Synthetic guide RNA, compositions, methods, and their uses

Abstract

This paper provides a method for producing synthetic RNA using a self-templated approach. [Solution] In some embodiments, synthetic gRNA is produced by contacting a first RNA with a second RNA, wherein the first RNA and the second RNA contain at least five complementary RNA nucleotides, the contact forming a stem structure or a stem-loop structure, and a ligation enzyme (i) ligating the first RNA and the second RNA within the stem structure, or (ii) ligating them at the ends of the stem structure, thereby forming a loop at the ends of the stem structure.

Description

Technical Field

[0001] Cross - reference to Related Applications This application claims the benefit and priority of US62 / 943,158 filed on December 3, 2019 and US63 / 031,262 filed on May 28, 2020, the contents of each of which are incorporated herein by reference.

Background Art

[0002] Guide RNA molecules (gRNA) associated with Cas endonucleases, and related enzymes including base editors, are used for applications in gene editing. A common form of gRNA used for therapeutic applications is a single unnatural RNA of about 100 nucleotides that forms a ribonucleoprotein with Cas9. Solid - phase synthesis using plasmid DNA and phosphoramidite chemistry is a typical approach for obtaining therapeutic sgRNA. The use of synthetic RNA is advantageous for increasing the chemical stability of sgRNA and for incorporating modifications that can reduce off - target editing of genomic DNA at unwanted positions.

[0003] There remain problems in the production of gRNA. For example, i) the length of the sgRNA molecule, typically 100 nucleotides in length, exceeds the limits of phosphoramidite chemistry. Phosphoramidite chemistry has a coupling efficiency of about 0.985^X (where X is the number of nucleotides) for RNA. For example, the synthesis of a 100 - nt - long gRNA yields about 20% of the full - length product before isolation. These lengths are beyond the capabilities of currently commercially available oligonucleotides. Significantly larger than those used in the base therapeutic (siRNA and antiseptic) ASOs are typically 20-50 nucleotides in length. Therefore, it is more suitable for purification. ii) Incomplete coupling (trancasion Formed from adduct products, incomplete deprotection, and random insertions of nucleotides. Complete removal of by-products is currently achieved by standard purification methods (e.g., chromatography). Electrophoresis cannot achieve this for RNA at these length scales. i. iii) By-products isolated together with the full-length product that have similar sequence homology to the full-length product. This reduces the activity of the ribonucleoprotein complex, potentially leading to off-target editing. It is possible. [Overview of the project]

[0004] Overcoming the challenges that limit the purity, integrity, and final (post-purification) yield of synthetic RNA. The process of synthesizing gRNA using chemical and / or enzymatic strategies is described herein. The present invention is described in part by two or more synthetic RNAs using an enzyme. It provides a ligation-based approach. Surprisingly, Egation-based approaches improve the purity, yield, and integrity of the produced gRNA. It was found that it could be increased. The purity, yield, and integrity of the resulting gRNA were Compared to previous methods of gRNA synthesis, this method offers increased editing efficiency and reduced off-target editing. This makes reduction possible. Ligation-based methods for gRNA synthesis allow for reduction later on. A method comprising using two or more partially complementary synthetic RNAs ("Ten") (Plate approach), and methods that do not require complementarity between two or more synthetic RNAs. This includes the "non-template approach."

[0005] In some embodiments, the first RNA is brought into contact with the second RNA, and the first RN RNA A and the second RNA contain at least five complementary RNA nucleotides, Making contact forms a stem structure or stem loop structure, and (i) Ligation of RNA 1 and RNA 2 with a ligation enzyme within the stem structure (ii) to ligate at the end of the stem structure, thereby stern A method is provided that includes forming a loop at the end of a m structure.

[0006] In some embodiments, contact forms a stem structure, and the ligation enzyme The first RNA and the second RNA are ligated at the end of the stem structure, and thereafter... It forms a loop at the end of the stem structure.

[0007] In some embodiments, contact is made to form a stem-loop structure and ligation The enzyme ligates the first RNA and the second RNA within the stem of the stem-loop structure. To do.

[0008] In some embodiments, the ligation enzyme is T4 RNA ligase 1, T4 RNA Ligase 2, RtcB ligase, heat-stable 5'App DNA / RNA ligase, Ele ctroLigase, T4 DNA ligase, T3 DNA ligase, T7 DNA ligase Gauze, Taq DNA ligase, Splint® ligase, E. coli DNA ligase Selected from the group consisting of T4 RNA ligase 1, 9°N DNA ligase, CircLigase, CircLigase II, DNA ligase I, DNA ligase III, and DNA ligase IV. Thus, in some embodiments, the ligation enzyme is T4 RNA ligase 1. In some embodiments, the ligation enzyme is T4 RNA ligase 2. In some embodiments, the ligation enzyme is RtcB ligase. In some embodiments, the ligation enzyme is thermostable 5’App DNA / RNA ligase. In some embodiments, the ligation enzyme is ElectroLigase. In some embodiments, the ligation enzyme is T4 DNA ligase. In some embodiments, the ligation enzyme is T3 DNA ligase. In some embodiments, the ligation enzyme is T7 DNA ligase. In some embodiments, the ligation enzyme is Taq DNA ligase. In some embodiments, the ligation enzyme is SplintR ligase E.coli DNA ligase. In some embodiments, the ligation enzyme is 9°N DNA ligase. In some embodiments, the ligation enzyme is CircLigase. In some embodiments, the ligation enzyme is CircLigase II. In some embodiments, the ligation enzyme is DNA ligase I. In some embodiments, the ligation enzyme is DNA ligase II. In some embodiments, the ligation enzyme is DNA ligase IV. selected Thus, in some embodiments, the ligation enzyme is T4 RNA ligase 1. In some embodiments, the ligation enzyme is T4 RNA ligase 2 is. In some embodiments, the ligation enzyme is RtcB ligase. In some embodiments the ligation enzyme is thermostable 5’App DNA / RNA ligase . In some embodiments, the ligation enzyme is ElectroLigase. In one In some embodiments, the ligation enzyme is T4 DNA ligase. In some embodiments the ligation enzyme is T3 DNA ligase. In some embodiments, the ligation enzyme is T7 DNA ligase. In some embodiments, the ligation enzyme is Taq DNA ligase. In some embodiments, the ligation enzyme is , SplintR ligase E.coli DNA ligase. In some embodiments the ligation enzyme is 9°N DNA ligase. In some embodiments, the ligation enzyme is CircLigase. In some embodiments, the ligation enzyme is CircLigaseII. In some embodiments, the ligation enzyme is D NA ligase I. In some embodiments, the ligation enzyme is DNA ligase I II. In some embodiments, the ligation enzyme is DNA ligase IV.

[0009] In some embodiments, the first and / or second RNA is chemically synthesized.

[0010] In some embodiments, the first RNA is clustered regularly i nterspersed short palindromic repeat(CRI SPR RNA (crRNA) is the first RNA, and the second RNA is transactivating RNA (tra It is crRNA.

[0011] In some embodiments, guide RNA (gRNA) is produced according to the method described herein. ru.

[0012] In some embodiments, the first RNA and / or the second RNA are chemically synthesized. ru.

[0013] In some embodiments, the first and / or second RNAs are synthesized enzymatically.

[0014] In some embodiments, the first RNA and / or the second RNA have modified bases Includes various modified RNA bases, including those known in the art, such as 2-methionine. Xyethoxy A, 2-methoxyethoxy MeC, 2-methoxyethoxy G, 2-methoxy Contains 2'-O-methoxyethyl bases (2'-MOE), such as ethoxy T. These bases include, for example, 2'-O-methylRNA bases and fluorobases. Several fluorobases are known, for example, fluoroC, fluoroU, fluoroA, fluoro It contains a 2'O base. Various 2'O methyl modifications can also be used in conjunction with the methods described herein. It may be used. For example, the following RNA containing one or more of the following 2'O methyl modifications, Can be used in conjunction with the method described: 2'-OMe-5-methyl-rC, 2'-O Me-rT, 2'-OMe-rI, 2'-OMe-2-amino-rA, aminolinker- C6-rC, aminolinker-C6-rU, 2'-OMe-5-Br-rU, 2'-OM e-5-I-rU、2OMe-7-deaza-rG。

[0015] In some embodiments, the first RNA and / or the second RNA are modified as follows, phosphatid One or more of the following: holothioate, 2'O-methyl, 2'fluoro(2'F), DNA include.

[0016] In some embodiments, the first RNA and / or the second RNA have 3' and 5' ends. It includes a 2'OMe modification at the end.

[0017] In some embodiments, the first RNA and / or the second RNA are among the following modifications. Contains one or more of the following: 2'-O-2-methoxyethyl (MOE), loc nucleic acid, cross-linked nucleic acid, Unlocked nucleic acids, peptide nucleic acids, morpholino nucleic acids.

[0018] In some embodiments, the first RNA and / or the second RNA have the following base modifications Contains one or more of the following: 2,6-diaminopurine, 2-aminopurine, pseudouracil N1-methyl-pseudracil, 5'methylcytosine, 2'pyrimidinone (Zebrali N), Chimin.

[0019] Other modified bases include, for example, 2-aminopurine, 5-bromo dU, and deoxyuri. Zin, 2,6-diaminopurine (2-amino-dA), dideoxy-C, deoxyinosyl n, hydroxymethyl dC, inverted dT, iso-dG, iso-dC, inverted dideoxy-T, 5-methyldC, 5-methyldC, 5-nitroindole, Super T (registered trademark) , 2'-Fr(C, U), 2'-NH2-r(C, U), 2,2'-anhydride-U, 3'- Desoxy-r(A,C,G,U), 3'-O-methyl-r(A,C,G,U), rT, r I, 5-methyl-rC, 2-amino-rA, r spacer (debase), 7-deaza-rG , 7-deaza-rA, 8-oxo-rG, 5-halogenated-U, N-alkylated-rN It is included.

[0020] Other chemically modified RNAs may be used in this specification. For example, the first The RNA and / or the second RNA are, for example, 5',Int,3' azide (NHS ezide). (ster), 5'-hexynyl, 5',Int,3'5-octadiinyl dU, 5',Int Biotin (azide), 5',Int 6-FAM (azide), and 5',Int 5 - May contain modified bases such as TAMRA (azide). Along with the methods described herein. Other examples of RNA nucleotide modifications that can be used include, for example, 5' phosphorylation and Examples of phosphorylation modifications include 3' phosphorylation. RNA also undergoes the following modifications: amino modification. Biotinylation, thiol modification, alkyne modification, adenylation, azide (NHS ester) One or more of the following: cholesterol-TEG, and digoxigenin (NHS ester) It may have.

[0021] In some embodiments, the first RNA and the second RNA are ligated with a ligation enzyme. By performing this process, a phosphodiester linkage is formed between the first RNA and the second RNA. It is made.

[0022] In some embodiments, the first RNA and / or the second RNA nucleotide are non-covalent. It is manipulated to enable coupled association.

[0023] In some embodiments, the stem-loop has a length of approximately 2 to 50 nucleotides.

[0024] In some embodiments, the first RNA and the second RNA have a small amount of complete complementarity. It contains at least two RNA nucleotides.

[0025] In some embodiments, the first RNA and the second RNA have a small amount of complete complementarity. It contains at least 3, 4, 5, 6, or 7 consecutive RNA nucleotides.

[0026] In some embodiments, RNA nucleotides having complete complementarity are located in the upper stem and / or located in the lower stem.

[0027] In some embodiments, the first RNA and the second RNA are the first RNA and the second At least 5, 6, or 7 chains that are complementary to the lower stem formed by RNA. It contains a series of RNA nucleotides.

[0028] In some embodiments, the first RNA and the second RNA are complementary in the upper stem. It contains at least 4 to 14 consecutive RNA nucleotides.

[0029] In some embodiments, the first RNA and the second RNA are complementary in the upper stem. It contains four consecutive RNA nucleotides.

[0030] In some embodiments, the first and second RNAs are 5-chain RNAs that are complementary at the upper stem. It contains a series of RNA nucleotides.

[0031] In some embodiments, the first and second RNAs are seven strands complementary at the upper stem. It contains a series of RNA nucleotides.

[0032] In some embodiments, the first and second RNAs are complementary at the upper stem, with 14 RNAs It contains consecutive RNA nucleotides.

[0033] In some embodiments, the first and second RNAs are seven strands complementary at the lower stem. It contains a series of RNA nucleotides.

[0034] In some embodiments, the first RNA and / or the second RNA are used in ligation yeast The process is manipulated to create the raw ligation area.

[0035] In some embodiments, the stem loops are 4, 5, 6, 7, 8, 9, 10, 11, 12, It contains loops of 13, 14, 15, or 16 nucleotides. Therefore, some actual In the application form, the stem loop consists of four nucleotides, also referred to herein as the tetraloop. It includes a loop. In some embodiments, the stem loop is a loop of five nucleotides. Includes. In some embodiments, the stem loop includes a loop of six nucleotides. In some embodiments, the stem loop includes a loop of seven nucleotides. So, the stem loop contains a loop of eight nucleotides. In some embodiments, the stem A muloop contains a loop of nine nucleotides. In some embodiments, the stem loop is , containing a loop of 10 nucleotides. In some embodiments, the stem loop has 11 It includes a nucleotide loop. In some embodiments, the stem loop consists of 12 nucleotides. It includes an ocide loop. In some embodiments, the stem loop consists of 13 nucleotides. Includes a loop. In some embodiments, the stem loop consists of a loop of 14 nucleotides. Includes. In some embodiments, the stem loop includes a loop of 15 nucleotides. In one embodiment, the stem loop includes a loop of 15 nucleotides.

[0036] In some embodiments, the first RNA and the second ligation are less than the loop. Ligation sites are located at 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 base pairs. This occurs. Therefore, in some embodiments, the ligaments of the first RNA and the second RNA are formed. The ligation occurs at the ligation site, which is at least one base pair away from the loop. In some embodiments, the ligation of the first RNA and the second RNA is performed in a loop or It occurs at the ligation site, which is at least two base pairs. In some embodiments, the first The ligation of RNA and the second RNA is at least three base pairs from the loop. It occurs at the eruption site. In some embodiments, the eruption of the first RNA and the second RNA Egation occurs at the ligation site, which is at least four base pairs from the loop. In one embodiment, the ligation of the first RNA and the second RNA is performed from the loop. It occurs at the ligation site, which is at least 5 base pairs. In some embodiments, the first RN The ligation of RNA A and the second RNA is at least 6 base pairs from the loop. Occurs at the ligation site. In some embodiments, the ligation of the first RNA and the second RNA The ligation occurs at the ligation site, which is at least 7 base pairs from the loop. In this embodiment, the ligation of the first RNA and the second RNA is less than the loop. Both occur at the ligation site, which consists of 8 base pairs. In some embodiments, the first RNA The ligation of the second RNA is a ligation of at least 9 base pairs from the loop. It occurs at the site. In some embodiments, the ligation of the first RNA and the second RNA The ligation occurs at a ligation site located at least 10 base pairs away from the loop.

[0037] In some embodiments, the ligation site is located two or three base pairs from the loop.

[0038] In some embodiments, the ligation of the first RNA and the second RNA is performed in the bulge. The lige is located at least 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 base pairs. It occurs at the region site. Therefore, in some embodiments, the first RNA and the second R The ligation of NA is at least 3 base pairs away from the bulge. It occurs at the site. In some embodiments, ligation of the first RNA and the second RNA It originates from the bulge at a ligation site which is at least 4 base pairs. In some embodiments So, the ligation of the first and second RNAs is at least 5 salts from the bulge. It occurs at the ligation site, which is a base pair. In some embodiments, the first RNA and the second RNA RNA ligation is a ligation site that is at least 6 base pairs from the bulge. This occurs. In some embodiments, ligation of the first RNA and the second RNA occurs. It originates from the bulge at a ligation site that is at least 7 base pairs. In some embodiments, Ligation of the first and second RNAs occurs from the bulge by at least 8 base pairs. This occurs at the ligation site, which is the first RNA and the second R NA ligation originates from the ligation site, which is at least 9 base pairs from the bulge. In some embodiments, the ligation of the first RNA and the second RNA is performed by It occurs at a ligation site that is at least 10 base pairs from the base. In some embodiments, Ligation of the first and second RNAs is at least 11 base pairs from the bulge. It occurs at the ligation site located there. In some embodiments, the first RNA and the second R NA ligation occurs at ligation sites located at least 12 base pairs from the bulge. To occur.

[0039] In some embodiments, the ligation of the first RNA and the second RNA is performed in the bulge. It occurs at ligation sites located at 3, 4, 5, or 11 base pairs.

[0040] In some embodiments, the first RNA and / or the second RNA are produced enzymatically. ru.

[0041] In some embodiments, the first RNA can form base pairs with a portion of the second RNA. Includes possible 3' sequences.

[0042] In some embodiments, the first RNA contains a phosphate at its 5' end.

[0043] In some embodiments, the first RNA is a donor RNA.

[0044] In some embodiments, the second RNA includes a variable protospacer region.

[0045] In some embodiments, the second RNA is an acceptor RNA.

[0046] In some embodiments, the first RNA contains adenosine triphosphate at its 5' end.

[0047] In some embodiments, approximately 8 to 50 nucleotides are complementary, and the first RNA and the second It enables base pairing between RNA and 2. In some embodiments, about 8 to 40 nuclei The rheotide is complementary, enabling base pairing between the first and second RNAs. In some embodiments, approximately 8 to 30 nucleotides are complementary, with the first RNA and the second RNA. It enables base pairing between two RNA molecules. In some embodiments, about 8 to 20 nuclei The rheotide is complementary, enabling base pairing between the first and second RNAs. In some embodiments, about 8 to 10 nucleotides are complementary, and the first RNA and the second It enables base pairing between two RNA molecules.

