Compositions and methods for treating and preventing prekallikrein-related conditions

Abstract

This invention provides a method for improving edema in human subjects who require it. [Solution] Provided herein are methods for administering ISIS 721744 to improve edema, and methods for reducing prekallikrein (PKK) RNA, protein, or activity in human subjects requiring such reduction. In certain cases, the methods are useful for improving at least one symptom of hereditary angioedema. Such symptoms of hereditary angioedema include, but are not limited to, nausea, vomiting, itching, headache, fatigue, abdominal pain, shortness of breath, rhinitis, anaphylaxis, bronchoconstriction, and swelling. In certain cases, the methods are useful for improving at least one symptom of macular edema. Such symptoms of macular edema include, but are not limited to, visual impairment and vision loss.

Description

Technical Field

[0001] Sequence Listing This application has been filed with an electronic sequence listing. This sequence listing is provided as a file named BIOL0377WOSEQ_ST25.txt with a size of 56 Kb, created on March 10, 2021. The information in this electronic form of the sequence listing is hereby incorporated by reference in its entirety into this specification.

[0002] Provided herein is a method of administering ISIS 721744 for use in a human subject who needs improvement of edema, reduction of prekallikrein (PKK) RNA, reduction of PKK protein, and / or reduction of PKK activity. In certain examples, the method is useful for improving at least one symptom of hereditary angioedema. Such symptoms of hereditary angioedema include, but are not limited to, swelling, nausea, vomiting, itching, headache, fatigue, abdominal pain, shortness of breath, rhinitis, anaphylaxis, and bronchoconstriction. In certain examples, the method is useful for improving at least one symptom of macular edema. Such symptoms of macular edema include, but are not limited to, blurred vision, wavy vision, distorted vision, and vision loss.

Background Art

[0003] Prekallikrein (PKK) is a glycoprotein encoded by the KLKB1 gene and is cleaved by activation of factor XII from the zymogen form to an enzymatic form called plasma kallikrein (PK). PK is a member of the kinin-kallikrein pathway involved in inflammation, blood pressure control, coagulation, and pain. PK generates plasmin from plasminogen and releases kinins (e.g., bradykinin) from kininogen. Further, PK can in turn activate FXII reciprocally, thereby enhancing the release of bradykinin.

[0004] Edema is a medical term referring to swelling of one or more parts of the body, including the limbs, torso, and airways (such as the sinuses, mouth, throat, and lungs). Edema occurs when small blood vessels leak fluid into nearby tissue due to injury, inflammation, or other conditions (e.g., hypoalbuminemia, allergies, congestive heart failure, diabetes, or genetic mutations). Edema can include, but is not limited to, various types such as hereditary angioedema (HAE), pulmonary edema, cerebral edema, and macular edema.

[0005] HAE is a rare autosomal dominant disorder characterized by recurrent and unpredictable episodes of swelling, particularly of the skin, gastric system, oral and pharyngeal tissues, and laryngeal mucosa, which can be life-threatening. Typical swelling in HAE is caused by locally increased vascular permeability and fluid leakage in response to excessive bradykinin formation resulting from improper control of components of the contact system. In most cases, HAE is caused by mutations in the SERPING1 gene, which encodes a C1 esterase inhibitor (C1-INH) that modifies the kinin-kallikrein pathway. These gene mutations cause C1-INH deficiency (Type I HAE) or dysfunction (Type II HAE). The SERPING1 gene encodes a C1 esterase inhibitor (C1-INH).

[0006] Patients with a rare, third type of HAE, type III HAE (also known as normal-level (nl)-C1-INH-HAE), exhibit normal levels of functional C1-INH and often present with clear clinical symptoms, including more frequent facial, pharyngeal, and tongue swelling. There are at least four subtypes of type III HAE: gene mutations in the FXII gene (F12) (e.g., Thr328Lys, Thr328Arg, Thr309Lys, Th Subtypes associated with r309Arg (also known as "HAE-FXII"), subtypes associated with plasminogen gene (PLG) mutations (e.g., Lys330Glu) (also known as "HAE-PLG"), subtypes associated with angiopoietin-1 gene (ANGPT1) mutations (e.g., Ala119Ser) (also known as "HAE-ANGPT1"), and subtypes not associated with F12, PLG, or ANGPT1 mutations (also known as "HAE-UI").

[0007] Macular edema is a condition in which fluid accumulates in the retina, including the macula, causing blurred, distorted, or wavy vision. In some cases, macular edema can lead to partial or complete vision loss. Macular edema may be caused by or associated with ophthalmic surgery, macular degeneration, retinal vascular occlusion, eye infections, and inflammation of the eye. Macular edema often occurs as a result of diabetic neuropathy, a complication of diabetes characterized by damage and leakage of blood vessels in and / or near the retina. Macular edema associated with diabetic neuropathy is called diabetic macular edema (DME). DME is the most common cause of vision loss or impairment in patients with diabetic retinopathy. [Brief explanation of the drawing]

[0008] [Figure 1] Figure 1A shows the mean plasma PKK protein concentration as a percentage change from baseline at multiple time points during monthly administration of ISIS 721744 in healthy volunteers. Figure 1B shows the mean plasma enzyme precursor activation (a measure of the plasma's ability to produce bradykinin) as a percentage change from baseline at multiple time points during monthly administration of ISIS 721744 in healthy volunteers.

[0009] Summary of the Invention Provided herein are methods for improving edema, and for reducing PKK RNA, PKK protein, and / or PKK activity in human subjects requiring such reduction. In certain embodiments, edema includes hereditary angioedema. In certain embodiments, edema includes macular edema. In certain embodiments, the method comprises administering a therapeutically effective dose of an oligomeric compound. In certain embodiments, the oligomeric compound is ISIS 721744. In certain embodiments, the therapeutically effective dose is in the range of about 40 mg to about 120 mg. In certain embodiments, the therapeutically effective dose is about 80 mg. In certain embodiments, the therapeutically effective dose is about 100 mg. In certain embodiments, the therapeutically effective dose is administered once every two weeks. In certain embodiments, the therapeutically effective dose is administered once every four weeks. In certain embodiments, the therapeutically effective dose is administered once every eight weeks. In certain embodiments, the method includes administering a loading dose of approximately 80 mg of ISIS 721744 once every four weeks, followed by a maintenance dose of 100 mg of ISIS 721744 once every four weeks. In certain embodiments, the method includes administering a loading dose of approximately 80 mg of ISIS 721744 once every four weeks, followed by a maintenance dose of 80 mg of ISIS 721744 once every eight weeks. In certain embodiments, the method includes administering a loading dose of approximately 80 mg of ISIS 721744 once every two weeks, followed by a maintenance dose of 80 mg of ISIS 721744 once every four weeks.

[0010] Modes for carrying out the invention Please understand that the general explanation above and the detailed explanation below are merely illustrative and descriptive, and not limiting. In this specification, the use of the singular includes the plural unless otherwise explicitly stated. When used in this specification, the use of "or" means "and / or" unless otherwise specified. Furthermore, the use of the term "including," as well as other forms such as "includes" and "contains," is not limiting. Also, "element" or "component" Unless otherwise explicitly stated, terms such as "[...]" include both elements and components containing one unit, and elements and components containing two or more subunits.

[0011] Section headings used herein are for structural purposes only and should not be construed as limiting the subject matter of the inventions described herein. All documents or parts of documents cited herein, including but not limited to patents, patent applications, articles, books, and papers, are expressly incorporated herein by reference to the parts and in whole of the documents discussed herein.

[0012] definition Unless otherwise specified, the nomenclature, procedures, and techniques used in relation to analytical chemistry, synthetic organic chemistry, and medical and pharmaceutical chemistry described herein are well known and commonly used in the art. Where permitted, all patents, patent applications, patent application publications, and other publications and data referenced throughout this disclosure are incorporated herein by reference in their entirety.

[0013] Unless otherwise specified, the following terms have the following meanings:

[0014] As used herein, "2'-deoxyribonucleoside" means a nucleoside containing a 2'-H(H)deoxyribosyl sugar moiety. In certain embodiments, the 2'-deoxyribonucleoside is a 2'-β-D-deoxyribonucleoside containing a 2'-β-D-deoxyribosyl sugar moiety having a β-D configuration similar to that found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, the 2'-deoxyribonucleoside may contain a modified nucleic acid base or an RNA nucleic acid base (uracil).

[0015] As used herein, "2'-MOE" refers to the 2'-OCH2CH2OCH3 group in place of the 2'-OH group in the ribosyl sugar moiety. The "2'-MOE sugar moiety" is the sugar moiety having the 2'-OCH2CH2OCH3 group in place of the 2'-OH group in the ribosyl sugar moiety. Unless otherwise specified, the 2'-MOE sugar moiety is in a β-D configuration. "MOE" refers to O-methoxyethyl.

[0016] As used herein, "2'-MOE nucleoside" means a nucleoside containing a 2'-MOE sugar moiety.

[0017] As used herein, "5-methylcytosine" refers to cytosine modified with a methyl group attached to the 5-position. 5-methylcytosine is a modified nucleic acid base.

[0018] As used herein, "approximately" means plus or minus 7% of the given value.

[0019] As used herein, “administer” means to give a drug to a human subject.

[0020] As used herein, “improvement” in relation to treatment means that at least one symptom is improved compared to the same symptom without treatment. In certain embodiments, improvement is a reduction in the severity or frequency of a symptom, or a delay in the onset or progression of the severity or frequency of a symptom.

[0021] As used herein, “angioedema attack” refers to a swelling in a part of the body of a person with HAE. This means that, in certain embodiments, the subject does not have injury or infection at the time of swelling onset. As used herein, “breakthrough attack” means an angioedema attack that occurs while the subject is receiving prophylactic treatment for HAE.

[0022] As used herein, "antiedema agent" means a pharmaceutical product that reduces, ameliorates, or prevents edema of a body part in a subject who needs it.

[0023] As used herein, "anti-inflammatory agent" means a pharmaceutical product that improves or prevents an inflammatory condition in a subject who needs it.

[0024] As used herein, "antithrombotic agent" means a pharmaceutical product that improves or prevents a thrombotic condition in a subject who needs it.

[0025] As used herein, "conjugate group" means an atomic group directly bonded to an oligonucleotide. The conjugate group includes a conjugate moiety and a conjugate linker that binds the conjugate moiety to the oligonucleotide.

[0026] As used herein, "conjugate linker" means a single bond or an atomic group containing at least one bond, for example, that connects the conjugate moiety to the oligonucleotide. In certain embodiments, the conjugate linker includes a cleavable moiety.

[0027] As used herein, "conjugate moiety" means an atomic group bonded to an oligonucleotide via a conjugate linker. In certain embodiments, the conjugate moiety includes a cell targeting moiety.

[0028] As used herein, "dosage" means the amount of a pharmaceutical product administered.

[0029] As used herein, "edema" means swelling of one or more body parts. In certain embodiments, the body part is a limb, for example, a hand, foot, arm, leg, or face. In certain embodiments, the body part is not a limb, for example, the abdomen, tongue, or eye. In certain embodiments, body parts such as, for example, the lungs, trachea, or sinuses facilitate breathing.

[0030] As used herein, "PKK RNA" refers to the RNA expression product of the human gene, KLKB1.

[0031] As used herein, "PKK protein" refers to the protein expression product of PKK RNA.

[0032] As used herein, "PKK activity" refers to the activity of the PKK protein in an activated partial thromboplastin time (aPPT) test (a test that characterizes the coagulation of the subject's blood). PKK activity in a test plasma sample from a subject is assayed in an aPPT test by adding the test plasma sample to a control plasma sample in which PKK is immunodepleted, and by determining the relative PKK activity by comparing the coagulation (time) of the resulting combined sample with one or more reference plasma samples having a reference amount of PKK.

[0033] As used herein, “inflammatory condition” means a condition in which a body part of the subject is red, swollen, painful, dysfunctional, or a combination thereof. In certain embodiments, an inflammatory condition includes any of the following: redness (flushing), elevated body temperature (fever), swelling (tumor), pain (algesia), or loss of function of a body part. In certain embodiments, the subject has a fever (body temperature above 37°C). In certain embodiments, an inflammatory condition includes diabetes, arthritis, asthma, hepatitis, ulcers. It is a combination of colitis, Crohn's disease, injury, or infection.

[0034] As used herein, “nucleoside bond” means a covalent bond between consecutive nucleosides in an oligonucleotide. As used herein, “modified nucleoside bond” means any nucleoside bond other than a phosphodiester nucleoside bond. “Phosphothioate nucleoside bond” is a modified nucleoside bond in which one of the non-bridged oxygen atoms of the phosphodiester nucleoside bond is replaced with a sulfur atom.

[0035] As used herein, the "KLKB1 gene" refers to the genomic sequence encoding PKK RNA. Generally, humans have two KLKB1 genes, which may have the same or different nucleic acid sequences.

[0036] As used herein, “loading dose” means a therapeutically effective amount of the drug administered during the initial dosing phase in which the steady-state concentration of the drug is achieved. “Initial loading dose” means the first loading dose administered. “Final loading dose” means the last loading dose administered before the initial maintenance dose is administered.

[0037] As used herein, “maintenance dose” means the therapeutically effective amount of the drug administered during the drug administration phase after the steady-state concentration of the drug has been achieved.

[0038] As used herein, “modified oligonucleotide” means an oligonucleotide in which at least one nucleoside or nucleoside bond has been modified.

[0039] As used herein, “nucleic acid base” means an unmodified or modified nucleic acid base. “Unmodified nucleic acid base” refers to adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). “Modified nucleic acid base” refers to an atomic group other than unmodified A, T, C, U, or G that can pair with at least one unmodified nucleic acid base. “5-methylcytosine” is a modified nucleic acid base. As used herein, “nucleic acid base sequence” refers to a continuous sequence of nucleic acid bases in a target nucleic acid or oligonucleotide, independent of any sugar or internucleoside bond modifications.

[0040] As used herein, “nucleoside” means a compound comprising a nucleic acid base and a sugar moiety. The nucleic acid base and sugar moiety may be independently unmodified or modified. As used herein, “modified nucleoside” means a nucleoside containing a modified nucleic acid base and / or a modified sugar moiety. “Bound nucleoside” means a nucleoside linked in a continuous sequence (i.e., no further nucleosides between bound nucleosides). As used herein, “oligonucleotide” means a chain of bound nucleosides linked via nucleoside-nucleoside bonds, where each nucleoside and nucleoside-nucleoside bond may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8 to 50 bound nucleosides.

[0041] As used herein, "oligomer compound" means a compound comprising an oligonucleotide and a conjugate group.

[0042] As used herein, “pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administration to human subjects. Certain such carriers enable the formulation of pharmaceutical compositions, for example, as tablets, pills, coated tablets, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral administration to human subjects. In certain embodiments, a pharmaceutically acceptable carrier or diluent is sterile water, sterile physiological salt It is water or a sterile buffer solution.

[0043] As used herein, “pharmaceutically acceptable salt” means a physiologically and pharmaceutically acceptable salt of a compound. A pharmaceutically acceptable salt retains the desired biological activity of the parent compound and does not impart any undesirable toxicological effects to the parent compound.

[0044] As used herein, "potassium salt" means a salt of an oligomeric compound, where the cation of the salt is potassium.

[0045] As used herein, “refractory” means resistant to the therapeutic agent or pharmaceutical used to treat a condition. In certain embodiments, a subject refractory to a therapeutic agent or pharmaceutical has one or more symptoms of the condition after receiving the therapeutic agent or pharmaceutical. In certain embodiments, the severity of one or more symptoms of this condition is not reduced by the therapeutic agent or pharmaceutical. In certain embodiments, the occurrence of one or more symptoms of this condition is not reduced by the therapeutic agent or pharmaceutical.

[0046] As used herein, "RNA" means RNA transcript, and unless otherwise specified, includes pre-mRNA and mature mRNA.

[0047] As used herein, "sodium salt" means a salt of an oligomeric compound, where the cation of the salt is sodium.

[0048] As used herein, “subject” means human or non-human animal. In certain embodiments, the subject is a human subject. “Subject requiring it” means a subject that would benefit from the administration of the oligomeric compound disclosed herein. In certain embodiments, the subject requiring it has edema.

[0049] As used herein, “sugar portion” means either an unmodified sugar portion or a modified sugar portion. “Unmodified sugar portion” means a 2'-OH(H)β-D-ribosyl portion found in RNA (“unmodified RNA sugar portion”) or a 2'-H(H)β-D-deoxyribosyl sugar portion found in DNA (“unmodified DNA sugar portion”). An unmodified sugar portion has one hydrogen atom at each of the 1', 3', and 4' positions, one oxygen atom at the 3' position, and two hydrogen atoms at the 5' position. “Modified sugar portion” or “modified sugar” means a modified furanosyl sugar portion or a sugar substitute.

[0050] As used herein, “symptom” means any physical feature or test result indicating the presence or degree of a disease or disorder. In particular embodiments, symptoms are those that are evident to the subject or to the medical professional examining or testing the subject.

[0051] As used herein, "therapeutic dose" means the amount of a drug that produces a therapeutic effect in a human subject. For example, a therapeutic dose improves the symptoms of a disease.

[0052] As used herein, “thromboembolic state” means any disease or condition involving embolism caused by a blood clot. Examples of such diseases and conditions include the categories of thrombosis, embolism, and thromboembolism. A thromboembolic state may also be called a thromboembolic event or thrombotic event. Those at risk of a thromboembolic state include, but are not limited to, hypertension, hypercholesterolemia, atrial fibrillation, heart valve disorder, valvular heart disease, mechanical heart valves, surgery, cancer, pregnancy, old age, oral use of contraceptives, immobility, sepsis, atrial fibrillation, atherosclerosis, coronary artery disease (CAD), and antiphospholipid disease. This includes individuals with syndromes, pro-thrombotic coagulation disorders (e.g., factor V Leiden thrombosis), or a combination of these.

