Translation systems with modified genetic code tables

JP2026083002A5Pending Publication Date: 2026-09-30CHUGAI PHARMA CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2026020069
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2020-06-25
Filing Date
2026-02-10
Publication Date
2026-09-30

AI Technical Summary

Technical Problem

Existing methods struggle to accurately differentiate and assign three amino acids to the same codon box, particularly for NNA and NNG codons, limiting the diversity and versatility of display libraries in translation systems.

Method used

A translation system is developed that uses tRNAs with specific anticodons complementary to M1M2A and M1M2G codons, allowing for the differentiation and assignment of different amino acids or amino acid analogs to these codons, enabling the translation of at least three types of amino acids from a single codon box.

Benefits of technology

The system achieves accurate and efficient translation of multiple amino acids, enhancing the diversity and versatility of display libraries, overcoming the limitations of wobble base pairs and previous methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000150_0000
    Figure 00000150_0000
  • Figure 00000151_0000
    Figure 00000151_0000
  • Figure 00000151_0001
    Figure 00000151_0001
Patent Text Reader

Abstract

This provides a new method that enables the differentiation of codon readings. [Solution] By using aminoacylated tRNA prepared by ligase-binding a pCpA-amino acid with a CA-deficient tRNA at the 3' end in a specific codon box, we succeeded in differentiating between NNA and NNG codons, which was difficult due to the presence of wobble base pairs. Furthermore, by assigning a different amino acid to the NNU or NNC codon in the same codon box and translating sequences containing three codons, NNU, NNA, and NNG or NNC, NNA, and NNG, we evaluated the ability to differentiate the codons. We found that only the amino acid corresponding to the target codon was specifically translated, resulting in accurate differentiation. It was also confirmed that a similar effect could be obtained by changing the sequence of the tRNA body.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This disclosure relates to a translation system having a modified genetic code table, and to a method of using the same. [Background technology]

[0002] Display libraries are an extremely useful technique for efficiently obtaining molecules that bind to target proteins using evolutionary engineering methods. To obtain molecules that exhibit high binding affinity to any target molecule, or to obtain multiple molecules that bind to various epitopes, panning from a highly diverse library is necessary. To construct a highly diverse library, one could consider increasing the number or types of building blocks. However, if molecular weight is limited from a membrane permeability standpoint, the number of building blocks is also limited. Therefore, increasing the types of building blocks is a crucial method for enhancing library diversity.

[0003] Reconstituted cell-free translation systems like PURESYSTEM (Non-Patent Literature 1) allow for adjustment of the concentrations of components such as amino acids, tRNA, and aminoacyl-tRNA synthetase (ARS), thereby altering the natural codon-amino acid mapping. Using such translation systems, it is possible to construct display libraries with more than 20 different building blocks. However, in the E. coli translation system using three-base codons, the existence of the wobble rule means that, in principle, 32 types of building blocks are considered the upper limit. More specifically, there is "play" in the pairing of the third letter of a codon and the first letter of an anticodon, allowing for pairings between G and U, known as wobble base pairs, in addition to Watson-Crick base pairs. Therefore, the anticodon GNN decodes the NNU and NNC codons, and the anticodon UNN decodes the NNA and NNG codons. As a result, these codons cannot be distinguished, and the number of amino acids that can be introduced into a single codon box is limited to a maximum of two (Non-Patent Literature 2).

[0004] To date, there have been reports (Non-Patent Documents 3, 4, and 1) of assigning different amino acids to the NNA and NNG codons in specific codon boxes. However, there are no reports of successfully expanding the number of building blocks by assigning yet another amino acid to the same codon box, thereby simultaneously and accurately distinguishing a total of three amino acids. Furthermore, the previously reported methods are considered to have low versatility in terms of the amino acids that can be selected. In addition, it has been mathematically shown that when aminoacyl-tRNA prepared outside the system is used for translation, a higher concentration of aminoacyl-tRNA is required than that of aminoacylated tRNA prepared by ARS in the system, and in that case, distinguishing between NNA and NNG codons becomes difficult (Non-Patent Document 5).

[0005] In this technological field, the quality of a display library is determined by the ability to map various amino acids to a codon table and to accurately read and translate each codon. It is extremely important that the amino acids assigned to each codon are specifically translated from that codon. [Prior art documents] [Patent Documents]

[0006] [Patent Document 1] WO2016 / 154675 [Non-patent literature]

[0007] [Non-Patent Document 1] Shimizu et al., Nat Biotechnol. 2001; 19(8): 751-755. [Non-Patent Document 2] Iwane et al., Nat Chem. 2016; 8(4): 317-325. [Non-Patent Document 3] Mukai et al., Nucleic Acids Res. 2015; 43(16): 8111-8122. [Non-Patent Document 4] Cui et al., J Am Chem Soc. 2015; 137(13): 4404-4413. [Non-Patent Document 5] Frenkel-Morgenstern et al., Mol Syst Biol. 2012; 8: 572. [Overview of the project] [Problems that the invention aims to solve]

[0008] While various attempts have been made to expand codons, there are no reports that clearly demonstrate that assigning different amino acids to NNA and NNG codons allows for accurate differentiation. Furthermore, there are no reports that clearly demonstrate that assigning three amino acids within the same codon box allows for accurate differentiation. This invention was made in view of this situation, and one of its objectives is to provide a new means that enables the differentiation of codons. [Means for solving the problem]

[0009] In this study, the inventors succeeded in distinguishing between NNA and NNG codons in a specific codon box, a task that was difficult due to the presence of wobble base pairs. Furthermore, they assigned different amino acids to the NNU or NNC codons in the same codon box. When sequences containing these three codons were actually translated and their ability to distinguish between them was evaluated, it was numerically confirmed that only the amino acids corresponding to the target codons were specifically translated, demonstrating successful and accurate differentiation.

[0010] This disclosure is based on such findings and specifically includes the embodiments described illustratively in [1] to

[32] below. [1] A translation system comprising tRNA having an anticodon complementary to the codon represented by M1M2A and tRNA having an anticodon complementary to the codon represented by M1M2G, M1 and M2 represent the first and second nucleosides of the codon, respectively, and M1 and M2 are independently selected from adenosine (A), guanosine (G), cytidine (C), and uridine (U). The translation system is such that each of the two types of tRNAs has a different amino acid or amino acid analog bound to it. [2] The translation system according to [1], in which at least two types of amino acids or amino acid analogs can be translated from a codon box composed of M1M2U, M1M2C, M1M2A, and M1M2G. [3] (i) A tRNA having an anticodon complementary to the codon represented by M1M2U, a tRNA having an anticodon complementary to the codon represented by M1M2A, and a tRNA having an anticodon complementary to the codon represented by M1M2G, or (ii) A translation system comprising a tRNA having an anticodon complementary to the codon represented by M1M2C, a tRNA having an anticodon complementary to the codon represented by M1M2A, and an anticodon complementary to the codon represented by M1M2G, where M1 and M2 each represent the first and second nucleotides of a codon, and M1 and M2 are each independently selected from any of adenosine (A), guanosine (G), cytidine (C), and uridine (U), A translation system in which the three types of tRNAs in (i) and (ii) are each bound to a different amino acid or amino acid analog. [4] The translation system according to any one of [1] to [3], in which at least three types of amino acids or amino acid analogs can be translated from a codon box composed of M1M2U, M1M2C, M1M2A, and M1M2G. [5] The translation system according to any one of [1] to [4], where M1 and M2 are any of the following (i) to (x): (i) M1 is uridine (U) and M2 is uridine (U), (ii) M1 is uridine (U) and M2 is adenosine (A), (iii) M1 is uridine (U) and M2 is guanosine (G), (iv) M1 is cytidine (C) and M2 is adenosine (A), (v) M1 is cytidine (C) and M2 is guanosine (G), (vi) M1 is adenosine (A) and M2 is uridine (U), (vii) M1 is adenosine (A) and M2 is cytidine (C), (viii) M1 is adenosine (A) and M2 is adenosine (A), (ix) M1 is adenosine (A) and M2 is guanosine (G), or (x) M1 is guanosine (G) and M2 is adenosine (A). [6] The translation systems listed in [5] where M1 and M2 are any of (i) through (vii) below: (i) M1 is uridine (U) and M2 is uridine (U), (ii) M1 is uridine (U) and M2 is guanosine (G), (iii) M1 is cytidine (C) and M2 is adenosine (A), (iv) M1 is cytidine (C) and M2 is guanosine (G), (v) M1 is adenosine (A) and M2 is adenosine (A), (vi) M1 is adenosine (A) and M2 is guanosine (G), or (vii) M1 is guanosine (G) and M2 is adenosine (A). [7] The translation system according to any one of [1] to [6], wherein the concentration of the tRNA per codon contained in the translation system is (i) 0.8 to 1000 μM, (ii) 1.6 to 500 μM, (iii) 3.2 to 250 μM, (iv) 6.4 to 150 μM, or (v) 10 to 100 μM. [8] The translation system according to any one of [1] to [7], wherein the amino acid is either a natural amino acid or a non-natural amino acid. [9] The translation system according to any one of [1] to [8], wherein the tRNA is either an initiation tRNA or an elongation tRNA.

[10] The translation system described in any of [1] to [9], wherein the tRNA is of prokaryotic or eukaryotic origin.

[11] The translation system according to any one of [1] to

[10] , wherein the anticodon comprises one or more nucleosides of adenosine (A), guanosine (G), cytidine (C), or uridine (U).

[12] A translation system described in any of [1] to

[11] that can translate more than 20 different amino acids or amino acid analogs from a single genetic code table.

[13] A cell-free translation system, as described in any of [1] to

[12] .

[14] The translation system described in

[13] is a reconstituted cell-free translation system.

[15] A translation system as described in

[13] or

[14] , comprising ribosomes derived from E. coli.

[16] The translation system according to any one of [1] to

[15] , wherein the tRNA is bound to the amino acid or amino acid analog outside the translation system.

[17] The translation system according to any one of [1] to

[16] , wherein, among the tRNAs, tRNAs having an anticodon complementary to the codon represented by M1M2A, and tRNAs having an anticodon complementary to the codon represented by M1M2G, are bound to the aforementioned amino acids or amino acid analogs outside the translation system.

[18] The translation system according to any one of [1] to

[17] , wherein the tRNA is obtained by the pCpA method, the pdCpA method, a method using an artificial RNA catalyst (flexizyme), or a method using aminoacyl-tRNA synthetase (ARS).

[19] A method for producing a translation system according to any one of [1] to

[18] , comprising binding the amino acid or amino acid analog to tRNA outside the translation system.

[20] The method according to

[19] , wherein the binding of an amino acid or amino acid analog to tRNA outside the translation system is performed by the pCpA method, the pdCpA method, a method using an artificial RNA catalyst (flexizyme), or a method using aminoacyl-tRNA synthetase (ARS). 〔twenty one〕 A method for producing peptides, comprising translating nucleic acids using a translation system described in any of [1] to

[18] or a translation system obtained by the method described in

[19] or

[20] . 〔twenty two〕 The method according to

[21] , wherein the peptide is a peptide having a cyclic portion. 〔twenty three〕 Peptides prepared by the method described in

[21] or

[22] . 〔twenty four〕 A method for producing a peptide library, comprising translating a nucleic acid library using a translation system described in any of [1] to

[18] or a translation system obtained by the method described in

[19] or

[20] . 〔twenty five〕 A peptide library prepared by the method described in

[24] .

[26] A method for identifying peptides having binding activity to a target molecule, comprising contacting the target molecule with the peptide library described in

[25] .

[27] The translation system according to any one of [1] to

[18] , wherein the anticodon does not contain lysidine.

[28] The translation system according to any one of [1] to

[18] and

[27] , wherein the anticodon does not contain a lysidine derivative.

[29] The translation system according to any one of [1] to

[18] ,

[27] , and

[28] , wherein the anticodon does not contain agmatidine.

[30] The translation system according to any one of [1] to

[18] and

[27] to

[29] , wherein the anticodon does not contain an agmatidine derivative.

[31] A translation system according to any one of [1] to

[18] and

[27] to

[30] , further comprising nucleic acids containing codons represented by M1M2A and M1M2G.

[32] The translation system according to

[31] , wherein the nucleic acid comprises (i) a codon represented by M1M2U, a codon represented by M1M2A, and a codon represented by M1M2G, or (ii) a codon represented by M1M2C, a codon represented by M1M2A, and a codon represented by M1M2G.

[0011] Furthermore, this disclosure includes embodiments described exemplarily in

[101] to

[120] below.

[101] A method for producing peptides, comprising translating nucleic acids using a translation system, The aforementioned translation system includes tRNA having an anticodon complementary to the codon represented by M1M2A, and tRNA having an anticodon complementary to the codon represented by M1M2G. M1 and M2 represent the first and second nucleosides of the codon, respectively, and M1 and M2 are independently selected from adenosine (A), guanosine (G), cytidine (C), and uridine (U). The manufacturing method wherein each of the two types of tRNA is bound to a different amino acid or amino acid analog.

[102] The method according to

[101] , wherein at least two amino acids or amino acid analogs can be translated from a codon box composed of M1M2U, M1M2C, M1M2A, and M1M2G.

[103] A method for producing peptides, comprising translating nucleic acids using a translation system, The aforementioned translation system, (i) tRNA having an anticodon complementary to the codon represented by M1M2U, tRNA having an anticodon complementary to the codon represented by M1M2A, and tRNA having an anticodon complementary to the codon represented by M1M2G, or (ii) comprising tRNA having an anticodon complementary to the codon represented by M1M2C, tRNA having an anticodon complementary to the codon represented by M1M2A, and tRNA having an anticodon complementary to the codon represented by M1M2G, M1 and M2 represent the first and second nucleosides of the codon, respectively, and M1 and M2 are independently selected from adenosine (A), guanosine (G), cytidine (C), and uridine (U). The production method wherein the three types of tRNAs in (i) and (ii) above are each bound to different amino acids or amino acid analogs.

[104] The method according to any one of

[101] to

[103] , wherein at least three amino acids or amino acid analogs can be translated from a codon box composed of M1M2U, M1M2C, M1M2A, and M1M2G.

[105] The method according to any of

[101] to

[104] , wherein M1 and M2 are any of (i) to (x) below: (i) M1 is uridine (U) and M2 is uridine (U), (ii) M1 is uridine (U) and M2 is adenosine (A), (iii) M1 is uridine (U) and M2 is guanosine (G), (iv) M1 is cytidine (C) and M2 is adenosine (A), (v) M1 is cytidine (C) and M2 is guanosine (G), (vi) M1 is adenosine (A) and M2 is uridine (U), (vii) M1 is adenosine (A) and M2 is cytidine (C), (viii) M1 is adenosine (A) and M2 is adenosine (A), (ix) M1 is adenosine (A) and M2 is guanosine (G), or (x) M1 is guanosine (G) and M2 is adenosine (A).

[106] The method described in

[105] , wherein M1 and M2 are any of (i) to (vii) below: (i) M1 is uridine (U) and M2 is uridine (U), (ii) M1 is uridine (U) and M2 is guanosine (G), (iii) M1 is cytidine (C) and M2 is adenosine (A), (iv) M1 is cytidine (C) and M2 is guanosine (G), (v) M1 is adenosine (A) and M2 is adenosine (A), (vi) M1 is adenosine (A) and M2 is guanosine (G), or (vii) M1 is guanosine (G) and M2 is adenosine (A).

[107] The method according to any one of

[101] to

[106] , wherein the concentration per codon of the tRNA contained in the translation system is (i) 0.8 to 1000 μM, (ii) 1.6 to 500 μM, (iii) 3.2 to 250 μM, (iv) 6.4 to 150 μM, or (v) 10 to 100 μM.

[108] The method according to any one of

[101] to

[107] , wherein the amino acid is a natural amino acid or a non-natural amino acid.

[109] The method according to any one of

[101] to

[108] , wherein the tRNA is an initiate tRNA or an elongation tRNA.

[110] The method according to any one of

[101] to

[109] , wherein the tRNA is a tRNA of prokaryotic origin or eukaryotic origin.

[111] The method according to any one of

[101] to

[110] , wherein the anticodon comprises one or more nucleosides of adenosine (A), guanosine (G), cytidine (C), or uridine (U).

[112] A method according to any one of

[101] to

[111] , which enables the translation of more than 20 amino acids from a single genetic code table.

[113] The method according to any one of

[101] to

[112] , wherein the translation system is a cell-free translation system.

[114] The method according to

[113] , wherein the translation system is a reconstituted cell-free translation system.

[115] The method according to

[113] or

[114] , wherein the translation system comprises ribosomes derived from Escherichia coli.

[116] The method according to any one of

[101] to

[115] , wherein the tRNA is bound to the amino acid or amino acid analog outside the translation system.

[117] The method according to any one of

[101] to

[116] , wherein, among the tRNAs, tRNAs having an anticodon complementary to the codon represented by M1M2A, and tRNAs having an anticodon complementary to the codon represented by M1M2G, are bound to the amino acid or amino acid analog outside the translation system.

[118] The method according to any one of

[101] to

[117] , wherein the tRNA is obtained by a pCpA method, a pdCpA method, a method using an artificial RNA catalyst (flexizyme), or a method using aminoacyl-tRNA synthetase (ARS).

[119] The method according to any one of

[101] to

[118] , wherein the nucleic acid comprises a codon represented by M1M2A and a codon represented by M1M2G.

[120] The method according to any one of

[103] to

[118] , wherein the nucleic acid comprises (i) a codon represented by M1M2U, a codon represented by M1M2A, and a codon represented by M1M2G, or (ii) a codon represented by M1M2C, a codon represented by M1M2A, and a codon represented by M1M2G.

[0012] Furthermore, this disclosure includes embodiments described exemplarily in sections

[201] to

[218] below.

[201] A kit or composition for producing peptides, It includes tRNAs having anticodons complementary to the codon represented by M1M2A, and tRNAs having anticodons complementary to the codon represented by M1M2G. M1 and M2 represent the first and second nucleosides of the codon, respectively, and M1 and M2 are independently selected from adenosine (A), guanosine (G), cytidine (C), and uridine (U). The kit or composition wherein each of the two types of tRNAs has a different amino acid or amino acid analog bound to it.

[202] The method according to

[201] , wherein at least two amino acids or amino acid analogs can be translated from a codon box composed of M1M2U, M1M2C, M1M2A, and M1M2G.

[203] A kit or composition for producing peptides, (i) tRNA having an anticodon complementary to the codon represented by M1M2U, tRNA having an anticodon complementary to the codon represented by M1M2A, and tRNA having an anticodon complementary to the codon represented by M1M2G, or (ii) tRNA having an anticodon complementary to the codon represented by M1M2C, tRNA having an anticodon complementary to the codon represented by M1M2A, and containing an anticodon complementary to the codon represented by M1M2G, M1 and M2 represent the first and second nucleosides of the codon, respectively, and M1 and M2 are independently selected from adenosine (A), guanosine (G), cytidine (C), and uridine (U). The kit or composition wherein each of the three types of tRNAs in (i) and (ii) above has a different amino acid or amino acid analog bound to it.

[204] A kit or composition according to any one of

[201] to

[203] , wherein at least three amino acids or amino acid analogs can be translated from a codon box composed of M1M2U, M1M2C, M1M2A, and M1M2G.

[205] A kit or composition according to any of

[201] to

[204] , wherein M1 and M2 are any of (i) to (x) below: (i) M1 is uridine (U) and M2 is uridine (U), (ii) M1 is uridine (U) and M2 is adenosine (A), (iii) M1 is uridine (U) and M2 is guanosine (G), (iv) M1 is cytidine (C) and M2 is adenosine (A), (v) M1 is cytidine (C) and M2 is guanosine (G), (vi) M1 is adenosine (A) and M2 is uridine (U), (vii) M1 is adenosine (A) and M2 is cytidine (C), (viii) M1 is adenosine (A) and M2 is adenosine (A), (ix) M1 is adenosine (A) and M2 is guanosine (G), or (x) M1 is guanosine (G) and M2 is adenosine (A).

[206] The kit or composition described in

[205] , wherein M1 and M2 are any of (i) to (vii) below: (i) M1 is uridine (U) and M2 is uridine (U), (ii) M1 is uridine (U) and M2 is guanosine (G), (iii) M1 is cytidine (C) and M2 is adenosine (A), (iv) M1 is cytidine (C) and M2 is guanosine (G), (v) M1 is adenosine (A) and M2 is adenosine (A), (vi) M1 is adenosine (A) and M2 is guanosine (G), or (vii) M1 is guanosine (G) and M2 is adenosine (A).

[207] A kit or composition according to any one of

[201] to

[206] , wherein the concentration of the tRNA per codon is (i) 0.8 to 1000 μM, (ii) 1.6 to 500 μM, (iii) 3.2 to 250 μM, (iv) 6.4 to 150 μM, or (v) 10 to 100 μM.

[208] The kit or composition according to any one of

[201] to

[207] , wherein the amino acid is a natural amino acid or a non-natural amino acid.

[209] The kit or composition according to any one of

[201] to

[208] , wherein the tRNA is an initiate tRNA or an elongation tRNA.

[210] The kit or composition according to any one of

[201] to

[209] , wherein the tRNA is derived from a prokaryote or a eukaryote.

[211] The kit or composition according to any one of

[201] to

[210] , wherein the anticodon comprises one or more nucleosides of adenosine (A), guanosine (G), cytidine (C), or uridine (U).

[212] A kit or composition according to any one of

[201] to

[211] , capable of translating more than 20 different amino acids from a single genetic code table.

[213] A kit or composition according to any one of

[201] to

[212] , wherein the translation system is a cell-free translation system.

[214] The kit or composition according to

[213] , wherein the translation system is a reconstituted cell-free translation system.

[215] The kit or composition according to

[213] or

[214] , wherein the translation system comprises ribosomes derived from Escherichia coli.

[216] The kit or composition according to any one of

[201] to

[215] , wherein the tRNA is conjugated with the amino acid or amino acid analog outside the translation system.

[217] The kit or composition according to any one of

[201] to

[216] , wherein, among the tRNAs, tRNAs having an anticodon complementary to the codon represented by M1M2A, and tRNAs having an anticodon complementary to the codon represented by M1M2G, are bound to the amino acid or amino acid analog outside the translation system.

[218] The kit or composition according to any one of

[201] to

[217] , wherein the tRNA is obtained by a pCpA method, a pdCpA method, a method using an artificial RNA catalyst (flexizyme), or a method using aminoacyl-tRNA synthetase (ARS). [Brief explanation of the drawing]

[0013] [Figure 1] Figure 1 shows the results of translation evaluation of three different amino acid readings within a single codon box, as described in Examples 6-7. The codons evaluated were CUU, CUA, and CUG. The vertical axis of the graph shows the amount of peptides translated when translation is performed with each combination of tRNA and mRNA described below (see Table 6 for specific measured values). tRNA: Compound AAtR-1 (anticodon: aag, amino acid: nBuG) Compound AAtR-2 (anticodon: uag, amino acid: Pic2) Compound AAtR-3 (anticodon: cag, amino acid: dA) mRNA: mR-1 (contains the CUU codon) mR-2 (contains the CUA codon) mR-3 (contains the CUG codon) [Figure 2]Figure 2 shows the results of translation evaluation of three different amino acid readings within a single codon box, as described in Examples 6-7. The codons evaluated were GUU, GUA, and GUG. The amount of peptides translated when translation is performed with each combination of tRNA and mRNA described below is shown on the vertical axis of the graph (see Table 7 for specific measured values). tRNA: Compound AAtR-4 (anticodon: aac, amino acid: nBuG) Compound AAtR-5 (anticodon: uac, amino acid: Pic2) Compound AAtR-6 (anticodon: cac, amino acid: dA) mRNA: mRNA-4 (contains the GUU codon) mRNA-5 (contains the GUA codon) mRNA-6 (contains the GUG codon) mRNA-6 (contains the GUG codon) [Figure 3] Figure 3 shows the results of translation evaluation of three different amino acid readings within a single codon box, as described in Examples 6-7. The codons evaluated were CAU, CAA, and CAG. The amount of peptides translated when translation is performed with each combination of tRNA and mRNA described below is shown on the vertical axis of the graph (see Table 8 for specific measured values). tRNA: Compound AAtR-7 (anticodon: aug, amino acid: nBuG) Compound AAtR-8 (anticodon: uug, amino acid: Pic2) Compound AAtR-9 (anticodon: cug, amino acid: dA) mRNA: mRNA-7 (contains the CAU codon) mRNA-8 (contains the CAA codon) mRNA-9 (contains the CAG codon) mRNA-9 (contains the CAG codon) [Figure 4] Figure 4 shows the results of translational evaluation of three different amino acid readings within a single codon box, as described in Examples 6-7. The codons evaluated were AAU, AAA, and AAG. The vertical axis of the graph shows the amount of peptides translated when translation is performed with each combination of tRNA and mRNA described below (see Table 9 for specific measured values). tRNA: Compound AAtR-10 (anticodon: auu, amino acid: nBuG) Compound AAtR-11 (anticodon: uuu, amino acid: Pic2) Compound AAtR-12 (anticodon: cuu, amino acid: dA) mRNA: mR-10 (contains the AAU codon) mR-11 (contains the AAA codon) mR-12 (contains the AAG codon) [Figure 5] Figure 5 shows the results of translation evaluation of three different amino acid readings within a single codon box, as described in Examples 6-7. The codons evaluated were GAU, GAA, and GAG. The amount of peptides translated when translation is performed with each combination of tRNA and mRNA described below is shown on the vertical axis of the graph (see Table 10 for specific measured values). tRNA: Compound AAtR-13 (anticodon: auc, amino acid: nBuG) Compound AAtR-14 (anticodon: uuc, amino acid: Pic2) Compound AAtR-15 (anticodon: cuc, amino acid: dA) mRNA: mR-13 (contains the GAU codon) mR-14 (contains the GAA codon) mR-15 (contains the GAG ​​codon) [Figure 6] Figure 6 shows the results of translation evaluation of three different amino acid readings within a single codon box, as described in Examples 6-7. The codons evaluated were UUU, UUA, and UUG. The vertical axis of the graph shows the amount of peptides translated when translation is performed with each combination of tRNA and mRNA described below (see Table 11 for specific measured values). tRNA: Compound AAtR-16 (anticodon: aaa, amino acid: nBuG) Compound AAtR-17 (anticodon: uaa, amino acid: Pic2) Compound AAtR-18 (anticodon: caa, amino acid: dA) mRNA: mR-16 (contains the UUU codon) mR-17 (contains the UUA codon) mR-18 (contains the UUG codon) [Figure 7]Figure 7 shows the results of translational evaluation of three different amino acid readings within a single codon box, as described in Examples 6-7. The codons evaluated were AGU, AGA, and AGG. The amount of peptides translated when translation is performed with each combination of tRNA and mRNA described below is shown on the vertical axis of the graph (see Table 12 for specific measured values). tRNA: Compound AAtR-19 (anticodon: acu, amino acid: nBuG) Compound AAtR-20 (anticodon: ucu, amino acid: Pic2) Compound AAtR-21 (anticodon: ccu, amino acid: dA) mRNA: mR-19 (contains the AGU codon) mR-20 (contains the AGA codon) mR-21 (contains the AGG codon) [Figure 8] Figure 8 shows the results of translational evaluation of three different amino acid readings within a single codon box, as described in Examples 6-7. The codons evaluated were UGC, UGA, and UGG. The amount of peptides translated when translation is performed with each combination of tRNA and mRNA described below is shown on the vertical axis of the graph (see Table 13 for specific measured values). tRNA: Compound AAtR-22 (anticodon: gca, amino acid: nBuG) Compound AAtR-23 (anticodon: uca, amino acid: Pic2) Compound AAtR-24 (anticodon: cca, amino acid: dA) mRNA: mRNA-22 (contains the UGC codon) mRNA-23 (contains the UGA codon) mRNA-24 (contains the UGG codon) [Figure 9]Figure 9 shows the results of translational evaluation of three different amino acid readings within a single codon box, as described in Examples 6-7. The codons evaluated were CAC, CAA, and CAG. The amount of peptides translated when translation is performed with each combination of tRNA and mRNA described below is shown on the vertical axis of the graph (see Table 14 for specific measured values). tRNA: Compound AAtR-26 (anticodon: gug, amino acid: nBuG) Compound AAtR-8 (anticodon: uug, amino acid: Pic2) Compound AAtR-9 (anticodon: cug, amino acid: dA) mRNA: mRNA-25 (contains the CAC codon) mRNA-8 (contains the CAA codon) mRNA-9 (contains the CAG codon) mRNA-9 (contains the CAG codon) [Figure 10] Figure 10 shows the results of translational evaluation of three different amino acid readings in a single codon box, as described in Examples 6-7. The codons evaluated were AAC, AAA, and AAG. The amount of peptides translated when translation is performed with each combination of tRNA and mRNA described below is shown on the vertical axis of the graph (see Table 15 for specific measured values). tRNA: Compound AAtR-27 (anticodon: guu, amino acid: nBuG) Compound AAtR-11 (anticodon: uuu, amino acid: Pic2) Compound AAtR-12 (anticodon: cuu, amino acid: dA) mRNA: mRNA-26 (contains the AAC codon) mRNA-11 (contains the AAA codon) mRNA-12 (contains the AAG codon) mRNA-13 (contains the AAA codon) mRNA-12 (contains the AAG codon) [Figure 11]Figure 11 shows the results of translation evaluation of three different amino acid readings within a single codon box, as described in Examples 6-7. The codons evaluated were AGC, AGA, and AGG. The amount of peptides translated when translation is performed with each combination of tRNA and mRNA described below is shown on the vertical axis of the graph (see Table 16 for specific measured values). tRNA: Compound AAtR-28 (anticodon: gcu, amino acid: nBuG) Compound AAtR-20 (anticodon: ucu, amino acid: Pic2) Compound AAtR-21 (anticodon: ccu, amino acid: dA) mRNA: mR-29 (contains the AGC codon) mR-20 (contains the AGA codon) mR-21 (contains the AGG codon) [Figure 12] Figure 12 shows the results of translational evaluation of three different amino acid readings in a single codon box, as described in Examples 6-7. The codons evaluated were CAU, CAA, and CAG. The amount of peptides translated when translation is performed with each combination of tRNA and mRNA described below is shown on the vertical axis of the graph (see Table 17 for specific measured values). tRNA: Compound AAtR-29 (anticodon: aug, amino acid: MeA3Pyr) Compound AAtR-30 (anticodon: uug, amino acid: StBuOH) Compound AAtR-31 (anticodon: cug, amino acid: MeSnPr) mRNA: mR-7 (contains the CAU codon) mR-8 (contains the CAA codon) mR-9 (contains the CAG codon) [Figure 13]Figure 13 shows the results of translational evaluation of three different amino acid readings in a single codon box, as described in Examples 6-7. The codons evaluated were AAU, AAA, and AAG. The amount of peptides translated when translation is performed with each combination of tRNA and mRNA described below is shown on the vertical axis of the graph (see Table 18 for specific measured values). tRNA: Compound AAtR-32 (anticodon: auu, amino acid: MeA3Pyr) Compound AAtR-33 (anticodon: uuu, amino acid: StBuOH) Compound AAtR-34 (anticodon: cuu, amino acid: MeSnPr) mRNA: mR-10 (contains the AAU codon) mR-11 (contains the AAA codon) mR-12 (contains the AAG codon) [Figure 14] Figure 14 shows the results of translation evaluation of three different amino acid readings in a single codon box, as described in Examples 6-7. The codons evaluated were GAU, GAA, and GAG. The amount of peptides translated when translation is performed with each combination of tRNA and mRNA described below is shown on the vertical axis of the graph (see Table 19 for specific measured values). tRNA: Compound AAtR-35 (anticodon: auc, amino acid: MeA3Pyr) Compound AAtR-36 (anticodon: uuc, amino acid: StBuOH) Compound AAtR-37 (anticodon: cuc, amino acid: MeSnPr) mRNA: mR-13 (contains the GAU codon) mR-14 (contains the GAA codon) mR-15 (contains the GAG ​​codon) [Figure 15]Figure 15 shows the results of translation evaluation of three different amino acid readings in a single codon box, as described in Examples 6-7. The codons evaluated were UUU, UUA, and UUG. The amount of peptides translated when translation is performed with each combination of tRNA and mRNA described below is shown on the vertical axis of the graph (see Table 20 for specific measured values). tRNA: Compound AAtR-38 (anticodon: aaa, amino acid: MeA3Pyr) Compound AAtR-39 (anticodon: uaa, amino acid: StBuOH) Compound AAtR-40 (anticodon: caa, amino acid: MeSnPr) mRNA: mR-16 (contains the UUU codon) mR-17 (contains the UUA codon) mR-18 (contains the UUG codon) [Figure 16] Figure 16 shows the results of translational evaluation of three different amino acid readings in a single codon box, as described in Examples 6-7. The codons evaluated were AGU, AGA, and AGG. The amount of peptides translated when translation is performed with each combination of tRNA and mRNA described below is shown on the vertical axis of the graph (see Table 21 for specific measured values). tRNA: Compound AAtR-41 (anticodon: acu, amino acid: MeA3Pyr) Compound AAtR-42 (anticodon: ucu, amino acid: StBuOH) Compound AAtR-43 (anticodon: ccu, amino acid: MeSnPr) mRNA: mR-19 (contains the AGU codon) mR-20 (contains the AGA codon) mR-21 (contains the AGG codon) [Figure 17]Figure 17 shows the results of translational evaluation of three different amino acid readings within a single codon box, as described in Examples 6-7. The codons evaluated were UGC, UGA, and UGG. The vertical axis of the graph shows the amount of peptides translated when translation is performed with each combination of tRNA and mRNA described below (see Table 22 for specific measured values). tRNA: Compound AAtR-44 (anticodon: gca, amino acid: MeA3Pyr) Compound AAtR-45 (anticodon: uca, amino acid: StBuOH) Compound AAtR-46 (anticodon: cca, amino acid: MeSnPr) mRNA: mR-22 (contains the UGC codon) mR-23 (contains the UGA codon) mR-24 (contains the UGG codon) [Figure 18] Figure 18 shows the results of translational evaluation of three different amino acid readings within a single codon box, as described in Examples 6-7. The codons evaluated were CAC, CAA, and CAG. The amount of peptides translated when translation is performed with each combination of tRNA and mRNA described below is shown on the vertical axis of the graph (see Table 23 for specific measured values). tRNA: Compound AAtR-47 (anticodon: gug, amino acid: MeA3Pyr) Compound AAtR-30 (anticodon: uug, amino acid: StBuOH) Compound AAtR-31 (anticodon: cug, amino acid: MeSnPr) mRNA: mR-25 (contains the CAC codon) mR-8 (contains the CAA codon) mR-9 (contains the CAG codon) [Figure 19]Figure 19 shows the results of translational evaluation of three different amino acid readings in a single codon box, as described in Examples 6-7. The codons evaluated were AAC, AAA, and AAG. The amount of peptides translated when translation is performed with each combination of tRNA and mRNA described below is shown on the vertical axis of the graph (see Table 24 for specific measured values). tRNA: Compound AAtR-48 (anticodon: guu, amino acid: MeA3Pyr) Compound AAtR-33 (anticodon: uuu, amino acid: StBuOH) Compound AAtR-34 (anticodon: cuu, amino acid: MeSnPr) mRNA: mR-26 (contains the AAC codon) mR-11 (contains the AAA codon) mR-12 (contains the AAG codon) [Figure 20] Figure 20 shows the results of translational evaluation of three different amino acid readings within a single codon box, as described in Examples 6-7. The codons evaluated were GAC, GAA, and GAG. The amount of peptides translated when translation is performed with each combination of tRNA and mRNA described below is shown on the vertical axis of the graph (see Table 25 for specific measured values). tRNA: Compound AAtR-49 (anticodon: guc, amino acid: MeA3Pyr) Compound AAtR-36 (anticodon: uuc, amino acid: StBuOH) Compound AAtR-37 (anticodon: cuc, amino acid: MeSnPr) mRNA: mR-27 (contains the GAC codon) mR-14 (contains the GAA codon) mR-15 (contains the GAG ​​codon) [Figure 21]Figure 21 shows the results of translational evaluation of three different amino acid readings within a single codon box, as described in Examples 6-7. The codons evaluated were UUC, UUA, and UUG. The vertical axis of the graph shows the amount of peptides translated when translation is performed with each combination of tRNA and mRNA described below (see Table 26 for specific measured values). tRNA: Compound AAtR-50 (anticodon: gaa, amino acid: MeA3Pyr) Compound AAtR-39 (anticodon: uaa, amino acid: StBuOH) Compound AAtR-40 (anticodon: caa, amino acid: MeSnPr) mRNA: mR-28 (contains the UUC codon) mR-17 (contains the UUA codon) mR-18 (contains the UUG codon) [Figure 22] Figure 22 shows the results of translational evaluation of three different amino acid readings in a single codon box, as described in Examples 6-7. The codons evaluated were AGC, AGA, and AGG. The amount of peptides translated when translation is performed with each combination of tRNA and mRNA described below is shown on the vertical axis of the graph (see Table 27 for specific measured values). tRNA: Compound AAtR-51 (anticodon: gcu, amino acid: MeA3Pyr) Compound AAtR-42 (anticodon: ucu, amino acid: StBuOH) Compound AAtR-43 (anticodon: ccu, amino acid: MeSnPr) mRNA: mR-29 (contains the AGC codon) mR-20 (contains the AGA codon) mR-21 (contains the AGG codon) [Figure 23-1]Figure 23-1 shows the results of translational evaluation of three different amino acid readings within a single codon box, as described in Examples 6-7. The codons evaluated were CGC, CGA, and CGG. The amount of peptides translated when translation is performed with each combination of tRNA and mRNA described below is shown on the vertical axis of the graph (see Table 28 for specific measured values). tRNA: Compound AAtR-57 (anticodon: gcg, amino acid: nBuG) Compound AAtR-58 (anticodon: ucg, amino acid: SPh2Cl) Compound AAtR-59 (anticodon: ccg, amino acid: dA) mRNA: mR-42 (contains the CGU codon) mR-43 (contains the CGA codon) mR-44 (contains the CGG codon) [Figure 23-2] Figure 23-2 shows the results of translational evaluation of three different amino acid readings within a single codon box, as described in Examples 6-7. The codons evaluated were CAU, CAA, and CAG. The amount of peptides translated when translation is performed with each combination of tRNA and mRNA described below is shown on the vertical axis of the graph (see Table 28-2 for specific measured values). tRNA: Compound AAtR-60 (anticodon: aug, amino acid: nBuGly) Compound AAtR-61 (anticodon: uug, amino acid: Pic2) Compound AAtR-62 (anticodon: cug, amino acid: dA) mRNA: mR-7 (contains the CAU codon) mR-8 (contains the CAA codon) mR-9 (contains the CAG codon) [Figure 23-3]Figure 23-3 shows the results of translational evaluation of three different amino acid readings within a single codon box, as described in Examples 6-7. The codons evaluated were CAU, CAA, and CAG. The amount of peptides translated when translation is performed with each combination of tRNA and mRNA described below is shown on the vertical axis of the graph (see Table 28-3 for specific measured values). tRNA: Compound AAtR-63 (anticodon: aug, amino acid: nBuGly) Compound AAtR-64 (anticodon: uug, amino acid: Pic2) Compound AAtR-65 (anticodon: cug, amino acid: dA) mRNA: mR-7 (contains the CAU codon) mR-8 (contains the CAA codon) mR-9 (contains the CAG codon) [Figure 23-4] Figure 23-4 shows the results of translational evaluation of three different amino acid readings in a single codon box, as described in Examples 6-7. The codons evaluated were CAC, CAA, and CAG. The amount of peptides translated when translation is performed with each combination of tRNA and mRNA described below is shown on the vertical axis of the graph (see Table 28-4 for specific measured values). tRNA: Compound AAtR-66 (anticodon: gug, amino acid: nBuGly) Compound AAtR-67 (anticodon: uug, amino acid: Pic2) Compound AAtR-68 (anticodon: cug, amino acid: dA) mRNA: mR-25 (contains the CAC codon) mR-8 (contains the CAA codon) mR-9 (contains the CAG codon) [Figure 23-5]Figure 23-5 shows the results of translational evaluation of three different amino acid readings in a single codon box, as described in Examples 6-7. The codons evaluated were CAC, CAA, and CAG. The amount of peptides translated when translation is performed with each combination of tRNA and mRNA described below is shown on the vertical axis of the graph (see Table 28-5 for specific measured values). tRNA: Compound AAtR-69 (anticodon: gug, amino acid: nBuGly) Compound AAtR-70 (anticodon: uug, amino acid: Pic2) Compound AAtR-71 (anticodon: cug, amino acid: dA) mRNA: mR-25 (contains the CAC codon) mR-8 (contains the CAA codon) mR-9 (contains the CAG codon) [Figure 23-6] Figure 23-6 shows the results of translational evaluation of three different amino acid readings within a single codon box, as described in Examples 6-7. The codons evaluated were GAU, GAA, and GAG. The amount of peptides translated when translation is performed with each combination of tRNA and mRNA described below is shown on the vertical axis of the graph (see Table 28-6 for specific measured values). tRNA: Compound AAtR-72 (anticodon: auc, amino acid: nBuGly) Compound AAtR-73 (anticodon: uuc, amino acid: Pic2) Compound AAtR-74 (anticodon: cuc, amino acid: dA) mRNA: mR-13 (contains the GAU codon) mR-14 (contains the GAA codon) mR-15 (contains the GAG ​​codon) [Figure 23-7]Figure 23-7 shows the results of translational evaluation of three different amino acid readings in a single codon box, as described in Examples 6-7. The codons evaluated were CAU, CAA, and CAG. The amount of peptides translated when translation is performed with each combination of tRNA and mRNA described below is shown on the vertical axis of the graph (see Table 28-7 for specific measured values). tRNA: Compound AAtR-75 (anticodon: aug, amino acid: MeA3Pr) Compound AAtR-76 (anticodon: uug, amino acid: StBuOH) Compound AAtR-77 (anticodon: cug, amino acid: MeSnPr) mRNA: mR-7 (contains the CAU codon) mR-8 (contains the CAA codon) mR-9 (contains the CAG codon) [Figure 23-8] Figure 23-8 shows the results of translational evaluation of three different amino acid readings within a single codon box, as described in Examples 6-7. The codons evaluated were CAC, CAA, and CAG. The amount of peptides translated when translation is performed with each combination of tRNA and mRNA described below is shown on the vertical axis of the graph (see Table 28-8 for specific measured values). RNA: Compound AAtR-78 (anticodon: gug, amino acid: MeA3Pr) Compound AAtR-79 (anticodon: uug, amino acid: StBuOH) Compound AAtR-80 (anticodon: cug, amino acid: MeSnPr) mRNA: mR-25 (contains the CAC codon) mR-8 (contains the CAA codon) mR-9 (contains the CAG codon) [Figure 23-9]Figure 23-9 shows the results of translational evaluation of three different amino acid readings within a single codon box, as described in Examples 6-7. The codons evaluated were GAU, GAA, and GAG. The amount of peptides translated when translation is performed with each combination of tRNA and mRNA described below is shown on the vertical axis of the graph (see Table 28-9 for specific measured values). tRNA: Compound AAtR-81 (anticodon: auc, amino acid: MeA3Pr) Compound AAtR-82 (anticodon: uuc, amino acid: StBuOH) Compound AAtR-83 (anticodon: cuc, amino acid: MeSnPr) mRNA: mR-13 (contains the GAU codon) mR-14 (contains the GAA codon) mR-15 (contains the GAG ​​codon) [Figure 24-1] Figure 24-1 shows the results of evaluating the changes in the translation amounts of the target peptide and crossreads under different aminoacylated tRNA concentrations, as described in Examples 6-7. The codons evaluated were UCU, UCC, UCA, and UCG. Translation was performed for each combination of tRNA and mRNA described below, and the resulting translation amounts of each peptide are shown on the vertical axis of the graph (see Table 29-1 for specific measurements). tRNA: Compound AAtR-52 (anticodon: uga, amino acid: MeHph) tRNA concentration: 12.8 μM, 6.4 μM, 3.2 μM, 1.6 μM, 0.8 μM mRNA: mR-30 (containing the UCU codon), mR-31 (containing the UCC codon), mR-32 (containing the UCA codon), mR-33 (containing the UCG codon) [Figure 24-2]Figure 24-2 shows the results of evaluating the changes in the translation amounts of the target peptide and crossreads under different aminoacylated tRNA concentrations, as described in Examples 6-7. The codons evaluated were UCU, UCC, UCA, and UCG. Translation was performed for each combination of tRNA and mRNA described below, and the ratio of the translation amount of the target peptide to the translation amount of each peptide obtained is shown on the vertical axis of the graph (see Table 29-2 for specific measurements). tRNA: Compound AAtR-52 (anticodon: uga, amino acid: MeHph) tRNA concentration: 12.8 μM, 6.4 μM, 3.2 μM, 1.6 μM, 0.8 μM mRNA: mR-30 (containing the UCU codon), mR-31 (containing the UCC codon), mR-32 (containing the UCA codon), mR-33 (containing the UCG codon) [Figure 25-1] Figure 25-1 shows the results of evaluating the changes in the translation amounts of the target peptide and crossreads under different aminoacylated tRNA concentrations, as described in Examples 6-7. The codons evaluated were ACU, ACC, ACA, and ACG. Translation was performed for each combination of tRNA and mRNA described below, and the resulting translation amounts of each peptide are shown on the vertical axis of the graph (see Table 30-1 for specific measurement values). tRNA: Compound AAtR-53 (anticodon: ugu, amino acid: MeHph) tRNA concentration: 12.8 μM, 6.4 μM, 3.2 μM, 1.6 μM, 0.8 μM mRNA: mR-34 (containing the ACU codon), mR-35 (containing the ACC codon), mR-36 (containing the ACA codon), mR-37 (containing the ACG codon) [Figure 25-2]Figure 25-2 shows the results of evaluating the changes in the translation amounts of the target peptide and crossreads under different aminoacylated tRNA concentrations, as described in Examples 6-7. The codons evaluated were ACU, ACC, ACA, and ACG. Translation was performed for each combination of tRNA and mRNA described below, and the ratio of the translation amount of the target peptide to the translation amount of each peptide obtained is shown on the vertical axis of the graph (see Table 30-2 for specific measurements). tRNA: Compound AAtR-53 (anticodon: ugu, amino acid: MeHph) tRNA concentration: 12.8 μM, 6.4 μM, 3.2 μM, 1.6 μM, 0.8 μM mRNA: mR-34 (containing the ACU codon), mR-35 (containing the ACC codon), mR-36 (containing the ACA codon), mR-37 (containing the ACG codon) [Figure 26-1] Figure 26-1 shows the results of evaluating the changes in the translation amounts of the target peptide and crossreads under different aminoacylated tRNA concentrations, as described in Examples 6-7. The codons evaluated were AUU, AUC, AUA, and AUG. Translation was performed for each combination of tRNA and mRNA described below, and the resulting translation amounts of each peptide are shown on the vertical axis of the graph (see Table 31-1 for specific measurements). tRNA: Compound AAtR-54 (anticodon: uau, amino acid: MeHph) tRNA concentration: 12.8 μM, 6.4 μM, 3.2 μM, 1.6 μM, 0.8 μM mRNA: mR-38 (contains AUU codon), mR-39 (contains AUC codon), mR-40 (contains AUA codon), mR-41 (contains AUG codon) [Figure 26-2]Figure 26-2 shows the results of evaluating the changes in the translation amounts of the target peptide and crossreads under different aminoacylated tRNA concentrations, as described in Examples 6-7. The codons evaluated were AUU, AUC, AUA, and AUG. Translation was performed for each combination of tRNA and mRNA described below, and the ratio of the translation amount of the target peptide to the translation amount of each peptide obtained is shown on the vertical axis of the graph (see Table 31-2 for specific measurements). tRNA: Compound AAtR-54 (anticodon: uau, amino acid: MeHph) tRNA concentration: 12.8 μM, 6.4 μM, 3.2 μM, 1.6 μM, 0.8 μM mRNA: mR-38 (contains AUU codon), mR-39 (contains AUC codon), mR-40 (contains AUA codon), mR-41 (contains AUG codon) [Figure 27-1] Figure 27-1 shows the results of evaluating the changes in the translation amounts of the target peptide and crossreads under different aminoacylated tRNA concentrations, as described in Examples 6-7. The codons evaluated were AUU, AUC, AUA, and AUG. Translation was performed for each combination of tRNA and mRNA described below, and the resulting translation amounts of each peptide are shown on the vertical axis of the graph (see Table 32-1 for specific measurements). tRNA: Compound AAtR-55 (anticodon: uau, amino acid: MeHph) tRNA concentration: 12.8 μM, 6.4 μM, 3.2 μM, 1.6 μM, 0.8 μM mRNA: mR-38 (contains AUU codon), mR-39 (contains AUC codon), mR-40 (contains AUA codon), mR-41 (contains AUG codon) [Figure 27-2]Figure 27-2 shows the results of evaluating the changes in the translation amounts of the target peptide and crossreads under different aminoacylated tRNA concentrations, as described in Examples 6-7. The codons evaluated were AUU, AUC, AUA, and AUG. Translation was performed for each combination of tRNA and mRNA described below, and the ratio of the translation amount of the target peptide to the translation amount of each peptide obtained is shown on the vertical axis of the graph (see Table 32-2 for specific measurements). tRNA: Compound AAtR-55 (anticodon: uau, amino acid: MeHph) tRNA concentration: 12.8 μM, 6.4 μM, 3.2 μM, 1.6 μM, 0.8 μM mRNA: mR-38 (contains AUU codon), mR-39 (contains AUC codon), mR-40 (contains AUA codon), mR-41 (contains AUG codon) [Figure 28-1] Figure 28-1 shows the results of evaluating the changes in the translation amounts of the target peptide and crossreads under different aminoacylated tRNA concentrations, as described in Examples 6-7. The codons evaluated were AUU, AUC, AUA, and AUG. Translation was performed for each combination of tRNA and mRNA described below, and the resulting translation amounts of each peptide are shown on the vertical axis of the graph (see Table 33-1 for specific measurements). tRNA: Compound AAtR-56 (anticodon: uau, amino acid: Ile) tRNA concentration: 12.8 μM, 6.4 μM, 3.2 μM, 1.6 μM, 0.8 μM mRNA: mR-38 (contains AUU codon), mR-39 (contains AUC codon), mR-40 (contains AUA codon), mR-41 (contains AUG codon) [Figure 28-2]Figure 28-2 shows the results of evaluating the changes in the translation amounts of the target peptide and crossreads under different aminoacylated tRNA concentrations, as described in Examples 6-7. The codons evaluated were AUU, AUC, AUA, and AUG. Translation was performed for each combination of tRNA and mRNA described below, and the ratio of the translation amount of the target peptide to the translation amount of each peptide obtained is shown on the vertical axis of the graph (see Table 33-2 for specific measurements). tRNA: Compound AAtR-56 (anticodon: uau, amino acid: Ile) tRNA concentration: 12.8 μM, 6.4 μM, 3.2 μM, 1.6 μM, 0.8 μM mRNA: mR-38 (contains AUU codon), mR-39 (contains AUC codon), mR-40 (contains AUA codon), mR-41 (contains AUG codon) [Modes for carrying out the invention]