[0048] In some embodiments, the 8 to 50 nucleotides are partially complementary. In this embodiment, approximately 8 to 40 nucleotides are partially complementary to the first RNA. This enables base pairing between the first RNA molecule and the second RNA molecule. In some embodiments, there are approximately 8 to 30 base pairs. Nucleotides are partially complementary, and the base pairing between the first RNA and the second RNA is... This enables the formation of nucleotides. In some embodiments, about 8 to 20 nucleotides are partially complementary. This enables base pairing between the first RNA and the second RNA. (Some embodiments) So, about 8-10 nucleotides are partially complementary, with the first RNA and the second R... This enables base pairing with NA.

[0049] In some embodiments, 8 to 50 nucleotides are approximately 50% to 99% complementary.

[0050] In some embodiments, 8 to 50 nucleotides are perfectly complementary. Morphologically, the approximately 8-40 nucleotides are completely complementary, with the first RNA and the second RNA... It enables base pairing with RNA. In some embodiments, about 8 to 30 nucleos The nucleotides are perfectly complementary, enabling base pairing between the first and second RNAs. In some embodiments, approximately 8 to 20 nucleotides are perfectly complementary, and the first This enables base pairing between the first RNA and the second RNA. In some embodiments, about 8~ The 10 nucleotides are perfectly complementary, and the salt between the first RNA and the second RNA It enables the formation of substrate pairs.

[0051] In some embodiments, the first and second RNAs have different nucleotide lengths.

[0052] In some embodiments, the first RNA has about 20 to 100 nucleotides. In some embodiments, the first RNA has about 20 to 90 nucleotides. In the embodiment, the first RNA has approximately 20 to 80 nucleotides. The first RNA then has approximately 20 to 70 nucleotides. In some embodiments, The first RNA has about 20 to 60 nucleotides. In some embodiments, the first RNA has approximately 20 to 50 nucleotides. In some embodiments, the first RNA It has about 20 to 40 nucleotides. In some embodiments, the first RNA has about It has 20 to 30 nucleotides.

[0053] In some embodiments, the second RNA has approximately 20 to 70 nucleotides. In some embodiments, the second RNA has approximately 20 to 60 nucleotides. Morphologically, the second RNA has approximately 20–50 nucleotides. In some embodiments... The second RNA has approximately 20 to 40 nucleotides. In some embodiments, RNA 2 has approximately 20 to 30 nucleotides.

[0054] In some embodiments, base pairing occurs in the lower stem.

[0055] In some embodiments, seven nucleotides are complementary in the lower stem, and the first This enables base pairing between the first RNA and the second RNA.

[0056] In some embodiments, base pairing occurs in the upper stem.

[0057] In some embodiments, two nucleotides are complementary in the upper stem, and the first This enables base pairing between the first RNA and the second RNA.

[0058] In some embodiments, gRNA consists of approximately 100 nucleotides and approximately 125 nucleos Tydo, approximately 150 nucleotides, approximately 175 nucleotides, approximately 200 nucleotides It has a length of more than 200 nucleotides, or about 200. Therefore, some actual In the applied form, the gRNA has a length of approximately 100 nucleotides. In some embodiments gRNA has a length of approximately 125 nucleotides. In some embodiments, gR NA has a length of approximately 150 nucleotides. In some embodiments, gRNA is It has a length of approximately 175 nucleotides. In some embodiments, the gRNA is approximately 200 It has a length of nucleotides. In some embodiments, the gRNA is larger than 200. It has a long nucleotide length.

[0059] In some embodiments, the gRNA is an elongation guide RNA, a prime editor guide RNA. A (pegRNA), or Cas12a guide RNA, Cas12b guide RNA, C as12c guide RNA, Cas12d, guide RNA, Cas12e guide RNA, C as12f guide RNA, Cas12g guide RNA, Cas12h guide RNA, Ca s12i guide RNA, Cas12j guide RNA, or Cas12k guide RNA These are Cas12 guide RNAs. Therefore, in some embodiments, the gRNA is It is an elongation guide RNA. In some embodiments, the gRNA is a prime editor guide RNA. It is RNA (pegRNA). In some embodiments, the gRNA is Cas12 guide R NA. Various Cas12s are known and in the relevant technical field, for example, Class 2. Examples include Cas12 derived from the CRISPR-Cas system. For example, any Cas12 derived from a Class 2 CRISPR-Cas system could be cited. In some embodiments, the methods described herein are Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas12f, Cas12g, Cas12 Synthesizes gRNAs of h, Cas12i, Cas12j, and / or Cas12k. This is suitable for. Therefore, in some embodiments, the gRNA is a Cas12a guide RN A. In some embodiments, the gRNA is Cas12b guide RNA. In some embodiments, the gRNA is Cas12c guide RNA. The RNA is a Cas12d guide RNA. In some embodiments, the gRNA is Cas This is a 12e guide RNA. In some embodiments, the gRNA is a Cas12f guide RNA. A. In some embodiments, the gRNA is Cas12 g-guide RNA. In some embodiments, the gRNA is Cas12h guide RNA. The RNA is a Cas12i guide RNA. In some embodiments, the gRNA is Cas This is a 12j guide RNA. In some embodiments, the gRNA is a Cas12k guide RNA. It is A.

[0060] In some embodiments, the gRNA consists of a spacer, lower stem, bulge, upper stem, and Includes one or more of the following: kusas and hairpins.

[0061] In some embodiments, the ratio of the first RNA to the second RNA is approximately 0.5:1, 0.6:1. , 0.7:1, 0.8:1, 0.9:1, 1:1, 1:0.9, 1:0.8, 1:0.7 They exist in a ratio of 1:0.6 or 1:0.5. Therefore, in some embodiments, the RNA 1 and RNA 2 are present in a ratio of approximately 0.5:1. In some embodiments, The first RNA and the second RNA are present in a ratio of approximately 0.6:1. In some embodiments, The first RNA and the second RNA are present in a ratio of approximately 0.7:1. In some embodiments, In some embodiments, the first RNA and the second RNA are present in a ratio of approximately 0.8:1. Then, the first RNA and the second RNA exist in a ratio of approximately 0.9:1. Some implementations In this state, the first RNA and the second RNA are present in a ratio of approximately 1:1. (Some embodiments) Then, the first RNA and the second RNA exist in a ratio of approximately 1:0.9. Some implementations In this state, the first RNA and the second RNA are present in a ratio of approximately 1:0.8. Morphologically, the first RNA and the second RNA are present in a ratio of approximately 1:0.7. In the morphological configuration, the first RNA and the second RNA are present in a ratio of approximately 1:0.6. In this embodiment, the first RNA and the second RNA are present in a ratio of approximately 1:0.5.

[0062] In some embodiments, the gRNA is approximately 50%, 55%, 60%, 65%, and 70%. %, approximately 75%, approximately 80%, approximately 85%, approximately 90%, approximately 95%, approximately 99% or more It is produced at a certain rate. Therefore, in some embodiments, gRNA is produced in a yield of about 50%. In some embodiments, gRNA is produced in a yield of approximately 55%. In this state, gRNA is produced with a yield of approximately 60%. In some embodiments, gRNA is produced. It is produced in a yield of approximately 65%. In some embodiments, gRNA is produced in a yield of approximately 70%. In some embodiments, gRNA is produced in a yield of approximately 75%. In this state, gRNA is produced with a yield of approximately 80%. In some embodiments, gRNA is produced. It is produced in a yield of approximately 85%. In some embodiments, gRNA is produced in a yield of approximately 90%. In some embodiments, gRNA is produced in a yield of approximately 95%. In this state, gRNA is produced with a yield of over 99%.

[0063] In some embodiments, gRNA yields 50% to 55% compared to conventional synthesis methods. , 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or so It is produced with further improvement. Therefore, in some embodiments, the gRNA is produced using conventional synthesis. Compared to the previous method, the yield is improved by 50%. In some embodiments, the gRNA is Compared to conventional synthesis methods, the yield is improved by 55%. In some embodiments, g RNA is produced with a 60% improvement in yield compared to conventional synthesis methods. In this state, gRNA is produced with a 55% improvement in yield compared to conventional synthesis methods. In this embodiment, gRNA is produced with a 60% improvement in yield compared to conventional synthesis methods. In some embodiments, the gRNA yield is improved by 65% ​​compared to conventional synthesis methods. It is produced in good yield. In some embodiments, gRNA is produced in a better yield compared to conventional synthesis methods. The production is improved by 70%. In some embodiments, gRNA is produced compared to conventional synthesis methods. This results in a 75% improvement in yield. In some embodiments, the gRNA is produced using conventional synthesis. Compared to the previous method, the yield is improved by 80%. In some embodiments, the gRNA is Compared to conventional synthesis methods, the yield is improved by 85%. In some embodiments, g RNA is produced with a 90% improvement in yield compared to conventional synthesis methods. In this state, gRNA is produced with a 99% improvement in yield compared to conventional synthesis methods. In one embodiment, gRNA is produced with a yield that is more than 99% better compared to conventional synthesis methods. To be born.

[0064] In some embodiments, a method for producing synthetic guide RNA (gRNA) is provided, and 5'-mo To provide a first RNA containing nophosphate, and to provide a second RNA, Oligonucleotides having partial complementarity to the first and second RNAs The complementarity of oligonucleotides is provided, and the salts of the first and second RNAs To enable and provide ligament formation between the first RNA and the second RNA. To provide a ligase for catalyzing synthesis, and thus to produce synthetic gRNA, Includes.

[0065] In some embodiments, a method for producing synthetic guide RNA (gRNA) is provided, and 5'-mo To provide a first RNA containing nophosphate, and a second RNA containing a blocked 3' end. To provide two RNAs and to address ligation between the first RNA and the second RNA. This includes providing a ligase for mediating and thus producing synthetic gRNA.

[0066] In some embodiments, the first RNA is a transactivating RNA (tracrRNA). Yes, the second RNA is clustered regularly interspersed. sed short palindromic repeat(CRISPR)RNA( It is crRNA.

[0067] In some embodiments, the oligonucleotide is about 100 nucleotides long. In the embodiment, the oligonucleotides are approximately 80, 90, 100, 110, 120, and 130 They are 140, 150, 160, 170, 180, 190, or 200 nucleotides long. .

[0068] In some embodiments, a method for producing synthetic guide RNA (gRNA) is provided. To provide two or more RNA fragments and to provide partial complementation for two or more RNA fragments To provide oligonucleotides having properties, wherein the complementarity of oligonucleotides , providing the ability to form base pairs with two or more RNA fragments, and two or more RN A provides a ligase for catalyzing ligation between fragments, and thus provides a synthetic guide R This includes producing NA.

[0069] In some embodiments, two or more RNA fragments are overhangs, blunt ends, or It will be ligated by Ruji.

[0070] In some embodiments, guide RNA (gRNA), or prime editing guide RNA ( pegRNA is synthesized by the method described herein. In some embodiments, The guide RNA is either Cas9 guide RNA or Cas12 guide RNA.

[0071] The methods described herein use Cas12 guide RNA such as Cas12b guide RNA. It can be used for synthesis. For example, the Cas12b RNA hairpin loop structure can be synthesized. These can be targeted as sites for splitting gRNA. For example, those shown in Figure 16. Various hairpin loop structures, such as the hairpin loop structure, determine the position where sgRNA is divided. Therefore, in some embodiments, Cas12 guide RNA can be targeted. By targeting one or more hairpin loop structures, according to the method described herein It can be synthesized. In some embodiments, one or more tetraloops in Cas12 RNA , and are targeted for ligation. For example, in some embodiments, Cas12b One or more tetraloops within RNA are targets for ligation. Morphologically, the targeted tetraloop is located at the 5' end of the Cas12 RNA. In this embodiment, the targeted tetraloop is located at the 3' end of the Cas12 RNA. In some embodiments, the targeted tetraloop is the 3' end of the Cas12 RNA. It is located within approximately 5 to 30 nucleotides from the end. In some embodiments, targeted The tralupe consists of approximately 5 to 30 nucleotides at the 5' end of the Cas12 RNA.

[0072] In some embodiments, targeted transcriptional activation, targeted transcriptional repression, and targeted epitherapy are used. A method for genome modification, or targeted genome modification, is provided, and this method is for eukaryotic cells. (a) synthetic guide RNA (gRNA) as defined in any one of the prior claims, ( b) At least one CRISPR / Cas protein, or at least one CRI This includes introducing nucleic acids that encode SPR / Cas proteins, (a) and (b) The interaction between the target sequence in chromosomal DNA leads to targeted transcriptional activation, and targeted This results in transcriptional repression, targeted epigenetic modification, or targeted genomic modification.

[0073] In some embodiments, a method for targeted RNA modification is provided, which is used for eukaryotic RNA. (a) synthetic guide RNA (gRNA) as defined in any one of the prior claims, ( b) At least one CRISPR / Cas protein, or at least one CRI This includes introducing nucleic acids that encode SPR / Cas proteins, (a) and (b) The interaction between RNA expressed by chromosomal DNA and the expression by chromosomal DNA It results in the modification of the RNA.

[0074] In some embodiments, RNA expressed by chromosomal DNA is a messenger RN It is A (mRNA).

[0075] In some embodiments, the CRISPR / Cas proteins are Cas9, Cpf1, Sa Select from Cas, Cas12, Cas13, or their modified versions. .

[0076] In some embodiments, synthetic guide RNA (gRNA) is synthesized according to the method described herein. A method for producing is provided.

[0077] In some embodiments, the second RNA can form base pairs with a portion of the first RNA. Includes possible 3' sequences.

[0078] In some embodiments, the second RNA includes a variable protospacer region.

[0079] In some embodiments, the first RNA contains a phosphate at its 5' end.

[0080] In some embodiments, contact is made to form a stem-loop structure and ligation The enzyme ligates the first RNA and the second RNA within the stem of the stem-loop structure. To do.

[0081] In some embodiments, the ligation enzyme is T4 RNA ligase 2.

[0082] In some embodiments, the stem loop includes a GC base pair in the upper stem.

[0083] In some embodiments, the upper stem is CGAUACGACAGAAC and at least about 8 Contains 0% identical nucleotide sequences. In some embodiments, the upper stem is CGAUAC Contains nucleotide sequences identical to GACAGAAC by at least approximately 85%. (Some embodiments) So, the upper stem is at least 90% identical to CGAUACGACAGAAC. Includes an Otid sequence. In some embodiments, the upper stem is CGAUACGACAGAAC It contains a nucleotide sequence that is at least approximately 95% identical to that. In some embodiments, the upper stem It contains a nucleotide sequence that is at least approximately 99% identical to CGAUACGACAGAAC. In some embodiments, the upper stem is the same nucleo as CGAUACGACAGAAC. Contains a cydoid sequence.

[0084] In some embodiments, the upper stem is a nucleo that is at least about 80% identical to CGCCG. Contains a cydoid sequence. In some embodiments, the upper stem is CGCCG and at least about 85% It contains the same nucleotide sequence. In some embodiments, the upper stem is CGCCG and less They contain at least 90% identical nucleotide sequences. In some embodiments, the upper stem is C It contains a nucleotide sequence that is at least about 80% identical to GCCG. In some embodiments, The stem contains a nucleotide sequence that is at least approximately 95% identical to that of CGCCG. In the application form, the upper stem has a nucleotide sequence that is at least approximately 99% identical to that of CGCCG. Includes. In some embodiments, the upper stem contains the same nucleotide sequence as CGCCG. .

[0085] In some embodiments, the upper stem is at least about 80% identical to CGGCCGC. It contains a rheotide sequence. In some embodiments, the upper stem is CGGCCGC and at least It contains approximately 85% identical nucleotide sequences. In some embodiments, the upper stem is CGGC It contains a nucleotide sequence that is at least about 90% identical to CGC. In some embodiments, the upper The stem contains a nucleotide sequence that is at least approximately 95% identical to CGGCCGC. In this embodiment, the upper stem is a nucleotide that is at least about 99% identical to CGGCCGC. Includes a sequence. In some embodiments, the upper stem is the same nucleotide as CGGCCGC. Includes arrays.

[0086] In some embodiments, the upper stem is a nucleo that is at least about 80% identical to CGCGC. Contains a cydoid sequence. In some embodiments, the upper stem is CGCGC and at least about 85% It contains the same nucleotide sequence. In some embodiments, the upper stem is CGCGC and less They contain at least 90% identical nucleotide sequences. In some embodiments, the upper stem is C It contains a nucleotide sequence that is at least about 95% identical to GCGC. In some embodiments, The stem contains a nucleotide sequence that is at least approximately 99% identical to that of CGCGC. In the application form, the upper stem contains the same nucleotide sequence as CGCGC.

[0087] In some embodiments, the upper stem is made of nucleotide that is at least about 80% identical to CGAU. Includes a D array. In some embodiments, the upper stem is at least about 85% identical to CGAU. It includes the nucleotide sequence of CGAU and at least It contains approximately 90% identical nucleotide sequences. In some embodiments, the upper stem is CGAU It contains a nucleotide sequence that is at least approximately 95% identical to that. In some embodiments, the upper stem It contains a nucleotide sequence that is at least about 99% identical to CGAU. In some embodiments, The upper stem contains the same nucleotide sequence as CGAU.

[0088] In some embodiments, the stem loop includes a GC base pair in the lower stem.

[0089] In some embodiments, the lower stem does not contain a GC base pair.

[0090] In some embodiments, the upper stem does not contain GC base pairs.