[0053] As used herein, "week" means 7 days.

[0054] Specific Embodiments This disclosure provides the following non-limiting numbered embodiments.

[0055] Embodiment 1. A method for improving edema in a human subject in need, comprising a therapeutically effective amount of an oligomeric compound having the following chemical structure: [ka] The method comprising administering (SEQ ID NO: 4), or a salt thereof, to the human subject.

[0056] Embodiment 2. The method according to Embodiment 1, wherein the salt is a sodium salt or a potassium salt.

[0057] Embodiment 3. A method for improving edema in a human subject in need, comprising a therapeutically effective amount of an oligomeric compound having the following chemical structure: [ka] The method comprising administering (SEQ ID NO: 4) to the human subject.

[0058] Embodiment 4. A method for improving edema in a human subject in need, comprising administering a therapeutically effective amount of an oligomeric compound to the human subject, wherein the oligomeric compound has the following chemical notation (5'→3'): (THA-GalNAc3)o Tes Ges It has mCeo Aeo Aes Gds Tds mCds Tds mCds Tds Tds Gds Gds mCds Aeo Aeo Aes mCes Ae (SEQ ID NO: 4), and (THA-GalNAc3)o has the following structure: [ka] It is represented as, A is an adenine nucleic acid base, mC is the 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, and The method wherein o is a phosphodiester nucleoside bond.

[0059] Embodiment 5. The method according to any one of Embodiments 1 to 4, wherein the edema is hereditary angioedema and at least one symptom of hereditary angioedema is improved.

[0060] Embodiment 6. The method according to Embodiment 5, wherein at least one symptom is selected from nausea, vomiting, itching, headache, fatigue, abdominal pain, shortness of breath, rhinitis, anaphylaxis, bronchoconstriction, and swelling, and combinations thereof.

[0061] Embodiment 7. The method according to any one of Embodiments 1 to 4, wherein the edema is macular edema and at least one symptom of macular edema is improved.

[0062] Embodiment 8. The method according to Embodiment 7, wherein at least one symptom is selected from blurred vision, wave vision, distorted vision, and visual acuity loss, and combinations thereof.

[0063] Embodiment 9. A method for reducing prekallikrein (PKK) RNA in a human subject requiring such reduction, comprising a therapeutically effective amount of an oligomeric compound having the following chemical structure: [ka] The method comprising administering (SEQ ID NO: 4), or a salt thereof, to the human subject.

[0064] Embodiment 10. The method according to Embodiment 9, wherein the salt is a sodium salt or a potassium salt.

[0065] Embodiment 11. A method for reducing PKK RNA in human subjects requiring such reduction, comprising a therapeutically effective amount of an oligomeric compound having the following chemical structure: [ka] The method comprising administering (SEQ ID NO: 4) to the human subject.

[0066] Embodiment 12. A method for reducing PKK RNA in a human subject requiring such reduction, comprising administering a therapeutically effective amount of an oligomer compound to the human subject, wherein the oligomer compound is chemically represented as follows (5'→3'): (THA-GalNAc3)o Tes Ges mCeo Aeo Aes Gds Tds mCds Tds mCds It has Tds Tds Gds Gds mCds Aeo Aeo Aes mCes Ae (SEQ ID NO: 4), and (THA-GalNAc3)o has the following structure: [ka] It is represented as, A is an adenine nucleic acid base, mC is the 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, and The method wherein o is a phosphodiester nucleoside bond.

[0067] Embodiment 13. A method for reducing PKK protein in human subjects requiring such reduction, comprising a therapeutically effective amount of an oligomeric compound having the following chemical structure: [ka] The method comprising administering (SEQ ID NO: 4), or a salt thereof, to the human subject.

[0068] Embodiment 14. The method according to Embodiment 13, wherein the salt is a sodium salt or a potassium salt.

[0069] Embodiment 15. A method for reducing PKK protein in human subjects requiring such reduction, comprising a therapeutically effective amount of an oligomeric compound having the following chemical structure: [ka] The method comprising administering (SEQ ID NO: 4) to the human subject.

[0070] Embodiment 16. A method for reducing PKK protein in a human subject requiring such reduction, comprising administering a therapeutically effective amount of an oligomer compound to the human subject, wherein the oligomer compound has the following chemical notation (5'→3'): (THA-GalNAc3)o Tes Ges mCeo Aeo Aes Gds Tds mCds Tds mCds Tds Tds Gds Gds mCds Aeo Aeo Aes mCes Ae (SEQ ID NO: 4), and (THA-GalNAc3)o has the following structure: [ka] It is represented as, A is an adenine nucleic acid base, mC is the 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, and The method wherein o is a phosphodiester nucleoside bond.

[0071] Embodiment 17. A method for reducing PKK activity in a human subject requiring such reduction, comprising a therapeutically effective amount of an oligomeric compound having the following chemical structure: [ka] The method comprising administering (SEQ ID NO: 4), or a salt thereof, to the human subject.

[0072] Embodiment 18. The method according to Embodiment 17, wherein the salt is a sodium salt or a potassium salt.

[0073] Embodiment 19. A method for reducing PKK activity in a human subject requiring such reduction, comprising a therapeutically effective amount of an oligomeric compound having the following chemical structure: [ka] The method comprising administering (SEQ ID NO: 4) to the human subject.

[0074] Embodiment 20. A method for reducing PKK activity in a human subject requiring such reduction, comprising administering a therapeutically effective amount of an oligomer compound to the human subject, wherein the oligomer compound has the following chemical notation (5'→3'): (THA-GalNAc3)o Tes Ges mCeo Aeo Aes Gds Tds mCds Tds mCds Tds Tds Gds Gds mCds Aeo Aeo Aes mCes Ae (SEQ ID NO: 4), and (THA-GalNAc3)o has the following structure: [ka] It is represented as, A is an adenine nucleic acid base, mC is the 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, and The method wherein o is a phosphodiester nucleoside bond.

[0075] Embodiment 21. The method according to any one of Embodiments 1 to 20, wherein the therapeutically effective dose is 20 mg.

[0076] Embodiment 22. The method according to any one of Embodiments 1 to 20, wherein the therapeutically effective dose is 40 mg.

[0077] Embodiment 23. The method according to any one of Embodiments 1 to 20, wherein the therapeutically effective dose is 60 mg.

[0078] Embodiment 24. The method according to any one of Embodiments 1 to 20, wherein the therapeutically effective dose is 80 mg.

[0079] Embodiment 25. The method according to any one of Embodiments 1 to 20, wherein the therapeutically effective dose is 100 mg.

[0080] Embodiment 26. The therapeutically effective doses are 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, 150 mg, 155 mg, 160 mg, 165 mg, The method according to any one of Embodiments 1 to 20, wherein the amount is 170 mg, 175 mg, 180 mg, 185 mg, 190 mg, 195 mg, 200 mg, 205 mg, 210 mg, 215 mg, 220 mg, 225 mg, 230 mg, 235 mg, 240 mg, 245 mg, 250 mg, 255 mg, 260 mg, 265 mg, 270 mg, 275 mg, 280 mg, 285 mg, 290 mg, 295 mg, and 300 mg.

[0081] Embodiment 27. The therapeutically effective dose is approximately 5 mg, approximately 10 mg, approximately 15 mg, approximately 20 mg, approximately 25 mg, approximately 30 mg, approximately 35 mg, approximately 40 mg, approximately 45 mg, approximately 50 mg, approximately 55 mg, approximately 60 mg, approximately 65 mg, approximately 70 mg, approximately 75 mg, approximately 80 mg, approximately 85 mg, approximately 90 mg, approximately 95 mg, approximately 100 mg, approximately 105 mg, approximately 110 mg, approximately 115 mg, approximately 120 mg, approximately 125 mg, approximately 130 mg, approximately 135 mg, approximately 140 mg, approximately 145 mg, The method according to any one of Embodiments 1 to 20, wherein the amount is approximately 150 mg, approximately 155 mg, approximately 160 mg, approximately 165 mg, approximately 170 mg, approximately 175 mg, approximately 180 mg, approximately 185 mg, approximately 190 mg, approximately 195 mg, approximately 200 mg, approximately 205 mg, approximately 210 mg, approximately 215 mg, approximately 220 mg, approximately 225 mg, approximately 230 mg, approximately 235 mg, approximately 240 mg, approximately 245 mg, approximately 250 mg, approximately 255 mg, approximately 260 mg, approximately 265 mg, approximately 270 mg, approximately 275 mg, approximately 280 mg, approximately 285 mg, approximately 290 mg, approximately 295 mg, and approximately 300 mg.

[0082] Embodiment 28. The therapeutically effective dose is 75.0 mg, 75.1 mg, 75.2 mg, 75.3 mg, 75.4 mg, 75.5 mg, 75.6 mg, 75.7 mg, 75.8 mg, 75.9 mg, 76.0 mg, 76.1 mg, 76.2 mg, 76.3 mg, 76.4 mg, 76.5 mg, 76.6 mg, 76.7 mg, 76.8 mg, 76.9 mg, 77.0 mg, 77.1 mg, 77.2 mg, 77.3 mg, 77.4 mg, 77.5mg, 77.6mg, 77.7mg, 77.8mg, 77.9mg, 78.0mg, 78.1mg, 78.2mg, 78.3mg, 78.4mg, 78.5mg, 78.6mg, 78.7mg, 78.8mg, 78.9mg, 79.0mg, 79.1mg, 79.2mg, 79.3mg, 79.4mg, 79.5mg, 79.6mg, 79.7mg, 79.8mg, 79.9mg, 80.0mg, 80.1 mg, 80.2mg, 80.3mg, 80.4mg, 80.5mg, 80.6mg, 80.7mg, 80.8mg, 80.9mg, 81.0mg, 81.1mg, 81.2mg, 81.3mg, 81.4mg, 81.5mg, 81.6mg, 81.7mg, 81.8mg, 81.9mg, 82.0mg, 82.1mg, 82.2mg, 82.3mg, 82.4mg, 82.5mg, 82.6mg, 82.7mg, 82.8 The method according to any one of Embodiments 1 to 20, wherein the amount is any of mg, 82.9 mg, 83.0 mg, 83.1 mg, 83.2 mg, 83.3 mg, 83.4 mg, 83.5 mg, 83.6 mg, 83.7 mg, 83.8 mg, 83.9 mg, 84.0 mg, 84.1 mg, 84.2 mg, 84.3 mg, 84.4 mg, 84.5 mg, 84.6 mg, 84.7 mg, 84.8 mg, 84.9 mg, and 85.0 mg.

[0083] Embodiment 29. The therapeutically effective dose is approximately 75.0 mg, approximately 75.1 mg, approximately 75.2 mg, approximately 75.3 mg, approximately 75.4 mg, approximately 75.5 mg, approximately 75.6 mg, approximately 75.7 mg, approximately 75.8 mg, approximately 75.9 mg, approximately 76.0 mg, approximately 76.1 mg, approximately 76.2 mg, approximately 76.3 mg, approximately 76.4 mg, approximately 76.5 mg, approximately 76.6 mg, approximately 76.6 Approximately 76.7mg, approximately 76.8mg, approximately 76.9mg, approximately 77.0mg, approximately 77.1mg, approximately 77.2mg, approximately 77.3mg, approximately 77.4mg, approximately 77.5mg, approximately 77.6mg, approximately 77.7mg, approximately 77.8mg, approximately 77.9mg, approximately 78.0mg, approximately 78.1mg, approximately 78.2mg, approximately 78.3mg, approximately 78.4mg, approximately 78.5mg, approximately 78.6mg, approximately 78.7mg, approximately 78.8mg, Approximately 78.9mg, approximately 79.0mg, approximately 79.1mg, approximately 79.2mg, approximately 79.3mg, approximately 79.4mg, approximately 79.5mg, approximately 79.6mg, approximately 79.7mg, approximately 79.8mg, approximately 79.9mg, approximately 80.0mg, approximately 80.1mg, approximately 80.2mg, approximately 80.3mg, approximately 80.4mg, approximately 80.5mg, approximately 80.6mg, approximately 80.7mg, approximately 80.8mg, approximately 80.9mg, approximately 81.0mg, Approximately 81.1mg, approximately 81.2mg, approximately 81.3mg, approximately 81.4mg, approximately 81.5mg, approximately 81.6mg, approximately 81.7mg, approximately 81.8mg, approximately 81.9mg, approximately 82.0mg, approximately 82.1mg, approximately 82.2mg, approximately 82.3mg, approximately 82.4mg, approximately 82.5mg, approximately 82.6mg, approximately 82.7mg, approximately 82.8mg, approximately 82.9mg, approximately 83.0mg, approximately 83.1mg, approximately 83.2mg, The method according to any one of Embodiments 1 to 20, wherein the amount is approximately 83.3 mg, approximately 83.4 mg, approximately 83.5 mg, approximately 83.6 mg, approximately 83.7 mg, approximately 83.8 mg, approximately 83.9 mg, approximately 84.0 mg, approximately 84.1 mg, approximately 84.2 mg, approximately 84.3 mg, approximately 84.4 mg, approximately 84.5 mg, approximately 84.6 mg, approximately 84.7 mg, approximately 84.8 mg, approximately 84.9 mg, and approximately 85.0 mg.

[0084] Embodiment 30. The therapeutically effective dose is 10mg-140mg, 10mg-130mg, 10mg-120mg, 10mg-110mg, 10mg-100mg, 10mg-90mg, 10mg-80mg, 10mg-70mg, 10mg-60mg, 10mg-50mg, 10mg-40mg, 10mg-30mg, 10mg-20mg, 20mg-140mg, 20mg-130mg, 20mg-120mg, 20mg-110mg, 20mg-100mg, 20mg-90mg, 20mg-80mg, 20mg-70mg, 20mg-60mg, 20mg- 50mg, 20mg~40mg, 20mg~30mg, 30mg~140mg, 30mg~130mg, 30mg~120mg, 30mg~110mg, 30mg~100mg, 30mg~90mg, 30mg~80mg, 30mg~70mg, 30mg~60mg, 30mg~ 50mg, 30mg~40mg, 40mg~140mg, 40mg~130mg, 40mg~120mg, 40mg~110mg, 40mg~100mg, 40mg~90mg, 40mg~80mg, 40mg~70mg, 40mg~60mg, 40mg~50mg, 50mg~ 140mg, 50mg~130mg, 50mg~120mg, 50mg~110mg, 50mg~100mg, 50mg~90mg, 50mg~80mg, 50mg~70mg, 50mg~60mg, 60mg~140mg, 60mg~130mg, 60mg~120mg, 60 mg~110mg, 60mg~100mg, 60mg~90mg, 60mg~80mg, 60mg~70mg, 70mg~140mg, 70mg~130mg, 70mg~120mg, 70mg~110mg, 70mg~100mg, 70mg~90mg, 70mg~80mg, 80mg~140mg, 80mg~130mg, 80mg~120mg, 80mg~110mg, 80mg~100mg, 80mg~90mg, 90mg~140mg, 90mg~130mg, 90mg~120mg, 90mg~110mg, 90mg~100mg, 100mg ~140mg, 100mg~130mg, 100mg~120mg, 100mg~110mg, 110mg~140mg, 110mg~130mg, 110mg~120mg, 120mg~140mg, 120mg~130mg, 130mg~140mg, 65mg~95mg,65mg~90mg, 65mg~85mg, 65mg~80mg, 65mg~75mg, 65mg~70mg, 70mg~95mg, 70mg~85mg, 70mg~75mg, 7 5mg~100mg, 75mg~95mg, 75mg~90mg, 75mg~85mg, 75mg~80mg, 80mg~95mg, 80mg~85mg, 85mg~100mg, 8 5mg~90mg, 90mg~95mg, 95mg~100mg, 80mg~89mg, 80mg~88mg, 80mg~87mg, 80mg~86mg, 80mg~84mg, 80 mg~83mg, 80mg~82mg, 80mg~81mg, 81mg~90mg, 82mg~89mg, 82mg~88mg, 82mg~87mg, 82mg~86mg, 82mg ~85mg, 82mg~84mg, 82mg~83mg, 83mg~90mg, 83mg~89mg, 83mg~88mg, 83mg~87mg, 83mg~86mg, 83mg~8 5mg, 83mg~84mg, 84mg~90mg, 84mg~89mg, 84mg~88mg, 84mg~87mg, 84mg~86mg, 84mg~85mg, 85mg~89m The method according to any one of Embodiments 1 to 20, wherein the amount is any one of g, 85 mg to 88 mg, 85 mg to 87 mg, 85 mg to 86 mg, 86 mg to 90 mg, 86 mg to 89 mg, 86 mg to 88 mg, 86 mg to 87 mg, 87 mg to 90 mg, 87 mg to 89 mg, 87 mg to 88 mg, 88 mg to 90 mg, 88 mg to 89 mg, and 89 mg to 90 mg.

[0085] Embodiment 31. The therapeutically effective dose is less than 300 mg, less than 295 mg, less than 290 mg, less than 285 mg, less than 280 mg, less than 275 mg, less than 270 mg, less than 265 mg, less than 260 mg, less than 255 mg, less than 250 mg, less than 245 mg, less than 240 mg, less than 235 mg, less than 230 mg, less than 225 mg, less than 220 mg, less than 215 mg, less than 210 mg, less than 205 mg, less than 200 mg, less than 195 mg, less than 190 mg, less than 185 mg, less than 180 mg, less than 175 mg, less than 170 mg, less than 165 mg The method according to any one of Embodiments 1 to 20, wherein the amount is less than 160 mg, less than 150 mg, less than 145 mg, less than 140 mg, less than 135 mg, less than 130 mg, less than 125 mg, less than 120 mg, less than 115 mg, less than 110 mg, less than 105 mg, less than 100 mg, less than 95 mg, less than 90 mg, less than 85 mg, less than 80 mg, less than 75 mg, less than 70 mg, less than 65 mg, less than 60 mg, less than 55 mg, less than 50 mg, less than 45 mg, less than 40 mg, less than 35 mg, less than 30 mg, less than 25 mg, and less than 20 mg.