[0014] I. Definition For the purpose of interpreting this Spec., the following definitions apply, and wherever applicable, a term used in the singular also includes the plural, and vice versa. It should be understood that the terms used herein are intended solely to describe a particular aspect and not to limit it. In the event of any conflict between the following definitions and any document incorporated herein by reference, the following definitions shall prevail.

[0015] A "codon" is a combination of three nucleosides (triplets) corresponding to each amino acid when genetic information in a living organism is translated into protein. In the case of DNA, four types of bases are used: adenine (A), guanine (G), cytosine (C), and thymine (T). In the case of mRNA, four types of bases are used: adenine (A), guanine (G), cytosine (C), and uracil (U). A table showing the correspondence between each codon and an amino acid is called the genetic code table or codon table, and 20 types of amino acids are assigned to 61 types of codons, excluding the stop codon (Table 1). The genetic code table listed in Table 1 is used in common by almost all organisms in eukaryotes and prokaryotes (eubacteria and archaea), and is therefore also called the standard genetic code table or universal genetic code table. In this disclosure, the genetic code table used in naturally occurring organisms is referred to as the natural genetic code table, and is distinguished from genetic code tables that have been artificially reprogrammed (in which the correspondence between codons and amino acids has been altered). In the genetic code table, four codons, where the first and second characters are common and only the third character differs, are typically grouped together in a single box; these are called codon boxes.

[0016] [Table 1]

[0017] In this disclosure, codons in mRNA may be represented as "M1M2M3," where M1, M2, and M3 represent the first, second, and third nucleosides of the codon, respectively.

[0018] An "anticodon" is a sequence of three consecutive nucleosides on tRNA that corresponds to a codon on mRNA. Similar to mRNA, anticodons can use four types of bases: adenine (A), guanine (G), cytosine (C), and uracil (U). Modified bases obtained by modifying these bases may also be used. The specific recognition of a codon by an anticodon allows the genetic information on mRNA to be read and translated into protein. The codon sequence on mRNA in the 5' to 3' direction and the anticodon sequence on tRNA in the 5' to 3' direction bind complementaryly, so complementary base pairs are formed between the nucleosides of the first, second, and third letters of the codon and the nucleosides of the third, second, and first letters of the anticodon, respectively.

[0019] In this disclosure, the anticodon in tRNA may be represented as "N1N2N3". Here, N1, N2, and N3 represent the first, second, and third nucleosides of the anticodon, respectively. According to the tRNA numbering rules described below, N1, N2, and N3 are numbered at positions 34, 35, and 36 of the tRNA, respectively.

[0020] In this disclosure, combinations of nucleic acids that can form thermodynamically stable base pairs are referred to as "complementary." In addition to Watson-Crick base pairs such as adenosine and uridine (AU) and guanosine and cytidine (GC), combinations of nucleic acids that form non-Watson-Crick base pairs such as guanosine and uridine (GU), inosine and uridine (IU), inosine and adenosine (IA), and inosine and cytidine (IC) are also included in the "complementary" nucleic acid combinations in this disclosure. In particular, while only Watson-Crick base pair formation is permitted between the first letter of a codon and the third letter of an anticodon, and between the second letter of a codon and the second letter of an anticodon, it is thought that the formation of non-Watson-Crick base pairs as described above is also permitted between the third letter of a codon and the first letter of an anticodon because of spatial fluctuations (wobble).

[0021] Messenger RNA (mRNA) is RNA that carries genetic information that can be translated into proteins. Genetic information is encoded on mRNA as codons, each corresponding to one of the 20 amino acids. Protein translation begins with a start codon and ends with a stop codon. In eukaryotes, the start codon is generally AUG, but in prokaryotes (bacteria and archaea), GUG and UUG may also be used as start codons in addition to AUG. AUG is a codon that codes for methionine (Met), and in eukaryotes and archaea, translation begins directly with methionine. On the other hand, in bacteria, only the start codon AUG corresponds to N-formylmethionine (fMet), so translation begins with formylmethionine. There are three types of stop codons: UAA (ochre), UAG (amber), and UGA (opal). When a stop codon is recognized by a protein called a translation termination factor (RF), the peptide chain synthesized up to that point dissociates from tRNA, and the translation process ends.

[0022] Transfer RNA (tRNA) is a short RNA molecule of less than 100 nucleotides that mediates peptide synthesis using mRNA as a template. In terms of secondary structure, it has a cloverleaf-like structure consisting of three stem-loops (D-arm, anticodon arm, and T-arm) and one stem (acceptor stem). Some tRNAs may also contain an additional variable loop. The anticodon arm contains a region consisting of three consecutive nucleosides called an anticodon, and codons are recognized when the anticodon forms a base pair with a codon on the mRNA. Meanwhile, the 3' end of tRNA contains a nucleic acid sequence (CCA sequence) consisting of cytidine-cytidine-adenosine, and an amino acid is added to the adenosine residue at the end of this sequence (specifically, the hydroxyl group at position 2 or 3 of the ribose of the adenosine residue forms an ester bond with the carboxyl group of the amino acid). tRNA with an added amino acid is called aminoacyl-tRNA. In this disclosure, aminoacyl-tRNA is included in the definition of tRNA. Furthermore, as described later, a method is known in which the two terminal residues (C and A) are removed from the CCA sequence of tRNA and used for the synthesis of aminoacyl-tRNA. Such tRNA from which the 3' terminal CA sequence has been removed is also included in the definition of tRNA in this disclosure. In living organisms, the addition of amino acids to tRNA is carried out by an enzyme called aminoacyl-tRNA synthetase (aaRS or ARS). Normally, there is one type of aminoacyl-tRNA synthetase for each amino acid, and each aminoacyl-tRNA synthetase specifically recognizes only a particular tRNA as a substrate from among multiple tRNAs, so the correspondence between tRNA and amino acids is strictly controlled.

[0023] Each nucleoside in tRNA is numbered according to the tRNA numbering rules (Sprinzl et al., Nucleic Acids Res (1998) 26: 148-153). For example, the anticodon is numbered from position 34 to 36, and the CCA sequence is numbered from position 74 to 76.

[0024] An "initiator tRNA" is a specific tRNA used at the start of mRNA translation. An initiator tRNA, bound to the initiating amino acid, is catalyzed by an initiation factor (IF) and introduced into a ribosome. Translation begins when it binds to the start codon on the mRNA. Generally, the methionine codon AUG is used as the start codon; therefore, the initiator tRNA has the anticodon corresponding to AUG and also binds methionine (or formylmethionine in prokaryotes) as the initiating amino acid.

[0025] "Elongator tRNA" refers to the tRNA used in the peptide chain elongation reaction during the translation process. In peptide synthesis, elongator tRNA, to which amino acids are bound, is sequentially transported to ribosomes by the GTP-modified translation elongation factor (EF) EF-Tu / eEF-1, thereby promoting the peptide chain elongation reaction.

[0026] In this disclosure, “tRNA body” refers to the main structural portion of tRNA (the nucleic acid-based portion) excluding the anticodon (positions 34–36). In some embodiments, the tRNA body in this disclosure refers to positions 1–33 and 37–76 of tRNA. In another embodiment, the tRNA body in this disclosure refers to positions 1–33 and 37–74 of tRNA.

[0027] Lysidine is a type of modified nucleoside, also known as 2-lysylcytidine (k2C or L). Lysidine is used as the first nucleoside of the anticodon in the isoleucine-corresponding tRNA (tRNA Ile2) in bacteria. tRNA Ile2 is synthesized as a precursor with a CAU anticodon, and then the first cytidine (C) of the anticodon is modified (converted) to lysidine (k2C) by the action of an enzyme called tRNA Ile-lysidine synthetase (TilS). As a result, tRNA Ile2 with the k2CAU anticodon is completed (Muramatsu et al., J Biol Chem (1988) 263: 9261-9267, Suzuki et al., FEBS Lett (2010) 584: 272-277). The k2CAU anticodon is known to specifically recognize only the isoleucine codon AUA. Furthermore, it is thought that only after the anticodon is modified to k2CAU can isoleucyl-tRNA synthetase recognize tRNA Ile2 as a substrate, leading to aminoacylation (addition of isoleucine) of tRNA Ile2.

[0028] Agmatidine is a type of modified nucleoside, also known as 2-agmatinylcytidine (agm2C or Agm). Agmatidine is used as the first nucleoside of the anticodon in tRNA (tRNA Ile2), which corresponds to isoleucine in archaea. tRNA Ile2 is synthesized as a precursor with the anticodon CAU, and then, by the action of an enzyme called tRNA Ile-agmatidine synthetase (TiaS), the first cytidine (C) of the anticodon is modified (converted) to agmatidine (agm2C). As a result, tRNA Ile2 with the anticodon agm2CAU is completed (Ikeuchi et al., Nat Chem Biol (2010) 6(4): 277-282). The anticodon agm2CAU is known to specifically recognize only the isoleucine codon AUA. Furthermore, it is thought that only when the anticodon is modified to agm2CAU can isoleucyl-tRNA synthetase recognize tRNA Ile2 as a substrate, leading to aminoacylation (addition of isoleucine) of tRNA Ile2.

[0029] In this disclosure, "cross-read" refers to the phenomenon in which an aminoacyl-tRNA recognizes codons other than the one it is intended to recognize, resulting in the translation of extra amino acids other than the intended ones. The extent to which extra amino acids are translated is not particularly limited, but it usually refers to a level that is judged to be insufficient in terms of translational orthogonality.

[0030] In this disclosure, "alkyl" refers to a monovalent group derived from an aliphatic hydrocarbon by removing one arbitrary hydrogen atom, which does not contain heteroatoms or unsaturated carbon-carbon bonds in its skeleton and has a subset of a hydrocarbyl or hydrocarbon group structure containing hydrogen and carbon atoms. The length n of the carbon chain is in the range of 1 to 20, and examples of alkyl groups include C1-C 10Examples include alkyl, C1-C6 alkyl, and C1-C3 alkyl groups. Specifically, examples include methyl, ethyl, propyl, butyl, pentyl, hexyl, isopropyl, t-butyl, sec-butyl, 1-methylpropyl, 1,1-dimethylpropyl, 2,2-dimethylpropyl, 1,2-dimethylpropyl, 1,1,2-trimethylpropyl, 1,2,2-trimethylpropyl, 1,1,2,2-tetramethylpropyl, 1-methylbutyl, 2-methylbutyl, 3-methylbutyl, 1,1-dimethylbutyl, 1,2-dimethylbutyl, 1,3-dimethylbutyl, 2,2-dimethylbutyl, 2,3-dimethylbutyl, 3,3-dimethylbutyl, 1-ethylbutyl, 2-ethylbutyl, isopentyl, and neopentyl.

[0031] In this disclosure, "cycloalkyl" means a saturated or partially saturated cyclic monovalent aliphatic hydrocarbon group, including monocyclic, bicyclocyclic, and spirocyclic rings. Examples of cycloalkyls include C3-C 10 Examples include cycloalkyl compounds, specifically cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, and bicyclo[2.2.1]heptyl.

[0032] In this disclosure, “alkenyl” is a monovalent group having at least one double bond (two adjacent SP2 carbon atoms). Depending on the arrangement of the double bond and any substitutions, the geometric configuration of the double bond can be entgegen (E) or thusanmen (Z), cis or trans. Examples of alkenyls include linear or branched alkenyls, including linear chains containing internal olefins. Examples of alkenyls include C2-C 10 Examples include alkenyls and C2-C6 alkenyls, specifically vinyl, allyl, 1-propenyl, 2-propenyl, 1-butenyl, 2-butenyl (including cis and trans forms), 3-butenyl, pentenyl, and hexenyl.

[0033] In this disclosure, "alkynyl" refers to a monovalent group having at least one triple bond (two adjacent SP carbon atoms). Examples include linear or branched alkynyls, and include internal alkylenes. Examples of alkynyls include C2-C 10 Examples include alkynyl and C2-C6 alkynyl compounds, specifically ethinyl, 1-propynyl, propargyl, 3-butynyl, pentynyl, hexynyl, 3-phenyl-2-propynyl, 3-(2'-fluorophenyl)-2-propynyl, 2-hydroxy-2-propynyl, 3-(3-fluorophenyl)-2-propynyl, and 3-methyl-(5-phenyl)-4-pentynyl.

[0034] In this disclosure, "aryl" means a monovalent aromatic hydrocarbon ring. Examples of aryls include C6-C 10 Examples include aryl compounds, specifically phenyl and naphthyl compounds (e.g., 1-naphthyl, 2-naphthyl).

[0035] In this disclosure, “heteroaryl” means a monovalent group of an aromatic ring containing heteroatoms among the ring-forming atoms, and which may be partially saturated. The ring may be a monocyclic ring or a fused ring of two rings (e.g., a bicyclic heteroaryl fused with benzene or a monocyclic heteroaryl). The number of atoms forming the ring is, for example, 5–10 (5-membered–10-membered heteroaryl). The number of heteroatoms contained among the ring-forming atoms is, for example, 1–5. Examples of heteroaryl compounds include furyl, thienyl, pyrrolyl, imidazolyl, pyrazolyl, thiazolyl, isothiazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiadiazolyl, triazolyl, tetrazolyl, pyridyl, pyrimidyl, pyridazinyl, pyrazinyl, triazinyl, benzofuranyl, benzothienyl, benzothiadiazolyl, benzothiazolyl, benzoxazolyl, benzoxadiazolyl, benzimidazolyl, indolyl, isoindolyl, indazolyl, quinolyl, isoquinolyl, cinnolinyl, quinazolinyl, quinoxalinyl, benzodioxolyl, indolidinyl, and imidazopyridyl.

[0036] In this disclosure, "arylalkyl (aralkyl)" means a group containing both aryl and alkyl, for example, a group in which at least one hydrogen atom of the alkyl is substituted with an aryl atom. Examples of aralkyls include C5-C 10 Examples include aryl C1-C6 alkyl groups, specifically benzyl.

[0037] In this disclosure, "alkylene" means a divalent group derived by removing one arbitrary hydrogen atom from the aforementioned "alkyl," and may be linear or branched. Examples of linear alkylenes include C2-C6 linear alkylenes and C4-C5 linear alkylenes, specifically -CH2-, -(CH2)2-, -(CH2)3-, -(CH2)4-, -(CH2)5-, and -(CH2)6-. Examples of branched alkylenes include C2-C6 branched alkylenes and C4-C5 branched alkylenes, specifically -CH(CH3)CH2-, -C(CH3)2-, -CH(CH3)CH2CH2-, -C(CH3)2CH2-, -CH2CH(CH3)CH2-, -CH2C(CH3)2-, and -CH2CH2CH(CH3)-.

[0038] In this disclosure, "alkenylene" means a divalent group derived from "alkenyl" by removing one arbitrary hydrogen atom, and may be linear or branched. Depending on the arrangement of the double bond and substituents (if present), it can take an entgegen (E) or thusanmene (Z), cis or trans configuration. Examples of linear alkenylenes include C2-C6 linear alkenylenes and C4-C5 linear alkenylenes, and specifically include -CH=CH-, -CH=CHCH2-, -CH2CH=CH-, -CH=CHCH2CH2-, -CH2CH=CHCH2-, -CH2CH=CHCH2CH=CH-, -CH=CHCH2CH2CH2-, -CH2CH2CH=CHCH2-, -CH2CH2CH2CH=CH-, and others.

[0039] In this disclosure, "arylene" means a divalent group derived by removing one arbitrary hydrogen atom from the aryl group. The ring may be a monoring or a fused ring. The number of atoms constituting the ring is not particularly limited, but for example, it is 6-10 (C6-C6). 10 Arirenes. Specifically, examples of arirenes include phenylene and naphthylene.

[0040] In this disclosure, "heteroarylene" means a divalent group derived by removing one arbitrary hydrogen atom from the heteroaryl group. The ring may be monocyclic or fused. The number of atoms constituting the ring is not particularly limited, but for example, it is 5-10 (5-membered to 10-membered heteroarylene). Specific examples of heteroarylenes include pyrrolediyl, imidazolediyl, pyrazolediyl, pyridinediyl, pyridazinediyl, pyrimidinediyl, pyrazinediyl, triazolediyl, triazinediyl, isoxazolediyl, oxazolediyl, oxadiazolediyl, isothiazolediyl, thiazolediyl, thiadiazolediyl, frangil, and thiophenediyl.

[0041] In this disclosure, "translation system" is defined as a concept encompassing both methods for translating peptides and compositions and kits for translating peptides. Translation systems typically include ribosomes, translation factors, tRNA, amino acids, aminoacyl-tRNA synthetase (aaRS), and factors necessary for peptide translation reactions, such as ATP and GTP. The main types of translation systems include those using living cells and those using cell extracts (cell-free translation systems). Examples of living cell translation systems include systems that introduce desired aminoacyl-tRNA and mRNA into living cells, such as African clawed frog oocytes or mammalian cells, using microinjection or lipofection methods to perform peptide translation (Nowak et al., Science (1995) 268: 439-442). Examples of cell-free translation systems include translation systems utilizing extracts from Escherichia coli (Chen et al., Methods Enzymol (1983) 101: 674-690), yeast (Gasior et al., J Biol Chem (1979) 254: 3965-3969), wheat germ (Erickson et al., Methods Enzymol (1983) 96: 38-50), rabbit reticulocytes (Jackson et al., Methods Enzymol (1983) 96: 50-74), HeLa cells (Barton et al., Methods Enzymol (1996) 275: 35-57), or insect cells (Swerdel et al., Comp Biochem Physiol B (1989) 93: 803-806). Such translation systems can be prepared as appropriate by methods known to those skilled in the art or by similar methods. Cell-free translation systems also include translation systems constructed by isolating and purifying the factors necessary for peptide translation and then reconstituting them (reconstituted cell-free translation systems) (Shimizu et al., Nat Biotech (2001) 19: 751-755).Reconstituted cell-free translation systems typically include ribosomes, amino acids, tRNA, aminoacyl-tRNA synthetase (aaRS), translation initiation factors (e.g., IF1, IF2, IF3), translation elongation factors (e.g., EF-Tu, EF-Ts, EF-G), translation termination factors (e.g., RF1, RF2, RF3), ribosome recycling factors (RRF), NTPs as energy sources, energy regeneration systems, and other factors necessary for translation. If transcription from DNA is also performed, RNA polymerase may be included. The various factors included in cell-free translation systems can be isolated and purified by methods well known to those skilled in the art, and reconstituted cell-free translation systems can be constructed as appropriate using these. Alternatively, commercially available reconstituted cell-free translation systems such as Gene Frontier's PUREfrex® and New England BioLabs' PURExpress® can be used. In the case of reconstituted cell-free translation systems, only the necessary components of the translation system can be reconstituted to construct the desired translation system.

[0042] Aminoacyl-tRNA is synthesized through a specific combination of amino acids, tRNA, and aminoacyl-tRNA synthetase, and this is used in peptide translation. Alternatively, aminoacyl-tRNA can be used directly as a component of the translation system. In particular, when amino acids that are difficult to aminoacylate with aminoacyl-tRNA synthetase, such as unnatural amino acids, are used in translation, it is desirable to use tRNA that has been pre-aminoacylated with unnatural amino acids as a component.

[0043] Translation is initiated by adding mRNA to the translation system. mRNA typically contains the sequence encoding the target peptide, and may also contain sequences that increase the efficiency of the translation reaction (e.g., the Shine-Dalgarno (SD) sequence in prokaryotes, the Kozac sequence in eukaryotes, etc.). Pre-transcribed mRNA may be added directly to the system, or instead of mRNA, a template DNA containing a promoter and a suitable RNA polymerase (e.g., a T7 promoter and T7 RNA polymerase) may be added to the system so that the mRNA is transcribed from the template DNA.

[0044] In this specification, the "~" symbol indicating a numerical range includes the values ​​at both ends of the range. For example, "A~B" means a numerical range where A is greater than or equal to B and B is less than or equal to B.

[0045] In this specification, the meaning of the terms “and / or” includes any combination of “and” and “or” as appropriate. Specifically, for example, “A, B, and / or C” includes the following seven variations: (i) A, (ii) B, (iii) C, (iv) A and B, (v) A and C, (vi) B and C, (vii) A, B, and C.

[0046] II. Translation System and Method for Manufacturing the Translation System In one aspect, the disclosure provides a translation system comprising a tRNA having an anticodon complementary to a codon represented as M1M2A, and a tRNA having an anticodon complementary to a codon represented as M1M2G. In one aspect, the disclosure comprises M1 and M2 representing the first and second nucleosides of a codon, respectively, and M1 and M2 are independently selected from adenosine (A), guanosine (G), cytidine (C), and uridine (U). Each of the two tRNAs included in the translation system in the disclosure may be an aminoacyl-tRNA to which different amino acids or amino acid analogs are bound. The tRNAs in the disclosure can selectively translate the codon represented as M1M2A and the codon represented as M1M2G. Therefore, by using the translation system containing the tRNA of this disclosure, at least two amino acids or amino acid analogs can be translated from a single codon box (which consists of a codon represented by M1M2U, a codon represented by M1M2C, a codon represented by M1M2A, and a codon represented by M1M2G). The codons represented by M1M2A and M1M2G in this disclosure include all combinations that can be identified by selecting M1 from adenosine (A), guanosine (G), cytidine (C), or uridine (U), and selecting M2 from adenosine (A), guanosine (G), cytidine (C), or uridine (U). In the disclosure, the phrase "selectively translate codons" can also be rephrased as "differentiate codons" or "reduce cross-reads," and these can be interpreted as having the same meaning.

[0047] In one aspect, the disclosure provides a translation system comprising tRNA having an anticodon complementary to a codon represented by M1M2U, tRNA having an anticodon complementary to a codon represented by M1M2A, and tRNA having an anticodon complementary to a codon represented by M1M2G. In another aspect, the disclosure provides a translation system comprising tRNA having an anticodon complementary to a codon represented by M1M2C, tRNA having an anticodon complementary to a codon represented by M1M2A, and tRNA having an anticodon complementary to a codon represented by M1M2G. In another aspect, in the disclosure, M1 and M2 represent the first and second nucleosides of a codon, respectively, and M1 and M2 are independently selected from adenosine (A), guanosine (G), cytidine (C), and uridine (U). Each of the three types of tRNAs included in the translation system of this disclosure can be an aminoacyl-tRNA to which different amino acids or amino acid analogs are bound. In one aspect, the tRNAs of this disclosure can selectively translate the codons represented by M1M2U, M1M2A, and M1M2G. In another aspect, the tRNAs of this disclosure can selectively translate the codons represented by M1M2C, M1M2A, and M1M2G. Therefore, by using a translation system containing the tRNAs of this disclosure, at least three different amino acids or amino acid analogs can be translated from a single codon box (which consists of the codons represented by M1M2U, M1M2C, M1M2A, and M1M2G). The codons represented by M1M2U and M1M2C in this disclosure include all combinations that can be identified by selecting M1 from adenosine (A), guanosine (G), cytidine (C), or uridine (U), and selecting M2 from adenosine (A), guanosine (G), cytidine (C), or uridine (U).