[0091] In some embodiments, the upper stem has at least 1, 2, 3, 4, 5, or 6, 7. It contains 8, 9, 10, 11, or 12 GC base pairs. In some embodiments, the stem is , containing at least one GC base pair. In some embodiments, the stem has at least two It contains GC base pairs. In some embodiments, the stem contains at least three GC base pairs. In some embodiments, the stem includes at least four GC base pairs. In this state, the stem contains at least two GC base pairs. In some embodiments, the stem is , containing at least 5 GC base pairs. In some embodiments, the stem has at least 6 It contains GC base pairs. In some embodiments, the stem contains at least seven GC base pairs. In some embodiments, the stem includes at least eight GC base pairs. In this state, the stem contains at least nine GC base pairs. In some embodiments, the stem is , containing at least 10 GC base pairs. In some embodiments, the stem has at least 1 It contains one GC base pair. In some embodiments, the stem contains at least 12 GC bases Includes pairs.

[0092] In some embodiments, the first RNA and the second RNA are ligated by Furthermore, the yield of the total product is at least 60%, 70%, 80%, 90%, or more than 95%. In some embodiments, the first and second RNAs are added to at least 6 of the full-length product. This results in a 0% yield. In some embodiments, the first and second RNAs yield a small amount of full-length product. It yields at least 70% yield. In some embodiments, the first and second RNAs are total This yields at least 80% of the long product. In some embodiments, the first and second R NA yields at least 90% of the total product. In some embodiments, the first The second RNA yields at least 95% of the full-length product. In some embodiments, The first and second RNAs yield over 95% of the full-length product.

[0093] In some embodiments, gRNA is produced in an amount of at least 1 gram.

[0094] In some embodiments, gRNA is at least 5 grams, 10 grams, 20 grams, 3 0 grams, 40 grams, 50 grams, 60 grams, 70 grams, 80 grams, 90 grams , or produced in an amount of 100 grams. Therefore, in some embodiments, gRNA is , is produced in an amount of at least 5 grams. In some embodiments, the gRNA is at least It is produced in an amount of 10 grams. In some embodiments, gRNA is produced in an amount of at least 20 grams. It is produced in an amount of . In some embodiments, gRNA is produced in an amount of at least 30 grams. In some embodiments, gRNA is produced in an amount of at least 40 grams. In some embodiments, gRNA is produced in an amount of at least 50 grams. In this state, gRNA is produced in an amount of at least 60 grams. In some embodiments, g RNA is produced in an amount of at least 70 grams. In some embodiments, gRNA is It is produced in an amount of at least 80 grams. In some embodiments, the gRNA is at least It is produced in an amount of 90 grams. In some embodiments, gRNA is produced in an amount of at least 100 grams. It is produced in quantities corresponding to the amount of mu.

[0095] In some embodiments, gRNA is produced in amounts less than 1 gram.

[0096] In some embodiments, the gRNA is approximately 0.05 grams, 0.1 grams, and 0.2 grams. M, 0.3 grams, 0.4 grams, 0.5 grams, 0.6 grams, 0.7 grams, 0.8 It is produced in amounts of grams, or 0.9 g. In some embodiments, the gRNA is about 0.0 It is produced in an amount of 5 grams. In some embodiments, gRNA is produced in an amount of about 0.1 grams. It is produced. In some embodiments, gRNA is produced in an amount of about 0.2 grams. In some embodiments, gRNA is produced in an amount of approximately 0.3 grams. RNA is produced in an amount of approximately 0.4 grams. In some embodiments, gRNA is approximately 0. It is produced in an amount of 5 grams. In some embodiments, gRNA is produced in an amount of about 0.6 grams. It is produced. In some embodiments, gRNA is produced in an amount of about 0.7 grams. In some embodiments, gRNA is produced in an amount of approximately 0.8 grams. RNA is produced in an amount of approximately 0.9 grams.

[0097] In some embodiments, the method is used for approximately 50%, 60%, 70%, 80%, 90%, or It produces gRNA with a purity of over 90%. In some embodiments, this method produces gRNA with a purity of approximately 50%. This produces gRNA. In some embodiments, this method produces gRNA with a purity of approximately 60%. In some embodiments, this method produces gRNA with a purity of approximately 70%. In some embodiments, this method produces gRNA with a purity of approximately 80%. This method produces gRNA with a purity of approximately 90%. In some embodiments, this method produces gRNA with a purity of 90%. It produces gRNA with a purity exceeding 100%.

[0098] In some embodiments, the first RNA is synthesized in the 3' to 5' direction.

[0099] In some embodiments, the second RNA is synthesized in the 3' to 5' direction.

[0100] In some embodiments, gRNA consists of approximately 100 nucleotides and approximately 125 nucleos Tydo, approximately 150 nucleotides, approximately 175 nucleotides, approximately 200 nucleotides It has a length of 1, or more than about 200 nucleotides. In some embodiments, gRNA has a length of approximately 100 nucleotides. In some embodiments, gRNA It has a length of approximately 125 nucleotides. In some embodiments, the gRNA is approximately 1 It has a length of 50 nucleotides. In some embodiments, the gRNA has about 175 nucleotides. It has the length of a nucleotide. In some embodiments, gRNA has about 200 nucleos It has the length of a nucleo. In some embodiments, the gRNA has more than 200 nucleos It has the length of a chidone.

[0101] In some embodiments, the loops are 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, It contains 14, 15, or 16 nucleotides. In some embodiments, the loop is It contains four nucleotides, also referred to as a tetraloop in the details. In some embodiments, The loop contains five nucleotides. In some embodiments, the loop contains six nucleotides. Includes. In some embodiments, the loop includes seven nucleotides. The loop contains 8 nucleotides. In some embodiments, the loop contains 9 nucleotides. Contains rheotide. In some embodiments, the loop contains 10 nucleotides. In some embodiments, the loop contains 11 nucleotides. In some embodiments, the loop is , containing 12 nucleotides. In some embodiments, the loop contains 13 nucleotides Includes. In some embodiments, the loop includes 14 nucleotides. So, the loop contains 15 nucleotides. In some embodiments, the loop contains 16 nucleotides. It contains the nucleotides.

[0102] In some embodiments, the ligation of the first RNA and the second RNA is in a loop or It occurs at ligation sites that are at least approximately 3 base pairs apart.

[0103] In some embodiments, the ligation portion is 1, 2, 3, 4, 5, 6 from the loop It is located in 10 base pairs. In some embodiments, the ligation site is one base from the loop. These are the paired parts. In some embodiments, the ligation portion is a ligation loop. It consists of two base pairs. In some embodiments, the ligation site is the ligation site. It consists of 3 base pairs from the base. In some embodiments, the ligation site is the ligation site. It consists of 4 base pairs from the ligation site. In some embodiments, the ligation site is It is 5 base pairs from the loop. In some embodiments, the ligation site is ligation It consists of 6 base pairs from the loop. In some embodiments, the ligation site is ligated It consists of 7 base pairs from the loop. In some embodiments, the ligation site is ligation It consists of 8 base pairs from the scholl loop. In some embodiments, the ligation site is ligate The ligation loop consists of 9 base pairs. In some embodiments, the ligation site is ligation It is located 10 base pairs from the gate loop.

[0104] In some embodiments, the first and / or second RNA includes one or more skeletal modifications. .

[0105] In some embodiments, one or more skeletal modifications are 2'O-methyl or phosphorothioate Includes t-modification. Therefore, in some embodiments, one or more skeletal modifications are 2'O-methyl Includes ligature modifications. In some embodiments, one or more skeletal modifications include phosphorothioate modifications. include.

[0106] In some embodiments, one or more skeletal modifications are 2'-O-methyl3'-phosphorothioe 2'O-methyl, 2'-ribo-3'-phosphorothioate, deoxy, or 5'-phosphorothioate Selected from sphate modifications. Therefore, in some embodiments, one or more skeletal modifications. This includes a 2'-O-methyl3'-phosphorothioate modification. In some embodiments, one The above modifications include 2'-ribo3'-phosphorothioate modifications. In some embodiments, One or more modifications include deoxy modifications. In some embodiments, one or more modifications include 5' Includes phosphate modification.

[0107] In some embodiments, one or more modifications are present at the ligation site.

[0108] In some embodiments, one or more modifications are made to the donor RNA and / or acceptor R It is present in NA. Therefore, in some embodiments, one or more modifications are present in the donor RNA. Yes, it exists. In some embodiments, one or more modifications are present in the acceptor RNA. In the embodiment of this part, one or more modifications are present in both the donor and acceptor RNAs. ru.

[0109] In some embodiments, the 3' and / or 5' ends of the donor RNA are located on one or more bones. It has a specific modification. Therefore, in some embodiments, the 3' end of the donor RNA has one or more modifications. It has the above skeletal modifications. In some embodiments, the 5' end of the donor RNA has one or more skeletal modifications. It has modifiers.

[0110] In some embodiments, the 3' and / or 5' ends of the acceptor RNA are one or more It has the above skeletal modification. Therefore, in some embodiments, the 3' end of the acceptor RNA The end has one or more skeletal modifications. In some embodiments, the 5' end of the acceptor RNA The end has one or more skeletal modifications.

[0111] In some embodiments, the concentrations of the first and / or second RNA are approximately 1 g / L to 5 g / L. It is L.

[0112] In some embodiments, the concentration of the fist and / or second RNA is approximately 1 g / L. In some embodiments, the concentration of the first and / or second RNA is approximately 2 g / L. In some embodiments, the concentration of the first and / or second RNA is approximately 3 g / L. In the administered form, the concentration of the fist and / or second RNA is approximately 4 g / L. In this state, the concentration of the first and / or second RNA is approximately 5 g / L.

[0113] In some embodiments, a first RNA containing a phosphate at its 5' end and a variable protozo A composition produced by the method described herein, comprising a second RNA containing a pacer region. The substance is provided, and the first RNA and the second RNA are linked by a non-covalent bond.

[0114] In some embodiments, a first RNA containing a phosphate at its 5' end and a variable protozo A composition produced by the method described herein, comprising a second RNA containing a pacer region. The substance is provided, and the first RNA and the second RNA are bound to the ligase.

[0115] In some embodiments, the ligase is T4 RNA ligase 2.

[0116] In some embodiments, the nucleo is at least approximately 80% identical to CGAUACGACAGAAC. A composition comprising RNA containing a cydoid sequence is provided. In some embodiments, CGAUAC A composition containing RNA with a nucleotide sequence that is at least approximately 85% identical to GACAGAAC. The object is provided. In some embodiments, CGAUACGACAGAAC and at least about A composition is provided that contains RNA having 90% identical nucleotide sequences. In this state, the nucleotide sequence is at least approximately 95% identical to CGAUACGACAGAAC. A composition containing RNA is provided. In some embodiments, CGAUACGACAG A composition is provided that contains RNA having the same nucleotide sequence as AAC.

[0117] In some embodiments, the RN contains a nucleotide sequence that is at least approximately 80% identical to that of CGCCG. A composition containing A is provided. In some embodiments, CGCCG and at least about 85% A composition is provided that contains RNA having the same nucleotide sequence. In some embodiments, A composition containing RNA having a nucleotide sequence identical to CGCCG by at least approximately 90% , provided. In some embodiments, nucleotides identical to CGCCG by at least about 95%. A composition is provided that contains RNA containing a nucleotide sequence. In some embodiments, the nucleotide sequence The column is identical to CGCCG.

[0118] In some embodiments, the nucleotide sequence is at least approximately 80% identical to that of CGGCCGC. A composition containing RNA is provided. In some embodiments, it contains CGGCCGC and at least A composition is provided that contains RNA with approximately 85% identical nucleotide sequences. Morphologically, RNA containing nucleotide sequences identical to CGGCCGC by at least approximately 90% A composition containing is provided. In some embodiments, CGGCCGC and at least about 95% A composition is provided that contains RNA having the same nucleotide sequence. In some embodiments, The nucleotide sequence is identical to that of CGGCCGC.

[0119] In some embodiments, the RN contains a nucleotide sequence that is at least about 80% identical to CGCGC. A composition containing A is provided. In some embodiments, CGCGC and at least about 85% A composition is provided that contains RNA having the same nucleotide sequence. In some embodiments, A composition containing RNA having a nucleotide sequence identical to CGCGC by at least approximately 90% , provided. In some embodiments, nucleotides identical to CGCGC by at least about 95%. A composition is provided that contains RNA containing a nucleotide sequence. In some embodiments, the nucleotide sequence The column is identical to CGCGC.

[0120] In some embodiments, a kit comprising the compositions described herein is provided.

[0121] In some embodiments, a first RNA comprising a trans-activating RNA (tracrRNA) sequence , a second RNA comprising a variable spacer region, and a ligase are provided .

[0122] In some embodiments, the kit comprises T4 RNA ligase 2.

[0123] Definitions To facilitate understanding of the present invention, certain terms are first defined below. Further definitions for the following terms and other terms are set forth throughout this specification.

[0124] a or an: As used herein, the articles "a" and "an" are used herein to refer to one or more than one (i.e., at least one) of the grammatical object of the article. By way of example , "an element" means one element or more than one element.

[0125] Approximately or about: As used herein, the terms "approximately" or "about" , when applied to one or more target values, refer to a value similar to the recited reference value. In certain embodiments , the terms "approximately" or "about" refer to a range of values within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12 %, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less of the recited reference value in either direction (greater or less ) (except when such a numerical value exceeds 100% of the possible values ).

[0126] Related: When the presence, level, and / or form of one correlates with the presence, level, and / or form of the other, the term is used herein, two events or entities are "related" to each other. For example, a particular entity (e.g., a polypeptide) is such that its presence, level, and / or form is (e.g., across a relevant population) correlated with the incidence and / or susceptibility of a disease, disorder, or condition, it is considered to be related to a particular disease, disorder, or condition. In some embodiments, when two or more entities interact directly or indirectly with each other, they are physically proximate to each other and are "related" to each other in such a way as to maintain that. In some embodiments, two or more entities that are physically related to each other are linked to each other by a covalent bond. In some embodiments, two or more entities that are physically related to each other are not linked by a covalent bond, but are related by non-covalent bonds, for example, by hydrogen bonds, van der Waals interactions, hydrophobic interactions, magnetism, and combinations thereof. In some embodiments, two or more entities that interact directly or indirectly with each other are physically proximate to each other and are "related" to each other in such a way as to maintain that. In some embodiments, two or more entities that are physically related to each other are linked to each other by a covalent bond. In some embodiments, two or more entities that are physically related to each other are not linked by a covalent bond, but are related by non-covalent bonds, for example, by hydrogen bonds, van der Waals interactions, hydrophobic interactions, magnetism, and combinations thereof. In some embodiments, two or more entities that are physically related to each other are linked to each other by a covalent bond. In some embodiments, two or more entities that are physically related to each other are not linked by a covalent bond, but are related by non-covalent bonds, for example, by hydrogen bonds, van der Waals interactions, hydrophobic interactions, magnetism, and combinations thereof. In some embodiments, two or more entities that are physically related to each other are not linked by a covalent bond, but are related by non-covalent bonds, for example, by hydrogen bonds, van der Waals interactions, hydrophobic interactions, magnetism, and combinations thereof. The base editor "base editor (BE)" or "nucleic acid base editor (NBE)"

[0127] means an agent that binds to a polynucleotide and has nucleic acid base modification activity. In various embodiments, the base editor includes, in combination with a guide polynucleotide (e.g., guide RNA), a nucleic acid base modifying polypeptide (e.g., deaminase) and a polynucleotide programmable (programmable) nucleotide binding domain. In various embodiments, the agent includes a protein domain having base editing activity, i.e., a domain that can modify a base (e.g., A, T, C, G, or U) within a nucleic acid molecule (e.g., DNA ). In various embodiments, the agent includes a protein domain having base editing activity, i.e., a domain that can modify a base (e.g., A, T, C, G, or U) within a nucleic acid molecule (e.g., DNA ). ). In various embodiments, the agent includes a protein domain having base editing activity, i.e., a domain that can modify a base (e.g., A, T, C, G, or U) within a nucleic acid molecule (e.g., DNA It is a biomolecular complex. In some embodiments, it is polynucleotide programmable DNA. The binding domain is fused to or linked to the deaminase domain. In one embodiment, the drug It is a fusion protein containing one or more domains that have base-editing activity. Another implementation In this state, the protein domain with base editing activity is linked to the guide RNA (for example) However, the RNA-binding motif on the guide RNA and the RNA-binding molecule fused to the deaminase (via the main). In some embodiments, the protein domain having base editing activity is It is possible to deaminate bases within nucleic acid molecules. In some embodiments, a base editor is used. This can deaminate one or more bases within a DNA molecule. In some embodiments, A base editor deaminates cytosine (C) or adenosine (A) within DNA. It is possible. In some embodiments, the base editor can remove cytosine (C) from the DNA. And adenosine (A) can be deaminated. In some embodiments, base eddy The ta is a cytidine base editor (CBE). In some embodiments, the base editor - is an adenosine base editor (ABE). In some embodiments, the base editor - is done using an adenosine base editor (ABE) and a cytidine base editor (CBE). In some embodiments, the base editor is fused with adenosine deaminase. It is a clease-inactive Cas9 (dCas9). In some embodiments, a base editor is used. - is an inhibitor of base excision repair (e.g., UGI domain or dISN domain) They are fused. In some embodiments, the fusion protein is Cas fused to deaminase. 9. Niccase and inhibitors of base excision repair (e.g., UGI domain or dISN domain) In other embodiments, the base editor includes (in) and . It is an editor. Details of the base editor can be found in International PCT Application No. 2017 / 045381. Issues (WO2018 / 027078) and US2016 / 058344 (WO20 As described in 17 / 070632), each of these is referred to in whole by this statement. It is used in books. Also, Komor, AC, et al., “Programmable le editing of a target base in genomic D NA without double-stranded DNA cleavage” Nature 533, 420-424 (2016), Gaudelli, NM, et al., “Programmable base editing of A·T to G·C in genomic DNA without DNA cleavage Nature 551, 464-471 (2017), Komor, AC ,et al.,“Improved base excision repair i nhibition and bacteriophage Mu Gam prote in yields C:G-to-T:A base editors with h igher efficiency and product purity” Sci ence Advances 3:eaao4774 (2017), and Rees, H .A.,et al.,“Base editing: precision chemistry try on the genome and transcriptome of living cells.” Nat Rev Genet. 2018 Dec; 19( 12): 770 - 788. doi: 10.1038 / s41576 - 018 - 0059 - Reference 1 is hereby incorporated by reference in its entirety for all purposes.