[0086] Embodiment 32. The therapeutically effective dose is less than approximately 300 mg, less than approximately 295 mg, less than approximately 290 mg, less than approximately 285 mg, less than approximately 280 mg, less than approximately 275 mg, less than approximately 270 mg, less than approximately 265 mg, less than approximately 260 mg, less than approximately 255 mg, less than approximately 250 mg, less than approximately 245 mg, less than approximately 240 mg, less than approximately 235 mg, less than approximately 230 mg, less than approximately 225 mg, less than approximately 220 mg, less than approximately 215 mg, less than approximately 210 mg, less than approximately 205 mg, less than approximately 200 mg, less than approximately 195 mg, less than approximately 190 mg, less than approximately 185 mg, less than approximately 180 mg, less than approximately 175 mg, less than approximately 170 mg, less than approximately 165 mg, The method according to any one of Embodiments 1 to 20, wherein the amount is less than approximately 160 mg, less than approximately 150 mg, less than approximately 145 mg, less than approximately 140 mg, less than approximately 135 mg, less than approximately 130 mg, less than approximately 125 mg, less than approximately 120 mg, less than approximately 115 mg, less than approximately 110 mg, less than approximately 105 mg, less than approximately 100 mg, less than approximately 95 mg, less than approximately 90 mg, less than approximately 85 mg, less than approximately 80 mg, less than approximately 75 mg, less than approximately 70 mg, less than approximately 65 mg, less than approximately 60 mg, less than approximately 55 mg, less than approximately 50 mg, less than approximately 45 mg, less than approximately 40 mg, less than approximately 35 mg, less than approximately 30 mg, less than approximately 25 mg, and less than approximately 20 mg.

[0087] Embodiment 33. The method according to any one of Embodiments 1 to 20, wherein the therapeutically effective dose is at least 10 mg, at least 15 mg, at least 20 mg, at least 25 mg, at least 30 mg, at least 35 mg, at least 40 mg, at least 45 mg, at least 50 mg, at least 55 mg, at least 60 mg, at least 65 mg, at least 70 mg, at least 75 mg, at least 80 mg, at least 85 mg, at least 90 mg, at least 95 mg, at least about 100 mg, at least 105 mg, at least 115 mg, at least 120 mg, at least 125 mg, at least 130 mg, at least 135 mg, at least 140 mg, at least 145 mg, and at least 150 mg.

[0088] Embodiment 34. The method according to any one of Embodiments 1 to 20, wherein the therapeutically effective dose is at least about 10 mg, at least about 15 mg, at least about 20 mg, at least about 25 mg, at least about 30 mg, at least about 35 mg, at least about 40 mg, at least about 45 mg, at least about 50 mg, at least about 55 mg, at least about 60 mg, at least about 65 mg, at least about 70 mg, at least about 75 mg, at least about 80 mg, at least about 85 mg, at least about 90 mg, at least about 95 mg, at least about 100 mg, at least about 105 mg, at least about 115 mg, at least about 120 mg, at least about 125 mg, at least about 130 mg, at least about 135 mg, at least about 140 mg, at least about 145 mg, and at least about 150 mg.

[0089] Embodiment 35. The method according to any one of Embodiments 1 to 34, comprising administering the oligomer compound once every four weeks.

[0090] Embodiment 36. The method according to any one of Embodiments 1 to 34, comprising administering the oligomer compound once every 8 weeks.

[0091] Embodiment 37. The method according to any one of Embodiments 1 to 34, comprising administering the oligomer compound once every four weeks.

[0092] Embodiment 38. The method according to any one of Embodiments 1 to 34, comprising administering the oligomer compound once every eight weeks.

[0093] Embodiment 39. A method according to any one of Embodiments 1 to 34, comprising administering the oligomer compound once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, once every 10 weeks, once every 11 weeks, once every 12 weeks, once every 13 weeks, once every 14 weeks, once every 15 weeks, once every 16 weeks, once every 17 weeks, once every 18 weeks, once every 19 weeks, or once every 20 weeks.

[0094] Embodiment 40. The method according to any one of Embodiments 1 to 34, comprising administering the oligomer compound once every approximately 4 weeks, once every approximately 5 weeks, once every approximately 6 weeks, once every approximately 7 weeks, once every approximately 8 weeks, once every approximately 9 weeks, once every approximately 10 weeks, once every approximately 11 weeks, once every approximately 12 weeks, once every approximately 13 weeks, once every approximately 14 weeks, once every approximately 15 weeks, once every approximately 16 weeks, once every approximately 17 weeks, once every approximately 18 weeks, once every approximately 19 weeks, or once every approximately 20 weeks.

[0095] Embodiment 41. The method according to any one of Embodiments 1 to 34, comprising administering at least two loading doses of the oligomer compound and at least two maintenance doses of the oligomer compound.

[0096] Embodiment 42. The method according to Embodiment 41, wherein the loading dose is 80 mg or about 80 mg.

[0097] Embodiment 43. The method according to Embodiment 41 or 42, wherein the maintenance dose is less than 80 mg.

[0098] Embodiment 44. The method according to Embodiment 43, wherein the maintenance dose is 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, or 75 mg.

[0099] Embodiment 45. The method according to Embodiment 43, wherein the maintenance dose is approximately 20 mg, approximately 25 mg, approximately 30 mg, approximately 35 mg, approximately 40 mg, approximately 45 mg, approximately 50 mg, approximately 55 mg, approximately 60 mg, approximately 65 mg, approximately 70 mg, or approximately 75 mg.

[0100] Embodiment 46. The method according to any one of Embodiments 41 to 45, comprising administering the loading dose once every four weeks, and administering at least two maintenance doses once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, once every nine weeks, once every ten weeks, once every eleven weeks, once every twelve weeks, once every thirteen weeks, once every fourteen weeks, once every fifteen weeks, once every sixteen weeks, once every seventeen weeks, once every eighteen weeks, once every nineteen weeks, or once every twenty weeks.

[0101] Embodiment 47. The loading dose is administered once every approximately 4 weeks, and at least two maintenance doses are administered once every approximately 5 weeks, once every approximately 6 weeks, once every approximately 7 weeks, once every approximately 8 weeks, once every approximately 9 weeks, once every approximately 10 weeks, once every approximately 11 weeks, once every approximately 12 weeks, once every approximately 13 weeks, once every approximately 14 weeks, once every approximately 15 weeks, once every approximately 16 weeks, once every approximately 17 weeks, once every approximately 18 weeks, and approximately 19 The method according to any one of Embodiments 41 to 45, comprising administering the drug once every week or once every 20 weeks.

[0102] Embodiment 48. The method according to any one of Embodiments 41 to 45, comprising administering the loading dose once every two weeks, and administering at least two maintenance doses once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, once every nine weeks, once every ten weeks, once every eleven weeks, once every twelve weeks, once every thirteen weeks, once every fourteen weeks, once every fifteen weeks, once every sixteen weeks, once every seventeen weeks, once every eighteen weeks, once every nineteen weeks, or once every twenty weeks.

[0103] Embodiment 49. The method according to any one of Embodiments 41 to 45, comprising administering the loading dose once every two weeks, and administering at least two maintenance doses once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, once every nine weeks, once every ten weeks, once every eleven weeks, once every twelve weeks, once every thirteen weeks, once every fourteen weeks, once every fifteen weeks, once every sixteen weeks, once every seventeen weeks, once every eighteen weeks, once every nineteen weeks, or once every twenty weeks.

[0104] Embodiment 50. The method according to any one of Embodiments 1 to 49, wherein the human subject has hereditary angioedema or is at risk of having it.

[0105] Embodiment 51. The method according to Embodiment 50, wherein the hereditary angioedema is type I HAE.

[0106] Embodiment 52. The method according to Embodiment 50, wherein the hereditary angioedema is type II HAE.

[0107] Embodiment 53. The method according to Embodiment 51 or 52, wherein the human subject has a gene mutation in the SERPING1 gene.

[0108] Embodiment 54. The method according to Embodiment 50, wherein the hereditary angioedema is type III HAE.

[0109] Embodiment 55. The method according to Embodiment 54, wherein the human subject has a gene mutation in a gene selected from F12, PLG, and ANGPT1.

[0110] Embodiment 56. The method according to Embodiment 54, wherein the subject does not have a gene mutation in a gene selected from F12, PLG, and ANGPT1.

[0111] Embodiment 57. The method according to any one of Embodiments 50 to 56, wherein the human subject is refractory to at least one anti-edema agent.

[0112] Embodiment 58. The method according to Embodiment 57, wherein the at least one anti-edema agent includes a histamine inhibitor, a C1 esterase inhibitor, an attenuated androgen, an antifibrinolytic agent, an angiotensin-converting enzyme inhibitor, an angiotensin II type 1 receptor blocker, a kallikrein inhibitor, a bradykinin B2 receptor antagonist, or a combination thereof.

[0113] Embodiment 59. The method according to any one of Embodiments 50 to 58, wherein the human subject is refractory to histamine inhibitors, antifibrinolytic agents, attenuated androgens, C1 esterase inhibitors, and bradykinin B2 receptor antagonists.

[0114] Embodiment 60. The method according to Embodiment 58 or 59, wherein the antifibrinolytic agent is tranexamic acid.

[0115] Embodiment 61. The method according to any one of Embodiments 58 to 60, wherein the attenuated androgen is danazol.

[0116] Embodiment 62. The method according to any one of Embodiments 58 to 61, wherein the bradykinin B2 receptor antagonist is icatibant.

[0117] Embodiment 63. The method according to any one of Embodiments 57 to 62, wherein the at least one anti-edema agent provides a reduction of less than 5%, less than 10%, less than 20%, less than 30%, less than 40%, or less than 50% in the incidence of angioedema attacks experienced by the subject, when measured over at least 1, at least 2, at least 3, at least 4, or at least 6 months after the first administration of the at least one anti-edema agent, compared to the incidence of angioedema attacks experienced by the subject before the first administration of the at least one anti-edema agent.

[0118] Embodiment 64. The method according to any one of Embodiments 57 to 63, wherein the at least one anti-edema agent reduces swelling by less than about 5%, less than about 10%, less than about 20%, less than about 30%, less than about 40%, or less than about 50% after about 1 hour, about 2 hours, about 4 hours, about 8 hours, about 12 hours, about 24 hours, or about 48 hours after the first administration of the at least one anti-edema agent.

[0119] Embodiment 65. The method according to any one of Embodiments 50 to 64, wherein the human subject, when measured over at least 1, 2, 3, 4, 5, 6, 8, or 12 months prior to administration, has an average of at least 1, at least 2, at least 3, at least 4, at least 5, or at least 6 episodes of angioedema per month.

[0120] Embodiment 66. The method according to any one of Embodiments 1 to 49, wherein the human subject has macular edema or is at risk of macular edema.

[0121] Embodiment 67. The method according to Embodiment 66, wherein the human subject has diabetes mellitus, diabetic macular edema, diabetic retinopathy, or a combination thereof.

[0122] Embodiment 68. A method for improving hereditary angioedema in a human subject in need thereof, comprising approximately 80 mg of an oligomeric compound having the following chemical structure: [ka] The method comprising administering (SEQ ID NO: 4), or a salt thereof, to the human subject.

[0123] Embodiment 69. The method according to Embodiment 68, wherein the salt is a sodium salt or a potassium salt.

[0124] Embodiment 70. A method for improving hereditary angioedema in a human subject in need thereof, comprising approximately 80 mg of an oligomeric compound having the following chemical structure: [ka] The method comprising administering (SEQ ID NO: 4) to the human subject.

[0125] Embodiment 71. A method for improving hereditary angioedema in a human subject in need thereof, comprising administering approximately 80 mg of an oligomer compound to the human subject, wherein the oligomer compound is chemically represented as follows (5'→3'): (THA-GalNAc3)o Tes Ges mCeo Aeo Aes Gds Tds mCds Tds mCds It has Tds Tds Gds Gds mCds Aeo Aeo Aes mCes Ae (SEQ ID NO: 4), and (THA-GalNAc3)o has the following structure: [ka] It is represented as, A is an adenine nucleic acid base, mC is the 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, and The method wherein o is a phosphodiester nucleoside bond.

[0126] The method according to any one of Embodiments 68 to 71, comprising administering 2.80 mg of the oligomer compound to the human subject.

[0127] Embodiment 73. The method according to any one of Embodiments 68 to 71, comprising administering to a human subject at least two doses of about 80 mg of the oligomer compound once every four weeks, and subsequently administering at least two doses of about 100 mg of the oligomer compound once every four weeks.

[0128] Embodiment 74. The method according to any one of Embodiments 68 to 71, comprising administering to a human subject at least two doses of 80 mg of the oligomer compound once every four weeks, followed by administering at least two doses of 100 mg of the oligomer compound once every four weeks.

[0129] Embodiment 75. The method according to Embodiment 73 or 74, wherein the human subject experiences at least one episode of angioedema during administration of 80 mg or about 80 mg of the oligomer compound once every four weeks or about once every four weeks.

[0130] Embodiment 76. The method according to any one of Embodiments 68 to 71, comprising administering to a human subject at least two loading doses of about 80 mg of the oligomer compound at about 4 weeks, and at least two maintenance doses of about 80 mg of the oligomer compound at about 8 weeks.

[0131] Embodiment 77. The method according to any one of Embodiments 68 to 71, comprising administering to the human subject at least two loading doses of 80 mg of the oligomer compound once every four weeks, and at least two maintenance doses of 80 mg of the oligomer compound once every eight weeks.

[0132] Embodiment 78. The method according to any one of Embodiments 75 to 77, wherein the subject does not experience an angioedema attack during administration of 80 mg or about 80 mg of the oligomer compound once every four weeks or once every four weeks.

[0133] Embodiment 79. The method according to any one of Embodiments 68 to 78, wherein the hereditary angioedema is type I HAE, type II HAE, or type III HAE.

[0134] Embodiment 80. The method according to Embodiment 79, wherein the hereditary angioedema is type III HAE, and the human subject has a gene mutation in a gene selected from F12, PLG, and ANGPT1.

[0135] Embodiment 81. The method according to Embodiment 79, wherein the hereditary angioedema is type III HAE, and the human subject does not have a gene mutation in a gene selected from F12, PLG, and ANGPT1.

[0136] Embodiment 82. The method according to any one of Embodiments 68 to 81, wherein the human subject is refractory to at least one anti-edema agent.

[0137] Embodiment 83. The method according to Embodiment 82, wherein the at least one anti-edema agent comprises a histamine inhibitor, a C1 esterase inhibitor, an attenuated androgen, an antifibrinolytic agent, an angiotensin-converting enzyme inhibitor, an angiotensin II type 1 receptor blocker, a kallikrein inhibitor, a bradykinin B2 receptor antagonist, or a combination thereof.

[0138] Embodiment 84. The method according to any one of Embodiments 68 to 83, wherein the human subject is refractory to histamine inhibitors, antifibrinolytic agents, attenuated androgens, C1 esterase inhibitors, and bradykinin B2 receptor antagonists.

[0139] Embodiment 85. The method according to Embodiment 83 or 84, wherein the antifibrinolytic agent is tranexamic acid.

[0140] Embodiment 86. The method according to any one of Embodiments 83 to 85, wherein the attenuated androgen is danazol.

[0141] Embodiment 87. The method according to any one of Embodiments 83 to 86, wherein the bradykinin B2 receptor antagonist is icatibant.

[0142] Embodiment 88. The method according to any one of Embodiments 82 to 87, wherein the at least one anti-edema agent provides a reduction of less than 5%, less than 10%, less than 20%, less than 30%, less than 40%, or less than 50% in the incidence of angioedema attacks experienced by the subject, when measured over at least 1, at least 2, at least 3, at least 4, or at least 6 months after the first administration of the at least one anti-edema agent, compared to the incidence of angioedema attacks experienced by the subject before the first administration of the at least one anti-edema agent.

[0143] Embodiment 89. The method according to any one of Embodiments 82 to 87, wherein the at least one anti-edema agent reduces swelling by less than about 5%, less than about 10%, less than about 20%, less than about 30%, less than about 40%, or less than 50% after about 1 hour, about 2 hours, about 4 hours, about 8 hours, about 12 hours, about 24 hours, or about 48 hours after the first administration of the at least one anti-edema agent.

[0144] Embodiment 90. The method according to any one of Embodiments 82 to 87, wherein the human subject, when measured over at least 1, 2, 3, 4, 5, 6, 8, or 12 months prior to administration, has an average of at least 1, at least 2, at least 3, at least 4, at least 5, or at least 6 episodes of angioedema per month.

[0145] Embodiment 91. A method for improving macular edema in a human subject requiring such improvement, comprising approximately 80 mg of an oligomeric compound having the following chemical structure: [ka] The method comprising administering (SEQ ID NO: 4), or a salt thereof, to the human subject.

[0146] Embodiment 92. The method according to Embodiment 91, wherein the salt is a sodium salt or a potassium salt.

[0147] Embodiment 93. A method for improving macular edema in a human subject requiring such improvement, comprising approximately 80 mg of an oligomeric compound having the following chemical structure: [ka] The method comprising administering (SEQ ID NO: 4) to the human subject.

[0148] Embodiment 94. A method for improving macular edema in a human subject in need thereof, comprising administering approximately 80 mg of an oligomer compound to the human subject, wherein the oligomer compound is chemically represented as follows (5'→3'): (THA-GalNAc3)o Tes Ges mCeo Aeo Aes Gds Tds mCds Tds mCds Tds Tds Gds Gds mCds Aeo Aeo Aes mCes Ae(distributed It has column number 4), and (THA-GalNAc3)o has the following structure: [ka] It is represented as, A is an adenine nucleic acid base, mC is the 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, and The method wherein o is a phosphodiester nucleoside bond.

