Affinity-matured humanization-binding domain that targets ROR2.

Affinity-matured and humanized antibodies targeting ROR2 offer enhanced cancer treatment efficacy by improving binding affinity and reducing immunogenicity, addressing the limitations of existing therapies for ROR2-expressing cancers.

JP2026108668APending Publication Date: 2026-06-30JULIUS MAXIMILIANS UNIV WURZBURG

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
JULIUS MAXIMILIANS UNIV WURZBURG
Filing Date
2026-03-04
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

There is a need for more effective cancer treatments and therapeutic agents that can target ROR2, a receptor tyrosine kinase-like orphan receptor 2, which is overexpressed in various cancers but has not been adequately addressed by existing FDA-approved monoclonal antibody therapies.

Method used

Development of affinity-matured and humanized antibodies, such as bispecific antibodies and chimeric antigen receptors (CARs), specifically designed to target ROR2, through rational design and mutagenesis of the complementarity-determining regions to enhance binding affinity and reduce immunogenicity.

Benefits of technology

The affinity-matured and humanized antibodies demonstrate higher efficacy and lower immunogenicity in clinical use, providing improved cancer treatment options for ROR2-expressing malignancies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026108668000034
    Figure 2026108668000034
  • Figure 2026108668000035
    Figure 2026108668000035
  • Figure 2026108668000036
    Figure 2026108668000036
Patent Text Reader

Abstract

More effective cancer treatments and more effective therapeutic agents are still needed. [Solution] The present invention provides antibodies and derivatives thereof, such as bispecific antibodies and chimeric antigen receptors (CARs), in which a targeting domain specific to the ROR2 antigen is affinity-matured and / or humanized. In particular, the present invention provides nucleic acids and vectors encoding the antibodies and derivatives, cells and pharmaceutical compositions containing them, for use in cancer treatment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to antibodies and derivatives thereof, such as bispecific antibodies and chimeric antigen receptors (CARs), having a targeting domain that is specific for the ROR2 antigen, affinity matured and / or humanized. The present invention particularly encompasses nucleic acids and vectors encoding said antibodies and derivatives for their use in cancer treatment, cells containing them, and pharmaceutical compositions.

Background Art

[0002] CAR-T cells The adoptive transfer of genetically modified T cells expressing a T cell receptor or chimeric antigen receptor (CAR) specific for a tumor-associated antigen is emerging as an effective modality for cancer treatment [1-5]. CAR is the most commonly constructed synthetic receptor by linking the single-chain variable fragment (scFV) of a monoclonal antibody (mAb) specific for a tumor cell surface molecule to a transmembrane domain, one or more intracellular co-stimulatory signaling molecules, and CD3ζ [6-8]. CAR-modified T cells confer non-MHC-restricted recognition of tumor cells, and durable responses have been reported in patients with B cell malignancies after treatment with autologous T cells modified with a CAR specific for the B cell lineage-restricted CD19 molecule. The main toxicities in these patients were related to tumor lysis, cytokine release, and delayed depletion of normal B lymphocytes [1-3, 5, 9].

[0003] ROR2 as a novel target for cancer treatment: Monoclonal antibodies (mAbs) are widely used for cancer immunotherapy, and approximately 30 antibody-based cancer treatments have been FDA-approved and are commercially available

[10] . The rarity of the identification of new suitable cancer antigens restricts the applications and patients suitable for mAb therapy. Receptor tyrosine kinases (RTKs) have demonstrated their general suitability as cancer antigens due to their overexpression on cancer cells.

[0004] One RTK that has not yet been targeted by an FDA-approved mAb is ROR2 (receptor tyrosine kinase-like orphan receptor 2), which is expressed during embryonic development but is tightly downregulated in postnatal tissues [11-13]. The fact that numerous solid and hematological malignancies have been shown to express ROR2 suggests its suitability as a target for antibody-based cancer therapy

[14] .

[0005] In recent years, the inventors have proposed ROR2 as a candidate substance for cancer immunotherapy. ROR2 is expressed during embryonic development and plays an important role in the development of the nervous system and skeleton. When associated with its ligand, WNT5A, it has been shown to be involved in the WNT signaling pathway, regulating migration and differentiation and facilitating cell polarization during embryonic development [15-18].

[0006] In mice

[19] and humans [20, 21], ROR2 is significantly downregulated after birth, but is overexpressed in several cancers [14, 15], including solid malignancies such as subsets of renal cell adenocarcinoma and breast cancer, and hematological malignancies such as multiple myeloma [22-25]. Among solid malignancies for which antibody-based cancer therapy has not been FDA-approved and is not commercially available, a notable indication is sarcoma, in which ROR2 overexpression has been found in osteosarcoma, leiomyosarcoma, and gastrointestinal stromal tumors (GIST) [21, 26]. Numerous studies have shown that ROR2 expression correlates with rapid disease progression, tumor invasion, and metastasis, and thus ROR2 is a promising cancer target and biomarker [24, 27, 28].

[0007] In recent years, ROR2 targeting campaigns have moved from preclinical to clinical investigations (NCT03504488, NCT03393936, NCT03960060), highlighting the suitability and attractiveness of ROR2 as a candidate antigen for antibody-based cancer therapy.

Prior Art Documents

Patent Documents

[0008] [Patent Document 1] WO2017 / 127702A1 [Non-patent literature]

[0009] [Non-Patent Document 1] Kabat, EA; Wu, TT; Perry, H.; Gottesman, K.; and Foeller, C. (1991) "Sequences of Proteins of Immunological Interest," 5th edition, NIH Publications 91-3242. [Overview of the project] [Problems that the invention aims to solve]

[0010] However, in this field of technology, there is still a need for more effective cancer treatments and therapeutic agents that can be used in such therapies. [Means for solving the problem]

[0011] This invention relates, in particular, to the affinity-matured humanized binding domain of the known anti-ROR2 antibody XBR2-401, as well as to antibody derivatives such as bispecific antibodies (bi-mAbs) and CARs, and their use for the construction of CAR-modified T cells. For example, for the description of the XBR2-401 antibody, please refer to the references [29, 30] incorporated throughout this invention by reference for all purposes. The bi-mAbs and CARs in this invention have a higher binding affinity and / or a higher degree of "humanity" compared to the parent rabbit XBR2-401 binding domain. In accordance with this invention, these bi-mAbs, CARs, and CAR-modified T cells are expected to exhibit higher efficacy and / or lower immunogenicity in clinical use in patients compared to the rabbit (XBR2-401) binding domain.

[0012] Based on an unpublished cocrystal structure of XBR2-401 in scFv format, which was a novel affinity-matured humanized monoclonal antibody (mAb) targeting the human ROR2 kringle domain (ROR2-Kr), we developed it from the prior art rabbit mAb XBR2-401[29,30]. The cocrystal structure provided a molecular picture of the interaction, defining both the paratope (antigen-binding site of the antibody) and the epitope (antibody-binding site of the antigen) at high resolution (1.2 Å). Surprisingly, the molecular picture of the paratope / epitope interface revealed a gap in the interaction between the third complementarity-determining region (HCDR3) of the heavy chain and the epitope. We hypothesized that this gap could be filled by adding and substituting amino acid residues in a short sequence of HCDR3 sequences. The inventors proposed that this method would increase affinity while maintaining the specificity of XBR2-401. Thus, a short sequence of HCDR3 in XBR2-401 was subjected to randomization of amino acid residues, including variations in length, i.e., the incorporation of 0, 1, and 2 further randomization positions. Subsequently, a library was selected for binding to human ROR2 using phage display technology. This rational design, combined with an in vitro evolutionary strategy, resulted in a novel panel of mAbs in which the HCDR3 sequence deviated from the mAb XBR2-401 in terms of both amino acid sequence composition and length. Subsequent analyses using surface plasmon resonance and cell microarray techniques confirmed that the intended increase in affinity was achieved without loss of specificity. Through rational design, one of the novel mAbs, designated XBR2-401-X3.12, was humanized, resulting in XBR2-401-hX3.12.5 and XBR2-401-hX3.12.6. Further co-crystallization of the latter with ROR2-Kr revealed the intended, tighter interaction between the paratope and epitope due to void closure.In summary, the remarkable findings of the inventors that led to the novel mAb claimed in this invention were based on the acquisition and analysis of detailed new data (structure obtained by X-ray crystallography of XBR2-401 complexed with ROR2-Kr) that were not available in the prior art. The basis for the teachings of this invention, for example, the filling of specific voids in paratope-epitope interactions, was confirmed by the structure obtained by X-ray crystallography of XBR2-401-hX3.12.6 in complex with ROR2-Kr.

[0013] In accordance with the present invention, affinity maturation can be carried out by any method known in the art. As a non-limiting example, affinity maturation of the VH and VL domains of XBR2-401 was carried out by random mutagenesis of a defined complementarity-determining region.

[0014] In accordance with the present invention, humanization can be carried out by any method known in the art. For example, the humanization of the VH and VL domains of the monoclonal antibody X3.12 was performed by CDR grafting and screening of the best conjugate to the ROR2 target via ELISA, flow cytometry, and surface plasmon resonance.

[0015] According to the present invention, recombinant mammalian cells expressing CARs, such as CAR T cells, can be prepared to express CARs in which the anti-ROR2 binding domains of the anti-ROR2 monoclonal antibodies X3.12, hX3.12.5, and hX3.12.6 have undergone affinity maturation and / or have been humanized.

[0016] The affinity maturation and humanization of ROR2-specific CARs differ from known clinical methods that rely on non-humanized ROR2-specific CARs. Surprisingly, the inventors have shown that affinity-matured ROR2-specific CARs have higher functionality than their non-affinity-matured counterparts.

[0017] Furthermore, the inventors have surprisingly shown that humanized affinity matured ROR2 bi-mAbs exhibiting advantageous functional properties can be produced according to the present invention.

[0018] Therefore, the present invention provides the following preferred embodiments: 1. An antibody capable of binding to human ROR2, or a derivative thereof capable of binding to human ROR2, comprising a light chain variable domain and a heavy chain variable domain, wherein the heavy chain variable domain comprises a CDR3 sequence having an amino acid sequence selected from the group consisting of SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, and the CDR3 sequence does not have the amino acid sequence of SEQ ID NO: 36. 2. The antibody or derivative thereof described in item 1, wherein the heavy chain variable domain comprises a CDR3 sequence having an amino acid sequence selected from the group consisting of SEQ ID NO: 24 and SEQ ID NO: 25. 3. An antibody or derivative thereof as described in item 1 or 2, wherein the heavy chain variable domain contains a CDR3 sequence having the amino acid sequence of SEQ ID NO: 24. 4. The antibody or derivative thereof according to item 1 or 2, wherein the heavy chain variable domain comprises a CDR3 sequence having an amino acid sequence selected from the group consisting of SEQ ID NOs: 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 37, and 38. 5. An antibody or derivative thereof according to item 1 or 2, wherein the heavy chain variable domain comprises a CDR3 sequence having an amino acid sequence selected from the group consisting of SEQ ID NOs: 26, 27, 28, 29, 30, 31, 32, 33, 34, and 35. 6. The antibody or derivative thereof described in item 4, wherein the heavy chain variable domain contains a CDR3 sequence having the amino acid sequence of SEQ ID NO: 26. 7. An antibody or derivative thereof according to any one of items 1 to 6, wherein the light chain variable domain comprises a CDR3 sequence having the amino acid sequence of SEQ ID NO: 43, or a CDR3 sequence that differs from the amino acid sequence of SEQ ID NO: 43 by no more than two amino acid residues. 8. The antibody or derivative thereof described in item 7, wherein the light chain variable domain comprises a CDR3 sequence having the amino acid sequence of SEQ ID NO: 43, or a CDR3 sequence that differs from the amino acid sequence of SEQ ID NO: 43 by not more than one amino acid residue. 9. The antibody or derivative thereof described in item 7, wherein the light chain variable domain contains a CDR3 sequence having the amino acid sequence of SEQ ID NO: 43. 10. An antibody or derivative thereof according to any one of items 1 to 9, wherein the heavy chain variable domain comprises a CDR2 sequence having the amino acid sequence of SEQ ID NO: 45, or a CDR2 sequence that differs from the amino acid sequence of SEQ ID NO: 45 by no more than two amino acid residues. 11. The antibody or derivative thereof described in item 10, wherein the heavy chain variable domain comprises a CDR2 sequence having the amino acid sequence of SEQ ID NO: 45, or a CDR2 sequence that differs from the amino acid sequence of SEQ ID NO: 45 by not more than one amino acid residue. 12. The antibody or derivative thereof described in item 10, wherein the heavy chain variable domain contains a CDR2 sequence having the amino acid sequence of SEQ ID NO: 45. 13. An antibody or derivative thereof according to any one of items 1 to 12, wherein the light chain variable domain comprises a CDR1 sequence having the amino acid sequence of SEQ ID NO: 41, or a CDR1 sequence that differs from the amino acid sequence of SEQ ID NO: 41 by no more than two amino acid residues. 14. The antibody or derivative thereof described in item 13, wherein the light chain variable domain comprises a CDR1 sequence having the amino acid sequence of SEQ ID NO: 41, or a CDR1 sequence that differs from the amino acid sequence of SEQ ID NO: 41 by not more than one amino acid residue. 15. An antibody or derivative thereof as described in item 13, wherein the light chain variable domain contains a CDR1 sequence having the amino acid sequence of SEQ ID NO: 41. 16. An antibody or derivative thereof according to any one of items 1 to 15, wherein the light chain variable domain comprises a CDR2 sequence having the amino acid sequence of SEQ ID NO: 42, or a CDR2 sequence that differs from the amino acid sequence of SEQ ID NO: 42 by no more than two amino acid residues. 17. The antibody or derivative thereof described in item 16, wherein the light chain variable domain comprises a CDR2 sequence having the amino acid sequence of SEQ ID NO: 42, or a CDR2 sequence that differs from the amino acid sequence of SEQ ID NO: 42 by not more than one amino acid residue. 18. An antibody or derivative thereof as described in item 16, wherein the light chain variable domain contains a CDR2 sequence having the amino acid sequence of SEQ ID NO: 42. 19. An antibody or derivative thereof according to any one of items 1 to 18, wherein the heavy chain variable domain comprises a CDR1 sequence having the amino acid sequence of SEQ ID NO: 44, or a CDR1 sequence that differs from the amino acid sequence of SEQ ID NO: 44 by no more than two amino acid residues. 20. The antibody or derivative thereof described in item 19, wherein the heavy chain variable domain comprises a CDR1 sequence having the amino acid sequence of SEQ ID NO: 44, or a CDR1 sequence that differs from the amino acid sequence of SEQ ID NO: 44 by not more than one amino acid residue. 21. The antibody or derivative thereof described in item 19, wherein the heavy chain variable domain contains a CDR1 sequence having the amino acid sequence of SEQ ID NO: 44. 22. An antibody or derivative thereof according to any one of items 1 to 3 and 5 to 21, which, as determined by surface plasmon resonance measurement, comprises a light chain variable domain having the amino acid sequence of SEQ ID NO: 2 and a heavy chain variable domain having the amino acid sequence of SEQ ID NO: 1, and is capable of binding to human ROR2 with a higher affinity than the corresponding antibody or derivative. 23. An antibody or derivative thereof according to any one of items 1 to 22, wherein (i) the heavy chain variable domain contains the amino acid sequence of SEQ ID NO: 3 and the light chain variable domain contains the amino acid sequence of SEQ ID NO: 4, or (ii) the heavy chain variable domain contains the amino acid sequence of SEQ ID NO: 5 and the light chain variable domain contains the amino acid sequence of SEQ ID NO: 6, or (iii) the heavy chain variable domain contains the amino acid sequence of SEQ ID NO: 7 and the light chain variable domain contains the amino acid sequence of SEQ ID NO: 6. 24. A humanized antibody or a derivative thereof, as described in any one of items 1 to 23. 25. An antibody or derivative thereof according to any one of items 1 to 24, wherein (ii) the heavy chain variable domain contains the amino acid sequence of SEQ ID NO: 5 and the light chain variable domain contains the amino acid sequence of SEQ ID NO: 6, or (iii) the heavy chain variable domain contains the amino acid sequence of SEQ ID NO: 7 and the light chain variable domain contains the amino acid sequence of SEQ ID NO: 6. 26. A bispecific antibody or a derivative thereof, as described in any one of items 1 to 25. 27. The antibody or derivative thereof described in item 26, wherein the bispecific antibody or derivative thereof is also capable of binding to human CD3. 28. An antibody or its derivative, as described in any one of items 1 to 27, which is an antibody derivative. 29. A derivative of item 28, which is an antibody fragment. 30. The derivative according to item 29, wherein the antibody fragment is Fab or bispecific scFv-Fc. 31. A derivative of CAR as described in item 28. 32. The derivative described in item 28, including an adapter for universal CAR. 33. A nucleic acid encoding an antibody or derivative as described in any one of items 1 to 32. 34. mRNA, the nucleic acid described in item 33. 35. The nucleic acid described in item 33, which is DNA. 36. The nucleic acid described in item 35, wherein the DNA is minicircle DNA or plasmid DNA. 37. Recombinant immune cells containing the CAR described in item 31, and / or recombinant immune cells containing the nucleic acid described in any one of items 33 to 36 that encodes the CAR described in item 31. 38. Recombinant immune cells as described in item 37, which are CD8+ killer T cells, CD4+ helper T cells, naive T cells, memory T cells, central memory T cells, effector memory T cells, memory stem cell T cells, invariant T cells, NKT cells, cytokine-induced killer T cells, g / d T cells, natural killer cells, monocytes, macrophages, dendritic cells, or granulocytes. 39. Recombinant immune cells, which are T cells, as described in item 37 or 38. 40. (i) An antibody or derivative thereof as described in any one of items 1 to 30 or 32; (ii) A nucleic acid as described in any one of items 33 to 36, which codes for a CAR as described in item 31; (iii) Recombinant immune cells as described in any one of items 37 to 39; or (iv) A combination of (i) and (ii), a combination of (i) and (iii), or a combination of (i) to (iii) A pharmaceutical composition containing the following: 41. The pharmaceutical composition described in item 40 for use in the treatment of cancer. 42. A pharmaceutical composition for use as described in item 41, wherein the cancer is a cancer that expresses ROR2. 43. A pharmaceutical composition for use as described in item 41 or 42, wherein the cancer is a blood cancer. 44. A pharmaceutical composition for use as described in item 41 or 42, wherein the cancer is a solid tumor. 45. A pharmaceutical composition for use according to any one of items 41 to 44, wherein the cancer is selected from the group consisting of multiple myeloma, renal cell carcinoma, pancreatic cancer, sarcoma, glioblastoma, and breast cancer. 46. ​​The compound, (i) Antibodies or derivatives thereof as described in any one of items 1 to 30 or 32; (ii) A nucleic acid as described in any one of items 33 to 36, which codes for a CAR as described in item 31; (iii) Recombinant immune cells as described in any one of items 37 to 39; or (iv) A combination of (i) and (ii), a combination of (i) and (iii), or a combination of (i) to (iii) The use of compounds for the diagnosis of cancer. 47. Compounds, (i) Antibodies or derivatives thereof as described in any one of items 1 to 30 or 32; (ii) A nucleic acid as described in any one of items 33 to 36, which codes for a CAR as described in item 31; (iii) Recombinant immune cells as described in any one of items 37 to 39; or (iv) A combination of (i) and (ii), a combination of (i) and (iii), or a combination of (i) to (iii) The use of compounds to determine the sensitivity of cancer to treatment. [Brief explanation of the drawing]