[0128] Base editing activity: “Base editing activity” means acting to chemically change a base in a polynucleotide (e.g., by deaminating a base ). In one embodiment, a first base is converted to a second base. In one embodiment, base editing activity is cytidine deaminase activity, e.g., converting a target C·G to T·A. In another embodiment, base editing activity is adenosine or adenine deaminase activity, e.g., converting A·T to G·C. In another embodiment, base editing activity is cytidine deaminase activity, e.g., converting a target C·G to T·A, and adenosine deaminase activity or adenine deaminase activity, e.g., converting A·T to G·C.

[0129] Base editor system: The term “base editor system” refers to a system for editing nucleic acid bases of a target nucleotide sequence. In various embodiments, a base editor (BE) system includes (1) a polynucleotide programmable nucleotide binding domain (e.g., Cas9) for deaminating a nucleic acid base in a target nucleotide sequence, a deaminase domain, and a cytidine deaminase domain, and (2) one or more guide polynucleotides (e.g., guide RNA) in combination with the polynucleotide programmable nucleotide binding domain. In various embodiments, a base editor (BE) system includes (1) a polynucleotide programmable nucleotide binding domain (e.g., Cas9) for deaminating a nucleic acid base in a target nucleotide sequence, a deaminase domain, and a cytidine deaminase domain, and (2) one or more guide polynucleotides (e.g., guide RNA) in combination with the polynucleotide programmable nucleotide binding domain. In various embodiments, a base editor (BE) system includes (1) a polynucleotide programmable nucleotide binding domain (e.g., Cas9) for deaminating a nucleic acid base in a target nucleotide sequence, a deaminase domain, and a cytidine deaminase domain, and (2) one or more guide polynucleotides The system uses nucleic acids selected from adenosine deaminase or cytidine deaminase. It includes a base editor domain and a domain having nucleic acid sequence-specific binding activity. In this embodiment, the base editor system (1) one or more of the target nucleotide sequence Polynucleotide programmable DNA binding domain for deamination of nucleic acid bases A base editor (BE) containing a deaminase domain, and (2) polynucleotides Contains one or more guide RNAs that bind to the rheotide programmable DNA binding domain. In some embodiments, the polynucleotide programmable nucleotide-binding domain is It is a polynucleotide programmable DNA-binding domain. In some embodiments, base The editor is a cytidine base editor (CBE). In some embodiments, the base editor The editor is an adenine or adenosine base editor (ABE). Some implementations In this state, the base editor is an adenine or adenosine base editor (ABE) or It is a cytidine base editor (CBE).

[0130] Biologically active: As used herein, the term "biologically active" means biologically active. This refers to the characteristics of any drug that is active in a biological system, especially in living organisms. For example, in living organisms When administered, a drug that has a biological effect on that organism is biologically active. It is considered that, in certain embodiments, if the peptide is biologically active, the peptide A portion of that peptide that shares at least one biological activity is typically "biological." This is referred to as the "scientifically active" part.

[0131] Crack: When used herein, cracking refers to the CRISPR system as described herein. This refers to the cleavage of a target nucleic acid produced by a nuclease. In some embodiments, this refers to a cleavage event. This is a double-stranded DNA break. In some embodiments, the cleavage event is a single-stranded DNA break. In some embodiments, the cleavage event is a single-stranded RNA break. In some embodiments, The cleavage event is a double-stranded RNA break.

[0132] Complementary: "Complementary" or "complementary" means that nucleic acids are traditionally Watson-Crick or It forms hydrogen bonds with another nucleic acid sequence through either Hoogsteen base pairing. This means that it is possible. Complementary base pairing is GC and AT base pairing. This also includes base pairing with common bases such as inosine. The proportion of complementarity is second nucleic acid molecules that can form hydrogen bonds with the nucleic acid sequence (e.g., Watson-Crick base pairing). This shows the proportion of adjacent residues within a sequence (for example, a second nucleic acid sequence having 10 nucleotides). A total of 10 nucleotide capsules in the first oligonucleotide that form a base pair with it. The 5, 6, 7, 8, 9, or 10 nucleotides of each cell make up 50%, 60%, and 7% of each cell. (Representing 0%, 80%, 90%, and 100% complementarity). In order to determine that the proportion is at least constant, a hydrogen bond is formed with the second nucleic acid sequence (for example) The proportion of adjacent residues in a nucleic acid molecule that can form a Watson-Crick base pair. The result is calculated and rounded to the nearest integer (for example, the second nucleotide with 23 nucleotides). A total of 23 nucleotides in the first oligonucleotide that form base pairs with the nucleic acid sequence. Of the ocides, 12, 13, 14, 15, 16, or 17 nucleotides each These represent 52%, 57%, 61%, 65%, 70%, and 74%, respectively, with less than 1%. (They all have complementarity levels of 50%, 50%, 60%, 60%, 70%, and 70%.) When used in detail, "substantially complementary" means that they are hybrid under biological conditions. This refers to inter-chain complementarity that allows for dilation. Substantially complementary sequences account for 60% of the total number of sequences. They have complementarity of 70%, 80%, 90%, 95%, or even 100%. By examining the nucleotide sequences of the two strands, under biological conditions, Techniques for determining whether or not hybridization is possible are well known in the field. That is the case.

[0133] Clustered Interspersed Short Palindromi c Repeat (CRISPR) related (CAS) systems: as used herein The CRISPR-Cas9 system includes a CRISPR effector, an RNA guide, and CRISPR, including other sequences and sequences encoding transcripts from the CRISPR locus Nucleic acids and / or proteins that are involved in or direct the activity of PR effectors This refers to the substance. In some embodiments, the CRISPR system manipulates the naturally occurring substance. This is a CRISPR system. In some embodiments, the components of the CRISPR system are C Nucleic acids (e.g., vectors) that encode one or more components of a stem, components in protein form , or a combination thereof.

[0134] CRISPR array: The term "CRISPR array" is used in the context of this document. In total, it begins with the first nucleotide of the first CRISPR repeat and the last (terminal) CRI CRISPR repeats and spacers that end at the last nucleotide of an SPR repeat. This refers to a nucleic acid (e.g., DNA) segment containing [a specific component]. Typically, this is found in CRISPR arrays. Each spacer is positioned between two repeats. "CRISPR repeat" or "C The terms "RISPR Direct Repeat" or "Direct Repeat" are used in this document. When used in writing, it shows little to no sequence variation within the CRISPR array. Alternatively, it refers to multiple short direct repeat sequences that are not shown at all.

[0135] CRISPR-related proteins (Cas): "CRISPR-related proteins", "CRI The terms "SPR effector," "effector," or "CRISPR enzyme" are used. When used herein, the enzyme is activated at a target site on nucleic acid identified by the RNA guide. Refers to a protein that performs and / or binds to a protein. In various embodiments, CRISP R effectors exhibit endonuclease activity, nicasse activity, and exonuclease activity. , has transposase activity and / or cleavage activity. In other embodiments, CRI SPR effectors are nuclease-inactive.

[0136] crRNA: The terms "CRISPR RNA" or "crRNA" are defined herein. When used, the CRISPR effector targets specific nucleic acid sequences. This refers to an RNA molecule containing a guide sequence used for target recognition. Typically, crRNA is used for target recognition. It includes a sequence that mediates and a sequence that forms a double strand with tracrRNA. In the application morphology, the crRNA:tracrRNA double strand binds to the CRISPR effector. do.

[0137] Double-stranded: As used herein, “double-stranded” means the interaction of two single-stranded nucleic acids This refers to the double helix structure that is formed by the following process. The two strands are typically arranged antiparallel to each other. Paired hydrogen bonds between bases between two directed single-stranded nucleic acids, i.e., "base pairing," Base pairing in double hemispheres is generally performed by Watson-Crick base pairing. This process is carried out, for example, with guanine (G) and cytosine (C) in DNA and RNA. Forming base pairs, adenine (A) forms base pairs with thymine (T) in DNA, Denine (A) forms a base pair with uracil (U) in RNA. The conditions for obtaining it include physiologically or biologically relevant conditions (e.g., intracellular: pH 7). 2. (140 mM potassium ions, extracellular pH 7.4, 145 mM sodium ions) It includes. Furthermore, the double helix stacks up interactions between adjacent nucleotides. Therefore, it is stabilized. When used herein, the double strand is used for base pairing or interaction. It can be established or maintained by accumulating these. The double helix is ​​substantially phase Formed by two complementary nucleic acid chains that may be complementary or may be perfectly complementary. Single-stranded nucleic acids that form base pairs across several bases undergo "hybridization." It is said that they "do it."

[0138] Exvivo: As used herein, the term “exvivo” refers to the in vivo of a multicellular organism. It refers to events that occur in cells or tissues cultured externally.

[0139] Functional equivalent or analogue: When used herein, “functional equivalent” or “functional equivalent” The term "functional analogue" is used in the context of functional derivatives of amino acid sequences, meaning a derivative of the original sequence. A component that retains substantially the same biological activity (either functional or structural) as its physical activity. The functional derivative or equivalent may be a natural derivative or synthetically produced. They may be manufactured. Exemplary functional derivatives include those in which the biological activity of the protein is conserved. Subject to the condition that, an amino acid having one or more amino acid substitutions, deletions, or additions. The sequence is given. The amino acid to be substituted is preferably chemically similar to the substituted amino acid. It possesses physical properties. Similar desirable chemophysical properties include similarity of charge and bulk. This includes hydrophobic and hydrophilic properties.

[0140] Half-life: As used herein, the term "half-life" refers to the protein concentration or This is the time required for the amount of activity, etc., to decrease to half of the value measured at the beginning of the period. ru.

[0141] Hybridization: "Hybridization" means stringen Under various conditions, complementary polynucleotide sequences (e.g., genes described herein) ) or means forming a double-stranded molecule between parts of it. (For example, Wahl, GMand SL Berger (1987) Methods Enzymol. 152:399, Kimmel, AR (1987) Methods Enzymol See .152:507). "Hybridization" is the process of combining complementary nucleic acid bases. Watson-Crick hydrogen bonds, Hoogsteen hydrogen bonds, or inverse Hoogsteen hydrogen bonds between them. It can be caused by hydrogen bonding. For example, adenine and thymine are hydrogen These are complementary nucleic acid bases that pair up through the formation of bonds.

[0142] To improve, increase, or decrease: When used herein, "improve", The terms “increase” or “decrease,” or their grammatical equivalents, are defined herein. Measurements in the same individual before the start of treatment, or in the absence of the treatment described herein. Values ​​relative to baseline measurements, such as measurements taken on a control object (or multiple control objects). This indicates that the "control subject" is a subject suffering from the same form of disease as the subject being treated. Furthermore, they are roughly the same age as the patients being treated.

[0143] Indel: As used herein, the term "indel" refers to a nucleic acid sequence. This refers to the insertion or deletion of a base. It generally results in a mutation and is a common genetic variation. It is in that form.

[0144] Inhibition: As used herein, means "to inhibit," "to inhibit," and "to inhibit." The term refers to reducing or lowering the activity and / or expression of a target protein or gene. This refers to a process or method of reducing something. Typically, it involves inhibiting a protein or gene. This is done by one or more methods described herein or recognized in the art. The measured protein or gene expression or related activity is at least 10% or more. For example, 20%, 30%, 40%, or 50%, 60%, 70%, 80%, 90% Or reducing it by more than 1, or by 2, 3, 4, 5, 1 This refers to a decrease in expression or related activity of 0x, 50x, 100x, or more.

[0145] In vitro: As used herein, the term “in vitro” refers to the in vitro of a multicellular organism. Rather, it occurs in artificial environments, such as in test tubes or reaction vessels, or in cell cultures. It refers to an event or phenomenon.

[0146] In vivo: As used herein, the term “in vivo” refers to both human and non-human organisms. This refers to events that occur within multicellular organisms such as animals. In the context of cell-based systems, this term is used. The term is used to refer to events that occur within living cells (as opposed to, for example, in an in vitro system). It can be used.

[0147] Oligonucleotide: As used herein, the term “oligonucleotide” Generally, a single-stranded or double-stranded DNA polynucleotide consists of approximately 5 to 100 nucleotides. This refers to oligonucleotides. Oligonucleotides are also known as "oligomers" or "oligos." They may be isolated from genes or chemically synthesized.

[0148] PAM: The term "PAM" or "Protospacer Adjacent Motif" is used in CRIS. Short segments following nucleic acid regions targeted for cleavage by the CRISPR system, such as PR-Cas9. It refers to a nucleic acid sequence (usually 2-6 base pairs long). Cas nuclease cleaves it. PAM may be required, generally 3-4 nucleotides below the cleavage site. Discovered by the flow.

[0149] Polypeptide: The term "polypeptide" as used herein means peptide. This term refers to a continuous chain of amino acids linked together by bonds. Although used to refer to acid chains, those skilled in the art will know that the term is not limited to long chains, but also to peptide bonds. Understand that it can refer to the smallest chain containing two amino acids linked together. It is likely that, as is known to those skilled in the art, polypeptides can be processed and / or modified. As used herein, the terms “polypeptide” and “peptide” are interchangeable. It is used.

[0150] To prevent: As used herein, the terms “to prevent” or “prevent” mean “disease.” When used in connection with the occurrence of illness, disability, and / or condition, disease, disability, and / Alternatively, it refers to reducing the risk of developing a condition.

[0151] Prime Editing Guide RNA: "Prime Editing Guide RNA" or "pegRNA" The term refers to both identifying the target site and coding the desired edit. This refers to the type of guide RNA. Prime editing guide RNA (pegRNA) is used in this technology. It is known in the field, and previously, for example, Anzalone AV, “Search h-and-replace genome editing without dou ble-strand breaks or donor DNA”Nature.20 19 Oct 21.doi:10.1038 / s41586-019-1711-4 It is described herein, and its entirety is incorporated herein by reference.

[0152] Protein: The term "protein" as used herein refers to individual units and It refers to one or more polypeptides that function together. A single polypeptide is an individual functional unit. and permanent or temporary physical interactions with other polypeptides to form individual functional units. When no association is required, the terms "polypeptide" and "protein" are interchangeable. It can be used for: Individual functional units, one or more polypeptides that physically associate with each other. When it consists of, the term "protein" is used as a physically coupled individual unit. This refers to multiple polypeptides that function together.

[0153] Reference: The entity, system, quantity, set of conditions, etc. of "reference" are as described herein. This refers to the actual nature of the test, the system, the quantity, the set of conditions, etc. For example, some In the embodiment, the “reference” antibody is a control antibody that has not been manipulated as described herein. ru.

[0154] RNA guide: The term RNA guide refers to the target nucleic acid of the protein described herein. This refers to RNA molecules that promote targeting. An example is an "RNA guide" or "guide R". "NA" refers to crRNA, or crRNA combined with a related tracrRNA. These are some examples, but are not limited to these. The latter may be an independent RNA, and These may be fused as a single RNA using a linker (sgRNA). Some implementations Morphologically, RNA guides are manipulated to include chemical or biochemical modifications, and some actual In its application form, the RNA guide may contain one or more nucleotides.

[0155] Sprint: The term "sprint" refers to at least two, three, or more sprints. Single-stranded RNA nucleotides can hybridize with single-stranded RNA. 'k' refers to DNA or other polymers.

[0156] Target: The term "target" as used herein refers to a diagnosis, prognosis, or treatment. It means any desired object. For example, the object could be a mammal, such as a human or a non-human. Primates (such as apes, monkeys, orangutans, or chimpanzees), dogs, cats, guinea pigs Mot, rabbit, rat, mouse, horse, cattle, or cow It is possible.

[0157] sgRNA: "sgRNA", "single guide RNA", or "guide RNA" The terms (i) guide sequence (crRNA sequence) and (ii) Cas9 nuclease This refers to a single guide RNA containing a recruiting sequence (tracrRNA).

[0158] Substantial Identity: The term "substantial identity" refers to the comparison between amino acid or nucleic acid sequences. As used herein, the two sequences are generally If the corresponding residues are identical, they are considered "substantially identical." As is well known in the art, amino acid or nucleic acid sequences are among various algorithms. It can be compared using either of the following, which is BLASTN for nucleotide sequences. And for amino acid sequences, see BLASTP, gapped BLAST, and PSI- This includes those available in commercially available computer programs such as BLAST. The program is Altschul, et al., Basic local alig nment search tool, J.Mol.Biol.,215(3):403 -410, 1990, Altschul, et al., Methods in Enz ymology, Altschul et al., Nucleic Acids Re s.25:3389-3402,1997, Baxevanis et al.,Bio informatics:A Practical Guide to the Ana lysis of Genes and Proteins, Wiley, 1998, Misener, et al., (eds.), Bioinformatics M Methods and Protocols(Methods in Molecule) In r Biology, Vol.132), Humana Press, 1999 It is described. In addition to identifying identical sequences, the above program is typically , providing an indicator of the degree of identity. In some embodiments, two sequences are the same as the corresponding residues. At least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% , 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or so If the above are identical across a related sequence of residues, they are considered substantially identical. It is done. In some embodiments, the related sequence is a complete sequence. In this state, the related sequence is at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125 , 150, 175, 200, 225, 250, 275, 300, 325, 350, 375 These are 400, 425, 450, 475, 500 or more residues.

