation, route of administration, type of disease or disorder, subject identity (e.g., age, sex, and / or weight), or host being treated.

[0141] The term "gene therapy," as used herein, refers to the insertion of a nucleic acid sequence (e.g., a polynucleotide comprising a promoter operably linked to a nucleic acid encoding a therapeutic molecule disclosed herein) into an individual's cells and / or tissues to treat, alleviate the symptoms of, or reduce the likelihood of a disease or aging-related condition. Gene therapy also includes the insertion of a transgene that is inhibitory in nature, i.e., inhibits, reduces, or decreases the expression, activity, or function of an endogenous gene or protein, such as an undesirable (e.g., aging-inducing) or aberrant (e.g., pathogenic) gene or protein. Such a transgene may be exogenous. An exogenous molecule or sequence is understood to be a molecule or sequence that does not normally occur in the treated cell, tissue, and / or individual.

[0142] The term "pharmaceutical composition," as used herein, refers to a composition comprising a compound or molecule described herein, e.g., an AAV vector disclosed herein, formulated with a pharmaceutically acceptable excipient, and capable of being manufactured or sold with the approval of a government regulatory agency as part of a therapeutic regimen for the treatment of a disease in a mammal.

[0143] The term "pharmaceutically acceptable excipient," as used herein, refers to any ingredient other than the compounds described herein (e.g., a vehicle capable of suspending or dissolving an active compound) that has the properties of being non-toxic and non-inflammatory in a patient.

[0144] The term "subject," as used herein, refers to any organism to which a composition disclosed herein, e.g., an AAV vector of the present disclosure, can be administered, for example, for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical subjects include any animal (e.g., mammals such as mice, rats, rabbits, etc., non-human primates, and humans). A subject can be a human or animal that may seek or require treatment, may need treatment, may be undergoing treatment, may be undergoing future treatment, or is receiving the care of a trained professional for a particular disease or condition.

[0145] The terms "treat," "treated," and "treating," as used herein, refer to both therapeutic treatment and prophylactic or preventative measures aimed at preventing or slowing (alleviating) an undesirable physiological, e.g., age-related, condition, disorder, or disease, or achieving a beneficial or desired clinical result. In some embodiments, an age-related condition includes signs and / or symptoms associated with natural aging. In some embodiments, treatment results in, for example, a reduction or alleviation of symptoms associated with an age-related disease or disorder. In some embodiments, treatment results in a beneficial or desired clinical result. Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms; reduction in the extent of a condition, disorder, or disease; a stabilized condition, disorder, or disease (i.e., not worsening); a delay in the onset or slowing of the progression of a condition, disorder, or disease; an improvement or remission (whether partial or complete) of a condition, disorder, or disease state, whether detectable or undetectable; an improvement in at least one measurable physical parameter, not necessarily discernible by the patient; or an improvement or amelioration of a condition, disorder, or disease. In some embodiments, treatment includes eliciting a clinically significant response without excessive levels of side effects. In some embodiments, treatment includes prolonging survival compared to the expected survival if not treated. As used herein, the term "improvement" or "improving" refers to reducing the severity of at least one indicator of a condition or disease. As used herein, the term "preventing" or "prevention" refers to delaying or forestalling the onset, development, or progression of a condition or disease for a period of time, for example, weeks, months, or years. Ameliorating a disease or disorder includes slowing the course of the disease or disorder or reducing the severity of later-onset age-related diseases or disorders.A "prophylactically effective amount" may vary depending on the characteristics of the agent, e.g., AAV vector, AAV capsid, or composition, the method of administration of the agent, the degree of risk of disease, and the medical history, age, weight, family history, genetic makeup, type of prior or concomitant treatment (if applicable), and other individual characteristics of the patient being treated.

[0146] The term "cell reprogramming," as used herein, refers to the process of modifying cells using reprogramming factors (e.g., reversing or preventing cellular changes that lead to dysfunction, deterioration, cell death, senescence, or aging phenomena). Cell reprogramming can be complete, such that a differentiated cell (e.g., a somatic cell) is reprogrammed into a pluripotent stem cell. Cell reprogramming can be incomplete, such that a differentiated cell (e.g., a somatic cell) retains its cellular identity. Cell reprogramming can be partial, for example, where stem cells are not created, resulting in cells that are rejuvenated or exhibit youthful attributes (e.g., increased survival, reduced inflammation). Cell reprogramming can also provide additional cellular functions or prevent cellular senescence.

[0147] The term "rejuvenating a cell," as used herein, is meant to include preventing or reversing the causes of cellular senescence without inducing a pluripotent state.

[0148] "Pluripotent state," as used herein, is meant to include a state in which a cell expresses at least one stem cell marker, such as, but not limited to, Esrrb, Nanog, Lin28, TRA-1-60 / TRA-1-81 / TRA-2-54, SSEA1, or SSEA4. Methods for measuring the expression of stem cell markers on cells are known in the art and include the methods described herein.

[0149] II. Polynucleotides Polynucleotides for the expression of cellular rejuvenation-promoting proteins in senescent cells are provided. In some embodiments, the polynucleotide comprises a promoter active in senescent cells. In some embodiments, the promoter is mIR146A. In some embodiments, the promoter is the promoter of the cyclin-dependent kinase inhibitor 2A (CDKN2A) / p16 gene. In some embodiments, the promoter is mir146A. In some embodiments, the promoter comprises a polynucleotide sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the human p16 promoter of SEQ ID NO: 1. In some embodiments, the promoter comprises the polynucleotide sequence of SEQ ID NO: 1. In some embodiments, the promoter comprises a polynucleotide sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the mouse p16 promoter of SEQ ID NO: 2. In some embodiments, the promoter comprises the polynucleotide sequence of SEQ ID NO: 2.

[0150] In some embodiments, the polynucleotide comprises a nucleic acid sequence encoding an Oct4 protein. In some embodiments, the Oct4 protein is a human Oct4 protein. In some embodiments, the polynucleotide comprises a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the human Oct4 sequence of SEQ ID NO: 3. In some embodiments, the promoter comprises the nucleic acid sequence of SEQ ID NO: 3.

[0151] In some embodiments, the polynucleotide comprises a nucleic acid sequence encoding a Sox2 protein. In some embodiments, the Sox2 protein is a human Sox2 protein. In some embodiments, the polynucleotide comprises a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the human Sox2 sequence of SEQ ID NO: 4. In some embodiments, the promoter comprises the nucleic acid sequence of SEQ ID NO: 4.

[0152] In some embodiments, the polynucleotide comprises a nucleic acid sequence encoding a Klf4 protein. In some embodiments, the Klf4 protein is a human Klf4 protein. In some embodiments, the polynucleotide comprises a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the human Klf4 sequence of SEQ ID NO: 5. In some embodiments, the promoter comprises the nucleic acid sequence of SEQ ID NO: 5.

[0153] In some embodiments, the nucleic acid sequence encoding the Oct4 protein, the nucleic acid sequence encoding the Sox2 protein, and / or the nucleic acid sequence encoding the Klf4 protein are operably linked to a promoter that is active in senescent cells. In some embodiments, the promoter is the p16 promoter. In some embodiments, the nucleic acid sequence encoding the Oct4 protein, the nucleic acid sequence encoding the Sox2 protein, and / or the nucleic acid sequence encoding the Klf4 protein are operably linked to the p16 promoter of SEQ ID NO: 1.

[0154] In some embodiments, the polynucleotide further comprises a proteolytic cleavable site. In some embodiments, the proteolytic cleavable site is a self-processing cleavage site or a furin cleavage site. In some embodiments, the self-processing cleavage site is a P2A, E2A, F2A, or T2A peptide. In some embodiments, the furin cleavage site comprises the consensus sequence RXK(R)R of SEQ ID NO: 6. Thus, the polypeptide produced when the polynucleotide is transcribed in a cell can be cleaved by cellular proteases to release the Oct4, Sox2, and Klf4 proteins.

[0155] In some embodiments, nucleic acid sequences encoding Oct4, Sox2, and Klf4 proteins are ordered in a 5'-3' direction on a polynucleotide, such that desired amounts of Oct4, Sox2, and Klf4, respectively, are produced in cells transduced with the polynucleotide. The amounts of Oct4, Sox2, and Klf4 proteins required for a particular cell type to induce partial reprogramming may vary, and polynucleotides can be selected that provide the optimal ratio of Oct4, Sox2, and Klf4 protein levels for partial reprogramming of each cell type. In some embodiments, the level of protein produced from a polynucleotide is highest when the polynucleotide sequence encoding the protein is located closest to the promoter sequence. In some embodiments, Oct4, Sox2, and Klf4 are located in 5'-3' order from the promoter sequence.

[0156] In some embodiments, the polynucleotide comprises a p16 promoter, a nucleic acid sequence encoding an Oct4 protein, a proteolytic cleavage site, and a nucleic acid sequence encoding a Sox2 protein.

[0157] In some embodiments, the polynucleotide comprises a p16 promoter, a nucleic acid sequence encoding an Oct4 protein, a proteolytic cleavage site, and a nucleic acid sequence encoding a Klf4 protein.

[0158] In some embodiments, the polynucleotide comprises a p16 promoter, a nucleic acid sequence encoding a Sox2 protein, a proteolytic cleavage site, and a nucleic acid sequence encoding a Klf4 protein.

[0159] In some embodiments, the polynucleotide comprises a p16 promoter, a nucleic acid sequence encoding an Oct4 protein, a first proteolytic cleavable site, a nucleic acid sequence encoding a Sox2 protein, a second proteolytic cleavable site, and a nucleic acid sequence encoding a Klf4 protein.

[0160] In some embodiments, the polynucleotide comprises, in the 5'-3' direction, a p16 promoter, a nucleic acid sequence encoding an Oct4 protein, a first proteolytic cleavable site, a nucleic acid sequence encoding a Klf4 protein, a second proteolytic cleavable site, and a nucleic acid sequence encoding a Sox2 protein.

[0161] In some embodiments, the polynucleotide comprises, in the 5'-3' direction, a p16 promoter, a nucleic acid sequence encoding a Sox2 protein, a first proteolytic cleavable site, a nucleic acid sequence encoding an Oct4 protein, a second proteolytic cleavable site, and a nucleic acid sequence encoding a Klf4 protein.

[0162] In some embodiments, the polynucleotide comprises, in the 5'-3' direction, a p16 promoter, a nucleic acid sequence encoding a Sox2 protein, a first proteolytic cleavable site, a nucleic acid sequence encoding a Ktlf4 protein, a second proteolytic cleavable site, and a nucleic acid sequence encoding an Oct4 protein.

[0163] In some embodiments, the polynucleotide comprises, in the 5'-3' direction, a p16 promoter, a nucleic acid sequence encoding a Klf4 protein, a first proteolytic cleavable site, a nucleic acid sequence encoding an Oct4 protein, a second proteolytic cleavable site, and a nucleic acid sequence encoding a Sox2 protein.

[0164] In some embodiments, the polynucleotide comprises, in the 5'-3' direction, a p16 promoter, a nucleic acid sequence encoding a Klf4 protein, a first proteolytic cleavable site, a nucleic acid sequence encoding a Sox2 protein, a second proteolytic cleavable site, and a nucleic acid sequence encoding an Oct4 protein.

[0165] In some embodiments, the p16 promoter is a human or mouse p16 promoter.

[0166] In some embodiments, the first proteolytic site is a P2A peptide, an E2A peptide, an F2A peptide, a T2A peptide, or the RXK(R)R consensus sequence of SEQ ID NO:6.

[0167] In some embodiments, the second proteolytic site is a P2A peptide, an E2A peptide, an F2A peptide, a T2A peptide, or the RXK(R)R consensus sequence of SEQ ID NO:6.