[0048] The translation system in this disclosure comprises several different types of tRNAs, from which several different types of amino acids or amino acid analogs can be translated. In one aspect, this disclosure provides compositions and kits for selectively translating codons, comprising several different types of tRNAs suitable for peptide translation. In another aspect, this disclosure provides a method for selectively translating codons, comprising the step of translating a nucleic acid in a translation system comprising several different types of tRNAs suitable for peptide translation. In a particular aspect, the tRNAs of this disclosure are included among the aforementioned several different types of tRNAs.

[0049] Examples of codon combinations that can be selectively translated in this disclosure include the combination of a codon represented by M1M2A and a codon represented by M1M2G, the combination of a codon represented by M1M2U, the combination of a codon represented by M1M2A and a codon represented by M1M2G, and the combination of a codon represented by M1M2C, the combination of a codon represented by M1M2A and a codon represented by M1M2G.

[0050] In one embodiment, the translation system in this disclosure may include nucleic acids containing one or more codons represented by M1M2A and M1M2G. In another embodiment, the translation system in this disclosure may include (i) nucleic acids containing one or more codons represented by M1M2U, M1M2A, and M1M2G, or (ii) nucleic acids containing one or more codons represented by M1M2C, M1M2A, and M1M2G. In yet another embodiment, the translation system in this disclosure may include nucleic acids containing one or more codons represented by M1M2A, M1M2G, M1M2U, and M1M2C. In one embodiment, the translation system in this disclosure may include one or more such nucleic acids.

[0051] In one aspect, this disclosure relates to a method for producing a translation system. The method for producing a translation system in this disclosure includes the step of conjugating an amino acid or amino acid analog to tRNA outside the translation system and / or artificially. In one aspect, the method for producing a translation system in this disclosure further includes the step of mixing the tRNA conjugated with the amino acid or amino acid analog with the translation system in this disclosure. A translation system typically includes ribosomes, translation factors, tRNA, amino acids, aminoacyl-tRNA synthetase (aaRS), and factors necessary for peptide translation reactions, such as ATP and GTP. In particular, in the case of a reconstituted cell-free translation system, only the necessary components of the translation system can be reconstituted to construct the desired translation system. The synthesis of aminoacyl-tRNA (tRNA with amino acids or amino acid analogs attached) within the translation system may occur within the translation system or outside of it. Furthermore, synthesis within and outside the translation system may be used in combination. In some embodiments, tRNAs having anticodons complementary to the codon represented by M1M2A and M1M2G in this disclosure are bound to amino acids or amino acid analogs outside the translation system. In some embodiments, tRNAs having anticodons complementary to the codon represented by M1M2U, M1M2A, and M1M2G in this disclosure are bound to amino acids or amino acid analogs outside the translation system. In some embodiments, tRNAs having anticodons complementary to the codon represented by M1M2C, M1M2A, and M1M2G in this disclosure are bound to amino acids or amino acid analogs outside the translation system. In a further embodiment, tRNAs other than those mentioned above that are included in the translation system may be bound to amino acids or amino acid analogs within the translation system, or to amino acids or amino acid analogs outside the translation system.

[0052] In this disclosure, tRNA is preferably an artificially linked amino acid or amino acid analog. tRNA may be natural tRNA derived from any organism (e.g., Escherichia coli), or it may be an artificially synthesized non-natural tRNA having a different sequence from natural tRNA. Alternatively, it may be an artificially synthesized tRNA having the same sequence as natural tRNA. Furthermore, tRNA in this disclosure may be "tRNA transcribed and synthesized in vitro."

[0053] In some embodiments, if the tRNA in this disclosure is a modified tRNA having a sequence different from that of natural tRNA, the modified tRNA may include at least one modification selected from the following group to one or more nucleosides constituting the tRNA: (i) addition (adding any new nucleoside to an existing tRNA), (ii) deletion (removing any nucleoside from an existing tRNA), (iii) substitution (replacing any nucleoside in an existing tRNA with another nucleoside), (iv) insertion (adding any new nucleoside between any two nucleosides in an existing tRNA), or (v) modification (changing a part of the structure of any nucleoside in an existing tRNA (e.g., a base portion or a sugar portion) to a different structure). The modification may be made to any structure of the tRNA (e.g., the D arm, anticodon arm, T arm, acceptor stem, variable loop, etc.). In some embodiments, the modification of the tRNA in this disclosure is made to the anticodon contained in the anticodon arm. In a further embodiment, the modification of the tRNA in this disclosure is performed on at least one of the 1st, 2nd, and 3rd nucleosides of the anticodon. According to the nucleoside numbering rules in tRNA, the 1st, 2nd, and 3rd nucleosides of the anticodon correspond to positions 34, 35, and 36 of the tRNA, respectively. In this specification, the 1st, 2nd, and 3rd nucleosides of the anticodon may be denoted as N1, N2, and N3, respectively. The number of nucleosides modified in the tRNA of this disclosure can be any number of one or more. In some embodiments, the number of nucleosides modified in the tRNA of this disclosure may be 20 or less, 15 or less, 10 or less, 9 or less, 8 or less, 7 or less, 6 or less, 5 or less, 4 or less, 3 or less, 2 or less, or 1. In another embodiment, the nucleic acid sequence of the modified tRNA is identical to that of the original nucleic acid sequence by 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more.In this disclosure, "percent (%) sequence identity" for a given nucleotide sequence is defined as the percentage ratio of nucleotides in a candidate sequence that are identical to nucleotides in a reference sequence, after the sequences have been aligned to obtain the greatest possible percent sequence identity and gaps have been introduced where necessary, and no conservative substitutions are considered part of the sequence identity. Alignment for the purpose of determining the percent sequence identity of a nucleotide sequence can be achieved by using various methods within the scope of the art, such as publicly available computer software, including BLAST, BLAST-2, ALIGN, Megalign (DNASTAR) software, or GENETYX® (Genetics Co., Ltd.). A person skilled in the art can determine appropriate parameters for aligning sequences, including any algorithm necessary to achieve the greatest possible alignment over the entire length of the sequences being compared.

[0054] In some embodiments, tRNA modification in this disclosure means the substitution of one or more nucleosides that make up the tRNA. With respect to the type of nucleoside, the substituted nucleoside may be any nucleoside present in natural tRNA, or it may be any nucleoside not present in natural tRNA (an artificially synthesized nucleoside). In addition to the four typical nucleosides adenosine, guanosine, cytidine, and uridine, natural tRNA also contains modified nucleosides obtained by modifying them (modified nucleosides). In some embodiments, the nucleosides present in natural tRNA may be selected from the following nucleosides: adenosine (A), cytidine (C), guanosine (G), uridine (U), 1-methyladenosine (m1A), 2-methyladenosine (m2A), N6-isopentenyladenosine (i6A), 2-methylthio-N6-isopentenyladenosine (ms2i6A), N6-methyladenosine (m6A), N6-threonylcarbamoyladenosine (m6A) t6A), N6-methyl-N6-threonylcarbamoyladenosine (m6t6A), 2-methylthio-N6-threonylcarbamoyladenosine (ms2t6A), 2'-O-methyladenosine (Am), inosine (I), 1-methylinosine (m1I), 2'-O-ribosyladenosine (phosphate);Ar(p), N6-(cis-hydroxyisopentenyl)adenosine (io6A), 2-thiocytidine (s2C), 2'-O-methylcytidine (Cm), N4-acetylcytidine (ac4C), 5-methylcytidine (m5C), 3-methylcytidine (m3C), lysidine (k2C), 5-formylcytidine (f5C), 2'-O-methyl-5-formylcytidine (f5Cm), agmatidine (agmatidine; agm2C), 2'-O-ribosylguanosine (phosphate); Gr(p)), 1-methylguanosine (m1G), N2-methylguanosine (m2G), 2'-O-methylguanosine (Gm), N2,N2-dimethylguanosine (m22G), N2,N2,2'-O-trimethylguanosine (m22Gm), 7-methylguanosine (m7G), archaeosine (G*), queuosine; Q), mannosylqueuosine (manQ), galactosylqueuosine (galQ), wybutosine (yW), peroxywybutosine (o2yW), 5-methylaminomethyluridine (mnm5U), 2-thiouridine (2-thiouridine;s2U), 2'-O-methyluridine (Um), 4-thiouridine (s4U), 5-carbamoylmethyluridine (ncm5U), 5-methoxycarbonylmethyluridine (mcm5U), 5-methylaminomethyl-2-thiouridine (mnm5s2U), 5-methoxycarbonylmethyl-2-thiouridine (mcm5s2U), uridine 5-oxyacetic acid (cmo5U), 5-methoxyuridine (mo5U), 5-carboxymethylaminomethyluridine (carboxymethylaminomethyluridine; cmnm5U), 5-carboxymethylaminomethyl-2-thiouridine (cmnm5s2U), 3-(3-amino-3-carboxypropyl)uridine (acp3U), 5-(carboxyhydroxymethyl)uridinemethyl ester (mchm5U), 5-carboxymethylaminomethyl-2'-O-methyluridine (cmnm5Um), 5-carbamoylmethyl-2'-O-methyluridine (ncm5Um), dihydrouridine (D), pseudouridine (Ψ), 1-methylpseudouridine (1-methylpseudouridine; m1Ψ), 2'-O-methylpseudouridine;Ψm), 5-methyluridine (m5U), 5-methyl-2-thiouridine (m5s2U), 5,2'-O-dimethyluridine (m5Um).

[0055] The tRNA modified in this disclosure can be appropriately selected from tRNAs having any nucleic acid sequence. In some embodiments, the tRNA is one of tRNA Ala, tRNA Arg, tRNA Asn, tRNA Asp, tRNA Cys, tRNA Gln, tRNA Glu, tRNA Gly, tRNA His, tRNA Ile, tRNA Leu, tRNA Lys, tRNA Met, tRNA Phe, tRNA Pro, tRNA Ser, tRNA Thr, tRNA Trp, tRNA Tyr, or tRNA Val. In addition to the 20 types of tRNA listed above, tRNA fMet, tRNA Sec (selenocysteine), tRNA Pyl (pyrrolicin), tRNA AsnE2, etc., may also be used. In certain embodiments, the tRNA is one of tRNA Glu, tRNA Asp, tRNA AsnE2, tRNA(fMet), or tRNA(Ile). The term tRNA body is sometimes used to refer to the main structural part of tRNA (the main structural part composed of nucleic acid).

[0056] In this disclosure, tRNA may be referred to as follows: • "tRNA Xxx" or "tRNA(Xxx)" indicates the full-length tRNA corresponding to amino acid Xxx (e.g., tRNA Glu or tRNA(Glu)). • "tRNA(Xxx)nnn" ... Indicates a tRNA (full length) that corresponds to amino acid Xxx and has an anticodon sequence of nnn (e.g., tRNA(Glu)uga or tRNA(Glu)Lga). • "tRNA(Xxx)nnn-CA" ... indicates a tRNA corresponding to amino acid Xxx, with an anticodon sequence of nnn (with the CA sequence at the 3' end removed) (e.g., tRNA(Glu)uga-CA or tRNA(Glu)Lga-CA).

[0057] In some embodiments, the tRNAs of this disclosure are either initiator tRNAs or elongation tRNAs. A tRNA may be created by modifying an initiator tRNA or elongation tRNA, and the tRNA created by modification may function as an initiator tRNA or elongation tRNA. Whether a tRNA functions as an initiator tRNA can be determined by whether, when used in a translation system, it (i) can be introduced into a ribosome via IF2, and (ii) can initiate peptide translation using the amino acid bound to the tRNA as the initiating amino acid. Whether a tRNA functions as an elongation tRNA can be determined by whether, when used in a translation system, it (i) can be introduced into a ribosome via EF-Tu, and (ii) can incorporate the amino acid bound to the tRNA into a peptide chain to elongate the peptide chain.

[0058] In some embodiments, the tRNAs of this disclosure are prokaryotic or eukaryotic tRNAs. Mutant tRNAs may be produced by modifying prokaryotic or eukaryotic tRNAs, and the tRNAs produced by modification may have the highest nucleic acid sequence identity with the prokaryotic or eukaryotic tRNAs. Eukaryotes are further classified into animals, plants, fungi, and protists. The tRNAs of this disclosure may be, for example, human tRNAs. Prokaryotes are further classified into bacteria and archaea. Examples of bacteria include Escherichia coli, Bacillus subtilis, Lactobacillus, or Desulfitobacterium hafniense. Examples of archaea include halophiles, thermophiles, or methanogens (e.g., Methanosarcina mazei, Methanosarcina barkeri, Methanocaldococcus jannaschii). The tRNAs in this disclosure may be derived from, for example, Escherichia coli, Desulfitobacterium hafniense, or Methanosarcina mazei.

[0059] In some embodiments, the tRNAs in this disclosure may not have an anticodon, for example, lysidine (k2C), a lysidine derivative, agmatidine (agm2C), or an agmatidine derivative in its first letter (N1). In certain embodiments, the tRNAs in this disclosure may not have an anticodon, for example, lysidine (k2C), a lysidine derivative, agmatidine (agm2C), or an agmatidine derivative in its first letter (N1).

[0060] tRNA can be synthesized, for example, by preparing DNA encoding a desired tRNA gene, placing an appropriate promoter such as T7, T3, or SP6 upstream of it, and performing a transcription reaction using RNA polymerase adapted to each promoter with the DNA as a template. Alternatively, tRNA can be prepared by purification from biological materials. For example, tRNA can be recovered by preparing an extract from tRNA-containing materials such as cells and adding a probe containing a sequence complementary to the tRNA nucleic acid sequence. In this case, it is also possible to prepare an expression vector capable of expressing the desired tRNA and use cells transformed with this expression vector as the material. tRNA synthesized by in vitro transcription usually contains only four typical nucleosides: adenosine, guanosine, cytidine, and uridine. On the other hand, tRNA synthesized intracellularly may also contain modified nucleosides obtained by modifying these nucleosides. Alternatively, tRNA can also be prepared by ligating fragments synthesized by transcription or chemically synthesized fragments by enzymatic reactions, as described in the examples below.

[0061] Aminoacyl-tRNAs can also be prepared by chemical and / or biological synthesis methods. For example, aminoacyl-tRNAs can be synthesized by attaching amino acids to tRNA using aminoacyl-tRNA synthetase (ARS). The amino acids may be natural or non-natural amino acids, as long as they can serve as substrates for ARS. Alternatively, natural amino acids may be attached to tRNA, and then chemical modifications may be made to the amino acids. Furthermore, numerous examples have been reported in which the effect on non-natural amino acids has been enhanced by introducing amino acid mutations into ARS (see, for example, WO2006 / 135096, WO2007 / 061136, WO2007 / 103307, WO2008 / 001947, WO2010 / 141851, WO2015 / 120287), and amino acids may be attached to tRNA using such mutant ARSs. Besides the ARS method, aminoacyl-tRNA can also be synthesized by removing the CA sequence from the 3' end of tRNA and then attaching an aminoacylated pdCpA (a dinucleotide composed of deoxycytidine and adenosine) to it using RNA ligase (pdCpA method; Hecht et al., J Biol Chem (1978) 253: 4517-4520). A method using pCpA (a dinucleotide composed of cytidine and adenosine) instead of pdCpA is also known (pCpA method; Wang et al., ACS Chem Biol (2015) 10: 2187-2192). That is, aminoacylated tRNA can be prepared by attaching the pCpA-amino acid to the CA-deficient tRNA at the 3' end using RNA ligase.Furthermore, aminoacyl-tRNA can also be synthesized by binding non-natural amino acids, which have been activated beforehand by esterification, to tRNA using an artificial RNA catalyst (flexizyme) (WO2007 / 066627, WO2012 / 026566, H. Murakami et al., Chemistry & Biology, Vol. 10, 2003, 655-662; H. Murakami et al., Chemistry & Biology, Vol. 10, 2003, 1077-1084; H. Murakami et al., Nature Methods 3, 2006, 357-359; N. Niwa et al., Bioorganic & Medicinal Chemistry Letters 19, 2009, 3892-3894). Flexizyme is an artificial RNA catalyst capable of linking amino acids or hydroxy acids to tRNA. The term "flexizyme" in this disclosure includes the original flexizyme (Fx), as well as modified versions thereof such as dinitrobenzylflexizyme (dFx), enhanced flexizyme (eFx), and aminoflexizyme (aFx).

[0062] In some embodiments, the tRNAs of this disclosure are bound to amino acids or amino acid analogs. These amino acids or amino acid analogs are typically bound to the 3' end of the tRNA, more specifically, to an adenosine residue in the 3'-terminal CCA sequence. The specific types of amino acids or amino acid analogs bound to the tRNA can be appropriately selected from the amino acids or amino acid analogs listed below.

[0063] The amino acids in this disclosure include α-amino acids, β-amino acids, γ-amino acids, etc. In terms of three-dimensional structure, both L-type and D-type amino acids are included. Furthermore, the amino acids in this disclosure include both natural and non-natural amino acids. In certain embodiments, natural amino acids consist of the following 20 α-amino acids: glycine (Gly), alanine (Ala), serine (Ser), threonine (Thr), valine (Val), leucine (Leu), isoleucine (Ile), phenylalanine (Phe), tyrosine (Tyr), tryptophan (Trp), histidine (His), glutamic acid (Glu), aspartic acid (Asp), glutamine (Gln), asparagine (Asn), cysteine ​​(Cys), methionine (Met), lysine (Lys), arginine (Arg), and proline (Pro). Alternatively, the natural amino acids in this disclosure may be those obtained by excluding one or more amino acids from the 20 amino acids mentioned above. In one embodiment, the natural amino acids consist of 19 amino acids excluding isoleucine. In another embodiment, the natural amino acids consist of 19 amino acids excluding methionine. In yet another embodiment, the natural amino acids consist of 18 amino acids excluding isoleucine and methionine. Natural amino acids are usually L-type amino acids.

[0064] In the present disclosure, non-natural amino acids refer to all amino acids excluding the natural amino acids composed of the above 20 types of α-amino acids. Examples of non-natural amino acids include β-amino acids, γ-amino acids, D-type amino acids, α-amino acids with side chains different from natural amino acids, α,α-disubstituted amino acids, amino acids in which the amino group of the main chain has a substituent (N-substituted amino acids), and the like. The side chain of the non-natural amino acid is not particularly limited, but in addition to a hydrogen atom, it may have, for example, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, cycloalkyl, etc. Further, in the case of α,α-disubstituted amino acids, two side chains may form a ring. Furthermore, these side chains may have one or more substituents. In a specific embodiment, the substituent can be selected from any functional group containing a halogen atom, O atom, S atom, N atom, B atom, Si atom, or P atom. For example, in the present disclosure, "C1-C6 alkyl having a halogen as a substituent" means "C1-C6 alkyl" in which at least one hydrogen atom in the alkyl is substituted with a halogen atom. Specifically, for example, trifluoromethyl, difluoromethyl, fluoromethyl, pentafluoroethyl, tetrafluoroethyl, trifluoroethyl, difluoroethyl, fluoroethyl, trichloromethyl, dichloromethyl, chloromethyl, pentachloroethyl, tetrachloroethyl, trichloroethyl, dichloroethyl, chloroethyl, etc. are included. Also, for example, "C5-C 10 aryl C1-C6 alkyl" means "C5-C 10 aryl C1-C6 alkyl" in which at least one hydrogen atom in the aryl and / or alkyl is substituted with a substituent. Furthermore, "having two or more substituents" also includes having a certain functional group (for example, a functional group containing an S atom) as a substituent, and further that the functional group has another substituent (for example, a substituent such as amino or halogen). For specific examples of non-natural amino acids, reference can also be made to WO2013 / 100132, WO2018 / 143145, etc.

[0065] The amino group in the main chain of a non-natural amino acid may be an unsubstituted amino group (NH2 group) or a substituted amino group (NHR group). Here, R represents an alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, or cycloalkyl group, which may have substituents. In addition, the carbon chain bonded to the N atom of the amino group in the main chain and the carbon atom at the α position may form a ring, as in proline. The substituent can be selected from any functional group containing a halogen atom, an O atom, an S atom, an N atom, a B atom, an Si atom, or a P atom. Examples of alkyl substitution of an amino group include N-methylation, N-ethylation, N-propylation, and N-butylation, while an example of aralkyl substitution is N-benzylation. Specific examples of N-methyl amino acids include N-methylalanine, N-methylglycine, N-methylphenylalanine, N-methyltyrosine, N-methyl-3-chlorophenylalanine, N-methyl-4-chlorophenylalanine, N-methyl-4-methoxyphenylalanine, N-methyl-4-thiazolealanine, N-methylhistidine, N-methylserine, and N-methylaspartic acid.

[0066] Examples of substituents containing halogen atoms include fluoro(-F), chloro(-Cl), bromo(-Br), and iod(-I).

[0067] Examples of substituents containing an oxygen atom include hydroxyl (-OH), oxy (-OR), carbonyl (-C=OR), carboxyl (-CO2H), oxycarbonyl (-C=O-OR), carbonyloxy (-OC=OR), thiocarbonyl (-C=O-SR), carbonylthio (-SC=OR), aminocarbonyl (-C=O-NHR), carbonylamino (-NH-C=OR), oxycarbonylamino (-NH-C=O-OR), sulfonylamino (-NH-SO2-R), aminosulfonyl (-SO2-NHR), sulfamoylamino (-NH-SO2-NHR), thiocarboxyl (-C(=O)-SH), and carboxylcarbonyl (-C(=O)-CO2H).

[0068] Examples of oxy (-OR) compounds include alkoxy, cycloalkoxy, alkenyloxy, alkynyloxy, aryloxy, heteroaryloxy, and aralkyloxy.

[0069] Examples of carbonyl (-C=OR) include formyl (-C=OH), alkylcarbonyl, cycloalkylcarbonyl, alkenylcarbonyl, alkynylcarbonyl, arylcarbonyl, heteroarylcarbonyl, and aralkylcarbonyl.

[0070] Examples of oxycarbonyl (-C=O-OR) include alkyloxycarbonyl, cycloalkyloxycarbonyl, alkenyloxycarbonyl, alkynyloxycarbonyl, aryloxycarbonyl, heteroaryloxycarbonyl, and aralkyloxycarbonyl.

[0071] Examples of carbonyloxy (-OC=OR) include alkylcarbonyloxy, cycloalkylcarbonyloxy, alkenylcarbonyloxy, alkynylcarbonyloxy, arylcarbonyloxy, heteroarylcarbonyloxy, and aralkylcarbonyloxy.

[0072] Examples of thiocarbonyl (-C=O-SR) include alkylthiocarbonyl, cycloalkylthiocarbonyl, alkenylthiocarbonyl, alkynylthiocarbonyl, arylthiocarbonyl, heteroarylthiocarbonyl, and aralkylthiocarbonyl.

[0073] Examples of carbonylthio (-SC=OR) include alkylcarbonylthio, cycloalkylcarbonylthio, alkenylcarbonylthio, alkynylcarbonylthio, arylcarbonylthio, heteroarylcarbonylthio, and aralkylcarbonylthio.

[0074] Examples of aminocarbonyl (-C=O-NHR) include alkylaminocarbonyl, cycloalkylaminocarbonyl, alkenylaminocarbonyl, alkynylaminocarbonyl, arylaminocarbonyl, heteroarylaminocarbonyl, and aralkylaminocarbonyl. Furthermore, the hydrogen atom bonded to the nitrogen atom in the -C=O-NHR may be substituted with a substituent selected from the group consisting of alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, and aralkyl.

[0075] Examples of carbonylaminos (-NH-C=OR) include alkylcarbonylaminos, cycloalkylcarbonylaminos, alkenylcarbonylaminos, alkynylcarbonylaminos, arylcarbonylaminos, heteroarylcarbonylaminos, and aralkylcarbonylaminos. Furthermore, the hydrogen atom bonded to the nitrogen atom in the -NH-C=OR may be substituted with a substituent selected from the group consisting of alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, and aralkyl.

[0076] Examples of oxycarbonylaminos (-NH-C=O-OR) include alkoxycarbonylaminos, cycloalkoxycarbonylaminos, alkenyloxycarbonylaminos, alkynyloxycarbonylaminos, aryloxycarbonylaminos, heteroaryloxycarbonylaminos, and aralkyloxycarbonylaminos. Furthermore, the H atoms bonded to the N atoms in the -NH-C=O-OR may be substituted with substituents selected from the group consisting of alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, and aralkyl.

[0077] Examples of sulfonylaminos (-NH-SO2-R) include alkylsulfonylaminos, cycloalkylsulfonylaminos, alkenylsulfonylaminos, alkynylsulfonylaminos, arylsulfonylaminos, heteroarylsulfonylaminos, and aralkylsulfonylaminos. Furthermore, the hydrogen atom bonded to the nitrogen atom in -NH-SO2-R may be substituted with a substituent selected from the group consisting of alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, and aralkyl.

[0078] Examples of aminosulfonyl (-SO2-NHR) include alkylaminosulfonyl, cycloalkylaminosulfonyl, alkenylaminosulfonyl, alkynylaminosulfonyl, arylaminosulfonyl, heteroarylaminosulfonyl, and aralkylaminosulfonyl. Furthermore, the hydrogen atom bonded to the nitrogen atom in -SO2-NHR may be substituted with a substituent selected from the group consisting of alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, and aralkyl.

[0079] Examples of sulfamoylaminos (-NH-SO2-NHR) include alkylsulfamoylaminos, cycloalkylsulfamoylaminos, alkenylsulfamoylaminos, alkynylsulfamoylaminos, arylsulfamoylaminos, heteroarylsulfamoylaminos, and aralkylsulfamoylaminos. Furthermore, at least one of the two H atoms bonded to the N atom in -NH-SO2-NHR may be substituted with a substituent selected from the group consisting of alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, and aralkyl. If both H atoms are substituted, the substituents may be selected independently, and these two substituents may form a ring.

[0080] Examples of substituents containing a sulfur atom include thiol (-SH), thio (-SR), sulfinyl (-S=OR), sulfonyl (-S(O)2-R), and sulfo (-SO3H).

[0081] Examples of thio(-SR) include alkylthio, cycloalkylthio, alkenylthio, alkynylthio, arylthio, heteroarylthio, and aralkylthio.

[0082] Examples of sulfinyl (-S=OR) include alkylsulfinyl, cycloalkylsulfinyl, alkenylsulfinyl, alkynylsulfinyl, arylsulfinyl, heteroarylsulfinyl, and aralkylsulfinyl.

[0083] Examples of sulfonyl (-S(O)2-R) include alkylsulfonyl, cycloalkylsulfonyl, alkenylsulfonyl, alkynylsulfonyl, arylsulfonyl, heteroarylsulfonyl, and aralkylsulfonyl.

[0084] Examples of substituents containing an N atom include azide (-N3), cyano (-CN), primary amino (-NH2), secondary amino (-NH-R), tertiary amino (-NR(R')), amidino (-C(=NH)-NH2), substituted amidino (-C(=NR)-NR'R''), guanidino (-NH-C(=NH)-NH2), substituted guanidino (-NR-C(=NR''')-NR'R''), and aminocarbonylamino (-NR-CO-NR'R'').

[0085] Examples of secondary amino acids (-NH-R) include alkylaminos, cycloalkylaminos, alkenylaminos, alkynylaminos, arylaminos, heteroarylaminos, and aralkylaminos.

[0086] The two substituents R and R' on the N atom of a tertiary amino acid (-NR(R')) can be independently selected from the group consisting of alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, and aralkyl groups. Examples of tertiary amino acids include alkyl(aralkyl)aminos. These two substituents may form a ring.

[0087] In substituted amidinos (-C(=NR)-NR'R''), the three substituents R, R', and R'' on the N atom can be independently selected from the group consisting of hydrogen atoms, alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, and aralkyl. Examples of substituted amidinos include alkyl(aralkyl)(aryl)amidinos. These substituents may form rings with each other.

[0088] The four substituents R, R', R'', and R''' on the N atom of the substituted guanidino (-NR-C(=NR''')-NR'R'') can be independently selected from the group consisting of a hydrogen atom, alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, and aralkyl. These substituents may form rings with respect to each other.

[0089] The three substituents R, R', and R'' on the N atom in aminocarbonylamino(-NR-CO-NR'R'') can be independently selected from the group consisting of a hydrogen atom, alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, and aralkyl. These substituents may form a ring with respect to each other.

[0090] Examples of substituents containing a B atom include boryl (-BR(R')) and dioxyboryl (-B(OR)(OR')). The two substituents R and R' on the B atom can be independently selected from the group consisting of a hydrogen atom, alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, and aralkyl. These substituents may form a ring with respect to each other.

[0091] In some embodiments, examples of amino acids in this disclosure include nBuG (2-(butylamino)acetic acid), Pic2 ((2S)-piperidine-2-carboxylic acid), dA ((2R)-2-aminopropanoic acid), MeA3Pyr ((2S)-2-(methylamino)-3-(3-pyridyl)propanoic acid), StBuOH ((2S)-3-(2-hydroxy-2-methyl-propoxy)-2-(methylamino)propanoic acid), MeSnPr ((2S)-2-(methylamino)-3-propoxy-propanoic acid), SPh2Cl ((2S)-2-amino-3-(2-chlorophenoxy)propanoic acid), MeHph ((2S)-2-(methylamino)-4-phenyl-butanoic acid), and Ile.

[0092] Examples of amino acid analogs in this disclosure include, for example, hydroxycarboxylic acids (hydroxy acids). Hydroxycarboxylic acids include α-hydroxycarboxylic acids, β-hydroxycarboxylic acids, γ-hydroxycarboxylic acids, etc. The α-carbon in a hydroxycarboxylic acid may have a side chain other than a hydrogen atom bonded to it, similar to amino acids. Both L-type and D-type stereostructures are possible. The structure of the side chain can be defined in the same way as the side chains of the natural or unnatural amino acids described above. Examples of hydroxycarboxylic acids include hydroxyacetic acid, lactic acid, and phenyllactic acid.

[0093] In this disclosure, amino acids may be translatable amino acids, and amino acid analogs may be translatable amino acid analogs. In this specification, "translatable" amino acids or amino acid analogs (sometimes collectively referred to as amino acids, etc.) mean amino acids, etc. that can be incorporated into peptides by translation synthesis (for example, using the translation system described in this disclosure). Whether an amino acid, etc. is translatable can be confirmed by a translation synthesis experiment using tRNA to which the amino acid, etc. is bound. A reconstituted cell-free translation system may be used for the translation synthesis experiment (see, for example, WO2013100132).

[0094] The non-natural amino acids and amino acid analogs in this disclosure can be prepared by conventionally known chemical synthesis methods, the synthesis methods described in the examples below, or similar synthesis methods.

[0095] In some embodiments, the tRNA of the Disclosure can read out codons represented by M1M2A and M1M2G and translate each of these codons into a different amino acid or amino acid analog. In some embodiments, the tRNA of the Disclosure can read out codons represented by M1M2U, M1M2A, and M1M2G and translate each of these codons into a different amino acid or amino acid analog. In some embodiments, the tRNA of the Disclosure can read out codons represented by M1M2C, M1M2A, and M1M2G and translate each of these codons into a different amino acid or amino acid analog. Here, the first nucleoside (M1) and the second nucleoside (M2) of the codon are independently selected from adenosine (A), guanosine (G), cytidine (C), and uridine (U). In another embodiment, the tRNA of the Disclosure has anticodons complementary to a specific codon represented by M1M2A and a specific codon represented by M1M2G. In yet another embodiment, the tRNA of the Disclosure has anticodons complementary to a specific codon represented by M1M2U, a specific codon represented by M1M2A, and a specific codon represented by M1M2G. In yet another embodiment, the tRNA of the Disclosure has anticodons complementary to a specific codon represented by M1M2C, a specific codon represented by M1M2A, and a specific codon represented by M1M2G. In a further embodiment, the third nucleoside (N3) and the second nucleoside (N2) of the anticodon in the tRNA can be selected as nucleosides complementary to M1 and M2, respectively, and N2 and N3 can each be independently selected from adenosine (A), guanosine (G), cytidine (C), and uridine (U). Specifically, when M2 (or M1) is adenosine, N2 (or N3) is uridine. When M2 (or M1) is guanosine, N2 (or N3) is cytidine. When M2 (or M1) is cytidine, N2 (or N3) is guanosine. When M2 (or M1) is uridine, N2 (or N3) is adenosine.

[0096] In the context of this disclosure, the expression "a tRNA is capable of translating a particular codon" essentially encompasses the expression "a tRNA has an anticodon complementary to a particular codon," and these expressions are interchangeable insofar as they refer to the sequence of the anticodon on the tRNA.

[0097] The first nucleoside (M1) and second nucleoside (M2) of the translatable codons of the tRNA constituting the translation system in this disclosure can be selected from the first nucleoside (M1) and second nucleoside (M2) of the codons constituting a particular codon box in the genetic code table, respectively. In a particular embodiment, the genetic code table is a standard genetic code table. In another embodiment, the genetic code table is a natural genetic code table.

[0098] In another embodiment, M1 and M2 in this disclosure can be selected from codon boxes in the natural genetic code table where a stop codon is assigned to the codon represented by M1M2A and an amino acid is assigned to the codon represented by M1M2G. In another embodiment, M1 and M2 in this disclosure can be selected from codon boxes in the natural genetic code table where both the codon represented by M1M2A and the codon represented by M1M2G are assigned to stop codons. In some embodiments, translation systems whose genetic code table is identical to that of the natural genetic code table are excluded from the translation systems in this disclosure. In some embodiments, translation systems whose genetic code table is identical to that of the genetic code table listed in Table 1 are excluded from the translation systems in this disclosure.

[0099] In one embodiment, M1 and M2 can be selected from the codons that constitute a codon box in which the codon whose third letter is A and the codon whose third letter is G both code for the same amino acid. For example, in a codon box represented by UUM3, the codon whose third letter is A (UUA) and the codon whose third letter is G (UUG) both code for the same amino acid (Leu), so the first nucleoside (U) and the second nucleoside (U) of the codons that constitute the same codon box can be selected as M1 and M2, respectively.

[0100] In one embodiment, M1 and M2 can be selected from the codons that constitute a codon box in which the codon whose third letter is U and the codon whose third letter is A both code for the same amino acid. For example, in a codon box represented by AUM3, the codon whose third letter is U (AUU) and the codon whose third letter is A (AUA) both code for the same amino acid (Ile), so the first nucleoside (A) and the second nucleoside (U) of the codons that constitute the same codon box can be selected as M1 and M2, respectively.

[0101] In one embodiment, M1 and M2 can be selected from the codons that constitute a codon box in which the codon whose third letter is A and the codon whose third letter is G code for different amino acids. For example, in a codon box represented by AUM3, the codon whose third letter is A (AUA) and the codon whose third letter is G (AUG) code for different amino acids (Ile and Met), so the first nucleoside (A) and the second nucleoside (U) of the codons that constitute the same codon box can be selected as M1 and M2, respectively.

[0102] In one embodiment, M1 and M2 can be selected from the codons that constitute a codon box in which the third character is A and / or the third character is G, respectively. For example, in a codon box represented by UGM3, the third character is A (UGA), which is the stop codon (opal), so the first nucleoside (U) and the second nucleoside (G) of the codons that constitute the same codon box can be selected as M1 and M2, respectively.

[0103] In a further embodiment, M1 and M2 may be selected from the M1 and M2 of codons that constitute a codon box represented by UUM3, respectively. Specifically, the first nucleoside (U) and the second nucleoside (U) of the codon can be selected as M1 and M2, respectively.

[0104] In a further embodiment, M1 and M2 may be selected from the M1 and M2 of the codons that constitute the codon box represented by UAM3, respectively. Specifically, the first nucleoside (U) and the second nucleoside (A) of the codon can be selected as M1 and M2, respectively.

[0105] In a further embodiment, M1 and M2 may be selected from the M1 and M2 of codons that constitute a codon box represented by UGM3, respectively. Specifically, the first nucleoside (U) and the second nucleoside (G) of the codon can be selected as M1 and M2, respectively.

[0106] In a further embodiment, M1 and M2 may be selected from the M1 and M2 of the codons that constitute the codon box represented by CAM3, respectively. Specifically, the first nucleoside (C) and the second nucleoside (A) of the codon can be selected as M1 and M2, respectively.

[0107] In a further embodiment, M1 and M2 may be selected from the M1 and M2 of codons that constitute a codon box represented by CGM3, respectively. Specifically, the first nucleoside (C) and the second nucleoside (G) of the codon can be selected as M1 and M2, respectively.

[0108] In a further embodiment, M1 and M2 may be selected from the M1 and M2 of codons that constitute a codon box represented by AUM3, respectively. Specifically, the first nucleoside (A) and the second nucleoside (U) of the codon can be selected as M1 and M2, respectively.