[0159] Targeted nucleic acid: The term "targeted nucleic acid" as used herein refers to CRISPR-C The as9 system can bind nucleotides of any length (onucleotides or polynucleotides). Cleotides, deoxyribonucleotides, ribonucleotides, or analogs thereof It refers to either one. The target nucleic acid may contain a coding region or a non-coding region. They may have a dimensional structure, including exons, introns, mRNA, tRNA, rRNA, and siRNA. shRNA, miRNA, ribozyme, cDNA, plasmid, vector, exogenous sequence , may include endogenous sequences. Target nucleic acids include modified nucleotides, methylated nucleotides. It may contain ocides or nucleotide analogs. The target nucleic acid is dispersed together with non-nucleic acid components. It may be used. The target nucleic acid is single-stranded, double-stranded, or multi-stranded DNA or RNA, Nomu DNA, cDNA, DNA-RNA hybrids, or purines and pyrimidine salts A base, or other natural, chemically or biochemically modified, unnatural, or derivative. Polymers containing nucleotide bases, but not limited to these.

[0160] Therapeutic dose: As used herein, the term “therapeutic dose” refers to any medically effective dose. A therapeutic molecule that provides a therapeutic effect to the target being treated with a reasonable benefit / risk ratio applicable to the treatment. For example, this refers to the amount of the manipulated antibody described herein. The therapeutic effect may be objective. (i.e., measurable by some test or marker), or subjective It is possible (i.e., the subject provides an indicator of the effect or makes the effect felt). In particular, "treatment An "effective dose" refers to a dose that improves symptoms associated with a disease, or prevents or delays the onset of the disease. By reducing the severity or frequency of the symptoms of the disease, Effective in treating, improving, or preventing a specific disease or condition, or in detecting This refers to the amount of therapeutic molecule or composition that is effective in demonstrating a possible therapeutic or preventive effect. The therapeutically effective dose may be administered in a drug regimen that may include multiple unit doses. For therapeutic molecules, the effective therapeutic dose (and / or the appropriate unit dose within an effective dosing regimen) ) may vary depending, for example, on the route of administration and in combination with other drugs. Also, any specific The specific therapeutically effective dose (and / or unit dose) for the target of the disorder being treated is The severity of the disability; the activity of the specific drug used; the specific composition used; the age of the target person. , weight, general health, sex and diet; administration time of the specific therapeutic molecule used, administration period Pathways, and / or excretion or metabolic rate; duration of treatment; and similar methods known in the medical field. It can depend on various factors, including those mentioned above.

[0161] tracrRNA: Also known as "tracrRNA" or "trans-activated crRNA". When used herein, the term refers to the targeted nucleic acid identified as a CRlSPR-related protein. This refers to RNA containing sequences that form the structure necessary for binding to a substance.

[0162] Treatment: As used herein, “treatment” (also “to treat” or “to treat”) The term ) refers to one or more symptoms or characteristics of a particular disease, disorder, and / or condition. To partially or completely alleviate, improve, reduce, inhibit, or delay the onset of the disease, or to reduce the severity of the disease, Therapeutic molecules that reduce the incidence of these (e.g., CRISP as described herein) This refers to any administration of the R-Cas therapeutic protein or system. Such treatment is related to Subjects who do not show signs of the disease, disorder, and / or condition, and / or disease, disorder It may be an object that only shows early signs of harm and / or a condition. Alternative or additional In addition, such treatment may be associated with one or more established diseases, disorders, and / or conditions. It may also be something that shows signs. [Brief explanation of the drawing]

[0163] The drawings are for illustrative purposes only, not for limitation.

[0164] [Figure 1] This is a schematic diagram illustrating the standard chemical synthesis of synthetic RNA. Synthetic RNA is typically synthesized via sequence-controlled polymerization on a solid support. Chemical synthesis is carried out in cycles, each containing various steps, as shown in the schematic diagram in Figure 1. [Figure 2] This is a general schematic diagram showing sgRNA interacting with a target DNA sequence. The schematic diagram shows various motifs present in sgRNA, including the stem-loop consisting of a spacer region, lower stem, tetraloop, and bulge region, the nexus motif, and a series of hairpin motifs. [Figure 3] Panel A shows two common approaches for sgRNA synthesis using ligation-based methods. In the first approach (1), ligation occurs at the loop portion of the stem-loop. In the second approach (2), ligation occurs at the helix of the stem-loop. In each approach, the stem-loop is extended and used to assemble sections for enzymatic ligation. Panel B in Figure 3 shows a schematic HPLC graph showing the separation between RNA fragments and the gRNA produced by ligating those fragments, represented by peaks. After ligation, a final purification step is performed using HPLC to remove unligated RNA fragments. Complete separation of RNA fragments from the full-length product (FLP) is possible. [Figure 4]This is a schematic diagram illustrating a typical click chemical reaction used in drug synthesis. Previous methods employed chemical ligation, which uses "click chemistry" to combine RNA fragments into full-length sgRNA. [Figure 5] Panels A-C show various substrates used for enzymatic ligation. Panel A in Figure 5 shows two RNA oligos associated with a sprint. In this scenario, the nick (e.g., the junction between the first and second RNAs) is sealed by the ligase, resulting in a native phosphodiester skeletal linkage. Panel B in Figure 5 shows two RNA oligos that have partial complementarity with each other and form a stem-loop structure by base-pairing together. Enzymatic ligation can be carried out with high efficiency in the loop section of the stem-loop. Panel C in Figure 5 shows two RNAs that base-pair with the sprint. Ligation can be carried out in various RNA associations and may not require prior association. [Figure 6]Panel A shows the most commonly used sgRNAs and their associated sequences and structures. Panel B in Figure 6 shows two representative RNA sequences and associated ligation sites for loop ligation. Panel C in Figure 6 shows two representative RNA sequences and ligation sites for helix ligation. The sequences are as follows: Panel A: XXXXXXXXXXXXXXXXXXXXGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGGACCGAGUCGGUGCAGACUUCUCCACAGGAGUCAGGUGCAC Panel B: XXXXXXXXXXXXXXXXXXXXGUUUUAGAGCUAUGCUGUCUUGCUCGA pUACAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU Panel C: XXXXXXXXXXXXXXXXXXXXGUUUUAGAGCUAUGCUGU pCUUGGAAACAAGACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU X is any nucleotide, and "p" indicates a free phosphate where the RNA is not covalently linked, as shown in the diagram. [Figure 7]Panel A shows the sequences of the fragments used in the ligation experiment. Both acceptor and donor sequences are shown. Base codes: A, adenosine; G, guanosine; U, uridine; C, cytidine; mU, 2'-O-methyl-adenosine; mC, 2'-O-methyl-uridine; mC, 2'-O-methyl-cytidine; pC, 5'-phosphorylated cytidine. Panel B shows the proposed structure of the pre-ligated complex. Acceptor and donor sequences are shown, corresponding to the acceptor and donor sequences shown in Figure 7 Panel A. Phosphates are represented as circles. Panel C shows a chromatogram showing: 1, acceptor fragment; 2, donor fragment; 3, product of the reaction between the acceptor and donor fragments in T4 RNA ligase 2. The reaction was carried out at 37°C using a 10 μM donor fragment, a 10 μM acceptor fragment, 40 μL of 1×T4 RNA ligase 2 reaction buffer (NEB), and 20 units of T4 RNA ligase 2. [Figure 8] Panel A shows RNA fragment designs for RNA donor 1 (Dnr-01), RNA acceptor 1 (Acp-01), and ligation complexes. The Dnr-01 and Acp-01 sequences are shown in Table 4. The letter "P" indicates the phosphate and ligation locations. Panel B in Figure 8 shows HPLC chromatograms of the reaction between Acp-1 and Dnr-1 with and without T4 RNA ligase 2. "FLP" stands for "full-length product". [Figure 9] Panel A shows the RNA fragment designs for RNA acceptor 2 (Acp-02), RNA donor 2 (Dnr-02), and the ligation complex. The letter "P" indicates the phosphate and ligation locations. Panel B in Figure 9 shows the HPLC chromatograms of the reaction between Acp-02 and Dnr-02 with and without ligase T4 RNA ligase 1. The sequences of Acp-02 and Dnr-02 are shown in Table 4. "FLP" stands for "full-length product". [Figure 10]Panel A shows RNA fragment designs for RNA acceptor 3 (Acp-03), RNA acceptor 3 (Dnr-03), and the ligation complex. The letter "P" indicates the location of the phosphate and ligation sites. Panel B in Figure 10 shows HPLC chromatograms of the reaction between Acp-03 and Dnr-03 with and without T4 RNA ligase 2. Panel C in Figure 10 shows fragment designs for RNA acceptor 4 (Acp-04), RNA donor 4 (Dnr-04), and the ligation complex. The letter "P" indicates the location of the ligation site. Panel D in Figure 10 shows HPLC chromatograms of the reaction between RNA acceptor 4 (Acp-04) and RNA donor 4 (Dnr-04) with and without T4 RNA ligase 2. The sequences of Acp-03 and Dnr-03 are shown in Table 4. "FLP" stands for "Full-length product". [Figure 11] Panel A shows RNA fragment designs for RNA acceptor 5 (Acp-05), RNA donor 5 (Dnr-05), and the ligation complex. The letter "P" indicates the location of the ligation site. Panel B in Figure 11 shows HPLC chromatograms of the reaction between Acp-05 and Dnr-05 with and without ligase 2. Panel C in Figure 11 shows RNA fragment designs for RNA acceptor 6 (Acp-06), RNA donor 6 (Dnr-06), and the ligation complex. The letter "P" indicates the location of the ligation site. Panel D in Figure 11 shows HPLC chromatograms of the reaction between Acp-06 and Dnr-06 with and without T4 RNA ligase 2. The sequences of Acp-05 and Dnr-05 are shown in Table 4. The letter "P" indicates the location of the ligation site. "FLP" stands for "Full-length product". [Figure 12]Panel A shows fragment designs for RNA acceptor 7 (Acp-07), RNA donor 7 (Dnr-07), and the ligation complex. The letter "P" indicates the location of the ligation site. Panel B in Figure 12 shows HPLC chromatograms of the reaction between Acp-07 and Dnr-07 with and without T4 RNA ligase 2. The sequences of Acp-07 and Dnr-07 are shown in Table 4. "FLP" stands for "full-length product". By-products produced in the reaction are labeled with "*". [Figure 13] This graph shows the reaction yield ("FLP") as a function of the starting fragment concentration (g / L). For these studies, RNA acceptor 5 / RNA donor 5 (Acp / Dnr-05) and RNA acceptor 6 / RNA donor 6 (Acp / Dnr-6) were used. "FLP" represents the "full-length product". [Figure 14] Panel A shows fragment designs for extensively modified fragments: RNA acceptor 8 (Acp-08), RNA donor 8 (Dnr-08), and the ligation complex. The Acp-08 and Dnr-08 sequences are shown in Table 4. Highlighted / shaded nucleotides in Panel A indicate the location of 2O-methyl modification. The letter "P" indicates the location of the ligation site. Panel B in Figure 14 shows HPLC chromatograms of these reactions. The letter "P" indicates the location of the phosphate and ligation. Panel B in Figure 14 shows chromatograms from the reactions in the presence (solid line) and absence (dotted line) of ligase (T4 RNA ligase 2). "FLP" represents the full-length product. [Figure 15] This graph shows the percentage of editing in fibroblasts using one of three guide RNAs (AD-08, AD-05, AD-06) synthesized using an adenine base editor (ABE) and an autotemplated ligation method. [Figure 16]This is a schematic diagram showing the sequence and secondary structure of the bhCas12b sgRNA of Bacillus hisashii. The diagram shows regions labeled "A," "B," and "C" that represent hairpin loop structures that can be targeted as sites for sgRNA splitting. The letter "N" in the sequence represents any nucleic acid base. [Modes for carrying out the invention]

[0165] The present invention provides a method for producing synthetic RNA. Any synthetic RNA can be produced by the method described herein. RNA can be produced. For example, in some embodiments, the provided ligation The method, in particular, involves Cas9, Cpf1, SaCas, Cas12, Cas13, and bases. Used with site-directed modification polypeptides such as editors and prime editors. When this occurs, it is useful for modifying a specific gene locus in target DNA or RNA. It can be used for the production of doRNA (gRNA). Surprisingly, the inventors have found that it has high purity. RNA fragmentation results in the production of gRNA with integrity and final (post-purification) yield. We discovered a method to produce gRNA from a single piece of tissue.

[0166] Various aspects of the present invention are described in detail in the following sections. Use of these sections is permitted. This invention is not intended to limit itself. Each section may be used in any aspect of the invention. It may be applied. In this application, the use of "or" means, unless otherwise specified, It means "and / or".

[0167] Guide RNA (gRNA) gRNA contains a polynucleotide sequence complementary to the target sequence. The sequence hybridizes, enabling sequence-specific binding of the CRISPR complex to the target nucleic acid. It directs. In some embodiments, the RNA guide is 50% or 60% relative to the target nucleic acid sequence. 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% , or they have 100% complementarity.

[0168] In some embodiments, the gRNA of the present invention has approximately 50 to 250 nucleotides. It is a rheotide. Therefore, in some embodiments, the gRNA of the present invention is about 50, 55 , 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115 , 120, 125, 130, 135, 140, 145, 150, 155, 160, 165 , 170, 175, 180, 185, 190, 195, 200, 205, 210, 215 , 220, 225, 230, 235, 240, 245, or 250 nucleotide lengths In some embodiments, the gRNA is about 50-75 nucleotides long. In the application form, the gRNA is approximately 75-100 nucleotides long. In some embodiments, gRNA is approximately 100-125 nucleotides long. In some embodiments, gRNA is It is approximately 125-150 nucleotides long. In some embodiments, the gRNA is approximately 150 It is approximately 175 nucleotides long. In some embodiments, the gRNA is about 175-200 nucleotides long. This is the creotide length. In some embodiments, the gRNA is approximately 200-225 nucleotides. It is long. In some embodiments, gRNA is about 225–250 nucleotides long. In some embodiments, gRNA is referred to as "prime editing guide RNA" or "pegRNA". " Anzalone et al., Nature, 2019 Oct 21 Please refer to the relevant document, the contents of which are incorporated herein by reference.

[0169] In some embodiments, gRNA is ligated crRNA and tracr It contains RNA. Various crRNA and tracrRNA sequences are known in the art. Yes, for example, some Type II CRISPR-Cas9 systems (e.g., W O2013 / 176772), Cpf1, SaCas, Cas12, and Prime Editing This is related to Cas.

[0170] gRNAs can be designed to target any target sequence. Optimal alignment This is the Needleman-Wunsch algorithm, Smith-Waterman algorithm Lugorism, Burrows-Wheeler algorithm, ClustlW, Clus Distribution including tlX, BLAST, Novoalign, SOAP, Maq and ELAND This is determined using any algorithm for aligning columns.

[0171] In some embodiments, the gRNA is designed to target specific target sequences within the cell's genome. It is designed to be such. In some embodiments, the gRNA is designed to lack a PAM sequence. In some embodiments, the gRNA sequence is folded, including mFold or Geneious The algorithm is used to design the structure to have an optimal secondary structure. So, gRNA expression is influenced by inducible promoters, for example, hormone-inducible, tetracycline It can be phosphorus or doxycycline-inducible, arabinose-inducible, or photo-inducible. ru.

[0172] In some embodiments, the gRNA sequence forms a complex with a CRISPR-related protein. "Dead crRNs" that can bind to specific targets without any substantial nuclease activity. A is a "dead guide" or a "dead guide array".

[0173] In some embodiments, the gRNA is chemically modified in the sugar phosphate backbone or base. In some embodiments, gRNA improves nuclease resistance or base pairing. To do this, one or more of the following modified nucleic acids are used: 2'O-methyl, 2'-F, or lock nucleic acid. It has. In some embodiments, the gRNA is 2-thiouridiene or N6-methyladene It may contain modified bases such as nosine.

[0174] In some embodiments, gRNA is a other oligonucleotide, peptide, protein, It is conjugated with tags, dyes, or polyethylene glycol.

[0175] In some embodiments, gRNA binds to specific target molecules due to its three-dimensional structure. Contains a ptamer or riboswitch sequence.

[0176] In some embodiments, the loop-forming sequence has a nucleotide length of 3, 4, 5 or more. In some embodiments, the loop is an array GAAA, AAAG, CAAA and / or or has AAAC.

[0177] In some embodiments, the gRNA has two, three, four, or five hairpins.

[0178] In some embodiments, the gRNA is a transcription terminus containing a polyT sequence comprising six nucleotides. Includes a ligature sequence.

[0179] Production of synthetic guide RNA This specification describes a method for producing synthetic RNA, such as guide RNA (gRNA). The method described produces synthetic RNA, such as gRNA, with high integrity and yield.

[0180] The ligation strategies described herein are for synthesizing synthetic RNA such as gRNA. Unlike previously reported chemical ligation strategies, the strategy described here is ligation The segment forms natural phosphate links at the site of the segment. (As described herein) The advantage of using a mentmented synthetic approach is that, compared to full-length gRNA, RNA The advantage is that shorter sections can be produced with higher purity after purification. This approach allows for the production of shorter sections with higher purity. The 5' acceptor is the smallest RNA fragment (approximately 30-50 nt), and therefore, It can be purified to a high level before saturation. The 3' donor is the phosphate required for synthesis. It is terminated with a gate, and therefore only the full-length fragment is incorporated into the full-length product (i.e., (Truncations are not suitable substrates.)

[0181] Consider gRNAs exceeding 100 nt, such as pegRNA or Cas12b guide. In some cases, the advantages of the methods described herein are increased. Enzyme ligation described herein This type has a very high yield (>80%), and oligonucleotide starting materials are high It can be selectively separated from the ligated product, and the full-length product is very pure. We guarantee that these types of enzymatic ligation are relatively inexpensive and scalable. It's easy.