[0149] The method according to any one of Embodiments 91 to 94, comprising administering 5.80 mg of the oligomer compound to the human subject.

[0150] Embodiment 96. The method according to any one of Embodiments 91 to 95, comprising administering to a human subject at least two loading doses of about 80 mg of the oligomer compound once every two weeks, and at least two maintenance doses of about 80 mg of the oligomer compound once every four weeks.

[0151] Embodiment 97. The method according to any one of Embodiments 91 to 95, comprising administering to a human subject at least two loading doses of 80 mg of the oligomer compound once every two weeks, and at least two maintenance doses of 80 mg of the oligomer compound once every four weeks.

[0152] Embodiment 98. The method according to any one of Embodiments 91 to 97, wherein the human subject has diabetic macular edema.

[0153] Embodiment 99. The method according to any one of Embodiments 1 to 98, wherein the human subject has an inflammatory state, a thromboembolic state, edema, or is at risk thereof.

[0154] Embodiment 100. The method according to any one of Embodiments 1 to 99, wherein the oligomer compound is administered by subcutaneous injection.

[0155] Embodiment 101. The method according to any one of Embodiments 1 to 100, wherein the oligomer compound is self-administered.

[0156] Embodiment 102. The method according to any one of Embodiments 1 to 101, wherein PKK RNA is reduced in the subject.

[0157] Embodiment 103. The method according to any one of Embodiments 1 to 102, wherein the PKK protein is reduced in the subject.

[0158] Embodiment 104. The method according to any one of Embodiments 1 to 103, wherein PKK activity is reduced in the subject.

[0159] I.PKK In certain embodiments, methods for reducing PKK RNA and / or PKK protein in cells or biological fluids of interest are described herein. PKK RNA is encoded by the human KLKB1 gene located on human chromosome 4. PKK protein is the protein expression product of PKK RNA. PKK protein is highly expressed in the liver compared to other cell types. A representative nucleic acid sequence of the human KLKB1 gene is given by GENBANK accession number NT_016354.19 (abbreviated from nucleotide 111693001 to 111730000) (incorporated herein as SEQ ID NO: 1). A representative nucleic acid sequence of human PKK mRNA is provided by GENBANK accession number NM_000892.3, incorporated herein as SEQ ID NO: 2. A representative protein sequence of human PKK protein is given by GENBANK accession number NP_000883.2, incorporated herein as SEQ ID NO: 3.

[0160] II.ISIS 721744 In certain embodiments, a method for administering the oligomeric compound, ISIS 721744, to a subject requiring it is described herein. In certain embodiments, ISIS 721744 is a 5-10-5 MOE gapmer having the sequence (5'→3') TGCAAGTCTCTTGGCAAACA (incorporated herein as SEQ ID NO: 4), where each of nucleosides 1-5 and 16-20 (5'→3') contains a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxyribonucleoside, and nucleosides 3-4, 4-5, 16-17, and 17-18 The nucleoside bonds between nucleosides are characterized as phosphodiester nucleoside bonds, and the nucleoside bonds between nucleosides 1-2, 2-3, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are characterized as phosphorothioate nucleoside bonds, with each cytosine being 5'-methylcytosine.

[0161] In certain embodiments, ISIS 721744 is represented by the following chemical notation (5'→3'): (THA-GalNAc3)o Tes Ges mCeo Aeo Aes Gds Tds mCds Tds mCds Tds Tds Gds Gds mCds Aeo Aeo Aes mCes Ae (SEQ ID NO: 4), where (THA-GalNAc3)o has the following structure: [ka] It is represented as, A is an adenine nucleic acid base, mC is the 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, and o is a phosphodiester nucleoside bond.

[0162] In certain embodiments, ISIS 721744 is represented by the following chemical structure: [ka] (Sequence ID 4). Structure 1. ISIS 721744

[0163] In certain embodiments, the sodium salt of ISIS 721744 is represented by the following chemical structure: [ka] (Sequence ID 4). Structure 2. Sodium salt of ISIS 721744

[0164] III. Specific pharmaceutical compositions In certain embodiments, a method for administering a pharmaceutical composition comprising the oligomeric compound ISIS 721744 is described herein. In certain embodiments, the pharmaceutical composition includes a pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises or essentially consists of sterile saline solution and ISIS 721744. In certain embodiments, the sterile saline is pharmaceutical-grade saline. In certain embodiments, the pharmaceutical composition comprises or essentially consists of saline and ISIS 721744. In certain embodiments, the sterile water is pharmaceutical-grade water. In certain embodiments, the pharmaceutical composition comprises or essentially consists of phosphate-buffered saline and ISIS 721744.

[0165] In certain embodiments, the pharmaceutical composition comprises one or more excipients and ISIS 721744. In certain such embodiments, the excipients are selected from water, saline solution, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.

[0166] In certain embodiments, a pharmaceutical composition comprising the oligomeric compound ISIS 721744 includes any pharmaceutically acceptable salt of the oligomeric compound ISIS 721744, an ester of ISIS 721744, or a salt of such ester. In certain embodiments, a pharmaceutical composition comprising ISIS 721744 can, when administered to a human subject, (directly or indirectly) deliver a biologically active metabolite or its residue. Thus, for example, this disclosure also covers pharmaceutically acceptable salts of the oligomeric compound ISIS 721744, prodrugs of ISIS 721744, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium salts and potassium salts.

[0167] In certain embodiments, the pharmaceutical composition comprises one or more lipid moieties and the oligomeric compound ISIS 721744. In certain embodiments, the lipid moieties are used to increase the distribution of ISIS 721744 to specific cells or tissues. In certain such methods, ISIS 721744 is introduced into pre-formed liposomes or lipoplexes made from a mixture of cationic and neutral lipids. In certain methods, DNA complexes with mono- or polycationic lipids are formed in the absence of neutral lipids.

[0168] In certain embodiments, the pharmaceutical compositions disclosed herein include a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing pharmaceutical compositions that include hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.

[0169] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver the oligomeric compound ISIS 721744 to a specific tissue or cell type. For example, in certain embodiments, the pharmaceutical composition comprises liposomes coated with a tissue-specific antibody.

[0170] In certain embodiments, the pharmaceutical composition includes a cosolvent system. Certain such cosolvent systems include, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such cosolvent systems are used with hydrophobic compounds. A non-limiting example of such a cosolvent system is the VPD cosolvent system, which is a solution of anhydrous ethanol containing 3 w / v% benzyl alcohol, 8 w / v% nonpolar surfactant Polysorbate 80™, and 65 w / v% polyethylene glycol 300. The proportions of the solvents can be significantly altered without substantially changing their solubility and toxicity properties. Furthermore, the identity of the cosolvent components can be changed; for example, other surfactants may be used instead of polysorbate 80™, the fraction size of polyethylene glycol may be changed, other biocompatible polymers may replace polyethylene glycol, such as polyvinylpyrrolidone, and dextrose may be replaced with other sugars or polysaccharides.

[0171] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for injectable administration (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intraventricular (ICV)). In certain such embodiments, the pharmaceutical composition comprises a carrier and is formulated in an aqueous solution, e.g., water or a physiologically compatible buffer, e.g., Hanks' solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other components (e.g., components that aid in dissolution or act as preservatives) are included. In certain embodiments, the injectable suspension is prepared using a suitable liquid carrier, suspending agent, etc. Specific pharmaceutical compositions for injection are provided in unit dosage forms, e.g., in ampoules or in multi-dose containers. Specific pharmaceutical compositions for injection are suspensions, solutions, or emulsions in an oily or aqueous vehicle and may contain formulation agents such as suspending agents, stabilizers, and / or dispersants. Specific solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.

[0172] Under certain conditions, the oligomeric compound ISIS 721744 functions as an acid. ISIS 721744 may be illustrated or described in protonated (free acid) form or in ionized and associated with a cation (salt) form, but aqueous solutions of ISIS 721744 exist in equilibrium between these forms. For example, the phosphate bond of ISIS 721744 in aqueous solution is in equilibrium between the free acid, anionic, and salt forms. Unless otherwise specified, the term "ISIS 721744" is intended to include all such forms. Furthermore, ISIS 721744 has several such bonds, each of which is in equilibrium. Therefore, ISIS 721744 in solution exists as an ensemble of certain forms, all in equilibrium at multiple positions. The term "ISIS 721744" is intended to include all such forms. Illustrated structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are also intended to include corresponding forms. Where the term "or its salt" follows a structure depicting the free acid of ISIS 721744, it expressly includes all such forms, which may be fully or partially protonated / deprotonated / associated with cations. In certain cases, one or more specific cations are identified.

[0173] In certain embodiments, ISIS 721744 is in an aqueous solution containing sodium. In certain embodiments, ISIS 721744 is in an aqueous solution containing potassium. In certain embodiments, ISIS 721744 is in PBS. In certain embodiments, ISIS 721744 is in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and / or HCl to obtain a desired pH.

[0174] In this specification, specific dosages are described. For clarity, the dosage of ISIS 721744 in milligrams represents the mass of the free acid form of ISIS 721744. As mentioned above, in aqueous solution, the free acid is in equilibrium with the anionic and salt forms. However, for the purpose of calculating the dosage, it is assumed that ISIS 721744 exists as a solvent-free, sodium acetate-free, anhydrous free acid. For example, if ISIS 721744 is in a sodium-containing solution (e.g., physiological saline), then ISIS 7217 ISIS 721744 may be partially or completely deprotonated and bound to Na+ ions. However, the mass of the protons is still counted in the weight of the dose, while the mass of the Na+ ions is not. Therefore, for example, a dose of 80 mg of ISIS 721744 is equal to the number of fully protonated molecules weighing 80 mg. This corresponds to 84 mg of solvent-free, sodium acetate-free, anhydrous sodium ISIS 721744. Similarly, a dose of 100 mg of ISIS 721744 is equivalent to 105 mg of solvent-free, sodium acetate-free, anhydrous sodium ISIS 721744.

[0175] IV. Specific Dosage In certain embodiments, the method described herein involves administering a therapeutically effective dose of the oligomeric compound ISIS 721744 to a target. In certain embodiments, the therapeutically effective dose is approximately 20 mg. In certain embodiments, the therapeutically effective dose is approximately 40 mg. In certain embodiments, the therapeutically effective dose is approximately 60 mg. In certain embodiments, the therapeutically effective dose is approximately 80 mg. In certain embodiments, the therapeutically effective dose is approximately 100 mg. In certain embodiments, the therapeutically effective dose is 20 mg. In certain embodiments, the therapeutically effective dose is 40 mg. In certain embodiments, the therapeutically effective dose is 60 mg. In certain embodiments, the therapeutically effective dose is 80 mg. In certain embodiments, the therapeutically effective dose is 100 mg.

[0176] In certain applications, the therapeutically effective dose is 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, 150 mg, 155 mg. The dosage is one of the following: 160mg, 165mg, 170mg, 175mg, 180mg, 185mg, 190mg, 195mg, 200mg, 205mg, 210mg, 215mg, 220mg, 225mg, 230mg, 235mg, 240mg, 245mg, 250mg, 255mg, 260mg, 265mg, 270mg, 275mg, 280mg, 285mg, 290mg, 295mg, or 300mg.

[0177] For specific uses, the effective therapeutic dose is approximately 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, 150 mg, and 155 mg. The dosage is one of the following: approximately 160 mg, approximately 165 mg, approximately 170 mg, approximately 175 mg, approximately 180 mg, approximately 185 mg, approximately 190 mg, approximately 195 mg, approximately 200 mg, approximately 205 mg, approximately 210 mg, approximately 215 mg, approximately 220 mg, approximately 225 mg, approximately 230 mg, approximately 235 mg, approximately 240 mg, approximately 245 mg, approximately 250 mg, approximately 255 mg, approximately 260 mg, approximately 265 mg, approximately 270 mg, approximately 275 mg, approximately 280 mg, approximately 285 mg, approximately 290 mg, approximately 295 mg, and approximately 300 mg.

[0178] In a specific embodiment, the therapeutically effective dose is 75.0 mg, 75.1 mg, 75.2 mg, 75.3 mg, 75.4 mg, 75.5 mg, 75.6 mg, 75.7 mg, 75.8 mg, 75.9 mg, 76.0 mg, 76.1 mg, 76.2 mg, 76.3 mg, 76.4 mg, 76.5 mg, 76.6 mg, 76.7 mg, 76.8 mg, 76.9 mg, 77 .0mg, 77.1mg, 77.2mg, 77.3mg, 77.4mg, 77.5mg, 77.6mg, 77.7mg, 77.8mg, 77.9mg, 78.0mg, 78.1m g, 78.2mg, 78.3mg, 78.4mg, 78.5mg, 78.6mg, 78.7mg, 78.8mg, 78.9mg, 79.0mg, 79.1mg, 79.2mg, 7 9.3mg, 79.4mg, 79.5mg, 79.6mg, 79.7mg, 79.8mg, 79.9mg, 80.0mg, 80.1mg, 80.2mg, 80.3mg, 80.4mg, 80.5mg, 80.6mg, 80.7mg , 80.8mg, 80.9mg, 81.0mg, 81.1mg, 81.2mg, 81.3mg, 81.4mg, 81.5mg, 81.6mg, 81.7mg, 81.8mg, 81.9mg, 82.0mg, 82.1mg, 82.2m The dosage is one of the following: g, 82.3mg, 82.4mg, 82.5mg, 82.6mg, 82.7mg, 82.8mg, 82.9mg, 83.0mg, 83.1mg, 83.2mg, 83.3mg, 83.4mg, 83.5mg, 83.6mg, 83.7mg, 83.8mg, 83.9mg, 84.0mg, 84.1mg, 84.2mg, 84.3mg, 84.4mg, 84.5mg, 84.6mg, 84.7mg, 84.8mg, 84.9mg, and 85.0mg.

[0179] In a specific embodiment, the therapeutically effective dose is approximately 75.0 mg, approximately 75.1 mg, approximately 75.2 mg, approximately 75.3 mg, approximately 75.4 mg, approximately 75.5 mg, approximately 75.6 mg, approximately 75.7 mg, approximately 75.8 mg, approximately 75.9 mg, approximately 76.0 mg, approximately 76.1 mg, approximately 76.2 mg, approximately 76.3 mg, approximately 76.4 mg, approximately 76.5 mg, approximately 76.6 mg, approximately 76.6 Approximately 76.7mg, approximately 76.8mg, approximately 76.9mg, approximately 77.0mg, approximately 77.1mg, approximately 77.2mg, approximately 77.3mg, approximately 77.4mg, approximately 77.5mg, approximately 77.6mg, approximately 77.7mg, approximately 77.8mg, approximately 77.9mg, approximately 78.0mg, approximately 78.1mg, approximately 78.2mg, approximately 78.3mg, approximately 78.4mg, approximately 78.5mg, approximately 78.6mg, approximately 78.7mg, approximately 7 8.8mg, approximately 78.9mg, approximately 79.0mg, approximately 79.1mg, approximately 79.2mg, approximately 79.3mg, approximately 79.4mg, approximately 79.5mg, approximately 79.6mg, approximately 79.7mg, approximately 79.8mg, approximately 79.9mg, approximately 80.0mg, approximately 80.1mg, approximately 80.2mg, approximately 80.3mg, approximately 80.4mg, approximately 80.5mg, approximately 80.6mg, approximately 80.7mg, approximately 80.8mg, approximately 80.9 mg, about 81.0mg, about 81.1mg, about 81.2mg, about 81.3mg, about 81.4mg, about 81.5mg, about 81.6mg, about 81.7mg, about 81.8mg, about 81.9mg, about 8 2.0mg, about 82.1mg, about 82.2mg, about 82.3mg, about 82.4mg, about 82.5mg, about 82.6mg, about 82.7mg, about 82.8mg, about 82.9mg, about 83.0mg The amounts are approximately 83.1 mg, 83.2 mg, 83.3 mg, 83.4 mg, 83.5 mg, 83.6 mg, 83.7 mg, 83.8 mg, 83.9 mg, 84.0 mg, 84.1 mg, 84.2 mg, 84.3 mg, 84.4 mg, 84.5 mg, 84.6 mg, 84.7 mg, 84.8 mg, 84.9 mg, and 85.0 mg.

[0180] In a specific embodiment, the therapeutically effective dose is 10mg-140mg, 10mg-130mg, 10mg-120mg, 10mg-110mg, 10mg-100mg, 10mg-90mg, 10mg-80mg, 10mg-70mg, 10mg-60mg, 10mg-50mg, 10mg-40mg, 10mg-30mg, 10mg-20mg, 20mg-140mg, 20mg-130mg, 20mg-120mg, 20mg-110mg, 20mg-100mg, 20mg-90mg, 20mg-80mg, 20mg-70mg, 20mg-60mg, 20mg-50mg, 20mg-40mg, 20mg-30mg, 30mg-140mg, 30mg-130mg, 30mg~120mg, 30mg~110mg, 30mg~100mg, 30mg~90mg, 30mg~80mg, 30mg~70mg, 30mg~60mg, 30 mg~50mg, 30mg~40mg, 40mg~140mg, 40mg~130mg, 40mg~120mg, 40mg~110mg, 40mg~100mg, 40 mg~90mg, 40mg~80mg, 40mg~70mg, 40mg~60mg, 40mg~50mg, 50mg~140mg, 50mg~130mg, 50mg~ 120mg, 50mg~110mg, 50mg~100mg, 50mg~90mg, 50mg~80mg, 50mg~70mg, 50mg~60mg, 60mg~14 0mg、60mg~130mg、60mg~120mg、60mg~110mg、60mg~100mg、60mg~90mg、60mg~80mg、60mg~70mg、70mg~140mg、70mg~130mg、70mg~120mg、70mg~110mg、70mg~100mg、70mg~90mg、70mg~80mg、80mg~140mg、80mg~130mg、80mg~120mg、80mg~110mg、80mg~100mg、80mg~90mg、90mg~140mg、90mg~130mg、90mg~120mg、90mg~110mg、90mg~100mg、100mg~140mg、100mg~130mg、100mg~120mg、100mg~110mg、110mg~140mg、110mg~130mg、110mg~120mg、120mg~140mg、120mg~130mg、130mg~140mg、65mg~95mg、65mg~90mg、65mg~85mg、65mg~80mg、65mg~75mg、65mg~70mg、70mg~95mg、70mg~85mg、70mg~75mg、75mg~100mg、75mg~95mg、75mg~90mg、75mg~85mg、75mg~80mg、80mg~95mg、80mg~85mg、85mg~100mg、85mg~90mg、90mg~95mg、95mg~100mg、80mg~89mg、80mg~88mg、80mg~87mg、80mg~86mg、80mg~84mg、80mg~83mg、80mg~82mg、80mg~81mg、81mg~90mg、82mg~89mg、82mg~88mg、82mg~87mg、82mg~86mg、82mg~85mg、82mg~84mg、82mg~83mg、83mg~90mg、83mg~89mg、83mg~88mg、83mg~87mg、83mg~86mg、83mg~85mg、83mg~84mg、84mg~90mg、84mg~89mg、84mg~88mg、84mg~87mg、84mg~86mg、84mg~85mg、85mg~89mg、85mg~88mg、85mg~87mg、85mg~86mg、86mg~90mg、86mg~89mg、86mg~88mg、86mg~87mg、87mg~90mg、87mg~89mg、87mg~88mg、The dosage is one of the following: 88mg-90mg, 88mg-89mg, or 89mg-90mg.