[0019] [Figure 1A] This figure shows the amino acid sequences of the parent XBR2-401 VH and VL sequences, as well as the coding sequence of the complete 401×V9-bi-mAb. The amino acid sequences of the parent XBR2-401 VH and XBR2-401 VL are shown. [Figure 1B] This figure shows the amino acid sequences of the VH and VL sequences of the parent XBR2-401, as well as the coding sequence of the complete 401×V9-bi-mAb. The complete amino acid sequence of the 401×V9 bi-mAb is shown in order from the N-terminus to the C-terminus. [Figure 1C] This figure shows the amino acid sequences of the VH and VL sequences of the parent XBR2-401, as well as the coding sequence of the complete 401×V9-bi-mAb. The complete amino acid sequence of 401 CAR is shown in N-terminus to C-terminus. Note that asterisks indicate the ends of the amino acid sequence. [Figure 2A] This figure shows the amino acid sequences of the VH and VL sequences of affinity-matured X3.12, and the coding sequence of the complete X3.12CAR. These are the VH and VL amino acid sequences of affinity-matured X3.12. [Figure 2B] This figure shows the amino acid sequences of the VH and VL sequences of affinity-matured X3.12, and the coding sequence of the complete X3.12CAR. The complete amino acid sequence of X3.12×V9 bi-mAb is shown in N-terminus to C-terminus. Note that asterisks indicate the ends of the amino acid sequences. [Figure 2C]This figure shows the amino acid sequences of the VH and VL sequences of affinity-matured X3.12, and the coding sequence of the complete X3.12CAR. The complete amino acid sequence of X3.12CAR is shown in N-terminus to C-terminus order. Note that asterisks indicate the ends of the amino acid sequence. [Figure 3A] This figure shows the VH and VL sequences of humanized hX3.12.5, the amino acid sequence of the complete hX3.12.5 bi-mAb sequence, and the coding sequence of the complete hX3.12.5 CAR. These are the VH and VL amino acid sequences of affinity-matured humanized hX3.12.5. [Figure 3B] This figure shows the VH and VL sequences of humanized hX3.12.5, the amino acid sequence of the complete hX3.12.5 bi-mAb sequence, and the coding sequence of the complete hX3.12.5 CAR. The complete amino acid sequence of hX3.12.5×V9 bi-mAb is shown in N-terminus to C-terminus. [Figure 3C] This figure shows the VH and VL sequences of humanized hX3.12.5, the amino acid sequence of the complete hX3.12.5 bi-mAb sequence, and the coding sequence of the complete hX3.12.5 CAR. The complete amino acid sequence of hX3.12.5 CAR is shown in N-terminus to C-terminus order. Note that asterisks indicate the ends of the amino acid sequence. [Figure 4A] This figure shows the VH and VL sequences of humanized hX3.12.6, the amino acid sequence of the complete hX3.12.6 bi-mAb sequence, and the coding sequence of the complete hX3.12.6 CAR. These are the VH and VL amino acid sequences of affinity-matured humanized hX3.12.6. [Figure 4B] This figure shows the VH and VL sequences of humanized hX3.12.6, the amino acid sequence of the complete hX3.12.6 bi-mAb sequence, and the coding sequence of the complete hX3.12.6 CAR. The complete amino acid sequence of hX3.12.6×V9 bi-mAb is shown in N-terminus to C-terminus. [Figure 4C]This figure shows the VH and VL sequences of humanized hX3.12.6, the amino acid sequence of the complete hX3.12.6 bi-mAb sequence, and the coding sequence of the complete hX3.12.6 CAR. The complete amino acid sequence of hX3.12.6 CAR is shown in N-terminus to C-terminus order. Note that asterisks indicate the ends of the amino acid sequence. [Figure 5] This figure shows the crystal structures of the parent mAb 401 and the affinity-mature humanized mAb hX3.12.6, complexed with hROR2-Kr. (A) (Top) The crystal structure of scFv 401 (VH ribbon and VL ribbon) complexed with hROR2-Kr (filled in) was determined by X-ray crystallography (PDB ID: 6OSH) at a resolution of 1.2 Å. The complex on the right has been rotated 90° to visualize the interaction of LCDR3 and HCDR3 with the epitopes. (Bottom) The magnified image of the 401:hROR2-Kr complex reveals that Trp96, a residue of HCDR3, is weakly hydrogen-bonded to His348, a skeletal residue of hROR2-Kr, at a distance of 3.4 Å (dotted line). (B) (Top) This is the crystal structure (PDB ID: 6OSV) at a resolution of 1.4 Å of hX3.12.6 (VH (black) and VL (light gray)), an affinity-matured humanized scFv complexed with hROR2-Kr. (Bottom) The magnified image of the hX3.12.6:hROR2-Kr complex reveals the increase in hydrogen bonds (left dotted line) (2.8 Å) and π-π / π-cation bonds (right dotted line) (4.2 Å) between Trp98, a residue of HCDR3, and His348 and His349, backbone residues of hROR2-Kr, respectively. The heavy chain variable domain (VH) is shown in dark color, while the light chain variable domain (VL) is shown in light color. [Figure 6] This figure shows a table of crystal structure parameters for the complex of 401:hROR2-Kr and hX3.12.6:hROR2-Kr, as well as for unbound hROR2-Kr. [Figure 7] This figure shows a table of residue interactions between hROR2-Kr and 401 or hX3.12.6, determined using the crystal structure. [Figure 8] This figure shows a comparison of the crystal structures, epitopes, and kringle domains of 401:hROR2-Kr, hX3.12.6:hROR2-Kr, and R11:hROR1-Kr. (A) The epitopes are a visual representation that can be compared between anti-ROR2 mAbs and anti-ROR1 mAbs. Dark and light colors represent the VH domain and VL domain, respectively. The ROR2 kringle domain and ROR1 kringle domain are shown in dark orange and light orange, respectively. The rmsd of the entire Cα position between the 401:hROR2-Kr complex and the hX3.12.6:hROR2-Kr complex was found to be 0.474 Å. (B) Comparison of the cocrystallized kringle domain of ROR2 and the cocrystallized kringle domain of ROR1 from left to right: Crystallized 401: This is the crystal structure of hROR2-Kr based on the hROR2-Kr complex. The epitope of 401 is marked in dark gray. Crystallized R11: This is the crystal structure of hROR1-Kr based on the hROR1-Kr complex. The epitope of R11 is marked in light gray. This is a polymerization of unbound hROR2-Kr (light gray) and hROR2-Kr (dark gray) derived from the 401:hROR2-Kr complex. The rmsd at the Cα position was 0.383 Å. The acetate ion is bound to Arg385 of unbound hROR2-Kr via mixed interactions between salt bridges and hydrogen bonds. (C) Alignment of amino acid sequences of the ROR2 and ROR1 kringle domains of mouse, human, and monkey (numbering for hROR2 is by uniprot.org). Residues containing the 401 and R11 epitopes are marked. Residues of the hROR2-Kr epitope not listed in Table I contained in Figure 7 interact with 401 and hX3.12.6 via van der Waals interactions. [Figure 9] This figure shows a table illustrating the construction of a centralized, randomized HCDR3 phage library. [Figure 10] This figure shows a table of reaction rate data for the top 12 mature anti-ROR2 clones with high HCDR3 affinity. [Figure 11]This figure shows the amino acid sequence alignment of the affinity-matured humanized variants VL and VH. It points to the locations of four framework regions (FWRs) and three CDRs. The numbers refer to Kabat numbering for variable domain residues, indicated by single-letter codes. Underlined residues are reverse mutations to the original rabbit residues. Dots represent identical residues in the alignment relative to VL1 or VH1. CDR residues are shown in bold. (Top) VL1 FWR is derived from the human germline IGKV1-NL1*01; VL1 CDR is grafted from X3.12. The amino acid sequence of VL2 is the same as VL1, but with seven reverse mutations from the human germline to the original rabbit residues of X3.12. (Below) VH1 FWR and VH2 FWR are derived from the human germline cells IGHV3-66*03 and IGHV3-48*03, respectively, and their CDRs are grafted from X3.12. VH3 and VH4 are derived from VH1 and VH2 by reverting the FWR residue from the human germline to the original rabbit residue of X3.12. [Figure 12] This figure shows a table of reaction rate data for humanized anti-ROR2 mAbs. [Figure 13]This figure shows the analysis of affinity-matured humanized mAbs by flow cytometry. (A) HEK 293F cells stably transfected with human ROR2 (allotype Thr245) were stained with PE-conjugated goat anti-human F(ab')2 pAb, following the parental Fab, affinity-matured Fab, and humanized Fab shown. Mock-transfected HEK 293F cells were used as a negative control. Fab was also examined against the T47D (ROR2+, ROR1-) cell line, the 786-O (ROR2+, ROR1+) cell line, and the MDA-MB-231 (ROR2-, ROR1+) cell line. Humanized anti-human CD3 Fab v9 and secondary antibody alone ("background") were used as further negative controls. (B) Following its conversion from Fab to scFv-Fc, the 786-O cell line, T47D cell line, and MDA-MB-231 cell line were stained with Alexa Fluor 647 conjugated donkey anti-human F(ab')2 pAb, following hX3.12.6. The secondary antibody alone was used as a negative control. (C) Flow cytometry using Alexa Fluor 647 conjugated donkey anti-human F(ab')2 pAb to stain HEK 293F cells stably transfected with human ROR2 (allotype Thr245) or mouse ROR2, following hX3.12.6 scFv-Fc. Mock-transfected HEK 293F cells and the secondary antibody alone ("background") were used as negative controls. All events were normalized to the mode. [Figure 14]This figure shows the analysis of affinity-matured humanized mAbs by SPR. (A) Biacore X100 sensorgrams are shown for the top 12 chimeric rabbit / human anti-human ROR2 Fabs selected from a concentrated mutagenesis library by phage display. (B) Biacore X100 sensorgrams are shown for humanized anti-human ROR2 Fabs. Fc-hROR2 was captured using a CM5 chip immobilized with mouse anti-human Fcγ mAb. The Fabs were injected at five different concentrations (200, 100, 50, 25, and 12.5 nM for chimeric Fabs, and 100 nM for humanized Fabs). The reaction rate parameters (kon and koff) and thermodynamic parameters (KD=koff / kon) for 1:1 binding were calculated and compiled in Table III and Table IV, shown in Figures 10 and 12, respectively. [Figure 15] This figure shows the melting point and melting curve of humanized Fab. (A) The melting point of the indicated Fab. The error bars represent the standard deviation (mean ± SD) of the mean of the triplicate. (B) The melting point was determined using the LightCycler 480 protein melting protocol. The triplicate curve is shown for each Fab. Melting of the Fab was measured up to 99°C. [Figure 16]This figure shows the analysis of the specificity of the affinity-matured humanized mAb hX3.12.6 using cell microarray technology. Using custom cell microarray technology from Retrogenix, the scFv-Fc format mAb hX3.12.6 was screened against 5647 human cell membrane proteins expressed on the surface of human HEK 293 cells. (A) Image of the ZsGreen1 spotting pattern for approximately 300 human cell membrane proteins in the custom cell microarray from Retrogenix. Untransfected HEK293F was also included in the microarray as a control. (B) Humanized scFv-Fc xh3.12.6 was screened at 20 μg / mL and visualized using AlexaFluor 647 conjugated goat anti-human IgG Fcγ pAb. FcγRIIα is predicted to be a nonspecific hit due to Fc binding. (C) This is a summary of the post-screening, in which a rituximab biosimilar (1 μg / mL) was screened as a control, and 20 μg / mL of hX3.12.6 scFv-Fc was identified as the only specific hit for ROR2 against 5647 human antigens arranged in a double-row configuration. [Figure 17]This figure shows the activity of ROR2×CD3 biAbs. (A) The ROR2×CD3 biAb shown, along with the control ROR1×CD3 and CD19×CD3 biAbs (all in heterodimer scFv-Fc format), was used with Alexa Fluor 647 conjugated donkey anti-human F(ab')2 pAb to stain 786-O cells, MDA-MB-231 cells, and Jurkat-T Lucia cells to confirm specific binding to ROR2 and CD3. The secondary antibody alone ("background") was used as a negative control. (B) A panel of ROR2×CD3 biAbs based on humanized, affinity-matured mAbs and parental mAbs was compared with ROR1×CD3 biAbs (all in heterodimer scFv-Fc format) and single-specific negative controls without T-cell engaging arms. (C) Specific lysis of cell lineages 786-O (ROR2+, ROR1+) and MDA-MB-231 (ROR2+, ROR1-) at 16 hours after incubation with expanded T cells in ex vivo is plotted, with the biAb concentration within the displayed range and the effector:target cell ratio set to 10:1. T cell activation was measured as the percentage of CD69+ T cells determined by flow cytometry and as cytokine IFN-γ release determined by ELISA. Significant differences between ROR2×CD3 (or ROR1×CD3) biAb and negative controls, which are single-specific scFv-Fc, were analyzed using one-way ANOVA based on independent triplicates, shown as mean ± SD (****, p<0.0001). [Figure 18]This figure shows the purification of affinity-matured humanized Fab and the purification of ROR2×CD3 biAb. (A) After tandem purification on KappaSelect and IMAC columns, the indicated Fab was analyzed by SDS-PAGE and Coomassie blue staining. Predicted bands were observed under non-reducing conditions (approx. 50 kDa) and reducing conditions (approx. 25 kDa). (B) Protein A purified biAb (and a negative control, which is a monospecific scFv-Fc) in heterodimer scFv-Fc format was confirmed by SDS-PAGE and Coomassie blue staining, showing the predicted non-reducing band at approximately 100 kDa and the reduced band at approximately 50 kDa. (C) This is the SEC elution profile for protein A purified biAb. The major peak at approximately 13 mL is monodisperse biAb, while the secondary peak at approximately 11 mL contains high molecular weight aggregates. The activity assay shown in Figure 9 is based on the purification of biAb using tandem protein A and SEC. [Figure 19] The diagram below shows the following from top to bottom: The IgG1 format is found in nature as a dimer containing a constant region (gray) and two N-terminal variable regions (VH and VL) that bind to the antigen. Fab consists only of the VH domain, CH1 domain, VL domain, and CL domain. The scFv-Fc format contains the Fc domain but lacks the CL and CH1 domains. VH and VL are fused via a polypeptide linker. On scFv-Fc, both variable regions are identical. The bispecific scFv-Fc format contains an Fc with a KIH (knobs-into-holes) mutation to allow dimerization between two different chains and to enable combinations of two different variable regions. The monospecific scFv-Fc format is used as a control to the bispecific scFv-Fc format. [Figure 20]This figure shows ROR2 expression in cancer cell lines as determined by flow cytometry. The hX3.12.5×h38C2 DVD antibody was covalently conjugated with AF647 and used to analyze the ROR2 expression patterns in various cancer cell lines, including T-47D (breast cancer), 786-O (renal cell carcinoma), U266 (multiple myeloma), and MDA-MB231 (breast cancer). [Figure 21] This figure shows the enrichment and detection of CAR-T cells using the EGFRt transduction marker. X3.12 A lentiviral vector encoding CAR was transduced into human CD4+ T cells or human CD8+ T cells, and then CAR-expressing cells were enriched by magnetically activated cell sorting (MACS) using the transduction marker, truncated epidermal growth factor receptor (EGFRt). The coding sequence (CDS) of EGFRt was ligated to the CDS of CAR via a 2A ribosome skipping sequence, and EGFRt expression can be used as a surrogate marker for CAR expression. (A) Flow cytometry plot supporting the frequency of EGFRt-positive CD4+ T cells after EGFRt enrichment by MACS. (B) Flow cytometry plot supporting the frequency of EGFRt-positive CD8+ T cells after EGFRt enrichment by MACS. [Figure 22] This figure shows the cytolytic activity of CD8+ T cells expressing the X3.12 CAR. It represents the cytolytic activity of primary human CD8+ T cells expressing affinity-matured X3.12, a ROR2-specific CAR, against ROR2-positive target cells. MDA-MB-231 was used as a negative control; it is a ROR2-negative human breast cancer cell line. T-47D (breast cancer), 786-O (renal cell carcinoma), and U266 (multiple myeloma) are established cancer cell lines that endogenously express ROR2. All target cell lines were manipulated to stably express firefly (P. pyralis) luciferase. Specific lysis of target cells was calculated based on the intensity of the luminescence signal after the addition of luciferin up to a final concentration of 150 μg / ml. [Figure 23] This figure shows cytokine secretion from T cells expressing X3.12-based ROR2-specific CARs. CD4+ CAR-T cells or CD8+ CAR-T cells expressing X3.12 CARs were co-cultured with ROR2-positive target cells in an E:T ratio of 4:1. The concentrations of the effector cytokines, IL-2 and IFN-γ, were measured by ELISA in the cell culture supernatant 24 hours after co-culture. Comparative cytokine secretion against ROR2-positive target cells (T-47D, 786-O, and U266) and MDA-MB-231 is shown for CD4+ T cells and CD8+ T cells from n=3 independent donors. [Figure 24] This figure shows the proliferation of T cells expressing X3.12 CAR. It represents the proliferation of CD4+ ROR2-specific CAR-T cells after stimulation with irradiated ROR2-positive target cells at an E:T ratio of 4:1. Exogenous cytokines were not added to the culture medium, and T cell proliferation was evaluated 72 hours after stimulation using CFSE dye dilution. The CFSE flow cytometry histograms are for X3.12 ROR2-specific CAR-T cells against ROR2-positive (T-47D, 786-O, and U266) target cells or ROR2-negative target cells. The gray filled curve represents control T cells (untransduced T cells). [Figure 25A]This figure shows the enrichment and detection of CAR knock-in T cells using the EGFRt transduction marker. Human CD4+ T cells or human CD8+ T cells were co-electropermeated with a homology-dependent repair template (HDRT) containing hTRAC-specific sgRNA / spCas9 ribonucleoprotein (RNP) and a cassette encoding XBR2-401 or X3.12 CAR. CAR knock-in T cells were enriched by magnetically activated cell sorting (MACS) using the transduction marker, truncated epidermal growth factor receptor (EGFRt). The coding sequence (CDS) of EGFRt was ligated to the CDS of the CAR via a 2A ribosome skipping sequence, allowing EGFRt expression to be used as a surrogate marker for CAR expression. The T cell receptor and CD3 are co-shuttle to the cell surface. Thus, CD3 negativity can be used to detect TRAC-KO T cells and knock-in T cells. This flow cytometry plot supports the frequency of EGFRt-positive CD4+ T cells after MACS enrichment. CD3 negativity of CAR knock-in T cells is represented in the adjacent histogram. [Figure 25B]This figure shows the enrichment and detection of CAR knock-in T cells using the EGFRt transduction marker. Human CD4+ T cells or human CD8+ T cells were co-electropermeated with a homology-dependent repair template (HDRT) containing hTRAC-specific sgRNA / spCas9 ribonucleoprotein (RNP) and a cassette encoding XBR2-401 or X3.12 CAR. CAR knock-in T cells were enriched by magnetically activated cell sorting (MACS) using the transduction marker, truncated epidermal growth factor receptor (EGFRt). The coding sequence (CDS) of EGFRt was ligated to the CDS of the CAR via a 2A ribosome skipping sequence, allowing EGFRt expression to be used as a surrogate marker for CAR expression. The T cell receptor and CD3 are co-shuttle to the cell surface. Thus, CD3 negativity can be used to detect TRAC-KO T cells and knock-in T cells. This flow cytometry plot supports the frequency of EGFRt-positive CD8+ T cells after MACS enrichment. CD3 negativity of CAR knock-in T cells is represented in the adjacent histogram. [Figure 26A] This figure shows the cytolytic activity of ROR2 CAR knock-in CD8+ T cells. It represents the cytolytic activity of primary human CD8+ T cells expressing XBR2-401 CAR or affinity-matured X3.12 CAR against ROR2-positive target cells under the control of the T cell receptor locus promoter. MDA-MB-231 is a ROR2-negative human breast cancer cell line used as a negative control. T-47D (breast cancer), 786-O (renal cell carcinoma), and U266 (multiple myeloma) are established cancer cell lines that endogenously express ROR2. All target cell lines were engineered to stably express firefly luciferase. Specific lysis of target cells was calculated based on the intensity of the luminescence signal after the addition of luciferin up to a final concentration of 150 μg / ml (data represent n=3 independent donors). [Figure 26B]This figure shows the cytolytic activity of ROR2 CAR knock-in CD8+ T cells. It presents combined data on the antigen-dependent cytolytic activity of ROR2-specific CAR-T cells against various ROR2-positive target cells (T-47D, 786-O, U266). ROR2-negative MDA-MB231 cells were used as a negative control (E:T ratio = 1:1, t = 24 hours, n = 3). [Figure 26C] This figure shows the cytolytic activity of ROR2 CAR knock-in CD8+ T cells. It represents the cytolytic activity of primary human CD8+ T cells expressing either the XBR2-401 ROR2-specific CAR or the X3.12 ROR2-specific CAR against ROR2-positive 786-O cells, under the control of the endogenous T cell receptor promoter using the xCELLigence platform. Normalized cell indices, directly correlated with the number of viable adherent tumor cells, were measured and plotted over time (data represent n=2 for independent donors). [Figure 27] This figure shows cytokine secretion from XBR2-401-based ROR2-specific CAR knock-in T cells or X3.12-based ROR2-specific CAR knock-in T cells. CD4+ CAR-T cells or CD8+ CAR-T cells expressing XBR2-401 CAR or X3.12 CAR were co-cultured with ROR2-positive target cells in an E:T ratio of 4:1. The concentrations of the effector cytokines IL-2 and IFN-γ were measured by ELISA in the cell culture supernatant 24 hours after co-culture. Comparative cytokine secretion against ROR2-positive target cells (T-47D, 786-O, and U266) and MDA-MB-231 is shown for CD4+ T cells and CD8+ T cells derived from n=3 independent donors. [Figure 28]This figure shows the proliferation of XBR2-401-based ROR2-specific CAR knock-in T cells or X3.12-based ROR2-specific CAR knock-in T cells. It shows the proliferation of CD8+ ROR2-specific CAR-T cells after stimulation with irradiated ROR2-positive target cells at an E:T ratio of 4:1. Exogenous cytokines were not added to the culture medium, and T cell proliferation was evaluated 72 hours after stimulation using CFSE dye dilution. The figure also shows CFSE flow cytometry histograms for ROR2-specific CAR-T cells using XBR2-401 (dotted line) or X3.12 (solid line) against ROR2-positive (T-47D, 786-O, and U266) target cells or ROR2-negative target cells. The gray filled curve represents the medium control for XBR2-401 CAR. [Figure 29A] This figure shows the generation, detection, and enrichment of ROR2 CAR-T cells. Lentiviral vectors encoding X3.12 CAR, hX3.12.5 CAR, or hX3.12.6 CAR were transduced into human CD4+ T cells or human CD8+ T cells. Subsequently, cells expressing the CAR were enriched using magnetically activated cell sorting (MACS) with the transduction marker, cleaved epidermal growth factor receptor (EGFRt). The coding sequence (CDS) of EGFRt was ligated to the CDS of the CAR via a 2A ribosome skipping sequence, allowing EGFRt expression to be used as a surrogate marker for CAR expression. This is a flow cytometry plot supporting the frequency of EGFRt-positive CD4+ T cells after EGFRt enrichment by MACS. [Figure 29B]This figure shows the generation, detection, and enrichment of ROR2 CAR-T cells. Lentiviral vectors encoding X3.12 CAR, hX3.12.5 CAR, or hX3.12.6 CAR were transduced into human CD4+ T cells or human CD8+ T cells. Subsequently, cells expressing the CAR were enriched using magnetically activated cell sorting (MACS) with the transduction marker, cleaved epidermal growth factor receptor (EGFRt). The coding sequence (CDS) of EGFRt was ligated to the CDS of the CAR via a 2A ribosome skipping sequence, allowing EGFRt expression to be used as a surrogate marker for CAR expression. This is a flow cytometry plot supporting the frequency of EGFRt-positive CD8+ T cells after EGFRt enrichment by MACS. [Figure 30A] This figure shows the cytolytic activity of humanized ROR2 CAR-T cells. It represents the cytolytic activity of primary human CD8+ T cells expressing X3.12-based CAR, hX3.12.5-based CAR, or hX3.12.6-based CAR against ROR2-positive target cells. OPM-2 is a ROR2-negative human multiple myeloma cell line used as a negative control. T-47D (breast cancer), 786-O (renal cell carcinoma), and U266 (multiple myeloma) are established cancer cell lines that endogenously express ROR2. All target cell lines were engineered to stably express firefly luciferase. Specific lysis of target cells was calculated based on the intensity of the luminescence signal after the addition of luciferin up to a final concentration of 150 μg / ml (data represent n=3 independent donors). [Figure 30B]This figure shows the cytolytic activity of humanized ROR2 CAR-T cells. It presents combined data on antigen-dependent cytolytic activity of X3.12-based, hX3.12.5-based, or hX3.12.6-based CAR-T cells against various ROR2-positive target cells (T-47D, 786-O, U266). ROR2-negative OPM-2 cells were used as a negative control (E:T ratio = 5:1, t = 6 hours, n = 3). Statistical analysis is based on paired comparisons using ANOVA for repeated measures and Dunnett's multiple comparison test (ns: not significant, * = p < 0.05, ** = p < 0.01, *** = p < 0.001). [Figure 31] This figure shows the flow cytometry analysis of ROR2 expression in OPM-2 cell lines. The hX3.12.6×h38C2 DVD antibody was covalently conjugated with AF647 and used to analyze the ROR2 expression patterns in various OPM-2 cells (multiple myeloma cells). [Figure 32] This figure shows cytokine secretion from X3.12-based ROR2-specific CAR T cells, hX3.12.5-based ROR2-specific CAR T cells, and hX3.12.6-based ROR2-specific CAR T cells. CD4+ CAR-T cells or CD8+ CAR-T cells expressing X3.12-based CAR, hX3.12.5-based CAR, or hX3.12.6-based CAR were co-cultured with ROR2-positive target cells in an E:T ratio of 4:1. The concentration of the effector cytokine IFN-γ was measured by ELISA in the cell culture supernatant 24 hours after co-culture. Comparative cytokine secretion against ROR2-positive target cells (T-47D, 786-O, and U266) and MDA-MB-231 is shown for n=3 independent donor-derived CD4+ T cells and CD8+ T cells. Statistical analysis is based on paired comparisons (ns: not significant, *=p<0.05, **=p<0.01, ***=p<0.001) using ANOVA and Dunnett's multiple comparison test for repeated measures. [Figure 33]This figure shows the proliferation of ROR2 CAR-T cells. It represents antigen-dependent proliferation of CD4+ x3.12-based ROR2-specific CAR-T cells, CD4+ h x3.12.5-based ROR2-specific CAR-T cells, or CD4+ h x3.12.6-based ROR2-specific CAR-T cells, as well as CD8+ x3.12-based ROR2-specific CAR-T cells, CD8+ h x3.12.5-based ROR2-specific CAR-T cells, or CD8+ h x3.12.6-based ROR2-specific CAR-T cells, after stimulation with irradiated ROR2-positive or irradiated ROR2-negative target cells at an E:T ratio of 4:1. Exogenous cytokines were not added to the culture medium, and T cell proliferation was evaluated 72 hours after stimulation using CFSE dye dilution. Cell fractions that had undergone at least one cell division were calculated as a measure to quantify antigen-dependent proliferation (n=3 for independent donors). Statistical analysis is based on paired comparisons (ns: not significant, *=p<0.05, **=p<0.01, ***=p<0.001) using ANOVA and Dunnett's multiple comparison test for repeated measures. [Modes for carrying out the invention]