[0182] Self-templated approach for producing synthetic gRNA In some embodiments, the method for producing synthetic gRNA includes: a complementary first The present invention provides a second RNA, and the complementarity is the base between the first and second RNAs. To provide a means to enable pair formation and stem-loop fabrication; using a ligation enzyme The first and second RNAs are ligated within the stem-loop, thus synthesizing gR To produce NA. This creates a helix between the first RNA and the second RNA. Using a template or other structure, enzymatic ligation of two RNAs is performed. This makes it possible to transform between the first RNA and the second RNA. The length and sequence composition of the structures formed promote non-covalent association, and RNA ligator It is modified to create the optimal ligation site for the enzyme that is compatible with the formulation.

[0183] Complementarity is the partial or complete relationship between the sets of nucleotides of the first and second RNAs. It could be any of the following. Complementarity allows for base pairing between complementary nucleotides. Partial phase In regions where complementarity exists, mismatched nucleotides are involved with the first RNA molecule and the second RNA molecule. This will result in the formation of a bulge or loop structure between the RNA molecule and the first RNA molecule. Based on hybridization between the first RNA molecule and the second RNA molecule, the first RNA molecule and Various structures can be formed between the first RNA molecule and the second RNA molecule. Figure 2 shows an example structure that can be formed between two RNA molecules. Ligations are stems, helices, loops, overhangs, blunt ends, or burls. This can occur in Ruzi.

[0184] Using this approach, the first RNA is ligated by one of several ligases. The 3' end (called the acceptor) of the second RNA containing the protospacer region It is synthesized with a phosphate at the 5' end that is eregged (called the donor).

[0185] In some embodiments, two or more RNA fragments are used with this approach to ligate It is performed. For example, in some embodiments, 2, 3, 4, 5, 6, 7, 8, 9, 10 Or more RNA fragments ligate using a self-template approach Therefore, in some embodiments, a self-templated RNA that produces synthetic RNA is used. The approach is to provide two or more RNA fragments and to provide parts to the two or more RNA fragments. To provide oligonucleotides having partial complementarity, The complementarity of provides that base pairing with two or more RNA fragments is possible, and two This provides a ligase for catalyzing ligation between the above RNA fragments, and therefore This includes producing guide RNA.

[0186] Various ligases can be used in conjunction with the methods described herein. For example, T 4 RNA ligase 1, T4 RNA ligase 2, RtcB ligase, heat-stable 5'Ap p DNA / RNA ligase, ElectroLigase, T4 DNA ligase, T 3 DNA ligase, T7 DNA ligase, Taq DNA ligase, SplintR Ligase E. coli DNA ligase, 9°N DNA ligase, CircLigas e, CircLigase II, DNA ligase I, DNA ligase III, and D One or more of NA ligase IV may be used. In some embodiments, T4 R NA ligase 1 ligates the first and second RNAs at the terminal loop. It is used for the following purpose. In some embodiments, T4 RNA ligase 2 is used for the first RNA Within the stem formed between the first RNA and the second RNA, the first RNA and the second RNA are separated into a ligament. It is used for compression.

[0187] Lige within the hairpin terminal loop formed between the first RNA and the second RNA. Various types of ligation, such as tions, are possible using this approach. 4 Various ligases such as RNA ligase 1 are involved in the formation of the hairpin terminal loop. It is suitable for ligation. Another type of ligation possible with this approach is the first This is an intra-double-stranded ligation formed between the first RNA and the second RNA. T4 R Various ligases, such as NA ligase 2 and DNA ligase, are formed between two RNAs. It is suitable for ligation of double-stranded fibers.

[0188] In some embodiments, the first RNA is a transactivating RNA (tracrRNA). Yes, the second RNA is clustered regularly interspersed. sed short palindromic repeat(CRISPR)RNA( It is crRNA.

[0189] In some embodiments, the first RNA is approximately 10 to 100 nucleotides long. Therefore, in some embodiments, the first RNA is approximately 10 to 25 nucleotides long. In some embodiments, the first RNA is approximately 25-40 nucleotides long. In this state, the first RNA is approximately 40-45 nucleotides long. In some embodiments, RNA 1 is approximately 45-60 nucleotides long. In some embodiments, the first RNA It is approximately 60-75 nucleotides long. In some embodiments, the first RNA is approximately 75 It is approximately 90 nucleotides long. In some embodiments, the first RNA is about 90-100 nucleotides long. He is the head of the Cleotide.

[0190] In some embodiments, the second RNA is approximately 10 to 100 nucleotides long. Therefore, in some embodiments, the second RNA is approximately 10 to 25 nucleotides long. In some embodiments, the second RNA is approximately 25-40 nucleotides long. In this state, the second RNA is approximately 40-45 nucleotides long. In some embodiments, RNA 2 is approximately 45-60 nucleotides long. In some embodiments, the second RNA It is approximately 60-75 nucleotides long. In some embodiments, the second RNA is approximately 75 It is approximately 90 nucleotides long. In some embodiments, the second RNA is about 90-100 nucleotides long. He is the head of the Cleotide.

[0191] Sprint template approach in synthetic RNA production In some embodiments, the sprint is used for the production of synthetic RNA. The purpose is to use a sprint as a template to generate one or more RNA molecules for the reaction. Allows for physical proximity. If more than two RNAs bind, split The use of this product promotes the production of synthetic RNA.

[0192] The sprint is any suitable polymer that can bring one or more RNA molecules into close proximity. This may be the case. For example, in some embodiments, the sprint is an RNA molecule or a DNA molecule. That is the case.

[0193] In some embodiments, the sprint is a section of the first RNA and the second RNA It has complementarity with n. This complementarity can be partial or complete. In some embodiments, a method for producing synthetic RNA such as guide RNA is provided. To provide a first RNA containing a 5' phosphate and a free 3'-hydroxyl group To provide a second RNA and to partially complement the first and second RNAs. To provide oligonucleotides having properties, wherein the complementarity of oligonucleotides , providing, enabling base pairing of the first and second RNAs, and the first RNA and It provides a ligase for catalyzing ligation with a second RNA, and therefore g This includes producing RNA.

[0194] In some embodiments, the sprint is coupled with a first RNA and a second R It is not complementary to the NA section. Therefore, in some embodiments, the guide A method for producing synthetic RNA such as RNA is provided, and a first RN containing a 5' phosphate is provided. To provide A, and to provide a second RNA containing free 3'-hydroxyl, and It has complementarity with the nucleotides of the first and second RNAs that are plucked. To provide oligonucleotides that do not exist, and to provide ligaments between the first RNA and the second RNA. It provides a ligase for catalyzing the process, and therefore produces gRNA. include.

[0195] Non-templated approaches for producing synthetic RNA In some embodiments, a non-templated approach is used, such as guide RNA. It produces synthetic RNA.

[0196] In some embodiments of the non-templated approach, 5' phosphate (5' monophosphate) A first RNA is provided that has a phosphate group (etc.), and the blocked 3' end (blocked A second RNA is provided that contains (such as a blocked 3'OH). The 3'OH of the second RNA is blocked. The purpose of this is to allow ligation to occur through untemplated mechanisms. The goal is to prevent the second RNA from cyclizing. For example, this non-temp Using the rateing approach, the 3' hydroxyl at the 3' end of the donor molecule is chemically The second R contains those that have been blocked or removed (e.g., dideoxynucleotides) It can contain NA, and enzymes (especially T4 RNA ligase 1) can be used with the first RNA and It catalyzes proper ligation with the second RNA. In some embodiments, this ligation The gation strategy will be implemented at a high level.

[0197] Therefore, in some embodiments, non-templated approaches that produce synthetic RNA are, To provide a first RNA containing a 5'-monophosphate and a blocked 3' end. To provide a second RNA containing and the ligase between the first RNA and the second RNA The invention provides a ligase for catalyzing a reaction, and thus produces gRNA, and includes .

[0198] Chemically modified RNA In some embodiments, the first RNA and / or the second RNA have a backbone or This includes chemical modifications to one or more of the bases. For example, chemically modified RNA is This may include chemical synthesis and modified sugars, bases, and skeletons that are not similar to natural nucleotides. It can be used to introduce highly modified monomers containing functional groups. .

[0199] Therefore, in some embodiments, the first RNA and / or the second RNA are modified. It contains the modified base. In some embodiments, the modified RNA contains the following: 2-methoxy Toxy A, 2-methoxyethoxy MeC, 2-methoxyethoxy G, 2-methoxyethoxy Contains one or more 2'-O-methoxyethyl bases (2'-MOEs), such as C-T. Other modified bases include, for example, 2'-O-methylRNA bases and fluorobases. It includes various fluorobases, for example, fluoroC, fluoroU, and fluoro. This includes Oro-A and Fluoro-G bases. Various 2'O-methyl modifications are also described herein. It can be used in conjunction with the following methods. For example, a method containing one or more of the following 2'O methyl modifications. The RNA below can be used with the method described: 2'-OMe-5-methyl- rC, 2'-OMe-rT, 2'-OMe-rI, 2'-OMe-2-amino-rA, A Minorinka-C6-rC, Aminolinker-C6-rU, 2'-OMe-5-Br-r U, 2'-OMe-5-I-rU, 2'OMe-7-deaza-rG.

[0200] In some embodiments, the first RNA and / or the second RNA are modified as follows, phosphatid One or more of the following: holothioate, 2'O-methyl, 2'fluoro(2'F), DNA include.

[0201] In some embodiments, the first RNA and / or the second RNA have 3' and 5' ends. It includes a 2'OMe modification at the end.

[0202] In some embodiments, the first RNA and / or the second RNA are among the following modifications. Contains one or more of the following: 2'-O-2-methoxyethyl (MOE), loc nucleic acid, cross-linked nucleic acid, Unlocked nucleic acids, peptide nucleic acids, morpholino nucleic acids.

[0203] In some embodiments, the first RNA and / or the second RNA have the following base modifications Contains one or more of the following: 2,6-diaminopurine, 2-aminopurine, pseudouracil N1-methyl-pseudracil, 5'methylcytosine, 2'pyrimidinone (Zebrali N), Chimin.

[0204] Other modified bases include, for example, 2-aminopurine, 5-bromo dU, and deoxyuri. Zin, 2,6-diaminopurine (2-amino-dA), dideoxy-C, deoxyinosyl n, hydroxymethyl dC, inverted dT, iso-dG, iso-dC, inverted dideoxy-T, 5-methyldC, 5-methyldC, 5-nitroindole, Super T (registered trademark) , 2'-Fr(C, U), 2'-NH2-r(C, U), 2,2'-anhydride-U, 3'- Desoxy-r(A,C,G,U), 3'-O-methyl-r(A,C,G,U), rT, r I, 5-methyl-rC, 2-amino-rA, r spacer (debase), 7-deaza-rG , 7-deaza-rA, 8-oxo-rG, 5-halogenated-U, N-alkylated-rN It is included.

[0205] Other chemically modified RNAs may be used in this specification. For example, the first The RNA and / or the second RNA are, for example, 5',Int,3' azide (NHS ezide). (ster), 5'-hexynyl, 5',Int,3'5-octadiinyl dU, 5',Int Biotin (azide), 5',Int 6-FAM (azide), and 5',Int 5 - May contain modified bases such as TAMRA (azide). Along with the methods described herein. Other examples of RNA nucleotide modifications that can be used include, for example, 5' phosphorylation and Examples of phosphorylation modifications include 3' phosphorylation. RNA also undergoes the following modifications, including amino acid modification. Biotinylation, thiol modification, alkyne modification, adenylation, azide (NHS ester) One or more of the following: cholesterol-TEG, and digoxigenin (NHS ester) It may have.

[0206] Ligation of acceptor and donor RNAs In some embodiments, the acceptor RNA and donor RNA are, Ligation site located at a set distance from the loop formed between and the donor RNA. Ligation occurs. For example, the ligation site is between acceptor RNA and donor RNA. From the loop formed with the RNA, at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or it is located in 10 base pairs. In some embodiments, the ligation site is 2 from the loop. It consists of 3 base pairs. A loop structure is formed between acceptor RNA and donor RNA. It can vary in length. For example, the bond formed between acceptor RNA and donor RNA. The loops are 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or It can be 16 nucleotides long. In some embodiments, the loop length is 4. The loop length is referred to herein as a tetraloop. In some embodiments, the loop is 7 It contains one nucleotide.

[0207] In some embodiments, the acceptor RNA and donor RNA are... - Ligation site located at a set distance from the bulge formed between the RNA and the RNA Ligation occurs. For example, ligation of acceptor RNA and donor RNA is at least 3, 4, 5, 6, 7, 8, 10, 11 or 12 base pairs away from the bulge This is performed at the ligation site. In some embodiments, acceptor RNA and donor RNA are used. RNA ligation is the ligation of 3, 4, 5, or 11 base pairs from the bulge. It occurs in the genital area.

[0208] Base pairing between acceptor RNA and donor RNA occurs at the lower stem and / or It can occur in the upper stem. Therefore, in some embodiments, acceptor RNA and RNA has nucleotide complementarity. Nucleotide complementarity is even partial. Often, for example, the complementarity between acceptor RNA and donor RNA is approximately 50% to 99%. % complementarity is also acceptable. In some embodiments, acceptor RNA and donor RN A has nucleotides that are perfectly complementary.

[0209] In some embodiments, the ratio of acceptor RNA to donor RNA is approximately 0.5:1, 0. 6:1, 0.7:1, 0.8:1, 0.9:1, 1:1, 1:0.9, 1:0.8, 1: They exist in ratios of 0.7, 1:0.6, or 1:0.5.

[0210] In some embodiments, the methods described herein are produced using conventional synthesis methods. This enables the production of gRNA with improved yield compared to gRNA. For example, some In the embodiments thereof, the gRNA produced according to the method described herein is a conventional synthesis method In comparison, the yields were approximately 50%, 55%, 60%, 65%, 70%, 75%, 80%, and 85%. Improve by %, 90%, 95%, 99%, or more.

[0211] In some embodiments, the GC content of the upper and / or lower stem is determined by the RNA ligament. This affects the yield, productivity, and purity of the reaction.

[0212] In some embodiments, acceptor RNA and donor RNA are located in the upper stem. It does not contain GC base pairs.

[0213] In some embodiments, a single donor fragment is used in conjunction with various acceptor fragments. This is possible. In this way, the donor fragment is one or more sets of various acceptor fragments. It can function as a universal donor fragment that can form pairs when combined.

[0214] In some embodiments, acceptor RNA and donor RNA are located in the upper stem. It is manipulated to contain GC base pairs. In some embodiments, acceptor RNA and The donor RNA has at least 1, 2, 3, 4, 5, 6, 7, 8, 9 in the upper stem. , containing 10, 11, or 12 GC base pairs. In some embodiments, acceptor R NA and donor RNA contain two GC nucleotides in the upper stem. Examples of upper stem nucleotides described in the book include CGAUACGACAGAAC( Sequence ID 1), CGCCG (Sequence ID 2), CGGCCGC (Sequence ID 3), CGCGC Examples include (SEQ ID NO: 4) and CGAU (SEQ ID NO: 5).

[0215] In some embodiments, acceptor RNA and donor RNA are located in the lower stem. It does not contain GC base pairs. In some embodiments, acceptor RNA and donor RNA are The lower stem contains a GC base pair.

[0216] In some embodiments, the concentrations of acceptor and donor RNA are approximately 1 g / L to 5 g / L. It is L. In some embodiments, the concentrations of acceptor and donor RNA are obtained in g It affects RNA yield, productivity, and purity.

[0217] In some embodiments, the temperature at which the ligation reaction occurs is the same as the temperature at which the RNA ligation reaction occurs. This affects the yield or productivity. In some embodiments, a ligation reaction occurs. The temperatures are approximately 15°C, 16°C, 17°C, 18°C, 19°C, 20°C, 21°C, 22°C, and 23°C. 24℃, 25℃, 26℃, 27℃, 28℃, 29℃, 30℃, 31℃, 32℃, 33℃ These are 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, or 40°C. Therefore, In some embodiments, the temperature at which the ligation reaction occurs is approximately 15°C. In some embodiments, the temperature at which the ligation reaction occurs is approximately 16°C. The temperature at which the ligation reaction occurs is approximately 17°C. In some embodiments, the ligation reaction The temperature at which the ligation reaction occurs is approximately 18°C. In some embodiments, the ligation reaction is The temperature at which this occurs is approximately 19°C. In some embodiments, the temperature at which the ligation reaction occurs is The temperature is approximately 20°C. In some embodiments, the temperature at which the ligation reaction occurs is approximately 21°C. The temperature is °C. In some embodiments, the temperature at which the ligation reaction occurs is approximately 22°C. In some embodiments, the temperature at which the ligation reaction occurs is approximately 23°C. In some embodiments, the temperature at which the ligation reaction occurs is approximately 24°C. The temperature at which the ligation reaction occurs is approximately 25°C. In some embodiments, the ligation reaction The temperature at which the reaction occurs is approximately 26°C. In some embodiments, the ligation reaction is The temperature at which this occurs is approximately 27°C. In some embodiments, the temperature at which the ligation reaction occurs is The temperature is approximately 28°C. In some embodiments, the temperature at which the ligation reaction occurs is approximately 29°C. The temperature is °C. In some embodiments, the temperature at which the ligation reaction occurs is approximately 30°C. In some embodiments, the temperature at which the ligation reaction occurs is approximately 31°C. In some embodiments, the temperature at which the ligation reaction occurs is approximately 32°C. The temperature at which the ligation reaction occurs is approximately 33°C. In some embodiments, the ligation reaction The temperature at which the reaction occurs is approximately 34°C. In some embodiments, the ligation reaction is The temperature at which this occurs is approximately 35°C. In some embodiments, the temperature at which the ligation reaction occurs is The temperature is approximately 36°C. In some embodiments, the temperature at which the ligation reaction occurs is approximately 37°C. The temperature is °C. In some embodiments, the temperature at which the ligation reaction occurs is approximately 38°C. In some embodiments, the temperature at which the ligation reaction occurs is approximately 39°C. Morphologically, the temperature at which the ligation reaction occurs is approximately 40°C.