[0181] In certain embodiments, the therapeutically effective dose is less than 300 mg, less than 295 mg, less than 290 mg, less than 285 mg, less than 280 mg, less than 275 mg, less than 270 mg, less than 265 mg, less than 260 mg, less than 255 mg, less than 250 mg, less than 245 mg, less than 240 mg, less than 235 mg, less than 230 mg, less than 225 mg, less than 220 mg, less than 215 mg, less than 210 mg, less than 205 mg, less than 200 mg, less than 195 mg, less than 190 mg, less than 185 mg, less than 180 mg, less than 175 mg, and 170 mg. It is any of the following: less than g, less than 165 mg, less than 160 mg, less than 150 mg, less than 145 mg, less than 140 mg, less than 135 mg, less than 130 mg, less than 125 mg, less than 120 mg, less than 115 mg, less than 110 mg, less than 105 mg, less than 100 mg, less than 95 mg, less than 90 mg, less than 85 mg, less than 80 mg, less than 75 mg, less than 70 mg, less than 65 mg, less than 60 mg, less than 55 mg, less than 50 mg, less than 45 mg, less than 40 mg, less than 35 mg, less than 30 mg, less than 25 mg, and less than 20 mg.

[0182] In specific accessibility cases, the therapeutic effective dose is less than approximately 300 mg, less than approximately 295 mg, less than approximately 290 mg, less than approximately 285 mg, less than approximately 280 mg, less than approximately 275 mg, less than approximately 270 mg, less than approximately 265 mg, less than approximately 260 mg, less than approximately 255 mg, less than approximately 250 mg, less than approximately 245 mg, less than approximately 240 mg, less than approximately 235 mg, less than approximately 230 mg, less than approximately 225 mg, less than approximately 220 mg, less than approximately 215 mg, less than approximately 210 mg, less than approximately 205 mg, and about 2 Less than 00mg, less than approximately 195mg, less than approximately 190mg, less than approximately 185mg, less than approximately 180mg, less than approximately 175mg, less than approximately 170mg, less than approximately 165mg, less than approximately 160mg, less than approximately 150mg, less than approximately 145mg, less than approximately 140mg, less than approximately 135mg, less than approximately 130mg, less than approximately 125mg, less than approximately 120mg, less than approximately 115mg, less than approximately 110mg, less than approximately 105mg, less than approximately 100mg, less than approximately 95mg, less than approximately 90mg, less than approximately 85mg The amount is one of the following: full, less than approximately 80 mg, less than approximately 75 mg, less than approximately 70 mg, less than approximately 65 mg, less than approximately 60 mg, less than approximately 55 mg, less than approximately 50 mg, less than approximately 45 mg, less than approximately 40 mg, less than approximately 35 mg, less than approximately 30 mg, less than approximately 25 mg, or less than approximately 20 mg.

[0183] For specific purposes, the therapeutically effective dose is any of the following: at least 10 mg, at least 15 mg, at least 20 mg, at least 25 mg, at least 30 mg, at least 35 mg, at least 40 mg, at least 45 mg, at least 50 mg, at least 55 mg, at least 60 mg, at least 65 mg, at least 70 mg, at least 75 mg, at least 80 mg, at least 85 mg, at least 90 mg, at least 95 mg, at least about 100 mg, at least 105 mg, at least 115 mg, at least 120 mg, at least 125 mg, at least 130 mg, at least 135 mg, at least 140 mg, at least 145 mg, and at least 150 mg. For specific purposes, the therapeutically effective dose does not exceed about 200 mg, about 250 mg, about 300 mg, about 350 mg, or about 400 mg.

[0184] For specific purposes, the therapeutically effective dose is at least about 10 mg, at least about 15 mg, at least about 20 mg, at least about 25 mg, at least about 30 mg, at least about 35 mg, at least about 40 mg, at least about 45 mg, at least about 50 mg, at least about 55 mg, at least about 60 mg, at least about 65 mg, at least about 70 mg, at least about 75 mg, at least about 80 mg, at least about 85 mg, at least about 90 mg, at least about 95 mg, at least about 100 mg, at least about 105 mg, at least about 115 mg, at least about 120 mg, at least about 125 mg, at least about 130 mg, at least about 135 mg, at least about 140 mg, at least about 145 mg, and at least about 150 mg. For specific purposes, the therapeutically effective dose does not exceed about 200 mg, about 250 mg, about 300 mg, about 350 mg, or about 400 mg.

[0185] V. Specific medication regimens In certain embodiments, the method described herein involves administering a therapeutically effective dose of the oligomeric compound ISIS 721744 to a subject one or more times. In certain embodiments, the method includes administering the therapeutically effective dose at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 times. In certain embodiments, the method includes administering the therapeutically effective dose once every two weeks. In certain embodiments, the method includes administering the therapeutically effective dose once every three weeks. In certain embodiments, the method includes administering the therapeutically effective dose once every four weeks. In certain embodiments, the method includes administering the therapeutically effective dose once every eight weeks. In certain embodiments, the method includes administering the therapeutically effective dose once every two weeks. In certain embodiments, the method includes administering the therapeutically effective dose once every three weeks. In certain embodiments, the method includes administering the therapeutically effective dose once every four weeks. In certain embodiments, the method includes administering the therapeutically effective dose once every eight weeks.

[0186] In certain embodiments, the method includes administering a therapeutically effective dose approximately every 1 day, every 2 days, every 3 days, every 4 days, every 5 days, every 6 days, every 7 days, every 8 days, every 9 days, and every 10 days.

[0187] In certain embodiments, the method includes administering a therapeutically effective dose approximately every 1 week, every 2 weeks, every 3 weeks, every 4 weeks, every 5 weeks, every 6 weeks, every 7 weeks, every 8 weeks, every 9 weeks, every 10 weeks, every 11 weeks, every 12 weeks, every 13 weeks, every 14 weeks, every 15 weeks, every 16 weeks, every 17 weeks, every 18 weeks, every 19 weeks, or every 20 weeks.

[0188] To specify an effective method, the method involves administering a therapeutically effective dose for at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months, or at least about 12 months.

[0189] Loading dose and maintenance dose In certain embodiments, the therapeutically effective dose is administered as a loading dose and / or maintenance dose. In certain embodiments, the method includes administering a loading dose(s), followed by a maintenance dose(s). In certain embodiments, the method includes administering a loading dose once every three weeks, and then a maintenance dose once every four weeks. In certain embodiments, the method includes administering a loading dose once every four weeks, and then a maintenance dose once every eight weeks.

[0190] In certain embodiments, the method includes administering at least two loading doses, at least three loading doses, at least four loading doses, at least five loading doses, or at least six loading doses. In certain embodiments, the method includes administering two, three, four, five, sixteen loading doses. In certain embodiments, the method includes administering one loading dose approximately every week, every two weeks, every three weeks, every four weeks, every five weeks, every six weeks, every seven weeks, every eight weeks, every nine weeks, every ten weeks, every eleven weeks, or every twelve weeks. In certain embodiments, the method includes administering an initial loading dose and administering a second loading dose approximately 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, or 12 weeks after the administration of the first loading dose.

[0191] In certain embodiments, the method includes administering at least two maintenance doses, at least three maintenance doses, at least four maintenance doses, at least five maintenance doses, or at least six maintenance doses. In certain embodiments, the method includes administering two, three, four, five, sixteen maintenance doses. In some cases, the method includes administering maintenance doses once every four weeks, once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, once every nine weeks, once every ten weeks, once every eleven weeks, once every twelve weeks, once every thirteen weeks, once every fourteen weeks, once every fifteen weeks, once every sixteen weeks, once every seventeen weeks, once every seventeen weeks, once every eighteen weeks, once every nineteen weeks, or once every twenty weeks. In certain embodiments, the method includes administering a first maintenance dose and administering a second maintenance dose approximately 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 13 weeks, 14 weeks, 15 weeks, 16 weeks, 17 weeks, 18 weeks, 19 weeks, or 20 weeks after the administration of the first maintenance dose.

[0192] In certain embodiments, the method includes administering a first maintenance dose(s) approximately 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 13 weeks, 14 weeks, 15 weeks, 16 weeks, 17 weeks, 18 weeks, 19 weeks, or 20 weeks after the last loading dose.

[0193] VI. Efficacy and Effectiveness In certain embodiments, the P in human cells or biological fluids described herein is A method for reducing KK RNA, PKK protein, and / or PKK activity, the method comprising administering a therapeutically effective dose of ISIS 721744 to a subject. In certain embodiments, the method reduces PKK RNA, PKK protein, and / or PKK activity in the blood of a human subject. In certain embodiments, the method reduces PKK RNA, PKK protein, and / or PKK activity in the liver of a human subject. For example, whether the method reduces the activity of PKK RNA, PKK protein, and / or PKK can be determined by detecting / quantifying a first amount of PKK RNA, PKK protein, and / or PKK activity in a first biological sample obtained before administration, and a second amount of PKK RNA, PKK protein, and / or PKK activity in a second biological sample obtained after administration, and by detecting or quantifying the reduction in the activity of PKK RNA, PKK protein, and / or PKK by comparing this first amount with the second amount.

[0194] In certain embodiments, the method includes reducing PKK RNA, PKK protein, PKK activity, or a combination thereof by a range defined by 1 to 100%, or any two of these values. In certain embodiments, the method includes reducing PKK RNA and / or PKK protein in 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51% This includes reducing by %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.

[0195] In certain embodiments, the method includes reducing PKK RNA, PKK protein, PKK activity, or a combination thereof in cells or subjects by at least about 5%, at least about 10%, at least about 15%, at least about 5%, at least 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95%.

[0196] In certain embodiments, the method includes reducing PKK RNA, PKK protein, PKK activity, or a combination thereof in cells or subjects by about 5% to about 10%, about 10% to about 15%, about 15% to about 20%, about 20% to about 25%, about 25% to about 30%, about 30% to about 35%, about 35% to about 40%, about 40% to about 45%, about 45% to about 50%, about 50% to about 55%, about 55% to about 60%, about 60% to about 65%, about 65% to about 70%, about 70% to about 75%, about 75% to about 80%, about 80% to about 85%, about 85% to about 90%, about 90% to about 95%, or about 95% to 100%. In certain embodiments, the method includes administering ISIS 721744 to a subject and detecting or quantifying PKK RNA, PKK protein, PKK activity, or a combination thereof in the subject's cells or biological fluid. In certain embodiments, the method includes detecting / quantifying PKK RNA, PKK protein, PKK activity, or a combination thereof in a first biological sample obtained before administration; detecting / quantifying PKK RNA, PKK protein, PKK activity, or a combination thereof in a second biological sample obtained after administration; and comparing the first amount with the second amount to determine PKK The method includes detecting or quantifying a reduction in RNA, PKK protein, PKK activity, or a combination thereof. In certain embodiments, the second biological sample is obtained within about 24 hours after administration. In certain embodiments, the second biological sample is obtained within about 1 week after administration. In certain embodiments, the second biological sample is obtained about 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 13 weeks, 14 weeks, 15 weeks, 16 weeks, 17 weeks, or 18 weeks after administration. In certain embodiments, the method includes increasing or decreasing the dose after comparing the first dose to the second dose. In certain embodiments, the method includes administering the first dose more frequently or less frequently after comparing the first dose to the second dose.

[0197] Evaluation of the effectiveness of ISIS 721744 A. Hereditary angioedema In certain embodiments, the methods described herein are sufficiently effective in improving or preventing at least one symptom of hereditary angioedema in human subjects. In certain embodiments, the at least one symptom of hereditary angioedema is selected from swelling, nausea, vomiting, itching, headache, fatigue, abdominal pain, shortness of breath, rhinitis, anaphylaxis, and bronchoconstriction, as well as combinations thereof.

[0198] In certain embodiments, the methods described herein are sufficiently effective in reducing the incidence of angioedema attacks in subjects having HAE. In certain embodiments, the methods described herein reduce the incidence of angioedema attacks by at least about 10%, at least about 20%, at least about 3, at least about 4, about 5, at least about 6, at least about 7, at least about 8, at least about 9, at least about 10, at least about 11, or at least about 12 months, as measured over a period of at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%. In certain embodiments, angioedema attacks include breakthrough attacks.

[0199] In certain embodiments, the method described herein is sufficiently effective in reducing the severity of angioedema attacks in subjects having HAE. In certain embodiments, the method described herein is sufficiently effective in reducing the swelling of a body part in a subject having angioedema attacks by a range defined by 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 99%, or any two of these values. The reduction in swelling can be measured, for example, by measuring around a body part (e.g., abdomen, arm, wrist, ankle, neck) before and after administration of the oligomeric compound ISIS 721744. In certain embodiments, the angioedema attack is a breakthrough attack.

[0200] In certain embodiments, the methods described herein are sufficiently effective in reducing the severity or incidence of angioedema attacks in subjects with HAE that are refractory to anti-edema agents. In certain embodiments, subjects refractory to anti-edema agents experience a reduction in the frequency of angioedema attacks by less than 5%, less than 10%, less than 20%, less than 30%, less than 40%, or less than 50% when measured over at least 1 month, at least 2 months, at least 3 months, at least 4 months, or at least 6 months after treatment with at least one anti-edema agent, compared to before treatment with at least one anti-edema agent. In certain embodiments, subjects refractory to at least one anti-edema agent do not experience a reduction in the frequency of angioedema attacks when measured over at least 1 month, at least 2 months, at least 3 months, at least 4 months, or at least 6 months after treatment with at least one anti-edema agent, compared to before treatment with at least one anti-edema agent. In certain embodiments, subjects who are refractory to anti-edema agents are shown to have at least one improvement compared to before treatment with at least one anti-edema agent. After treatment with one anti-edema agent, when measured at approximately 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 24 hours, or 48 hours, a reduction of less than 5%, 10%, 20%, 30%, 40%, or 50% of swelling is experienced. In certain embodiments, subjects refractory to anti-edema agents continue to have at least one symptom of an angioedema attack, as observed approximately 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 24 hours, or 48 hours after treatment with at least one anti-edema agent. In certain embodiments, subjects refractory to hereditary angioedema continue to have one or more symptoms of hereditary angioedema when treated prophylactically with one or more anti-edema agents. In certain embodiments, subjects refractory to hereditary angioedema continue to have angioedema attacks when treated prophylactically with one or more anti-edema agents. In certain embodiments, angioedema attacks include breakthrough attacks.

[0201] B. Macular edema In certain embodiments, the methods described herein are sufficiently effective in improving at least one symptom of macular edema in human subjects. In certain embodiments, the at least one symptom of macular edema is selected from blurred vision, wave vision, distorted vision, loss of vision, and combinations thereof.

[0202] In certain embodiments, the method described herein is sufficiently effective to improve the visual acuity of subjects with macular edema, as assessed by the central subfield thickness (CST), also known as the (central)foveal retinal thickness. The CST is the average thickness of the macula in the central region of the macula with a diameter of 1 mm and can be measured using a Zeiss Cirrus instrument or a Heidelberg Spectralis instrument. In certain embodiments, subjects with macular edema have a CST of at least about 300 μm, at least about 310 μm, at least about 320 μm, at least about 330 μm, at least about 340 μm, or at least about 350 μm prior to administration. In certain embodiments, the method reduces the subject's CST by at least about 10 μm, at least about 20 μm, at least about 30 μm, at least about 40 μm, at least about 50 μm, or at least about 60 μm.

[0203] In certain embodiments, the methods described herein are sufficiently effective to improve visual acuity or best-corrected visual acuity (BCVA) in subjects with macular edema, as assessed by the Snellen visual acuity chart, Sloan chart, or Early Treatment Diabetic Retinopathy Study (ETDRS) chart. These charts display letters in multiple rows, with the letters gradually decreasing in size with each subsequent row. The chart is placed at a distance from the subject, who is asked to read the letters. The subject receives a score based on their ability to read the letters arranged in multiple rows. In certain embodiments, subjects with macular edema have visual acuity scores of less than 20 / 25, less than 20 / 32, less than 20 / 40, less than 20 / 50, or less than 20 / 63, as assessed by the Snellen visual acuity chart or equivalent scores on the Sloan chart or ETDRS chart. In certain embodiments, the method increases visual acuity by at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 letters on any one of these charts.