[0168] In some embodiments, the polynucleotide comprises a second p16 promoter.

[0169] In some embodiments, the polynucleotide comprises, in the 5'-3' direction, a first p16 promoter, a nucleic acid sequence encoding an Oct4 protein, a second p16 promoter, a nucleic acid sequence encoding a Sox2 protein, a proteolytic cleavage site, and a nucleic acid sequence encoding a Klf4 protein.

[0170] In some embodiments, the polynucleotide comprises, in the 5'-3' direction, a first p16 promoter, a nucleic acid sequence encoding an Oct4 protein, a second p16 promoter, a nucleic acid sequence encoding a Klf4 protein, a proteolytic cleavage site, and a nucleic acid sequence encoding a Sox2 protein.

[0171] In some embodiments, the polynucleotide comprises, in the 5'-3' direction, a first p16 promoter, a nucleic acid sequence encoding an Oct4 protein, a proteolytic cleavage site, a nucleic acid sequence encoding a Sox2 protein, a second promoter, and a nucleic acid sequence encoding a Klf4 protein.

[0172] In some embodiments, the polynucleotide comprises, in the 5'-3' direction, a first p16 promoter, a nucleic acid sequence encoding a Sox2 protein, a proteolytic cleavage site, a nucleic acid sequence encoding an Oct4 protein, a second promoter, and a nucleic acid sequence encoding a Klf4 protein.

[0173] In some embodiments, the polynucleotide comprises, in the 5'-3' direction, a first p16 promoter, a nucleic acid sequence encoding an Oct4 protein, a proteolytic cleavable site, a nucleic acid sequence encoding a Klf4 protein, a second promoter, and a nucleic acid sequence encoding a Sox2 protein.

[0174] In some embodiments, the polynucleotide comprises, in the 5'-3' direction, a first p16 promoter, a nucleic acid sequence encoding a Klf4 protein, a proteolytic cleavage site, a nucleic acid sequence encoding an Oct4 protein, a second promoter, and a nucleic acid sequence encoding a Sox2 protein.

[0175] In some embodiments, the first and second promoters initiate transcription in the same direction.

[0176] In some embodiments, the first and second promoters initiate transcription in different directions.

[0177] In some embodiments, the polynucleotide further comprises a polyadenylation signal sequence, hi some embodiments, the polyadenylation signal sequence is an SV40 polyadenylation signal sequence, a human growth hormone polyadenylation signal sequence, or a bovine growth hormone polyadenylation signal sequence.

[0178] In some embodiments, the polynucleotide further comprises a WPRE sequence.

[0179] In some embodiments, the polynucleotide further comprises an IRES.

[0180] In some embodiments, the polynucleotide comprises, in the 5'-3' direction, a p16 promoter, a nucleic acid sequence encoding an Oct4 protein, a first IRES, a nucleic acid sequence encoding a Sox2 protein, a second IRES, and a nucleic acid sequence encoding a Klf4 protein.

[0181] In some embodiments, the polynucleotide comprises, in the 5'-3' direction, a p16 promoter, a nucleic acid sequence encoding an Oct4 protein, a first IRES, a nucleic acid sequence encoding a Klf4 protein, a second IRES, and a nucleic acid sequence encoding a Sox2 protein.

[0182] In some embodiments, the polynucleotide comprises, in the 5'-3' direction, a p16 promoter, a nucleic acid sequence encoding a Sox2 protein, a first IRES, a nucleic acid sequence encoding an Oct4 protein, a second IRES, and a nucleic acid sequence encoding a Klf4 protein.

[0183] In some embodiments, the polynucleotide comprises, in the 5'-3' direction, a p16 promoter, a nucleic acid sequence encoding a Sox2 protein, a first IRES, a nucleic acid sequence encoding a Klf4 protein, a second IRES, and a nucleic acid sequence encoding an Oct4 protein.

[0184] In some embodiments, the polynucleotide comprises, in the 5'-3' direction, a p16 promoter, a nucleic acid sequence encoding a Klf4 protein, a first IRES, a nucleic acid sequence encoding an Oct4 protein, a second IRES, and a nucleic acid sequence encoding a Sox2 protein.

[0185] In some embodiments, the polynucleotide comprises, in the 5'-3' direction, a p16 promoter, a nucleic acid sequence encoding a Klf4 protein, a first IRES, a nucleic acid sequence encoding a Sox2 protein, a second IRES, and a nucleic acid sequence encoding an Oct4 protein.

[0186] In some embodiments, the polynucleotide comprises, in the 5'-3' direction, a first p16 promoter, a nucleic acid sequence encoding an Oct4 protein, a second p16 promoter, a nucleic acid sequence encoding a Sox2 protein, an IRES, and a nucleic acid sequence encoding a Klf4 protein.

[0187] In some embodiments, the polynucleotide comprises, in the 5'-3' direction, a first p16 promoter, a nucleic acid sequence encoding an Oct4 protein, a second p16 promoter, a nucleic acid sequence encoding a Klf4 protein, an IRES, and a nucleic acid sequence encoding a Sox2 protein.

[0188] In some embodiments, the polynucleotide comprises, in the 5'-3' direction, a first p16 promoter, a nucleic acid sequence encoding an Oct4 protein, an IRES, a nucleic acid sequence encoding a Sox2 protein, a second promoter, and a nucleic acid sequence encoding a Klf4 protein.

[0189] In some embodiments, the polynucleotide comprises, in the 5'-3' direction, a first p16 promoter, a nucleic acid sequence encoding a Sox2 protein, an IRES, a nucleic acid sequence encoding an Oct4 protein, a second promoter, and a nucleic acid sequence encoding a Klf4 protein.

[0190] In some embodiments, the polynucleotide comprises, in the 5'-3' direction, a first p16 promoter, a nucleic acid sequence encoding an Oct4 protein, an IRES, a nucleic acid sequence encoding a Klf4 protein, a second promoter, and a nucleic acid sequence encoding a Sox2 protein.

[0191] In some embodiments, the polynucleotide comprises, in the 5'-3' direction, a first p16 promoter, a nucleic acid sequence encoding a Klf4 protein, an IRES, a nucleic acid sequence encoding an Oct4 protein, a second promoter, and a nucleic acid sequence encoding a Sox2 protein.

[0192] In some embodiments, the polynucleotide further comprises a nucleic acid sequence encoding a marker protein, ie, β-galactosidase protein, green fluorescent protein, red fluorescent protein, yellow fluorescent protein, cyan fluorescent protein, or blue fluorescent protein, tdTomato protein, or mCherry protein.

[0193] In some embodiments, the polynucleotide comprises an intron sequence, hi some embodiments, the intron sequence comprises a CMV intron sequence, a β-actin intron sequence, a chicken β-actin intron, an SV40 enhancer sequence, or a combination thereof.

[0194] III. Vectors and Cells Also provided are vectors comprising the polynucleotides described herein.

[0195] In some aspects, the vector is a viral vector. In some aspects, the vector is a non-viral vector. In some aspects, the vector is a lipid. In some aspects, the vector is a polymer.

[0196] In some embodiments, the viral vector is an adeno-associated viral (AAV) vector, an adenoviral vector, a lentiviral vector, or a retroviral vector. In some embodiments, the AAV vector is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVRH8, AAVrh9, AAV9, AAVrh10, AAV10, AAVRH10, AAV11, AAV12, or AAV-DJ vector.

[0197] In some embodiments, an AAV vector with a broad targeting spectrum is selected to transduce a variety of cell types. In some embodiments, the AAV vector is an AAV-DJ vector.

[0198] In some embodiments, AAV vectors with specific targeting spectrum are selected to transduce selected cell types. The targeting specificity of various AAV vectors is known in the art (see, for example, AAV Production Protocol, Genemedi Biotech, Inc. 2018).

[0199] In some embodiments, AAV vectors are modified to target one or more selected cell types.For example, AAV cap sequence can be modified to remove cell targeting epitopes from capsid, and alternative cell targeting sequences can be introduced into capsid.AAV cap sequence modified in this way is known in the art.

[0200] In some embodiments, the non-viral vector is a plasmid DNA, RNA, a cationic polymer, a lipid, a lipopolymer, or a chemical derivative thereof.

[0201] In some embodiments, the cationic polymer is present in an amount sufficient to produce a ratio of amine nitrogens in the cationic polymer to phosphates in the DNA plasmid vector or RNA vector of about 0.1:1 to about 100:1.

[0202] In some embodiments, the cationic polymer is present in an amount sufficient to produce a ratio of amine nitrogens in the cationic polymer to phosphate in the DNA plasmid vector or RNA vector of about 0.1:1 to about 10:1.

[0203] In some embodiments, the cationic polymer is present in an amount sufficient to produce a ratio of amine nitrogens in the cationic polymer to phosphate in the DNA plasmid vector or RNA vector of about 0.1:1 to about 5:1.

[0204] In some embodiments, the non-viral vector comprises about 0.5 mg / ml to about 5.0 mg / ml of a polynucleotide complexed with a cationic polymer, hi some embodiments, the cationic polymer is poly(ethyleneimine) (PEI) polymer, poly-L-lysine, polyamidoamine, diethylaminoethyl dextran, chitosan, poly(dimethylaminoethyl methacrylate), or a derivative thereof.

[0205] Additionally provided are cells comprising the polynucleotides described herein or the vectors described herein, hi some aspects, the cells may be bacterial cells, yeast cells, fungal cells, insect cells, or mammalian cells.

[0206] In some aspects, cells comprising the polynucleotides described herein can be used to manufacture viral vectors. In some aspects, the cells are insect cells comprising the polynucleotides described herein and additional viral vector production components and are used to prepare the viral vectors described herein. In some aspects, the cells are mammalian cells comprising the polynucleotides described herein and additional viral vector production components and are used to prepare the viral vectors described herein.

[0207] In some aspects, the cells are insect cells that contain the polynucleotides and AAV viral vector production components described herein and are used to prepare AAV vectors.

[0208] In some aspects, the cells are mammalian cells that contain the polynucleotides and AAV viral vector production components described herein and are used to prepare AAV vectors.

[0209] In some embodiments, cells comprising the polynucleotides described herein can be used to treat a subject. In some embodiments, cells comprising the polynucleotides described herein can be administered to a subject in need of reversing senescence, whereupon the cells express a protein encoded by the polynucleotide described herein, and the expressed protein reverses cellular processes associated with the senescent phenotype. In some embodiments, cells comprising the polynucleotides described herein replicate after administration to a subject. In some embodiments, cells comprising the polynucleotides described herein can be hematopoietic progenitor cells. In some embodiments, cells comprising the polynucleotides described herein can be hematopoietic stem cells. In some embodiments, cells comprising the polynucleotides described herein can be mesenchymal / stromal stem cells. In some embodiments, cells comprising the polynucleotides described herein can be adipose stem cells.

[0210] IV. Compositions and Kits Also provided are compositions comprising the polynucleotides described herein and / or the vectors described herein. In some embodiments, the compositions are gene therapy compositions. In some embodiments, the compositions comprise the polynucleotides described herein and the delivery agents or vectors described herein.

[0211] In some embodiments, the delivery agent is a cationic polymer, hi some embodiments, the delivery agent is a lipid, lipopolymer, or chemical derivative thereof.

[0212] In some embodiments, the cationic polymer of the composition is present in an amount sufficient to produce a ratio of amine nitrogens in the cationic polymer to phosphates in the DNA plasmid or RNA of about 0.1:1 to about 100:1.

[0213] In some embodiments, the cationic polymer of the composition is present in an amount sufficient to produce a ratio of amine nitrogens in the cationic polymer to phosphates in the DNA plasmid or RNA of about 0.1:1 to about 10:1.