[0218] In some embodiments, the acceptor RNA and donor RNA have complete complementarity. It contains at least two RNA nucleotides. In some embodiments, acceptor RN A and donor RNA contain five standard base pairs in the lower stem. Morphologically, acceptor RNA and donor RNA have two non-standard structures in the lower stem. It contains a specific base pair. In some embodiments, the acceptor RNA and donor RNA are above The stem contains two standard base pairs. In some embodiments, acceptor RN A and donor RNA contain 8 base pairs. In some embodiments, the base pairs are adjacent. No. In some embodiments, the base pairs are adjacent.

[0219] Gene editing using gRNA The synthetic gRNAs described herein are suitable gene editing systems for targeted gene editing. It can be used in conjunction with a gene silencing event, or a desired target gene. This can lead to changes in gene expression (e.g., increase or decrease). Therefore, in some embodiments, the synthetic gRNA described herein is used for targeted transcriptional activity Sexualization, targeted transcriptional repression, targeted epigenetic modification, or targeted genome It can be used in a method for modification, and this method involves (a) determining in eukaryotic cells (b) Synthetic guide RNA (gRNA) that is corrected, (b) at least one CRISPR / Cas A protein, or a nucleic acid encoding at least one CRISPR / Cas protein. This includes introducing (a) and (b) and the interaction between the target sequence in chromosomal DNA. Uses include targeted transcriptional activation, targeted transcriptional repression, and targeted epigenetic modification. Alternatively, it can result in targeted genome modifications.

[0220] In some embodiments, the synthetic RNA described herein is used in a gene editing system that includes the following: It can be used in the following. The synthetic guide RNA described herein is RNA gas The id can hybridize to direct repeat sequences and target nucleic acids. Synthetic guide RNA containing a spacer sequence; gene editing protein, which is a gene editing protein. The editing enzyme binds to the RNA guide and triggers the cleavage of a target nucleic acid sequence complementary to the RNA guide. Gene editing proteins that can cause this.

[0221] In some embodiments, the synthetic RNA described herein is used in a gene editing system that includes the following: It can be used. The synthetic guide RNA described herein, wherein the RNA guide is It can hybridize direct repeat sequences and target nucleic acids. Synthetic guide RNA containing a pacer sequence; and gene editing protein h, The gene editing protein is fused to the deaminase, and the gene editing protein fusion is R It can bind to an NA guide and edit a target nucleic acid sequence complementary to the RNA guide.

[0222] In some embodiments, the present invention provides a method for altering the expression of a target nucleic acid in eukaryotic cells. The cells are then brought into contact with the gene editing protein and the synthetic guide RNA described herein. This includes the RNA guide hybridizing the direct repeat sequence and the target nucleic acid. It contains a spacer sequence that can be modified, and the gene editing protein is RNA guided It can bind to the RNA guide and induce cleavage of a target nucleic acid sequence complementary to the RNA guide.

[0223] In some embodiments, the present invention provides a method for altering the expression of a target nucleic acid in eukaryotic cells. The cells are then brought into contact with the gene editing protein and the synthetic guide RNA described herein. This includes the RNA guide hybridizing the direct repeat sequence target nucleic acid. The gene editing protein includes a spacer sequence that can be used to edit RNA. It can bind to the RNA guide and edit target nucleic acid sequences complementary to the RNA guide.

[0224] In some embodiments, the present invention provides a method for modifying target nucleic acids in eukaryotic cells. This includes contacting the gene editing protein with the synthetic guide RNA described herein. Furthermore, the RNA guide hybridizes with the direct repeat sequence and target nucleic acid. It includes a spacer sequence that allows the gene editing protein to bind to the RNA guide. This allows for the editing of target nucleic acid sequences complementary to the RNA guide.

[0225] In some embodiments, the gene editing method or system targets a specific gene in a site-specific manner. The fusion protein contains an effector that modifies A, and the modification activity is methyltrans Ferase activity, demethylase activity, acetyltransferase activity, deacetylase Activity, kinase activity, phosphatase activity, ubiquitin ligase activity, deubiquitination activity Sex, adenylation activity, deadenylation activity, SUMOylation activity, deSUMOylation activity, ribosyl Integraylation activity, denomibosylation activity, myristoylation activity, denomiristoylation activity, integrator ligase activity, transposase activity, recombinase activity, polymerase activity, ligase activity It includes helicase activity or nuclease activity, and any one of these is DNA Alternatively, modify DNA-related polypeptides (e.g., histone or DNA-binding proteins). It is possible.

[0226] In some embodiments, the gene editing method or system is an adenosine or cytosine salt. Deamin can modify bases and function as a site-specific base editor. DNA sequences are edited by chemically modifying nucleotide bases, including with enzymes called nucleotide anase. It contains a fusion protein having an enzyme that can perform a certain action. For example, it typically uses RNA as a substrate. The APOBEC1 cytidine deaminase used in this process, when fused with Cas9, becomes single-stranded. It can be targeted to double-stranded DNA, and directly converts cytidine to uridine, Tad Enzyme A has evolved to deaminate adenosine into inosine. Therefore Therefore, "base editing" using deaminase is a process that modifies one target DNA base to another. Enables grammatical conversion. Various base editors are known in the field, It can be used in the methods and systems described herein. Exemplary base ed For example, Rees and Liu, Nature Review Gene This is described in tics, 2018, 19(12):770-788, and its contents are as follows: This is referenced in the specification.

[0227] In some embodiments, base editing is used to guide stop codons to silence genes. In some embodiments, base editing is performed by modifying the amino acid sequence. This results in modified protein function.

[0228] In some embodiments, the synthetic guide RNA described herein regulates the transcription of target DNA. It can be used in gene editing methods or systems. In some embodiments, synthetic gas IdioRNAs include tRNA, rRNA, snoRNA, siRNA, miRNA, and long A gene editing method or system that modulates the expression of target non-coding RNAs, including ncRNAs. It can be used in [location].

[0229] In some embodiments, the synthetic guide RNA described herein is suitable for gene editing systems. It is used for targeted manipulation of chromatin loop structures. Regulatory genome Targeted manipulation of chromatin loops between regions can overcome genetic defects or abnormalities. To inhibit enhancer-promoter connections, we manipulate the endogenous chromatin structure, This provides a means to enable the formation of new enhancer-promoter connections.

[0230] In some embodiments, the synthetic guide RNA described herein is a beneficial clinical viable Alternatively, it can be used in conjunction with gene editing systems for modifying pathogenic mutations by inserting suppressor mutations. It will be done.

[0231] therapeutic use The synthetic guide RNA described herein is used in gene editing systems for various therapeutic applications. It can be used in such applications. Therefore, in some embodiments, treatment of a disability or disease is not required. A method is provided for treating a disability or disease in the subject, and this method applies to the subject, This includes administering the synthetic guide RNA described in the book together with the gene editing system. Gene editing systems are known in this field, for example, CRISPR-C in particular. as9, Cpf1, SpCas9, SaCas, Cas12, and Prime Editing Cas This includes. The synthetic gRNAs described herein can be used with any gene editing system. It is possible.

[0232] In some embodiments, the synthetic guide RNA described herein is used in conjunction with a gene editing system. It is used to treat various diseases and disorders, such as genetic disorders (e.g., monogenic disorders). It can treat diseases that can be treated by nuclease activity, as well as various cancers.

[0233] In some embodiments, the synthetic guide RNA described herein is used in conjunction with a gene editing system. It is used in such a way (for example, by inserting, deleting, or mutating one or more nucleic acid residues). The target nucleic acid can be edited in order to modify the target nucleic acid. For example, in some embodiments, The CRISPR system is used with the synthetic gRNA described herein to achieve the desired nucleic acid distribution. Includes exogenous donor template nucleic acids (e.g., DNA or RNA molecules) containing columns When a cleavage event induced by the CRISPR system is resolved, the cellular molecular mechanisms are extrinsic to the extrinsic Sex donor template nucleic acids are used to repair and / or resolve cleavage events. Alternatively, Cellular molecular mechanisms utilize endogenous templates in the repair and / or resolution of cleavage events. It can be used. In some embodiments, the synthetic guide RNA described herein is genetic. Used in conjunction with a sub-editing system, it alters target nucleic acids, inserting, deleting, and / or puncturing them. This results in a mutation. In some embodiments, the insertion is a scarless insertion (i.e., a cleavage). The intended nucleus to the target nucleic acid does not result in additional unintended nucleic acid sequences during event resolution. (Insertion of acid sequence). Donor template nucleic acids are double-stranded or single-stranded nucleic acid molecules (e.g., D It can be NA or RNA.

[0234] In one embodiment, the synthetic guide RNA described herein is used for RNA overexpression, toxic RNA, and / or due to mutant RNA (e.g., splicing defects or truncation) It can be used in conjunction with gene editing systems to treat diseases caused by it.

[0235] In some embodiments, the synthetic guide RNA described herein is used in conjunction with a gene editing system. It is used in a trans-action manner that affects RNA-dependent functions and can cause various diseases. Mutations can be targeted.

[0236] In some embodiments, the synthetic guide RNA described herein is used in conjunction with a gene editing system. Systolic splicing, which is used in conjunction with splicing defects and can cause disease. It may be possible to target mutations that disrupt the code.

[0237] The synthetic guide RNA described herein has antiviral activity, particularly against RNA viruses. It can be used in conjunction with the gene editing system CAN. For example, it can target viral RNA sequences. To target viral RNA, a suitable synthetic RNA guide selected for this purpose is used. .

[0238] The synthetic guide RNA described herein is used in conjunction with a gene editing system to target ( For example, it can treat cancer in human subjects. For example, abnormalities (including, for example, point mutations) (or alternatively spliced, etc.) and target RNA molecules found in cancer cells. This induces cell death (e.g., via apoptosis) in those cancer cells. It depends on doing it.

[0239] The synthetic guide RNA described herein is used in conjunction with a gene editing system to target... It can treat infectious diseases in such cases. For example, by targeting and inducing cell death in infected somatic cells. Therefore, R expressed by the infective organism (e.g., bacteria, viruses, parasites, or protozoa) This is achieved by targeting NA molecules. The synthetic guide RNA described herein is a gene editing system. Used in conjunction with stem cells, it can treat diseases in which intracellular infectious agents infect host target cells.

[0240] In applications where it is desirable to insert a polynucleotide sequence into a target DNA sequence, The polynucleotides containing the donor sequence to be inserted are also provided to the cell. "Donor polynucleotides" are opening up by site-directed modification polypeptides. This refers to the nucleic acid sequence inserted into the cleavage site. The donor polynucleotide is the genotype at the cleavage site. Sufficient homology to the mu sequence, for example, adjacent to the cleavage site, for example, about 50 of the cleavage site Within a certain number of bases, for example, within approximately 30 bases, within approximately 15 bases, within approximately 10 bases, within approximately 5 bases Nucleotide sequences within or directly adjacent to the cleavage site and 70%, 80%, 85%, 90% , containing 95% or 100% homology, and between it and genome sequences that have homology. It supports homology-directed repair. The sequence homology between the donor and genome sequences is approximately 25,5 0, 100, or 200 nucleotides, or more than 200 nucleotides (and Homology-directed repair involves 10 to 200 nucleotides (or any integer value greater than or equal to 10) This would support the donor sequence of any length, for example, 10 nucleotides or more, 50 More than nucleotides, more than 100 nucleotides, more than 250 nucleotides, 500 nucleos It could be more than 1000 nucleotides, more than 1000 nucleotides, more than 5000 nucleotides, etc.

[0241] The donor sequence is typically not identical to the genome sequence being substituted. Rather, the donor sequence Insofar as sufficient homology exists to support homology-directed repair, with respect to genome sequences This may include at least one single base change, insertion, deletion, inversion, or transposition. In this embodiment, the donor sequence has homology orientation between the target DNA region and two adjacent sequences. So that the repair results in the insertion of a non-homologous sequence into the target region, two homologous regions and adjacent non-homologous regions The sequence is also not homologous to the target DNA region. The vector skeleton may contain sequences that are not intended for insertion. Generally, donor vectors The homologous regions of the column have at least 50% sequence identity with the genome sequence to which recombination is desired. In certain embodiments, 60%, 70%, 80%, 90%, 95%, 98% Sequence identity of %, 99%, or 99.9% exists. Donor polynucleotide length Depending on the context, array identity can exist for any value between 1% and 100%.

[0242] The donor sequence is compared to the genome sequence with specific sequence differences, such as restriction sites, nucleos. Tide polymorphisms, selectable markers (e.g., drug resistance genes, fluorescent proteins, enzymes, etc.) These may include, and are used to evaluate the success of donor sequence insertion at the cleavage site. It may be used, or in some cases, for other purposes (e.g., targeted genomic genetics) (To indicate expression in the cosmos) it can be used. In some cases, a place located within the code domain. In addition, such differences in nucleotide sequences do not change the amino acid sequence, or siren It performs amino acid changes (i.e., changes that do not affect the structure or function of the protein). Alternatively, differences in these sequences can be activated later for the removal of marker sequences. This may include adjacent recombination sequences such as FLP and loxP sequences.

[0243] The donor sequence may be single-stranded DNA, single-stranded RNA, double-stranded DNA, or double-stranded RNA. It can be supplied to cells. It can be introduced into cells in a linear or cyclic form. Linear form When introduced, the ends of the donor sequence are modified by methods known to those skilled in the art (e.g., exo It can be protected from nucleotide degradation. For example, one or more dideoxynucleotide residues A molecule is attached to the 3' end of a linear molecule, and / or a self-complementary oligonucleotide is attached. Ligation occurs at one or both of the terminal ends. Protects exogenous polynucleotides from degradation. Additional methods for this include the addition of terminal amino groups, as well as, for example, phosphorothiocyanate Phosphoramides, as well as O-methylribose or deoxyribose residues Examples of modified nucleotide linkages used include, but are not limited to, linear chains. As an alternative to protecting the ends of the donor sequence, the additional length of the sequence affects recombination. The donor sequence may be located outside the region of homology that can be decomposed without any decomposition. It has additional sequences such as the origin, promoter, and genes encoding antibiotic resistance. It can be introduced into cells as part of a vector molecule. Furthermore, the donor sequence can be used for DNA targeting. RNA and / or site-directed modified polypeptides and / or donor polynucleotides As described above regarding nucleic acids that code, as naked nucleic acids, liposomes or It can be introduced as nucleic acid complexed with drugs such as poloxamer, or as a virus ( For example, it can be delivered by adenovirus (AAAV).

[0244] According to the method described above, the target DNA region is cleaved and modified ex vivo, i.e. It can be "genetically modified". In some embodiments, a selectable marker is used in the target DNA region. Similar to when inserted into a region, a population of cells separates the genetically modified cells from the rest of the population. By separating them, they can be concentrated in those containing genetic modification. Before concentration, Genetically modified cells make up more than 1% of the cell population (for example, more than 2%, more than 3%, more than 4%). , 5% or more, 6% or more, 7% or more, 8% or more, 9% or more, 10% or more, 15% or more, and It may only make up 20% or more. The isolation of "genetically modified" cells is used This can be achieved by any suitable and convenient separation technique for the selectable markers. For example, If a fluorescent marker is inserted, cells can be separated by fluorescence-activated cell sorting. If cell surface markers are inserted, cells can be separated using affinity separation techniques, such as magnetic separation. Affinity chromatography, "panning" where affinity reagents are bound to a solid matrix, Alternatively, they can be separated from heterogeneous populations by other convenient techniques. One example of such a technique is a fluorescence-activated cell sorting machine, which has multiple color channels and low-angle It also has various degrees of sophistication, such as obtuse-angle light scattering detection channels and impedance channels. This can be done. The cells use a dye associated with dead cells (e.g., propidium iodide). This can lead to selection against dead cells. It is excessively detrimental to the survival rate of genetically modified cells. Any other technique may be used. Highly concentrated in cells containing modified DNA The cell composition is achieved in this manner. "Highly concentrated" means genetically modified cells. However, more than 70%, more than 75%, more than 80%, more than 85%, more than 90% of the cell composition, for example This means that it is approximately 95% or more, or 98% or more. In other words, the composition is It may be a substantially pure composition of genetically modified cells.

[0245] Genetically modified cells produced by the methods described herein can be used immediately. Alternatively, cells could be frozen at liquid nitrogen temperature, stored for extended periods, thawed, and reused. In such cases, the cells are typically treated with 10% dimethyl sulfoxide (DMSO) and 50% In order to preserve serum, 40% buffered medium, or cells at such freezing temperatures, in the art Frozen cultured cells are frozen in several other commonly used solutions and then thawed. To do this, it is decompressed in a format commonly known in the relevant technical field.

[0246] Genetically modified cells can be cultured in vitro under various culture conditions. They can grow, that is, they can grow under conditions that promote cell proliferation. The culture medium is, for example, It may be a liquid or semi-solid containing agar, methylcellulose, etc. Cell populations are usually Bovine fetal serum (approximately 5-10%), L-glutamine, thiols, especially 2-mercaptoethine Nol, and antibiotics such as penicillin and streptomycin were supplemented. It can be suspended in a suitable nutrient medium such as Iscove's modified DMEM or RPMI1640. The culture may contain growth factors to which regulatory T cells respond. These growth factors, through specific effects on transmembrane receptors, are present in cultures or intact tissues. It is a molecule that can promote cell survival, proliferation, and / or differentiation in any of the following ways. Growth factors include polypeptides and non-polypeptide factors.