[0020] Unless otherwise specified herein, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art in the fields of gene therapy, immunology, biochemistry, genetics, and molecular biology.

[0021] All methods and materials similar to or equivalent to those described herein may also be used in the implementation or testing of the present invention, but this specification describes only the methods and materials that are appropriate. All publications, patents, and patent applications cited herein are incorporated herein in their entirety by reference for all purposes. References referred to herein are indicated by reference numbers in square brackets in the bibliography at the end of this specification (for example, "

[31] " or "Reference

[31] "). In case of any conflict, including definitions, this specification shall prevail over the cited references. Furthermore, materials, methods, and examples are illustrative only and are not intended to be limiting unless otherwise specified.

[0022] Non-human antibodies can be humanized by CDR grafting via methods known in the art. Humanization increases the homology (i.e., humanity) of the binding domain to the binding domain of human antibodies, reducing the potential immunogenicity of humanized antibodies in humans, which is expected to improve the safety and therapeutic applicability profile in human patients. On the other hand, antibody humanization often involves a reduction in the binding affinity of the humanized antibody to its antigen and often requires affinity maturation (see reference

[31] , incorporated throughout by reference for all purposes).

[0023] Furthermore, it has been observed that the use of humanized antibody fragments to create targeting domains for CARs can result in a decrease in the CAR's performance in binding to target antigens and the induction of effector function in cells expressing the CAR.

[0024] In this invention, the inventors used previously unpublished protein crystal structure data relating to epitopes and paratopes to develop a rational design-based affinity maturation of an existing anti-ROR2 antibody (rabbit antibody; incorporated in its entirety by reference for all purposes, WO2017 / 127702A1). Novel binding agents were isolated from a phage display library and characterized in vitro. Surface plasmon resonance revealed a tenfold increase in binding affinity (Kd = 0.7 nM).

[0025] The most potent clone was selected, and the antibody was humanized. The affinity-matured humanized clones (hX3.12.5 and hX3.12.6) were re-evaluated in vitro and showed a slight decrease in binding affinity (Kd=2.6nM and Kd=3.8nM, respectively) compared to the affinity-matured clone (X3.12). Antigen specificity was verified using cell microarray technology, and these findings were further confirmed by protein X-ray crystallography.

[0026] The inventors created ROR2×CD3 bi-mAbs from mature humanized clones and parental antibodies. All clones showed potent antigen-specific antitumor efficacy as determined by cell lysis assays. In addition, hX3.12.5×CD3 bi-mAb showed significantly more potent activation of T cells as determined by CD69 expression levels and IFN-γ secretion.

[0027] The inventors also generated second-generation ROR2 CAR-T cells using parental antibody clones and affinity-mature antibody clones, and functionally characterized them in vitro. Briefly, both antibody variants exhibited potent antitumor efficacy, determined by antigen-dependent cell lysis, cytokine secretion, and proliferation. Under dose-limiting conditions, CARs derived from affinity-mature antibodies outperformed those from the parental clones.

[0028] The “recombinant mammalian cells” according to the present invention may be any cells as defined herein. Preferably, the recombinant mammalian cells are isolated cells. Recombinant mammalian cells according to the present invention may be prepared according to known pharmaceutical standards. For example, recombinant mammalian cells may be formulated for administration to humans.

[0029] The "CAR" according to the present invention may be in any possible form. In a preferred embodiment, the CAR exists in an isolated form. In another preferred embodiment, the CAR according to the present invention, or the nucleic acid encoding the CAR, may be present in a composition. The composition may be a pharmaceutical composition.

[0030] The present invention includes switchable CAR T cells controlled by Fab or other antibody fragments. Examples of such types of switchable CAR T cells are described in [64-67]. This can be achieved by linking an adapter, which is a molecule to which a universal CAR binds, to a Fab or other antibody fragment that recognizes ROR2. When the adapter is administered, such switchable CAR-T cells can target and kill only cancer cells that express ROR2. This allows for titrable and reversible control of CAR T cells, as illustrated in

[67] . The switchable CAR-T platform also allows for simultaneous or sequential administration of different adapters. Different adapters may target the same antigen or different antigens, for example, ROR2 and additional antigens. The use of multiple adapters may effectively evolve CAR-T therapy from monoclonal recognition to polyclonal recognition to counter heterogeneity of target cells and resistance in cancer. Therefore, in a preferred embodiment of the present invention, an antibody derivative capable of binding to human ROR2 according to the present invention may be a derivative containing an adapter for universal CAR. Those skilled in the art will understand that such a derivative can confer ROR2 specificity to universal CAR.

[0031] Sequence alignment of sequences according to the present invention is performed using appropriate alignment parameters known in the art and an appropriate algorithm, preferably using the BLAST algorithm (see references [32, 33]).

[0032] "K D The term "K" or "K D The term "value" refers to the equilibrium dissociation constant known in the art. In the context of this invention, these terms may refer to the equilibrium dissociation constant of an antibody or derivative thereof (e.g., CAR T cell or antibody) capable of binding to ROR2 with respect to a target antigen (i.e., ROR2). The equilibrium dissociation constant is a measure of the tendency of a complex (e.g., an antigen-targeting agent complex) to reversibly dissociate into its components (e.g., the antigen and the targeting agent). In the art, K D A method for determining the value is known. Preferably, K D The value is determined by surface plasmon resonance measurement.

[0033] As used herein, the term “antibody” refers to any functional antibody capable of specifically binding to a target antigen. Without limitation, the term “antibody” encompasses antibodies derived from any suitable source species, including birds such as chickens, and mammals such as mice, goats, non-human primates, and humans. Preferably, the antibody is a humanized antibody or a human antibody. A humanized antibody is an antibody containing a human sequence and a secondary non-human sequence that confers binding specificity to the target antigen (e.g., ROR2). Preferably, the antibody is a monoclonal antibody that can be prepared by methods well known in the art. The term “antibody” encompasses isotype antibodies, such as IgG1, IgG2, IgG3, or IgG4, IgE, IgA, IgM, or IgD. The term “antibody” encompasses monomeric antibodies (IgD, IgE, IgG, etc.) or oligomeric antibodies (IgA or IgM, etc.). The term antibody also includes (without being particularly limited) isolated antibodies and genetically modified antibodies, such as chimeric antibodies or bispecific antibodies, or antibody conjugates with drugs such as anticancer drugs or cytotoxic drugs. A bispecific antibody capable of binding to ROR2 according to the present invention may be a T-cell engager such as a CD3×ROR2 BiTE (Bi-specific T-cell engager) or DART (dual-affinity re-targeting proteins). The “antibodies” (e.g., monoclonal antibodies) or “derivatives thereof” described herein may be linked to different molecules. For example, molecules that can be linked to antibodies may be other proteins (e.g., other antibodies), molecular labels (e.g., fluorescent labels, luminescent labels, colored labels, or radioactive molecular labels), pharmaceuticals, and / or toxic agents. The antibody or antigen-binding moiety may be linked directly (e.g., in the form of a fusion between two proteins) or via a linker molecule (e.g., any suitable type of chemical linker known in the art).

[0034] Antibody derivatives, or derivatives of antibodies capable of binding to ROR2 as used herein, include a portion of an antibody that retains the ability of the antibody to specifically bind to the ROR2 antigen. This ability can be determined, for example, by determining the ability of the antigen-binding portion to compete with the antibody for specific binding to the antigen, via methods known in the art. Antibody derivatives can be prepared by any suitable method known in the art, including recombinant DNA methods and preparation by chemical or enzymatic fragmentation of the antibody. Antibody derivatives can be Fab fragments, F(ab') fragments, F(ab')2 fragments, single-chain antibodies (scFv), single-domain antibodies, diabodies, or any other portion of an antibody that retains the ability of the antibody to specifically bind to the antigen. The antibody derivatives of the present invention may also be chimeric antigen receptors (CARs).

[0035] The terminology used in connection with this invention for antibodies or derivatives thereof, including their variable domains and their CDR sequences, follows the numbering system by Kabat. The numbering system by Kabat is described in Kabat EA, Wu, TT, Perry, H., Gottesman, K., and Foeller, C. (1991) “Sequences of Proteins of Immunological Interest,” 5th edition, NIH Publications 91-3242 (Reference

[68] ).