[0214] In some embodiments, the cationic polymer of the composition is present in an amount sufficient to produce a ratio of amine nitrogens in the cationic polymer to phosphates in the DNA plasmid or RNA of about 0.1:1 to about 5:1.

[0215] In some embodiments, the polynucleotides described herein are present in a complex with a cationic polymer of the composition at about 0.5 mg / ml to about 5.0 mg / ml, hi some embodiments, the cationic polymer of the composition is poly(ethyleneimine) (PEI) polymer, poly-L-lysine, polyamidoamine, diethylaminoethyl dextran, chitosan, poly(dimethylaminoethyl methacrylate), or derivatives thereof.

[0216] Additionally, pharmaceutical compositions are provided. In some aspects, the pharmaceutical compositions comprise a pharmaceutically acceptable carrier or excipient.

[0217] Some examples of materials that can function as pharmaceutically acceptable carriers include: (1) sugars, such as lactose, glucose, and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose and its derivatives, such as sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository wax; (9) oils, such as peanut oil, cottonseed oil, sunflower oil, sesame oil, olive oil, corn oil, and soybean oil; and (10) glycols, such as Examples of suitable non-toxic and compatible materials include, but are not limited to, propylene glycol, (11) polyols, such as glycerin, sorbitol, mannitol, and polyethylene glycol, (12) esters, such as ethyl oleate and ethyl laurate, (13) agar, (14) buffers, such as magnesium hydroxide and aluminum hydroxide, (15) alginic acid, (16) pyrogen-free water, (17) isotonic saline, (18) Ringer's solution, (19) ethyl alcohol, (20) pH buffers, (21) polyesters, polycarbonates, and / or polyanhydrides, and (22) other non-toxic and compatible materials used in pharmaceutical formulations.

[0218] Additional non-limiting examples of agents suitable for formulation with the polynucleotides of the present disclosure include PEG-conjugated nucleic acids, phospholipid-conjugated nucleic acids, nucleic acids containing lipophilic moieties, phosphorothioates, P-glycoprotein inhibitors (such as Pluronic P85) which may enhance drug entry into various tissues, biodegradable polymers such as poly(DL-lactide-co-glycolide) microspheres for sustained release delivery after implantation (Emerich, DF et al., 1999, Cell Transplant, 8, 47-58) Alkermes, Inc. Cambridge, Mass., and loaded nanoparticles such as those made of polybutylcyanoacrylate which can deliver drugs across the blood-brain barrier and alter neuronal uptake mechanisms (Prog Neuropsychopharmacol Biol Psychiatry, 23, 941-949, 1999).

[0219] In some embodiments, the compositions further include wetting agents, emulsifying agents, and lubricating agents, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, releasing agents, coating agents, sweetening, flavoring, and perfuming agents, preservatives, and antioxidants.

[0220] Examples of pharmaceutically acceptable antioxidants include: (1) water-soluble antioxidants such as ascorbic acid, cysteine ​​hydrochloride, sodium bisulfate, sodium metabisulfite, and sodium sulfite; (2) oil-soluble antioxidants such as ascorbic acid palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, and alpha-tocopherol; and (3) metal chelating agents such as citric acid, ethylenediaminetetraacetic acid (EDTA), sorbitol, tartaric acid, and phosphoric acid.

[0221] In some embodiments, compositions of the present disclosure include those suitable for oral, nasal, topical (including buccal and sublingual), rectal, vaginal, and / or parenteral administration. The compositions may conveniently be presented in unit dosage form and prepared by any method known in the art of pharmacy. The amount of active ingredient which may be combined with a carrier material to produce a single dosage form will vary depending upon the host treated and the particular mode of administration. The amount of active ingredient which may be combined with a carrier material to produce a single dosage form will generally be that amount of the compound which produces a therapeutic effect. Generally, out of one hundred percent, this amount will range from about 0.1 percent to about ninety-nine percent of the active ingredient, preferably from about 5 percent to about 70 percent, and most preferably from about 10 percent to about 30 percent.

[0222] In some aspects, the compositions of the present disclosure comprise an excipient selected from cyclodextrins, celluloses, liposomes, micelle-forming agents such as bile acids, and polymeric carriers such as polyesters and polyanhydrides; and a polynucleotide described herein. In some aspects, the compositions render the polynucleotide described herein orally bioavailable.

[0223] Methods of preparing these compositions or pharmaceutical compositions include the step of bringing into association a polynucleotide of the present disclosure with the carrier and, optionally, one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing into association a polynucleotide of the present disclosure with liquid carriers, or finely divided solid carriers, or both, and then, if necessary, shaping the product.

[0224] Compositions of the present disclosure suitable for oral administration may be in the form of capsules, cachets, pills, tablets, sweetened tablets (using a flavored base, usually sucrose and acacia or tragacanth), powder, granules, or a solution or suspension in an aqueous or non-aqueous liquid, or an oil-in-water or water-in-oil liquid emulsion, or an elixir or syrup, or a pastille (using an inert base such as gelatin and glycerin, or sucrose and acacia), and / or mouthwash, each containing a predetermined amount of a compound of the present disclosure as an active ingredient. The polynucleotides described herein may also be administered as a bolus, electuary, or paste.

[0225] In solid dosage forms of the present disclosure for oral administration (capsules, tablets, pills, dragees, powders, granules, lozenges, etc.), the active ingredient may be mixed with one or more pharmaceutically acceptable carriers such as sodium citrate or dicalcium phosphate, and / or any of the following: (1) fillers or extenders, for example, starch, lactose, sucrose, glucose, mannitol, and / or silicic acid; (2) binders, for example, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidone, sucrose, and / or acacia; (3) humectants, for example, glycerol; (4) disintegrants, for example, agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates; and sodium carbonate, (5) solvents, such as paraffin, (6) absorption enhancers, such as quaternary ammonium compounds, and surfactants, such as poloxamer and sodium lauryl sulfate, (7) wetting agents, such as cetyl alcohol, glycerol monostearate, and nonionic surfactants, (8) absorbents, such as kaolin and bentonite clay, (9) lubricants, such as talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium lauryl sulfate, zinc stearate, sodium stearate, stearic acid, and mixtures thereof, (10) coloring agents, and (11) controlled-release agents, such as crospovidone or ethylcellulose. In capsules, tablets, and pills, pharmaceutical compositions may also contain buffering agents. Similar types of solid pharmaceutical compositions can also be used as fillers in soft and hard-shell gelatin capsules, using excipients such as lactose or milk sugar and high molecular weight polyethylene glycols.

[0226] Tablets may be made by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared using binders (e.g., gelatin or hydroxypropylmethylcellulose), lubricants, inert diluents, preservatives, disintegrants (e.g., sodium starch glycolate or cross-linked sodium carboxymethylcellulose), surfactants, or dispersants. Molded tablets may be made by molding a mixture of the powdered compound moistened with an inert liquid diluent in a suitable machine.

[0227] Tablets and other solid dosage forms of the pharmaceutical compositions of the present disclosure, such as dragees, capsules, pills, and granules, can optionally be scored or prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical formulation art. They can also be formulated to provide sustained or controlled release of the active ingredient therein, for example, using hydroxypropylmethylcellulose, other polymer matrices, liposomes, and / or microspheres, with proportions varied to provide the desired release profile. They may also be formulated for rapid release, for example, lyophilized. They can be sterilized, for example, by filtration through a bacteria-retaining filter or by incorporating a sterilizing agent in the form of a sterile solid pharmaceutical composition that can be dissolved in sterile water or some other sterile injectable medium immediately before use. These pharmaceutical compositions can also optionally contain opacifying agents and can be composed to release the active ingredient(s) only, or preferentially, in a certain portion of the gastrointestinal tract, optionally in a delayed manner. Examples of embedding compositions that can be used include polymeric substances and waxes. The active ingredient can also be in micro-encapsulated form, if appropriate, with one or more of the above-mentioned excipients.

[0228] Liquid dosage forms for oral administration of the compounds of the present disclosure include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups, and elixirs.In addition to the active ingredient, the liquid dosage forms can contain inert diluents commonly used in the art, such as water or other solvents, solubilizers and emulsifiers, for example, ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oils (e.g., cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil, and sesame oil), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycol, and fatty acid esters of sorbitan, and mixtures thereof.

[0229] Besides inert diluents, the oral pharmaceutical compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, coloring, perfuming, and preservative agents.

[0230] In addition to the polynucleotides, suspensions can contain suspending agents such as ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar and tragacanth, and mixtures thereof.

[0231] Formulations for rectal or vaginal administration can be made by mixing one or more of the polynucleotides described herein with one or more suitable non-irritating excipients or carriers including, for example, cocoa butter, polyethylene glycol, a suppository wax, or a salicylate, and can be provided as suppositories that are solid at room temperature but liquid at body temperature and therefore will melt in the rectal or vaginal cavity to release the active compound.

[0232] Formulations or dosage forms for topical or transdermal administration of the polynucleotides or vectors described herein include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches, and inhalants. The polynucleotides may be mixed under sterile conditions with a pharmaceutically acceptable carrier, and with any preservatives, buffers, or propellants that may be required. Ointments, pastes, creams, and gels may contain, in addition to the polynucleotides described herein, excipients such as animal and vegetable fats, oils, waxes, paraffin, starch, tragacanth, cellulose derivatives, polyethylene glycol, silicone, bentonite, silicic acid, talc, and zinc oxide, or mixtures thereof.

[0233] Powders and sprays can contain, in addition to the polynucleotides described herein, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates, and polyamide powder, or mixtures of these substances. Sprays can additionally contain common propellants such as chlorofluorohydrocarbons and volatile unsubstituted hydrocarbons, such as butane and propane.

[0234] Another advantage of transdermal patches is that they control the delivery of the polynucleotide or vector described herein to the body. Such dosage forms can be made by dissolving or dispersing the polynucleotide or vector in a suitable medium. Absorption enhancers can also be used to increase the flux of the drug through the skin. The flux rate can be controlled by providing a rate-controlling membrane or dispersing the drug in a polymer matrix or gel, among other methods known in the art.

[0235] Pharmaceutical compositions suitable for parenteral administration may contain one or more polynucleotides or vectors described herein in combination with one or more pharmaceutically acceptable sterile isotonic aqueous or non-aqueous solutions, dispersions, suspensions, or emulsions, or sterile powders that can be reconstituted immediately before use into sterile injectable solutions or dispersions, which may contain sugars, alcohols, antioxidants, buffers, bacteriostats, solutes that render the composition isotonic with the blood of the intended recipient, or suspending or thickening agents. Examples of suitable aqueous and non-aqueous carriers that can be used in pharmaceutical compositions of the present disclosure include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, etc.), and suitable mixtures thereof, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.

[0236] These pharmaceutical compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents, and dispersing agents. Prevention of the action of microorganisms on the polynucleotides or vectors described herein can be ensured by the inclusion of various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like, in the compositions. Furthermore, prolonged absorption of the injectable pharmaceutical form can be brought about by the inclusion of agents that delay absorption, such as aluminum monostearate and gelatin.

[0237] In some embodiments, to prolong the effect of the polynucleotides or vectors described herein or delay absorption from subcutaneous or intramuscular injection, a liquid suspension of crystalline or amorphous material with poor water solubility can be used, among other methods known in the art. The rate of absorption of a composition containing a polynucleotide or vector described herein depends upon its rate of dissolution, which may depend upon crystal size and crystalline form. Alternatively, delayed absorption of a parenterally administered drug form can be accomplished by dissolving or suspending the polynucleotide or vector described herein in an oil vehicle.