[0109] In a further embodiment, M1 and M2 may be selected from the M1 and M2 of codons that constitute a codon box represented by ACM3, respectively. Specifically, the first nucleoside (A) and the second nucleoside (C) of the codon can be selected as M1 and M2, respectively.

[0110] In a further embodiment, M1 and M2 may be selected from the M1 and M2 of the codons that constitute the codon box represented by AAM3, respectively. Specifically, the first nucleoside (A) and the second nucleoside (A) of the codon can be selected as M1 and M2, respectively.

[0111] In a further embodiment, M1 and M2 may be selected from the M1 and M2 of codons that constitute a codon box represented by AGM3, respectively. Specifically, the first nucleoside (A) and the second nucleoside (G) of the codon can be selected as M1 and M2, respectively.

[0112] In a further embodiment, M1 and M2 may be selected from the M1 and M2 of codons that constitute a codon box represented by GAM3, respectively. Specifically, the first nucleoside (G) and the second nucleoside (A) of the codon can be selected as M1 and M2, respectively.

[0113] The third nucleoside (N3) and the second nucleoside (N2) of the anticodon in the tRNA disclosed herein can be selected as nucleosides complementary to M1 and M2, respectively.

[0114] In one embodiment, N3 and N2 can be selected as nucleosides complementary to the first nucleoside (U) and the second nucleoside (U) of the codon that constitutes the codon box represented by UUM3, respectively. Specifically, A can be selected as N3 and A as N2.

[0115] In one embodiment, N3 and N2 can be selected as nucleosides complementary to the first nucleoside (U) and the second nucleoside (A) of the codon that constitutes the codon box represented by UAM3, respectively. Specifically, A can be selected as N3 and U as N2.

[0116] In one embodiment, N3 and N2 can be selected as nucleosides complementary to the first nucleoside (U) and the second nucleoside (G) of the codon that constitutes the codon box represented by UGM3, respectively. Specifically, A can be selected as N3 and C as N2.

[0117] In one embodiment, N3 and N2 can be selected as nucleosides complementary to the first nucleoside (C) and the second nucleoside (A) of the codon that constitutes the codon box represented by CAM3, respectively. Specifically, G can be selected as N3 and U as N2.

[0118] In one embodiment, N3 and N2 can be selected as nucleosides complementary to the first nucleoside (C) and the second nucleoside (G) of the codon that constitutes the codon box represented by CGM3, respectively. Specifically, G can be selected as N3 and C as N2.

[0119] In one embodiment, N3 and N2 can be selected as nucleosides complementary to the first nucleoside (A) and the second nucleoside (U) of the codon that constitutes the codon box represented by AUM3, respectively. Specifically, U can be selected as N3 and A as N2.

[0120] In one embodiment, N3 and N2 can be selected as nucleosides complementary to the first nucleoside (A) and the second nucleoside (C) of the codon that constitutes the codon box represented by ACM3, respectively. Specifically, U can be selected as N3 and G as N2.

[0121] In one embodiment, N3 and N2 can be selected as nucleosides complementary to the first nucleoside (A) and the second nucleoside (A) in the codon that constitutes the codon box represented by AAM3, respectively. Specifically, U can be selected as N3 and U as N2.

[0122] In one embodiment, N3 and N2 can be selected as nucleosides complementary to the first nucleoside (A) and the second nucleoside (G) of the codon that constitutes the codon box represented by AGM3, respectively. Specifically, U can be selected as N3 and C as N2.

[0123] In one embodiment, N3 and N2 can be selected as nucleosides complementary to the first nucleoside (G) and the second nucleoside (A) of the codon that constitutes the codon box represented by GAM3, respectively. Specifically, C can be selected as N3 and U as N2.

[0124] In some embodiments, a tRNA having an anticodon complementary to the codon represented by M1M2A in this disclosure can selectively translate the codon represented by M1M2A compared to other codons. These other codons may be different codons from the one represented by M1M2A, such as M1M2U, M1M2C, or M1M2G. In certain embodiments, a tRNA having an anticodon complementary to the codon represented by M1M2A in this disclosure can selectively translate the codon represented by M1M2A compared to any of the codons represented by M1M2U, M1M2C, and M1M2G.

[0125] In one aspect of this disclosure, the ability of a tRNA to selectively translate M1M2A codons means that the amount of M1M2A codons translated by the tRNA is, for example, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 15 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or 100 times greater than the amount of other codons translated by the tRNA. For example, whether a certain tRNA can selectively translate the codon represented by CUA can be determined by whether the amount of CUA codon translated by the tRNA is, for example, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 15 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or 100 times greater than the amount of CUG codon translated by the tRNA.

[0126] When comparing the amount of a specific codon (e.g., M1M2A) translated with the amount of other codons (e.g., M1M2G) translated, one can, for example, prepare an mRNA encoding a peptide that contains the M1M2A codon, and another mRNA that has the same nucleic acid sequence as the first mRNA except that the M1M2A codon is replaced with the M1M2G codon. These two mRNAs are then translated under the same conditions, and the resulting amounts of the two synthesized peptides are compared.

[0127] In another embodiment, the codon represented by M1M2A may be selectively translated by a tRNA having an anticodon complementary to the codon represented by M1M2A in this disclosure, rather than by other tRNAs. These other tRNAs may be tRNAs having an anticodon complementary to a codon different from the codon represented by M1M2A, such as a tRNA having an anticodon complementary to any of the codons M1M2U, M1M2C, or M1M2G. In a particular embodiment, the codon represented by M1M2A may be selectively translated by a tRNA having an anticodon complementary to the codon M1M2A in this disclosure, rather than by any of the tRNAs having an anticodon complementary to the codon M1M2U, the M1M2C, or the M1M2G.

[0128] In one aspect of this disclosure, the ability of a codon represented by M1M2A to be selectively translated by a certain tRNA means that the amount of M1M2A codon translated by that tRNA is, for example, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 15 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or 100 times greater than the amount of M1M2A codon translated by other tRNAs. For example, whether a codon represented by CUA can be selectively translated by a certain tRNA can be determined by whether the amount of CUA codon translated by that tRNA is, for example, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 15 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or 100 times greater than the amount of CUA codon translated by a tRNA having an anticodon complementary to the CUG codon (for example, a tRNA having an anticodon for CAG).

[0129] The translation system of this disclosure may have both of the above characteristics. That is, in a particular embodiment, in the translation system of this disclosure, (i) a tRNA having an anticodon complementary to the codon represented by M1M2A can selectively translate the codon represented by M1M2A compared to other codons, and (ii) the codon represented by M1M2A can be selectively translated by tRNA having an anticodon complementary to the codon represented by M1M2A compared to other tRNAs. When such a relationship holds, in the translation system of this disclosure, peptide translation using tRNA having an anticodon complementary to the codon represented by M1M2A and peptide translation using other tRNAs are in an independent relationship that does not interact with each other, i.e., an orthogonal relationship. In translation systems of naturally occurring organisms, a strict correspondence relationship is originally established between codons and amino acids, so the addition of tRNAs that are not orthogonal can disrupt this correspondence relationship and may have a fatal effect on the function of the translation system. Therefore, in the translation system of this disclosure, the establishment of orthogonality between tRNAs having anticodons complementary to the codons represented by M1M2A and other tRNAs can be considered one of its important features.

[0130] In one embodiment, the translation system in this disclosure comprises at least two tRNAs: (a) a tRNA having an anticodon complementary to the codon represented by M1M2A, and (b) a tRNA having an anticodon complementary to the codon represented by M1M2G. The tRNAs having an anticodon complementary to the codon represented by M1M2A and the tRNAs having an anticodon complementary to the codon represented by M1M2G in this disclosure may have identical or different nucleic acid sequences other than the anticodon. If the nucleic acid sequences other than the anticodon are identical, the physicochemical properties of these two tRNAs may be similar to each other, which may allow for the construction of a more homogeneous and stable translation system.

[0131] In some embodiments, a tRNA having an anticodon complementary to the codon represented by M1M2G in this disclosure can selectively translate the codon represented by M1M2G compared to other codons. These other codons may be different from the codon represented by M1M2G, such as M1M2U, M1M2C, or M1M2A. In certain embodiments, a tRNA having an anticodon complementary to the codon represented by M1M2G in this disclosure can selectively translate the codon represented by M1M2G compared to any of the codons represented by M1M2U, M1M2C, and M1M2A.

[0132] In one aspect of this disclosure, the ability of a tRNA to selectively translate M1M2G codons means that the amount of M1M2G codons translated by the tRNA is, for example, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 15 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or 100 times greater than the amount of other codons translated by the tRNA. For example, whether a certain tRNA can selectively translate codons represented by CUG can be determined by whether the amount of CUG codons translated by the tRNA is, for example, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 15 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or 100 times greater than the amount of CUA codons translated by the tRNA.

[0133] In another embodiment, the codon represented by M1M2G may be selectively translated by a tRNA having an anticodon complementary to the codon represented by M1M2G in this disclosure, rather than by other tRNAs. These other tRNAs may be tRNAs having an anticodon complementary to a codon different from the codon represented by M1M2G, such as a tRNA having an anticodon complementary to any of the codons M1M2U, M1M2C, or M1M2A. In a particular embodiment, the codon represented by M1M2G may be selectively translated by a tRNA having an anticodon complementary to the codon M1M2G in this disclosure, rather than by any of the tRNAs having an anticodon complementary to the codon M1M2U, the M1M2C, or the M1M2A.

[0134] In one aspect of this disclosure, the ability of a codon represented by M1M2G to be selectively translated by a certain tRNA means that the amount of M1M2G codon translated by that tRNA is, for example, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 15 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or 100 times greater than the amount of M1M2G codon translated by other tRNAs. For example, whether a codon represented by CUG can be selectively translated by a certain tRNA can be determined by whether the amount of CUG codon translated by that tRNA is, for example, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 15 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or 100 times greater than the amount of CUG codon translated by a tRNA having an anticodon complementary to the CUA codon (for example, a tRNA having an anticodon for UAG).

[0135] The translation system of this disclosure may have both of the above characteristics. That is, in a particular embodiment, in the translation system of this disclosure, (i) a tRNA having an anticodon complementary to the codon represented by M1M2G can selectively translate the codon represented by M1M2G compared to other codons, and (ii) the codon represented by M1M2G can be selectively translated by tRNA having an anticodon complementary to the codon represented by M1M2G compared to other tRNAs. When such a relationship holds, in the translation system of this disclosure, peptide translation using tRNA having an anticodon complementary to the codon represented by M1M2G and peptide translation using other tRNAs can be said to be in an independent relationship, i.e., orthogonal, where they do not interact with each other. The establishment of orthogonality between tRNA having an anticodon complementary to the codon represented by M1M2G and other tRNAs in the translation system of this disclosure can be an important characteristic.

[0136] In a further embodiment, the amino acid bound to the tRNA having an anticodon complementary to the codon represented by M1M2A in this disclosure (hereinafter also referred to as "amino acid-A") and the amino acid bound to the tRNA having an anticodon complementary to the codon represented by M1M2G (hereinafter also referred to as "amino acid-G") are of different types. When the orthogonal relationship described above holds for the tRNA having an anticodon complementary to the codon represented by M1M2A and the tRNA having an anticodon complementary to the codon represented by M1M2G in this disclosure, there is a one-to-one correspondence between the M1M2A codon and amino acid-A, and between the M1M2G codon and amino acid-G in this translation system. That is, in the translation system of this disclosure, it is possible to translate two different types of amino acids from two codons, (i) M1M2A and (ii) M1M2G, that exist within the same codon box.

[0137] In one embodiment, the translation system in this disclosure comprises at least three tRNAs: (a) a tRNA having an anticodon complementary to the codon represented by M1M2A, (b) a tRNA having an anticodon complementary to the codon represented by M1M2G, and (c) a tRNA having an anticodon complementary to the codon represented by M1M2U. The tRNAs having an anticodon complementary to the codon represented by M1M2A, the tRNA having an anticodon complementary to the codon represented by M1M2G, and the tRNA having an anticodon complementary to the codon represented by M1M2U in this disclosure may have identical nucleic acid sequences other than the anticodon, or they may be different from each other. If the nucleic acid sequences other than the anticodon are identical, the physicochemical properties of these three tRNAs may be similar to each other, which may allow for the construction of a more homogeneous and stable translation system.

[0138] In some embodiments, a tRNA having an anticodon complementary to the codon represented by M1M2U in this disclosure can selectively translate the codon represented by M1M2U compared to other codons. These other codons may be different from the codon represented by M1M2U, for example, the codons represented by M1M2A or M1M2G. In certain embodiments, a tRNA having an anticodon complementary to the codon represented by M1M2U in this disclosure can selectively translate the codon represented by M1M2U compared to either the codon represented by M1M2A or M1M2G.

[0139] In one aspect of this disclosure, the ability of a tRNA to selectively translate M1M2U codons means that the amount of M1M2U codons translated by the tRNA is, for example, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 15 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or 100 times greater than the amount of other codons translated by the tRNA. For example, whether a certain tRNA can selectively translate codons represented by CUU can be determined by whether the amount of CUU codons translated by the tRNA is, for example, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 15 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or 100 times greater than the amount of CUA codons translated by the tRNA.

[0140] In another embodiment, the codon represented by M1M2U may be selectively translated by a tRNA having an anticodon complementary to the codon represented by M1M2U in this disclosure, rather than by other tRNAs. These other tRNAs may be tRNAs having an anticodon complementary to a codon different from the codon represented by M1M2U, such as a tRNA having an anticodon complementary to either the M1M2A or M1M2G codon. In a particular embodiment, the codon represented by M1M2U may be selectively translated by a tRNA having an anticodon complementary to the M1M2U codon in this disclosure, rather than by a tRNA having an anticodon complementary to the M1M2A codon or a tRNA having an anticodon complementary to the M1M2G codon.

[0141] In one aspect of this disclosure, the ability of a codon represented by M1M2U to be selectively translated by a certain tRNA means that the amount of M1M2U codon translated by that tRNA is, for example, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 15 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or 100 times greater than the amount of M1M2U codon translated by other tRNAs. For example, whether a codon represented by CUU can be selectively translated by a certain tRNA can be determined by whether the amount of CUU codon translated by that tRNA is, for example, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 15 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or 100 times greater than the amount of CUU codon translated by a tRNA having an anticodon complementary to the CUA codon (for example, a tRNA having an anticodon of UAG).

[0142] The translation system of this disclosure may have both of the above characteristics. That is, in a particular embodiment, in the translation system of this disclosure, (i) a tRNA having an anticodon complementary to the codon represented by M1M2U can selectively translate the codon represented by M1M2U compared to other codons, and (ii) the codon represented by M1M2U can be selectively translated by tRNA having an anticodon complementary to the codon represented by M1M2U compared to other tRNAs. When such a relationship holds, in the translation system of this disclosure, peptide translation using tRNA having an anticodon complementary to the codon represented by M1M2U and peptide translation using other tRNAs are in an independent relationship that does not interact with each other, i.e., an orthogonal relationship. The establishment of orthogonality between tRNA having an anticodon complementary to the codon represented by M1M2U and other tRNAs in the translation system of this disclosure can be one of its important characteristics.

[0143] In a further embodiment, the amino acids bound to the tRNA having an anticodon complementary to the codon represented by M1M2A in this disclosure ("amino acid-A"), the amino acids bound to the tRNA having an anticodon complementary to the codon represented by M1M2G ("amino acid-G"), and the amino acids bound to the tRNA having an anticodon complementary to the codon represented by M1M2U (hereinafter, this amino acid will also be referred to as "amino acid-U") are all different types of amino acids. When the orthogonal relationships described above hold true for the tRNA having an anticodon complementary to the codon represented by M1M2A, the tRNA having an anticodon complementary to the codon represented by M1M2G, and the tRNA having an anticodon complementary to the codon represented by M1M2U in this disclosure, there is a one-to-one correspondence between the codon of M1M2A and amino acid-A, the codon of M1M2G and amino acid-G, and the codon of M1M2U and amino acid-U in this translation system. In other words, the translation system of this disclosure can translate three different amino acids from three codons located within the same codon box: (i) M1M2A, (ii) M1M2G, and (iii) M1M2U. Alternatively, the translation system of this disclosure can translate three different amino acids from a codon box composed of M1M2U, M1M2C, M1M2A, and M1M2G.

[0144] In one embodiment, the translation system in this disclosure comprises at least three tRNAs: (a) a tRNA having an anticodon complementary to the codon represented by M1M2A, (b) a tRNA having an anticodon complementary to the codon represented by M1M2G, and (c) a tRNA having an anticodon complementary to the codon represented by M1M2C. The tRNAs having an anticodon complementary to the codon represented by M1M2A, the tRNA having an anticodon complementary to the codon represented by M1M2G, and the tRNA having an anticodon complementary to the codon represented by M1M2C in this disclosure may have identical nucleic acid sequences other than the anticodon, or they may be different from each other. If the nucleic acid sequences other than the anticodon are identical, the physicochemical properties of these three tRNAs may be similar to each other, which may allow for the construction of a more homogeneous and stable translation system.

[0145] In some embodiments, a tRNA having an anticodon complementary to the codon represented by M1M2C in this disclosure can selectively translate the codon represented by M1M2C compared to other codons. These other codons may be different from the codon represented by M1M2C, for example, the codon represented by M1M2A or M1M2G. In certain embodiments, a tRNA having an anticodon complementary to the codon represented by M1M2C in this disclosure can selectively translate the codon represented by M1M2C compared to either the codon represented by M1M2A or M1M2G.

[0146] In one aspect of this disclosure, the ability of a tRNA to selectively translate M1M2C codons means that the amount of M1M2C codons translated by the tRNA is, for example, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 15 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or 100 times greater than the amount of other codons translated by the tRNA. For example, whether a certain tRNA can selectively translate codons represented by CUC can be determined by whether the amount of CUC codons translated by the tRNA is, for example, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 15 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or 100 times greater than the amount of CUA codons translated by the tRNA.

[0147] In another embodiment, the codon represented by M1M2C may be selectively translated by a tRNA having an anticodon complementary to the codon represented by M1M2C in this disclosure, rather than by other tRNAs. These other tRNAs may be tRNAs having an anticodon complementary to a codon different from the codon represented by M1M2C, such as a tRNA having an anticodon complementary to either the M1M2A or M1M2G codon. In a particular embodiment, the codon represented by M1M2C may be selectively translated by a tRNA having an anticodon complementary to the M1M2C codon in this disclosure, rather than by a tRNA having an anticodon complementary to the M1M2A codon or a tRNA having an anticodon complementary to the M1M2G codon.

[0148] In one aspect of this disclosure, the ability of a codon represented by M1M2C to be selectively translated by a certain tRNA means that the amount of M1M2C codon translated by that tRNA is, for example, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 15 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or 100 times greater than the amount of M1M2C codon translated by other tRNAs. For example, whether a codon represented by CUC can be selectively translated by a certain tRNA can be determined by whether the amount of CUC codon translated by that tRNA is, for example, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 15 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or 100 times greater than the amount of CUC codon translated by a tRNA having an anticodon complementary to the CUA codon (for example, a tRNA having an anticodon of UAG).

[0149] The translation system of this disclosure may have both of the above characteristics. That is, in a particular embodiment, in the translation system of this disclosure, (i) a tRNA having an anticodon complementary to the codon represented by M1M2C can selectively translate the codon represented by M1M2C compared to other codons, and (ii) the codon represented by M1M2C can be selectively translated by tRNA having an anticodon complementary to the codon represented by M1M2C compared to other tRNAs. When such a relationship holds, in the translation system of this disclosure, peptide translation using tRNA having an anticodon complementary to the codon represented by M1M2C and peptide translation using other tRNAs are in an independent relationship that does not interact with each other, i.e., an orthogonal relationship. The establishment of orthogonality between tRNA having an anticodon complementary to the codon represented by M1M2C and other tRNAs in the translation system of this disclosure can be an important characteristic.

[0150] In a further embodiment, the amino acid bound to the tRNA having an anticodon complementary to the codon represented by M1M2A in this disclosure ("amino acid-A"), the amino acid bound to the tRNA having an anticodon complementary to the codon represented by M1M2G ("amino acid-G"), and the amino acid bound to the tRNA having an anticodon complementary to the codon represented by M1M2C (hereinafter, this amino acid will also be referred to as "amino acid-C") are all different types of amino acids. When the above-described orthogonal relationships hold with respect to the tRNA having an anticodon complementary to the codon represented by M1M2A, the tRNA having an anticodon complementary to the codon represented by M1M2G, and the tRNA having an anticodon complementary to the codon represented by M1M2C in this disclosure, there is a one-to-one correspondence between the codon of M1M2A and amino acid-A, the codon of M1M2G and amino acid-G, and the codon of M1M2C and amino acid-C in this translation system. In other words, the translation system of this disclosure can translate three different amino acids from three codons located within the same codon box: (i) M1M2A, (ii) M1M2G, and (iii) M1M2C. Alternatively, the translation system of this disclosure can translate three different amino acids from a codon box composed of M1M2U, M1M2C, M1M2A, and M1M2G.

[0151] In some embodiments, at least one of the tRNAs having an anticodon complementary to the codon represented by M1M2A, tRNAs having an anticodon complementary to the codon represented by M1M2G, tRNAs having an anticodon complementary to the codon represented by M1M2U, and tRNAs having an anticodon complementary to the codon represented by M1M2C may have a non-natural amino acid bound to it.

[0152] In some embodiments, the tRNA of this disclosure may be assigned to a codon constituting at least one codon box in the genetic code table. In a further embodiment, the tRNA of this disclosure may be assigned to codons constituting multiple codon boxes in the genetic code table. The multiple codon boxes can be, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 codon boxes. Which codon box each tRNA is assigned to is determined by the second nucleoside (N2) and third nucleoside (N3) of the anticodon that the tRNA has. tRNAs assigned to codons constituting different codon boxes will have different N2 and N3 values. Furthermore, tRNAs assigned to codons constituting different codon boxes may have identical or different nucleic acid sequences other than the anticodon. If the nucleic acid sequences other than the anticodon are identical, the physicochemical properties of these tRNAs may be similar to each other, potentially leading to the construction of a more homogeneous and stable translation system.

[0153] In certain embodiments, the tRNA of this disclosure may be assigned to a codon constituting at least one codon box selected from (i) to (x) below in the genetic code table. In further embodiments, the tRNA of this disclosure may be assigned to a codon constituting at least two, three, four, five, six, seven, eight, nine, or ten codon boxes selected from (i) to (x) below in the genetic code table. (i) Codon boxes where the codon is represented by UUM3, (ii) A codon box in which the codon is represented by UAM3, (iii) Codon box where the codon is represented by UGM3, (iv) Codon box where the codon is represented by CAM3, (v) Codon box where the codon is represented by CGM3, (vi) Codon boxes where the codon is represented by AUM3, (vii) Codon boxes where the codon is represented by ACM3, (viii) A codon box where the codon is represented as AAM3, (ix) Codon box where the codon is represented by AGM3, (x) A codon box represented by GAM3.

[0154] In certain embodiments, the tRNA of this disclosure may be assigned to a codon constituting at least one codon box selected from (i) to (vii) below in the genetic code table. In further embodiments, the tRNA of this disclosure may be assigned to codons constituting at least two, three, four, five, six, or seven codon boxes selected from (i) to (vii) below in the genetic code table. (i) Codon boxes where the codon is represented by UUM3, (ii) Codon boxes where the codon is represented by UGM3, (iii) Codon box where the codon is represented by CAM3, (iv) Codon box where the codon is represented by CGM3, (v) Codon box where the codon is represented as AAM3, (vi) Codon boxes where the codon is represented by AGM3, (vii) A codon box represented by GAM3.

[0155] In some embodiments, any tRNA can be assigned to the codons constituting the remaining codon boxes to which the tRNA of the Disclosure was not assigned. Preferably, a set of any tRNAs capable of translating each codon into some amino acid is assigned to the codons constituting the remaining codon boxes. Such a set of tRNAs may be derived from natural tRNAs or may be artificially synthesized tRNAs.

[0156] In some embodiments, the translation system of this disclosure can translate one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, or twenty types of amino acids or amino acid analogs. Alternatively, by using the tRNA of this disclosure to read out the M1M2A and M1M2G codons, the M1M2U, M1M2A and M1M2G codons, or the M1M2C, M1M2A and M1M2G codons in a single codon box, it is possible to translate more than twenty types of amino acids or amino acid analogs. In a further embodiment, the translation system of this disclosure can translate, for example, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, or 48 types of amino acids or amino acid analogs.

[0157] In some embodiments, the translation system of this disclosure is a cell-free translation system. In further embodiments, the translation system of this disclosure is a reconstituted cell-free translation system. Cell extracts and factors necessary for peptide translation in the cell-free translation system (e.g., ribosomes) can be derived from various biological materials. Examples of such biological materials include Escherichia coli, yeast, wheat germ, rabbit reticulocytes, HeLa cells, or insect cells. In some embodiments, the cell-free translation system of this disclosure includes ribosomes derived from Escherichia coli.

[0158] In some embodiments, the translation system of this disclosure may contain tRNA per codon (tRNA corresponding to each codon) at concentrations within a range that can be specified by a lower limit selected from the group consisting of 0.8 μM, 1.6 μM, 2.4 μM, 3.2 μM, 4.0 μM, 4.8 μM, 5.6 μM, 6.4 μM, and 10 μM, and an upper limit selected from the group consisting of 100 μM, 150 μM, 200 μM, 250 μM, 300 μM, 350 μM, 400 μM, 450 μM, 500 μM, 550 μM, 600 μM, 650 μM, 700 μM, 750 μM, 800 μM, 850 μM, 900 μM, 950 μM, and 1000 μM. Specifically, for example, it can be included at a concentration of 0.8 to 1000 μM, preferably 1.6 to 500 μM, more preferably 3.2 to 250 μM, even more preferably 6.4 to 150 μM, and particularly preferably 10 to 100 μM.

[0159] In certain embodiments, the codon in the translation system of the disclosure is a codon in which M1 is uridine (U) and M2 is uridine (U). That is, the tRNA of the disclosure can be assigned to a codon box represented by the codon UUM3. By using the translation system containing the tRNA of the disclosure, two amino acids can be selectively translated from the codon combinations UUA and UUG. Alternatively, three amino acids can be selectively translated from the codon combinations UUU, UUA, UUG, or UUC, UUA, UUG. In order to selectively translate these codons, it is preferable to use an artificially synthesized tRNA (e.g., transcriptionally synthesized tRNA) as the tRNA of the disclosure. In that case, in addition to using the sequence of a natural tRNA, it is also possible to use a sequence derived from any tRNA (e.g., tRNA(Glu), tRNA(AsnE2), tRNA(Asp), etc.) in the portion other than the anticodon, and ligate the desired anticodon sequence thereto. The tRNAs of this disclosure preferably consist only of four nucleosides, including the anticodon portion: adenosine (A), guanosine (G), cytidine (C), and uridine (U), and it is desirable that they do not contain any other modified nucleosides. A cell-free translation system, particularly a reconstituted cell-free translation system, is preferred as the translation system for this disclosure. When aminoacylating each tRNA, it is preferable to attach the amino acids outside the translation system, and preferred methods for this include, for example, the pCpA method, the pdCpA method, a method using an artificial RNA catalyst (flexizyme), or a method using aminoacyl-tRNA synthetase (ARS). Both natural and unnatural amino acids can be used as the amino acids attached to each tRNA, but it is preferable from the viewpoint of the purpose of this disclosure to use unnatural amino acids that are not included in the natural genetic code table. The concentration of the tRNAs of this disclosure per codon in the translation system is preferably, for example, in the range of 0.8 to 1000 μM.

[0160] In certain embodiments, the codon in the translation system of the disclosure is a codon in which M1 is uridine (U) and M2 is adenosine (A). That is, the tRNA of the disclosure can be assigned to a codon box represented by the codon UAM3. By using the translation system containing the tRNA of the disclosure, two amino acids can be selectively translated from the codon combinations UAA and UAG. Alternatively, three amino acids can be selectively translated from the codon combinations UAU, UAA, and UAG, or UAC, UAA, and UAG. It is preferable to use an artificially synthesized tRNA (e.g., transcriptionally synthesized tRNA) as the tRNA of the disclosure. In this case, in addition to using the sequence of a natural tRNA, it is also possible to use a sequence derived from any tRNA (e.g., tRNA(Glu), tRNA(AsnE2), tRNA(Asp), etc.) in the portion other than the anticodon, and ligate the desired anticodon sequence thereto. The tRNAs of this disclosure preferably consist only of four nucleosides, including the anticodon portion: adenosine (A), guanosine (G), cytidine (C), and uridine (U), and it is desirable that they do not contain any other modified nucleosides. A cell-free translation system, particularly a reconstituted cell-free translation system, is preferred as the translation system for this disclosure. When aminoacylating each tRNA, it is preferable to attach the amino acids outside the translation system, and preferred methods for this include, for example, the pCpA method, the pdCpA method, a method using an artificial RNA catalyst (flexizyme), or a method using aminoacyl-tRNA synthetase (ARS). Both natural and unnatural amino acids can be used as the amino acids attached to each tRNA, but it is preferable from the viewpoint of the purpose of this disclosure to use unnatural amino acids that are not included in the natural genetic code table. The concentration of the tRNAs of this disclosure per codon in the translation system is preferably, for example, in the range of 0.8 to 1000 μM.

[0161] In certain embodiments, the codon in the translation system of the present disclosure is a codon in which M1 is uridine (U) and M2 is guanosine (G). That is, the tRNA of the present disclosure can be assigned to a codon box represented by the codon UGM3. By using the translation system containing the tRNA of the present disclosure, two amino acids can be selectively translated from the UGA and UGG codon combinations. Alternatively, three amino acids can be selectively translated from the UGU, UGA, UGG codon combination, or the UGC, UGA, UGG codon combination. It is preferable to use an artificially synthesized tRNA (e.g., transcriptionally synthesized tRNA) as the tRNA of the present disclosure. In that case, in addition to using the sequence of a natural tRNA, it is also possible to use a sequence derived from any tRNA (e.g., tRNA(Glu), tRNA(AsnE2), tRNA(Asp), etc.) in the portion other than the anticodon, and ligate the desired anticodon sequence thereto. The tRNAs of this disclosure preferably consist only of four nucleosides, including the anticodon portion: adenosine (A), guanosine (G), cytidine (C), and uridine (U), and it is desirable that they do not contain any other modified nucleosides. A cell-free translation system, particularly a reconstituted cell-free translation system, is preferred as the translation system for this disclosure. When aminoacylating each tRNA, it is preferable to attach the amino acids outside the translation system, and preferred methods for this include, for example, the pCpA method, the pdCpA method, a method using an artificial RNA catalyst (flexizyme), or a method using aminoacyl-tRNA synthetase (ARS). Both natural and unnatural amino acids can be used as the amino acids attached to each tRNA, but it is preferable from the viewpoint of the purpose of this disclosure to use unnatural amino acids that are not included in the natural genetic code table. The concentration of the tRNAs of this disclosure per codon in the translation system is preferably, for example, in the range of 0.8 to 1000 μM.

[0162] In certain embodiments, the codon in the translation system of the present disclosure is a codon in which M1 is cytidine (C) and M2 is adenosine (A). That is, the tRNA of the present disclosure can be assigned to a codon box represented by CAM3. By using the translation system containing the tRNA of the present disclosure, two amino acids can be selectively translated from the codon combination of CAA and CAG. Alternatively, three amino acids can be selectively translated from the codon combination of CAU, CAA, CAG, or CAC, CAA, CAG. It is preferable to use an artificially synthesized tRNA (e.g., transcriptionally synthesized tRNA) as the tRNA of the present disclosure. In that case, in addition to using the sequence of a natural tRNA, it is also possible to use a sequence derived from any tRNA (e.g., tRNA(Glu), tRNA(AsnE2), tRNA(Asp), etc.) in the portion other than the anticodon, and ligate the desired anticodon sequence thereto. The tRNAs of this disclosure preferably consist only of four nucleosides, including the anticodon portion: adenosine (A), guanosine (G), cytidine (C), and uridine (U), and it is desirable that they do not contain any other modified nucleosides. A cell-free translation system, particularly a reconstituted cell-free translation system, is preferred as the translation system for this disclosure. When aminoacylating each tRNA, it is preferable to attach the amino acids outside the translation system, and preferred methods for this include, for example, the pCpA method, the pdCpA method, a method using an artificial RNA catalyst (flexizyme), or a method using aminoacyl-tRNA synthetase (ARS). Both natural and unnatural amino acids can be used as the amino acids attached to each tRNA, but it is preferable from the viewpoint of the purpose of this disclosure to use unnatural amino acids that are not included in the natural genetic code table. The concentration of the tRNAs of this disclosure per codon in the translation system is preferably, for example, in the range of 0.8 to 1000 μM.

[0163] In certain embodiments, the codon in the translation system of the present disclosure is a codon in which M1 is cytidine (C) and M2 is guanosine (G). That is, the tRNA of the present disclosure can be assigned to a codon box represented by the codon CGM3. By using the translation system containing the tRNA of the present disclosure, two amino acids can be selectively translated from the codon combinations of CGA and CGG. Alternatively, three amino acids can be selectively translated from the codon combinations of CGU, CGA, and CGG, or CGC, CGA, and CGG. It is preferable to use an artificially synthesized tRNA (e.g., transcriptionally synthesized tRNA) as the tRNA of the present disclosure. In that case, in addition to using the sequence of a natural tRNA, it is also possible to use a sequence derived from any tRNA (e.g., tRNA(Glu), tRNA(AsnE2), tRNA(Asp), etc.) in the portion other than the anticodon, and ligate the desired anticodon sequence thereto. The tRNAs of this disclosure preferably consist only of four nucleosides, including the anticodon portion: adenosine (A), guanosine (G), cytidine (C), and uridine (U), and it is desirable that they do not contain any other modified nucleosides. A cell-free translation system, particularly a reconstituted cell-free translation system, is preferred as the translation system for this disclosure. When aminoacylating each tRNA, it is preferable to attach the amino acids outside the translation system, and preferred methods for this include, for example, the pCpA method, the pdCpA method, a method using an artificial RNA catalyst (flexizyme), or a method using aminoacyl-tRNA synthetase (ARS). Both natural and unnatural amino acids can be used as the amino acids attached to each tRNA, but it is preferable from the viewpoint of the purpose of this disclosure to use unnatural amino acids that are not included in the natural genetic code table. The concentration of the tRNAs of this disclosure per codon in the translation system is preferably, for example, in the range of 0.8 to 1000 μM.

[0164] In certain embodiments, the codon in the translation system of the present disclosure is a codon in which M1 is adenosine (A) and M2 is uridine (U). That is, the tRNA of the present disclosure can be assigned to a codon box represented by the codon AUM3. By using the translation system containing the tRNA of the present disclosure, two amino acids can be selectively translated from the AUA and AUG codon combination. Alternatively, three amino acids can be selectively translated from the AUU, AUA, AUG codon combination, or the AUC, AUA, AUG codon combination. It is preferable to use an artificially synthesized tRNA (e.g., transcriptionally synthesized tRNA) as the tRNA of the present disclosure. In that case, in addition to using the sequence of a natural tRNA, it is also possible to use a sequence derived from any tRNA (e.g., tRNA(Glu), tRNA(AsnE2), tRNA(Asp), etc.) in the portion other than the anticodon, and ligate the desired anticodon sequence thereto. The tRNAs of this disclosure preferably consist only of four nucleosides, including the anticodon portion: adenosine (A), guanosine (G), cytidine (C), and uridine (U), and it is desirable that they do not contain any other modified nucleosides. A cell-free translation system, particularly a reconstituted cell-free translation system, is preferred as the translation system for this disclosure. When aminoacylating each tRNA, it is preferable to attach the amino acids outside the translation system, and preferred methods for this include, for example, the pCpA method, the pdCpA method, a method using an artificial RNA catalyst (flexizyme), or a method using aminoacyl-tRNA synthetase (ARS). Both natural and unnatural amino acids can be used as the amino acids attached to each tRNA, but it is preferable from the viewpoint of the purpose of this disclosure to use unnatural amino acids that are not included in the natural genetic code table. The concentration of the tRNAs of this disclosure per codon in the translation system is preferably, for example, in the range of 0.8 to 1000 μM.