[0036] In accordance with the present invention, terms such as "cancer treatment," "treating cancer," "cancer therapy," or "cancer immunotherapy" refer to a therapeutic procedure. Whether a therapeutic procedure is effective can be evaluated, for example, by assessing whether the procedure inhibits cancer growth in one or more treated patients. Preferably, the inhibition is statistically significant, as can be assessed by appropriate statistical tests known in the art. Inhibition of cancer growth may be evaluated by comparing cancer growth in a group of patients treated according to the present invention with that of an untreated control group, or by comparing a group of patients receiving standard cancer treatment in the art plus treatment according to the present invention with a control group of patients receiving only standard cancer treatment in the art. Such studies for evaluating inhibition of cancer growth should be designed according to acceptable criteria for clinical studies with sufficient statistical power, such as double-blind studies or randomized controlled studies. The term "treating cancer" includes inhibition of cancer growth when it is partially inhibited (i.e., cancer growth in the patient is delayed compared to the patient's control group), inhibition when cancer growth is completely inhibited (i.e., cancer growth in the patient is stopped), and inhibition when cancer growth is reversed (i.e., the cancer regresses). Evaluation of whether a treatment is effective may be based on known clinical indicators of cancer progression. In the context of hematological cancers that do not form solid tumors, cancer growth may be evaluated by known methods, such as methods based on cancer cell counting.

[0037] The cancer treatment according to the present invention does not exclude the possibility that further therapeutic benefits or secondary therapeutic benefits may also occur in the patient.

[0038] The cancer treatment according to this invention may be a first-line treatment, a second-line treatment, a third-line treatment, or a fourth-line treatment. The treatment may also be a treatment beyond the fourth-line treatment. The meanings of these terms are publicly known in the art and follow the terminology commonly used by the U.S. National Cancer Institute.

[0039] As used herein, the term "capable of binding to ~" refers to the ability to form a complex with the molecule to be bound (e.g., ROR2). Binding typically occurs non-covalently through intermolecular forces such as ionic bonds, hydrogen bonds, and van der Waals forces, and is typically reversible. A variety of methods and assays for determining binding ability are known in the art. Binding is usually high-affinity binding, in which case K D The affinity measured by the value is preferably less than 1 μM, more preferably less than 50 nM, even more preferably less than 10 nM, even more preferably less than 7 nM, even more preferably less than 5 nM, even more preferably less than 1 nM, or in the range of 0.1 nM to 1 nM.

[0040] For example, an antibody or derivative thereof according to the present invention can bind to ROR2, in which case K D The affinity for ROR2, as measured by a value, is preferably less than 50 nM, more preferably less than 10 nM, even more preferably less than 7 nM, even more preferably less than 5 nM, even more preferably less than 1 nM, or in the range of 0.1 nM to 1 nM. Pharmaceutical compositions according to the present invention are prepared according to known standards for the preparation of pharmaceutical compositions. For example, compositions are prepared in a manner that allows them to be properly stored and administered. That is, compositions may contain pharmaceutically acceptable components, such as carriers, excipients, or stabilizers. Such pharmaceutically acceptable components are not toxic in the amounts used when the pharmaceutical composition is administered to a patient. Acceptable pharmaceutical components added to the pharmaceutical composition may be selected based on the chemical properties of the active agent (e.g., an antibody or derivative thereof capable of binding to ROR2, or recombinant cells according to the present invention, or nucleic acids according to the present invention), the specific intended use of the pharmaceutical composition, and the route of administration. According to the present invention, it is understood that the compositions are suitable for administration to humans.

[0041] In this specification, pharmaceutically acceptable carriers may be used as known in the art. As used herein, the term “pharmaceutically acceptable” means approved by a U.S. federal or state regulatory agency, or for use in mammals, and more specifically for use in humans, listed in the United States Pharmacopeia, the European Pharmacopeia, or any other generally recognized pharmacopoeia. pharmaceutically acceptable carriers include, but are not limited to, physiological saline, buffered physiological saline, dextrose, water, glycerol, sterile isotonic aqueous buffers, and combinations thereof. It will be understood that formulations may be appropriately adapted to the administration method.

[0042] The "plasmid" used in accordance with the present invention may be any type of plasmid known in the art that is suitable for use in the present invention. For example, the plasmid may be a nanoplasmid.

[0043] Each occurrence of the terms "including" or "containing" used herein may, at their discretion, be replaced with "consisting of" or "consisting of."

[0044] Further Preferred Embodiments In a preferred embodiment, the present invention includes an antibody capable of binding to human ROR2, or a derivative thereof capable of binding to human ROR2, comprising a light chain variable domain and a heavy chain variable domain, wherein the heavy chain variable domain comprises a CDR3 sequence having an amino acid sequence selected from the group consisting of SEQ ID NOs: 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 37, and 38.

[0045] In another embodiment, the present invention comprises a bispecific antibody comprising scFv-Fc with a knob mutation defined by the amino acid sequence shown in Figure 1B, and scFv-Fc with a hole mutation defined by the amino acid sequence shown in Figure 1B.

[0046] In another preferred embodiment, the present invention comprises a bispecific antibody comprising scFv-Fc with a knob mutation defined by the amino acid sequence shown in Figure 2B, and scFv-Fc with a hole mutation defined by the amino acid sequence shown in Figure 2B.

[0047] In another preferred embodiment, the present invention comprises a bispecific antibody comprising scFv-Fc with a knob mutation defined by the amino acid sequence shown in Figure 3B, and scFv-Fc with a hole mutation defined by the amino acid sequence shown in Figure 3B.

[0048] In another embodiment, the present invention includes CARs defined by the amino acid sequence shown in Figure 1C.

[0049] In another preferred embodiment, the present invention includes CARs defined by the amino acid sequence shown in Figure 2C.

[0050] In another preferred embodiment, the present invention includes CARs defined by the amino acid sequence shown in Figure 3C.

[0051] According to all other embodiments of the present invention, antibodies and derivatives thereof according to the present invention are preferably capable of binding to the kringle domain of human ROR2.

[0052] In more preferred embodiments of the above aspects and embodiments, the antibody or derivative thereof may have any of the other features of the present invention described herein. The antibody or derivative thereof may be part of a pharmaceutical composition or CAR that can be used, for example, in the treatment of cancer as described herein. Similarly, the present invention also includes nucleic acids encoding the antibodies or derivatives thereof of the above aspects of the present invention, for example, in the form of a vector such as a viral vector, and pharmaceutical compositions comprising such nucleic acids.

[0053] array The sequences referred to herein are as follows:

[0054] Amino acid sequences are indicated using standard single-letter amino acid codes in N-terminus to C-terminus order, unless otherwise indicated. Nucleic acid sequences are indicated using standard nucleic acid codes in 5' to 3' order, unless otherwise indicated.

[0055] Amino acid sequence: >XBR2-401 VH sequence (Sequence ID 1):

[0056] [ka]

[0057] >XBR2-401 VL sequence (SEQ ID NO: 2):

[0058] [ka]

[0059] >X3.12 VH array (sequence number 3):

[0060] [ka]

[0061] >X3.12 VL sequence (sequence number 4):

[0062] [ka]

[0063] >hX3.12.5 VH array (sequence number 5):

[0064] [ka]

[0065] >hX3.12.5 VL sequence (sequence number 6):

[0066] [ka]

[0067] >hX3.12.6 VH array (sequence number 7):

[0068] [ka]

[0069] 4(GS)×3 linker(Sequence No. 8): GGGGSGGGGSGGGGS

[0070] Hinge, CH2 (non-glycosylation mutation), and CH3 (N297A) (SEQ ID NO: 9):

[0071] [ka]

[0072] V9 scFV heavy chain variable domain (VH) (SEQ ID NO: 10):

[0073] [ka]

[0074] (G4S) x 3 linkers (Sequence ID 11): SSGGGGSGGGGSGGGGS

[0075] V9 scFV light chain variable domain (VL) (SEQ ID NO: 12):

[0076] [ka]

[0077] Hinge, CH2 (non-glycosylation mutation), and CH3 (N297A) (SEQ ID NO: 13):

[0078] [ka]

[0079] GMCSF signal peptide (SEQ ID NO: 14): MLLLVTSLLLCELPHPAFLLIP

[0080] Partial amino acid sequence of human ROR1 (SEQ ID NO: 15) shown in Figure 8: FKSD

[0081] Figure 8 shows a further partial amino acid sequence of human ROR1 (SEQ ID NO: 51): TFTALR

[0082] IgG4 hinge (SEQ ID NO: 16): ESKYGPPCPPCP

[0083] CD28 transmembrane domain (SEQ ID NO: 17): MFWVLVVVGGVLACYSLLVTVAFIIFWV

[0084] CD3ζ signaling domain (SEQ ID NO: 18):

[0085] [ka]

[0086] T2A ribosome skipping sequence (SEQ ID NO: 19): LEGGGEGRGSLLTCGDVEENPGPR

[0087] EGFRt (Sequence ID 20):

[0088] [ka]

[0089] Human Ig heavy chain signal peptide (SEQ ID NO: 21): MDWTWRILFLVAAATGAHS

[0090] Partial amino acid sequence of human ROR2 (SEQ ID NO: 22):

[0091] [ka]

[0092] HCDR3 sequence (SEQ ID NO: 23) shown in Figure 9: DXXSLNI (Note that X is an amino acid that can be selected from any naturally occurring amino acid.)

[0093] HCDR3 sequence (sequence number 24) shown in Figure 9: DXXXSLNI (Note that X is an amino acid that can be selected from any naturally occurring amino acid.)

[0094] HCDR3 sequence (SEQ ID NO: 25) shown in Figure 9: DXXXXSLNI (Note that X is an amino acid that can be selected from any naturally occurring amino acid.)

[0095] HCDR3 sequence (sequence number 26) as shown in Figure 10:

[0096] [ka]

[0097] HCDR3 sequence (sequence number 27) as shown in Figure 10:

[0098] [ka]

[0099] HCDR3 sequence (sequence number 28) as shown in Figure 10:

[0100] [ka]

[0101] HCDR3 sequence (sequence number 29) as shown in Figure 10:

[0102] [ka]

[0103] HCDR3 sequence (sequence number 30) as shown in Figure 10:

[0104] [ka]

[0105] HCDR3 sequence (sequence number 31) as shown in Figure 10:

[0106] [ka]

[0107] HCDR3 sequence (sequence number 32) as shown in Figure 10:

[0108] [ka]

[0109] HCDR3 sequence (sequence number 33) as shown in Figure 10:

[0110] [ka]

[0111] HCDR3 sequence (sequence number 34) as shown in Figure 10:

[0112] [ka]

[0113] HCDR3 sequence (sequence number 35) as shown in Figure 10:

[0114] [ka]

[0115] HCDR3 sequence (sequence number 36) as shown in Figure 10:

[0116] [ka]

[0117] HCDR3 sequence (sequence number 37) as shown in Figure 10:

[0118] [ka]

[0119] HCDR3 sequence (sequence number 38) as shown in Figure 10:

[0120] [ka]

[0121] VL1 sequence (sequence number 39) as shown in Figure 11:

[0122] [ka]

[0123] VH1 sequence (sequence number 40) as shown in Figure 11:

[0124] [ka]

[0125] LCDR1 sequence (sequence number 41) as shown in Figure 11:

[0126] [ka]

[0127] LCDR2 sequence (sequence number 42) in Figure 11:

[0128] [ka]

[0129] LCDR3 sequence (sequence number 43) as shown in Figure 11:

[0130] [ka]

[0131] HCDR1 sequence (sequence number 44) as shown in Figure 11: SYGVT

[0132] HCDR2 sequence (sequence number 45) as shown in Figure 11:

[0133] [ka]

[0134] HCDR3 sequence (sequence number 52) as shown in Figure 11: DDRWSLNI

[0135] Partial amino acid sequences of VhX3.12 and Vh401 (SEQ ID NO: 53) as shown in Figure 11: QSVK

[0136] Partial amino acid sequences of Vh3, VhX3.12, and Vh401 (SEQ ID NO: 54) as shown in Figure 11: NTNE

[0137] Nucleic acid sequence: STOP Primer (SEQ ID NO: 46): ACCTATTTTCTGTGCGAGGATTGTAATCCCTTAACATCTGGGGACCA

[0138] Unirev Primer (SEQ ID NO: 47): ATCTCTCGCACAGAAATAGGT

[0139] X2 primer (SEQ ID NO: 48): ACCTATTTCTGTGCGAGAGATNNKNNKTCCCTTAACATCTGGGGACCA

[0140] X3 primer (SEQ ID NO: 49): ACCTATTTCTGTGCGAGAGATNNKNNKNNKTCCCTTAACATCTGGGGACCA

[0141] X4 primer (SEQ ID NO: 50): ACCTATTTCTGTGCGAGAGATNNKNNKNNKNNKTCCCTTAACATCTGGGGACCA [Examples]

[0142] The present invention is illustrated by the following non-limiting examples:

[0143] (Example 1) Affinity maturation, humanization, and co-crystallization of rabbit anti-human ROR2 monoclonal antibodies for therapeutic efficacy. Materials and methods: Cell lineage and primary cells The breast cancer cell lines, MDA-MB-231 and T47D, were purchased from ATCC and grown in DMEM (Thermo Fisher Scientific), 100 U / mL penicillin / streptomycin (Thermo Fisher Scientific), and 10% (v / v) FBS (BioFluid Technologies). The renal cell adenocarcinoma cell line, 786-O (NCI-60 panel cell line obtained from The Scripps Research Institute's Cell-Based High-Throughput Screening Core), was grown in RPMI 1640 (Thermo Fisher Scientific), 100 U / mL penicillin / streptomycin (Thermo Fisher Scientific), and 10% (v / v) FBS (BioFluid Technologies). Stable transfected HEK 293F cells with human ROR2 (Thr245 allotype), mouse ROR2, and mock vectors have been previously published

[29] . The same study showed that the mAb 401 binds to both the Thr245 and Ala245 allotypes of ROR2, which arise from a single nucleotide polymorphism (SNP; rs10820900) within the frizzled domain (hROR2-Fz) of human ROR2. Human PBMCs were purchased from AllCells and cultured in X-VIVO 20 medium (Lonza) with 5% (v / v) off-the-clot human AB serum (Gemini Bio-Products) and 100 U / mL IL-2 (Cell Sciences). As previously described

[34] , primary T cells were expanded from PBMCs using Dynabeads ClinExVivo CD3 / CD28 (Thermo Fisher Scientific).The Jurkat-T Lucia NFAT reporter cell line was purchased from InvivoGen and cultured in RPMI 1640 (modified by ATCC) medium with 100 U / mL penicillin / streptomycin. For subculture, 10% (v / v) FBS (BioFluid Tech.); 100 μg / mL zeocin (manufactured by InvivoGen) was added.

[0144] Crystallization and structure determination of 401 and hX3.12.6 in complex with hROR2-Kr Cloning, expression, and purification: DNA fragments encoding Fab 401, Fab hX3.12.6, and full-length human ROR2 (clone ID: 40146553; manufactured by GE Healthcare Dharmacon) were amplified by PCR, respectively, to create the corresponding scFv format (V H -3×(GGGGS)-V L ), and the kringle domain of human ROR2 (hROR2-Kr). The PCR product encoding hROR2-Kr was cloned into the pET15b expression vector (manufactured by Novagen)

[35] modified to co-express Escherichia coli (E. coli) chaperone / disulfide isomerase (DsbC) to create pET15b-hROR2-Kr-DsbC, which expresses hROR2-Kr with a thrombin-cleavable N-terminal hexa-histidine tag. The scFv-encoding PCR products containing their native ribosome-binding sites were inserted between hROR2-Kr and DsbC, resulting in pET15b-hROR2-Kr-scFv 401-DsbC and pET15b-hROR2-Kr-scFv hX3.12.6-DsbC. Escherichia coli of the Rosetta-gami2(DE3) strain (manufactured by Novagen) was transformed with each of the three expression plasmids. The transformed Escherichia coli was grown at 37 °C with stirring at 230 rpm in LB medium containing ampicillin, tetracycline, and chloramphenicol. When the cell density reached an OD of 0.6 595Once the cell expression level was reached, protein expression was induced with 0.3 mM isopropyl β-D-thiogalactoside (IPTG). The cells were then grown at 20°C for a further 18 hours.

[0145] Protein purification: The bacterial pellet was resuspended in sonication buffer (20 mM HEPES, pH 8.0, 500 mM NaCl, 15 mM imidazole, 10% (v / v) glycerol), sonicated in an ice bath, and centrifuged at 53,300 × g for 25 minutes. The supernatant was loaded onto a custom-packed 10 mL HIS-Select column (Sigma-Aldrich) and washed with sonication buffer. The bound proteins were eluted using a linear gradient with 15 mM to 500 mM imidazole. The eluted proteins were treated with thrombin (Sigma-Aldrich) overnight at 4°C to remove the N-terminal hexahistidine tag in hROR2-Kr. The cleaved proteins were further purified on a Superdex 200 26 / 60 column (GE Healthcare) equilibrated with 50 mM NaCl, 10 mM HEPES, and pH 7.4.

[0146] Crystallization and Structure Determination: Crystals of the scFv401:hROR2-Kr complex were grown by vapor diffusion at room temperature (RT) using a precipitant containing 1.5 μL of 14 mg / mL protein, an equal volume of 0.1 M tribasic sodium citrate dihydrate, and 15% (w / v) polyethylene glycol 3350. Sufficient growth occurred within 2 days. hROR2-Kr yielded clustered crystals by vapor diffusion at RT using 2 μL of 14 mg / mL protein with 1 μL of a precipitant containing 0.2 M lithium acetate and 20% (w / v) PEG 3350. The crystal clusters were crushed and seeded onto droplets equilibrated at a protein:precipitant ratio of 3:1 to obtain single crystals. Crystals of the scFv hX3.12.6:hROR2-Kr complex were grown by vapor diffusion in RT using a precipitating agent containing 1.5 μL of 3 mg / mL protein, and equal volumes of 10 mM MgCl2 hexahydrate, 5 mM nickel(II) chloride hexahydrate, 0.1 M Na-HEPES pH 7.0, and 13% (w / v) PEG 4000. After removing excess mother liquor, the crystals were flash-frozen in liquid nitrogen using a nylon loop. Diffraction datasets for both scFv401:hROR2-Kr and hROR2-Kr, with a Bragg spacing of 1.1 Å, were recovered using a Rayonix MX300 detector at the Advanced Photon Source (APS) beamline LS-CAT 21-ID-F synchrotron facility (Argonne National Laboratory). Diffraction datasets for the scFv hX3.12.6:hROR2-Kr, with a Bragg spacing of 1.3 Å, were collected using the PILATUS3 S 6M detector at the Advanced Light Source (ALS) beamline 5.0.2 synchrotron facility (Lawrence Berkeley National Laboratory). The datasets were processed using autoPROC, which uses XDS as the processing engine.