[0238] Injectable depot forms can be made by forming microencapsule matrices of polynucleotides in biodegradable polymers such as polylactide-polyglycolide. The release rate of the polynucleotide or vector can be controlled depending on the ratio of polynucleotide or vector to polymer and the properties of the particular polymer used. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations can also be prepared by entrapping the polynucleotide or vector in liposomes or microemulsions that are compatible with body tissues.

[0239] When the polynucleotides or vectors described herein are administered to humans and animals as pharmaceuticals, they can be given as they are or as pharmaceutical compositions containing, for example, 0.1 to 99% (more preferably, 10 to 30%) of the active ingredient combined with a pharmaceutically acceptable carrier.

[0240] As mentioned above, the formulations or preparations of the present disclosure can be administered orally, parenterally, topically, or rectally. They are usually administered in a form suitable for each administration route. For example, they are administered in the form of tablets or capsules, by injection, inhalation, eye drops, ointments, suppositories, etc., by injection, infusion, or inhalation, by topical administration with lotions or ointments, and by rectal administration with suppositories.

[0241] Regardless of the route of administration selected, the polynucleotides or vectors described herein, which may be used in a suitable hydrated form, and / or the pharmaceutical compositions of the present disclosure, may be formulated into pharmaceutically acceptable dosage forms by conventional methods known to those of skill in the art. The actual dosage level of the active ingredient in the pharmaceutical compositions of the present disclosure may be varied to obtain an amount of the active ingredient that is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without causing unacceptable toxicity to the patient.

[0242] The selected dosage level will depend on a variety of factors, including the activity of the particular polynucleotide or vector, or ester, salt, or amide thereof, employed, the route of administration, the time of administration, the rate of excretion or metabolism of the particular polynucleotide or vector employed, the rate and extent of absorption, the duration of treatment, other drugs, compounds, and / or materials used in combination with the particular polynucleotide or vector employed, the age, sex, weight, condition, general health, and medical history of the patient being treated, and similar factors well known in the medical field.

[0243] A physician or veterinarian of ordinary skill in the art can easily determine and prescribe the effective amount of pharmaceutical composition required. For example, a physician or veterinarian may start the dosage of the composition of the present disclosure used in the pharmaceutical composition at a level lower than that required to achieve the desired therapeutic effect, and gradually increase the dosage until the desired effect is achieved. In general, an appropriate daily dose of the composition of the present disclosure is the amount of polynucleotide or vector that is the lowest effective dose to produce a therapeutic effect. Such an effective dose will generally depend on the factors described above. In general, oral and parenteral doses of the composition of the present disclosure for a patient, when used for the indicated effect, will range from about 0.0001 to about 100 mg per kilogram of body weight per day.

[0244] Polynucleotides can be administered to cells by a variety of methods known to those skilled in the art, including, but not limited to, encapsulation in liposomes, iontophoresis, or incorporation into other vehicles such as hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres, as described herein and known to those skilled in the art. In some embodiments, microemulsification techniques can be utilized to improve bioavailability. Examples include trimethrin (Dordunoo, SK, et al., Drug Development and Industrial Pharmacy, 17(12), 1685-1713, 1991 and REV 5901 (Sheen, PC, et al., J Pharm Sci 80(7), 712-714, 1991). Among other advantages, microemulsification improves bioavailability by directing absorption preferentially into the lymphatic system rather than the circulatory system, thereby bypassing the liver and preventing degradation of viral vector particles, for example, in the hepatobiliary circulation.

[0245] In some embodiments, the formulation contains micelles formed from a polynucleotide or vector described herein and at least one amphiphilic carrier, wherein the micelles have an average diameter of less than about 100 nm. In some embodiments, micelles having an average diameter of less than about 50 nm are used with the polynucleotides or vectors described herein. In some embodiments, micelles having an average diameter of less than about 30 nm, or even less than about 20 nm, are used.

[0246] While any suitable amphiphilic carrier is contemplated, presently preferred carriers are those that have Generally Regarded as Safe (GRAS) status and are capable of solubilizing the polynucleotide or vector described herein and microemulsifying it at a subsequent stage when the solution comes into contact with a complex aqueous phase (such as that found in the human digestive tract). Typically, amphiphilic components that meet these requirements have an HLB (hydrophilic to lipophilic balance) value of 2 to 20 and their structures contain straight-chain aliphatic radicals ranging from C-6 to C-20. Examples include polyethylene glycolated fatty glycerides and polyethylene glycol.

[0247] Examples of amphiphilic carriers include saturated and monounsaturated polyethylene glycolated fatty acid glycerides, such as those obtained from various fully or partially hydrogenated vegetable oils. Such oils can advantageously consist of tri-, di-, and mono-fatty acid glycerides and di- and mono-polyethylene glycol esters of the corresponding fatty acids; a particularly preferred fatty acid composition includes capric acid 4-10, capric acid 3-9, lauric acid 40-50, myristic acid 14-24, palmitic acid 4-14, and stearic acid 5-15%. Another useful class of amphiphilic carriers includes sorbitan and / or sorbitol partially esterified with saturated or monounsaturated fatty acids (SPAN-series) or the corresponding ethoxylated analogs (TWEEN-series).

[0248] Commercially available amphiphilic carriers may be particularly useful, including the Gelucire series, Labrafil, Labrasol, or Lauroglycol (all manufactured and sold by Gattefosse Corporation, Saint Priest, France), PEG-mono-oleate, PEG-di-oleate, PEG-mono- and di-laurate, lecithin, polysorbate 80, and the like (manufactured and sold by numerous companies in the United States and around the world).

[0249] In some aspects, delivery can be achieved by using liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, etc., to introduce the pharmaceutical composition into suitable host cells. In particular, the pharmaceutical composition can be formulated for delivery encapsulated in any of lipid particles, liposomes, vesicles, nanospheres, nanoparticles, etc. The formulation and use of such delivery vehicles can be carried out using known conventional techniques.

[0250] Suitable hydrophilic polymers for use with the polynucleotides or vectors described herein are those that are readily soluble in water, can be covalently attached to vesicle-forming lipids, and are tolerated in vivo without toxic effects (i.e., are biocompatible). Suitable polymers include polyethylene glycol (PEG), polylactic acid (also called polylactide), polyglycolic acid (also called polyglycolide), polylactic acid-polyglycolic acid copolymers, and polyvinyl alcohol. In some embodiments, the polymer has a molecular weight of about 100 or 120 daltons up to about 5,000 or 10,000 daltons, or about 300 daltons to about 5,000 daltons. In some embodiments, the polymer is polyethylene glycol having a molecular weight of about 100 to about 5,000 daltons, or about 300 to about 5,000 daltons. In some embodiments, the polymer is 750 dalton polyethylene glycol (PEG(750)). Polymers may also be defined by the number of monomers therein; in some embodiments, polymers of at least about three monomers are used, for example, PEG polymers consisting of three monomers (approximately 150 daltons).

[0251] Other hydrophilic polymers that may be suitable for use in the present disclosure include polyvinylpyrrolidone, polymethoxazoline, polyethyloxazoline, polyhydroxypropylmethacrylamide, polymethacrylamide, polydimethylacrylamide, and derivatized celluloses, such as hydroxymethylcellulose or hydroxyethylcellulose.

[0252] In some aspects, the compositions of the present disclosure comprise a biocompatible polymer selected from the group consisting of polyamides, polycarbonates, polyalkylenes, polymers of acrylic and methacrylic acid esters, polyvinyl polymers, polyglycolides, polysiloxanes, polyurethanes and copolymers thereof, cellulose, polypropylene, polyethylene, polystyrene, polymers of lactic and glycolic acid, polyanhydrides, poly(ortho)esters, poly(butyric acid), poly(valeric acid), poly(lactide-co-caprolactone), polysaccharides, proteins, polyhyaluronic acid, polycyanoacrylates, and blends, mixtures, or copolymers thereof.

[0253] In some embodiments, the compositions of the present disclosure comprise a cationic polymer. In some embodiments, the cationic polymer comprises a polyethyleneimine (PEI) backbone. In some embodiments, the PEI backbone is linked to a lipid or polyethylene glycol. In some embodiments, the cationic polymer comprises cationic dextran, cationic chitosan, cationic gelatin, cationic cellulose, or cationic cyclodextrin.

[0254] In some embodiments, the compositions of the present disclosure include cyclodextrins. Cyclodextrins are cyclic oligosaccharides that allow complexation with a variety of relatively hydrophobic compounds through van der Waals interactions and hydrogen bond formation. For a general review of cyclodextrin chemistry, see Wenz, Agnew, Chem. Int. Ed. Engl., 33:803-822 (1994). The physicochemical properties of cyclodextrin derivatives strongly depend on the type and degree of substitution. For example, their aqueous solubility ranges from insoluble (e.g., triacetyl-beta-cyclodextrin) to 147% soluble (w / v) (G-2-beta-cyclodextrin). Furthermore, they are soluble in many organic solvents. The properties of cyclodextrins allow for control of the solubility of various formulation components by increasing or decreasing their solubility. Many cyclodextrins and methods for their preparation have been described. For example, Parmeter (I) et al. (U.S. Pat. No. 3,453,259) and Gramera et al. (U.S. Pat. No. 3,459,731) described electrically neutral cyclodextrins. Other derivatives include cyclodextrins with cationic character [Parmeter (II), U.S. Pat. No. 3,453,257], insoluble cross-linked cyclodextrins (Solms, U.S. Pat. No. 3,420,788), and cyclodextrins with anionic character [Parmeter (III), U.S. Pat. No. 3,426,011]. Among cyclodextrin derivatives with anionic character, carboxylic acids, phosphorous acids, phosphinic acids, phosphonic acids, phosphoric acids, thiophosphonic acids, thiosulfinic acids, and sulfonic acids are added to the parent cyclodextrin [see Parmeter (III) (supra)]. Additionally, sulfoalkyl ether cyclodextrin derivatives are described by Stella et al. (US Pat. No. 5,134,127).

[0255] In some embodiments, the compositions of the present disclosure comprise liposomes. Liposomes consist of at least one lipid bilayer membrane surrounding an aqueous interior compartment. Liposomes can be characterized by membrane type and size. Small unilamellar vesicles (SUVs) have a single membrane and typically range from 0.02 to 0.05 μm in diameter, while large unilamellar vesicles (LUVS) are typically larger than 0.05 μm. Large oligolamellar vesicles and multilamellar vesicles have multiple, usually concentric, membrane layers and are typically larger than 0.1 μm. Liposomes with several non-concentric membranes, i.e., several smaller vesicles contained within a larger vesicle, are called multivesicular vesicles.

[0256] In some embodiments, compositions comprising liposomes containing the polynucleotides or vectors described herein are used, and the liposome membrane is formulated to provide liposomes with increased transport capacity. Alternatively or additionally, the compositions of the present disclosure can be contained within or adsorbed onto the liposome bilayer of the liposome. The polynucleotides described herein can be aggregated with lipid surfactants and carried within the interior space of the liposome. In these cases, the liposome membrane is formulated to withstand the disruptive effects of active agent-surfactant aggregates.

[0257] In some embodiments, the lipid bilayer of the liposome contains lipids derivatized with polyethylene glycol (PEG), such that PEG chains extend from the interior surface of the lipid bilayer into the interior space enclosed by the liposome and from the exterior of the lipid bilayer into the surrounding environment.