[0165] In certain embodiments, the codon in the translation system of the present disclosure is a codon in which M1 is adenosine (A) and M2 is cytidine (C). That is, the tRNA of the present disclosure can be assigned to a codon box represented by ACM3. By using the translation system containing the tRNA of the present disclosure, two amino acids can be selectively translated from the codon combinations ACA and ACG. Alternatively, three amino acids can be selectively translated from the codon combinations ACU, ACA, ACG, or ACC, ACA, ACG. It is preferable to use an artificially synthesized tRNA (e.g., transcriptionally synthesized tRNA) as the tRNA of the present disclosure. In that case, in addition to using the sequence of a natural tRNA, it is also possible to use a sequence derived from any tRNA (e.g., tRNA(Glu), tRNA(AsnE2), tRNA(Asp), etc.) in the portion other than the anticodon, and ligate the desired anticodon sequence thereto. The tRNAs of this disclosure preferably consist only of four nucleosides, including the anticodon portion: adenosine (A), guanosine (G), cytidine (C), and uridine (U), and it is desirable that they do not contain any other modified nucleosides. A cell-free translation system, particularly a reconstituted cell-free translation system, is preferred as the translation system for this disclosure. When aminoacylating each tRNA, it is preferable to attach the amino acids outside the translation system, and preferred methods for this include, for example, the pCpA method, the pdCpA method, a method using an artificial RNA catalyst (flexizyme), or a method using aminoacyl-tRNA synthetase (ARS). Both natural and unnatural amino acids can be used as the amino acids attached to each tRNA, but it is preferable from the viewpoint of the purpose of this disclosure to use unnatural amino acids that are not included in the natural genetic code table. The concentration of the tRNAs of this disclosure per codon in the translation system is preferably, for example, in the range of 0.8 to 1000 μM.

[0166] In certain embodiments, the codon in the translation system of the disclosure is a codon in which M1 is adenosine (A) and M2 is adenosine (A). That is, the tRNA of the disclosure can be assigned to a codon box represented by the codon AAM3. By using the translation system containing the tRNA of the disclosure, two amino acids can be selectively translated from the AAA and AAG codon combination. Alternatively, three amino acids can be selectively translated from the AAU, AAA, AAG codon combination, or the AAC, AAA, AAG codon combination. It is preferable to use an artificially synthesized tRNA (e.g., transcriptionally synthesized tRNA) as the tRNA of the disclosure. In that case, in addition to using the sequence of a natural tRNA, it is also possible to use a sequence derived from any tRNA (e.g., tRNA(Glu), tRNA(AsnE2), tRNA(Asp), etc.) in the portion other than the anticodon, and ligate the desired anticodon sequence thereto. The tRNAs of this disclosure preferably consist only of four nucleosides, including the anticodon portion: adenosine (A), guanosine (G), cytidine (C), and uridine (U), and it is desirable that they do not contain any other modified nucleosides. A cell-free translation system, particularly a reconstituted cell-free translation system, is preferred as the translation system for this disclosure. When aminoacylating each tRNA, it is preferable to attach the amino acids outside the translation system, and preferred methods for this include, for example, the pCpA method, the pdCpA method, a method using an artificial RNA catalyst (flexizyme), or a method using aminoacyl-tRNA synthetase (ARS). Both natural and unnatural amino acids can be used as the amino acids attached to each tRNA, but it is preferable from the viewpoint of the purpose of this disclosure to use unnatural amino acids that are not included in the natural genetic code table. The concentration of the tRNAs of this disclosure per codon in the translation system is preferably, for example, in the range of 0.8 to 1000 μM.

[0167] In certain embodiments, the codon in the translation system of the present disclosure is a codon in which M1 is adenosine (A) and M2 is guanosine (G). That is, the tRNA of the present disclosure can be assigned to a codon box represented by the codon AGM3. By using the translation system containing the tRNA of the present disclosure, two amino acids can be selectively translated from the AGA and AGG codon combination. Alternatively, three amino acids can be selectively translated from the AGU, AGA, AGG codon combination, or the AGC, AGA, AGG codon combination. It is preferable to use an artificially synthesized tRNA (e.g., transcriptionally synthesized tRNA) as the tRNA of the present disclosure. In that case, in addition to using the sequence of a natural tRNA, it is also possible to use a sequence derived from any tRNA (e.g., tRNA(Glu), tRNA(AsnE2), tRNA(Asp), etc.) in the portion other than the anticodon, and ligate the desired anticodon sequence thereto. The tRNAs of this disclosure preferably consist only of four nucleosides, including the anticodon portion: adenosine (A), guanosine (G), cytidine (C), and uridine (U), and it is desirable that they do not contain any other modified nucleosides. A cell-free translation system, particularly a reconstituted cell-free translation system, is preferred as the translation system for this disclosure. When aminoacylating each tRNA, it is preferable to attach the amino acids outside the translation system, and preferred methods for this include, for example, the pCpA method, the pdCpA method, a method using an artificial RNA catalyst (flexizyme), or a method using aminoacyl-tRNA synthetase (ARS). Both natural and unnatural amino acids can be used as the amino acids attached to each tRNA, but it is preferable from the viewpoint of the purpose of this disclosure to use unnatural amino acids that are not included in the natural genetic code table. The concentration of the tRNAs of this disclosure per codon in the translation system is preferably, for example, in the range of 0.8 to 1000 μM.

[0168] In certain embodiments, the codon in the translation system of the disclosure is a codon in which M1 is guanosine (G) and M2 is adenosine (A). That is, the tRNA of the disclosure can be assigned to a codon box represented by the codon GAM3. By using the translation system containing the tRNA of the disclosure, two amino acids can be selectively translated from the codon combinations GAA and GAG. Alternatively, three amino acids can be selectively translated from the codon combinations GAU, GAA, GAG, or GAC, GAA, GAG. It is preferable to use an artificially synthesized tRNA (e.g., transcriptionally synthesized tRNA) as the tRNA of the disclosure. In that case, in addition to using the sequence of a natural tRNA, it is also possible to use a sequence derived from any tRNA (e.g., tRNA(Glu), tRNA(AsnE2), tRNA(Asp), etc.) in the portion other than the anticodon, and ligate the desired anticodon sequence thereto. The tRNAs of this disclosure preferably consist only of four nucleosides, including the anticodon portion: adenosine (A), guanosine (G), cytidine (C), and uridine (U), and it is desirable that they do not contain any other modified nucleosides. A cell-free translation system, particularly a reconstituted cell-free translation system, is preferred as the translation system for this disclosure. When aminoacylating each tRNA, it is preferable to attach the amino acids outside the translation system, and preferred methods for this include, for example, the pCpA method, the pdCpA method, a method using an artificial RNA catalyst (flexizyme), or a method using aminoacyl-tRNA synthetase (ARS). Both natural and unnatural amino acids can be used as the amino acids attached to each tRNA, but it is preferable from the viewpoint of the purpose of this disclosure to use unnatural amino acids that are not included in the natural genetic code table. The concentration of the tRNAs of this disclosure per codon in the translation system is preferably, for example, in the range of 0.8 to 1000 μM.

[0169] III. Methods, compositions, and kits for producing peptides In one aspect, the present disclosure provides a method for producing a peptide, comprising translating a nucleic acid using a translation system provided in the present disclosure. Specifically, the present disclosure relates to a method for producing a peptide, comprising translating a nucleic acid in a translation system comprising tRNA having an anticodon complementary to a codon represented as M1M2A, and tRNA having an anticodon complementary to a codon represented as M1M2G. In one aspect, in the present disclosure, M1 and M2 represent the first and second nucleosides of a codon, respectively, and M1 and M2 are independently selected from adenosine (A), guanosine (G), cytidine (C), and uridine (U). In another aspect, each of the two types of tRNAs is bound to a different amino acid or amino acid analog. In addition, in the manufacturing method of this disclosure, at least two amino acids or amino acid analogs can be translated from the codon represented by M1M2U, the codon represented by M1M2C, the codon represented by M1M2A, and the codon represented by M1M2G.

[0170] In one aspect, the present disclosure relates to a method for producing peptides, comprising translating nucleic acids in a translation system comprising tRNA having an anticodon complementary to a codon represented by M1M2U, tRNA having an anticodon complementary to a codon represented by M1M2A, and tRNA having an anticodon complementary to a codon represented by M1M2G. In another aspect, the present disclosure relates to a method for producing peptides, comprising translating nucleic acids in a translation system comprising tRNA having an anticodon complementary to a codon represented by M1M2C, tRNA having an anticodon complementary to a codon represented by M1M2A, and tRNA having an anticodon complementary to a codon represented by M1M2G. In another aspect, in the present disclosure, M1 and M2 represent the first and second nucleosides of a codon, respectively, and M1 and M2 are independently selected from adenosine (A), guanosine (G), cytidine (C), and uridine (U). In one aspect, each of the three types of tRNA has a different amino acid or amino acid analog bound to it. In another aspect, in the manufacturing method of this disclosure, at least three types of amino acids or amino acid analogs can be translated from the codon represented by M1M2U, the codon represented by M1M2C, the codon represented by M1M2A, and the codon represented by M1M2G.

[0171] The nucleic acids in this disclosure may each contain one or more codons represented by M1M2A and M1M2G. The peptide production method in this disclosure may include a process in which the tRNA in this disclosure selectively translates (or reads) the M1M2A and M1M2G codons that may be contained in the nucleic acid, one or more times. In one embodiment, the peptide production method in this disclosure may translate one or more nucleic acids containing these codons.

[0172] The nucleic acids in the present disclosure may each contain one or more codons represented by M1M2U, codons represented by M1M2A, and codons represented by M1M2G. The method for producing a peptide in the present disclosure may include a process (or a process of discrimination) in which the tRNA in the present disclosure selectively translates each of the codons represented by M1M2U, codons represented by M1M2A, and codons represented by M1M2G that may be contained in the nucleic acid once or multiple times. In one aspect, in the method for producing a peptide in the present disclosure, one or more types of nucleic acids containing these codons may be translated.

[0173] The nucleic acids in the present disclosure may each contain one or more codons represented by M1M2C, codons represented by M1M2A, and codons represented by M1M2G. The method for producing a peptide in the present disclosure may include a process (or a process of discrimination) in which the tRNA in the present disclosure selectively translates each of the codons represented by M1M2C, codons represented by M1M2A, and codons represented by M1M2G that may be contained in the nucleic acid once or multiple times. In one aspect, in the method for producing a peptide in the present disclosure, one or more types of nucleic acids containing these codons may be translated.

[0174] The nucleic acids in the present disclosure may each contain one or more codons represented by M1M2U, codons represented by M1M2C, codons represented by M1M2A, and codons represented by M1M2G. The method for producing a peptide in the present disclosure may include a process (or a process of discrimination) in which the tRNA in the present disclosure selectively translates each of the codons represented by M1M2U, codons represented by M1M2C, codons represented by M1M2A, and codons represented by M1M2G that may be contained in the nucleic acid once or multiple times. In one aspect, in the method for producing a peptide in the present disclosure, one or more types of nucleic acids containing these codons may be translated.

[0175] In one aspect, the present disclosure relates to a composition and a kit for producing a peptide, comprising a tRNA having an anticodon complementary to the codon represented by M1M2A and a tRNA having an anticodon complementary to the codon represented by M1M2G. In one aspect, in the present disclosure, M1 and M2 each represent the first and second nucleotides of the codon, and M1 and M2 are each independently selected from any of adenosine (A), guanosine (G), cytidine (C), and uridine (U). In one aspect, each of the two types of tRNAs is bound to a different amino acid or amino acid analogue. Also in one aspect, by using the composition and kit in the present disclosure, at least two amino acids or amino acid analogues can be translated from the codons represented by M1M2U, M1M2C, M1M2A, and M1M2G.

[0176] In one aspect, the disclosure relates to compositions and kits for producing peptides comprising tRNA having an anticodon complementary to a codon represented as M1M2U, tRNA having an anticodon complementary to a codon represented as M1M2A, and tRNA having an anticodon complementary to a codon represented as M1M2G. In another aspect, the disclosure relates to compositions and kits for producing peptides comprising tRNA having an anticodon complementary to a codon represented as M1M2C, tRNA having an anticodon complementary to a codon represented as M1M2A, and tRNA having an anticodon complementary to a codon represented as M1M2G. In another aspect, in the disclosure, M1 and M2 represent the first and second nucleosides of a codon, respectively, and M1 and M2 are independently selected from adenosine (A), guanosine (G), cytidine (C), and uridine (U). In one aspect, each of the three types of tRNA has a different amino acid or amino acid analog bound to it. In another aspect, in the manufacturing method of this disclosure, at least three types of amino acids or amino acid analogs can be translated from the codon represented by M1M2U, the codon represented by M1M2C, the codon represented by M1M2A, and the codon represented by M1M2G.

[0177] The tRNA constituting the translation system in this disclosure can constitute a composition including buffers and other substances commonly used in nucleic acid translation. The tRNA constituting the translation system in this disclosure can also be pre-packaged with various substances commonly used in peptide translation and supplied as a kit. The various substances included in the kit can be in powder or liquid form depending on their intended use. These can be stored in a suitable container and used as needed.

[0178] In this disclosure, compounds in which two or more amino acids are linked by an amide bond may be included in the peptides of this disclosure. Compounds in which amino acid analogs such as hydroxycarboxylic acids are linked by an ester bond instead of amino acids may also be included in the peptides of this disclosure. The number of amino acids or amino acid analogs included in the peptide is not particularly limited as long as there are two or more, but examples include two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, etc. Also, examples include 100 or less, 80 or less, 50 or less, 30 or less, 25 or less, 20 or less, 19 or less, 18 or less, 17 or less, 16 or less, 15 or less, 14 or less, 13 or less, 12 or less, etc. Alternatively, one can choose from 9, 10, 11 or 12.

[0179] In one aspect, the compositions and kits of this disclosure may contain nucleic acids. In one embodiment, the nucleic acids constituting the compositions and kits of this disclosure may each contain one or more codons represented by M1M2A and M1M2G. In another embodiment, the nucleic acids constituting the compositions and kits of this disclosure may each contain (i) one or more codons represented by M1M2U, M1M2A, and M1M2G, or (ii) one or more codons represented by M1M2C, M1M2A, and M1M2G. In another embodiment, the nucleic acids constituting the compositions and kits of this disclosure may each contain one or more codons represented by M1M2A, M1M2G, M1M2U, and M1M2C. In one embodiment, the compositions and kits of this disclosure may contain one or more such nucleic acids.

[0180] In one embodiment, the peptide of the Disclosure may contain N-substituted amino acids, the number of which may be, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, etc. In another embodiment, the peptide of the Disclosure may contain unsubstituted amino acids, the number of which may be, for example, 1, 2, 3, 4, etc. In a further embodiment, the peptide of the Disclosure may contain both N-substituted amino acids and unsubstituted amino acids.

[0181] In some embodiments, the peptides of this disclosure may be linear peptides or peptides having a cyclic portion. A peptide having a cyclic portion means a peptide in which a cyclic structure is formed within the molecule by the binding of the main chain or side chain of one amino acid or amino acid analog present on the peptide chain to the main chain or side chain of another amino acid or amino acid analog present on the same peptide chain. A peptide having a cyclic portion may consist only of a cyclic portion or may contain both a cyclic portion and a linear portion. The number of amino acids or amino acid analogs contained in the cyclic portion may be, for example, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, etc., and may also be 14 or less, 13 or less, 12 or less, 11 or less, etc. Alternatively, it may be selected from 9, 10, or 11. The number of amino acids or amino acid analogs contained in the linear portion may be, for example, 0 or more, and may also be 8 or less, 7 or less, 6 or less, 5 or less, 4 or less, etc. Alternatively, you can choose from 0, 1, 2, or 3 items.

[0182] For example, a peptide bond formed from an amino group and a carboxyl group can be used as a bond to form the cyclic portion. In addition, amide bonds, disulfide bonds, ether bonds, thioether bonds, ester bonds, thioester bonds, carbon-carbon bonds, alkyl bonds, alkenyl bonds, phosphonate ether bonds, azo bonds, amine bonds, C=NC bonds, lactam crosslinks, carbamoyl bonds, urea bonds, thiourea bonds, thioamide bonds, sulfinyl bonds, sulfonyl bonds, triazole bonds, benzoxazole bonds, etc., formed from appropriate combinations of functional groups can be used. Carbon-carbon bonds can be formed by transition metal-catalyzed reactions such as the Suzuki reaction, Heck reaction, and Sonogashira reaction. In one embodiment, the peptide of this disclosure contains at least one set of functional groups capable of forming the above bonds intramolecularly. The formation of the cyclic portion may be achieved by separately performing a reaction to bond the above functional groups together after a linear peptide has been produced using the translation system of this disclosure. For the synthesis of peptides containing cyclic portions, you can also refer to WO2013 / 100132, WO2012 / 026566, WO2012 / 033154, WO2012 / 074130, WO2015 / 030014, WO2018 / 052002, Comb Chem High Throughput Screen (2010) 13: 75-87, Nat Chem Biol (2009) 5: 502-507, Nat Chem Biol (2009) 5: 888-90, Bioconjug Chem (2007) 18: 469-476, ChemBioChem (2009) 10: 787-798, Chem Commun (Camb) (2011) 47: 9946-9958, etc.

[0183] In some embodiments, the nucleic acid translated in the translation system of the present disclosure is mRNA. The mRNA may encode a peptide having a desired amino acid sequence. By adding the mRNA to the translation system of the present disclosure, the mRNA can be translated into a peptide. On the other hand, if the translation system includes an RNA polymerase for transcribing DNA into mRNA, by adding the DNA to the translation system of the present disclosure, both the transcription of the DNA into mRNA and the translation of the mRNA into a peptide can be performed simultaneously. The mRNA may contain at least the codons represented by M1M2A and M1M2G, the codon represented by M1M2U, the codon represented by M1M2A and M1M2G, or the codon represented by M1M2C, the codon represented by M1M2A and M1M2G.

[0184] While methionine is typically present as the starting amino acid at the N-terminus of a peptide to be translated, several methods have been reported for introducing amino acids other than methionine to the N-terminus. These methods may be used in combination with the peptide production methods described herein. One such method is to translate nucleic acids that start from a desired amino acid using an initiation tRNA aminoacylated with an amino acid other than methionine (Initiation Suppression). In particular, since the tolerance for exogenous amino acids is higher at the start of translation than during peptide chain elongation, it may be possible to use amino acids with structures significantly different from natural amino acids at the N-terminus (Goto & Suga, J Am Chem Soc (2009) 131(14): 5040-5041). Another method is to start translation from the second or later codon by removing the initiation methionyl tRNA from the translation system or by replacing the starting amino acid with an amino acid other than methionine that has low translation efficiency (Initiation Read-Through). Another method involves removing the methionine at the N-terminus of a peptide by treating it with enzymes such as peptide deformylase and methionine aminopeptidase (Meinnel et al., Biochimie (1993) 75: 1061-1075). By preparing a peptide library that starts with methionine and treating it with the above enzymes, a peptide library in which the N-terminus starts with a random amino acid can be prepared.

[0185] In another aspect, the Disclosure provides peptides produced by the peptide production methods described herein. Peptides obtained by further chemical modification of peptides produced by the methods described herein are also included in the peptides provided by the Disclosure.

[0186] In one aspect, this disclosure provides a method for producing a peptide library, comprising translating a nucleic acid library using the translation system of this disclosure. By preparing multiple nucleic acid molecules, each encoding a peptide and exhibiting a high degree of diversity in nucleic acid sequences, and translating each of these into peptides, multiple peptide molecules exhibiting a high degree of diversity in amino acid sequences can be produced. The size of the library is not particularly limited, but for example, 10 6 The above 10 7 The above 10 8 The above 10 9 The above 10 10 The above 10 11 The above 10 12 The above 10 13 The above 10 14The above are some examples of possible nucleic acids. The nucleic acid may be DNA or RNA. RNA is usually mRNA. DNA is translated into peptides via transcription to mRNA. Such nucleic acid libraries can be prepared by methods known to those skilled in the art or by similar methods. When synthesizing nucleic acid libraries, multiple nucleic acid molecules with diverse nucleic acid sequences can be easily prepared by using mixed bases at desired positions. Examples of codons using mixed bases include NNN (where N represents a mixture of four bases: A, T, G, and C), NNW (where W represents a mixture of two bases: A and T), NNM (where W represents a mixture of two bases: A and C), NNK (where K represents a mixture of two bases: G and T), and NNS (where S represents a mixture of two bases: C and G). Alternatively, by limiting the base used in the third letter of the codon to one of A, T, G, or C, it is possible to synthesize nucleic acid libraries that encode only certain specific amino acids. Furthermore, when creating codons containing mixed bases, it is possible to arbitrarily adjust the frequency of occurrence of the amino acids derived from that codon by mixing multiple bases in different ratios rather than equal proportions. By preparing multiple codon units of different types, using the above-mentioned codons as a single unit, and linking them in a desired order, it becomes possible to design a library in which the position and frequency of occurrence of the included amino acids are controlled.

[0187] In some embodiments, the peptide library in this disclosure is a library in which peptides are displayed on nucleic acids (a nucleic acid display library, or simply a display library). The display library is characterized in that a phenotype and a genotype are associated by the binding of a peptide to the nucleic acid encoding it to form a complex. Examples of major display libraries include mRNA display (Roberts and Szostak, Proc Natl Acad Sci USA (1997) 94: 12297-12302), in vitro virus display (Nemoto et al., FEBS Lett (1997) 414: 405-408), cDNA display (Yamaguchi et al., Nucleic Acids Res (2009) 37: e108), ribosome display (Mattheakis et al, Proc Natl Acad Sci USA (1994) 91: 9022-9026), covalent display (Reiersen et al., Nucleic Acids Res (2005) 33: e10), and CIS display (Odegrip et al., Proc Natl Acad Sci USA (2004) 101: Libraries prepared using methods such as those described in 2806-2810 can be cited. Alternatively, libraries prepared using the in vitro compartmentalization method (Tawfik and Griffiths, Nat Biotechnol (1998) 16: 652-656) can also be cited as a form of display library.

[0188] In another aspect, the Disclosure provides a peptide library prepared by the method for producing a peptide library in the Disclosure.

[0189] In one aspect, this disclosure provides a method for identifying peptides having binding activity to a target molecule, the method comprising contacting a target molecule with a peptide library according to this disclosure. The target molecule is not particularly limited and can be appropriately selected from, for example, small molecules, large molecules, nucleic acids, peptides, proteins, sugars, lipids, etc. The target molecule may be an extracellular molecule or an intracellular molecule. Alternatively, it may be a molecule located on the cell membrane, in which case the extracellular domain, transmembrane domain, or intracellular domain may be targeted. In the step of contacting the peptide library with the target molecule, the target molecule is usually immobilized on some kind of solid support (e.g., a microtiter plate or microbeads). Subsequently, peptides that are not bound to the target molecule can be removed and only the peptides bound to the target molecule can be recovered, thereby selectively enriching peptides having binding activity to the target molecule (panning method). If the peptide library used is a nucleic acid display library, the recovered peptides are bound to nucleic acids encoding their genetic information, so by isolating and analyzing them, the nucleic acid sequence and amino acid sequence encoding the recovered peptides can be easily identified. Furthermore, based on the obtained nucleic acid sequence or amino acid sequence, the identified peptides can be individually manufactured using chemical synthesis or genetic engineering techniques.

[0190] In one aspect, the present disclosure provides a nucleic acid-peptide complex comprising a peptide and a nucleic acid encoding the peptide, the complex having the following characteristics: (i) The nucleic acid sequence encoding the peptide contains two codons, M1M2A and M1M2G, (ii) In the amino acid sequence of the peptide, the types of amino acids or amino acid analogs corresponding to the M1M2A codon and the types of amino acids or amino acid analogs corresponding to the M1M2G codon are different from each other. Here, M1 and M2 represent the first and second characters of a particular codon, respectively (except for codons where M1 is A and M2 is U).

[0191] In a further aspect, the present disclosure provides a nucleic acid-peptide complex comprising a peptide and a nucleic acid encoding the peptide, the complex having the following characteristics: (i) The nucleic acid sequence encoding the peptide contains three codons: M1M2U, M1M2A, and M1M2G, (ii) In the amino acid sequence of the peptide, the types of amino acids or amino acid analogs corresponding to the M1M2U codon, the M1M2A codon, and the M1M2G codon are all different from each other. Here, M1 and M2 represent the first and second characters of a particular codon, respectively.

[0192] In another aspect, the present disclosure provides a nucleic acid-peptide complex comprising a peptide and a nucleic acid encoding the peptide, the complex having the following characteristics: (i) The nucleic acid sequence encoding the peptide contains three codons: M1M2C, M1M2A, and M1M2G, (ii) In the amino acid sequence of the peptide, the types of amino acids or amino acid analogs corresponding to the M1M2C codon, the amino acids or amino acid analogs corresponding to the M1M2A codon, and the amino acids or amino acid analogs corresponding to the M1M2G codon are all different from each other. Here, M1 and M2 represent the first and second characters of a particular codon, respectively.

[0193] In some embodiments, the nucleic acid-peptide complex described above can be included therein as one of the elements constituting a peptide library (particularly a nucleic acid display library). In one embodiment, the present disclosure provides a library (a peptide library or a nucleic acid display library) containing the nucleic acid-peptide complex in the present disclosure. In certain embodiments, the above-described nucleic acid-peptide complex and library can be prepared using the tRNA in the present disclosure or the translation system in the present disclosure. All prior art documents cited herein are incorporated herein by reference.

Examples

[0194] The present invention is further illustrated by the following examples, but is not limited to the following examples. In addition, the following abbreviations were used in the examples. AA Ammonium acetate CH2CN Cyanomethyl group DBU 1,8-Diazabicyclo[5.4.0]-7-undecene DCM Dichloromethane DIC N,N-Diisopropylcarbodiimide DIPEA N,N-Diisopropylethylamine DMF Dimethylformamide DMSO Dimethyl sulfoxide FA Formic acid Fmoc 9-Fluorenylmethyloxycarbonyl group F-Pnaz 4-(2-(4-Fluorophenyl)acetamido)benzyloxycarbonyl group:

Chemical formula

[0195] In addition, the following abbreviations were used in this example: Gly or G (glycine), Ile or I (isoleucine), Leu or L (leucine), Phe or F (phenylalanine), Pro or P (proline), Thr or T (threonine). In addition to these, the abbreviations listed in Table 2 were used.

[0196] [Table 2]

[0197] Furthermore, the analysis conditions for LCMS are shown in Table 3 below.

[0198] [Table 3]

[0199] Example 1. Synthesis of pCpA-amino acids for use in a cell-free translation system. Aminoacylated pCpA (SS14, SS15, SS16, SS48, SS49, SS50, SS51) were synthesized according to the following scheme. [ka]

[0200] Synthesis of (S)-1-(((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)piperidine-2-carboxylic acid (compound SS17, F-Pnaz-Pic2-OH) [ka]

[0201] Under a nitrogen atmosphere, a mixture of (S)-piperidine-2-carboxylic acid (42.6 mg, 0.33 mmol) and carbonate-(4-nitrophenyl)-4-(2-(4-fluorophenyl)acetamide)benzyl (compound ts11) (140 mg, 0.44 mmol) synthesized by the method described in Patent Document (WO2018143145A1) was mixed with DMF (330 μL) at room temperature. After stirring at room temperature for 5 minutes, triethylamine (105.6 μL, 2.25 mmol) was added at 0°C. The reaction mixture was stirred at room temperature for 30 minutes, and then purified by reverse-phase silica gel column chromatography (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution) to obtain (S)-1-(((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)piperidine-2-carboxylic acid (compound SS17, F-Pnaz-Pic2-OH) (92 mg, 67%). LCMS(ESI) m / z = 413 (MH)- Retention time: 0.70 minutes (Analysis conditions SQDFA05_01)

[0202] (S)-Piperidine-1,2-dicarboxylic acid 1-(4-(2-(4-fluorophenyl)acetamide)benzyl) 2-(cyanomethyl)(compound SS18, F-Pnaz-Pic2-OCH) 2 Synthesis of CN [ka]

[0203] Under a nitrogen atmosphere, ((S)-1-(((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)piperidine-2-carboxylic acid (compound SS17, F-Pnaz-Pic2-OH) (30 mg, 0.072 mmol) and N-ethyl-isopropylpropan-2-amine (DIPEA) (20.23 μL, 0.116 mmol) were dissolved in acetonitrile (90 μL), and 2-bromoacetonitrile (5.34 μL, 0.080 mmol) was added at 0°C, and the mixture was stirred at room temperature for 2 hours. The reaction mixture was concentrated to obtain the crude product (S)-piperidine-1,2-dicarboxylic acid 1-(4-(2-(4-fluorophenyl)acetamide)benzyl) 2-(cyanomethyl) (compound SS18, F-Pnaz-Pic2-OCH2CN). The crude product obtained was dissolved in acetonitrile (2.00 It was dissolved in (mL) and used directly in the next step. LCMS(ESI) m / z = 452 (MH)- Retention time: 0.79 minutes (Analysis conditions SQDFA05_01)

[0204] Synthesis of (2S)-piperidine-1,2-dicarboxylic acid 1-(4-(2-(4-fluorophenyl)acetamide)benzyl) 2-((2R,3S,4R,5R)-2-((((((2R,3S,4R,5R)-5-(4-amino-2-oxopyrimidine-1(2H)-yl)-4-hydroxy-2-((phosphonooxy)methyl)tetrahydrofuran-3-yl)oxy)(hydroxy)phosphoryl)oxy)methyl)-5-(6-amino-9H-purine-9-yl)-4-hydroxytetrahydrofuran-3-yl) (compound SS14, F-Pnaz-Pic2-pCpA) [ka]

[0205] Dissolve ((2R,3R,4R,5R)-5-(4-amino-2-oxopyrimidine-1(2H)-yl)-3-(((((2R,3S,4R,5R)-5-(6-amino-9H-purine-9-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)(hydroxy)phosphoryl)oxy)-4-((tetrahydrofuran-2-yl)oxy)tetrahydrofuran-2-yl)methyl (compound pc01) (113 mg, 0.156 mmol) synthesized by the method described in the literature (Helv. Chim. Acta, 90, 297-310) in buffer A (40 mL), and (S)-piperidine-1,2-dicarboxylic acid 1-(4-(2-(4-fluorophenyl)acetamide)benzyl) A solution of 2-(cyanomethyl) (compound SS18, F-Pnaz-Pic2-OCH2CN) (35.4 mg, 0.078 mmol) in acetonitrile (2.00 mL) was added, and the mixture was stirred at room temperature for 150 minutes. After cooling the reaction mixture to 0°C, trifluoroacetic acid (2.00 mL) was added. The reaction mixture was stirred at 0°C for 45 minutes, and then purified by reverse-phase silica gel column chromatography (0.05% trifluoroacetic acid aqueous solution / 0.05% trifluoroacetic acid acetonitrile) to obtain the title compound (compound SS14, F-Pnaz-Pic2-pCpA) (6.0 mg, 7.3%). LCMS(ESI) m / z = 1047.5 (MH)- Retention time: 0.50 minutes (Analysis conditions SQDFA05_01)

[0206] Buffer solution A was prepared as follows. Acetic acid was added to an aqueous solution of N,N,N-trimethylhexadecane-1-aminium chloride (6.40 g, 20 mmol) and imidazole (6.81 g, 100 mmol) to obtain buffer A (1 L) with pH 8 and containing 20 mM N,N,N-trimethylhexadecane-1-aminium and 100 mM imidazole.

[0207] Synthesis of O-(2-chlorophenyl)-N-(((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)-L-serine (compound SS19, F-Pnaz-SPh2Cl-OH) [ka]

[0208] Under a nitrogen atmosphere, a mixture of O-(2-chlorophenyl)-L-serine (compound aa63) (1.25 g, 5.80 mmol) synthesized by the method described in Patent Document (WO2018225864) and carbonate-(4-nitrophenyl)-4-(2-(4-fluorophenyl)acetamide)benzyl (compound ts11) (2 g, 4.71 mmol) synthesized by the method described in Patent Document (WO2018143145A1) was mixed with DMSO (15 mL) and triethylamine (0.95 g, 9.42 mmol) at room temperature. The reaction mixture was stirred at room temperature for 16 hours, and then purified by reverse-phase silica gel column chromatography (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution) to obtain O-(2-chlorophenyl)-N-(((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)-L-serine (compound SS19, F-Pnaz-SPh2Cl-OH) (1.8 g, 73%). LCMS(ESI) m / z = 523 (M+Na)+ Retention time: 1.26 minutes (Analysis conditions SMD method 6)

[0209] Cyanomethyl O-(2-chlorophenyl)-N-(((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)-L-serinate (compound SS20, F-Pnaz-SPh2Cl-OCH 2 Synthesis of CN [ka]

[0210] Under a nitrogen atmosphere, O-(2-chlorophenyl)-N-(((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)-L-serine (compound SS19, F-Pnaz-SPh2Cl-OH) (800 mg, 1.60 mmol) and N-ethyl-isopropylpropan-2-amine (DIPEA) (0.412 g, 3.19 mmol) were dissolved in DCM (15 mL), 2-bromoacetonitrile (760 mg, 6.34 mmol) was added at room temperature, and the mixture was stirred at room temperature for 16 hours. The reaction mixture was concentrated and purified by reverse-phase silica gel column chromatography (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution) to obtain cyanomethyl O-(2-chlorophenyl)-N-(((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)-L-serinate (compound SS20, F-Pnaz-SPh2Cl-OCH2CN) (220 mg, 26%). The obtained product was dissolved in acetonitrile (5 mL) and used in the next step. LCMS(ESI) m / z = 562 (M+Na)+ Retention time: 1.15 minutes (Analysis conditions SMD method 4)

[0211] Synthesis of (2R,3S,4R,5R)-2-((((((2R,3S,4R,5R)-5-(4-amino-2-oxopyrimidine-1(2H)-yl)-4-hydroxy-2-((phosphonooxy)methyl)tetrahydrofuran-3-yl)oxy)(hydroxy)phosphoryl)oxy)methyl)-5-(6-amino-9H-purine-9-yl)-4-hydroxytetrahydrofuran-3-yl O-(2-chlorophenyl)-N-(((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)-L-serinate (compound SS15, F-Pnaz-SPh2Cl-pCpA) [ka]

[0212] Dissolve dihydrogen phosphate ((2R,3R,4R,5R)-5-(4-amino-2-oxopyrimidine-1(2H)-yl)-3-(((((2R,3S,4R,5R)-5-(6-amino-9H-purine-9-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)(hydroxy)phosphoryl)oxy)-4-((tetrahydrofuran-2-yl)oxy)tetrahydrofuran-2-yl)methyl (compound pc01) (400 mg, 0.55 mmol) in buffer A (100 mL), and cyanomethyl O-(2-chlorophenyl)-N-(((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)-L-serinate (compound SS20, F-Pnaz-SPh2Cl-OCH2CN) (220 mg, 0.41 mmol) in buffer A (100 mL). A 5 mL solution of acetonitrile ( mmol) was added dropwise using a syringe pump over a period of 15 minutes or more, and the mixture was stirred at room temperature for 5 minutes. Subsequently, trifluoroacetic acid (2.3 mL) was added to the reaction mixture. After lyophilization of the reaction mixture, it was purified by reverse-phase silica gel column chromatography (0.05% trifluoroacetic acid aqueous solution / 0.05% trifluoroacetic acid acetonitrile) to obtain the title compound (compound SS15, F-Pnaz-SPh2Cl-pCpA) (20.7 mg, 2%). LCMS(ESI) m / z = 1133.4 (MH)- Retention time: 0.55 minutes (Analysis conditions SQDFA05_01)

[0213] Synthesis of ((S)-2-(methylamino)-4-phenylbutanoic acid (compound SS21, MeHph-OH) [ka]

[0214] (S)-2-((((9H-fluoren-9-yl)methoxy)carbonyl)(methyl)amino)-4-phenylbutanoic acid (compound aa11) (150 mg, 0.361 mmol), synthesized by the method described in Patent Document (WO2018225864), was mixed with DCM (903 μL), water (903 μL), and piperidine (178 μL, 1.805 mmol) at room temperature. The reaction mixture was stirred at room temperature for 30 minutes, and then purified by reverse-phase silica gel column chromatography (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution) to obtain ((S)-2-(methylamino)-4-phenylbutanoic acid (compound SS21, MeHph-OH) (55 mg, 79%). LCMS(ESI) m / z = 192 (MH)- Retention time: 0.15 minutes (Analysis conditions SQDFA05_02)

[0215] Synthesis of (S)-2-((((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)(methyl)amino)-4-phenylbutanoic acid (compound SS22, F-Pnaz-MeHph-OH) [ka]

[0216] Under a nitrogen atmosphere, DMSO (727 μL) was added at room temperature to a mixture of ((S)-2-(methylamino)-4-phenylbutanoic acid (compound SS21, MeHph-OH) (35.1 mg, 0.182 mmol) and carbonate-(4-nitrophenyl)-4-(2-(4-fluorophenyl)acetamide)benzyl (compound ts11) (85 mg, 0.20 mmol) synthesized by the method described in Patent Document (WO2018143145A1). Triethylamine (76 μL, 0.545 mmol) was added at 50°C. The reaction mixture was stirred at 40°C for 16 hours, and then purified by reverse-phase silica gel column chromatography (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution) to obtain (S)-2-((((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)(methyl)amino)-4-phenylbutanoic acid (compound SS22, F-Pnaz-MeHph-OH) (80 mg, 92%). LCMS(ESI) m / z = 477 (MH)- Retention time: 0.85 minutes (Analysis conditions SQDFA05_02)