[36] The structure was elucidated by molecular substitution using PHASER

[37] as the search model for PDB ID:6BA5(scFvR11:hROR1-Kr)

[34] . Refinement of the crystal structure analysis was performed using PHENIX version 1.14

[38] . Manual reconstruction and correction of the structure was performed using Coot

[39] . Data processing statistics and refinement statistics are shown (Figure 6). Molecular images (Figures 5A, 5B, and 8A, 8B) were created using PyMOL

[40] . Interaction interfaces were analyzed using PDBePISA [41, 42]. Structural validation was performed using MolProbity

[43] .

[0147] affinity maturation Library preparation: The 401 stop mutant was prepared using double-extension PCR with the sense primer STOP and the antisense primer unirev to avoid library contamination by the parent 401. Subsequently, three different libraries were prepared by randomizing and extending HCDR3 using NNK codons, with two randomization codons (X2) placed at residues 96 and 97 of HCDR3, a further randomization codon (X3) placed immediately downstream of residue 97, and two further randomization codons (X4) placed immediately downstream of residue 97. These variants were prepared by double-extension PCR using the NNK-denaturing sense primers X2, X3, or X4 in combination with the antisense primer unirev. The final constructs were cloned into the phagemide pC3C with the flanking primers C-5'SFIVL and c-3'sfivh, as previously described

[29] . Primer sequence: STOP:5'-ACCTATTTCTGTGCGAGGATTGTAATCCCTTAACATCTGGGGACCA-3';unirev:5'-ATCTCTCGCACAGAAATAGGT-3';X2:5'-ACCTATTTCTGTGCGAGAGATNNKNNKTCCCTTAAC ATCTGGGGACCA-3';X3:5'-ACCTATTTCTGTGCGAGAGATNNKNNKNNKTCCCTTAACATCTGGGGACCA-3';

[0148] Library selection: Following the published protocol for selection of rabbit / human chimeric Fab by phage display

[44] , three different panning techniques were investigated. The first technique involved conventional surface panning (3 rounds) using 1 μg of hROR2-Fc in 25 μL of PBS for immobilization on a 96-well ELISA plate (Costar 3690; Corning), 3% (w / v) of BSA in PBS for blocking, and 10 washes using 0.05% (v / v) of Tween 20 in PBS (TPBS). The second method involved surface competitive panning (one round using the second round of conventional surface panning) with 100 ng of immobilized and blocked hROR2-Fc as described above, followed by a 2-hour pre-incubation with a 10-fold molar excess of parent Fab 401, and 15 washes with TPBS. The third method involved solution competitive panning (5 rounds) with half-reduction amounts of biotinylated

[44] hROR2-Fc (100–6.25 ng in PBS), followed by pre-incubation with a 10-fold molar excess of parent Fab 401 for various concentrations of hROR2-Fc. Each step involved capture with streptavidin-coated magnetic beads (Dynabeads MyOne Streptavidin C1; Thermo Fisher Scientific), acid elution using 100 mM glycine-HCl (pH 2.2), panning rounds 2 and 3, and panning rounds 4 and 5 (i.e., without intermittent re-amplification), and coupling with a wash step to increase rigor (Tween 20 with 0.05% (v / v) to 0.5% (v / v) in PBS). Using the published protocol

[44] , the final output colonies were screened by Fab ELISA using immobilized hROR2-Fc, and the HCDR3 of positive clones was determined by DNA sequencing.

[0149] Humanization Humanization of X3.12 was performed by using IgBlast (www.ncbi.nlm.nih.gov / igblast / ) to find the closest human germline with minimal polymorphisms, determined using the Mammal:Human (Homo sapiens) link (www.imgt.org / IMGTrepertoire / Proteins / ) for IGHV and IGKV in IMGT. Rational mutations

[45] were performed to varying degrees to determine the mutations necessary to preserve affinity for ROR2.

[0150] Cloning, expression, and purification of Fab All selected Fab variants were cloned, with modifications, as described in

[29] . Briefly, the Fab variants were cloned into the bacterial expression vector pET11a

[46] , which was used to transform E. coli Rosetta (DE3) strain (EMD Millipore). The culture supernatant was tandem purified using a 1 mL HiTrap Kappa Select HP column followed by a 1 mL HisTrap HP column with an AKTA FPLC analyzer (all GE Healthcare). (The top 12 rabbit / human chimeric anti-human Fabs were purified using only the 1 mL HisTrap HP column). Protein purity was analyzed by SDS-PAGE and Coomassie blue staining. 280 The concentration of the purified Fab mutant was determined using the absorbance in the specified location.

[0151] Surface plasmon resonance The reaction rate and thermodynamic parameters for the binding of purified anti-ROR2 Fab mutants to ROR2 were measured using SPR performed on a Biacore X100 analyzer with Biacore reagents and Biacore software (GE Healthcare), as previously described

[29] . Briefly, to capture the hROR2-Fc antigen, mouse anti-human IgG C was applied to a CM5 sensor chip. HTwo mAbs were immobilized. To confirm the regeneration of the sensor chip, after measuring the highest concentration, each Fab variant was diluted with 100 nM 1x concentration HBS-EP+ running buffer, and then further diluted 2x using 1x concentration HBS-EP+ running buffer to create a total of five dilutions, with the lowest concentration repeats.

[0152] Thermal stability assay To melt the protein, we followed the procedure described in the LightCycler 480 Instrument Quick Guide (Roche). We used the parent Fab 401 at 1 mg / mL and determined the optimal conditions using Optimization Table 1 as suggested in the Quick Guide. Roche Protein Melting software was used for analysis. The optimal conditions required 0.5 μL of 1 mg / mL Fab, 1.0 μL of SYPRO Orange Dye 100x stock solution, and 8.50 μL of Dulbecco's PBS (DPBS). All Fab samples were examined in triplicate under these conditions.

[0153] Cell microarrays by Retrogenix Custom pre-screening, full-screening, and post-screening were performed by Retrogenix, as previously described.[29, 47]

[0154] Functionality research Preparation of ROR2×CD3 bispecific antibodies: Cloning, expression, and purification of ROR2×CD3 biAbs in the heterodimer nonglycosylated scFv-Fc format followed the previously described

[48] , modified protocol. Briefly, the sequence encoding scFv was synthesized as gBlocks (Integrated DNA Technologies) containing the sequence encoding the signal peptide at the N-terminus. The hinge domain and heavy chain constant domain of human IgG1, C1, were used. H 2 and C HDuplication extension PCR was used to incorporate the sequence encoding 3. The previously described KIH (knobs-into-holes) mutation

[49] was replaced with CD3 scFv-hinge-C. H 2-C H 3-code arrangement, and ROR2 scFv-hinge-C H 2-C H It was incorporated into a 3-chord arrangement. C H The non-glycosylating mutation N297A within sequence 2 was incorporated into both sequences. These scFv-Fc coding sequences were then inserted into the mammalian expression vector pCEP4 using the KpnI and XhoI restriction sites. Following DNA sequencing for validation (Eton Bioscience), cells were cultured at 37°C with shaking in 150 mL of FreeStyle medium (Thermo Fisher Scientific) in an atmosphere of 8% CO2 and 100% humidity, using polyethyleneimine (PEI; Polysciences), yielding 3 × 10⁶ cells per mL. 6 Plasmids were transfected into HEK 293F cells (Thermo Fisher Scientific). After 6–12 hours, an additional 150 mL of FreeStyle medium was added. After 3 days, the supernatant was collected, followed by filtration and purification using a 1 mL HiTrap Protein A HP column (GE Healthcare) with an AKTA FPLC analyzer (GE Healthcare), and then size exclusion chromatography using a Superdex 200 10 / 300 GL column (GE Healthcare Life Sciences) equilibrated with water and then DPBS. The yield was typically approximately 5–10 mg / L. The purity of biAb was confirmed by Coomassie blue staining following SDS-PAGE. 280 The absorbance was measured at [location].

[0155] Flow cytometry: Target cells 1 × 10⁶ 5Individual staining was performed in the same manner as the standard method and as previously described [29, 34], with 5 μg / mL of Fab or biAb in 100 μL of cytometry buffer (PBS supplemented with 1% (w / v) BSA and 0.1% (w / v) sodium azid). After washing, cells were incubated on ice for 1 hour with a 1:1,000 dilution of PE-conjugated goat anti-human IgG F(ab')2 fragment-specific pAb or Alexa Fluor 647-conjugated donkey anti-goat IgG(H+L) pAb (both in Jackson ImmunoResearch F(ab')2 format) in 100 μL of flow cytometry buffer. Alexa Fluor 647-conjugated mouse anti-human CD69 mAb was purchased from BioLegend. The cells were analyzed using a FACSCanto analyzer (BD Biosciences) and FlowJo analysis software (Tree Star).

[0156] In vitro cytotoxicity assays and T cell activation assays: Cytotoxicity was measured using CytoTox-Glo (Promega) according to the manufacturer's protocol and, with some modifications, to previously published publications

[48] . Primary T cells expanded from healthy donor PBMCs were used as effector cells, and 786-O cells or MDA-MB-231 cells were used as target cells in an effector-to-target cell ratio of 10:1. Cells were incubated in X-VIVO 20 medium (Lonza) with 5% (v / v) off-the-clot human AB serum. First, target cells (2 × 10⁶) were incubated. 4 ) are incubated with biAb, and then effector cells (2 × 10¹⁶) are added to each well of a 96-well tissue culture plate in a final volume of 100 μL. 5Following the addition of ), incubation was performed at 37°C for 16 hours. BiAbs in the concentration range of 2 ng / mL to 1 μg / mL were used. The plate was centrifuged, and 50 μL of supernatant was transferred to a 96-well clear-bottomed white-walled plate (Costar 3610; Corning) containing 25 μL of CytoTox-Glo reagent per well. After incubation for 15 minutes in RT, the plate was read using a SpectraMax M5 analyzer with SoftMax Pro software set to luminescence. Following the ELISA Ready-SET-Go! Reagent protocol (eBioscience), further supernatant from previous studies was diluted 20-fold and used for human IFN-γ ELISA.

[0157] result: Crystallization of mAb XBR2-401 in complex with human ROR2 kringle domain The inventors have previously reported on the binding of a panel of 12 rabbit / human chimeric Fabs selected from a naive rabbit antibody library to human ROR2

[29] . Of these, the Fab-format and IgG1-format mAb XBR2-401 ("401") (Figure 19) were shown to be specific to the kringle domain of ROR2 (hROR2-Kr) and recognize both human and mouse orthologs, but not to its closest relative, ROR1

[29] . To define the paratopes and epitopes of 401, the inventors used X-ray crystallography to elucidate the structure of 401 in scFv (Figure 19) format in complex with hROR2-Kr (Figure 6) (Protein Data Bank ID (PDB): 6OSH) at a resolution of 1.2 Å (Figure 5A). The crystal contained one complex within an asymmetric unit. Except for the 15-amino acid scFv linker, all residues in the crystal were sufficiently resolved. The filled surface area between 401 and hROR2-Kr was 720 Å. 2These components comprised 7.0% and 15.9% of the total surface area of ​​401 and hROR2-Kr, respectively. Van der Waals contacts were occupied by HCDR2 and LCDR3 of 401. In particular, Ala95 (numbered by Kabat) derived from LCDR3 was contained within shallow hydrophobic pockets created by three, five, and six residues of the hROR2-Kr loop

[50] : Leu350, Pro368, Gln371, Trp376, Phe378, and Met386. On the other hand, His349 of loop 3, derived from hROR2-Kr, protruded into the main pocket formed by CDR, resulting in a salt bridge to Asp32 of LCDR1 (Figure 7). The interface also contained numerous direct and water-mediated hydrogen bonding interactions (Figure 7), predominantly composed of residues derived from HCDR2 and LCDR1. Compared to residues derived from HCDR2 and LCDR3, which are deeply involved in epitope recognition, Trp96 (numbered by Kabat) derived from HCDR3 resulted in limited interaction with hROR2-Kr via a suboptimal hydrogen bond with His348 and a van der Waals interaction with His349, with the potential to form a π-π bond (Figure 5A). This observation presented an opportunity to optimize the binding of HCDR3 to the kringle domain.

[0158] hROR2-Kr and hROR1-Kr share 58% amino acid sequence identity

[11] . When the epitope residue of hROR2-Kr recognized by 401 was compared with the epitope residue mediating the recognition of R11:hROR1-Kr

[34] , no residue duplication was found (Figure 8). This observation explains why there is no cross-reactivity between 401 and R11 despite the homologous amino acid sequences of hROR2-Kr and hROR1-Kr. When antibodies bound to the kringle domain derived from the 401:hROR2-Kr complex were compared with antibodies bound to the kringle domain derived from the R11:hROR1-Kr complex, the mean squared deviation (rmsd) of the Cα position was found to be 0.695 Å, revealing a highly conserved tertiary structure of the two Kr domains.

[0159] The inventors also crystallized the structure of unbound hROR2-Kr and elucidated it at a resolution of 1.1 Å (Figure 8B right). The rmsd of the unbound hROR2-Kr structure relative to 401-bound hROR2-Kr was 0.383 Å, indicating a very slight difference between the coordinates. In particular, in the unbound hROR2-Kr structure, Arg385 formed a mixed interaction of salt crosslinking / hydrogen bonding with acetate derived from the crystallization solution (Figure 8B right). In the crystal structure of the 401:hROR2-Kr complex, binding sites overlapping with canonical lysine-binding sites (LBS)

[51] in other kringle domains were partially targeted for binding by 401. Polymerization of the unbound hROR2-Kr structure onto 401-bound hROR2-Kr showed a small shift in loop 5 due to the bound acetate ion (Figure 8B right).

[0160] Overall, our finding that there is no overlap between the ROR2 epitope and the ROR1 epitope, along with our finding that the binding of HCDR3 401 to hROR2-Kr is below optimal, reveals an opportunity for affinity maturation in vitro.

[0161] Affinity maturation via phage display A phage display library was constructed to induce concentrated mutagenesis at residues 96 and 97 (numbered by Kabat; Figure 11) of 401 HCDR3 by adding 0, 1, or 2 further randomized residues (Figure 9). The cocrystal structure of 401:hROR2-Kr depicted a void between hROR2 and HCDR3 that could be filled by long-chain mature HCDR3, potentially improving mAb affinity, so further randomization sites were investigated. Selection of the hROR2-Fc bond was performed using three methods: surface selection, surface competitive selection, and solution competitive panning (see "Experimental Procedure"). All competitive panning protocols used the dissociation rate constant (k offFabs with low values of were selected, and thus, selection pressure was applied to Fabs with high affinity. From three combinatorial libraries, 144 clones were selected and analyzed for binding to ROR2 and expression of Fab from the supernatant via ELISA. The top 12 clones with the highest absorbance ratio (ratio of binding to hROR2 to expression) were purified. Surface plasmon resonance (SPR), thermodynamic parameters (K D ), and reaction rate parameters (k on and k off ) were used to determine the interaction with hROR2. XBR2-401-X3.12 ("X3.12"), a clone obtained from the X3 library, revealed the highest affinity (K D = 0.7 nM) (Figure 10, Figure 14A), which was at least a 5-fold improvement from 401. The HCDR3 sequence of X3.12 differed from 401 at two residue positions, was 1 residue longer, and changed the HCDR3 sequence from DWTSLNI to DDRWSLNI (Figure 10). The next step to further increase the therapeutic validity of affinity matured X3.12 was to use humanization.

[0162] Humanization by CDR grafting Humanization of the affinity matured rabbit / human chimeric X3.12 Fab was performed in three main steps. First, using IgBlast (see "Experimental Procedures" for online tool), the human germline sequences with the highest identity to the variable light chain (V L ) amino acid sequence and variable heavy chain (V H ) amino acid sequence of X3.12 were identified. Then, referring to the IMGT repertoire, germline sequences with >3 polymorphisms were excluded. The human germline sequences with the highest amino acid sequence identity to X3.12 and the minimum number of polymorphisms were the heavy chain germline sequence IGHV3-66 * 03, IGHV3-48 * 03, and the light chain germline sequence IGKV1-NL1 *It was 01. Secondly, the CDR derived from X3.12, determined using Kabat numbering, was grafted into these three framework sequences (Figure 11; V L 1. V H 1. V H 2) Thirdly, the residues that were determined to conserve affinity

[45] were reversed from human germline residues to the original rabbit residues. These three steps, consisting of CDR grafting and rational reverse mutation, yielded four heavy chain mutants (V H 1-V H 4) and two light chain mutants (V L 1. V L 2) was formed (Figure 11). To determine the percentage of human identity, these humanized sequences were compared to the IMGT database for human germline antibody sequences using the IMGT / DomainGapAlign tool. L 1. V L 2, and V H 1-V H The human identity of each of the four individuals was 88.6%. * 87.1%, 86.6%, 87.8%, 73.5% * , and 80.4% * [Displayed as a star ( *Percentages with a parentheses indicate that the first “hit” on IMGT DomainGapAlign was not human.

[52] WHO criteria state that for an antibody to be considered a humanized antibody, it must have more than 85% human identity and the first “hit” on the IMGT DomainGapAlign tool must be human.

[46] All combinations of heavy-chain and light-chain Fab were cloned into pET11a variants

[46] , expressed in Escherichia coli Rosetta strains, and then Fab expression and binding to hROR2 were quantified via ELISA to exclude unbound clones. The remaining clones, hX3.12.5, hX3.12.6, hX3.12.7, and hX3.12.8, also had a high binding-to-expression ratio compared to X3.12. The overall identity percentages of these mutants to the human germline were 87%, 87%, 80%, and 84%, respectively, and all mutants were V L Figure 12 was used. Therefore, according to WHO standards, hX3.12.5 and hX3.12.6 are considered to be humanized mAbs, while hX3.12.7 and hX3.12.8 are considered to be chimeric mAbs.