[0204] In certain embodiments, the method described herein is sufficiently effective to improve the visual acuity of subjects with macular edema and improve the subjects' assessment on the Diabetic Retinopathy Severity Scale (DRSS), as assessed by color fundus photography. The DRSS is described in more detail by Staurenghi et al., Br J Ophthalmol. 2018;102:954-958. In certain embodiments, the method provides at least a two-step improvement in the subjects' DRSS score.

[0205] VII. Specific Combination Therapies In certain embodiments, the method includes administering ISIS 721744 co-administered with at least one other drug. In certain embodiments, the at least one other drug improves edema. In certain embodiments, edema is hereditary angioedema. In certain embodiments, edema is macular edema. In certain embodiments, ISIS 721744 is administered co-administered with at least one other drug to produce a combination effect. In certain embodiments, ISIS 721744 is administered co-administered with at least one other drug to produce a synergistic effect.

[0206] In certain embodiments, ISIS 721744 and at least one other pharmaceutical are administered simultaneously. In certain embodiments, ISIS 721744 and at least one other pharmaceutical are administered at different times. In certain embodiments, ISIS 721744 and at least one other pharmaceutical are prepared together in a single formulation. In certain embodiments, ISIS 721744 and at least one other pharmaceutical are administered and prepared separately.

[0207] In certain embodiments, ISIS 721744 is administered co-administered with an anti-edema agent to subjects having HAE. Non-limiting examples of anti-edema agents include C1-INH protein, angiotensin-converting enzyme inhibitors, angiotensin II type 1 receptor blockers (ARBs), antihistamines, corticosteroids, antifibrinolytic agents (e.g., tranexamic acid), bradykinin inhibitors, bradykinin type 2 receptor blockers (e.g., icatibant), kallikrein inhibitors (e.g., lanadermab, ecalantide, BCX7353), and attenuated androgens (e.g., danazol, stanozolol, oxandrolone). In certain embodiments, the anti-edema agent is a plasma-derived C1-INH concentrate or recombinant C1-INH concentrate. In certain embodiments, the subject is female, and the anti-edema agent includes a gonadotropin-releasing hormone or its analogues that can deplete the subject's estrogen or inhibit estrogen activity.

[0208] In certain embodiments, ISIS 721744 is administered concurrently to patients with macular edema with at least one of the following: a corticosteroid, a nonsteroidal anti-inflammatory drug (NSAID), and a vascular endothelial growth factor (VEGF) inhibitor (e.g., an anti-VEGF antibody).

[0209] In certain embodiments, ISIS 721744 is administered co-administered with an antithrombotic agent to patients requiring it. Non-limiting examples of antithrombotic agents include nonsteroidal anti-NSAIDs, cyclooxygenase inhibitors (e.g., aspirin), adenosine diphosphate (ADP) receptor inhibitors (e.g., clopidogrel and ticlopidine), phosphodiesterase inhibitors (e.g., cilostazol), glycoprotein IIB / IIIA inhibitors (e.g., absiximab, eptifivatide, tirofiban, and defibrotide), adenosine reuptake inhibitors (e.g., dipyridamole), coumarins (e.g., warfarin), heparin and its derivatives (e.g., enoxaparin), direct thrombin inhibitors (e.g., repirudine, bivalirudine), apixaban, and small molecule compounds that directly interfere with the enzymatic action of specific coagulation factors (e.g., rivaroxaban, which interferes with factor Xa).

[0210] In certain embodiments, ISIS 721744 is administered co-administered with an anti-inflammatory agent to patients requiring it. Non-limiting examples of anti-inflammatory agents include methotrexate, abatacept, infliximab, cyclophosphamide, azathioprine, corticosteroids, cyclosporine A, aminosalicylates, sulfasalazine, hydroxychloroquine, leflunomide, etanercept, efalizumab, 6-mercaptopurine (6-MP), tumor necrosis factor alpha (TNFα), and other cytokine blockers or antagonists. In certain embodiments, the anti-inflammatory agent includes nonsteroidal anti-inflammatory drugs (NSAIDs). Examples of NSAIDs, but not limited to, include acetylsalicylic acid, magnesium cholinesalicylate, diflunisal, magnesium salicylate, salsalate, and sodium salicylate. Examples include thorium, diclofenac, etodrug, fenoprofen, flurbiprofen, indomethacin, ketoprofen, ketrolac, meclofename, naproxen, nabumetone, phenylbutazone, piroxicam, sulindac, tolmetin, acetaminophen, ibuprofen, Cox-2 inhibitors, meloxicam, and tramadol.

[0211] In certain embodiments, the method includes administering ISIS 721744 to a subject requiring it, and performing plasma exchange on the subject before, during, and / or after administration. [Examples]

[0212] The following examples illustrate, but are not limiting, specific embodiments of the present disclosure. Furthermore, where specific embodiments are provided, the inventors intend to provide a general application of those specific embodiments. For example, the disclosure of an oligonucleotide having a particular motif provides reasonable support for further oligonucleotides having that motif or a similar motif. Similarly, for example, where a particular high-affinity modification is found at a particular position, other high-affinity modifications at the same position are also considered appropriate unless otherwise indicated.

[0213] Example 1: Phase 1 human clinical trial using ISIS 721744 ISIS 721744 was supplied in sterile saline at a concentration of 100 mg / mL. Various doses of ISIS 721744 were tested in randomized, double-blind, placebo-controlled trials to evaluate its safety, tolerability, pharmacokinetics, and pharmacodynamics in healthy volunteers. Participants received either placebo or ISIS 721744 four times monthly via subcutaneous injection, with each injection containing a dose of 20, 40, 60, or 80 mg.

[0214] ISIS 721744 resulted in a dose-dependent mean reduction in plasma PKK protein concentration (Figure 1A) and enzyme precursor activation (Figure 1B). Enzyme precursor activation was described by Ferrone et al., “IONIS-PKK Rx a Novel Antisense Measurements were taken as described in "Inhibitor of Prekallikrein and Bradykinin Production," 2019, Nucleic Acid Ther., (29):82-91. The mean reduction in plasma PKK levels across all dose groups was 52.9% to 93.6% below baseline. In the 80 mg group, plasma PKK protein levels showed a mean (±SD) reduction of 93.6% (±2.3) from baseline two weeks after the last dose. Pharmacological effects persisted for three months after the last dose in this dose group, resulting in a mean reduction of 74.7% (±12.7) from baseline in PKK levels. Similarly, plasma enzyme precursor activation showed mean (±SD) reductions from baseline of 98.6% (±2.0) at two weeks and 76.6% (±13.4) at three months after the last dose in the 80 mg dose group.

[0215] No serious adverse events occurred, and no patients discontinued treatment due to treatment-related adverse events (TEAEs). Clinical laboratory tests for coagulation, aPTT, and prothrombin showed no dose- or time-dependent changes.

[0216] Example 2: Proof-of-Concept Study of Efficacy in Type I HAE Patients To evaluate the clinical efficacy and tolerability of ISIS 721744, patients with type I HAE were selected. These patients had a history of life-threatening angioedema attacks, on average twice per month. These patients also reported intolerance to approved medications for the treatment of HAE, including tranexamic acid, attenuated androgens, and C1 inhibitor concentrates.

[0217] Eight weeks after discontinuing previous prophylactic treatment, the patient developed ISIS 721744 at 80m It was administered subcutaneously at a dose of g. This dose was administered monthly for 8 months. Plasma PKK activity was measured at least monthly. Briefly, patient plasma samples were added to PKK-deficient plasma, and the resulting samples were compared to samples of known PKK concentration in an activated partial thromboplastin time (aPTT) test, a blood test that characterizes blood clotting. Table 1 shows that plasma PKK activity (compared to the baseline of previous prophylactic treatment) decreased during treatment with ISIS 721744. Plasma PKK activity decreased to approximately one-fourth after 6 months of treatment with ISIS 721744. No angioedema attacks were reported during the 8 months of treatment with ISIS 721744. Other prophylactic HAE therapies have not been reported to eliminate all breakthrough attacks during such periods. The treatment was well-tolerated, and no adverse events at the injection site were reported.

Table 1

[0218] Example 3: Proof-of-concept study of efficacy in type III HAE patients To evaluate the clinical efficacy and tolerability of ISIS 721744, patients with type III HAE were selected. This patient had normal levels and function of C1-INH and no typical mutations of nl-C1-INH-HAE. This patient had a history of life-threatening angioedema attacks (6 - 10 attacks per month) despite all available treatment options, including weekly plasma exchange with albumin / NaCl solution. This patient was refractory or intolerant to histamine inhibitors, antifibrinolytics (tranexamic acid), attenuated androgens (danazol), C1 inhibitor concentrates, and bradykinin B2 receptor antagonists (icatibant).

[0219] Seven weeks after the discontinuation of previous prophylactic treatment, the patient was administered ISIS 721744 subcutaneously at a dose of 80 mg. This dose was administered again four weeks later. Over the following weeks, a series of severe angioedema attacks were reported, following H. influenza pneumonia with respiratory failure, catheter-related bloodstream infections, and multiple hospitalizations due to surgery. The dosing interval was increased up to once every three weeks during the first hospitalization, which occurred seven weeks after the first administration of ISIS 721744. Separate from the aforementioned hospitalizations, when measured over nine months during which ISIS 721744 was administered, the frequency of attacks was reduced to one attack per month. Weekly plasma exchange was successfully discontinued eight weeks after the last hospitalization. Table 2 shows that plasma PKK activity (compared to the baseline of previous prophylactic treatment) was reduced during the course of treatment with ISIS 721744. Plasma PKK activity was measured as described in Example 2. Administration of ISIS 721744 was well tolerated and no injection site reactions were seen.

Table 2

[0220] Example 4: Phase 2 Human Clinical Trial of ISIS 721744 for HAE ISIS 721744 is being evaluated in a phase 2 multi-center randomized placebo-controlled trial in patients with type I HAE, type II HAE, or type III HAE. Patients with type III HAE may not be eligible if they have mutations in genes selected from F12, PLG, and ANGPTL1. During an 8-week screening period, patients must experience at least two angioedema attacks. Patients are randomized to receive subcutaneous treatment with 80 mg of ISIS 721744 or placebo every four weeks for at least 12 weeks. Patients who do not have an attack during these 12 weeks are switched to a 100 mg dose. Patients who do not have an attack during these 12 weeks have the frequency of administration reduced to every eight weeks.

[0221] Pharmacodynamics and efficacy are evaluated at multiple time points, including the measurement of cleaved high molecular weight kininogen (cHK) levels and / or the rate of change in plasma PKK activity. PKK activity is determined as described in Example 2. The primary endpoint is the time-normalized number of angioedema episodes per month. Patient safety is closely monitored throughout the study period. Safety and tolerability assessments include, for example, physical examination, vital signs, adverse events, concomitant medications, and plasma clinical tests.

[0222] Example 5: Phase 2 human clinical trial of ISIS 721744 for macular edema The safety and efficacy of ISIS 721744 in patients with diabetic macular edema will be evaluated in a randomized, double-blind, placebo-controlled phase 2 trial. Some patients may have previously received other treatments for macular edema, such as anti-VEGF antibodies or other VEGF inhibitors. Patients will be randomized to receive subcutaneous treatment with 80 mg of ISIS 721744 or placebo at weeks 1, 3, 5, 9, and 13.