[0217] (S)-2-((((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)(methyl)amino)-4-phenylbutanoic acid cyanomethyl (compound SS23, F-Pnaz-MeHph-OCH 2 Synthesis of CN [ka]

[0218] Under a nitrogen atmosphere, 533 μL of acetonitrile was added at room temperature to a mixture of (S)-2-((((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)(methyl)amino)-4-phenylbutanoic acid (compound SS22, F-Pnaz-MeHph-OH) (77 mg, 0.16 mmol) and N-ethyl-isopropylpropan-2-amine (DIPEA) (31 μL, 0.176 mmol). Subsequently, 86 μL of 2-bromoacetonitrile (1.280 mmol) was added at room temperature, and the reaction mixture was stirred at 40°C for 1 hour. The reaction mixture was concentrated to obtain the crude product (S)-2-((((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)(methyl)amino)-4-phenylbutanoic acid cyanomethyl (compound SS23, F-Pnaz-MeHph-OCH2CN). The obtained crude product was dissolved in acetonitrile (5.00 mL) and used directly in the next step. LCMS(ESI) m / z = 516 (MH)- Retention time: 0.92 minutes (Analysis conditions SQDFA05_02)

[0219] Synthesis of (2S)-2-((((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)(methyl)amino)-4-phenylbutanoic acid (2R,3S,4R,5R)-2-((((((2R,3S,4R,5R)-5-(4-amino-2-oxopyrimidine-1(2H)-yl)-4-hydroxy-2-((phosphonooxy)methyl)tetrahydrofuran-3-yl)oxy)(hydroxy)phosphoryl)oxy)methyl)-5-(6-amino-9H-purine-9-yl)-4-hydroxytetrahydrofuran-3-yl (compound SS16, F-Pnaz-MeHph-pCpA) [ka]

[0220] Dissolve ((2R,3R,4R,5R)-5-(4-amino-2-oxopyrimidine-1(2H)-yl)-3-(((((2R,3S,4R,5R)-5-(6-amino-9H-purine-9-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)(hydroxy)phosphoryl)oxy)-4-((tetrahydrofuran-2-yl)oxy)tetrahydrofuran-2-yl)methyl (compound pc01) (127 mg, 0.176 mmol) in buffer A (100 mL), and (S)-2-((((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)(methyl)amino)-4-phenylbutanoic acid cyanomethyl (compound SS23, F-Pnaz-MeHph-OCH2CN) (83 mg, 0.16 A 5.00 mL solution of mmol) of trifluoroacetic acid (acetonitrile) was added and the mixture was stirred at room temperature for 1 hour. After cooling the reaction mixture to 0°C, 5.00 mL of trifluoroacetic acid was added. The reaction mixture was stirred at 0°C for 1 hour, and then purified by reverse-phase silica gel column chromatography (0.05% aqueous trifluoroacetic acid solution / 0.05% trifluoroacetic acid acetonitrile), followed by further purification by reverse-phase silica gel column chromatography (0.1% aqueous formic acid solution / 0.1% formic acid acetonitrile solution) to obtain the title compound (compound SS16, F-Pnaz-MeHph-pCpA) (26 mg, 14.6%). LCMS(ESI) m / z = 1111.5 (MH)- Retention time: 0.64 minutes (Analysis conditions SQDFA05_02)

[0221] The synthetic intermediate for compound SS48 was synthesized according to the following scheme. [ka]

[0222] Synthesis of (S)-2-((((9H-fluoren-9-yl)methoxy)carbonyl)(methyl)amino)-3-(pyridine-3-yl)propanoic acid compound 2,2,2-trifluoroacetate (compound SS52, Fmoc-MeA3Pyr-OH·TFA) [ka]

[0223] (S)-2-((((9H-fluoren-9-yl)methoxy)carbonyl)amino)-3-(pyridine-3-yl)propanoic acid (15 g, 38.62 mmol), trifluoroacetic acid (27 mL, 348 mmol), and paraformaldehyde ((CH2O) n (3.48 g, 116 mmol) was suspended in toluene (50 mL) and stirred at 40°C for 16 hours under a nitrogen atmosphere. After cooling to room temperature, the reaction mixture was concentrated under reduced pressure. The residue was dissolved in DCM and washed with saturated sodium bicarbonate aqueous solution. The organic layer was dried over anhydrous sodium sulfate, and the solvent was removed by filtration and concentration under reduced pressure to obtain (S)-5-oxo-4-(pyridine-3-ylmethyl)oxazolidine-3-carboxylic acid (9H-fluoren-9-yl)methyl as the crude product. The crude product obtained, (S)-5-oxo-4-(pyridine-3-ylmethyl)oxazolidine-3-carboxylic acid (9H-fluoren-9-yl) (18 g, 44.95 mmol), was dissolved in dichloroethane (100 mL), and triethylsilane (Et3SiH) (47 g, 404.20 mmol) and trifluoroacetic acid (100 mL) were added at room temperature. The reaction mixture was stirred under a nitrogen atmosphere at 70°C for 16 hours, and then concentrated under reduced pressure. The resulting residue was dissolved in isopropyl acetate, and a mixed solution of t-butyl methyl ether and hexane (9:1) was added. The solution was stirred at room temperature for 20 minutes, and then allowed to stand at 4°C for 1 hour. The resulting precipitate was collected by filtration and washed with a cooled mixed solution of t-butyl methyl ether and hexane (9:1) to obtain (S)-2-((((9H-fluoren-9-yl)methoxy)carbonyl)(methyl)amino)-3-(pyridine-3-yl)propanoic acid compound 2,2,2-trifluoroacetate (compound SS52, Fmoc-MeA3Pyr-OH·TFA) (19 g, 95%). LCMS(ESI) m / z = 403 (M+H)+ Retention time: 0.77 minutes (Analysis conditions SMD method 1)

[0224] Synthesis of (S)-2-(methylamino)-3-(pyridine-3-yl)propanoic acid (compound SS53, MeA3Pyr-OH) [ka]

[0225] (S)-2-((((9H-fluoren-9-yl)methoxy)carbonyl)(methyl)amino)-3-(pyridine-3-yl)propanoic acid compound 2,2,2-trifluoroacetate (compound SS52, Fmoc-MeA3Pyr-OH·TFA) (19 g, 47.21 mmol) was mixed with DMF (72 mL) and piperidine (28.5 mL) at room temperature, and the reaction mixture was stirred at room temperature for 3 hours. Diethyl ether (140 mL) and hexane (280 mL) were added, and the mixture was stirred at room temperature for a further 3 hours. The resulting precipitate was collected by filtration, and (S)-2-(methylamino)-3-(pyridine-3-yl)propanoic acid (compound SS53, MeA3Pyr-OH) (7 g) was quantitatively obtained. LCMS(ESI) m / z = 181 (M+H)+ Retention time: 0.15 minutes (Analysis conditions SMD method 2)

[0226] Synthesis of (S)-2-((((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)(methyl)amino)-3-(pyridine-3-yl)propanoic acid (compound SS54, F-Pnaz-MeA3Pyr-OH) [ka]

[0227] Under a nitrogen atmosphere, a mixture of (S)-2-(methylamino)-3-(pyridine-3-yl)propanoic acid (compound SS53, MeA3Pyr-OH) (970 mg, 5.38 mmol) and carbonate-(4-nitrophenyl)-4-(2-(4-fluorophenyl)acetamide)benzyl (compound ts11) (2 g, 4.71 mmol) synthesized by the method described in Patent Document (WO2018143145A1) was mixed with DMSO (15 mL) and triethylamine (950 mg, 9.43 mmol) at room temperature. The reaction mixture was stirred at 40°C for 16 hours, and then purified by reverse-phase silica gel column chromatography (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution) to obtain (S)-2-((((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)(methyl)amino)-3-(pyridine-3-yl)propanoic acid (compound SS54, F-Pnaz-MeA3Pyr-OH) (1.0 g, 46%). LCMS(ESI) m / z = 466 (M+H)+ Retention time: 0.98 minutes (Analysis conditions SMD method 3)

[0228] (S)-2-((((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)(methyl)amino)-3-(pyridine-3-yl)propanoate cyanomethyl (compound SS55, F-Pnaz-MeA3Pyr-OCH 2 Synthesis of CN [ka]

[0229] Under a nitrogen atmosphere, a mixture of (S)-2-((((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)(methyl)amino)-3-(pyridine-3-yl)propanoic acid (compound SS54, F-Pnaz-MeA3Pyr-OH) (800 mg, 1.72 mmol) and N-ethyl-isopropylpropan-2-amine (DIPEA) (444 mg, 3.44 mmol) was dissolved in DCM (20 mL), 2-bromoacetonitrile (818 mg, 6.82 mmol) was added at room temperature, and the mixture was stirred at room temperature for 6 hours. The reaction mixture was concentrated and purified by normal-phase silica gel column chromatography (ethyl acetate / petroleum ether) to obtain (S)-2-((((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)(methyl)amino)-3-(pyridine-3-yl)propanoate cyanomethyl (compound SS55, F-Pnaz-MeA3Pyr-OCH2CN) (221 mg, 25%). LCMS(ESI) m / z = 505 (M+H)+ Retention time: 0.83 minutes (Analysis conditions SMD method 4)

[0230] Synthesis of (2S)-2-((((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)(methyl)amino)-3-(pyridine-3-yl)propanoic acid (2R,3S,4R,5R)-2-((((((2R,3S,4R,5R)-5-(4-amino-2-oxopyrimidine-1(2H)-yl)-4-hydroxy-2-((phosphonooxy)methyl)tetrahydrofuran-3-yl)oxy)(hydroxy)phosphoryl)oxy)methyl)-5-(6-amino-9H-purine-9-yl)-4-hydroxytetrahydrofuran-3-yl (compound SS48, F-Pnaz-MeA3Pyr-pCpA) [ka]

[0231] Buffer A (100 mL) contains ((2R,3R,4R,5R)-5-(4-amino-2-oxopyrimidine-1(2H)-yl)-3-(((((2R,3S,4R,5R)-5-(6-amino-9H-purine-9-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)(hydroxy)phosphoryl)oxy)-4-((tetrahydrofuran-2-yl)oxy)tetrahydrofuran-2-yl)methyl (compound pc01) (400 mg, 0.55) synthesized by the method described in the literature (Helv. Chim. Acta, 90, 297-310). (S)-2-((((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)(methyl)amino)-3-(pyridin-3-yl)propanoate cyanomethyl (compound SS55, F-Pnaz-MeA3Pyr-OCH2CN) (146 mg, 0.29 mmol) was dissolved, and an acetonitrile solution (5 mL) of (S)-2-((((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)(methyl)amino)-3-(pyridin-3-yl)propanoate cyanomethyl (compound SS55, F-Pnaz-MeA3Pyr-OCH2CN) (146 mg, 0.29 mmol) was added dropwise using a syringe pump over 15 minutes or more, and the mixture was stirred at room temperature for 1 hour. Trifluoroacetic acid (2.3 mL) was added to the reaction mixture, and the reaction mixture was freeze-dried. After purification by reverse-phase silica gel column chromatography (0.05% trifluoroacetic acid aqueous solution / 0.05% trifluoroacetic acid acetonitrile), the title compound (compound SS48, F-Pnaz-MeA3Pyr-pCpA) (64.4 mg, 5%) was obtained. LCMS(ESI) m / z = 1098.5 (MH)- Retention time: 0.39 minutes (Analysis conditions SQDFA05_01)

[0232] Synthesis of N-(((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)-O-(2-hydroxy-2-methylpropyl)-L-serine (compound SS56, F-Pnaz-StBuOH-OH) [ka]

[0233] Under a nitrogen atmosphere, a mixture of O-(2-hydroxy-2-methylpropyl)-L-serine (0.5 g, 2.83 mmol) synthesized by the method described in Patent Document (WO2018225864) and carbonate-(4-nitrophenyl)-4-(2-(4-fluorophenyl)acetamide)benzyl (compound ts11) (1 g, 2.36 mmol) synthesized by the method described in Patent Document (WO2018143145A1) was mixed with DMSO (7 mL) and triethylamine (0.65 mL, 4.72 mmol) at room temperature. The reaction mixture was stirred at room temperature for 16 hours, and then purified by reverse-phase silica gel column chromatography (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution) to obtain N-(((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)-O-(2-hydroxy-2-methylpropyl)-L-serine (compound SS56, F-Pnaz-StBuOH-OH) (1 g, 92%). LCMS(ESI) m / z = 485 (M+Na)+ Retention time: 0.80 minutes (Analysis conditions SMD method 5)

[0234] Cyanomethyl N-(((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)-O-(2-hydroxy-2-methylpropyl)-L-serinate (compound SS57, F-Pnaz-StBuOH-OCH 2 Synthesis of CN [ka]

[0235] Under a nitrogen atmosphere, N-(((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)-O-(2-hydroxy-2-methylpropyl)-L-serine (compound SS56, F-Pnaz-StBuOH-OH) (1.2 g, 2.59 mmol) and N-ethyl-isopropylpropan-2-amine (DIPEA) (670 mg, 5.18 mmol) were dissolved in DCM (36 mL), 2-bromoacetonitrile (1.23 g, 10.25 mmol) was added at room temperature, and the mixture was stirred at room temperature for 48 hours. The reaction mixture was concentrated and purified by normal-phase silica gel column chromatography (ethyl acetate / petroleum ether) to obtain cyanomethyl N-(((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)-O-(2-hydroxy-2-methylpropyl)-L-serinate (compound SS57, F-Pnaz-StBuOH-OCH2CN) (1 g, 77%). LCMS(ESI) m / z = 524 (M+Na)+ Retention time: 0.97 minutes (Analysis conditions SMD method 4)

[0236] Synthesis of (2R,3S,4R,5R)-2-((((((2R,3S,4R,5R)-5-(4-amino-2-oxopyrimidine-1(2H)-yl)-4-hydroxy-2-((phosphonooxy)methyl)tetrahydrofuran-3-yl)oxy)(hydroxy)phosphoryl)oxy)methyl)-5-(6-amino-9H-purine-9-yl)-4-hydroxytetrahydrofuran-3-yl N-(((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)-O-(2-hydroxy-2-methylpropyl)-L-serinate (compound SS49, F-Pnaz-StBuOH-pCpA) [ka]

[0237] Dissolve dihydrogen phosphate ((2R,3R,4R,5R)-5-(4-amino-2-oxopyrimidine-1(2H)-yl)-3-(((((2R,3S,4R,5R)-5-(6-amino-9H-purine-9-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)(hydroxy)phosphoryl)oxy)-4-((tetrahydrofuran-2-yl)oxy)tetrahydrofuran-2-yl)methyl (compound pc01) (400 mg, 0.55 mmol), synthesized by the method described in the literature (Helv. Chim. Acta, 90, 297-310), in buffer A (100 mL) and cyanomethyl A 5 mL acetonitrile solution of N-(((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)-O-(2-hydroxy-2-methylpropyl)-L-serinate (compound SS57, F-Pnaz-StBuOH-OCH2CN) (139 mg, 0.28 mmol) was added dropwise over 15 minutes or more using a syringe pump, and the mixture was stirred at room temperature for 1 hour. Trifluoroacetic acid (2.3 mL) was added to the reaction mixture, and the reaction mixture was freeze-dried. The mixture was then purified by reverse-phase silica gel column chromatography (0.05% trifluoroacetic acid aqueous solution / 0.05% trifluoroacetic acid acetonitrile) to obtain the title compound (compound SS49, F-Pnaz-StBuOH-pCpA) (55.3 mg, 5%). LCMS(ESI) m / z = 1095.4 (MH)- Retention time: 0.46 minutes (Analysis conditions SQDFA05_01)

[0238] Synthesis of N-methyl-O-propyl-L-serine (compound SS58, MeSnPr-OH) [ka]

[0239] (S)-2-((((9H-fluoren-9-yl)methoxy)carbonyl)(methyl)amino)-4-phenylbutanoic acid (compound aa52) (20 g, 52.16 mmol), synthesized by the method described in patent document (WO2018225864), was mixed with DMF (80 mL) and piperidine (30 mL) at room temperature, and the reaction mixture was stirred at room temperature for 3 hours. Diethyl ether (160 mL) and hexane (500 mL) were added, and the mixture was stirred at room temperature for a further 3 hours. The resulting precipitate was collected by filtration to obtain N-methyl-O-propyl-L-serine (compound SS58, MeSnPr-OH) (7 g, 83%). LCMS(ESI) m / z = 162 (M+H)+ Retention time: 0.34 minutes (Analysis conditions SMD method 2)

[0240] Synthesis of N-(((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)-N-methyl-O-propyl-L-serine (compound SS59, F-Pnaz-MeSnPr-OH) [ka]

[0241] Under a nitrogen atmosphere, a mixture of N-methyl-O-propyl-L-serine (compound SS58, MeSnPr-OH) (920 mg, 5.71 mmol) and carbonate-(4-nitrophenyl)-4-(2-(4-fluorophenyl)acetamide)benzyl (compound ts11) (2 g, 4.71 mmol) synthesized by the method described in Patent Document (WO2018143145A1) was mixed with DMSO (15 mL) and triethylamine (1.3 mL, 9.43 mmol) at room temperature. The reaction mixture was stirred at room temperature for 16 hours, and then purified by reverse-phase silica gel column chromatography (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution) to obtain N-(((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)-N-methyl-O-propyl-L-serine (compound SS59, F-Pnaz-MeSnPr-OH) (2 g, 95%). LCMS(ESI) m / z = 469 (M+Na)+ Retention time: 1.23 minutes (Analysis conditions SMD method 3)

[0242] Cyanomethyl N-(((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)-N-methyl-O-propyl-L-serinate (compound SS60, F-Pnaz-MeSnPr-OCH 2 Synthesis of CN [ka]

[0243] Under a nitrogen atmosphere, a mixture of N-(((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)-N-methyl-O-propyl-L-serine (compound SS59, F-Pnaz-MeSnPr-OH) (2.2 g, 4.93 mmol) and N-ethyl-isopropylpropan-2-amine (DIPEA) (1.28 g, 9.90 mmol) was dissolved in DCM (40 mL), 2-bromoacetonitrile (2.35 g, 19.59 mmol) was added at room temperature, and the mixture was stirred at room temperature for 48 hours. The reaction mixture was concentrated and purified by normal-phase silica gel column chromatography (ethyl acetate / petroleum ether) to obtain cyanomethyl N-(((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)-N-methyl-O-propyl-L-serinate (compound SS60, F-Pnaz-MeSnPr-OCH2CN) (2 g, 84%). LCMS(ESI) m / z = 508 (M+Na)+ Retention time: 1.32 minutes (Analysis conditions SMD method 3)

[0244] Synthesis of (2R,3S,4R,5R)-2-((((((2R,3S,4R,5R)-5-(4-amino-2-oxopyrimidine-1(2H)-yl)-4-hydroxy-2-((phosphonooxy)methyl)tetrahydrofuran-3-yl)oxy)(hydroxy)phosphoryl)oxy)methyl)-5-(6-amino-9H-purine-9-yl)-4-hydroxytetrahydrofuran-3-yl N-(((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)-N-methyl-O-propyl-L-serinate (compound SS50, F-Pnaz-MeSnPr-pCpA) [ka]

[0245] Dissolve dihydrogen phosphate ((2R,3R,4R,5R)-5-(4-amino-2-oxopyrimidine-1(2H)-yl)-3-(((((2R,3S,4R,5R)-5-(6-amino-9H-purine-9-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)(hydroxy)phosphoryl)oxy)-4-((tetrahydrofuran-2-yl)oxy)tetrahydrofuran-2-yl)methyl (compound pc01) (400 mg, 0.55 mmol), synthesized by the method described in the literature (Helv. Chim. Acta, 90, 297-310), in buffer A (100 mL) and cyanomethyl A 5 mL acetonitrile solution of N-(((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)-N-methyl-O-propyl-L-serinate (compound SS60, F-Pnaz-MeSnPr-OCH2CN) (135 mg, 0.28 mmol) was added dropwise over 15 minutes or more using a syringe pump, and the mixture was stirred at room temperature for 4 hours. Trifluoroacetic acid (2.3 mL) was added to the reaction mixture, and after lyophilization of the reaction mixture, it was purified by reverse-phase silica gel column chromatography (0.05% trifluoroacetic acid aqueous solution / 0.05% trifluoroacetic acid acetonitrile) to obtain the title compound (compound SS50, F-Pnaz-MeSnPr-pCpA) (70.2 mg, 6%). LCMS(ESI) m / z = 1079.5 (MH)- Retention time: 0.52 minutes (Analysis conditions SQDFA05_01)

[0246] Synthesis of (((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)-L-isoleucine (compound SS61, F-Pnaz-Ile-OH) [ka]

[0247] Under a nitrogen atmosphere, a mixture of L-isoleucine (52.5 mg, 0.40 mmol) and carbonate-(4-nitrophenyl)-4-(2-(4-fluorophenyl)acetamide)benzyl (compound ts11) (178 mg, 0.42 mmol) synthesized by the method described in Patent Document (WO2018143145A1) was mixed with DMSO (2 mL) and triethylamine (128 μL, 0.92 mmol) at room temperature. The reaction mixture was stirred at room temperature for 2.5 days, and then purified by reverse-phase silica gel column chromatography (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution) to obtain (((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)-L-isoleucine (compound SS61, F-Pnaz-Ile-OH) (125 mg, 75%). LCMS(ESI) m / z = 415.4 (MH)- Retention time: 0.74 minutes (Analysis conditions SQDFA05_02)

[0248] Cyanomethyl (((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)-L-isoleucineate (compound SS62, F-Pnaz-Ile-OCH 2 Synthesis of CN [ka]

[0249] Under a nitrogen atmosphere, (((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)-L-isoleucine (compound SS61, F-Pnaz-Ile-OH) (42 mg, 0.1 mmol) and 2-bromoacetonitrile (13 μL, 0.200 mmol) were dissolved in acetonitrile (500 μL), and N-ethyl-isopropylpropan-2-amine (DIPEA) (35 μL, 0.200 mmol) was added at room temperature. The mixture was stirred at room temperature for 16 hours. The reaction mixture was concentrated to obtain the crude product cyanomethyl (((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)-L-isoleucine (compound SS62, F-Pnaz-Ile-OCH2CN). The obtained crude product was dissolved in acetonitrile (3.00 mL) and used directly in the next step. LCMS(ESI) m / z = 454 (MH)- Retention time: 0.83 minutes (Analysis conditions SQDFA05_02)

[0250] Synthesis of (2R,3S,4R,5R)-2-((((((2R,3S,4R,5R)-5-(4-amino-2-oxopyrimidine-1(2H)-yl)-4-hydroxy-2-((phosphonooxy)methyl)tetrahydrofuran-3-yl)oxy)(hydroxy)phosphoryl)oxy)methyl)-5-(6-amino-9H-purine-9-yl)-4-hydroxytetrahydrofuran-3-yl (((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)-L-isoleucineate (compound SS51, F-Pnaz-Ile-pCpA) [ka]

[0251] Dissolve dihydrogen phosphate ((2R,3R,4R,5R)-5-(4-amino-2-oxopyrimidine-1(2H)-yl)-3-(((((2R,3S,4R,5R)-5-(6-amino-9H-purine-9-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)(hydroxy)phosphoryl)oxy)-4-((tetrahydrofuran-2-yl)oxy)tetrahydrofuran-2-yl)methyl (compound pc01) (72.2 mg, 0.100 mmol) synthesized by the method described in the literature (Helv. Chim. Acta, 90, 297-310) in buffer A (60 mL), and cyanomethyl A solution of (((4-(2-(4-fluorophenyl)acetamide)benzyl)oxy)carbonyl)-L-isoleucine (compound SS62, F-Pnaz-Ile-OCH2CN) (45.5 mg, 0.100 mmol) in acetonitrile (3.00 mL) was added and the mixture was stirred at room temperature for 20 hours. After cooling the reaction mixture to 0°C, trifluoroacetic acid (3.00 mL) was added. The reaction mixture was stirred at room temperature for 30 minutes, and then purified by reverse-phase silica gel column chromatography (0.05% trifluoroacetic acid aqueous solution / 0.05% trifluoroacetic acid acetonitrile) to obtain the title compound (compound SS51, F-Pnaz-Ile-pCpA) (12 mg, 11.4%). LCMS(ESI) m / z = 1049.4 (MH)- Retention time: 0.54 minutes (Analysis conditions SQDFA05_02)

[0252] Example 2. Synthesis of BdpFL-Phe-pCpA(MT01) Synthesis of (3-(5,5-difluoro-7,9-dimethyl-5H-4λ4,5λ4-dipyrrolo[1,2-c:2',1'-f][1,3,2]diazabolinin-3-yl)propanoyl)-L-phenylalanine (compound MT02, BdpFL-Phe-OH) [ka]

[0253] Under a nitrogen atmosphere, 3-(2-carboxyethyl)-5,5-difluoro-7,9-dimethyl-5H-5λ4-dipyrrolo[1,2-c:2',1'-f][1,3,2]diazabolinine-4-ium (200 mg, 0.685 mmol) and 1-hydroxypyrrolidine-2,5-dione (87 mg, 0.753 mmol) were mixed in NMP (4.5 mL) with DIC (0.128 ml, 0.822 mmol) at room temperature, and the mixture was stirred overnight at 40°C. After returning to room temperature, L-phenylalanine (113 mg, 0.685 mmol) and TEA (0.191 ml, 1.369 mmol) were added to the reaction mixture, and the mixture was stirred overnight at 40°C. The reaction mixture was purified by reverse-phase column chromatography (0.1% FA MeCN / H2O) to obtain (3-(5,5-difluoro-7,9-dimethyl-5H-4λ4,5λ4-dipyrrolo[1,2-c:2',1'-f][1,3,2]diazabolinin-3-yl)propanoyl)-L-phenylalanine (compound MT02, BdpFL-Phe-OH) (102 mg, 34% yield). LCMS(ESI) m / z = 438.3 (MH)- Retention time: 0.78 minutes (Analysis conditions SQDFA05_02)

[0254] (3-(5,5-difluoro-7,9-dimethyl-5H-4λ4,5λ4-dipyrrolo[1,2-c:2',1'-f][1,3,2]diazabolinin-3-yl)propanoyl)-L-phenylalanine cyanomethyl ester (compound MT03, BdpFL-Phe-OCH 2 Synthesis of CN [ka]

[0255] Under a nitrogen atmosphere, (3-(5,5-difluoro-7,9-dimethyl-5H-4λ4,5λ4-dipyrrolo[1,2-c:2',1'-f][1,3,2]diazabolinin-3-yl)propanoyl)-L-phenylalanine (50 mg, 0.114 mmol) and N-ethyl-isopropylpropan-2-amine (DIPEA) (31.0 μL, 0.177 mmol) were dissolved in acetonitrile (500 μL), and 2-bromoacetonitrile (12 μL, 0.177 mmol) was added at 0°C, followed by stirring at 40°C for 3 hours. The reaction mixture was concentrated to obtain (3-(5,5-difluoro-7,9-dimethyl-5H-4λ4,5λ4-dipyrrolo[1,2-c:2',1'-f][1,3,2]diazabolinin-3-yl)propanoyl)-L-phenylalanine cyanomethyl ester (compound MT03, BdpFL-Phe-OCH2CN) as the crude product. The obtained crude product was used directly in the next step. LCMS(ESI) m / z = 477.3(MH)- Retention time: 0.86 minutes (Analysis conditions SQDFA05_01)

[0256] 3-(3-(((2S)-1-(((2R,3S,4R,5R)-2-((((((2R,3S,4R,5R)-5-(4-amino-2-oxopyrimidine-1(2H)-yl)-4-hydroxy-2-((phosphonooxy)methyl)tetrahydrofuran-3-yl)oxy)(hydroxy)phospholyl)oxy)methyl)-5-(6-amino-9H-purine-9-yl)-4-hydroxytetrahydrofuran-3-yl)oxy)-1-oxo-3-phenylpropane-2-yl)amino)-3-oxopropyl)-5,5-difluoro-7,9-dimethyl-5H-5λ4-dipyrrolo Synthesis of [1,2-c:2',1'-f][1,3,2]diazabolinine-4-ium (compound MT01, BdpFL-Phe-pCpA) [ka]

[0257] ((2R,3R,4R,5R)-5-(4-amino-2-oxopyrimidine-1(2H)-yl)-3-(((((2R,3S,4R,5R)-5-(6-amino-9H-purine-9-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)(hydroxy)phosphoryl)oxy)-4-((tetrahydrofuran-2-yl)oxy)tetrahydrofuran-2-yl)methyl (compound pc01) (33.2 mg, 0.046 mmol) was dissolved in buffer A (11.3 mL) to form (3-(5,5-difluoro-7,9-dimethyl-5H-4λ4,5λ4-dipyrrolo[1,2-c:2',1'-f][1,3,2]diazabolinin-3-yl)propanoyl)-L-phenylalanine A solution of cyanomethyl ester (compound MT03, BdpFL-Phe-OCH2CN) (11 mg, 0.023 mmol) in acetonitrile (0.13 mL) was added, and the mixture was stirred at room temperature for 45 minutes. TFA (0.56 mL) was added to the reaction mixture at 0°C, and the mixture was stirred for 5 minutes, followed by stirring at room temperature for 10 minutes. The reaction mixture was purified by reverse-phase silica gel column chromatography (0.05% TFA MeCN / H2O) to obtain the title compound (compound MT01, BdpFL-Phe-pCpA) (2.1 mg, 8.5% yield). LCMS(ESI) m / z = 1072.5 (MH)- Retention time: 0.56 minutes (Analysis conditions SQDFA05_02)

[0258] Example 3. Synthesis of a peptide (LCT-67) with BdpFL at the N-terminus for use as a standard for LC / MS. [ka]

[0259] Using 100 mg of 2-chloromethylresin supported with Fmoc-Gly-OH, peptide elongation was performed in a peptide synthesizer using Fmoc-Gly-OH, Fmoc-Thr(THP)-OH(aa01), Fmoc-Ile-OH, Fmoc-Leu-OH, Fmoc-Phe-OH, Fmoc-MePhe-OH, and Fmoc-Pro-OH synthesized by the method described in Patent Document (WO2018225864) as Fmoc amino acids (abbreviations for amino acids are described separately in this specification). Peptide elongation was performed according to the peptide synthesis method using the Fmoc method (WO2013100132B2). After peptide elongation, the N-terminal Fmoc group was removed on the peptide synthesizer, and then the resin was washed with DCM. TFE / DCM (1:1, v / v, 2 mL) was added to the resin and shaken for 1 hour to excis the peptide from the resin. After the reaction was complete, the resin was removed by filtering the solution in the tube through a synthesis column, and the resin was washed twice with TFE / DCM (1:1, v / v, 1 mL). All extracts were mixed, DMF (2 mL) was added, and the mixture was concentrated under reduced pressure. The resulting residue was dissolved in NMP (1 mL), and 4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-propionic acid N-succinimidyl ester (5 mg, 0.013 mmol) was added at room temperature. After stirring for 19 hours, the reaction mixture was passed through reverse-phase silica gel column chromatography (0.1% FA MeCN / H2O), and the fraction containing the intermediate was concentrated under reduced pressure. The resulting residue was dissolved in 5% TFA in DCM (2 mL) and stirred at room temperature for 2 hours. After concentrating the reaction mixture under reduced pressure, the resulting residue was purified by reverse-phase silica gel column chromatography (0.1% FA MeCN / H2O) to obtain the title compound (LCT-67) (13 mg). The amino acid sequence of LCT-67 is shown in SEQ ID NO: 223. LCMS(ESI) m / z = 1751.2(MH)- Retention time: 0.97 minutes (Analysis conditions SQDFA05_02)

[0260] Example 4. Synthesis of a peptide (LCT-12) with BdpFL at the N-terminus for use as a standard for LC / MS. [ka]

[0261] Using 100 mg of 2-chloromethylresin supported with Fmoc-Ala-OH, peptide elongation was performed in a peptide synthesizer using Fmoc-Gly-OH, Fmoc-Thr(THP)-OH, Fmoc-Ile-OH, Fmoc-Phe-OH, and Fmoc-Pro-OH as Fmoc amino acids (abbreviations for amino acids are described separately in this specification). Peptide elongation was performed according to the Fmoc peptide synthesis method (WO2013100132B2). After peptide elongation, the N-terminal Fmoc group was removed on the peptide synthesizer, and the resin was washed with DCM. TFE / DCM (1:1, v / v, 2 mL) was added to the resin and shaken for 1 hour to excis the peptide from the resin. After the reaction was complete, the resin was removed by filtering the solution in the tube through a synthesis column, and the resin was washed twice with TFE / DCM (1:1, v / v, 1 mL). All extracts were mixed, DMF (2 mL) was added, and the mixture was concentrated under reduced pressure. The resulting residue was dissolved in NMP (0.5 mL), and 1 / 4 (125 μL) of it was used for the next reaction. BdpFL succinimide ester (140 μL), prepared to 76.5 mM, was added to the peptide NMP solution at room temperature, stirred overnight at 40°C, and then concentrated under reduced pressure. The resulting residue was dissolved in 0.05 M tetramethylammonium bisulfate in HFIP (1.2 mL, 0.060 mmol) and stirred at room temperature for 2 hours. The reaction mixture was purified by reverse-phase silica gel column chromatography (0.1% FA MeCN / H2O) to obtain the title compound (LCT-12) (0.3 mg). The amino acid sequence of LCT-12 is shown in Sequence ID No. 222. LCMS(ESI) m / z = 1972.9 (MH)- Retention time: 0.74 minutes (Analysis conditions SQDFA05_01)

[0262] Example 5. Synthesis of aminoacyl-tRNA tRNA (sequence numbers 38(TR-1) to 74(TR-37) and 242(TR-38) to 259(TR-55)) was synthesized from template DNA (sequence numbers 1(D-1) to 34(D-34), 35(D-76) to 37(D-78), and 224(D-82) to 241(D-99)) by in vitro transcription using T7 RNA polymerase, and purified using the RNeasy kit (Qiagen).