[0163] Characterization of affinity-mature humanized Fabs After expression and purification (Figure 18A), the affinities of hX3.12.5, hX3.12.6, hX3.12.7, and hX3.12.8 were determined by SPR to be 2.6 nM, 3.8 nM, 1.4 nM, and 5.2 nM, respectively (Figures 12, 14B). Moving forward, the inventors focused on hX3.12.5 Fab and hX3.12.6 Fab, which have the highest degree of human identity while retaining nanomolar affinity for hROR2. The supporting flow cytometry data showed that hX3.12.5 and hX3.12.6 bind to HEK 293F cells that stably overexpress the hROR2-Thr245 allotype

[29] , while binding to mock-transfected HEK 293F control cell lines that express some ROR2 is minimal (Figure 13A). A Fab containing the framework region of hX3.12.6 and the parental 401 CDR sequences was generated and incorporated for reference (h401.6: affinity of 16 nM; Figure 12). The clones, hX3.12.5 and hX3.12.6, also bound to the breast cancer cell line T47D (ROR2+, ROR1-) and the renal cell adenocarcinoma cell line 786-O (ROR2+, ROR1+), but did not bind to the breast cancer cell line MDA231 (ROR2-, ROR1+) (Figure 13A). The LightCycler 480 was used to address the thermal stability of the humanized Fabs by measuring their melting points. The rabbit / human chimeric Fabs, X3.12 and 401, exhibited slightly higher thermal stability than the humanized Fabs, hX3.12.5 and hX3.12.6, along with h401.6 (Figure 15). The melting points of the affinity matured humanized Fabs are similar to those of previously reported Fabs, suggesting that they are stable [53, 54].

[0164] To investigate the specificity of hX3.12.6 for ROR2, the Fab was first converted to a scFv-Fc, which is an IgG1-like format. This format has V L and V HThe hX3.12.6 scFv-Fc contains two scFv (Figure 19) fused to a human IgG1 Fc fragment using the (Gly4Ser)3 linker between the two cells. The hX3.12.6 scFv-Fc was screened against 786-O, T47D, and MDA-MB-231, and as previously described, all cell lines except MDA-MB-231 were confirmed to be ROR2+ ​​(Figure 13B). The inventors also confirmed the cross-reactivity of hX3.12.6 with mouse ROR2 stably expressed on HEK 293, as previously described

[29] (Figure 13C). Similar to what we did with XBR2-401, a parent mAb in rabbit / human chimeric IgG1 format

[29] , we screened hX3.12.6 scFv-Fc against 5,647 human cell membrane proteins (i.e., human cell surface antigens) expressed on the surface of human HEK 293 cells and arranged in pairs on 16 slides

[47] . Spotting patterns of ZsGreen1 correlating with human cell surface antigen expression (Figure 16A) are shown for slides containing human ROR2 (Figure 16B). The fact that ROR2 was the only specific interaction identified in the screening with hX3.12.6 scFv-Fc (Figures 16B, 16C) confirms that neither affinity maturation nor humanization reduced the high specificity of the parent mAb.

[0165] Next, hX3.12.6 scFv was cocrystallized with hROR2-Kr, and its structure was determined at a resolution of 1.4 Å (Figures 5B and 6). The structure of the hX3.12.6-hROR2-Kr complex allowed for the comparison of affinity-matured HCDR3 with the parent HCDR3, particularly the π-π interactions formed with hROR2-Kr (Figures 5B and 7). Similar to 401, in hX3.12.6, Ala95 was embedded within hROR2-Kr, and the salt bridge between the light chain Asp32 and hROR2-Kr was also retained. All hydrogen bonding interactions and van der Waals contacts present in 401:hROR2-Kr remained intact within the hX3.12.6:hROR2-Kr complex, except for changes in HCDR3 due to affinity maturation, including Asp96 and Arg97. These two residues do not directly interact with hROR2-Kr, but they help to properly position Trp98, which is in contact with hROR2-Kr. Trp98 in hX3.12.6 further improves its interaction with hROR2-Kr and is optimized from Trp96 of 401, which is located at the tip of the HCDR3 loop (Figures 5A and 5B). Unlike in the case of 401, the side chain of Trp98 optimizes the hydrogen bonding interaction with the skeletal oxygen of His348 of hROR2-Kr. The side chain of Trp98 also exhibits the geometric characteristics of the π-π / π-cation interaction with His349 of hROR2-Kr (Figure 5B bottom, Figure 7). The finding that the rmsd between 401 and hX3.12.6 within each of these cocrystal structures was 0.446 Å suggests that the structural differences are minute (Figure 8A). The fact that the crystallized kringle domain complexed with 401 or hX3.12.6 had an rmsd of 0.279 Å indicates that no related changes were observed between the two kringle domains. In summary, these findings confirm that the rational design of affinity maturation by the inventors is extremely important in improving binding to ROR2.

[0166] Development and characterization of ROR2 x CD3 bispecific antibodies To determine the functionality of the affinity-matured humanized antibody, hX3.12.6 was converted to ROR2×CD3 biAb and purified with Protein A and SEC (Figures 19, 18B, and 18C). The inventors used the same heterodimer / nonglycosylated scFv-Fc format that they have previously reported for ROR1×CD3 and CD19×CD3 biAb [34, 48]. This is C H N297A, a nonglycosylation mutation in 2 domains, C H KIH (knobs-into-holes) mutations in 3 domains, specifically, C H The knob mutations in 3 are S354C and T366W, and C H This was performed by combining the whole mutations Y349C, T366S, L368A, and Y407V in 3 [49, 55, 56]. For the anti-CD3 arm, a well-defined, affinity-matured, humanized anti-human CD3 mAb v9 was used

[57] . It was confirmed that BiAb binds to 786-O and Jurkat-T Lucia (CD3+) but not to MDA-MB-231 (Figure 17A). Primary T cells were expanded in vitro from two different healthy donor peripheral blood mononuclear cells (PBMCs) by adding anti-CD3 / anti-CD28 beads and IL-2. Next, the in vitro biAb-mediated target-dependent cytotoxicity of the expanded primary T cells was investigated. For three ROR2×CD3 biAbs; 401×v9, hX3.12.6×v9, and hX3.12.5×v9, and the positive control biAb ROR1×CD3 biAb XBR1-402×v9 (402×v9), the EC levels were 0.19, 0.21, 0.15, and 0.25 μg / mL (1.9 nM, 2.1 nM, 1.5 nM, and 2.5 nM) (Figure 17B), respectively. 50Specific lysis of 786-O cells was observed based on the values. A single-specific hX3.12.6 scFv-Fc was used as a negative control. To confirm that these biAbs specifically kill 786-O cells via binding to ROR2 and CD3, the inventors examined the ROR2- / ROR1+ cell line, MDA-MB-231, and found that all ROR2×CD3 biAbs were inactive up to 1 μg / mL (Figure 17B). The positive control, ROR1×CD3 biAb, actually showed the predicted specific cytolysis due to its binding to ROR1 on MDA-MB-231 cells. T cell activation was quantified by flow cytometry using an anti-CD69 mAb, a known marker for early T cell activation. Humanized biAbs hX3.12.6×v9, hX3.12.5×v9, and the parent 401×v9, incubated with T cells at 0.2 μg / mL, upregulated CD69 in over 50% of T cells in the presence of 786-O, but not in the presence of MDA-MB-231 cells (Figure 17C). The negative control hX3.12.6 scFv-Fc did not exhibit upregulation of CD69. When the release of the type 1 cytokine IFN-γ was evaluated by ELISA, all ROR2×CD3 biAbs induced cytokine release in the presence of ROR2+ ​​target cells, but not in the presence of ROR2- target cells (Figure 17C). As previously shown

[34] , R11×v9 induced comparable cytokine release in the presence of ROR1+ target cells.

[0167] (Example 2) Preparation of ROR2-specific CAR-modified human CD8+ T cells and ROR2-specific CAR-modified human CD4+ T cells with affinity-matured targeting domains, and functional testing thereof. Materials and methods: Human subjects Blood samples were obtained from healthy donors who submitted informed consent to participate in a research protocol approved by the Institutional Review Board of the University of Wuerzburg (Universitaetsklinikum Wuerzburg, UKW). Peripheral blood mononuclear cells (PBMCs) were isolated by centrifugation on a Ficoll-Hypaque (Sigma, St. Louis, MO).

[0168] cell line The 293T cell line, MDA-MB231 cell line, T-47D cell line, 786-O cell line, and U266 cell line were obtained from American Type Culture Collection. Luciferase-expressing cell lines were derived by transduction of the firefly luciferase (ffluc) gene into the aforementioned cell lines using lentivirus. The cells were cultured in Dulbecco's modified Eagle medium supplemented with 10% fetal bovine serum and 100 U / mL penicillin / streptomycin, or in RPMI-1640 medium supplemented with 10% fetal bovine serum and 100 U / mL penicillin / streptomycin.

[0169] Cell line phenotyping Tumor cell lines were stained with AF647 conjugate hX3.12.5×h38C2 DVD antibody or a matched isotype control. To differentiate between live and dead cells, staining with 7-AAD (BD Biosciences) was performed as instructed by the manufacturer. Flow analysis was performed on FACS Canto II (BD), and the data were analyzed using FlowJo software (Treestar, Ashland, OR).

[0170] Immunophenotyping PBMCs and T cell lines were stained with one or more of the following: CD3, CD4, CD8, and matched isotype-controlled conjugate mAbs (BD Biosciences, San Jose, CA). Transduced T cell lines were stained with AF647 conjugate anti-EGFR antibody (ImClone Systems Incorporated, Branchburg, NJ). To differentiate between live and dead cells, staining with 7-AAD (BD Biosciences) was performed as instructed by the manufacturer. Flow analysis was performed on FACS Canto II (BD), and data were analyzed using FlowJo software (FlowJo LLC, Ashland, OR).

[0171] Construction of lentiviral vectors, preparation of lentiviruses, and generation of CAR-T cells The construction of an epHIV7 lentiviral vector containing a ROR2-specific CAR, along with an optimal spacer and a CD28 costimulatory domain or a 4-1BB costimulatory domain, is described (see references [58, 59], incorporated throughout by reference for all purposes). All CAR constructs encoded a cleaved epidermal growth factor receptor (EGFRt; also known as tEGFR) downstream of the CAR (see reference

[60] , incorporated throughout by reference for all purposes). The genes were ligated by a T2A ribosome skipping element.

[0172] Lentiviral supernatants encoding CAR / EGFRt and ffluc / eGFP were produced in 293T cells co-transfected with lentiviral vector plasmids and their respective packaging vectors, pCHGP-2, pCMV-Rev2, and pCMV-G, using Calphos transfection reagent (Clontech, Mountain View, CA). The culture medium was changed 16 hours after transfection, and the lentiviruses were collected after 72 hours. CAR-T cells were prepared as described in

[61] . Briefly, CD8+ bulk T cells or CD4+ bulk T cells were isolated from healthy donor PBMCs, activated with anti-CD3 / CD28 beads (Life Technologies), and transduced with lentiviral supernatant. Lentiviral transduction was performed on day 2 via spinoculation, and T cells were propagated in RPMI-1640 containing 10% human serum, GlutaMAX (Life Technologies), 100 U / mL penicillin-streptomycin, and 50 U / mL IL-2. Trypan blue staining was performed to quantify viable T cells. After expansion, EGFRt+ T cells were enriched by magnetically activated cell sorting and expanded by polyclonal stimulation with CD3-specific Okt3 antibody and irradiated allogeneic PBMCs and EBV-LCL feeder cells.

[0173] Cytotoxicity assay, cytokine secretion assay, and CFSE proliferation assay Target cells that stably express firefly luciferase, 5 × 10 cells per well. 3 In triplicate wells, effector T cells with diverse effector-to-target (E:T) ratios were incubated with each other. The decrease in luminescence signal in wells containing target cells and T cells was measured using a Tecan light meter. Specific lysis was calculated for each E:T ratio using a standard formula with untransduced T cells to correct for TCR-mediated cell lysis.

[0174] For the analysis of cytokine secretion, 5 × 10 4T cells were seeded in a triple-well system with target cells in a 4:1 ratio. After 24 hours of incubation, IFN-γ and IL-2 levels were measured in the supernatant collected by ELISA (Biolegend).

[0175] For proliferation analysis, 5 × 10 4 T cells were labeled with 0.2 μM carboxyfluorescein succinimimidyl ester (CFSE, Invitrogen), washed, and seeded in a triple-well cell culture medium free of exogenous cytokines in a 4:1 ratio with target cells irradiated to a lethal dose. After 72 hours of incubation, dead cells were labeled with anti-CD3 mAb, anti-CD4 mAb, or anti-CD8 mAb and 7-AAD to exclude them from analysis. The samples were analyzed by flow cytometry, and cell division of live T cells was evaluated using the CFSE dilution method.

[0176] result Generation, detection, and enrichment of ROR2 CAR-T cells PBMCs derived from healthy donors were isolated by Ficoll-Hypaque density gradient centrifugation, and bulk CD4+ human T cells or CD8+ human T cells were extracted from this cell population using MACS. Immediately after isolation, T cells were activated with CD3 / 28 Dynabeads for 2 days, and then transduced by spinoculation with a lentiviral vector encoding an X3.12-based ROR2-specific CAR at a multiplicity of infection (MOI) of 3. Dynabeads were removed 4 days after transduction, and on day 10, T cells were enriched for EGFRt-positive cells by labeling with biotinylated monoclonal αEGFR antibody and via MACS with anti-biotin microbeads. After enrichment, the EGFRt-positive fraction accounted for over 90% of the total cells in a reproducible manner (Figures 21A and 21B).

[0177] ROR2 cytolytic activity of CAR-T cells X3.12-based ROR2-specific CAR-T cells were generated as described above, and their cytolytic activity was evaluated in a 24-hour cytotoxicity assay against ROR2-positive, ffluc-expressing target cell lines: T-47D, 786-O, and U266 (see Figure 20). No specific lysis against the ROR2-negative MDA-MB-231 control was detected. The assay was repeated under the same conditions in three independent healthy donors (n=3) (Figure 22).

[0178] Secretion of effector cytokines after ROR2-specific activation of ROR2 CAR-T cells CD4+ X3.12-based ROR2-specific CAR-T cells or CD8+ X3.12-based ROR2-specific CAR-T cells were generated as described above and co-cultured with a target cell line expressing ROR2 in a 4:1 E:T ratio for 24 hours. After incubation, the cell culture supernatant was collected and analyzed for the presence of the effector cytokines IL-2 and IFN-γ by ELISA. As a control, cells were co-cultured with ROR2-negative MDA-MB231 cells or in the absence of target cells (medium control). To control the overall ability of CAR-T cells to produce the target effector cytokines, cells were polyclonally stimulated with a combination of 12-myristate-13-acetate phorbol (PMA), a protein kinase C (PKC) / NF-κB activator, and ionomycin, a Ca2+ ionophore. The assay procedure was repeated for n=3 unrelated healthy donors, and the measured cytokine concentrations were used for group-specific analysis (Figure 23).

[0179] ROR2-specific CAR T cells based on X3.12 showed an antigen-dependent cytokine secretion profile. Additionally, cytokine secretion levels were correlated with the ROR2 expression levels on target cells, and 786-O and U266 showed the highest levels of cytokine secretion. Generally, CD4+ T cells secreted higher amounts of IL-2 and IFN-γ than CD8+ T cells. IFN-γ was detected exclusively in samples containing ROR2-positive targets or PMA / Iono, and the average concentration ranged from 400 - 1000 pg / mL (CD4+ T cells) and 200 - 500 pg / mL (CD8+ T cells). IL-2 was also detected exclusively in samples containing ROR2-positive target cells, and the average concentration ranged from 300 - 1000 pg / ml (CD4+ T cells) and 150 - 300 pg / mL (CD8+ T cells).

[0180] Proliferation of ROR2 CAR-T cells CD4+ X3.12-based ROR2-specific CAR-T cells or CD8+ X3.12-based ROR2-specific CAR-T cells were generated as described, labeled with CFSE, and co-cultured at a 4:1 E:T ratio with a target cell line expressing ROR2 that had been irradiated at a lethal dose in the absence of exogenous cytokines for 72 hours. After the incubation time, the T cells were recovered and analyzed by flow cytometry for CFSE dilution. As negative controls, the CAR-T cells were co-cultured with ROR2-negative MDA-MB-231 cells or medium, and as positive controls, they were co-cultured in the presence of 50 UI / ml of IL-2.

[0181] ROR2-negative MDA-MB-231 and medium alone did not cause T cell proliferation. However, for X3.12-based ROR2-specific CAR T cells against ROR2-positive target cells, a high degree of proliferation of antigen-dependent CAR-T cells was observed (Figure 24). These findings confirm that the detected proliferation of ROR2 CAR-T cells was mediated by the CAR in response to stimulation by ROR2-positive cells.

[0182] (Example 3) Detailed analysis of functional differences between ROR2-specific CAR knock-in T cells derived from XBR2-401 and ROR2-specific CAR knock-in T cells derived from X3.12. Materials and methods: Human subjects Blood samples were obtained from healthy donors who submitted informed consent to participate in a research protocol approved by the Institutional Review Board of the University of Wuerzburg (Universitaetsklinikum Wuerzburg, UKW). Peripheral blood mononuclear cells (PBMCs) were isolated by centrifugation on a Ficoll-Hypaque (Sigma, St. Louis, MO).

[0183] cell line The 293T cell line, MDA-MB231 cell line, T-47D cell line, 786-O cell line, and U266 cell line were obtained from American Type Culture Collection. Luciferase-expressing cell lines were derived by transduction of the firefly luciferase (ffluc) gene into the aforementioned cell lines using lentivirus. The cells were cultured in Dulbecco's modified Eagle medium supplemented with 10% fetal bovine serum and 100 U / mL penicillin / streptomycin, or in RPMI-1640 medium supplemented with 10% fetal bovine serum and 100 U / mL penicillin / streptomycin.

[0184] Generation, enrichment, and expansion of CAR knock-in T cells. The virus-free knock-in of the target gene to the T cell receptor locus of primary human T cells has recently been described (integrated in its entirety by reference for all purposes

[62] ). All CAR constructs encoded the cleaved epidermal growth factor receptor (EGFRt; also known as tEGFR) downstream of the CAR (see reference

[60] , integrated in its entirety by reference for all purposes). The genes were ligated by a T2A ribosome skipping element.