[0223] Pharmacodynamics and efficacy will be evaluated at multiple time points. The primary endpoint is the proportion of patients with a reduction in central retinal subfield thickness (CST) of more than 60 μm at 17 and 25 weeks from the first dose. Secondary endpoints include the proportion of patients with a mean increase of 5 or more in best corrected visual acuity (BCVA) at 17 and 25 weeks from the first dose. Additional exploratory endpoints include mean changes in CST and BCVA scores, improvement of 2 or more levels on the Diabetic Retinopathy Severity Scale (DRSS), resolution of macular edema defined as CST at <300 μm for Cirrus or <320 μm for Heidelberg Spectralis, improvement in visual acuity letter scores of 10 letters (2 lines gain) or 15 letters (3 lines gain), and absolute and relative reductions over time in plasma PKK RNA and / or plasma PKK protein concentrations. Patient safety will be closely monitored throughout the study period. Safety and tolerability assessments include, for example, physical examination, vital signs, adverse events, concomitant medications, and plasma clinical tests. In some embodiments, the present invention may be described as follows. [Aspect 1] A method for improving edema in a human subject in need thereof, comprising a therapeutically effective amount of an oligomeric compound having the following chemical structure: [ka] The method comprising administering (SEQ ID NO: 4), or a salt thereof, to the human subject. [Aspect 2] The method according to aspect 1, wherein the salt is a sodium salt or a potassium salt. [Aspect 3] A method for improving edema in a human subject in need thereof, comprising a therapeutically effective amount of an oligomeric compound having the following chemical structure: [ka] The method comprising administering (SEQ ID NO: 4) to the human subject. [Aspect 4] A method for improving edema in a human subject in need thereof, comprising administering a therapeutically effective amount of an oligomer compound to the human subject, wherein the oligomer compound has the following chemical notation (5'→3'): (THA-GalNAc3)o Tes Ges mCeo Aeo Aes Gds Tds mCds Tds mCds Tds Tds Gds Gds mCds Aeo Aeo Aes mCes Ae (SEQ ID NO: 4), and (THA-GalNAc3)o has the following structure: [ka] It is represented as, A is an adenine nucleic acid base, mC is the 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, and The method wherein o is a phosphodiester nucleoside bond. [Aspect 5] The method according to any one of aspects 1 to 4, wherein the edema is hereditary angioedema, and at least one symptom of hereditary angioedema is improved. [Aspect 6] The method according to aspect 5, wherein at least one symptom is selected from nausea, vomiting, itching, headache, fatigue, abdominal pain, shortness of breath, rhinitis, anaphylaxis, bronchoconstriction, and swelling, and combinations thereof. [Aspect 7] The method according to any one of aspects 1 to 4, wherein the edema is macular edema and at least one symptom of macular edema is improved. [Aspect 8] The method according to aspect 7, wherein at least one symptom is selected from blurred vision, wavy vision, distorted vision, and visual acuity loss, and combinations thereof. [Aspect 9] A method for reducing prekallikrein (PKK) RNA in a human subject requiring such reduction, comprising a therapeutically effective amount of an oligomeric compound having the following chemical structure: [ka] The method comprising administering (SEQ ID NO: 4), or a salt thereof, to the human subject. [Aspect 10] The method according to aspect 9, wherein the salt is a sodium salt or a potassium salt. [Aspect 11] A method for reducing PKK RNA in a human subject requiring such reduction, comprising a therapeutically effective amount of an oligomeric compound having the following chemical structure: [ka] The method comprising administering (SEQ ID NO: 4) to the human subject. [Aspect 12] A method for reducing PKK RNA in a human subject who needs it, comprising administering to the human subject a therapeutically effective amount of an oligomeric compound, wherein the oligomeric compound has the following chemical notation (5’→3’): (THA-GalNAc3)o Tes Ges mCeo Aeo Aes Gds Tds mCds Tds mCds Tds Tds Gds Gds mCds Aeo Aeo Aes mCes Ae (SEQ ID NO: 4), and (THA-GalNAc3)o has the following structure: [Chemical formula] represented by A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE sugar moiety, d is a 2’-2’-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, and o is a phosphodiester internucleoside linkage, the said method. [Aspect 13] A method for reducing PKK protein in a human subject who needs it, comprising administering to the human subject a therapeutically effective amount of an oligomeric compound with the following chemical structure: [Chemical formula] (SEQ ID NO: 4), or a salt thereof, to the human subject, the said method. [Aspect 14] The method according to Aspect 13, wherein the salt is a sodium salt or a potassium salt. [Aspect 15] A method for reducing PKK protein in a human subject who needs it, comprising administering to the human subject a therapeutically effective amount of an oligomeric compound with the following chemical structure: [Chemical formula] (SEQ ID NO: 4) to the human subject, the said method. [Aspect 16] A method for reducing PKK protein in a human subject requiring such reduction, comprising administering a therapeutically effective amount of an oligomer compound to the human subject, wherein the oligomer compound has the following chemical notation (5'→3'): (THA-GalNAc3)o Tes Ges mCeo Aeo Aes Gds Tds mCds Tds mCds Tds Tds Gds Gds mCds Aeo Aeo Aes mCes Ae (SEQ ID NO: 4), and (THA-GalNAc3)o has the following structure: [ka] It is represented as, A is an adenine nucleic acid base, mC is the 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, and The method wherein o is a phosphodiester nucleoside bond. [Aspect 17] A method for reducing PKK activity in a human subject requiring such reduction, comprising a therapeutically effective amount of an oligomeric compound having the following chemical structure: [ka] The method comprising administering (SEQ ID NO: 4), or a salt thereof, to the human subject. [Aspect 18] The method according to aspect 17, wherein the salt is a sodium salt or a potassium salt. [Aspect 19] A method for reducing PKK activity in a human subject requiring such reduction, comprising a therapeutically effective amount of an oligomeric compound having the following chemical structure: [ka] The method comprising administering (SEQ ID NO: 4) to the human subject. [Aspect 20] A method for reducing PKK activity in a human subject requiring such reduction, comprising administering a therapeutically effective amount of an oligomer compound to the human subject, wherein the oligomer compound has the following chemical notation (5'→3'): (THA-GalNAc3)o Tes Ges mCeo Aeo Aes Gds Tds mCds Tds mCds Tds Tds Gds Gds mCds Aeo Aeo Aes mCes Ae (SEQ ID NO: 4), and (THA-GalNAc3)o has the following structure: [ka] It is represented as, A is an adenine nucleic acid base, mC is the 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, and The method wherein o is a phosphodiester nucleoside bond. [Aspect 21] The method according to any one of aspects 1 to 20, wherein the therapeutically effective dose is 20 mg. [Aspect 22] The method according to any one of aspects 1 to 20, wherein the therapeutically effective dose is 40 mg. [Aspect 23] The method according to any one of aspects 1 to 20, wherein the therapeutically effective dose is 60 mg. [Aspect 24] The method according to any one of aspects 1 to 20, wherein the therapeutic effective dose is 80 mg. [Aspect 25] The method according to any one of aspects 1 to 20, wherein the therapeutically effective dose is 100 mg. [Pattern 26] The therapeutically effective dose is 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, 150 mg, 155 mg, 160 mg, 165 mg The method according to any one of embodiments 1 to 20, wherein the amount is any of 170 mg, 175 mg, 180 mg, 185 mg, 190 mg, 195 mg, 200 mg, 205 mg, 210 mg, 215 mg, 220 mg, 225 mg, 230 mg, 235 mg, 240 mg, 245 mg, 250 mg, 255 mg, 260 mg, 265 mg, 270 mg, 275 mg, 280 mg, 285 mg, 290 mg, 295 mg, and 300 mg. [Aspect 27] The therapeutically effective dose is approximately 5 mg, approximately 10 mg, approximately 15 mg, approximately 20 mg, approximately 25 mg, approximately 30 mg, approximately 35 mg, approximately 40 mg, approximately 45 mg, approximately 50 mg, approximately 55 mg, approximately 60 mg, approximately 65 mg, approximately 70 mg, approximately 75 mg, approximately 80 mg, approximately 85 mg, approximately 90 mg, approximately 95 mg, approximately 100 mg, approximately 105 mg, approximately 110 mg, approximately 115 mg, approximately 120 mg, approximately 125 mg, approximately 130 mg, approximately 135 mg, approximately 140 mg, approximately 145 mg, approximately 150 mg, approximately 155 mg, approximately 160 mg, approximately 16 The method according to any one of embodiments 1 to 20, wherein the amount is 5 mg, approximately 170 mg, approximately 175 mg, approximately 180 mg, approximately 185 mg, approximately 190 mg, approximately 195 mg, approximately 200 mg, approximately 205 mg, approximately 210 mg, approximately 215 mg, approximately 220 mg, approximately 225 mg, approximately 230 mg, approximately 235 mg, approximately 240 mg, approximately 245 mg, approximately 250 mg, approximately 255 mg, approximately 260 mg, approximately 265 mg, approximately 270 mg, approximately 275 mg, approximately 280 mg, approximately 285 mg, approximately 290 mg, approximately 295 mg, and approximately 300 mg. [Aspect 28] The therapeutically effective dose is 75.0 mg, 75.1 mg, 75.2 mg, 75.3 mg, 75.4 mg, 75.5 mg, 75.6 mg, 75.7 mg, 75.8 mg, 75.9 mg, 76.0 mg, 76.1 mg, 76.2 mg, 76.3 mg, 76.4 mg, 76.5 mg, 76.6 mg, 76.7 mg, 76.8 mg, 76.9 mg, 77.0 mg, 77.1 mg, 77.2 mg, 77.3 mg, 77.4 mg, 77.5mg, 77.6mg, 77.7mg, 77.8mg, 77.9mg, 78.0mg, 78.1mg, 78.2mg, 78.3mg, 78.4mg, 78.5mg, 78.6mg, 78.7mg, 78.8mg, 78.9mg, 79.0mg, 79.1mg, 79.2mg, 79.3mg, 79.4mg, 79.5mg, 79.6mg, 79.7mg, 79.8mg, 79.9mg, 80.0mg, 80. 1mg, 80.2mg, 80.3mg, 80.4mg, 80.5mg, 80.6mg, 80.7mg, 80.8mg, 80.9mg, 81.0mg, 81.1mg, 81.2mg, 81.3mg, 81.4mg , 81.5mg, 81.6mg, 81.7mg, 81.8mg, 81.9mg, 82.0mg, 82.1mg, 82.2mg, 82.3mg, 82.4mg, 82.5mg, 82.6mg, 82.7mg, 82 The method according to any one of embodiments 1 to 20, wherein the amount is any of 0.8 mg, 82.9 mg, 83.0 mg, 83.1 mg, 83.2 mg, 83.3 mg, 83.4 mg, 83.5 mg, 83.6 mg, 83.7 mg, 83.8 mg, 83.9 mg, 84.0 mg, 84.1 mg, 84.2 mg, 84.3 mg, 84.4 mg, 84.5 mg, 84.6 mg, 84.7 mg, 84.8 mg, 84.9 mg, and 85.0 mg. [Aspect 29] The therapeutically effective dose is approximately 75.0 mg, approximately 75.1 mg, approximately 75.2 mg, approximately 75.3 mg, approximately 75.4 mg, approximately 75.5 mg, approximately 75.6 mg, approximately 75.7 mg, approximately 75.8 mg, approximately 75.9 mg, approximately 76.0 mg, approximately 76.1 mg, approximately 76.2 mg, approximately 76.3 mg, approximately 76.4 mg, approximately 76.5 mg, approximately 76.6 mg, approximately 76.6 Approximately 76.7mg, 76.8mg, 76.9mg, 77.0mg, 77.1mg, 77.2mg, 77.3mg, 77.4mg, 77.5mg, 77.6mg, 77.7mg, 77.8mg, 77.9mg, 78.0mg, 78.1mg, 78.2mg, 78.3mg, 78.4mg, 78.5mg, 78.6mg, 78.7mg, 78.8mg Approximately 78.9mg, 79.0mg, 79.1mg, 79.2mg, 79.3mg, 79.4mg, 79.5mg, 79.6mg, 79.7mg, 79.8mg, 79.9mg, 80.0mg, 80.1mg, 80.2mg, 80.3mg, 80.4mg, 80.5mg, 80.6mg, 80.7mg, 80.8mg, 80.9mg, 81.0mg g, about 81.1mg, about 81.2mg, about 81.3mg, about 81.4mg, about 81.5mg, about 81.6mg, about 81.7mg, about 81.8mg, about 81.9mg, about 82.0mg, about 82.1 mg, about 82.2 mg, about 82.3 mg, about 82.4 mg, about 82.5 mg, about 82.6 mg, about 82.7 mg, about 82.8 mg, about 82.9 mg, about 83.0 mg, about 83.1 mg, about 83.2 The method according to any one of embodiments 1 to 20, wherein the amount is any of mg, approximately 83.3 mg, approximately 83.4 mg, approximately 83.5 mg, approximately 83.6 mg, approximately 83.7 mg, approximately 83.8 mg, approximately 83.9 mg, approximately 84.0 mg, approximately 84.1 mg, approximately 84.2 mg, approximately 84.3 mg, approximately 84.4 mg, approximately 84.5 mg, approximately 84.6 mg, approximately 84.7 mg, approximately 84.8 mg, approximately 84.9 mg, and approximately 85.0 mg. [Pattern 30] The therapeutically effective dose is 10mg-140mg, 10mg-130mg, 10mg-120mg, 10mg-110mg, 10mg-100mg, 10mg-90mg, 10mg-80mg, 10mg-70mg, 10mg-60mg, 10mg-50mg, 10mg-40mg, 10mg-30mg, 10mg-20mg, 20mg-140mg, 20mg-130mg, 20mg-120mg, 20mg-110mg, 20mg-100mg, 20mg-90mg, 20mg-80mg, 20mg-70mg, 20mg-60mg, 20mg- 50mg, 20mg~40mg, 20mg~30mg, 30mg~140mg, 30mg~130mg, 30mg~120mg, 30mg~110mg, 30mg~100mg, 30mg~90mg, 30mg~80mg, 30mg~70mg, 30mg~60mg, 30mg~ 50mg, 30mg~40mg, 40mg~140mg, 40mg~130mg, 40mg~120mg, 40mg~110mg, 40mg~100mg, 40mg~90mg, 40mg~80mg, 40mg~70mg, 40mg~60mg, 40mg~50mg, 50mg~ 140mg, 50mg~130mg, 50mg~120mg, 50mg~110mg, 50mg~100mg, 50mg~90mg, 50mg~80mg, 50mg~70mg, 50mg~60mg, 60mg~140mg, 60mg~130mg, 60mg~120mg, 60 mg~110mg, 60mg~100mg, 60mg~90mg, 60mg~80mg, 60mg~70mg, 70mg~140mg, 70mg~130mg, 70mg~120mg, 70mg~110mg, 70mg~100mg, 70mg~90mg, 70mg~80mg, 80mg~140mg, 80mg~130mg, 80mg~120mg, 80mg~110mg, 80mg~100mg, 80mg~90mg, 90mg~140mg, 90mg~130mg, 90mg~120mg, 90mg~110mg, 90mg~100mg, 100mg ~140mg, 100mg~130mg, 100mg~120mg, 100mg~110mg, 110mg~140mg, 110mg~130mg, 110mg~120mg, 120mg~140mg, 120mg~130mg, 130mg~140mg, 65mg~95mg,65mg~90mg, 65mg~85mg, 65mg~80mg, 65mg~75mg, 65mg~70mg, 70mg~95mg, 70mg~85mg, 70mg~75mg, 7 5mg~100mg, 75mg~95mg, 75mg~90mg, 75mg~85mg, 75mg~80mg, 80mg~95mg, 80mg~85mg, 85mg~100mg, 8 5mg~90mg, 90mg~95mg, 95mg~100mg, 80mg~89mg, 80mg~88mg, 80mg~87mg, 80mg~86mg, 80mg~84mg, 8 0mg~83mg, 80mg~82mg, 80mg~81mg, 81mg~90mg, 82mg~89mg, 82mg~88mg, 82mg~87mg, 82mg~86mg, 82m g~85mg, 82mg~84mg, 82mg~83mg, 83mg~90mg, 83mg~89mg, 83mg~88mg, 83mg~87mg, 83mg~86mg, 83mg ~85mg, 83mg~84mg, 84mg~90mg, 84mg~89mg, 84mg~88mg, 84mg~87mg, 84mg~86mg, 84mg~85mg, 85mg~8 The method according to any one of 1 to 20, wherein the dosage is 9 mg, 85 mg to 88 mg, 85 mg to 87 mg, 85 mg to 86 mg, 86 mg to 90 mg, 86 mg to 89 mg, 86 mg to 88 mg, 86 mg to 87 mg, 87 mg to 90 mg, 87 mg to 89 mg, 87 mg to 88 mg, 88 mg to 90 mg, 88 mg to 89 mg, and 89 mg to 90 mg. [Pattern 31] The therapeutically effective dose is less than 300 mg, less than 295 mg, less than 290 mg, less than 285 mg, less than 280 mg, less than 275 mg, less than 270 mg, less than 265 mg, less than 260 mg, less than 255 mg, less than 250 mg, less than 245 mg, less than 240 mg, less than 235 mg, less than 230 mg, less than 225 mg, less than 220 mg, less than 215 mg, less than 210 mg, less than 205 mg, less than 200 mg, less than 195 mg, less than 190 mg, less than 185 mg, less than 180 mg, less than 175 mg, less than 170 mg, less than 165 mg The method according to any one of the embodiments 1 to 20, wherein the amount is less than 160 mg, less than 150 mg, less than 145 mg, less than 140 mg, less than 135 mg, less than 130 mg, less than 125 mg, less than 120 mg, less than 115 mg, less than 110 mg, less than 105 mg, less than 100 mg, less than 95 mg, less than 90 mg, less than 85 mg, less than 80 mg, less than 75 mg, less than 70 mg, less than 65 mg, less than 60 mg, less than 55 mg, less than 50 mg, less than 45 mg, less than 40 mg, less than 35 mg, less than 30 mg, less than 25 mg, and less than 20 mg. [Pattern 32] The therapeutically effective dose is less than approximately 300 mg, less than approximately 295 mg, less than approximately 290 mg, less than approximately 285 mg, less than approximately 280 mg, less than approximately 275 mg, less than approximately 270 mg, less than approximately 265 mg, less than approximately 260 mg, less than approximately 255 mg, less than approximately 250 mg, less than approximately 245 mg, less than approximately 240 mg, less than approximately 235 mg, less than approximately 230 mg, less than approximately 225 mg, less than approximately 220 mg, less than approximately 215 mg, less than approximately 210 mg, less than approximately 205 mg, less than approximately 200 mg, less than approximately 195 mg, less than approximately 190 mg, less than approximately 185 mg, less than approximately 180 mg, less than approximately 175 mg, less than approximately 170 mg, less than approximately 165 mg The method according to any one of embodiments 1 to 20, wherein the amount is less than approximately 160 mg, less than approximately 150 mg, less than approximately 145 mg, less than approximately 140 mg, less than approximately 135 mg, less than approximately 130 mg, less than approximately 125 mg, less than approximately 120 mg, less than approximately 115 mg, less than approximately 110 mg, less than approximately 105 mg, less than approximately 100 mg, less than approximately 95 mg, less than approximately 90 mg, less than approximately 85 mg, less than approximately 80 mg, less than approximately 75 mg, less than approximately 70 mg, less than approximately 65 mg, less than approximately 60 mg, less than approximately 55 mg, less than approximately 50 mg, less than approximately 45 mg, less than approximately 40 mg, less than approximately 35 mg, less than approximately 30 mg, less than approximately 25 mg, and less than approximately 20 mg. [Aspect 33] The method according to any one of aspects 1 to 20, wherein the therapeutically effective dose is at least 10 mg, at least 15 mg, at least 20 mg, at least 25 mg, at least 30 mg, at least 35 mg, at least 40 mg, at least 45 mg, at least 50 mg, at least 55 mg, at least 60 mg, at least 65 mg, at least 70 mg, at least 75 mg, at least 80 mg, at least 85 mg, at least 90 mg, at least 95 mg, at least about 100 mg, at least 105 mg, at least 115 mg, at least 120 mg, at least 125 mg, at least 130 mg, at least 135 mg, at least 140 mg, at least 145 mg, and at least 150 mg. [Aspect 34] The method according to any one of aspects 1 to 20, wherein the therapeutically effective dose is at least about 10 mg, at least about 15 mg, at least about 20 mg, at least about 25 mg, at least about 30 mg, at least about 35 mg, at least about 40 mg, at least about 45 mg, at least about 50 mg, at least about 55 mg, at least about 60 mg, at least about 65 mg, at least about 70 mg, at least about 75 mg, at least about 80 mg, at least about 85 mg, at least about 90 mg, at least about 95 mg, at least about 100 mg, at least about 105 mg, at least about 115 mg, at least about 120 mg, at least about 125 mg, at least about 130 mg, at least about 135 mg, at least about 140 mg, at least about 145 mg, and at least about 150 mg. [Aspect 35] The method according to any one of aspects 1 to 34, comprising administering the oligomer compound once every four weeks. [Aspect 36] The method according to any one of aspects 1 to 34, comprising administering the oligomer compound once every 8 weeks. [Aspect 37] The method according to any one of aspects 1 to 34, comprising administering the oligomer compound once every four weeks. [Aspect 38] The method according to any one of aspects 1 to 34, comprising administering the oligomer compound once every eight weeks. [Aspect 39] A method according to any one of Aspects 1 to 34, comprising administering the oligomer compound once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, once every 10 weeks, once every 11 weeks, once every 12 weeks, once every 13 weeks, once every 14 weeks, once every 15 weeks, once every 16 weeks, once every 17 weeks, once every 18 weeks, once every 19 weeks, or once every 20 weeks. [Aspect 40] A method according to any one of aspects 1 to 34, comprising administering the oligomer compound once every approximately 4 weeks, once every approximately 5 weeks, once every approximately 6 weeks, once every approximately 7 weeks, once every approximately 8 weeks, once every approximately 9 weeks, once every approximately 10 weeks, once every approximately 11 weeks, once every approximately 12 weeks, once every approximately 13 weeks, once every approximately 14 weeks, once every approximately 15 weeks, once every approximately 16 weeks, once every approximately 17 weeks, once every approximately 18 weeks, once every approximately 19 weeks, or once every approximately 20 weeks. [Aspect 41] The method according to any one of aspects 1 to 34, comprising administering at least two loading doses of the oligomer compound and at least two maintenance doses of the oligomer compound. [Aspect 42] The method according to aspect 41, wherein the loading dose is 80 mg or about 80 mg. [Aspect 43] The method according to aspect 41 or 42, wherein the maintenance dose is less than 80 mg. [Aspect 44] The method according to aspect 43, wherein the maintenance dose is 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, or 75 mg. [Aspect 45] The method according to aspect 43, wherein the maintenance dose is approximately 20 mg, approximately 25 mg, approximately 30 mg, approximately 35 mg, approximately 40 mg, approximately 45 mg, approximately 50 mg, approximately 55 mg, approximately 60 mg, approximately 65 mg, approximately 70 mg, or approximately 75 mg. [Aspect 46] The method according to any one of aspects 41 to 45, comprising administering the loading dose once every four weeks, and administering at least two maintenance doses once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, once every nine weeks, once every ten weeks, once every eleven weeks, once every twelve weeks, once every thirteen weeks, once every fourteen weeks, once every fifteen weeks, once every sixteen weeks, once every seventeen weeks, once every eighteen weeks, once every nineteen weeks, or once every twenty weeks. [Aspect 47] The method according to any one of aspects 41 to 45, comprising administering the loading dose once every four weeks, and administering at least two maintenance doses once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, once every nine weeks, once every ten weeks, once every eleven weeks, once every twelve weeks, once every thirteen weeks, once every fourteen weeks, once every fifteen weeks, once every sixteen weeks, once every seventeen weeks, once every eighteen weeks, once every nineteen weeks, or once every twenty weeks. [Aspect 48] The method according to any one of aspects 41 to 45, comprising administering the loading dose once every two weeks, and administering at least two maintenance doses once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, once every nine weeks, once every ten weeks, once every eleven weeks, once every twelve weeks, once every thirteen weeks, once every fourteen weeks, once every fifteen weeks, once every sixteen weeks, once every seventeen weeks, once every eighteen weeks, once every nineteen weeks, or once every twenty weeks. [Aspect 49] The method according to any one of aspects 41 to 45, comprising administering the loading dose once every two weeks, and administering at least two maintenance doses once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, once every nine weeks, once every ten weeks, once every eleven weeks, once every twelve weeks, once every thirteen weeks, once every fourteen weeks, once every fifteen weeks, once every sixteen weeks, once every seventeen weeks, once every eighteen weeks, once every nineteen weeks, or once every twenty weeks. [Aspect 50] The method according to any one of aspects 1 to 49, wherein the human subject has hereditary angioedema or is at risk thereof. [Aspect 51] The method according to aspect 50, wherein the hereditary angioedema is type I HAE. [Aspect 52] The method according to aspect 50, wherein the hereditary angioedema is type II HAE. [Aspect 53] The method according to aspect 51 or 52, wherein the human subject has a gene mutation in the SERPING1 gene. [Aspect 54] The method according to aspect 50, wherein the hereditary angioedema is type III HAE. [Aspect 55] The method according to aspect 54, wherein the human subject has a gene mutation in a gene selected from F12, PLG, and ANGPT1. [Aspect 56] The method according to aspect 54, wherein the subject does not have a gene mutation in a gene selected from F12, PLG, and ANGPT1. [Aspect 57] The method according to any one of aspects 50 to 56, wherein the human subject is refractory to at least one anti-edema agent. [Aspect 58] The method according to aspect 57, wherein the at least one anti-edema agent comprises a histamine inhibitor, a C1 esterase inhibitor, an attenuated androgen, an antifibrinolytic agent, an angiotensin-converting enzyme inhibitor, an angiotensin II type 1 receptor blocker, a kallikrein inhibitor, a bradykinin B2 receptor antagonist, or a combination thereof. [Aspect 59] The method according to any one of aspects 50 to 58, wherein the human subject is refractory to histamine inhibitors, antifibrinolytic agents, attenuated androgens, C1 esterase inhibitors, and bradykinin B2 receptor antagonists. [Aspect 60] The method according to aspect 58 or 59, wherein the antifibrinolytic agent is tranexamic acid. [Aspect 61] The method according to any one of aspects 58 to 60, wherein the attenuated androgen is danazol. [Aspect 62] The method according to any one of aspects 58 to 61, wherein the bradykinin B2 receptor antagonist is icatibant. [Aspect 63] The method according to any one of aspects 57 to 62, wherein the at least one anti-edema agent provides a reduction of less than 5%, less than 10%, less than 20%, less than 30%, less than 40%, or less than 50% in the incidence of angioedema attacks experienced by the subject, when measured over at least 1, at least 2, at least 3, at least 4, or at least 6 months after the first administration of the at least one anti-edema agent, compared to the incidence of angioedema attacks experienced by the subject before the first administration of the at least one anti-edema agent. [Aspect 64] The method according to any one of aspects 57 to 63, wherein the at least one anti-edema agent reduces swelling by about 5%, about 10%, about 20%, about 30%, about 40%, or about 50% about 1 hour, about 2 hours, about 4 hours, about 8 hours, about 12 hours, about 24 hours, or about 48 hours after the first administration of the at least one anti-edema agent. [Aspect 65] The method according to any one of aspects 50 to 64, wherein the human subject, when measured over at least 1, 2, 3, 4, 5, 6, 8, or 12 months prior to administration, has an average of at least 1, at least 2, at least 3, at least 4, at least 5, or at least 6 episodes of angioedema per month. [Aspect 66] The method according to any one of aspects 1 to 49, wherein the human subject has macular edema or is at risk of macular edema. [Aspect 67] The method according to aspect 66, wherein the human subject has diabetes mellitus, diabetic macular edema, diabetic retinopathy, or a combination thereof. [Aspect 68] A method for improving hereditary angioedema in a human subject in need thereof, comprising approximately 80 mg of an oligomeric compound having the following chemical structure: [ka] The method comprising administering (SEQ ID NO: 4), or a salt thereof, to the human subject. [Aspect 69] The method according to aspect 68, wherein the salt is a sodium salt or a potassium salt. [Aspect 70] A method for improving hereditary angioedema in a human subject in need thereof, comprising approximately 80 mg of an oligomeric compound having the following chemical structure: [ka] The method comprising administering (SEQ ID NO: 4) to the human subject. [Aspect 71] A method for improving hereditary angioedema in a human subject in need thereof, comprising administering approximately 80 mg of an oligomer compound to the human subject, wherein the oligomer compound has the following chemical notation (5'→3'): (THA-GalNAc3)o Tes Ges mCeo Aeo Aes Gds Tds mCds Tds mCds Tds Tds Gds Gds mCds Aeo Aeo Aes mCes Ae (SEQ ID NO: 4), and (THA-GalNAc3)o has the following structure: [ka] It is represented as, A is an adenine nucleic acid base, mC is the 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, and The method wherein o is a phosphodiester nucleoside bond. [Aspect 72] The method according to any one of aspects 68 to 71, comprising administering 80 mg of the oligomer compound to the human subject. [Aspect 73] The method according to any one of aspects 68 to 71, comprising administering to a human subject at least two doses of about 80 mg of the oligomer compound once every four weeks, and subsequently administering at least two doses of about 100 mg of the oligomer compound once every four weeks. [Aspect 74] The method according to any one of aspects 68 to 71, comprising administering to a human subject at least two doses of 80 mg of the oligomer compound once every four weeks, followed by administering at least two doses of 100 mg of the oligomer compound once every four weeks. [Aspect 75] The method according to aspect 73 or 74, wherein the human subject experiences at least one episode of angioedema during administration of 80 mg or about 80 mg of the oligomer compound once every four weeks or once every four weeks. [Aspect 76] The method according to any one of aspects 68 to 71, comprising administering to the human subject at least two loading doses of about 80 mg of the oligomer compound at about 4 weeks, and at least two maintenance doses of about 80 mg of the oligomer compound at about 8 weeks. [Aspect 77] The method according to any one of aspects 68 to 71, comprising administering to the human subject at least two loading doses of 80 mg of the oligomer compound once every four weeks, and at least two maintenance doses of 80 mg of the oligomer compound once every eight weeks. [Aspect 78] The method according to any one of aspects 75 to 77, wherein the subject does not experience an angioedema attack while being administered 80 mg or about 80 mg of the oligomer compound once every four weeks or about once every four weeks. [Aspect 79] The method according to any one of aspects 68 to 78, wherein the hereditary angioedema is type I HAE, type II HAE, or type III HAE. [Aspect 80] The method according to aspect 79, wherein the hereditary angioedema is type III HAE, and the human subject has a gene mutation in a gene selected from F12, PLG, and ANGPT1. [Aspect 81] The method according to aspect 79, wherein the hereditary angioedema is type III HAE, and the human subject does not have a gene mutation in a gene selected from F12, PLG, and ANGPT1. [Aspect 82] The method according to any one of aspects 68 to 81, wherein the human subject is refractory to at least one anti-edema agent. [Aspect 83] The method according to aspect 82, wherein the at least one anti-edema agent includes a histamine inhibitor, a C1 esterase inhibitor, an attenuated androgen, an antifibrinolytic agent, an angiotensin-converting enzyme inhibitor, an angiotensin II type 1 receptor blocker, a kallikrein inhibitor, a bradykinin B2 receptor antagonist, or a combination thereof. [Aspect 84] The method according to any one of aspects 68 to 83, wherein the human subject is refractory to histamine inhibitors, antifibrinolytic agents, attenuated androgens, C1 esterase inhibitors, and bradykinin B2 receptor antagonists. [Aspect 85] The method according to aspect 83 or 84, wherein the antifibrinolytic agent is tranexamic acid. [Aspect 86] The method according to any one of aspects 83 to 85, wherein the attenuated androgen is danazol. [Aspect 87] The method according to any one of aspects 83 to 86, wherein the bradykinin B2 receptor antagonist is icatibant. [Aspect 88] The method according to any one of aspects 82 to 87, wherein the at least one anti-edema agent provides a reduction of less than 5%, less than 10%, less than 20%, less than 30%, less than 40%, or less than 50% in the incidence of angioedema attacks experienced by the subject, measured over at least 1, at least 2, at least 3, at least 4, or at least 6 months after the first administration of the at least one anti-edema agent, compared to the incidence of angioedema attacks experienced by the subject before the first administration of the at least one anti-edema agent. [Aspect 89] The method according to any one of aspects 82 to 87, wherein the at least one anti-edema agent reduces swelling by less than about 5%, less than about 10%, less than about 20%, less than about 30%, less than about 40%, or less than 50% about 1 hour, about 2 hours, about 4 hours, about 8 hours, about 12 hours, about 24 hours, or about 48 hours after the first administration of the at least one anti-edema agent. [Aspect 90] The method according to any one of aspects 82 to 87, wherein the human subject, when measured over at least 1, 2, 3, 4, 5, 6, 8, or 12 months prior to administration, has an average of at least 1, at least 2, at least 3, at least 4, at least 5, or at least 6 episodes of angioedema per month. [Aspect 91] A method for improving macular edema in a human subject in need thereof, comprising approximately 80 mg of an oligomeric compound having the following chemical structure: [ka] The method comprising administering (SEQ ID NO: 4), or a salt thereof, to the human subject. [Aspect 92] The method according to aspect 91, wherein the salt is a sodium salt or a potassium salt. [Aspect 93] A method for improving macular edema in a human subject requiring such improvement, comprising approximately 80 mg of an oligomeric compound having the following chemical structure: [ka] The method comprising administering (SEQ ID NO: 4) to the human subject. [Aspect 94] A method for improving macular edema in a human subject in need thereof, comprising administering approximately 80 mg of an oligomer compound to the human subject, wherein the oligomer compound has the following chemical notation (5'→3'): (THA-GalNAc3)o Tes Ges mCeo Aeo Aes Gds Tds mCds Tds mCds Tds Tds Gds Gds mCds Aeo Aeo Aes mCes Ae (SEQ ID NO: 4), and (THA-GalNAc3)o has the following structure: [ka] It is represented as, A is an adenine nucleic acid base, mC is the 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, and The method wherein o is a phosphodiester nucleoside bond. [Aspect 95] The method according to any one of aspects 91 to 94, comprising administering 80 mg of the oligomer compound to the human subject. [Aspect 96] The method according to any one of aspects 91 to 95, comprising administering to a human subject at least two loading doses of about 80 mg of the oligomer compound once every two weeks, and at least two maintenance doses of about 80 mg of the oligomer compound once every four weeks. [Aspect 97] The method according to any one of aspects 91 to 95, comprising administering to the human subject at least two loading doses of 80 mg of the oligomer compound once every two weeks, and at least two maintenance doses of 80 mg of the oligomer compound once every four weeks. [Aspect 98] The method according to any one of aspects 91 to 97, wherein the human subject has diabetic macular edema. [Aspect 99] The method according to any one of aspects 1 to 98, wherein the human subject has an inflammatory state, a thromboembolic state, edema, or is at risk thereof. [Aspect 100] The method according to any one of aspects 1 to 99, wherein the oligomer compound is administered by subcutaneous injection. [Aspect 101] The method according to any one of aspects 1 to 100, wherein the oligomer compound is self-administered. [Aspect 102] The method according to any one of aspects 1 to 101, wherein PKK RNA is reduced in the subject. [Aspect 103] The method according to any one of aspects 1 to 102, wherein the PKK protein is reduced in the subject. [Aspect 104] The method according to any one of aspects 1 to 103, wherein PKK activity is reduced in the subject.