[0263] Template DNA Sequence ID: 1(D-1) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTAAGACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 2(D-2) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTTAGACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 3(D-3) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTCAGACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 4(D-4) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTAACACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 5(D-5) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTTACACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 6(D-6) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTCTCACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 7(D-7) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTATGACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 8(D-8) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTTTGACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 9(D-9) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTCTGACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 10(D-10) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTATTACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 11(D-11) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTTTTACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 12(D-12) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTCTTACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 13(D-13) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTATCACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 14(D-14) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 15(D-15) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTCTCACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 16(D-16) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTAAAACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 17(D-17) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTTAAACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 18(D-18) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTCAAACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 19 (D-19) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTACTACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 20(D-20) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTTCTACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 21(D-21) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTCCTACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 22(D-22) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTGCAACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 23(D-23) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTTCAACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 24 (D-24) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTCCAACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 25(D-25) DNA sequence: GGCGTAATACGACTCACTATAGGCGGGGTGGAGCAGCCTGGTAGCTCGTCGGGCTCATAACCCGAAGATCGTCGGTTCAAATCCGGCCCCGCAA Template DNA sequence number: 26(D-26) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTGTGACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 27 (D-27) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTGTTACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 28(D-28) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTGTCACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 29 (D-29) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTGAAACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 30 (D-30) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTGCTACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 31(D-31) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTTGAACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 32 (D-32) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTTGTACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 33(D-33) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTTATACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 34 (D-34) DNA sequence: GGCGTAATACGACTCACTATAGGCCCCTTAGCTCAGTGGTTAGAGCAGGCGACTTATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCAC Template DNA Sequence ID: 35(D-76) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTGCGACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 36(D-77) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTTCGACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 37(D-78) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTCCGACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA Sequence ID: 224(D-82) DNA sequence: GGCGTAATACGACTCACTATAGGAGCGGTAGTTCAGTCGGTTAGAATACCTGCCTAUGACGCAGGGGGTCGCGGGTTCGAGTCCCGTCCGTTCCGC Template DNA Sequence ID: 225(D-83) DNA sequence: GGCGTAATACGACTCACTATAGGAGCGGTAGTTCAGTCGGTTAGAATACCTGCTTAUGATGCAGGGGGTCGCGGGTTCGAGTCCCGTCCGTTCCGC Template DNA Sequence ID: 226(D-84) DNA sequence: GGCGTAATACGACTCACTATAGGAGCGGTAGTTCAGTCGGTTAGAATACCTGCCTGUGACGCAGGGGGTCGCGGGTTCGAGTCCCGTCCGTTCCGC Template DNA Sequence ID: 227(D-85) DNA sequence: GGCGTAATACGACTCACTATAGGAGCGGTAGTTCAGTCGGTTAGAATACCTGCTTGUGATGCAGGGGGTCGCGGGTTCGAGTCCCGTCCGTTCCGC Template DNA Sequence ID: 228(D-86) DNA sequence: GGCGTAATACGACTCACTATAGGAGCGGTAGTTCAGTCGGTTAGAATACCTGCCTUUGACGCAGGGGGTCGCGGGTTCGAGTCCCGTCCGTTCCGC Template DNA Sequence ID: 229(D-87) DNA sequence: GGCGTAATACGACTCACTATAGGAGCGGTAGTTCAGTCGGTTAGAATACCTGCTTUUGATGCAGGGGGTCGCGGGTTCGAGTCCCGTCCGTTCCGC Template DNA Sequence ID: 230(D-88) DNA sequence: GGCGTAATACGACTCACTATAGGAGCGGTAGTTCAGTCGGTTAGAATACCTGCCTCUGACGCAGGGGGTCGCGGGTTCGAGTCCCGTCCGTTCCGC Template DNA Sequence ID: 231(D-89) DNA sequence: GGCGTAATACGACTCACTATAGGAGCGGTAGTTCAGTCGGTTAGAATACCTGCTTCUGATGCAGGGGGTCGCGGGTTCGAGTCCCGTCCGTTCCGC Template DNA Sequence ID: 232(D-90) DNA sequence: GGCGTAATACGACTCACTATAGGAGCGGTAGTTCAGTCGGTTAGAATACCTGCCTAUCACGCAGGGGGTCGCGGGTTCGAGTCCCGTCCGTTCCGC Template DNA Sequence ID: 233(D-91) DNA sequence: GGCGTAATACGACTCACTATAGGAGCGGTAGTTCAGTCGGTTAGAATACCTGCCTUUCACGCAGGGGGTCGCGGGTTCGAGTCCCGTCCGTTCCGC Template DNA Sequence ID: 234(D-92) DNA sequence: GGCGTAATACGACTCACTATAGGAGCGGTAGTTCAGTCGGTTAGAATACCTGCCTCUCACGCAGGGGGTCGCGGGTTCGAGTCCCGTCCGTTCCGC Template DNA Sequence ID: 235(D-93) DNA sequence: GGCGTAATACGACTCACTATAGGCTCTGTAGTTCAGTCGGTAGAACGGCGGATTATGATTCCGTATGTCACTGGTTCGAGTCCAGTCAGAGCCGC Template DNA Sequence ID: 236(D-94) DNA sequence: GGCGTAATACGACTCACTATAGGCTCTGTAGTTCAGTCGGTAGAACGGCGGATTGTGATTCCGTATGTCACTGGTTCGAGTCCAGTCAGAGCCGC Template DNA Sequence ID: 237(D-95) DNA sequence: GGCGTAATACGACTCACTATAGGCTCTGTAGTTCAGTCGGTAGAACGGCGGATTTTGATTCCGTATGTCACTGGTTCGAGTCCAGTCAGAGCCGC Template DNA Sequence ID: 238(D-96) DNA sequence: GGCGTAATACGACTCACTATAGGCTCTGTAGTTCAGTCGGTAGAACGGCGGATTCTGATTCCGTATGTCACTGGTTCGAGTCCAGTCAGAGCCGC Template DNA Sequence ID: 239(D-97) DNA sequence: GGCGTAATACGACTCACTATAGGCTCTGTAGTTCAGTCGGTAGAACGGCGGACTATCACTCCGTATGTCACTGGTTCGAGTCCAGTCAGAGCCGC Template DNA Sequence ID: 240(D-98) DNA sequence: GGCGTAATACGACTCACTATAGGCTCTGTAGTTCAGTCGGTAGAACGGCGGACTTTCACTCCGTATGTCACTGGTTCGAGTCCAGTCAGAGCCGC Template DNA Sequence ID: 241(D-99) DNA sequence: GGCGTAATACGACTCACTATAGGCTCTGTAGTTCAGTCGGTAGAACGGCGGACTCTCACTCCGTATGTCACTGGTTCGAGTCCAGTCAGAGCCGC

[0264] tRNA Sequence ID: 38(TR-1) tRNA(Glu)aag-CARNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUAAGACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA Sequence ID: 39(TR-2) tRNA(Glu)uag-CARNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUUAGACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA sequence number: 40 (TR-3) tRNA(Glu)cag-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUCAGACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA sequence number: 41 (TR-4) tRNA(Glu)aac-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUAACACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA SEQ ID NO:42(TR-5) tRNA(Glu)uac-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUUACACGGCGUAAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA SEQ ID NO:43(TR-6) tRNA(Glu)cac-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUCACACGGCGGUAAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA SEQ ID NO:44(TR-7) tRNA(Glu)aug-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUAUGACGGCGGUAAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA SEQ ID NO:45(TR-8) tRNA(Glu)uug-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUUUGACGGCGGUAAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA SEQ ID NO:46(TR-9) tRNA(Glu)cug-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUCUGACGGCGGUACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA SEQ ID NO:47(TR-10) tRNA(Glu)auu-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUAUUACGGCGUAAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA sequence number: 48 (TR-11) tRNA(Glu)uuu-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUUUUACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA sequence number: 49 (TR-12) tRNA(Glu)cuu-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUCUUACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA Sequence ID: 50 (TR-13) tRNA(Glu)auc-CARNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUAUCACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA sequence number: 51 (TR-14) tRNA(Glu)uuc-CARNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUUUCACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA sequence number: 52 (TR-15) tRNA(Glu)cuc-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUCUCACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA Sequence ID: 53 (TR-16) tRNA(Glu)aaa-CARNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUAAAACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA sequence number: 54 (TR-17) tRNA(Glu)uaa-CARNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUUAAAACGGCGGUAAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA SEQ ID NO:55(TR-18) tRNA(Glu)caa-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUCAAACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA SEQ ID NO:56(TR-19) tRNA(Glu)acu-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUACUACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA SEQ ID NO:57(TR-20) tRNA(Glu)ucu-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUUCUACGGCGGUAAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA SEQ ID NO:58(TR-21) tRNA(Glu)ccu-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUCCUACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA SEQ ID NO:59(TR-22) tRNA(Glu)gca-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUGCAACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA SEQ ID NO:60(TR-23) tRNA(Glu)uca-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUUCAACGGCGGUAAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA sequence number: 61 (TR-24) tRNA(Glu)cca-CARNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUCCAACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA sequence number: 62 (TR-25) tRNA(fMet)cau-CA RNA sequence: GGCGGGGUGGAGCAGCCUGGUAGCUCGUCGGGCUCAUAACCCGAAGAUCGUCGGUUCAAAUCCGGCCCCGCAA tRNA Sequence ID: 63 (TR-26) tRNA(Glu)gug-CARNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUGUGACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA sequence number: 64 (TR-27) tRNA(Glu)guu-CARNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUGUUACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA Sequence ID: 65 (TR-28) tRNA(Glu)guc-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUGUCACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA sequence number: 66 (TR-29) tRNA(Glu)gaa-CARNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUGAAACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA sequence number: 67 (TR-30) tRNA(Glu)gcu-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUGCUACGGCGGUAAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA SEQ ID NO:68(TR-31) tRNA(Glu)uga-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUUGAACGCGGUAAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA SEQ ID NO:69(TR-32) tRNA(Glu)ugu-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUUGUACGGCGGUAAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA SEQ ID NO:70(TR-33) tRNA(Glu)uau-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUUAUACGGCGGUAAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA SEQ ID NO:71(TR-34) tRNA(Ile)uau-CA RNA sequence: GGCCCCUUAGCUCAGUGGUUAGAGCAGGCGACUUAUAAUCGCUUGGUCGCUGGUUCAAGUCCAGCAGGGGCCAC tRNA SEQ ID NO:72(TR-35) tRNA(Glu)gcg-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUGCGACGGCGGUAAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA SEQ ID NO:73(TR-36) tRNA(Glu)ucg-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUUCGACGCGGUAAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA sequence number: 74 (TR-37) tRNA(Glu)ccg-CARNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUCCGACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA Sequence ID: 242 (TR-38) tRNA(Asp)aug-CA RNA sequence: GGAGCGGUAGUUCAGUCGGUUAGAAUACCUGCCUAUGACGCAGGGGGUCGCGGGUUCGAGUCCCGUCCGUUCCGC tRNA sequence number: 243 (TR-39) tRNA(Asp)ccg-CA RNA sequence: GGAGCGGUAGUUCAGUCGGUUAGAAUACCUGCUUAUGAUGCAGGGGGUCGCGGGUUCGAGUCCCGUCCGUUCCGC tRNA sequence number: 244 (TR-40) tRNA(Asp)gug-CA RNA sequence: GGAGCGGUAGUUCAGUCGGUUAGAAUACCUGCCUGUGACGCAGGGGGUCGCGGGUUCGAGUCCCGUCCGUUCCGC tRNA sequence number: 245 (TR-41) tRNA(Asp)gug-CA RNA sequence: GGAGCGGUAGUUCAGUCGGUUAGAAUACCUGCUUGUGAUGCAGGGGGUCGCGGGUUCGAGUCCCGUCCGUUCCGC tRNA sequence number: 246 (TR-42) tRNA(Asp)uug-CA RNA sequence: GGAGCGGUAGUUCAGUCGGUUAGAAUACCUGCCUUUGACGCAGGGGGUCGCGGGUUCGAGUCCCGUCCGUUCCGC tRNA sequence number: 247 (TR-43) tRNA(Asp)uug-CA RNA sequence: GGAGCGGUAGUUCAGUCGGUUAGAAUACCUGCUUUUGAUGCAGGGGGUCGCGGGUUCGAGUCCCGUCCGUUCCGC tRNA sequence number: 248 (TR-44) tRNA(Asp)cug-CA RNA sequence: GGAGCGGUAGUUCAGUCGGUUAGAAUACCUGCCUCUGACGCAGGGGGUCGCGGGUUCGAGUCCCGUCCGUUCCGC tRNA sequence number: 249 (TR-45) tRNA(Asp)cug-CA RNA sequence: GGAGCGGUAGUUCAGUCGGUUAGAAUACCUGCUUCUGAUGCAGGGGGUCGCGGGUUCGAGUCCCGUCCGUUCCGC tRNA sequence number: 250 (TR-46) tRNA(Asp)auc-CA RNA sequence: GGAGCGGUAGUUCAGUCGGUUAGAAUACCUGCCUAUCACGCAGGGGGUCGCGGGUUCGAGUCCCGUCCGUUCCGC tRNA sequence number: 251 (TR-47) tRNA(Asp)uuc-CA RNA sequence: GGAGCGGUAGUUCAGUCGGUUAGAAUACCUGCCUUUCACGCAGGGGGUCGCGGGUUCGAGUCCCGUCCGUUCCGC tRNA sequence number: 252 (TR-48) tRNA(Asp)cuc-CA RNA sequence: GGAGCGGUAGUUCAGUCGGUUAGAAUACCUGCCUCUCACGCAGGGGGUCGCGGGUUCGAGUCCCGUCCGUUCCGC tRNA sequence number: 253 (TR-49) tRNA(AsnE2)aug-CA RNA sequence: GGCUCUGUAGUUCAGUCGGUAGAACGGCGGAUUAUGAUUCCGUAUGUCACUGGUUCGAGUCCAGUCAGAGCCGC tRNA sequence number: 254 (TR-50) tRNA(AsnE2)gug-CA RNA sequence: GGCUCUGUAGUUCAGUCGGUAGAACGGCGGAUUGUGAUUCCGUAUGUCACUGGUUCGAGUCCAGUCAGAGCCGC tRNA sequence number: 255 (TR-51) tRNA(AsnE2)uug-CA RNA sequence: GGCUCUGUAGUUCAGUCGGUAGAACGGCGGAUUUUGAUUCCGUAUGUCACUGGUUCGAGUCCAGUCAGAGCCGC tRNA sequence number: 256 (TR-52) tRNA(AsnE2)cug-CA RNA sequence: GGCUCUGUAGUUCAGUCGGUAGAACGGCGGAUUCUGAUUCCGUAUGUCACUGGUUCGAGUCCAGUCAGAGCCGC tRNA sequence number: 257 (TR-53) tRNA(AsnE2)auc-CA RNA sequence: GGCUCUGUAGUUCAGUCGGUAGAACGGCGGACUAUCACUCCGUAUGUCCUGGUUCGAGUCCAGUCAGAGCCGC tRNA sequence number: 258 (TR-54) tRNA(AsnE2)uuc-CA RNA sequence: GGCUCUGUAGUUCAGUCGGUAGAACGGCGGACUUUCACUCCGUAUGUCACUGGUUCGAGUCCAGUCAGAGCCGC tRNA sequence number: 259 (TR-55) tRNA(AsnE2)cuc-CA RNA sequence: GGCUCUGUAGUUCAGUCGGUAGAACGGCGGACUCUCACUCCGUAUUGUCACUGGUUCGAGUCCAGUCAGAGCCGC

[0265] Preparation of an aminoacyl-tRNA mixture using aminoacyl pCpA To prepare compound AAtR-1, a reaction solution was prepared by making up with nuclease-free water to the following concentration: 25 μM transcribed tRNA (Glu)aag-CA (SEQ ID NO: 38 (TR-1)), 50 mM HEPES-KOH pH 7.5, 20 mM MgCl2, 1 mM ATP, 0.6 unit / μl T4 RNA ligase (New England Bio Lab.), and 0.25 mM aminoacylated pCpA (DMSO solution of compound ts14 described in patent (WO2018143145A1), synthesized by the method described in patent (WO2018143145A1)). The ligation reaction was carried out at 15°C for 45 minutes. However, before adding the T4 RNA ligase and aminoacylated pCpA, the reaction solution was heated at 95°C for 2 minutes and then left at room temperature for 5 minutes to pre-fold the tRNA. Furthermore, all aminoacylated pCpA compounds beginning with "ts" or "TS" hereafter are compounds described in WO2018143145A1, synthesized by the method described in WO2018143145A1. Similarly, to prepare compound AAtR-2, a ligation reaction was performed on transcribed tRNA (Glu)uag-CA (SEQ ID NO: 39 (TR-2)) with aminoacylated pCpA (SS14) using the method described above. Similarly, to prepare compound AAtR-3, a ligation reaction was performed on transcribed tRNA (Glu)cag-CA (SEQ ID NO: 40 (TR-3)) with aminoacylated pCpA (TS24) using the method described above. Similarly, to prepare compound AAtR-4, the ligation reaction of aminoacylated pCpA(ts14) with transcribed tRNA(Glu)aac-CA (SEQ ID NO: 41(TR-4)) was performed using the method described above. Similarly, to prepare compound AAtR-5, a ligation reaction was performed on transcribed tRNA (Glu)uac-CA (SEQ ID NO: 42 (TR-5)) with aminoacylated pCpA (SS14) using the method described above. Similarly, to prepare compound AAtR-6, a ligation reaction was performed on transcribed tRNA (Glu)cac-CA (SEQ ID NO: 43 (TR-6)) with aminoacylated pCpA (TS24) using the method described above. Similarly, to prepare compound AAtR-7, a ligation reaction was performed on transcribed tRNA(Glu)aug-CA (SEQ ID NO: 44(TR-7)) with aminoacylated pCpA(ts14) using the method described above. Similarly, to prepare compound AAtR-8, a ligation reaction was performed on transcribed tRNA (Glu)uug-CA (SEQ ID NO: 45 (TR-8)) with aminoacylated pCpA (SS14) using the method described above. Similarly, to prepare compound AAtR-9, a ligation reaction was performed on transcribed tRNA (Glu)cug-CA (SEQ ID NO: 46 (TR-9)) with aminoacylated pCpA (TS24) using the method described above. Similarly, to prepare compound AAtR-10, a ligation reaction was performed on transcribed tRNA (Glu)auu-CA (SEQ ID NO: 47 (TR-10)) with aminoacylated pCpA (ts14) using the method described above. Similarly, to prepare compound AAtR-11, a ligation reaction was performed on transcribed tRNA (Glu)uuu-CA (SEQ ID NO: 48 (TR-11)) with aminoacylated pCpA (SS14) using the method described above. Similarly, to prepare compound AAtR-12, a ligation reaction was performed on transcribed tRNA (Glu)cuu-CA (SEQ ID NO: 49 (TR-12)) with aminoacylated pCpA (TS24) using the method described above. Similarly, to prepare compound AAtR-13, a ligation reaction was performed on transcribed tRNA (Glu)auc-CA (SEQ ID NO: 50 (TR-13)) with aminoacylated pCpA (ts14) using the method described above. Similarly, to prepare compound AAtR-14, a ligation reaction was performed on transcribed tRNA (Glu)uuc-CA (SEQ ID NO: 51 (TR-14)) with aminoacylated pCpA (SS14) using the method described above. Similarly, to prepare compound AAtR-15, a ligation reaction was performed on transcribed tRNA (Glu)cuc-CA (SEQ ID NO: 52 (TR-15)) with aminoacylated pCpA (TS24) using the method described above. Similarly, to prepare compound AAtR-16, the transcriptional tRNA (Glu)aaa-CA (SEQ ID NO: 53 (TR-16)) was ligated with aminoacylated pCpA (ts14) using the method described above. Similarly, to prepare compound AAtR-17, a ligation reaction was performed on transcribed tRNA (Glu)uaa-CA (SEQ ID NO: 54 (TR-17)) with aminoacylated pCpA (SS14) using the method described above. Similarly, to prepare compound AAtR-18, a ligation reaction was performed on transcribed tRNA (Glu)caa-CA (SEQ ID NO: 55 (TR-18)) with aminoacylated pCpA (TS24) using the method described above. Similarly, to prepare compound AAtR-19, a ligation reaction was performed on transcribed tRNA (Glu)acu-CA (SEQ ID NO: 56 (TR-19)) with aminoacylated pCpA (ts14) using the method described above. Similarly, to prepare compound AAtR-20, a ligation reaction was performed on transcribed tRNA (Glu)ucu-CA (SEQ ID NO: 57 (TR-20)) with aminoacylated pCpA (SS14) using the method described above. Similarly, to prepare compound AAtR-21, a ligation reaction was performed on transcribed tRNA (Glu)ccu-CA (SEQ ID NO: 58 (TR-21)) with aminoacylated pCpA (TS24) using the method described above. Similarly, to prepare compound AAtR-22, a ligation reaction was performed on transcribed tRNA(Glu)gca-CA (SEQ ID NO: 59(TR-22)) with aminoacylated pCpA(ts14) using the method described above. Similarly, to prepare compound AAtR-23, a ligation reaction was performed on transcribed tRNA (Glu)uca-CA (SEQ ID NO: 60 (TR-23)) with aminoacylated pCpA (SS14) using the method described above. Similarly, to prepare compound AAtR-24, a ligation reaction was performed on transcribed tRNA (Glu)cca-CA (SEQ ID NO: 61 (TR-24)) with aminoacylated pCpA (TS24) using the method described above. Similarly, to prepare compound AAtR-26, a ligation reaction was performed on transcribed tRNA (Glu)gug-CA (SEQ ID NO: 63 (TR-26)) with aminoacylated pCpA (ts14) using the method described above. Similarly, to prepare compound AAtR-27, a ligation reaction was performed on transcribed tRNA (Glu)guu-CA (SEQ ID NO: 64 (TR-27)) with aminoacylated pCpA (ts14) using the method described above. Similarly, to prepare compound AAtR-28, a ligation reaction was performed on transcribed tRNA (Glu)gcu-CA (SEQ ID NO: 67 (TR-30)) with aminoacylated pCpA (ts14) using the method described above. Similarly, to prepare compound AAtR-29, a ligation reaction was performed on transcribed tRNA (Glu)aug-CA (SEQ ID NO: 44 (TR-7)) with aminoacylated pCpA (SS48) using the method described above. Similarly, to prepare compound AAtR-30, a ligation reaction was performed on transcribed tRNA (Glu)uug-CA (SEQ ID NO: 45 (TR-8)) with aminoacylated pCpA (SS49) using the method described above. Similarly, to prepare compound AAtR-31, a ligation reaction was performed on transcribed tRNA (Glu)cug-CA (SEQ ID NO: 46 (TR-9)) with aminoacylated pCpA (SS50) using the method described above. Similarly, to prepare compound AAtR-32, a ligation reaction was performed on transcribed tRNA (Glu)auu-CA (SEQ ID NO: 47 (TR-10)) with aminoacylated pCpA (SS48) using the method described above. Similarly, to prepare compound AAtR-33, a ligation reaction was performed on transcribed tRNA (Glu)uuu-CA (SEQ ID NO: 48 (TR-11)) with aminoacylated pCpA (SS49) using the method described above. Similarly, to prepare compound AAtR-34, a ligation reaction was performed on transcribed tRNA (Glu)cuu-CA (SEQ ID NO: 49 (TR-12)) with aminoacylated pCpA (SS50) using the method described above. Similarly, to prepare compound AAtR-35, a ligation reaction was performed on transcribed tRNA (Glu)auc-CA (SEQ ID NO: 50 (TR-13)) with aminoacylated pCpA (SS48) using the method described above. Similarly, to prepare compound AAtR-36, a ligation reaction was performed on transcribed tRNA (Glu)uuc-CA (SEQ ID NO: 51 (TR-14)) with aminoacylated pCpA (SS49) using the method described above. Similarly, to prepare compound AAtR-37, a ligation reaction was performed on transcribed tRNA (Glu)cuc-CA (SEQ ID NO: 52 (TR-15)) with aminoacylated pCpA (SS50) using the method described above. Similarly, to prepare compound AAtR-38, a ligation reaction was performed on transcribed tRNA (Glu)aaa-CA (SEQ ID NO: 53 (TR-16)) with aminoacylated pCpA (SS48) using the method described above. Similarly, to prepare compound AAtR-39, a ligation reaction was performed on transcribed tRNA (Glu)uaa-CA (SEQ ID NO: 54 (TR-17)) with aminoacylated pCpA (SS49) using the method described above. Similarly, to prepare compound AAtR-40, a ligation reaction was performed on transcribed tRNA (Glu)caa-CA (SEQ ID NO: 55 (TR-18)) with aminoacylated pCpA (SS50) using the method described above. Similarly, to prepare compound AAtR-41, a ligation reaction was performed on transcribed tRNA (Glu)acu-CA (SEQ ID NO: 56 (TR-19)) with aminoacylated pCpA (SS48) using the method described above. Similarly, to prepare compound AAtR-42, a ligation reaction was performed on transcribed tRNA (Glu)ucu-CA (SEQ ID NO: 57 (TR-20)) with aminoacylated pCpA (SS49) using the method described above. Similarly, to prepare compound AAtR-43, a ligation reaction was performed on transcribed tRNA (Glu)ccu-CA (SEQ ID NO: 58 (TR-21)) with aminoacylated pCpA (SS50) using the method described above. Similarly, to prepare compound AAtR-44, a ligation reaction was performed on transcribed tRNA (Glu)gca-CA (SEQ ID NO: 59 (TR-22)) with aminoacylated pCpA (SS48) using the method described above. Similarly, to prepare compound AAtR-45, a ligation reaction was performed on transcribed tRNA (Glu)uca-CA (SEQ ID NO: 60 (TR-23)) with aminoacylated pCpA (SS49) using the method described above. Similarly, to prepare compound AAtR-46, a ligation reaction was performed on transcribed tRNA (Glu)cca-CA (SEQ ID NO: 61 (TR-24)) with aminoacylated pCpA (SS50) using the method described above. Similarly, to prepare compound AAtR-47, a ligation reaction was performed on transcribed tRNA (Glu)gug-CA (SEQ ID NO: 63 (TR-26)) with aminoacylated pCpA (SS48) using the method described above. Similarly, to prepare compound AAtR-48, a ligation reaction was performed on transcribed tRNA (Glu)guu-CA (SEQ ID NO: 64 (TR-27)) with aminoacylated pCpA (SS48) using the method described above. Similarly, to prepare compound AAtR-49, a ligation reaction was performed on transcribed tRNA (Glu)guc-CA (SEQ ID NO: 65 (TR-28)) with aminoacylated pCpA (SS48) using the method described above. Similarly, to prepare compound AAtR-50, a ligation reaction was performed on transcribed tRNA (Glu)gaa-CA (SEQ ID NO: 66 (TR-29)) with aminoacylated pCpA (SS48) using the method described above. Similarly, to prepare compound AAtR-51, a ligation reaction was performed on transcribed tRNA (Glu)gcu-CA (SEQ ID NO: 67 (TR-30)) with aminoacylated pCpA (SS48) using the method described above. Similarly, to prepare compound AAtR-52, a ligation reaction was performed on transcribed tRNA (Glu)uga-CA (SEQ ID NO: 68 (TR-31)) with aminoacylated pCpA (SS16) using the method described above. Similarly, to prepare compound AAtR-53, a ligation reaction was performed on transcribed tRNA (Glu)ugu-CA (SEQ ID NO: 69 (TR-32)) with aminoacylated pCpA (SS16) using the method described above. Similarly, to prepare compound AAtR-54, a ligation reaction was performed on transcribed tRNA (Glu)uau-CA (SEQ ID NO: 70 (TR-33)) with aminoacylated pCpA (SS16) using the method described above. Similarly, to prepare compound AAtR-55, a ligation reaction was performed on transcribed tRNA (Ile)uau-CA (SEQ ID NO: 71 (TR-34)) with aminoacylated pCpA (SS16) using the method described above. Similarly, to prepare compound AAtR-56, a ligation reaction was performed on transcribed tRNA (Ile)uau-CA (SEQ ID NO: 71 (TR-34)) with aminoacylated pCpA (SS51) using the method described above. Similarly, to prepare compound AAtR-57, a ligation reaction was performed on transcribed tRNA(Glu)gcg-CA (SEQ ID NO: 72(TR-35)) with aminoacylated pCpA(ts14) using the method described above. Similarly, to prepare compound AAtR-58, a ligation reaction was performed on transcribed tRNA (Glu)ucg-CA (SEQ ID NO: 73 (TR-36)) with aminoacylated pCpA (SS15) using the method described above. Similarly, to prepare compound AAtR-59, a ligation reaction was performed on transcribed tRNA (Glu)ccg-CA (SEQ ID NO: 74 (TR-37)) with aminoacylated pCpA (TS24) using the method described above. Similarly, to prepare compound AAtR-60, a ligation reaction was performed on transcribed tRNA(Asp)aug-CA (SEQ ID NO: 242(TR-38)) with aminoacylated pCpA(ts14) using the method described above. Similarly, to prepare compound AAtR-61, a ligation reaction was performed on transcribed tRNA(Asp)uug-CA (SEQ ID NO: 246(TR-42)) with aminoacylated pCpA(SS14) using the method described above. Similarly, to prepare compound AAtR-62, a ligation reaction was performed on transcribed tRNA(Asp)cug-CA (SEQ ID NO: 248(TR-44)) with aminoacylated pCpA(TS24) using the method described above. Similarly, to prepare compound AAtR-63, a ligation reaction was performed on transcribed tRNA(Asp)aug-CA (SEQ ID NO: 243(TR-39)) with aminoacylated pCpA(ts14) using the method described above. Similarly, to prepare compound AAtR-64, a ligation reaction was performed on transcribed tRNA(Asp)uug-CA (SEQ ID NO: 247(TR-43)) with aminoacylated pCpA(SS14) using the method described above. Similarly, to prepare compound AAtR-65, a ligation reaction was performed on transcribed tRNA(Asp)cug-CA (SEQ ID NO: 249(TR-45)) with aminoacylated pCpA(TS24) using the method described above. Similarly, to prepare compound AAtR-66, a ligation reaction was performed on transcribed tRNA(Asp)gug-CA (SEQ ID NO: 244(TR-40)) with aminoacylated pCpA(ts14) using the method described above. Similarly, to prepare compound AAtR-67, a ligation reaction was performed on transcribed tRNA(Asp)uug-CA (SEQ ID NO: 246(TR-42)) with aminoacylated pCpA(SS14) using the method described above. Similarly, to prepare compound AAtR-68, a ligation reaction was performed on transcribed tRNA(Asp)cug-CA (SEQ ID NO: 248(TR-44)) with aminoacylated pCpA(TS24) using the method described above. Similarly, to prepare compound AAtR-69, a ligation reaction was performed on transcribed tRNA(Asp)gug-CA (SEQ ID NO: 245(TR-41)) with aminoacylated pCpA(ts14) using the method described above. Similarly, to prepare compound AAtR-70, a ligation reaction was performed on transcribed tRNA(Asp)uug-CA (SEQ ID NO: 247(TR-43)) with aminoacylated pCpA(SS14) using the method described above. Similarly, to prepare compound AAtR-71, a ligation reaction was performed on transcribed tRNA(Asp)cug-CA (SEQ ID NO: 249(TR-45)) with aminoacylated pCpA(TS24) using the method described above. Similarly, to prepare compound AAtR-72, a ligation reaction was performed on transcribed tRNA(Asp)auc-CA (SEQ ID NO: 250(TR-46)) with aminoacylated pCpA(ts14) using the method described above. Similarly, to prepare compound AAtR-73, a ligation reaction was performed on transcribed tRNA(Asp)uuc-CA (SEQ ID NO: 251(TR-47)) with aminoacylated pCpA(SS14) using the method described above. Similarly, to prepare compound AAtR-74, a ligation reaction was performed on transcribed tRNA (Asp)cuc-CA (SEQ ID NO: 252 (TR-48)) with aminoacylated pCpA (TS24) using the method described above. Similarly, to prepare compound AAtR-75, a ligation reaction was performed on transcribed tRNA (AsnE2)aug-CA (SEQ ID NO: 253 (TR-49)) with aminoacylated pCpA (SS48) using the method described above. Similarly, to prepare compound AAtR-76, a ligation reaction was performed on transcribed tRNA (AsnE2)uug-CA (SEQ ID NO: 255 (TR-51)) with aminoacylated pCpA (SS49) using the method described above. Similarly, to prepare compound AAtR-77, a ligation reaction was performed on transcribed tRNA (AsnE2)cug-CA (SEQ ID NO: 256 (TR-52)) with aminoacylated pCpA (SS50) using the method described above. Similarly, to prepare compound AAtR-78, a ligation reaction was performed on transcribed tRNA (AsnE2)gug-CA (SEQ ID NO: 254 (TR-50)) with aminoacylated pCpA (SS48) using the method described above. Similarly, to prepare compound AAtR-79, a ligation reaction was performed on transcribed tRNA (AsnE2)uug-CA (SEQ ID NO: 255 (TR-51)) with aminoacylated pCpA (SS49) using the method described above. Similarly, to prepare compound AAtR-80, a ligation reaction was performed on transcribed tRNA (AsnE2)cug-CA (SEQ ID NO: 256 (TR-52)) with aminoacylated pCpA (SS50) using the method described above. Similarly, to prepare compound AAtR-81, a ligation reaction was performed on transcribed tRNA (AsnE2)auc-CA (SEQ ID NO: 257 (TR-53)) with aminoacylated pCpA (SS48) using the method described above. Similarly, to prepare compound AAtR-82, a ligation reaction was performed on transcribed tRNA (AsnE2)uuc-CA (SEQ ID NO: 258 (TR-54)) with aminoacylated pCpA (SS49) using the method described above. Similarly, to prepare compound AAtR-83, a ligation reaction was performed on transcribed tRNA (AsnE2)cuc-CA (SEQ ID NO: 259 (TR-55)) with aminoacylated pCpA (SS50) using the method described above.

[0266] After adding 0.3 M sodium acetate to the solutions following each ligation reaction, phenol-chloroform solution was added. At this stage, the ligation products were mixed, and either the mixture or the individual products were extracted with phenol-chloroform and precipitated with ethanol to recover the results. Specifically, 0.3M sodium acetate was added to three ligation products, compound AAtR-1, compound AAtR-2, and compound AAtR-3, and then phenol-chloroform solution was added. Equal volumes of these solutions were mixed, and phenol-chloroform extraction and ethanol precipitation were performed to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-1, compound AAtR-2, and compound AAtR-3). Similarly, 0.3M sodium acetate was added to the three ligation products of compound AAtR-4, compound AAtR-5, and compound AAtR-6, and phenol-chloroform solution was added to each. Equal volumes of these solutions were mixed, and phenol-chloroform extraction and ethanol precipitation were performed to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-4, compound AAtR-5, and compound AAtR-6). Similarly, 0.3M sodium acetate was added to the three ligation products of compound AAtR-7, compound AAtR-8, and compound AAtR-9, and phenol-chloroform solution was added to each. Equal volumes of these solutions were mixed, and phenol-chloroform extraction and ethanol precipitation were performed to prepare an aminoacylated tRNA mixture (a mixture of compounds AAtR-7, AAtR-8, and AAtR-9). Similarly, 0.3M sodium acetate was added to the three ligation products of compound AAtR-10, compound AAtR-11, and compound AAtR-12, and a phenol-chloroform solution was added to each. Equal volumes of these solutions were mixed, and phenol-chloroform extraction and ethanol precipitation were performed to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-10, compound AAtR-11, and compound AAtR-12). Similarly, 0.3M sodium acetate was added to the three ligation products of compound AAtR-13, compound AAtR-14, and compound AAtR-15, and phenol-chloroform solution was added to each. Equal volumes of these solutions were mixed, and phenol-chloroform extraction and ethanol precipitation were performed to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-13, compound AAtR-14, and compound AAtR-15). Similarly, 0.3M sodium acetate was added to the three ligation products of compound AAtR-16, compound AAtR-17, and compound AAtR-18, and phenol-chloroform solution was added to each. Equal volumes of these solutions were mixed, and phenol-chloroform extraction and ethanol precipitation were performed to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-16, compound AAtR-17, and compound AAtR-18). Similarly, 0.3M sodium acetate was added to the three ligation products of compound AAtR-19, compound AAtR-20, and compound AAtR-21, and a phenol-chloroform solution was added. Equal volumes of these solutions were mixed, and phenol-chloroform extraction and ethanol precipitation were performed to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-19, compound AAtR-20, and compound AAtR-21). Similarly, 0.3M sodium acetate was added to the three ligation products of compound AAtR-22, compound AAtR-23, and compound AAtR-24, and phenol-chloroform solution was added to each. Equal volumes of these solutions were mixed, and phenol-chloroform extraction and ethanol precipitation were performed to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-22, compound AAtR-23, and compound AAtR-24). Similarly, 0.3M sodium acetate was added to the three ligation products of compound AAtR-26, compound AAtR-8, and compound AAtR-9, and phenol-chloroform solution was added to each. Equal volumes of these solutions were mixed, and phenol-chloroform extraction and ethanol precipitation were performed to prepare an aminoacylated tRNA mixture (a mixture of compounds AAtR-26, AAtR-8, and AAtR-9). Similarly, 0.3M sodium acetate was added to the three ligation products of compound AAtR-27, compound AAtR-11, and compound AAtR-12, and a phenol-chloroform solution was added. Equal volumes of these solutions were mixed, and phenol-chloroform extraction and ethanol precipitation were performed to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-27, compound AAtR-11, and compound AAtR-12). Similarly, 0.3M sodium acetate was added to the three ligation products of compound AAtR-28, compound AAtR-20, and compound AAtR-21, and a phenol-chloroform solution was added. Equal volumes of these solutions were mixed, and phenol-chloroform extraction and ethanol precipitation were performed to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-28, compound AAtR-20, and compound AAtR-21). Similarly, 0.3M sodium acetate was added to the three ligation products of compound AAtR-29, compound AAtR-30, and compound AAtR-31, and phenol-chloroform solution was added to each. Equal volumes of these solutions were mixed, and phenol-chloroform extraction and ethanol precipitation were performed to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-29, compound AAtR-30, and compound AAtR-31). Similarly, 0.3M sodium acetate was added to the three ligation products of compound AAtR-32, compound AAtR-33, and compound AAtR-34, and a phenol-chloroform solution was added. Equal volumes of these solutions were mixed, and phenol-chloroform extraction and ethanol precipitation were performed to prepare an aminoacylated tRNA mixture (a mixture of compounds AAtR-32, AAtR-33, and AAtR-34). Similarly, 0.3M sodium acetate was added to the three ligation products of compound AAtR-35, compound AAtR-36, and compound AAtR-37, and phenol-chloroform solution was added to each. Equal volumes of these solutions were mixed, and phenol-chloroform extraction and ethanol precipitation were performed to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-35, compound AAtR-36, and compound AAtR-37). Similarly, 0.3M sodium acetate was added to the three ligation products of compound AAtR-38, compound AAtR-39, and compound AAtR-40, and a phenol-chloroform solution was added. Equal volumes of these solutions were mixed, and phenol-chloroform extraction and ethanol precipitation were performed to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-38, compound AAtR-39, and compound AAtR-40). Similarly, 0.3M sodium acetate was added to the three ligation products of compound AAtR-41, compound AAtR-42, and compound AAtR-43, and a phenol-chloroform solution was added. Equal volumes of these solutions were mixed, and phenol-chloroform extraction and ethanol precipitation were performed to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-41, compound AAtR-42, and compound AAtR-43). Similarly, 0.3M sodium acetate was added to the three ligation products of compound AAtR-44, compound AAtR-45, and compound AAtR-46, and phenol-chloroform solution was added to each. Equal volumes of these solutions were mixed, and phenol-chloroform extraction and ethanol precipitation were performed to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-44, compound AAtR-45, and compound AAtR-46). Similarly, 0.3M sodium acetate was added to the three ligation products of compound AAtR-47, compound AAtR-30, and compound AAtR-31, and phenol-chloroform solution was added to each. Equal volumes of these solutions were mixed, and phenol-chloroform extraction and ethanol precipitation were performed to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-47, compound AAtR-30, and compound AAtR-31). Similarly, 0.3M sodium acetate was added to the three ligation products of compound AAtR-48, compound AAtR-33, and compound AAtR-34, and phenol-chloroform solution was added to each. Equal volumes of these solutions were mixed, and phenol-chloroform extraction and ethanol precipitation were performed to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-48, compound AAtR-33, and compound AAtR-34). Similarly, 0.3M sodium acetate was added to the three ligation products of compound AAtR-49, compound AAtR-36, and compound AAtR-37, and phenol-chloroform solution was added to each. Equal volumes of these solutions were mixed, and phenol-chloroform extraction and ethanol precipitation were performed to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-49, compound AAtR-36, and compound AAtR-37). Similarly, 0.3M sodium acetate was added to the three ligation products of compound AAtR-50, compound AAtR-39, and compound AAtR-40, and phenol-chloroform solution was added to each. Equal volumes of these solutions were mixed, and phenol-chloroform extraction and ethanol precipitation were performed to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-50, compound AAtR-39, and compound AAtR-40). Similarly, 0.3M sodium acetate was added to the three ligation products of compound AAtR-51, compound AAtR-42, and compound AAtR-43, and a phenol-chloroform solution was added. Equal volumes of these solutions were mixed, and phenol-chloroform extraction and ethanol precipitation were performed to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-51, compound AAtR-42, and compound AAtR-43). Similarly, 0.3M sodium acetate was added to the ligation products of two compounds, AAtR-57 and AAtR-59, and phenol-chloroform solution was added to each. Equal volumes of these solutions were mixed, and phenol-chloroform extraction and ethanol precipitation were performed to prepare an aminoacylated tRNA mixture (a mixture of compounds AAtR-57 and AAtR-59). Similarly, 0.3M sodium acetate was added to the three ligation products of compound AAtR-60, compound AAtR-61, and compound AAtR-62, and phenol-chloroform solution was added to each. Equal volumes of these solutions were mixed, and phenol-chloroform extraction and ethanol precipitation were performed to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-60, compound AAtR-61, and compound AAtR-62). Similarly, 0.3M sodium acetate was added to the three ligation products of compound AAtR-63, compound AAtR-64, and compound AAtR-65, and phenol-chloroform solution was added to each. Equal volumes of these solutions were mixed, and phenol-chloroform extraction and ethanol precipitation were performed to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-63, compound AAtR-64, and compound AAtR-65). Similarly, 0.3M sodium acetate was added to the three ligation products of compound AAtR-66, compound AAtR-67, and compound AAtR-68, and phenol-chloroform solution was added to each. Equal volumes of these solutions were mixed, and phenol-chloroform extraction and ethanol precipitation were performed to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-66, compound AAtR-67, and compound AAtR-68). Similarly, 0.3M sodium acetate was added to the three ligation products of compound AAtR-69, compound AAtR-70, and compound AAtR-71, and phenol-chloroform solution was added to each. Equal volumes of these solutions were mixed, and phenol-chloroform extraction and ethanol precipitation were performed to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-69, compound AAtR-70, and compound AAtR-71). Similarly, 0.3M sodium acetate was added to the three ligation products of compound AAtR-72, compound AAtR-73, and compound AAtR-74, and phenol-chloroform solution was added to each. Equal volumes of these solutions were mixed, and phenol-chloroform extraction and ethanol precipitation were performed to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-72, compound AAtR-73, and compound AAtR-74). Similarly, 0.3M sodium acetate was added to the three ligation products of compound AAtR-75, compound AAtR-76, and compound AAtR-77, and phenol-chloroform solution was added to each. Equal volumes of these solutions were mixed, and phenol-chloroform extraction and ethanol precipitation were performed to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-75, compound AAtR-76, and compound AAtR-77). Similarly, 0.3M sodium acetate was added to the three ligation products of compound AAtR-78, compound AAtR-79, and compound AAtR-80, and phenol-chloroform solution was added to each. Equal volumes of these solutions were mixed, and phenol-chloroform extraction and ethanol precipitation were performed to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-78, compound AAtR-79, and compound AAtR-80). Similarly, 0.3M sodium acetate was added to the three ligation products of compound AAtR-81, compound AAtR-82, and compound AAtR-83, and phenol-chloroform solution was added to each. Equal volumes of these solutions were mixed, and phenol-chloroform extraction and ethanol precipitation were performed to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-81, compound AAtR-82, and compound AAtR-83).