[0185] HDR templates containing two homology sequences for the human T cell receptor locus alpha chain (TRAC), CAR CDS, and EGFRt were custom synthesized and amplified by polymerase chain reaction (PCR). CAR knock-in T cells were generated as described in

[62] . Briefly, CD8+ bulk T cells or CD4+ bulk T cells were isolated from healthy donor PBMCs and activated with anti-CD3 / CD28 beads (Life Technologies). On day 3, virus-free CAR knock-in was performed by co-electroporation of a homology-dependent repair template (HDRT) containing hTRAC-specific sgRNA / spCas9 ribonucleoprotein (RNP) and a cassette encoding XBR2-401 or X3.12 CAR. T cells were propagated in RPMI-1640 containing 10% human serum, GlutaMAX (Life Technologies), 100 U / mL penicillin-streptomycin, and 50 U / mL IL-2. Trypan blue staining was performed to quantify viable T cells. After expansion, EGFRt+ T cells were enriched by magnetically activated cell sorting and expanded by polyclonal stimulation with ROR2-positive U266 feeder cells irradiated at a lethal dose.

[0186] Cytotoxicity assay, cytokine secretion assay, and CFSE proliferation assay Target cells that stably express firefly luciferase, 5 × 10 cells per well. 3 In triplicate wells, effector T cells with diverse effector-to-target (E:T) ratios were incubated with each other. The decrease in luminescence signal in wells containing target cells and T cells was measured using a Tecan illuminometer. Specific lysis was calculated using a standard formula with TRAC KO T cells at each E:T ratio to normalize the data.

[0187] For the analysis of cytokine secretion, 5 × 10 4T cells were seeded in a triple-well system with target cells in a 4:1 ratio. After 24 hours of incubation, IFN-γ and IL-2 levels were measured in the supernatant collected by ELISA (Biolegend).

[0188] For proliferation analysis, 5 × 10 4 T cells were labeled with 0.2 μM carboxyfluorescein succinimimidyl ester (CFSE, Invitrogen), washed, and seeded in a triple-well cell culture medium free of exogenous cytokines in a 4:1 ratio with target cells irradiated to a lethal dose. After 72 hours of incubation, dead cells were labeled with anti-CD3 mAb, anti-CD4 mAb, or anti-CD8 mAb and 7-AAD to exclude them from analysis. The samples were analyzed by flow cytometry, and cell division of live T cells was evaluated using the CFSE dilution method.

[0189] For the xCELLigence killing assay, adherent tumor cells were seeded, adhered for 16 hours, and incubated with CAR-T cells in a triplicate at a 1:10 E:T ratio. Impedance values ​​were measured at 15-minute intervals for >96 hours.

[0190] result Generation, detection, and enrichment of ROR2 CAR knock-in T cells To investigate the effect of binding affinity (see Figure 10) on CAR functionality under controlled conditions, the inventors decided to use CAR hTRAC locus knock-in. This method eliminates the additional benefit of inserting multiple CARs into the T cell genome, allowing the investigation of the effect of binding affinity on CAR-T cell functionality in the presence of a single CAR copy within the genome.

[0191] PBMCs derived from healthy donors were isolated by Ficoll-Hypaque density gradient centrifugation, and bulk CD4+ human T cells or CD8+ human T cells were extracted from this cell population using MACS. Immediately after isolation, T cells were activated with CD3 / 28 Dynabeads for 2 days, and CAR knock-in was performed as previously described. Dynabeads were removed 4 days after knock-in, and on day 10, T cells were enriched for EGFRt-positive cells by labeling with biotinylated monoclonal αEGFR antibody and via MACS with anti-biotin microbeads. After enrichment, ROR2-CAR knock-in T cells in the EGFRt-positive fraction were reproducibly present in approximately 75-85% of the cells. However, the significantly lower median fluorescence intensity (MFI) compared to lentiviral-generated ROR2 CAR-T cells indicates tighter regulation of the CAR expression pattern upon integration into the TRAC locus (Figures 21, 25A, and 25B). In human T cells, CD3 and TCR are delivered together to the cell surface. The absence of CD3 on the cell surface in the absence of TCR also makes CD3 a suitable surrogate marker for TCR knockout efficiency (see Figures 25A and 25B, right-hand figure).

[0192] ROR2 cytolytic activity of CAR-T cells CAR-T cells were generated as described above, and their cytolytic activity was evaluated in a 24-hour cytotoxicity assay against ROR2-positive, ffluc-expressing target cell lines, T-47D, 786-O, and U266 (Figure 20). No specific lysis against the ROR2-negative MDA-MB-231 control was detected. Under these conditions, X3.12-based CAR knock-in T cells consistently outperformed XBR2-401-based CAR T cells (Figure 26A). The assay was repeated under the same conditions in n=3 independent healthy donors (Figure 26B).

[0193] In addition, the xCELLigence platform was used to investigate in more detail the effect of CAR binding affinity on the functionality of CAR-T cells. To challenge the cells, the inventors decided to use a low E:T ratio (1:10). Surprisingly, XBR2-401-based CAR knock-in T cells were unable to control the proliferation of 786-O tumors under these conditions, whereas X3.12-based CAR knock-in T cells efficiently eradicated 786-O cells (Figure 26C).

[0194] Secretion of effector cytokines after ROR2-specific activation of ROR2 CAR-T cells CD4+ CAR-T cells or CD8+ CAR-T cells were generated as described above and co-cultured for 24 hours at a 4:1 E:T ratio with a ROR2-expressing target cell line irradiated with a lethal dose. After incubation, the cell culture supernatant was collected and analyzed for the presence of the effector cytokines IL-2 and IFN-γ by ELISA. As a control, cells were co-cultured with ROR2-negative MDA-MB231 cells or in the absence of target cells (culture medium control). To control the overall ability of CAR-T cells to produce the target effector cytokines, cells were polyclonally stimulated with a combination of 12-myristate-13-acetate phorbol (PMA), a protein kinase C (PKC) / NF-κB activator, and ionomycin, a Ca2+ ionophore. The assay procedure was repeated for unrelated healthy T cell donors, up to n=3, and the measured cytokine concentrations were used for group-by-group analysis (Figure 27).

[0195] Both IFN-γ and IL-2 were detected exclusively in samples containing ROR2-positive target cells. Here again, cytokine secretion was highly dependent on antigen expression levels (see Figure 20), with 786-O and U266 inducing the highest levels of cytokine secretion. The overall correlation between high binder affinity and high cytokine secretion was particularly evident in target cells with low antigen expression (U266) and extremely low antigen expression (T-47D). This effect was particularly clear in T-47D cells. While cytokine levels secreted by XBR2-401-based CAR knock-in T cells were only slightly above background levels, X3.12-based CAR knock-in T cells consistently secreted IL-2 at 300–1200 pg / mL and IFN-γ at 300–2000 pg / mL.

[0196] ROR2 CAR-T cell proliferation CD4+ CAR-T cells or CD8+ CAR-T cells were generated as described, labeled with CFSE, and co-cultured for 72 hours at a 4:1 E:T ratio with ROR2-expressing target cell lines irradiated to a lethal dose in the absence of exogenous cytokines. After incubation, T cells were harvested and the CFSE dilution was analyzed by flow cytometry. As a negative control, CAR-T cells were co-cultured with ROR2-negative MDA-MB-231 cells or culture medium, and as a positive control, they were co-cultured in the presence of 50 UI / ml of IL-2.

[0197] ROR2-negative MDA-MB-231 and the culture medium alone did not induce proliferation of T cells expressing either of the two CARs. However, when ROR2-positive target cells were used, activation of CAR-T cells via their respective CARs resulted in significant proliferation of antigen-dependent cells (Figure 28). These findings support the conclusion that the proliferation of detected ROR2 CAR-T cells was mediated by the CAR in response to stimulation by ROR2-positive cells. In all cases, X3.12-based CAR knock-in T cells showed greater proliferation than XBR2-401-based CAR knock-in T cells against ROR2-positive tumor cells.

[0198] conclusion In summary, our findings highlight the superiority of X3.12-based CAR knock-in T cells over XBR2-401-based CAR knock-in T cells. X3.12-based CAR knock-in T cells consistently outperformed XBR2-401-based CAR knock-in T cells in all assays.

[0199] Our data indicate that increased affinity for X3.12 provides further advantages to CAR T cells, even in situations of low antigen expression, which has been reported to be the leading cause of tumor recurrence after CAR T cell treatment.

[0200] (Example 4) Functional verification of the humanized ROR2 CAR Materials and methods: Human subjects Blood samples were obtained from healthy donors who submitted informed consent to participate in a research protocol approved by the Institutional Review Board of the University of Wuerzburg (Universitaetsklinikum Wuerzburg, UKW). Peripheral blood mononuclear cells (PBMCs) were isolated by centrifugation on a Ficoll-Hypaque (Sigma, St. Louis, MO).

[0201] cell line The HEK-293T, T-47D, 786-O, and U266 cell lines were obtained from American Type Culture Collection. OPM-2 cells were obtained from DSMZ. Cell lines expressing luciferase were derived by transduction of the firefly luciferase (ffluc) gene into the aforementioned cell lines using lentivirus. The cells were cultured in Dulbecco's modified Eagle medium supplemented with 10% fetal bovine serum and 100 U / mL penicillin / streptomycin, or in RPMI-1640 medium supplemented with 10% fetal bovine serum and 100 U / mL penicillin / streptomycin.

[0202] Construction of lentiviral vectors, preparation of lentiviruses, and generation of CAR-T cells The construction of an epHIV7 lentiviral vector containing a ROR2-specific CAR, along with an optimal spacer and a cd28 costimulatory domain or a 4-1BB costimulatory domain, is described (see references [58, 59], incorporated throughout by reference for all purposes). All CAR constructs encoded a cleaved epidermal growth factor receptor (EGFRt; also known as tEGFR) downstream of the CAR (see reference

[60] , incorporated throughout by reference for all purposes). The genes were ligated by a T2A ribosome skipping element.

[0203] Lentiviral supernatants encoding CAR / EGFRt and ffluc / eGFP were produced in 293T cells co-transfected with lentiviral vector plasmids and their respective packaging vectors, pCHGP-2, pCMV-Rev2, and pCMV-G, using Calphos transfection reagent (Clontech, Mountain View, CA). The culture medium was changed 16 hours after transfection, and the lentiviruses were collected after 72 hours. CAR-T cells were prepared as described in

[61] . Briefly, CD8+ bulk T cells or CD4+ bulk T cells were isolated from healthy donor PBMCs, activated with anti-CD3 / CD28 beads (Life Technologies), and transduced with lentiviral supernatant. Lentiviral transduction was performed on day 2 via spinoculation, and T cells were propagated in RPMI-1640 containing 10% human serum, GlutaMAX (Life Technologies), 100 U / mL penicillin-streptomycin, and 50 U / mL IL-2. Trypan blue staining was performed to quantify viable T cells. After expansion, EGFRt+ T cells were enriched by magnetically activated cell sorting and expanded by polyclonal stimulation with CD3-specific Okt3 antibody and irradiated allogeneic PBMCs and EBV-LCL feeder cells.

[0204] Cytotoxicity assay, cytokine secretion assay, and CFSE proliferation assay Target cells that stably express firefly luciferase, 5 × 10 cells per well. 3 In triplicate wells, effector T cells with diverse effector-to-target (E:T) ratios were incubated with each other. The decrease in luminescence signal in wells containing target cells and T cells was measured using a Tecan light meter. Specific lysis was calculated for each E:T ratio using a standard formula with non-transduced T cells to compensate for TCR-mediated cell lysis. For sequential killing assays, T cells were challenged again with freshly harvested tumor cells at specified E:T ratios every 24 hours.

[0205] For the analysis of cytokine secretion, 5 × 10 4 T cells were seeded in a triple-well system with target cells in a 4:1 ratio. After 24 hours of incubation, IFN-γ levels were measured in the supernatant collected using ELISA (Biolegend).

[0206] For proliferation analysis, 5 × 10 4 T cells were labeled with 0.2 μM carboxyfluorescein succinimimidyl ester (CFSE, Invitrogen), washed, and seeded in a triple-well cell culture medium free of exogenous cytokines in a 4:1 ratio with target cells irradiated to a lethal dose. After 72 hours of incubation, dead cells were labeled with anti-CD3 mAb, anti-CD4 mAb, or anti-CD8 mAb and 7-AAD to exclude them from analysis. Samples were analyzed by flow cytometry, and cell division of viable T cells was evaluated using the CFSE dilution method. The growth index, expansion index, and the percentage of cells that underwent any given number of cell divisions were extracted using FlowJo (Tree Star).

[0207] result Generation, detection, and enrichment of ROR2 CAR-T cells PBMCs derived from healthy donors were isolated by Ficoll-Hypaque density gradient centrifugation, and bulk CD4+ human T cells or CD8+ human T cells were extracted from this cell population using MACS. Immediately after isolation, T cells were activated with CD3 / 28 Dynabeads for 1 day, and then transduced by spinoculation with lentiviral vectors encoding X3.12-based ROR2-specific CARs, hX3.12.5-based ROR2-specific CARs, or hX3.12.6-based ROR2-specific CARs at a multiplicity of infection (MOI) of 3. Dynabeads were removed 4 days after transduction, and on day 10, T cells were enriched with EGFRt-positive cells via labeling with biotinylated monoclonal αEGFR antibody and MACS using anti-biotin microbeads. After enrichment, the EGFRt-positive fraction reproducibly comprised over 89% of the total cells (Figures 29A and 29B).

[0208] Cell lysis activity of humanized ROR2 CAR-T cells CAR-T cells were generated as described above, and their cytolytic activity was evaluated in a 24-hour cytotoxicity assay against ROR2-positive, ffluc-expressing target cell lines T-47D, 786-O, and U266, as well as ROR2-negative OPM-2 cells (see Figure 30A). The assay was repeated under the same conditions in n=3 independent healthy donors (Figure 30B). The reduction in cytolytic activity of hX3.12.5 compared to both X3.12-derived and hX3.12.6-derived CAR-T cells was consistent with previous studies using the biAb format of hX3.12.5 and hX3.12.6. This effect was more pronounced under conditions of low antigen expression (T-47D) and decreased in the presence of moderate antigen density (786-O) and high antigen density (U-266). Specific lysis against ROR2-negative OPM-2 controls was not detected (Figure 31). Statistical analysis included ANOVA for repeated measures and paired comparisons using Dunnett's multiple comparison test (ns: not significant). *=p<0.05, ** =p<0.01, *** (Based on the fact that p < 0.001).

[0209] Secretion of effector cytokines after ROR2-specific activation of ROR2 CAR-T cells CD4+ X3.12-based ROR2-specific CAR-T cells, CD4+ hX3.12.5-based ROR2-specific CAR-T cells, and CD4+ hX3.12.6-based ROR2-specific CAR-T cells, or CD8+ X3.12-based ROR2-specific CAR-T cells, CD8+ hX3.12.5-based ROR2-specific CAR-T cells, and CD8+ hX3.12.6-based ROR2-specific CAR-T cells were generated as described above and co-cultured with ROR2-expressing target cell lines in a 4:1 E:T ratio for 24 hours. After incubation, the cell culture supernatant was collected and analyzed for the presence of the effector cytokine IFN-γ by ELISA. As a control, cells were co-cultured with ROR2-negative OPM-2 cells or in the absence of target cells (medium control). To control the overall ability of CAR-T cells to produce target effector cytokines, cells were polyclonally stimulated with a combination of 12-myristate-13-acetate phorbol (PMA), a protein kinase C (PKC) / NF-κB activator, and ionomycin, a Ca2+ ionophore. The assay procedure was repeated for n=3 unrelated healthy donors, and the measured cytokine concentrations were used for group-by-group analysis (Figure 32).

[0210] All three ROR2-specific CAR T cell variants exhibited antigen-dependent cytokine secretion profiles. The degree to which cytokine secretion levels were influenced by antigen expression levels was less than the influence of cytolysis. Generally, CD4+ T cells secreted higher amounts of IFN-γ than CD8+ T cells. IFN-γ was detected exclusively in samples containing ROR2-positive targets or PMA / Iono, with mean concentrations ranging from 600–2200 pg / mL (CD4+ T cells) and 100–1200 pg / mL (CD8+ T cells). hX3.12.5-based ROR2-specific CAR T cells resulted in lower IFN-γ secretion in both CD4+ and CD8+ T cells. No statistically significant difference in IFN-γ secretion was found between X3.12-based CAR T cells and hX3.12.6-based CAR T cells. Statistical analysis included ANOVA for repeated measures and Dunnett's multiple comparison test for paired comparisons (ns: not significant). * =p<0.05, ** =p<0.01, *** (Based on the fact that p < 0.001).

[0211] ROR2 CAR-T cell proliferation CD4+ X3.12-based ROR2-specific CAR-T cells or CD8+ X3.12-based ROR2-specific CAR-T cells were generated as described, labeled with CFSE, and co-cultured for 72 hours at a 4:1 E:T ratio with ROR2-positive target cell lines irradiated to a lethal dose in the absence of exogenous cytokines. After incubation, T cells were harvested and the CFSE dilution was analyzed by flow cytometry. As a negative control, CAR-T cells were co-cultured with ROR2-negative OPM-2 cells or culture medium, and as a positive control, they were co-cultured in the presence of 50 UI / ml of IL-2.

[0212] ROR2-negative OPM-2 and medium alone did not induce T cell proliferation. However, for all three ROR2-specific CAR T cells against ROR2-positive target cells, high levels of antigen-dependent CAR-T cell proliferation were observed (Figure 33). The dependence of the proliferation level on the antigen expression level (T-47D < 786-O < U-266) was consistent with the data obtained from the cytotoxicity assay. At all expression levels, significantly different differences in the proliferation of CAR T cells were detected, and X3.12-based CAR T cells and hX3.12.6-based CAR T cells outperformed hX3.12.5-derived CAR T cells. The fact that hX3.12.5-based CAR T cells did not proliferate as highly as X3.12-based CAR T cells and hX3.12.6-based CAR T cells was consistent with previous findings, but no statistically significant difference in the proliferation of antigen-dependent T cells was found between the X3.12-based CAR and the hX3.12.6-based CAR. Statistical analysis was based on ANOVA for repeated measures and Dunnett's multiple comparison test for paired comparisons (n.s.: not significant, * = p < 0.05, ** = p < 0.01, *** , p < 0.001). These findings support that the detected proliferation of ROR2 CAR-T cells was mediated by the CAR in response to stimulation by ROR2-positive cells.