Claims

1. The following chemical structure is used to improve hereditary angioedema in human subjects requiring treatment of hereditary angioedema: 【Chemistry 1】 A pharmaceutical composition comprising (SEQ ID NO: 4), or an oligomeric compound of its salt, Herein, the improvement comprises administering a therapeutically effective amount of the oligomer compound to the human subject, wherein the salt is optionally a sodium salt or a potassium salt. Herein, the therapeutically effective dose is 20 mg to 80 mg of the pharmaceutical composition.

2. The following chemical structure is used to improve hereditary angioedema in human subjects requiring treatment of hereditary angioedema: 【Chemistry 2】 A pharmaceutical composition comprising (SEQ ID NO: 4), Herein, the improvement includes administering a therapeutically effective amount of the oligomer compound to the human subject. Herein, the therapeutically effective dose is 20 mg to 80 mg of the pharmaceutical composition.

3. The pharmaceutical composition according to claim 1 or 2, wherein the therapeutically effective dose is 20 mg to 60 mg.

4. The pharmaceutical composition according to claim 1 or 2, wherein the therapeutically effective dose is 20 mg.

5. The pharmaceutical composition according to claim 1 or 2, wherein the therapeutically effective dose is 40 mg.

6. The pharmaceutical composition according to claim 1 or 2, wherein the therapeutically effective dose is 60 mg.

7. The pharmaceutical composition according to claim 1 or 2, wherein the therapeutically effective dose is 80 mg.

8. A pharmaceutical composition according to any one of claims 1 to 7, wherein at least one symptom of hereditary angioedema is improved, and the at least one symptom is selected from nausea, vomiting, itching, headache, fatigue, abdominal pain, shortness of breath, rhinitis, anaphylaxis, bronchoconstriction, and swelling, and combinations thereof.

9. The aforementioned improvements a) The oligomer compound once every 3 to 9 weeks; b) The oligomer compound once every four weeks, or once every eight weeks; or c) The oligomer compound once every month, or once every two months; A pharmaceutical composition according to any one of claims 1 to 8, comprising administration.

10. The above improvement involves 20 mg to 80 mg of the oligomer compound, a) Once every four weeks; or b) Once every month; A pharmaceutical composition according to any one of claims 1 to 9, comprising administration.

11. The above improvement involves 20 mg to 80 mg of the oligomer compound, a) Once every 8 weeks; or b) Once every two months; A pharmaceutical composition according to any one of claims 1 to 9, comprising administration.

12. The aforementioned improvements a) In human subjects, administer at least two doses of the oligomer compound in an amount of 20 mg to 80 mg once every four weeks, and then administer at least two doses of the oligomer compound in an amount of 20 mg to 80 mg once every eight weeks; b) In human subjects, administer at least two doses of the oligomer compound in an amount of 20 mg to 80 mg once every four weeks, and then administer at least two doses of the oligomer compound in an amount of 20 mg to 80 mg once every four weeks; c) Administering at least two doses of the oligomer compound in an amount of 20 mg to 80 mg to human subjects once every month, and then administering at least two doses of the oligomer compound in an amount of 20 mg to 80 mg once every two months; or, d) In human subjects, administer at least two doses of the oligomer compound in an amount of 20 mg to 80 mg once every month, and then administer at least two doses of the oligomer compound in an amount of 20 mg to 80 mg once every two months; A pharmaceutical composition according to any one of claims 1 to 9, comprising the above.

13. a) The hereditary angioedema is type I HAE; b) The hereditary angioedema is type II HAE; or, c) The hereditary angioedema is type III HAE; A pharmaceutical composition according to any one of claims 1 to 12, comprising the above.

14. The pharmaceutical composition according to claim 13, wherein the hereditary angioedema is type I HAE, and the human subject has a gene mutation in the SERPING1 gene.

15. The pharmaceutical composition according to claim 13, wherein the hereditary angioedema is type II HAE, and the human subject has a gene mutation in the SERPING1 gene.

16. The pharmaceutical composition according to claim 13, wherein the hereditary angioedema is type III HAE, and the human subject has a gene mutation in a gene selected from F12, PLG, and ANGPT1.

17. The pharmaceutical composition according to any one of claims 1 to 16, wherein the human subject is refractory to at least one anti-edema agent.

18. The pharmaceutical composition according to claim 17, wherein the at least one anti-edema agent comprises a histamine inhibitor, a C1 esterase inhibitor, an attenuated androgen, an antifibrinolytic agent, an angiotensin-converting enzyme inhibitor, an angiotensin II type 1 receptor blocker, a kallikrein inhibitor, a bradykinin B2 receptor antagonist, or a combination thereof.

19. The pharmaceutical composition according to any one of claims 1 to 18, wherein the human subject, when measured over at least 1, 2, 3, 4, 5, 6, 8, or 12 months prior to administration of the oligomer compound, has an average of at least 1, at least 2, at least 3, at least 4, at least 5, or at least 6 episodes of angioedema per month.

20. The pharmaceutical composition according to any one of claims 1 to 19, wherein, after administration of the oligomer compound, the subject has a reduction of at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% in the frequency of angioedema attacks.

21. The pharmaceutical composition according to any one of claims 1 to 20, wherein, when measured over at least one, two, three, or four months during treatment with the oligomer compound, the subject has an average of fewer than two or fewer than one episode of angioedema per month after administration of the oligomer compound.

22. The pharmaceutical composition according to any one of claims 1 to 21, wherein the oligomer compound is administered by subcutaneous injection, and optionally, the oligomer compound is self-administered.

23. Herein, the human subject has a gene mutation in the SERPING1 gene, and herein, a) 20 mg to 80 mg of the oligomer compound is administered to the human subjects every four weeks or every eight weeks; The human subject, when measured over at least 1, 2, 3, 4, 5, 6, 8, or 12 months prior to administration of the oligomer compound, had at least one, at least two, at least three, at least four, at least five, or at least six episodes of angioedema per month on average; and, The human subject, when measured over at least one, two, three, or four months during treatment with the oligomer compound, has an average of fewer than two or fewer than one episode of angioedema per month; or b) The oligomer compound is administered to the human subjects in an amount of 20 mg to 80 mg every one or two months; The human subject, when measured over at least 1, 2, 3, 4, 5, 6, 8, or 12 months prior to administration of the oligomer compound, had at least one, at least two, at least three, at least four, at least five, or at least six episodes of angioedema per month on average; and, The human subject, when measured over at least one, two, three, or four months during treatment with the oligomer compound, has an average of fewer than two or fewer than one episode of angioedema per month; A pharmaceutical composition according to any one of claims 1 to 22.

24. The pharmaceutical composition according to any one of claims 1 to 23, wherein the oligomer compound is formulated in sterile saline or phosphate-buffered saline at a concentration of 100 mg / ml.

Images