[0258] The active agent, e.g., a polynucleotide or vector contained within the liposomes described herein, is in solubilized form. Aggregates of surfactant and active agent (e.g., emulsions or micelles containing the polynucleotide or vector) can be encapsulated within the interior space of liposomes according to the present disclosure. The surfactant acts to disperse and solubilize the polynucleotide or vector and can be selected from any suitable aliphatic, alicyclic, or aromatic surfactant, including, but not limited to, biocompatible lysophosphatidylcholines (LPGs) of various chain lengths (e.g., about C14 to about C20). Polymer-derivatized lipids, such as PEG-lipids, can also be used for micelle formation because they act to inhibit micelle / membrane fusion and because the addition of a polymer to the surfactant molecule reduces the surfactant's CMC, aiding in micelle formation. Surfactants with CMCs in the micromolar range are preferred, although surfactants with higher CMCs can be used to prepare micelles encapsulated within the liposomes of the present disclosure.

[0259] Liposomes according to the present disclosure can be prepared by any of a variety of techniques known in the art. See, for example, U.S. Patent No. 4,235,871; PCT Publication WO 96 / 14057; New RRC, Liposomes: A practical approach, IRL Press, Oxford (1990), pp. 33-104; Lasic DD, Liposomes from physics to applications, Elsevier Science Publishers BV, Amsterdam, 1993. For example, the liposomes described herein can be prepared by diffusing a lipid derivatized with a hydrophilic polymer into a preformed liposome, e.g., by exposing the preformed liposome to micelles composed of a lipid-grafted polymer at a lipid concentration corresponding to the final molar percentage of derivatized lipid desired in the liposome. Liposomes containing hydrophilic polymers can also be formed by homogenization, lipid-field hydration, or extrusion techniques, as are well known in the art.

[0260] In some embodiments of the formulation procedure, the active agent is first dispersed in lysophosphatidylcholine or other low CMC surfactant (containing a polymer-grafted lipid) by sonication. The resulting micellar suspension of the active agent is then used to rehydrate a dried lipid sample containing an appropriate mole percent of polymer-grafted lipid or cholesterol. The lipid and active agent suspension is then formed into liposomes using extrusion techniques well known in the art, and the resulting liposomes are separated from the non-encapsulated solution by standard column separation.

[0261] In some embodiments, liposomes are prepared to have a substantially uniform size within a selected size range. One effective sizing method involves extruding an aqueous suspension of liposomes through a series of polycarbonate membranes having a selected uniform pore size, the pore size of which will approximately correspond to the largest size of liposomes produced by extrusion through that membrane. See, e.g., U.S. Pat. No. 4,737,323 (April 12, 1988). In some embodiments, reagents such as DharmaFECT® and Lipofectamine® can be used to introduce polynucleotides or proteins into cells.

[0262] The release characteristics of the disclosed formulations depend on the encapsulation material, the concentration of encapsulated polynucleotide, and the presence of release modifiers. For example, release can be engineered to be pH-dependent, e.g., using a pH-sensitive coating that releases only at low pH in the stomach or at higher pH in the intestine. Enteric coatings can be used to prevent release from occurring until after passage through the stomach. Multiple coatings or mixtures of cyanamide encapsulated in different materials can be used to obtain an initial release in the stomach, followed by later release in the intestine. Release can also be engineered by including salts or pore-forming agents, which can increase water uptake or release of the composition by diffusion from the capsule. Excipients that alter the solubility of the composition can also be used to control the release rate. Agents that promote matrix degradation or release from the matrix can also be incorporated. They can be added to the composition as a separate phase (i.e., as particulates) or co-dissolved in the polymer phase, depending on the composition. In some embodiments, the amount is 0.1 to 30 percent (w / w polymer). Types of degradation accelerators include inorganic salts such as ammonium sulfate and ammonium chloride; organic acids such as citric acid, benzoic acid, and ascorbic acid; inorganic bases such as sodium carbonate, potassium carbonate, calcium carbonate, zinc carbonate, and zinc hydroxide; organic bases such as protamine sulfate, spermine, choline, ethanolamine, diethanolamine, and triethanolamine; and surfactants such as Tween® and Pluronic®. Pore-forming agents (i.e., water-soluble compounds such as inorganic salts and sugars) that impart microstructure to the matrix are added as microparticles, typically in the range of 1 to 30 percent (w / w polymer).

[0263] In some aspects, uptake can also be manipulated by altering the residence time of the particle in the intestine. This can be achieved, for example, by coating the particle with a mucoadhesive polymer or by selecting a mucoadhesive polymer as the encapsulating material. Examples include most polymers with free carboxyl groups, such as chitosan, cellulose, and especially polyacrylates (as used herein, polyacrylate refers to polymers containing acrylate groups and modified acrylate groups, e.g., cyanoacrylate and methacrylate).

[0264] In some embodiments, the polynucleotide or vector can be formulated to be contained within or adapted to be released by a surgical or medical device or implant. In some embodiments, the implant can be coated or otherwise treated with the polynucleotide or vector. For example, hydrogels or other polymers, such as biocompatible and / or biodegradable polymers, can be used to coat the implant with the pharmaceutical compositions of the present disclosure (i.e., the use of hydrogels or other polymers makes the composition suitable for use in medical devices). Polymers and copolymers for coating medical devices with drugs are well known in the art. Examples of implants include, but are not limited to, stents, drug-eluting stents, sutures, prosthetic devices, vascular catheters, dialysis catheters, vascular grafts, artificial heart valves, cardiac pacemakers, implantable cardioverter-defibrillators, IV needles, devices for bone fixation and formation such as pins, screws, plates, and other devices, and artificial tissue matrices for wound healing.

[0265] In some aspects, polynucleotides for use according to the present disclosure may be formulated for administration in any convenient manner for use in human or veterinary medicine, by analogy with other pharmaceuticals. Polynucleotides or vectors and their corresponding formulations may be administered alone or in combination with other therapeutic strategies in the treatment of progeria syndromes, premature aging, signs and / or symptoms of aging, such as stem cell therapy, administration of reverse transcriptase inhibitors, and therapies that counter the cellular aging process.

[0266] V. Methods for Producing Recombinant AAV Particles Recombinant viral particles are provided for administration to a subject in need of cellular reprogramming from a senescent phenotype to a non-senescent phenotype. In some embodiments, the recombinant viral particles are AAV particles.

[0267] In some embodiments, methods for producing rAAV include (i) providing a cell with an adeno-associated virus (AAV) rep gene, an AAV cap gene, a nucleic acid comprising a polynucleotide described herein, a vector described herein, and at least one AAV serotype 2 inverted terminal repeat sequence; (ii) providing helper functions to generate a productive AAV infection; (ii) allowing AAV assembly; and (iii) harvesting the rAAV.

[0268] In some embodiments, the AAV rep gene and the AAV cap gene are provided by a plasmid.

[0269] In some embodiments, the AAV rep gene and the AAV cap gene are provided by the adenoviral vector.

[0270] In some embodiments, the AAV rep gene and the AAV cap gene are stably integrated into the genome of the cell.

[0271] In some embodiments, the helper functions are provided by a plasmid.

[0272] In some embodiments, helper functions are provided by the adenoviral vector.

[0273] In some aspects, provided is an rAAV produced by the methods described herein.

[0274] VI. Treatment Method Methods are provided for treating, preventing, or suppressing premature aging or an age-related disease in a subject, the methods comprising administering to the subject a therapeutically effective amount of a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein, in an amount effective to treat, prevent, or suppress premature aging or an age-related disease in the subject.

[0275] In some embodiments, the subject has a progeria syndrome.

[0276] In some embodiments, the progeria syndrome is selected from the group consisting of Hutchinson-Gilford progeria syndrome, Werner syndrome, atypical progeria, mandibular dysplasia type A, mandibular dysplasia type B, MTX2-associated mandibular dysplasia, mandibular hypoplasia, progeria features and lipodystrophy syndrome (MDPL), Nestor-Guillermo progeria syndrome, and restrictive skin disorder.

[0277] In some embodiments, the subject has a mutation in the LMNA gene, the ZMPSTE24 gene, the BANF1 gene, the POLD1 gene, the MTX2 gene, or the WRN gene.

[0278] In some embodiments, the subject has signs and / or symptoms of aging.

[0279] In some aspects, methods are provided for treating, preventing, or suppressing signs or symptoms of aging in a subject, the methods comprising administering to the subject a therapeutically effective amount of a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein, in an amount effective to treat, prevent, or suppress signs and symptoms of aging in the subject.

[0280] In some aspects, methods are provided for treating cellular senescence-associated aging in a subject in need thereof, hi some aspects, the method comprises administering to the subject a therapeutically effective amount of a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein.

[0281] In some embodiments, methods are provided for reprogramming senescent cells to a non-senescent phenotype. In some embodiments, methods are provided for reprogramming p16-expressing cells to non-p16-expressing cells. In some embodiments, the p16-expressing cells are senescent cells. In some embodiments, the p16-expressing cells are naturally senescent cells. In some embodiments, the p16-expressing cells are prematurely senescent cells. In some embodiments, methods are provided for reprogramming p16-expressing cells in an aging organism. In some embodiments, the methods partially or completely reverse cellular senescence. In some embodiments, the methods partially or completely reverse cellular senescence in naturally senescent cells. In some embodiments, the methods partially or completely reverse cellular senescence in prematurely senescent cells. In some embodiments, the methods partially or completely reverse cellular senescence in an aging organism. In some aspects, the method comprises contacting a senescent cell and / or an elderly cell and / or an old cell with a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, or an rAAV described herein, or a pharmaceutical composition described herein in an amount effective to partially reprogram the senescent cell to a non-senescent phenotype, and / or the old cell to a non-senescent or hyposenescent phenotype, and / or the senescent cell to a non-senescent phenotype.

[0282] In some aspects, methods are provided for reprogramming senescent cells in a subject to a non-senescent phenotype, hi some aspects, the method comprises administering to a subject in need thereof a therapeutically effective amount of a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein, and partially reprogramming the subject's senescent cells to a non-senescent phenotype.

[0283] In some aspects, methods are provided for inhibiting senescence-associated secretory phenotype (SASP) activity in a cell. In some aspects, the method comprises contacting a cell with a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein in an amount effective to inhibit SASP activity in the cell.

[0284] In some embodiments, methods are provided for rejuvenating senescent cells to a non-senescent phenotype. In some embodiments, the method comprises contacting the senescent cells with a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein in an amount effective to partially reprogram the senescent cells. In some embodiments, the method further comprises contacting the senescent cells with a polynucleotide described herein or a vector described herein in an amount effective to inhibit SASP activity in the senescent cells.

[0285] In some aspects, methods are provided for rejuvenating senescent cells in a subject to a non-senescent phenotype. In some aspects, the method comprises administering to a subject in need thereof a therapeutically effective amount of a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, a rAAV described herein, or a pharmaceutical composition described herein to partially reprogram the senescent cells, and administering to the subject a therapeutically effective amount of a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, a rAAV described herein, or a pharmaceutical composition described herein to inhibit SASP activity.

[0286] In some embodiments, methods are provided for rejuvenating senescent cells in a subject to a non-senescent or hyposenescent phenotype. In some embodiments, the methods comprise administering to a subject in need thereof a therapeutically effective amount of a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein to partially reprogram the senescent cells. In some embodiments, the senescent cells are naturally senescent cells, prematurely senescent cells, and / or cells within a senescent organism. In some embodiments, the senescent cells are p16-expressing cells. In some embodiments, administration of a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein to senescent cells partially or completely reverses the senescent cells to non-senescent or hyposenescent cells. In some embodiments, administration of a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein to p16-expressing cells partially or completely reverses the p16-expressing cells to non-p16-expressing cells. In some aspects, administration of a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein to a p16-expressing cell reduces p16 expression in the cell.