[0267] The following compounds were purified and prepared without mixing. Sodium acetate was added to the ligation product of compound AAtR-52 to a concentration of 0.3 M, and then a phenol-chloroform solution was added. This solution was then subjected to phenol-chloroform extraction and ethanol precipitation to prepare compound AAtR-52. Sodium acetate was added to the ligation product of compound AAtR-53 to a concentration of 0.3 M, and then a phenol-chloroform solution was added. This solution was then subjected to phenol-chloroform extraction and ethanol precipitation to prepare compound AAtR-53. Sodium acetate was added to the ligation product of compound AAtR-54 to a concentration of 0.3 M, and then a phenol-chloroform solution was added. This solution was then subjected to phenol-chloroform extraction and ethanol precipitation to prepare compound AAtR-54. Sodium acetate was added to the ligation product of compound AAtR-55 to a concentration of 0.3 M, and then a phenol-chloroform solution was added. This solution was then subjected to phenol-chloroform extraction and ethanol precipitation to prepare compound AAtR-55. Sodium acetate was added to the ligation product of compound AAtR-56 to a concentration of 0.3 M, and then a phenol-chloroform solution was added. This solution was then subjected to phenol-chloroform extraction and ethanol precipitation to prepare compound AAtR-56. Sodium acetate was added to the ligation product of compound AAtR-58 to a concentration of 0.3 M, and then a phenol-chloroform solution was added. This solution was then subjected to phenol-chloroform extraction and ethanol precipitation to prepare compound AAtR-58.

[0268] Preparation of initiator aminoacyl-tRNA using aminoacyl pCpA A reaction solution was prepared by making up with nuclease-free water to obtain 25 μM transcribed tRNA (fMet)cau-CA (SEQ ID NO: 62 (TR-25)), 50 mM HEPES-KOH pH 7.5, 20 mM MgCl2, 1 mM ATP, 0.6 units / μl T4 RNA ligase (New England Bio Lab.), and 0.25 mM aminoacylated pCpA (MT01 in DMSO solution). The ligation reaction was carried out at 15°C for 45 minutes. However, the reaction solution before adding the T4 RNA ligase and aminoacylated pCpA was heated at 95°C for 2 minutes and then left at room temperature for 5 minutes to pre-fold the tRNA. Sodium acetate was added to the ligation reaction solution to a concentration of 0.3 M, and the mixture was extracted with phenol-chloroform. The initiator aminoacyl-tRNA (compound AAtR-25) was recovered by ethanol precipitation. The initiator aminoacylated tRNA was dissolved in 1 mM sodium acetate immediately before being added to the translation mixture.

[0269] Compound AAtR-1, SEQ ID NO: 75 nBuG-tRNA(Glu)aag [ka]

[0270] Compound AAtR-2, Sequence ID: 76 Pic2-tRNA(Glu)uag [ka]

[0271] Compound AAtR-3, Sequence ID: 77 dA-tRNA(Glu)cag [ka]

[0272] Compound AAtR-4, SEQ ID NO: 78 nBuG-tRNA(Glu)aac [ka]

[0273] Compound AAtR-5, SEQ ID NO: 79 Pic2-tRNA(Glu)uac [ka]

[0274] Compound AATR-6, SEQ ID NO: 80 dA-tRNA(Glu)cac [ka]

[0275] Compound AAtR-7, SEQ ID NO: 81 nBuG-tRNA(Glu)aug [ka]

[0276] Compound AAtR-8, SEQ ID NO: 82 Pic2-tRNA(Glu)uug [ka]

[0277] Compound AAtR-9, SEQ ID NO: 83 dA-tRNA(Glu)cug [ka]

[0278] Compound AAtR-10, SEQ ID NO: 84 nBuG-tRNA(Glu)auu [ka]

[0279] Compound AAtR-11, Sequence ID: 85 Pic2-tRNA(Glu)uuu [ka]

[0280] Compound AAtR-12, Sequence ID: 86 dA-tRNA(Glu)cuu [ka]

[0281] Compound AAtR-13, SEQ ID NO: 87 nBuG-tRNA(Glu)auc [ka]

[0282] Compound AAtR-14, SEQ ID NO: 88 Pic2-tRNA(Glu)uuc [ka]

[0283] Compound AAtR-15, SEQ ID NO: 89 dA-tRNA(Glu)cuc [ka]

[0284] Compound AAtR-16, SEQ ID NO: 90 nBuG-tRNA(Glu)aaa [ka]

[0285] Compound AAtR-17, SEQ ID NO: 91 Pic2-tRNA(Glu)uaa [ka]

[0286] Compound AAtR-18, Sequence ID: 92 dA-tRNA(Glu)caa [ka]

[0287] Compound AAtR-19, SEQ ID NO: 93 nBuG-tRNA(Glu)acu [ka]

[0288] Compound AAtR-20, SEQ ID NO: 94 Pic2-tRNA(Glu)ucu [ka]

[0289] Compound AAtR-21, Sequence ID: 95 dA-tRNA(Glu)ccu [ka]

[0290] Compound AAtR-22, Sequence ID: 96 nBuG-tRNA(Glu)gca [ka]

[0291] Compound AAtR-23, Sequence ID: 97 Pic2-tRNA(Glu)uca [ka]

[0292] Compound AAtR-24, SEQ ID NO: 98 dA-tRNA(Glu)cca [ka]

[0293] Compound AAtR-25, SEQ ID NO: 99 BdpFL-Phe-tRNA(fMet)cau [ka]

[0294] Compound AAtR-26, Sequence ID: 100 nBuG-tRNA(Glu)gug [ka]

[0295] Compound AAtR-27, Sequence ID: 101 nBuG-tRNA(Glu)guu [ka]

[0296] Compound AAtR-28, Sequence ID: 102 nBuG-tRNA(Glu)gcu [ka]

[0297] Compound AAtR-29, SEQ ID NO: 103 MeA3Pr-tRNA(Glu)aug [ka]

[0298] Compound AAtR-30, SEQ ID NO: 104 StBuOH-tRNA(Glu)uug [ka]

[0299] Compound AAtR-31, SEQ ID NO: 105 MeSnPr-tRNA(Glu)cug [ka]

[0300] Compound AAtR-32, Sequence ID: 106 MeA3Pr-tRNA(Glu)auu [ka]

[0301] Compound AAtR-33, SEQ ID NO: 107 StBuOH-tRNA(Glu)uuu [ka]

[0302] Compound AAtR-34, SEQ ID NO: 108 MeSnPr-tRNA(Glu)cuu [ka]

[0303] Compound AAtR-35, SEQ ID NO: 109 MeA3Pr-tRNA(Glu)auc [ka]

[0304] Compound AAtR-36, SEQ ID NO: 110 StBuOH-tRNA(Glu)uuc [ka]

[0305] Compound AAtR-37, SEQ ID NO: 111 MeSnPr-tRNA(Glu)cuc [ka]

[0306] Compound AAtR-38, SEQ ID NO: 112 MeA3Pr-tRNA(Glu)aaa [ka]

[0307] Compound AAtR-39, SEQ ID NO: 113 StBuOH-tRNA(Glu)uaa [ka]

[0308] Compound AAtR-40, SEQ ID NO: 114 MeSnPr-tRNA(Glu)caa [ka]

[0309] Compound AAtR-41, SEQ ID NO: 115 MeA3Pr-tRNA(Glu)acu [ka]

[0310] Compound AAtR-42, Sequence ID: 116 StBuOH-tRNA(Glu)ucu [ka]

[0311] Compound AAtR-43, SEQ ID NO: 117 MeSnPr-tRNA(Glu)ccu [ka]

[0312] Compound AAtR-44, SEQ ID NO: 118 MeA3Pr-tRNA(Glu)gca [ka]

[0313] Compound AAtR-45, SEQ ID NO: 119 StBuOH-tRNA(Glu)uca [ka]

[0314] Compound AAtR-46, Sequence ID: 120 MeSnPr-tRNA(Glu)cca [ka]

[0315] Compound AAtR-47, SEQ ID NO: 121 MeA3Pr-tRNA(Glu)gug [ka]

[0316] Compound AAtR-48, Sequence ID: 122 MeA3Pr-tRNA(Glu)guu [ka]

[0317] Compound AAtR-49, SEQ ID NO: 123 MeA3Pr-tRNA(Glu)guc [ka]

[0318] Compound AAtR-50, Sequence ID: 124 MeA3Pr-tRNA(Glu)gaa [ka]

[0319] Compound AAtR-51, Sequence ID: 125 MeA3Pr-tRNA(Glu)gcu [ka]

[0320] Compound AAtR-52, Sequence ID: 126 MeHph-tRNA(Glu)uga [ka]

[0321] Compound AAtR-53, Sequence ID: 127 MeHph-tRNA(Glu)ugu [ka]

[0322] Compound AAtR-54, Sequence ID: 128 MeHph-tRNA(Glu)uau [ka]

[0323] Compound AAtR-55, Sequence ID: 129 MeHph-tRNA(Ile2)uau [ka]

[0324] Compound AAtR-56, SEQ ID NO: 130 Ile-tRNA(Ile2)uau [ka]

[0325] Compound AAtR-57, SEQ ID NO: 131 nBuG-tRNA(Glu)gcg [ka]

[0326] Compound AAtR-58, SEQ ID NO: 132 SPh2Cl-tRNA(Glu)ucg [ka]

[0327] Compound AAtR-59, SEQ ID NO: 133 dA-tRNA(Glu)ccg [ka]

[0328] Compound AAtR-60, Sequence ID: 260 nBuGly-tRNA(Asp1)_aug [ka]

[0329] Compound AAtR-61, Sequence ID: 261 Pic2-tRNA(Asp1)_uug [ka]

[0330] Compound AAtR-62, Sequence ID: 262 dA-tRNA(Asp1)_cug [ka]

[0331] Compound AAtR-63, SEQ ID NO: 263 nBuGly-tRNA(Asp1-ACL7U)_aug [ka]

[0332] Compound AAtR-64, SEQ ID NO: 264 Pic2-tRNA(Asp1-ACL7A)_uug [ka]

[0333] Compound AAtR-65, Sequence ID: 265 dA-tRNA(Asp1-ACL7G)_cug [ka]

[0334] Compound AAtR-66, Sequence ID: 266 nBuGly-tRNA(Asp1)_gug [ka]

[0335] Compound AAtR-67, Sequence ID: 267 Pic2-tRNA(Asp1)_uug [ka]

[0336] Compound AAtR-68, SEQ ID NO: 268 dA-tRNA(Asp1)_cug [ka]

[0337] Compound AAtR-69, SEQ ID NO: 269 nBuGly-tRNA(Asp1-ACL7C)_gug [ka]

[0338] Compound AAtR-70, Sequence ID: 270 Pic2-tRNA(Asp1-ACL7A)_uug [ka]

[0339] Compound AAtR-71, Sequence ID: 271 dA-tRNA(Asp1-ACL7G)_cug [ka]

[0340] Compound AAtR-72, Sequence ID: 272 nBuGly-tRNA(Asp1)_auc [ka]

[0341] Compound AAtR-73, Sequence ID: 273 Pic2-tRNA(Asp1)_uuc [ka]

[0342] Compound AAtR-74, SEQ ID NO: 274 nBuGly-tRNA(Asp1)_cuc [ka]

[0343] Compound AAtR-75, SEQ ID NO: 275 MeA3Pr-tRNA(AsnE2+ACL)_aug [ka]

[0344] Compound AAtR-76, Sequence ID: 276 StBuOH-tRNA(AsnE2+ACL)_uug [ka]

[0345] Compound AAtR-77, Sequence ID: 277 MeSnPr-tRNA(AsnE2+ACL)_cug [ka]

[0346] Compound AAtR-78, SEQ ID NO: 278 MeA3Pr-tRNA(AsnE2+ACL)_gug [ka]

[0347] Compound AAtR-79, SEQ ID NO: 279 StBuOH-tRNA(AsnE2+ACL)_uug [ka]

[0348] Compound AAtR-80, SEQ ID NO: 280 MeSnPr-tRNA(AsnE2+ACL)_cug [ka]

[0349] Compound AAtR-81, Sequence ID: 281 MeA3Pr-tRNA(AsnE2+ACL)_auc [ka]

[0350] Compound AAtR-82, Sequence ID: 282 StBuOH-tRNA(AsnE2+ACL)_uuc [ka]

[0351] Compound AAtR-83, SEQ ID NO: 283 MeSnPr-tRNA(AsnE2+ACL)_cuc [ka]

[0352] Example 6. Translation and synthesis of peptides Next, we conducted an experiment to confirm the differentiation of three different amino acids within a single codon box, given the presence of three types of aminoacylated tRNAs. Specifically, we translated template mRNAs (template mRNAs SEQ ID NOs: 134 (mR-1) to 162 (mR-29), and 219 (mR-42) to 221 (mR-44)) containing one of the three codons within the same codon box, while the rest of the sequence was identical, using an aminoacylated tRNA mixture to synthesize peptide compounds. In certain codon boxes, we were able to differentiate between wobble codons and simultaneously differentiate another codon. We tested two different amino acid combinations, and under both conditions, it was shown that differentiation of three amino acids within a single codon box was possible in certain codon boxes.

[0353] For the translation system, we used the PURE system, a reconstituted cell-free protein synthesis system derived from prokaryotes. Specifically, the translation solution contains: 1mM GTP, 1mM ATP, 20mM creatine phosphate, 50mM HEPES-KOH pH7.6, 100mM potassium acetate, 10mM magnesium acetate, 2mM spermidine, 1mM dithiothreitol, 1.5mg / ml E. coli MRE600 (RNase-negative) derived tRNA (Roche), 0.26μM EF-G, 0.24μM RF2, 0.17μM RF3, 0.5μM RRF, 4μg / ml creatine kinase, 3μg / ml myokinase, 2 units / ml inorganic pyrophosphatase, 1.1μg / ml nucleoside diphosphate kinase, 2.7μM IF1, 0.4μM IF2, 1.5μM IF3, 40μM EF-Tu, 35μM EF-Ts, 1μM EF-P-Lys, 0.4 units / μl RNasein Ribonuclease inhibitor (Promega, N2111), 1.2 μM ribosome, 0.5 mM PGA, 0.09 μM GlyRS, 0.4 μM IleRS, 0.68 μM PheRS, 0.16 μM ProRS, 0.09 μM ThrRS) are mixed with 1 μM The translation reaction was carried out by adding template mRNA (SEQ ID NO: 134 (mR-1), SEQ ID NO: 135 (mR-2), or SEQ ID NO: 136 (mR-3)), 0.25 mM each of the natural amino acids encoded by each template mRNA, 10 μM of initiator aminoacylated tRNA (compound AAtR-25), and 30 μM of aminoacylated tRNA mixture (a mixture of compounds AAtR-1, AAtR-2, and AAtR-3) to the translation reaction mixture and allowing it to stand at 37°C for 1 hour.

[0354] Cell-free translation was also performed for the other sequences (SEQ ID NO: 137(mR-4), SEQ ID NO: 138(mR-5), SEQ ID NO: 139(mR-6)). Specifically, the translation solution contains: 1mM GTP, 1mM ATP, 20mM creatine phosphate, 50mM HEPES-KOH pH7.6, 100mM potassium acetate, 10mM magnesium acetate, 2mM spermidine, 1mM dithiothreitol, 1.5mg / ml E. coli MRE600 (RNase-negative) derived tRNA (Roche), 0.26μM EF-G, 0.24μM RF2, 0.17μM RF3, 0.5μM RRF, 4μg / ml creatine kinase, 3μg / ml myokinase, 2 units / ml inorganic pyrophosphatase, 1.1μg / ml nucleoside diphosphate kinase, 2.7μM IF1, 0.4μM IF2, 1.5μM IF3, 40μM EF-Tu, 35μM EF-Ts, 1μM EF-P-Lys, 0.4 units / μl RNasein Ribonuclease inhibitor (Promega, N2111), 1.2 μM ribosome, 0.5 mM PGA, 0.09 μM GlyRS, 0.4 μM IleRS, 0.68 μM PheRS, 0.16 μM ProRS, 0.09 μM ThrRS) are mixed with 1 μM The translation reaction was carried out by adding template mRNA (SEQ ID NO: 137 (mR-4), SEQ ID NO: 138 (mR-5), or SEQ ID NO: 139 (mR-6)), 0.25 mM each of the natural amino acids encoded by each template mRNA, 10 μM of initiator aminoacylated tRNA (compound AAtR-25), and a 30 μM aminoacylated tRNA mixture (a mixture of compounds AAtR-4, AAtR-5, and AAtR-6) to the translation reaction mixture and allowing it to stand at 37°C for 1 hour.

[0355] Cell-free translation was also performed for the other sequences (SEQ ID NO: 140(mR-7), SEQ ID NO: 141(mR-8), SEQ ID NO: 142(mR-9)). Specifically, the translation solution contains: 1mM GTP, 1mM ATP, 20mM creatine phosphate, 50mM HEPES-KOH pH7.6, 100mM potassium acetate, 10mM magnesium acetate, 2mM spermidine, 1mM dithiothreitol, 1.5mg / ml E. coli MRE600 (RNase-negative) derived tRNA (Roche), 0.26μM EF-G, 0.24μM RF2, 0.17μM RF3, 0.5μM RRF, 4μg / ml creatine kinase, 3μg / ml myokinase, 2 units / ml inorganic pyrophosphatase, 1.1μg / ml nucleoside diphosphate kinase, 2.7μM IF1, 0.4μM IF2, 1.5μM IF3, 40μM EF-Tu, 54μM EF-Ts, 1μM EF-P-Lys, 0.4 units / μl RNasein Ribonuclease inhibitor (Promega, N2111), 1.2 μM ribosome, 0.5 mM PGA, 0.09 μM GlyRS, 0.4 μM IleRS, 0.68 μM PheRS, 0.16 μM ProRS, 0.09 μM ThrRS) are mixed with 1 μM template mRNA (SEQ ID NO: 140 (mR-7), SEQ ID NO: 141 (mR-8), or SEQ ID NO: 142 (mR-9)), 0.25 mM each of the natural amino acids encoded by each template mRNA, 10 μM initiator aminoacylated tRNA (compound AAtR-25), and an aminoacylated tRNA mixture (a mixture of compounds AAtR-7, AAtR-8, and AAtR-9). The translation reaction was carried out by adding a mixture of AAtR-29, compound AAtR-30, and compound AAtR-31; a mixture of compound AAtR-60, compound AAtR-61, and compound AAtR-62; a mixture of compound AAtR-63, compound AAtR-64, and compound AAtR-65; or a mixture of compound AAtR-75, compound AAtR-76, and compound AAtR-77) to the translation reaction mixture to a concentration of 30 μM and allowing it to stand at 37°C for 1 hour.

[0356] Cell-free translation was also performed for the other sequences (SEQ ID NO: 143(mR-10), SEQ ID NO: 144(mR-11), SEQ ID NO: 145(mR-12)). Specifically, the translation solution contains: 1mM GTP, 1mM ATP, 20mM creatine phosphate, 50mM HEPES-KOH pH7.6, 100mM potassium acetate, 10mM magnesium acetate, 2mM spermidine, 1mM dithiothreitol, 1.5mg / ml E. coli MRE600 (RNase-negative) derived tRNA (Roche), 0.26μM EF-G, 0.24μM RF2, 0.17μM RF3, 0.5μM RRF, 4μg / ml creatine kinase, 3μg / ml myokinase, 2 units / ml inorganic pyrophosphatase, 1.1μg / ml nucleoside diphosphate kinase, 2.7μM IF1, 0.4μM IF2, 1.5μM IF3, 40μM EF-Tu, 54μM EF-Ts, 1μM EF-P-Lys, 0.4 units / μl RNasein Ribonuclease inhibitor (Promega, N2111), 1.2 μM ribosome, 0.5 mM PGA, 0.09 μM GlyRS, 0.4 μM IleRS, 0.68 μM PheRS, 0.16 μM ProRS, 0.09 μM ThrRS) are mixed with 1 μM The translation reaction was carried out by adding template mRNA (SEQ ID NO: 143 (mR-10), SEQ ID NO: 144 (mR-11), or SEQ ID NO: 145 (mR-12)), 0.25 mM each of the natural amino acids encoded by each template mRNA, 10 μM of initiator aminoacylated tRNA (compound AAtR-25), and 30 μM of aminoacylated tRNA mixture (a mixture of compounds AAtR-10, AAtR-11, and AAtR-12, or a mixture of compounds AAtR-32, AAtR-33, and AAtR-34) to the translation reaction mixture and allowing it to stand at 37°C for 1 hour.

[0357] Cell-free translation was also performed for the other sequences (SEQ ID NO: 146(mR-13), SEQ ID NO: 147(mR-14), SEQ ID NO: 148(mR-15)). Specifically, the translation solution contains: 1mM GTP, 1mM ATP, 20mM creatine phosphate, 50mM HEPES-KOH pH7.6, 100mM potassium acetate, 10mM magnesium acetate, 2mM spermidine, 1mM dithiothreitol, 1.5mg / ml E. coli MRE600 (RNase-negative) derived tRNA (Roche), 0.26μM EF-G, 0.24μM RF2, 0.17μM RF3, 0.5μM RRF, 4μg / ml creatine kinase, 3μg / ml myokinase, 2 units / ml inorganic pyrophosphatase, 1.1μg / ml nucleoside diphosphate kinase, 2.7μM IF1, 0.4μM IF2, 1.5μM IF3, 40μM EF-Tu, 49μM EF-Ts, 1μM EF-P-Lys, 0.4 units / μl RNasein Ribonuclease inhibitor (Promega, N2111), 1.2 μM ribosome, 0.5 mM PGA, 0.09 μM GlyRS, 0.4 μM IleRS, 0.68 μM PheRS, 0.16 μM ProRS, 0.09 μM ThrRS) are mixed with 1 μM The translation reaction was carried out by adding the following to the translation reaction mixture: template mRNA (SEQ ID NO: 146 (mR-13), SEQ ID NO: 147 (mR-14), or SEQ ID NO: 148 (mR-15)), 0.25 mM each of the natural amino acids encoded by each template mRNA, 10 μM of initiator aminoacylated tRNA (compound AAtR-25), and 30 μM of aminoacylated tRNA mixture (a mixture of compounds AAtR-13, AAtR-14, and AAtR-15; a mixture of compounds AAtR-72, AAtR-73, and AAtR-74; or a mixture of compounds AAtR-81, AAtR-82, and AAtR-83), and letting it stand at 37°C for 1 hour.

[0358] Cell-free translation was also performed for the other sequences (Sequence ID: 149 (mR-16), Sequence ID: 150 (mR-17), Sequence ID: 151 (mR-18)). Specifically, the translation solution contains: 1mM GTP, 1mM ATP, 20mM creatine phosphate, 50mM HEPES-KOH pH7.6, 100mM potassium acetate, 10mM magnesium acetate, 2mM spermidine, 1mM dithiothreitol, 1.5mg / ml E. coli MRE600 (RNase-negative) derived tRNA (Roche), 0.26μM EF-G, 0.24μM RF2, 0.17μM RF3, 0.5μM RRF, 4μg / ml creatine kinase, 3μg / ml myokinase, 2 units / ml inorganic pyrophosphatase, 1.1μg / ml nucleoside diphosphate kinase, 2.7μM IF1, 0.4μM IF2, 1.5μM IF3, 40μM EF-Tu, 54μM EF-Ts, 1μM EF-P-Lys, 0.4 units / μl RNasein Ribonuclease inhibitor (Promega, N2111), 1.2 μM ribosome, 0.5 mM PGA, 0.09 μM GlyRS, 0.4 μM IleRS, 0.68 μM PheRS, 0.16 μM ProRS, 0.02 μM ValRS) are mixed with 1 μM The translation reaction was carried out by adding template mRNA (SEQ ID NO: 149 (mR-16), SEQ ID NO: 150 (mR-17), SEQ ID NO: 151 (mR-18)), 0.25 mM each of the natural amino acids encoded by each template mRNA, 10 μM of initiator aminoacylated tRNA (compound AAtR-25), and 30 μM of aminoacylated tRNA mixture (a mixture of compounds AAtR-16, AAtR-17, and AAtR-18, or a mixture of compounds AAtR-38, AAtR-39, and AAtR-40) to the translation reaction mixture and allowing it to stand at 37°C for 1 hour.

[0359] Cell-free translation was also performed for the other sequences (SEQ ID NO: 152(mR-19), SEQ ID NO: 153(mR-20), SEQ ID NO: 154(mR-21)). Specifically, the translation solution contains: 1mM GTP, 1mM ATP, 20mM creatine phosphate, 50mM HEPES-KOH pH7.6, 100mM potassium acetate, 10mM magnesium acetate, 2mM spermidine, 1mM dithiothreitol, 1.5mg / ml E. coli MRE600 (RNase-negative) derived tRNA (Roche), 0.26μM EF-G, 0.24μM RF2, 0.17μM RF3, 0.5μM RRF, 4μg / ml creatine kinase, 3μg / ml myokinase, 2 units / ml inorganic pyrophosphatase, 1.1μg / ml nucleoside diphosphate kinase, 2.7μM IF1, 0.4μM IF2, 1.5μM IF3, 40μM EF-Tu, 35μM EF-Ts, 1μM EF-P-Lys, 0.4 units / μl RNasein Ribonuclease inhibitor (Promega, N2111), 1.2 μM ribosome, 0.5 mM PGA, 0.09 μM GlyRS, 0.4 μM IleRS, 0.68 μM PheRS, 0.16 μM ProRS, 0.09 μM ThrRS) are mixed with 1 μM The translation reaction was carried out by adding template mRNA (SEQ ID NO: 152 (mR-19), SEQ ID NO: 153 (mR-20), or SEQ ID NO: 154 (mR-21)), 0.25 mM each of the natural amino acids encoded by each template mRNA, 10 μM of initiator aminoacylated tRNA (compound AAtR-25), and 30 μM of aminoacylated tRNA mixture (a mixture of compounds AAtR-19, AAtR-20, and AAtR-21, or a mixture of compounds AAtR-41, AAtR-42, and AAtR-43) to the translation reaction mixture and allowing it to stand at 37°C for 1 hour.

[0360] Cell-free translation was also performed for the other sequences (Sequence ID: 155 (mR-22), Sequence ID: 156 (mR-23), Sequence ID: 157 (mR-24)). Specifically, the translation solution contains: 1mM GTP, 1mM ATP, 20mM creatine phosphate, 50mM HEPES-KOH pH7.6, 100mM potassium acetate, 10mM magnesium acetate, 2mM spermidine, 1mM dithiothreitol, 1.5mg / ml E. coli MRE600 (RNase-negative) derived tRNA (Roche), 0.26μM EF-G, 0.25μM RF1, 4μg / ml creatine kinase, 3μg / ml myokinase, 2 units / ml inorganic pyrophosphatase, 1.1μg / ml nucleoside diphosphate kinase, 2.7μM IF1, 0.4μM IF2, 1.5μM IF3, 40μM EF-Tu, 34.6μM EF-Ts, 0.4 units / μl RNasein Ribonuclease Inhibitor (Promega, N2111), 1.2 μM ribosome, 0.5 mM PGA, 0.09 μM GlyRS, 0.4 μM IleRS, 0.68 μM PheRS, 0.16 μM ProRS, 0.09 μM ThrRS), 1 μM The translation reaction was carried out by adding template mRNA (SEQ ID NO: 155 (mR-22), SEQ ID NO: 156 (mR-23), or SEQ ID NO: 157 (mR-24)), 0.25 mM each of the natural amino acids encoded by each template mRNA, 10 μM of initiator aminoacylated tRNA (compound AAtR-25), and 30 μM of aminoacylated tRNA mixture (a mixture of compounds AAtR-22, AAtR-23, and AAtR-24, or a mixture of compounds AAtR-44, AAtR-45, and AAtR-46) to the translation reaction mixture and allowing it to stand at 37°C for 1 hour.

[0361] Cell-free translation was also performed for the other sequences (SEQ ID NO: 158(mR-25), SEQ ID NO: 141(mR-8), SEQ ID NO: 142(mR-9)). Specifically, the translation solution contains: 1mM GTP, 1mM ATP, 20mM creatine phosphate, 50mM HEPES-KOH pH7.6, 100mM potassium acetate, 10mM magnesium acetate, 2mM spermidine, 1mM dithiothreitol, 3μM Ala1BtRNA 1.5mg / ml E. coli MRE600 (RNase-ne...

Claims

1. M 1 M 2 tRNA and M having an anticodon complementary to the codon represented by A. 1 M 2 A translation system containing a tRNA having an anticodon complementary to the codon represented by G, M 1 and M 2 These represent the first and second nucleosides of the codon, respectively, M 1 and M 2 Each of these is independently selected from adenosine (A), guanosine (G), cytidine (C), and uridine (U). The tRNA is assigned to codons that constitute at least two, three, four, five, six, or seven codon boxes selected from (i) to (vii) below, (i) A codon box in which M1 is uridine (U) and M2 is uridine (U), (ii) A codon box in which M1 is uridine (U) and M2 is guanosine (G), (iii) A codon box in which M1 is cytidine (C) and M2 is adenosine (A), (iv) A codon box in which M1 is cytidine (C) and M2 is guanosine (G), (v) A codon box in which M1 is adenosine (A) and M2 is adenosine (A), (vi) A codon box in which M1 is adenosine (A) and M2 is guanosine (G), or (vii) A codon box in which M1 is guanosine (G) and M2 is adenosine (A), In each of the two, three, four, five, six, or seven codon boxes, the amino acid or amino acid analog bound to the tRNA having an anticodon complementary to the codon represented by M1M2A is different from the amino acid or amino acid analog bound to the tRNA having an anticodon complementary to the codon represented by M1M2G. The aforementioned anticodon is a translation system that does not contain lysidine or agmatidine.

2. The translation system according to claim 1, wherein the concentration of the tRNA per codon contained in the translation system is any of (i) 0.8 to 1000 μM, (ii) 1.6 to 500 μM, (iii) 3.2 to 250 μM, (iv) 6.4 to 150 μM, or (v) 10 to 100 μM.

3. The translation system according to claim 1 or 2, wherein the amino acid is a natural amino acid or a non-natural amino acid.

4. The translation system according to any one of claims 1 to 3, wherein the tRNA is an initiation tRNA or an elongation tRNA.

5. The translation system according to any one of claims 1 to 4, wherein the tRNA is derived from a prokaryote or a eukaryote.

6. The translation system according to any one of claims 1 to 5, wherein the anticodon comprises one or more nucleosides of adenosine (A), guanosine (G), cytidine (C), or uridine (U).

7. The translation system according to any one of claims 1 to 6, which is capable of translating more than 20 types of amino acids or amino acid analogs from a single genetic code table.

8. The translation system according to any one of claims 1 to 7, which is a cell-free translation system.

9. The translation system according to claim 8, which is a reconstituted cell-free translation system.

10. The translation system according to claim 8 or 9, comprising ribosomes derived from E. coli.

11. The translation system according to any one of claims 1 to 10, wherein the tRNA is bound to the amino acid or amino acid analog outside the translation system.

12. The translation system according to any one of claims 1 to 11, wherein among the tRNAs, a tRNA having an anticodon complementary to the codon represented by M1M2A and a tRNA having an anticodon complementary to the codon represented by M1M2G are bound to the amino acid or amino acid analog outside the translation system.

13. The translation system according to any one of claims 1 to 12, wherein the tRNA is obtained by a pCpA method, a pdCpA method, a method using an artificial RNA catalyst (flexizyme), or a method using aminoacyl-tRNA synthetase (ARS).

14. A method for producing a translation system according to any one of claims 1 to 13, comprising binding the amino acid or amino acid analog to tRNA outside the translation system.

15. The method for producing a translation system according to claim 14, wherein the binding of an amino acid or amino acid analog to tRNA outside the translation system is performed by a pCpA method, a pdCpA method, a method using an artificial RNA catalyst (flexizyme), or a method using aminoacyl-tRNA synthetase (ARS).

16. A method for producing a peptide, comprising translating nucleic acids using a translation system described in any one of claims 1 to 13 or a translation system obtained by the method described in claim 14 or 15.

17. The method according to claim 16, wherein the peptide is a peptide having a cyclic portion.

18. A method for producing a peptide library, comprising translating a nucleic acid library using a translation system described in any one of claims 1 to 13 or a translation system obtained by the method described in claim 14 or 15.