[0213] Conclusion In summary, our findings indicate that humanization of the binder affects the potency of the resulting CAR T cells, and that potency equivalent to that of the original binder can be favorably achieved through optimal binder humanization. In this analysis, we were able to demonstrate that CAR-T cells derived from humanized hX3.12.6 were at least as potent as CAR-T cells based on the parental clone (X3.12) in terms of antigen-dependent cytolysis, cytokine secretion, and proliferation, whereas hX3.12.5-based ROR2 CAR-T cells showed reduced cytolysis, cytokine secretion, and proliferation. In addition, our data suggest that the superiority of hX3.12.6 and X3.12 over hX3.12.5 may be particularly beneficial in situations of low antigen expression, which has been reported to be a major reason for tumor recurrence after CAR-T cell treatment. [Industrial applicability]

[0214] Antibodies and derivatives according to the present invention can be industrially manufactured and sold as products for use as defined herein (e.g., for treating cancer as defined herein), in accordance with known standards for the manufacture of pharmaceuticals and diagnostic products. Therefore, the present invention is industrially applicable.

[0215] References 1. Kalos, M., et al., T cells with chimeric antigen receptors have potent antitumor effects and can establish memory in patients with advanced leukemia. Sci Transl Med, 2011. 3(95): p. 95ra73. 2. Kochenderfer, J.N., et al., B-cell depletion and remissions of malignancy along with cytokine-associated toxicity in a clinical trial of anti-CD19 chimeric-antigen-receptor-transduced T cells. Blood, 2012. 119(12): p. 2709-20. 3. Kochenderfer, J.N., et al., Eradication of B-lineage cells and regression of lymphoma in a patient treated with autologous T cells genetically engineered to recognize CD19. Blood, 2010. 116(20): p. 4099-102. 4. Morgan, R.A., et al., Cancer regression in patients after transfer of genetically engineered lymphocytes. Science, 2006. 314(5796): p. 126-9. 5. Porter, D.L., et al., Chimeric antigen receptor-modified T cells in chronic lymphoid leukemia. N Engl J Med, 2011. 365(8): p. 725-33. 6. Eshhar, Z., et al., Specific activation and targeting of cytotoxic lymphocytes through chimeric single chains consisting of antibody-binding domains and the gamma or zeta subunits of the immunoglobulin and T-cell receptors. Proc Natl Acad Sci U S A, 1993. 90(2): p. 720-4. 7. Kershaw, M.H., et al., Supernatural T cells: genetic modification of T cells for cancer therapy. Nat Rev Immunol, 2005. 5(12): p. 928-40. 8. Sadelain, M., I. Riviere, and R. Brentjens, Targeting tumours with genetically enhanced T lymphocytes. Nat Rev Cancer, 2003. 3(1): p. 35-45. 9. Brentjens, R.J., et al., Safety and persistence of adoptively transferred autologous CD19-targeted T cells in patients with relapsed or chemotherapy refractory B-cell leukemias. Blood, 2011. 118(18): p. 4817-28. 10. Almagro, J.C., et al., Progress and Challenges in the Design and Clinical Development of Antibodies for Cancer Therapy. Front Immunol, 2017. 8: p. 1751. 11. Masiakowski, P. and R.D. Carroll, A novel family of cell surface receptors with tyrosine kinase-like domain. J Biol Chem, 1992. 267(36): p. 26181-90. 12. Stricker, S., V. Rauschenberger, and A. Schambony, ROR-Family Receptor Tyrosine Kinases. Curr Top Dev Biol, 2017. 123: p. 105-142. 13. Matsuda, T., et al., Expression of the receptor tyrosine kinase genes, Ror1 and Ror2, during mouse development. Mech Dev, 2001. 105(1-2): p. 153-6. 14. Rebagay, G., et al., ROR1 and ROR2 in human malignancies: potentials for targeted therapy. Front Oncol, 2012. 2: p. 34. 15. Debebe, Z. and W.K. Rathmell, Ror2 as a therapeutic target in cancer. Pharmacol Ther, 2015. 150: p. 143-8. 16. Niehrs, C., The complex world of WNT receptor signalling. Nat Rev Mol Cell Biol, 2012. 13(12): p. 767-79. 17. DeChiara, T.M., et al., Ror2, encoding a receptor-like tyrosine kinase, is required for cartilage and growth plate development. Nat Genet, 2000. 24(3): p. 271-4. 18. Green, J.L., S.G. Kuntz, and P.W. Sternberg, Ror receptor tyrosine kinases: orphans no more. Trends Cell Biol, 2008. 18(11): p. 536-44. 19. Al-Shawi, R., et al., Expression of the Ror1 and Ror2 receptor tyrosine kinase genes during mouse development. Dev Genes Evol, 2001. 211(4): p. 161-71. 20. Forrester, W.C., The Ror receptor tyrosine kinase family. Cell Mol Life Sci, 2002. 59(1): p. 83-96. 21. Morioka, K., et al., Orphan receptor tyrosine kinase ROR2 as a potential therapeutic target for osteosarcoma. Cancer Sci, 2009. 100(7): p. 1227-33. 22. Wright, T.M., et al., Ror2, a developmentally regulated kinase, promotes tumor growth potential in renal cell carcinoma. Oncogene, 2009. 28(27): p. 2513-23. 23. Wright, T.M. and W.K. Rathmell, Identification of Ror2 as a hypoxia-inducible factor target in von Hippel-Lindau-associated renal cell carcinoma. J Biol Chem, 2010. 285(17): p. 12916-24. 24. Henry, C., et al., Expression of the novel Wnt receptor ROR2 is increased in breast cancer and may regulate both beta-catenin dependent and independent Wnt signalling. J Cancer Res Clin Oncol, 2015. 141(2): p. 243-54. 25. Frenquelli, M., et al., The WNT receptor ROR2 drives the interaction of multiple myeloma cells with the microenvironment through AKT activation. Leukemia, 2020. 34(1): p. 257-270. 26. Edris, B., et al., ROR2 is a novel prognostic biomarker and a potential therapeutic target in leiomyosarcoma and gastrointestinal stromal tumour. J Pathol, 2012. 227(2): p. 223-33. 27. Bayerlova, M., et al., Ror2 Signaling and Its Relevance in Breast Cancer Progression. Front Oncol, 2017. 7: p. 135. 28. O'Connell, M.P., et al., Hypoxia induces phenotypic plasticity and therapy resistance in melanoma via the tyrosine kinase receptors ROR1 and ROR2. Cancer Discov, 2013. 3(12): p. 1378-93. 29. Peng, H., et al., Mining naive rabbit antibody repertoires by phage display for monoclonal antibodies of therapeutic utility. J Mol Biol, 2017. 429(19): p. 2954-2973. 30. Rader, C., Peng, H., and Li, X., PCT / US2017 / 014370. 2017. 31. Baca, M., et al., Antibody humanization using monovalent phage display. J Biol Chem, 1997. 272(16): p. 10678-84. 32. Altschul, S.F., et al., Basic local alignment search tool. J Mol Biol, 1990. 215(3): p. 403-10. 33. Altschul, S.F., et al., Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res, 1997. 25(17): p. 3389-402. 34. Qi, J., et al., Potent and selective antitumor activity of a T cell-engaging bispecific antibody targeting a membrane-proximal epitope of ROR1. PNAS, 2018. 115(24): p. E5467-E5476. 35. Park, H., F.G. Adsit, and J.C. Boyington, The 1.4 angstrom crystal structure of the human oxidized low density lipoprotein receptor lox-1. J Biol Chem, 2005. 280(14): p. 13593-9. 36. Otwinowski, Z. and W. Minor, Macromolecular Crystallography, Part A. Methods in Enzymology. Vol. 276. 1997: Academic Press. 37. Vagin A and Teplyakov A, MOLREP: an automated program for molecular replacement. Journal of Applied Crystallography, 1997. 30(6): p. 1022-1025. 38. Adams PD, et al., PHENIX: building new software for automated crystallographic structure determination. Acta Crystallogr D Biol Crystallogr., 2002. 58(Pt 11): p. 1948-54. Epub 2002 Oct 21. 39. Emsley, P. and K. Cowtan, Coot: model-building tools for molecular graphics. Acta Crystallogr D Biol Crystallogr, 2004. 60(Pt 12 Pt 1): p. 2126-32. 40. Pettersen, E.F., et al., UCSF Chimera--a visualization system for exploratory research and analysis. J Comput Chem, 2004. 25(13): p. 1605-12. 41. Brunger, A.T., et al., Crystallography & NMR system: A new software suite for macromolecular structure determination. Acta Crystallogr D Biol Crystallogr, 1998. 54(Pt 5): p. 905-21. 42. Brunger, A.T., Version 1.2 of the Crystallography and NMR system. Nat Protoc, 2007. 2(11): p. 2728-33. 43. Chen, V.B., et al., MolProbity: all-atom structure validation for macromolecular crystallography. Acta Crystallogr D Biol Crystallogr, 2010. 66(Pt 1): p. 12-21. 44. Rader, C., Generation and selection of rabbit antibody libraries by phage display. Methods Mol Biol, 2009. 525: p. 101-28, xiv. 45. Zhang, Y.F. and M. Ho, Humanization of rabbit monoclonal antibodies via grafting combined Kabat / IMGT / Paratome complementarity-determining regions: Rationale and examples. mAbs, 2017. 9(3): p. 419-429. 46. Stahl, S.J., et al., Generation and characterization of a chimeric rabbit / human Fab for co-crystallization of HIV-1 Rev. J Mol Biol, 2010. 397(3): p. 697-708. 47. Freeth, J. and J. Soden, New Advances in Cell Microarray Technology to Expand Applications in Target Deconvolution and Off-Target Screening. SLAS Discov, 2019: p. 10.1177 / 2472555219897567. 48. Robinson, H.R., et al., A CD19 / CD3 bispecific antibody for effective immunotherapy of chronic lymphocytic leukemia in the ibrutinib era. Blood, 2018. 132(5): p. 521-532. 49. Merchant, A.M., et al., An efficient route to human bispecific IgG. Nat Biotechnol, 1998. 16(7): p. 677-81. 50. Lee, C.H., et al., Engineering of a human kringle domain into agonistic and antagonistic binding proteins functioning in vitro and in vivo. PNAS, 2010. 107(21): p. 9567-71. 51. Wang, M., et al., Solution structure of the complex of VEK-30 and plasminogen kringle 2. J Struct Biol, 2010. 169(3): p. 349-59. 52. Jones, T.D., et al., The INNs and outs of antibody nonproprietary names. mAbs, 2016. 8(1): p. 1-9. 53. Menzen, T. and W. Friess, Temperature-ramped studies on the aggregation, unfolding, and interaction of a therapeutic monoclonal antibody. J Pharm Sci, 2014. 103(2): p. 445-55. 54. McConnell, A.D., et al., A general approach to antibody thermostabilization. mAbs, 2014. 6(5): p. 1274-82. 55. Hristodorov, D., et al., Generation and comparative characterization of glycosylated and aglycosylated human IgG1 antibodies. Mol Biotechnol, 2013. 53(3): p. 326-35. 56. Atwell, S., et al., Stable heterodimers from remodeling the domain interface of a homodimer using a phage display library. J Mol Biol, 1997. 270(1): p. 26-35. 57. Zhu, Z., G.D. Lewis, and P. Carter, Engineering high affinity humanized anti-p185HER2 / anti-CD3 bispecific F(ab′)2 for efficient lysis of p185HER2 overexpressing tumor cells. IJC, 1995. 62(3): p. 319-324. 58. Maus, M.V., et al., T cells expressing chimeric antigen receptors can cause anaphylaxis in humans. Cancer Immunol Res, 2013. 1(1): p. 26-31. 59. Sommermeyer, D., et al., Fully human CD19-specific chimeric antigen receptors for T-cell therapy. Leukemia, 2017. 31(10): p. 2191-2199. 60. Wang, X., et al., A transgene-encoded cell surface polypeptide for selection, in vivo tracking, and ablation of engineered cells. Blood, 2011. 118(5): p. 1255-63. 61. Hudecek, M., et al., Receptor affinity and extracellular domain modifications affect tumor recognition by ROR1-specific chimeric antigen receptor T cells. Clin Cancer Res, 2013. 19(12): p. 3153-64. 62. Roth, T.L., et al., Reprogramming human T cell function and specificity with non-viral genome targeting. Nature, 2018. 559(7714): p. 405-409. 63. WO 2017 / 127702 A1 64. D. T. Rodgers, M. Mazagova, E. N. Hampton, Y. Cao, N. S. Ramadoss, I. R. Hardy, A. Schulman, J. Du, F. Wang, O. Singer, J. Ma, V. Nunez, J. Shen, A. K. Woods, T. M. Wright, P. G. Schultz, C. H. Kim, T. S. Young, Proc Natl Acad Sci U S A 2016, 113, E459-468. 65. J. S. Ma, J. Y. Kim, S. A. Kazane, S. H. Choi, H. Y. Yun, M. S. Kim, D. T. Rodgers, H. M. Pugh, O. Singer, S. B. Sun, B. R. Fonslow, J. N. Kochenderfer, T. M. Wright, P. G. Schultz, T. S. Young, C. H. Kim, Y. Cao, Proc Natl Acad Sci U S A 2016, 113, E450-458. 66. Y. Cao, D. T. Rodgers, J. Du, I. Ahmad, E. N. Hampton, J. S. Ma, M. Mazagova, S. H. Choi, H. Y. Yun, H. Xiao, P. Yang, X. Luo, R. K. Lim, H. M. Pugh, F. Wang, S. A. Kazane, T. M. Wright, C. H. Kim, P. G. Schultz, T. S. Young, Angew Chem Int Ed Engl 2016, 55, 7520-7524. 67. L. J. B. Brandt, M. B. Barnkob, Y. S. Michaels, J. Heiselberg, T. Barington, Front Immunol 2020, 26 February 2020 (doi.org / 10.3389 / fimmu.2020.00326). 68. Kabat E.A., Wu,T.T., Perry,H., Gottesman,K. and Foeller,C. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition. NIH Publication No. 91-3242.

Claims

1. A chimeric antigen receptor (CAR) capable of binding to human ROR2, wherein the CAR comprises a light chain variable domain and a heavy chain variable domain. The light chain variable domain contains a CDR1 sequence having the amino acid sequence of SEQ ID NO:

41. The light chain variable domain contains a CDR2 sequence having the amino acid sequence of SEQ ID NO:

42. The light chain variable domain contains a CDR3 sequence having the amino acid sequence of SEQ ID NO:

43. The heavy chain variable domain contains a CDR1 sequence having the amino acid sequence of SEQ ID NO:

44. The heavy chain variable domain contains a CDR2 sequence having the amino acid sequence of SEQ ID NO:

45. The heavy chain variable domain contains a CDR3 sequence having an amino acid sequence selected from the group consisting of SEQ ID NOs: 26, 27, 28, 29, 30, 31, 32, 33, 34, and 35. CAR.

2. The CAR according to claim 1, wherein the heavy chain variable domain comprises a CDR3 sequence having the amino acid sequence of SEQ ID NO:

26.

3. The CAR according to claim 1 or 2, which, as determined by surface plasmon resonance measurement, is capable of binding to human ROR2 with a higher affinity than the corresponding CAR, comprising a light chain variable domain having the amino acid sequence of SEQ ID NO: 2 and a heavy chain variable domain having the amino acid sequence of SEQ ID NO:

1.

4. (i) the heavy chain variable domain comprises the amino acid sequence of SEQ ID NO: 3 and the light chain variable domain comprises the amino acid sequence of SEQ ID NO: 4, or (ii) the heavy chain variable domain comprises the amino acid sequence of SEQ ID NO: 5 and the light chain variable domain comprises the amino acid sequence of SEQ ID NO: 6, or (iii) the heavy chain variable domain comprises the amino acid sequence of SEQ ID NO: 7 and the light chain variable domain comprises the amino acid sequence of SEQ ID NO: 6, according to any one of claims 1 to 3.

5. A humanized carcinoma according to any one of claims 1 to 4.

6. (ii) The heavy chain variable domain comprises the amino acid sequence of SEQ ID NO: 5 and the light chain variable domain comprises the amino acid sequence of SEQ ID NO: 6, or (iii) The heavy chain variable domain comprises the amino acid sequence of SEQ ID NO: 7 and the light chain variable domain comprises the amino acid sequence of SEQ ID NO: 6, according to any one of claims 1 to 5.

7. A nucleic acid encoding a CAR according to any one of claims 1 to 6.

8. The nucleic acid according to claim 7, wherein the nucleic acid is mRNA.

9. The nucleic acid according to claim 7, which is DNA.

10. The nucleic acid according to claim 9, wherein the DNA is minicircle DNA or plasmid DNA.

11. Recombinant immune cells comprising a CAR according to any one of claims 1 to 6 and / or a nucleic acid according to any one of claims 7 to 10 encoding a CAR according to any one of claims 1 to 6.

12. Recombinant immune cells according to claim 11, wherein the immune cells are CD8+ killer T cells, CD4+ helper T cells, naive T cells, memory T cells, central memory T cells, effector memory T cells, memory stem cell T cells, invariant T cells, NKT cells, cytokine-induced killer T cells, g / d T cells, natural killer cells, monocytes, macrophages, dendritic cells, or granulocytes.

13. The recombinant immune cell according to claim 11 or 12, wherein the immune cell is a T cell.

14. (i) The CAR according to any one of claims 1 to 6; (ii) The nucleic acid according to any one of claims 7 to 10 that encodes the CAR according to any one of claims 1 to 6; (iii) Recombinant immune cells according to any one of claims 11 to 13; or (iv) A combination of (i) and (ii), a combination of (i) and (iii), or a combination of (i) to (iii) A pharmaceutical composition containing the following:

15. The pharmaceutical composition according to claim 14 for use in the treatment of cancer.

16. The pharmaceutical composition according to claim 15, wherein the cancer is a cancer that expresses ROR2.

17. The pharmaceutical composition according to claim 15 or 16, wherein the cancer is a blood cancer.

18. The pharmaceutical composition according to claim 15 or 16, wherein the cancer is a solid tumor.

19. The pharmaceutical composition according to any one of claims 15 to 18, wherein the cancer is selected from the group consisting of multiple myeloma, renal cell carcinoma, pancreatic cancer, sarcoma, glioblastoma, and breast cancer.