[0287] In some aspects, administration induces an increase in epidermal thickness, a decrease in mesangial area in the kidney, an increase in structural arrangement of hepatocytes in the liver, reversal of lymphocyte depletion in germinal centers of the spleen, a decrease in the levels of inflammatory markers, an increase in the number of hematopoietic stem cells, restoration of bone marrow tissue, and / or an increase in activation of DNA repair pathways in the subject.

[0288] In some embodiments, the reduction in the level of inflammatory markers includes a reduction in neutrophil infiltration in the liver and a reduction in inflammatory signatures in the spleen.

[0289] In some aspects, methods are provided for increasing age-related survival in a subject, hi some aspects, the method comprises administering to a subject in need thereof a therapeutically effective amount of a polynucleotide described herein, as described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein, and reprogramming senescent cells in the subject, thereby increasing age-related survival in the subject.

[0290] In some embodiments, the subject is a human.

[0291] In some embodiments, methods of treatment are provided that include contacting a cell with a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein in an amount effective to partially reprogram the cell. In some embodiments, the contacting is performed ex vivo, e.g., in a cell culture dish. In some embodiments, the contacted cell is then administered to a subject in need of a partially reprogrammed cell.

[0292] In some aspects, methods of treatment are provided, comprising contacting a cell with a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein in an amount effective to partially reprogram the cell. In further aspects, the method comprises administering the cell to a subject in need of a partially reprogrammed cell. In some aspects, the cell is a fibroblast. In some aspects, the fibroblast is a mammalian fibroblast. In some aspects, the fibroblast is a human fibroblast.

[0293] In some aspects, there is provided a use of a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein to treat cellular senescence-associated senescence.

[0294] In some aspects, there is provided a use of a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein in the manufacture of a medicament for treating cellular senescence-associated aging.

[0295] In some aspects, an article of manufacture is provided that includes a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein.

[0296] In some embodiments, the method further comprises administering to the subject an additional therapeutic agent.

[0297] In some aspects, the polynucleotides described herein, the vectors described herein, the cells described herein, the compositions described herein, the rAAV described herein, the pharmaceutical compositions described herein are administered intravenously, intramuscularly, intradermally, subcutaneously, intraperitoneally, or intranasally.

[0298] In some embodiments, the administration process can vary depending on the composition or compositions and the desired effect. Thus, the administration process includes administering a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein to a patient in need of such treatment.

[0299] In some aspects, administration can be achieved by any means appropriate for the therapeutic agent, for example, parenteral, mucosal, pulmonary, subcutaneous, intradermal, topical, catheter-based, or oral delivery. Parenteral delivery can include, for example, subcutaneous, intravenous, intramuscular, intraarterial, intraperitoneal, intralymphatic delivery, and injection into the tissue of an organ. Mucosal delivery can include, for example, intranasal delivery, administration to a patient's respiratory tract, i.e., nose, sinuses, pharynx, lungs, e.g., as nasal drops, inhalation, vaporization, or other methods known in the art. Oral or intranasal delivery can include administration of an aerosol. Pulmonary delivery can include inhalation of the agent. Catheter-based delivery can include delivery by iontophoretic catheter-based delivery. Oral delivery can include delivery of a coated pill or oral administration of a liquid. Administration may also generally include delivery in a pharmaceutically acceptable carrier, such as a buffer, polypeptide, peptide, polysaccharide conjugate, liposome, and / or lipid, in accordance with the methods and compositions described herein.

[0300] In some aspects, a therapeutically effective amount of a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein is administered intravenously, intramuscularly, intradermally, subcutaneously, intraperitoneally, or intranasally.

[0301] In some aspects, a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein is delivered to a subject or tissue of a subject as a combination therapy.

[0302] In some embodiments, the polynucleotides described herein, the vectors described herein, the cells described herein, the compositions described herein, the rAAV described herein, and the pharmaceutical compositions described herein are delivered to a subject or tissue of a subject along with at least one additional therapeutic agent. In some embodiments, the polynucleotides described herein, the vectors described herein, the cells described herein, the compositions described herein, the rAAV described herein, and the pharmaceutical compositions described herein are administered to a subject before, after, or together with at least one additional therapeutic agent.

[0303] In some aspects, the polynucleotides described herein, vectors described herein, cells described herein, compositions described herein, rAAV described herein, pharmaceutical compositions described herein, and at least one additional therapeutic agent can be administered by the same route or by different routes, essentially at the same time (i.e., simultaneously, concurrently), or at different times (e.g., sequentially, successively, alternating, consecutively, or according to any other type of alternating regime). In some aspects, the additional therapeutic agent can be administered prior to, simultaneously with, or following administration of a polynucleotide or vector described herein. For example, in some aspects, the polynucleotide or vector is administered to a patient receiving background anti-aging therapy. For example, in some aspects, the patient has been treated with an anti-aging therapy prior to administration of a polynucleotide or vector described herein and continues to receive the anti-aging therapy.

[0304] In some embodiments, a first therapeutic composition of the combination may be administered by intravenous injection and an additional therapeutic composition of the combination may be administered intradermally. Alternatively, for example, all therapeutic compositions may be administered by intravenous injection, or all therapeutic compositions may be administered by intradermal injection.

[0305] The routes of administration described are intended only as a guide, as a skilled artisan can readily determine the optimum route of administration and dosage for any particular animal and condition. [Example]

[0306] Materials and Methods cell culture Human primary lung fibroblast IMR90 cells were obtained from ATCC and cultured in DMEM (Gibco), 10% FBS (Gibco), 1% penicillin / streptomycin (Invitrogen), 1x Glutamax (Invitrogen), and non-essential amino acids (Invitrogen). HEK293A cells were used for AAV production and maintained in medium containing DMEM, 10% FBS, and 1% penicillin / streptomycin. All cells were cultured at 37°C in a humidified incubator with 7% CO2. Cells were split at regular intervals when they reached approximately 70% confluency, and the medium was changed every two days.

[0307] AAV production AAV was prepared using HEK293-AAV cells (Cell Biolabs, Inc.) as described, with minor modifications (Grieger, JC, Choi, VW & Samulski, RJ Nat Protoc 1, 1412-1428, 2006). Cells were transfected using PEI (MW 40000) followed by CsCl gradient purification. Viral titers were determined by qPCR using primers (ITR-F: 5'GGAACCCCTAGTGATGGAGTT3' and ITR-R: 5'CGGCCTCAGTGAGCGA3').

[0308] inhibitors The topoisomerase inhibitor etoposide (Sigma-Aldrich, St. Louis, USA) was dissolved in sterile PBS and diluted to a working concentration of 15 μM before use.

[0309] Plasmid vector All plasmids used in this study are shown in Figures 12-17.

[0310] Quantitative real-time PCR mRNA levels were quantified as previously described (Sahu, SK et al. Nat Commun 8, 1523, 2017). Briefly, total RNA was prepared using Trizol (Invitrogen) and reverse transcribed with a First Strand cDNA Synthesis Kit (Fermentas). Transcripts were quantified by PCR using SYBR Green PCR MasterMix (ABI) on a ViiA7 PCR machine (Life Technologies). Human or mouse GAPDH and TBP primers were used for normalization. Detailed sequences of the primers used in this study are listed below. Mouse real-time PCR primers are listed in Table 1. [Table 1]

[0311] Human real-time PCR primers are listed in Table 2. [Table 2]

[0312] mouse All animal experiments were approved by the Universidad Catolica San Antonio de Murcia IACUC and conducted in accordance with protocols and ethical guidelines that conformed to regulatory standards. LMNAG609G mice were generated by Carlos Lopez-Otin at the University of Oviedo, Spain, and kindly provided by Brian Kennedy at the Buck Institute. Eight-week-old male C57BL / 6J mice were obtained from the Jackson Laboratory. p16-3MR (trimodality reporter) mice were obtained from the Jackson Laboratory. p16-3MR mice contain a synthetic Renilla luciferase (LUC) monomeric red fluorescent protein (mRFP) and a functional domain of a ganciclovir-sensitive truncated herpes simplex virus type 1 thymidine kinase (HSV-TK) under one copy of the CDKN2A (p16) promoter. p16-3MR mice showed induction of luciferase, consistent with p16 expression during aging. Animals were housed in a specific pathogen-free environment and maintained under standard conditions with a 12-hour day / night cycle and free access to food and water.

[0313] Adeno-associated virus (AAV) particles (1 x 10 as indicated) of the AAV DJ serotype carrying GFP or the CDKN2A promoter-OSK 11 Each mouse was injected via the tail vein with 300 μL of PBS containing 10 gene copies (GC) / mouse. Mice were observed periodically for weight loss and other abnormalities. Mice were sacrificed by CO2 inhalation or cervical dislocation, and blood was collected by cardiac puncture. Tissues were either immediately fixed or flash-frozen for H&E and RNA analysis.

[0314] Open field test Baseline activity was measured for 10 min by placing each mouse individually in the center of a 40 × 40 cm white box with 40 cm high walls. Light intensity was 290 lx in the center of the arena. Mouse activity was digitally recorded using a video camera placed 1 m above the center of the arena. Automated detection of mouse paths was analyzed using SYGNIS Tracker software (SYGNIS). In addition to analyzing general locomotion, the latency, duration of stay, and number of visits of mice to the inner arena (10 × 10 cm) away from the walls were calculated to measure anxiety levels. The open field test was performed on postnatal day 135.

[0315] IHC staining For IHC, tissues were harvested and fixed in 10% neutralized formalin for 2 days and then stored in 70% ethanol until further processing. H&E staining of paraffin sections was performed according to standard protocols.

[0316] Hematopoietic stem / progenitor cell analysis in mice Bone marrow cells were isolated from the tibia and femur of mice and stained with antibodies as detailed below. Antibody staining was performed for 90 minutes, followed by a PBS wash before analysis. Bone marrow analysis was performed on a FACS Aria II cell sorter (BD Biosciences). Collected data was analyzed with FlowJo software (Tree Star, Ashland, OR). The frequency of myeloid cell types was determined at 2 × 10 per mouse. 6 Calculated from 10 live lineage BM cells.

[0317] Phenotypic cell surface markers marking hematopoietic stem / progenitor cells (including HSCs, MPPs, and LMPPs) were stained with a lineage cocktail (CD4, CD8, B220, Gr-1, TER-119, and CD127), CD34, CD150, CD41, c-Kit, Sca-1, and Flt3).

[0318] RNA-seq and data analysis Total RNA was extracted using the Invitrogen PureLink RNA Mini Kit. Extracted RNA was quantified at OD 260 nm using an ND-1000 spectrophotometer (Nanodrop Technology), and RNA quality was assessed with the RNA 6000 LabChip kit using a Bioanalyzer 2100 (Agilent Technologies). Poly-A RNA isolation and library preparation were performed using the NEBNext® Poly(A) mRNA Magnetic Isolation Module and the NEBNext® Ultra™ II RNA Library Prep Kit for Illumina® according to the manufacturer's instructions. Sequencing was performed single-end, 50-cycle, on an Illumina HiSeq 4000 SR50. Reads were aligned to the mouse genome (mm8) using TopHat (version 2.0.9) (Trapnell, C., Pachter, L. & Salzberg, S. Bioinformatics 25, 1105-1111, 2009) with default options. After library size normalization using DESeq (Anders, S. & Huber, W. Genome Biol 11, R106, 2010), expression was quantified and expressed as reads per million mapped reads per transcript kilobase (RPKM) using cufflink (version 2.1.1) (Trapnell, C. et al. Nat Biotechnol 28, 511-515, 2010). Differential expression analysis was performed using the DESeq package with an FDR cutoff of 0.1.

[0319] Availability of data and materials Next-generation sequencing data generated in this study are available on the NCBI GEO website under accession number GSE201710.

[0320] Example 1 - Suppression and partial reprogramming of senescence-associated secretory phenotype (SASP) activity Cellular senescence plays a major role in physiological aging and HGPS, driven by both cell-intrinsic and SASP-mediated cell-extrinsic programs (Coppe, J.-P., Desprez, P.-Y., Krtolica, A. & Campisi, J. Annual Review of Pathology: Mechanisms of Disease 5, 99-118, 2010; Kuilman, T. & Peeper, D.S. Nat Rev Cancer 9, 81-94, 2009; Di Mitri, D. et al. Nature 515, 134-137, 2014; Eggert, T. et al. Cancer Cell 30, 533-547, 2016). Although senescent cells are considered harmful to the organism, they also play beneficial roles in various physiological processes, such as wound healing and prevention of fibrosis. For example, p16 高 Continuous or acute elimination of senescent cells disrupts the blood-tissue barrier, subsequently leading to liver and perivascular tissue fibrosis and poor health (Grosse, L. et al. Cell Metab 32, 87-99 e86, 2020). Furthermore, because the cellular composition of typical tissues and organs in aging organisms is dominated by large numbers of senescent cells, depleting many of them may not necessarily be a desirable strategy for preventing further health deterioration. Indeed, recent advances have demonstrated the important role of senescent cells in normal physiological function and demonstrated that targeting senescent cells for elimination can have deleterious consequences (Baker, DJ et al. Nature 479, 232-236 (2011); Reyes, N.S. et al. Science 378, 192-201 (2022)). Thus, to target senescent cells in a manner that is most beneficial to organismal lifespan, compositions and methods are needed that target the appropriate cell type and / or the appropriate cell state, e.g., senescent cells, elderly cells, somatic cells, and / or stem cells.

[0321] To target senescent cells, we explored two approaches: inhibition of SASP activity and partial reprogramming (Figures 1A and 2B). To suppress SASP, a dominant-negative isoform of NFκBIA, which is effective in blocking NF-κB nuclear translocation, we used a master transcriptional inducer of SASP (Figures 1A, 2B, and 2C). For partial reprogramming-mediated rejuvenation, we used the transcription factors Oct4, Sox2, and Klf4 (OSK) (Figure 1A). We delivered the transcription factors and dominant-negative isoforms of NFκBIA using adenovirus-associated virus (AAV) vectors containing recombinant AAV genomes carrying genes encoding Oct4, Sox2, and Klf4 (OSK) or dominant-negative isoforms of NFκBIA under the control of the Cdkn2a promoter within the AAV2 inverted terminal repeats (Figure 1A). Notably, Cdkn2a is an established marker of senescence (Figures 2A and 3F). For example, genome browser tracks derived from ChIP assays of H3K27 acetylation marks performed in proliferative and senescent human lung fibroblasts (IMR90 cells) showed enrichment of H3K27 acetylation at the CDKN2A and miR146 promoters in senescent cells ( Figure 3F ). Furthermore, CDKN2A is expressed in various tissues in a premature aging mouse model harboring a point mutation in the Lmna gene (LAKI) and exhibiting symptoms reminiscent of the accelerated aging seen in patients with Hutchinson-Gilford progeria syndrome (HGPS) (Figures 1G, top panel, and 3C) (see, for example, Krishnamurthy, J. et al. J Clin Invest 114, 1299-1307, 2004; He, S. & Sharpless, NEC Cell 169, 1000-1011, 2017; Muss, H. B. et al. Transl Cancer Res 9, 5732-5742, 2020). According to the published human single-cell transcriptome atlas (Tabula Sapiens), high expression of p16(CDKN2A) is found in elderly individuals, and high p16(CDKN2A)-expressing cells are mostly immune system-related cells (Figure 2A).Senescent cell-specific induction of target genes transduced via AAV particles carrying the respective transgenes under the control of the CDKN2A promoter was confirmed in an in vitro cell line ( Fig. 2C ).

[0322] Notably, NF-κB is primarily cytoplasmic in young cells, but translocates into the nucleus during senescence and induces the SASP. When senescent mouse fibroblasts were transduced with the CDKN2A promoter-NFKBIA(dn) AAV, NFκB remained in the cytoplasm of senescent cells, confirming the promoter and transgene functionality of the CDKN2A promoter-NFKBIA(dn) AAV vector in vitro (Figure 2C).

[0323] In an in vitro model of DNA damage-induced senescence in mouse embryonic fibroblasts (MEFs) treated with etoposide for 2 days, DNA damage increased CDKN2A expression in both cells treated with the CDKN2A promoter-OSK AAV and those treated with the control GFP AAV. However, CDKN2A promoter-OSK AAV transduction further increased CDKN2A expression and increased the expression of Oct4 and Sox2 in CDKN2A promoter-OSK AAV-transduced cells, confirming the promoter and transgene functionality of the CDKN2A promoter-OSK AAV vector in vitro (Figure 2D).

[0324] Example 2 - Cellular reprogramming of p16(CDKN2A)-expressing cells in a p16-marker-expressing mouse model in vivo To better analyze the fate of reprogrammed senescent cells in vivo, we used a mouse model (p16-3MR trimodality reporter mouse) containing a single copy of the p16 promoter, a synthetic Renilla luciferase (LUC) monomeric red fluorescent protein (mRFP), and a functional domain of a ganciclovir-sensitive truncated herpes simplex virus type 1 thymidine kinase (HSV-TK) (Figure 2E; see also Demaria, M. et al., Dev Cell 31, 722-733, 2014). For in vivo studies, we chose the AAV-DJ serotype because of its broad organ tropism in mice (Figures 3A and 3B).

[0325] A single dose of m-CDKN2A promoter-GFP AAV-DJ was injected into aged p16-3MR mice (22 months old), and RFP and GFP signals were assessed in various organs 15 days after injection (Figure 2F). The spleens of aged 3MR mice showed high levels of RFP-positive cells, indicating high levels of senescent cells. Coexpression of GFP and RFP in splenocytes indicated m-CDKN2A promoter-GFP AAV-DJ-mediated GFP expression in senescent cells (Figure 2F, magnified image, yellow).

[0326] In the liver, despite AAV-DJ successfully transducing hepatocytes, few RFP-expressing hepatocytes were observed, and no GFP / RFP coexpression was observed. This indicates a low amount of senescent cells in the liver (Figure 2F; the few light-colored dots in the liver image did not overlap with the DAPI nuclear stain and are likely due to background fluorescence). Overall, these studies confirmed the successful targeting of p16-expressing cells using the CDKN2A promoter-GFP AAV-DJ vector.

[0327] To analyze the fate of senescent cells undergoing cell reprogramming in vivo, aged p16-3MR mice (22 months old) were injected with m-CDKN2A promoter-OSK AAV-DJ and GFP AAV-DJ control. p16-3MR mice treated with CDKN2A promoter-OSK AAV-DJ showed reduced luciferase expression at 24 and 26 months (2 and 4 months after CDKN2A promoter-OSK AAV-DJ injection) compared with control mice injected with constitutive promoter-GFP AAV-DJ, indicating a reduction in senescent cells upon treatment with CDKN2A promoter-OSK AAV-DJ (Figures 7F, 9G, and 9H). These results demonstrated that CDKN2A promoter-driven OSK expression successfully reduced the number of senescent cells in CDKN2A promoter-3MR mice in vivo.

[0328] Example 3 - Impact of Senescent Cell-Specific Interventions on Organism Lifespan To test whether senescent cell-specific interventions could ameliorate aging-related phenotypes and extend biological lifespan, we used the prematurely aging LAKI- / - mouse model (Figures 1B and 3D). Eight-week-old LAKI- / - mice were injected with a single dose of AAV-DJ carrying CAG-GFP, m-CDKN2A promoter-OSK, or m-CDKN2A promoter-NFκBIA-dn (Figure 1B). Blockade of SASP activity in senescent cells with m-CDKN2A promoter-NFκBIA-dn significantly improved median lifespan (control: 120 days vs. CDKN2A promoter-NFκBIA: 140 days, approximately 17%). Partial reprogramming via OSK expression significantly improved both median (approximately 40%) and maximum (approximately 32%) lifespan in LAKI- / - mice (Figure 1C). Oct4 expression was confirmed in various tissues after m-CDKN2A promoter-OSK AAV-DJ transduction (Figure 3E). Different senescence promoters, such as mir146a, are known to be more sensitive and dynamic in response to senescence / SASP (Kang, C. et al., Science 349, aaa5612 (2015)) (Figure 3F). However, LAKI- / - mice transduced with m-mir146 OSK AAV-DJ showed weaker improvements in health and lifespan compared to those transduced with CDKN2A promoter-driven OSK expression (Figure 3G).

[0329] CDKN2A promoter-OSK expression significantly prevented the progressive weight loss characteristic of LAKI- / - mice and improved overall strength and activity, likely due to improved systemic physiology (Figures 4A and 4B). Detailed autopsy analysis performed at 135 days of age revealed gross improvements in the appearance of the gastrointestinal tract (reduced megacolon / megacecum with hardened feces) and reduced splenic atrophy in CDKN2A promoter-OSK LAKI- / - mice (Figures 4C and 4D). Morphological and histological changes in many organs, including the skin, liver, spleen, and kidney, were improved in LAKI- / - mice treated with CDKN2A promoter-OSK AAV-DJ compared with control mice treated with GFP AAV-DJ (Figures 1D, 4E, and 4F). For example, increased epidermal and dermal thickness, decreased mesangial area in the kidney, decreased renal atrophy, and increased hepatocyte structural arrangement in the liver were observed with CDKN2A promoter-OSK (Figures 1D, 4E, and 4F). Furthermore, after CDKN2A promoter-OSK, the spleens of LAKI- / - mice showed significant recovery of lymphocyte depletion in the white pulp, as visualized by macroscopic shrinkage of the spleen and reduced germinal center size (Figure 1D).

[0330] Although the majority of p16-high expressing cells are vascular endothelial cells, macrophages, and adipocytes (see, e.g., Grosse, L., et al., "Defined p16(High) Senescent Cell Types Are Indispensable for Mouse Healthspan." Cell Metab 32, 87-99 e86, 2020), expression of OSK in senescent cells of LAKI- / - mice significantly reduced the overall inflammatory response in a broader range of organs (Figures 1G and 1H). Notably, administration of CDKN2A promoter-OSK to LAKI- / - mice reduced CDKN2A / p16 expression in treated mice, indicating that CDKN2A / p16 promoter-OSK treatment successfully reduced the senescence marker p16. Analysis of Oct4 and Sox2 transgene expression in different organs showed more pronounced expression in some tissues, including bone marrow, indicating a paracrine mode of signaling that promoted an overall improvement in homeostasis of various organs and suppression of inflammatory responses in LAKI− / − mice (Figure 4G).

[0331] Example 4 - Reversal of aging in a premature aging mouse model As aging progresses, immunosenescence plays a key role in promoting the aging of various organs (Lee, KA, Flores, RR, Jang, IH, Saathoff, A., Robbins, PD, Immune Senescence, Immunosenescence and Aging. Front Aging 3, 900028, 2022). For example, aging bone marrow exhibits reduced HSC homing capacity, reduced per-cell repopulation self-renewal activity, a bias toward myeloid differentiation, and increased stress-induced apoptosis, which collectively promote age-related pathologies (Esplin, BL, Let et al. J Immunol 186, 5367-5375, 2011; Schuettpelz, LG & Link, DC Front Immunol 4, 204, 2013; Huggins, CJ et al. Mol Cell Biol 33, 3242-3258, 2013). In the spleen, aging leads to abnormalities in the functional compartments (red pulp and white pulp) that consist of specialized populations of macrophages, B cells, and stromal cells that are involved in the early response to bloodborne pathogens (Junt, T., Scandella, E., Ludewig, B., Form follows function: lymphoid tissue microarchitecture in antimicrobial immune defence. Nat Rev Immunol 8, 764-775, 2008).

[0332] Treatment of aged LAKI- / - mice with CDKN2A promoter-OSK AAV-DJ reversed bone marrow immunosenescence to a younger cell state in both the hematopoietic stem cell multipotent precursor (HSC-MMP) and hematopoietic stem cell (HSC) compartments (Figures 1E and 1F). Furthermore, treatment with CDKN2A promoter-OSK AAV-DJ reversed the accelerated depletion of the HSC population in LAKI- / - mice (Figures 5A-5D). For example, increased expression of Ki67 in CDKN2A promoter-OSK AAV-DJ-treated mice, compared with constitutive promoter-GFP AAV-DJ controls, indicated increased proliferation in the bone marrow compartment (Figure 5E). Furthermore, an increase in the percentage of CD34(-)CD150(+) cells in cultured bone marrow cells from LAKI- / - mice treated with CDKN2A promoter-OSK AAV-DJ compared with CDKN2A promoter-GFP AAV-DJ controls indicated an increase in stem cells upon treatment with CDKN2A promoter-OSK AAV-DJ (Figure 5I). Furthermore, a reversion of certain immune cell populations to a younger state was observed in LAKI- / - mice treated with CDKN2A promoter-OSK AAV-DJ (Figure 5J).

[0333] Bulk transcriptome analysis of skin, liver, spleen, and bone marrow revealed distinct tissue-specific transcriptome changes upon CDKN2A promoter-OSK AAV-DJ delivery into LAKI- / - mice (Figures 1H, 6A-6D), but not overall organ-specific transcriptome changes, indicating that CDKN2A promoter-OSK suppressed inflammation without altering cellular identity (Figure 6E). Furthermore, immune compartment-related organs, such as bone marrow and spleen, showed more pronounced transcriptional changes compared to other tissues tested (Figures 1H, 6A-6D). For example, bone marrow and spleen transcriptomes showed reduced inflammatory signaling and activated immune clearance pathways (Figures 1H, 6C, and 6D). Collectively, these results point to novel therapeutic interventions, both in vivo and ex vivo, that could restore bone marrow function and ultimately increase healthspan.

[0334] Example 5 - Reversal of senescence in human cells in vitro To further understand cell fate upon senescent-specific OSK expression, we used human primary lung fibroblasts (IMR90) recruited to various stages of senescence. During replicative senescence, expression of human OSK (hOSK) under the control of the human CDKN2A promoter resulted in a transcriptional reversal toward younger stages (Figures 7A, 7B, 8A, 9A, and 9B). Interestingly, hCDKN2A promoter-hOSK potently and specifically reversed the inflammatory response during replicative senescence (Figures 7C, 8F, and 9C). However, CDKN2A promoter-hOSK had no substantial effect on cell cycle-related genes in senescent cells (Figures 7D, 8C, 8D, and 9C), and cell cycle progression increased only in younger cells (Figure 8D). Furthermore, reversal of the inflammatory response in the senescent transcriptome upon hCDKN2A promoter-hOSK treatment of human IMR90 cells occurred without altering cellular identity (Figure 8E).

[0335] Furthermore, transcriptome analysis of senescent IMR90 cells transduced with hCDKN2A promoter-hOSK showed that, while stress response and energy-consuming anabolic pathways were reduced, some extracellular matrix (ECM) compartments were activated to a healthier stage upon hCDKN2A promoter-hOSK transduction, resulting in increased expression of elastin and collagen 1A1 (COL1A1) (Figures 9D and 9E).

[0336] Similar transcriptional reversal, indicative of cellular rejuvenation, was observed in DNA damage- and oncogene (RAS)-induced cellular senescence (Figs. 7E, 8A, and 9F).

[0337] Notably, a decrease in p16 senescence marker expression was observed in INR90 cells treated with CDKN2A promoter-OSK, indicating a reduction in the cellular senescent phenotype upon CDKN2A promoter-OSK treatment ( Figure 7A ).

[0338] Example 6 - Long-term effects of partial reprogramming on physiological aging in wild-type mice To evaluate the effect of CDKN2A promoter-OSK on physiological aging, we injected a single dose of CDKN2A promoter-OSK AAV-DJ or CDKN2A promoter-GFP AAV-DJ control into 60-day-old wild-type mice, and observed a 100% survival rate at 300 days (Figure 10A). Furthermore, we injected a single dose of CDKN2A promoter-OSK AAV-DJ or CDKN2A promoter-GFP AAV-DJ control into 18-month-old wild-type mice. We observed that mice injected with CDKN2A promoter-OSK AAV-DJ maintained their body weight, had an increased lifespan, and exhibited increased overall fitness compared with CDKN2A promoter-GFP AAV-DJ control mice (Figures 10B, 10C, and 11B).

[0339] In summary, the results of the above experiments demonstrated activation of repair and rejuvenation pathways in p16-expressing cells after partial cell reprogramming. No tumors were observed upon long-term CDKN2A promoter-driven OSK expression in young mice, and a similar tumor frequency was observed upon long-term CDKN2A promoter-driven OSK expression in aged wild-type mice compared with controls (Figure 11A).

[0340] The results described herein demonstrate that partial cellular reprogramming of senescent cells can have broad organismal rejuvenation effects without the risk of tumor induction or organ failure due to loss of cell number and identity.

[0341] The sequences described herein are shown in Table 3. [Table 3] [Table 4] [Table 5]

Table 6

Table 7

Table 8

Table 9

Table 10

Table 11

Table 12

Table 13

Table 14

Table 15

[0342] It is understood that the Detailed Description section, and not the Summary and Abstract sections, is intended to be used to interpret the claims. The Summary and Abstract sections may set forth one or more exemplary embodiments of the invention contemplated by the inventor(s), although not all, and are therefore not intended to limit the scope of the invention and the appended claims in any way.

[0343] The present invention has been described above using functional building blocks that illustrate the implementation of certain functions and their relationships. The boundaries of these functional building blocks have been arbitrarily defined herein for the convenience of the description. Alternative boundaries may be defined so long as the specified functions and their relationships are appropriately performed.

[0344] The foregoing description of specific embodiments fully reveals the general nature of the present invention, and those skilled in the art, by applying knowledge within that art, can readily modify and / or adapt such specific embodiments for various uses without undue experimentation and without departing from the general scope of the present invention. Therefore, such adaptations and modifications are intended to be within the meaning and range of equivalents of the disclosed embodiments, based on the teaching and guidance provided herein. It is to be understood that the phrases or terminology used herein are for the purpose of description, not of limitation, and that the terms or phrases used herein will be interpreted by those of ordinary skill in the art in light of this teaching and guidance.

[0345] The scope and applicability of the present invention should not be limited by any of the above-described exemplary embodiments, but should be defined only in accordance with the following claims and their equivalents.

Claims

1. A polynucleotide containing a CDKN2A promoter operably ligated to a nucleic acid sequence encoding the dominant-negative nuclear factor kappa-BIA (dnNKκBIA) protein.

2. The polynucleotide according to claim 1, wherein the CDKN2A promoter comprises a human CDKN2A promoter or a mouse CDKN2A promoter.

3. (a) The human CDKN2A promoter comprises a nucleotide sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1, or (b) The mouse CDKN2A promoter comprises a nucleotide sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 2, according to Claim 1.

4. The polynucleotide according to claim 1, wherein the dnNKκBIA protein comprises human dnNKκBIA protein.

5. The polynucleotide according to claim 1, wherein the nucleic acid sequence encoding the dnNKκBIA protein includes SEQ ID NO:

7.

6. The polynucleotide according to claim 1, further comprising a WPRE sequence, a polyadenylation signal sequence, an IRES, a proteolytic cleavage site, and / or a reporter gene.

7. The polynucleotide according to claim 6, wherein the polyadenylation signal sequence includes an SV40 polyadenylation signal sequence, a human growth hormone polyadenylation signal sequence, or a bovine growth hormone polyadenylation signal sequence.

8. The polynucleotide according to claim 6, wherein the protein degradation cleavage site is selected from the group consisting of self-processing cleavage sites and furin cleavage sites.

9. The polynucleotide according to claim 8, wherein the self-processing cleavage site comprises a P2A, E2A, F2A, or T2A peptide.

10. The polynucleotide according to claim 8, wherein the furin cleavage site includes the consensus sequence RXK(R)R of SEQ ID NO:

6.

11. A polynucleotide containing the nucleic acid sequence of SEQ ID NO: 11 or SEQ ID NO:

12.

12. A vector comprising a polynucleotide according to any one of claims 1 to 11.

13. The vector according to claim 12, comprising a viral vector, a nonviral vector, or a polymer.

14. The vector according to claim 13, wherein the viral vector includes an adeno-associated virus (AAV) vector, an adenovirus vector, a lentiviral vector, or a retrovirus vector.

15. The vector according to claim 14, wherein the AAV vector includes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVRH8, AAVrh9, AAV9, AAVrh10, AAV10, AAV11, AAV12, or AAV-DJ vector.

16. The vector according to claim 13, wherein the nonviral vector comprises a plasmid.

17. The vector according to claim 13, wherein the polymer comprises a cationic polymer containing a polyethyleneimine (PEI) skeleton linked to a lipid or polyethylene glycol (PEG).

18. A cell comprising a polynucleotide according to any one of claims 1 to 11.

19. The cell according to claim 18, comprising bacterial cells, insect cells, or animal cells.

20. The cell according to claim 19, wherein the animal cell includes a mammalian cell.

21. A composition comprising a polynucleotide and a carrier according to any one of claims 1 to 11.

22. A recombinant adeno-associated vector (rAAV) virus comprising the polynucleotide and AAV capsid protein according to any one of claims 1 to 11.

23. The rAAV according to claim 22, comprising an AAV-DJ capsid.

24. A pharmaceutical composition comprising a polynucleotide according to any one of claims 1 to 11, and a pharmaceutically acceptable carrier.

25. A kit comprising the polynucleotide described in any one of claims 1 to 11.

26. A method for producing rAAV, (i) To provide cells with an adeno-associated virus (AAV) rep gene, an AAV cap gene, a nucleic acid comprising a polynucleotide according to any one of claims 1 to 11, and at least one AAV serotype 2 reverse terminal repeat sequence, (ii) To provide a helper function for generating a proliferative AAV infection, (iii) To enable the construction of the AAV, (iv) The method comprising collecting the rAAV.

27. A pharmaceutical composition for reprogramming senescent cells to a non-senescent phenotype, comprising a polynucleotide according to any one of claims 1 to 11.

28. A pharmaceutical composition for reducing the number of senescent cells in a target, comprising a polynucleotide according to any one of claims 1 to 11.

29. A pharmaceutical composition for extending the lifespan of a target organism, comprising a polynucleotide as described in any one of claims 1 to 11.

30. A pharmaceutical composition for reducing progressive weight loss in aging subjects, comprising a polynucleotide according to any one of claims 1 to 11.

31. A pharmaceutical composition for inhibiting senescence-associated secretory phenotype (SASP) activity in cells, comprising a polynucleotide according to any one of claims 1 to 11.

32. A pharmaceutical composition for increasing the survival rate related to aging of a target, comprising a polynucleotide according to any one of claims 1 to 11.

33. A pharmaceutical composition for the treatment of Hutchinson-Gilford progeria syndrome, comprising a polynucleotide according to any one of claims 1 to 11.

Images