[0247] These genetically modified cells can be used, for example, to treat diseases or to fight against [unclear / unclear]. For use as an HIV drug, anti-disease drug, or anti-cancer drug, for purposes such as gene therapy, and in agriculture. For the production of genetically modified organisms in or for biological research, transplanted into subjects It may be possible. The subjects may be newborns, young people, or adults. The particular purpose is to monitor feeding movements. It is an object. Mammalian species that can be treated with this method include dogs and cats, horses, and cows. This includes animals such as sheep, as well as primates, especially humans. Animal models, especially small mammals. (For example, mice, rats, guinea pigs, hamsters, lagoons (for example, rabbits)) (etc.) may be used for experimental investigations.

[0248] Cells, either alone in a target or, for example, within the tissue to which cells are transplanted, promote cell growth and / or may be provided with a suitable substrate or matrix to support the organization. Typically, at least 1 × 10 3 Individual cells, for example, 5 × 10 3 Individual cells, 1 × 10 4 pieces Cells, 5 × 10 4 Individual cells, 1 × 10 5 Individual cells, 1 × 10 6 One or more cells or The above is administered. The cells are delivered via the following routes: parenteral, subcutaneous, intravenous, intracranial, intraspinal, and intraocular. The cells can be introduced into the target via either injection, catheterization, or cerebrospinal fluid. Cells can also be introduced by transgenic animals (e.g., transgenic animals). It may be introduced into embryos (e.g., blastocysts) for the purpose of generating Sgenic mice. stomach.

[0249] The number of treatment administrations to the subject may vary. Introducing genetically modified cells into the subject is It may be a single event, but in certain circumstances, such treatment may be limited to a specific period. It may take time to induce improvement and may require a series of continuous, repeated treatments. Therefore, multiple administrations of genetically modified cells may be necessary before the effects are observed. The precise protocol depends on the disease or condition, the stage of the disease, and the individual being treated. It depends on the parameters.

[0250] In other aspects of the present invention, for example, to treat diseases, or as antiviral agents, antipathogens For purposes such as gene therapy, as a medicine or anti-cancer drug, genes in agriculture For the production of recombinant organisms or for biological research, again, DNA-targeted RNA and / or site-directed modified polypeptides and / or donor polynucleotides are used This modifies cellular DNA in vivo. In these in vivo embodiments, DNA targeting is performed. RNA and / or site-directed modified polypeptides and / or donor polynucleotides The drug is administered directly to the individual. DNA-targeted RNA and / or site-directed modified polypeptides Peptides and / or donor polynucleotides are targeted to peptides, small molecules, and nucleic acids. The drug is administered by any of several well-known methods in the art. It may be given DNA-targeted RNA and / or site-directed modified polypeptides and / or Alternatively, donor polynucleotides can be incorporated into various formulations. More specifically, the present invention DNA-targeting RNA and / or site-directed modified polypeptides and / or donors Polynucleotides, when combined with appropriate pharmaceutically acceptable carriers or diluents, can be used as drugs. It can be formulated into a scientific composition.

[0251] The pharmaceutical preparation contains one or more DNA-targeted RNs present in a pharmaceutically acceptable vehicle. A and / or site-directed modified polypeptides and / or donor polynucleotides It is a composition containing [the substance]. "Pharmacologically acceptable vehicle" is defined by a federal or state government regulatory body. It may be a vehicle approved by or listed in the United States.

[0252] Pharmacopoeias or other generally accepted pharmacopoeias for use in mammals such as humans The term "vehicle" refers to the formulation of the compounds of the present invention for administration to mammals. This refers to a diluent, adjuvant, excipient, or carrier. Such a pharmaceutical vehicle is a lipid, for example. For example, liposomes, such as liposome dendrimers; water, as well as peanut oil, large Includes petroleum-derived, animal-derived, plant-derived, or synthetic-derived oils such as soybean oil, mineral oil, and sesame oil. Liquids such as oil and saline solution; acacia gum, gelatin, starch paste, talc, keratin These may include tin, colloidal silica, urea, etc. In addition, they can be used as auxiliary agents, stabilizers, thickeners, and lubricants. Agents and colorants may be used. The pharmaceutical composition may be in the form of tablets, capsules, powders, or granules. Drugs, ointments, solutions, suppositories, injections, inhalants, gels, particulates, and aerosols. DNA can be formulated into any solid, semi-solid, liquid, or gaseous preparation. Targeted RNA and / or site-directed modified polypeptides and / or donor polynuclei Reotide can be administered orally, orally, rectally, parenterally, intraperitoneally, intradermally, transdermally, intratracheally, intraocularly, etc. This can be achieved by various methods, including administration. The activator may be systemic after administration, Alternatively, it may be used for local administration, intramural administration, or to act to retain the active dose at the transplant site. The use of implants may be localized. The activator is formulated for immediate action. It may be formulated for sustained release.

[0253] In some conditions, especially those affecting the central nervous system, crossing the blood-brain barrier (BBB) ​​is necessary. There are times when it is necessary to formulate drugs. Drug delivery across the blood-brain barrier (BBB) One strategy is to use penetrating agents such as mannitol or leukotrienes, or Biochemically, the breakdown of the BBB can be caused by the use of vasoactive substances such as bradykinin. It involves destruction. Using the blood-brain barrier (BBB) ​​opening to target specific drugs to brain tumors is also an option. It is a limb. The BBB-destroying agent, when administered by intravascular injection, is the therapeutic agent of the present invention. It can be administered in combination with therapeutic compositions. Other strategies for crossing the blood-brain barrier include caveolin-1 mediated. Sexual transcytosis, carrier-mediated transport of glucose and amino acid carriers Receptor-mediated transcytosis of insulin or transferrin, and This includes endogenous transporters such as p-glycoprotein and other active efflux transporters. The use of a stem may be involved. Active transport is used to facilitate transport across the endothelial wall of blood vessels. The delivery portion may also be conjugated with a therapeutic compound for use in the present invention. .

[0254] Alternatively, drug delivery of therapeutic agents behind the blood-brain barrier (BBB) ​​can be localized, for example, into the subarachnoid space. It is also acceptable for them to do so.

[0255] Typically, an effective amount of DNA-targeting RNA and / or site-directed modification polypeptides. and / or donor polynucleotides are provided. Ex vivo methods are discussed above. As described above, DNA-targeting RNA and / or site-directed modified polypeptides and / Alternatively, the effective amount or effective dose of donor polynucleotides can be determined using a negative control, e.g., an empty vector. Observations between two homologous sequences compared to cells in contact with the ter or unrelated polypeptide. This is the amount that induces an increase of more than twice the amount of recombination. The amount of recombination is, for example, as described above. It is described and measured by any convenient method known in the art. It is possible that the administered DNA-targeting RNA and / or site-directed modified polypeptides The calculation of the effective amount or effective dose of donor polynucleotides is within the scope of the skills of a person skilled in the art. This is within the bounds of the art and is commonplace for those skilled in the art. The final dose administered depends on the route of administration and the treatment. It depends on the nature of the malfunction or condition being affected.

[0256] The effective dose given to a particular patient depends on various factors, some of which vary from patient to patient. It differs from that. A competent clinician will, when necessary, halt or reverse the progression of the disease state. This will allow us to determine the effective dose of the therapeutic agent to administer to the patient. LD50 Animal Day Using the available information about the drug and other available information, clinicians can determine the appropriate route of administration. This allows for the determination of the maximum safe dose for an individual. For example, the dose administered intravenously is the therapeutic dose. Considering the larger volume of fluid in which the composition is administered, a larger dose than that administered intrathecally is required. In some cases, compositions are rapidly removed from the body in order to maintain therapeutic concentrations. It may be administered in higher doses or repeated doses. Using conventional techniques, capable Clinicians can optimize the dosage of specific medications during routine clinical trials. It is likely.

[0257] DNA-targeted RNA and / or site-directed modified polypeptides for inclusion in drugs. and / or donor polynucleotides can be obtained from suitable commercial sources. One suggestion is to administer DNA-targeting RNA and / or a portion of the DNA by parenteral administration per dose. The total pharmaceutically effective amount of position-directed modified polypeptides and / or donor polynucleotides is It falls within the range that can be measured by a dose-response curve.

[0258] DNA-targeted RNA and / or site-directed modified polypeptides and / or donors Polynucleotide-based therapies, i.e., DNA-targeted RNA used for therapeutic administration. and / or site-directed modified polypeptides and / or donor polynucleotide preparations The product must be sterile. Sterility is achieved by using a sterile filtration membrane (e.g., a 0.2 μm membrane). This is easily achieved by filtering through the solution. Therapeutic compositions are generally sterile and removed. A container with an opening, for example, one for intravenous injection having a stopper that can be penetrated by a subcutaneous injection needle. Placed in a solution bag or vial. DNA-targeted RNA and / or site-directed. Therapies based on modified polypeptides and / or donor polynucleotides are available in aqueous solution. , or as a lyophilized preparation for reconstitution, in unit dose or multi-dose containers, for example, dense It can be stored in sealed ampoules or vials. An example of a lyophilized formulation is a 10 mL vial. The container was filled with 5 ml of sterile filtered 1% (w / v) aqueous solution of the compound, and the resulting mixture was frozen. The solution is dried. The injection solution is prepared by reconstituting the freeze-dried compound using bacteriostatic water for injection. It is prepared in this way.

[0259] The pharmaceutical composition is prepared for animal or human administration, depending on the desired formulation. Pharmacologically acceptable diluents defined as vehicles commonly used for formulation It may include a non-toxic carrier. The diluent does not affect the biological activity of the combination. They are selected accordingly. Examples of such diluents include distilled water, buffer water, physiological saline, PBS, and Ringer's water. These are a solution of dextrose, a solution of Hanks, and a solution of dextrose. In addition, pharmaceutical compositions or The formulation may contain other carriers, adjuvants, or non-toxic, non-therapeutic, non-immunogenic stabilizers or excipients. The composition may also include pH adjusters and buffers, toxicity adjusters, wetting agents, and It may include additional substances that approximate physiological conditions, such as detergents.

[0260] The composition may also contain any of the various stabilizers, such as antioxidants. If the scientific composition contains a polypeptide, the polypeptide is stable in vivo. To enhance qualitative properties, or otherwise enhance the pharmacological properties (e.g., poly (Increases the half-life of peptides, reduces their toxicity, and enhances their solubility or uptake.) It can be complexed with various well-known compounds. Examples of such modifiers or complexing agents include: Examples include sulfates, glucons, citrates, and phosphates. The core of the composition Acids or polypeptides can also be complexed with molecules that enhance their in vivo properties. Such molecules include, for example, carbohydrates, polyamines, amino acids, other peptides, and io Nutrients (e.g., sodium, potassium, calcium, magnesium, manganese), and fats. Quality is included.

[0261] Pharmaceutical compositions may be administered for prophylactic and / or therapeutic purposes. The active ingredient Toxicity and therapeutic efficacy are measured, for example, by the LD50 (lethal dose for 50% of the population) and This includes determining the ED50 (the therapeutically effective dose for 50% of the population) in cell culture Toxicity can be determined by standard pharmaceutical procedures in nutrient and / or laboratory animals. The dose-to-treatment ratio is a therapeutic indicator and is expressed as the ratio LD50 / ED50. It is possible. Therapies that show a large therapeutic indicator are preferred.

[0262] Data obtained from cell culture and / or animal studies can be used to determine the range of dosages for humans. It can be used in the formulation of [product name]. The dosage of the active ingredient is typically low toxicity E This is a line within the circulating concentration range, including D50. The dosage depends on the dosage form and application used. This range may vary depending on the route of administration.

[0263] The components used to formulate pharmaceutical compositions are preferably of high purity, and latent Substantially free of harmful pollutants (e.g., at least National Foods (NF) ) grade, generally at least analytical grade, and more typically at least pharmaceutical grade. (and). Furthermore, compositions intended for in vivo use are usually sterile. Given a compound To the extent that the substance must be synthesized before use, the resulting product is typically synthesized or any potential toxic agents that may be present during the purification process, in particular any endotoxins It does not contain qualitatively. The composition for parental administration is also sterile, substantially isotonic, and G It is manufactured under MP conditions.

[0264] Delivery system The synthetic RNA described herein, together with the desired gene editing system components, For example, various delivery systems such as plasmids and delivery vectors can be used to deliver the desired details. It can be delivered to cells.

[0265] The synthetic RNA described herein is delivered by nanoparticles, which may be organic or inorganic. It is possible. Nanoparticles are well known in the art. Any suitable nanoparticle design can be used. To deliver components of a genome editing system, or nucleic acids encoding such components. This is possible. For example, organic (e.g., lipid and / or polymer) nanoparticles are a feature of this disclosure. In certain embodiments, it may be suitable for use as a delivery vehicle. Table 1 (below) shows: Exemplary lipids for use in nanoparticle formulations and / or gene transfer are shown. [Table 1] JPEG2026113460000003.jpg171162

[0266] Table 2 lists exemplary polymers used in gene transfer and / or nanoparticle formulations. do. [Table 2]

[0267] Table 3 shows the delivery methods for the Cas9-encoding polynucleotides described herein. To summarize. [Table 3]

[0268] In another embodiment, the delivery of the genome editing system comprising the synthetic gRNA described herein is This can be achieved by delivering nucleoproteins (RNPs) to cells. RNPs are targeted The complex with the gRNA contains nucleic acid-binding proteins (e.g., Cas9). RNPs are For example, Zuris, JA et al., 2015, Nat. Biotechnol As reported by ogy,33(1):73-80, electroporation Using known methods such as nucleotide or cationic lipid-mediated methods It can be delivered to cells. RNPs are available for use with CRISPR base editor systems. This is advantageous, and is particularly beneficial for cells that are difficult to transfect (e.g., primary cells). Furthermore, RNPs are also eukaryotic plasmids that can be used, in particular, in CRISPR plasmids. If the motor (e.g., CMV or EF1A) is not sufficiently expressed, the stool in the cell It can alleviate difficulties that may arise in protein expression. Advantageously, the use of RNPs is intracellular It does not require the delivery of foreign DNA to the nucleic acid-binding protein and the gRNA complex. RNPs containing these components degrade over time, therefore, using RNPs can have off-target effects. This may be restrictive. Using RNP in a similar manner to plasmid-based technologies. Then, a binding protein (e.g., a Cas9 variant) is delivered, and homologous recombination repair (HDR) is performed. ) can be induced.

[0269] To drive a CRISPR system (for example, including the synthetic gRNA described herein) The promoter used may include AAV ITR. This is the space within the vector. This may be advantageous in eliminating the need for additional promoter elements that could occupy the space. The freed-up additional space can be used for additional elements (e.g., guide nucleic acids or selectable) It can drive the expression of (capable markers). ITR activity is relatively weak, therefore selected It can be used to reduce the potential toxicity caused by the overexpression of nucleases.

[0270] Using any suitable promoter, the emission of Cas9 and, if applicable, guide nucleic acids It can drive the current expression. In the case of ubiquitous expression, possible promoters to use include CMV, C Examples include AG, CBh, PGK, SV40, ferritin heavy chain or light chain, etc. Brain In the case of expression in other CNS cells, a suitable promoter is to all neurons In contrast, synapsin I affects excitatory neurons, while CaMKIIα affects GABAergic neurons. Possible candidates for ron include GAD67, GAD65, or VGAT. (Hepatocytes) In the case of expression, the albumin promoter is a preferred promoter. For expression in lung cells, SP-B may be a suitable promoter. In the case of cells, ICAM can be cited as a suitable promoter. In the case of hematopoietic cells, Suitable promoters may include IFNβ or CD45. In the case of osteoblasts, A suitable promoter could be OG-2.

[0271] In some cases, a separate promoter may be used for base editing and matching within the same nucleic acid molecule. It drives the expression of guide nucleic acids. For example, a vector or viral vector drives the expression of bases. A first promoter operably linked to a nucleic acid encoding a descriptor, and a guide nucleic acid It may include a second promoter that is operably coupled.

[0272] The promoters used to drive the expression of guide nucleic acids are U6 or H1. Possible examples of PolIII promoters include gRNA adeno-associated virus (AAV). To express ), use the PolII promoter and intron cassette.

[0273] Cas9 and synthetic gRNA are used in adeno-associated viruses (AAV), lentiviruses, and other viruses. Using denovirus or other plasmid or viral vector types, U.S. Patent Patent No. 8,454,972 (Formulations and Dosages for Adenovirus), U.S. Patent No. 8,404 U.S. Patent No. 658 (Formulations and Dosages for AAV), and U.S. Patent No. 5,846,946 (D Formulations for NA plasmids (dosage), as well as for lentiviruses, AAVs, and adenoviruses. Using formulations and dosages from clinical trials and publications related to clinical trials involving viruses It can be delivered. For example, in the case of AAV, the route of administration, formulation, and dosage are as specified in the U.S. Act 8. This may be similar to clinical trials involving patient number 454,972 and AAV. In the case of adenovirus. The route of administration, formulation, and dosage are specified in U.S. Patent No. 8,404,658 and Adenovirus This may be similar to clinical trials involving plasma delivery. In the case of plasmid delivery, the route of administration, formulation, and use The quantity may be similar to that of U.S. Patent No. 5,846,946 and clinical trials involving plasmids. The dosage may be based on or estimated for an individual with an average weight of 70 kg (e.g., an adult male). The dosage may be adjusted for different patients, subjects, and mammals of different body weights and species. The frequency of administration depends on age, Gender, overall health status, other conditions of the patient or subject, and the specific condition being addressed are also included. Depending on the usual factors including the symptoms, it is within the scope of a physician or veterinarian (e.g., physician, veterinarian). Yes. Viral vectors can be injected into the target tissue. Cell type-specific base editors In this case, the expression of the base editor and any guide nucleic acid is controlled by a cell type-specific promoter. It can be driven by that.

[0274] For in vivo delivery, AAV may be advantageous over other viral vectors. In some cases, AAV allows for low toxicity, which is due to the cellular particles that can activate the immune response. This may be due to a purification method that does not require ultracentrifugation. In some cases, AAV can be a host genotype. Because it is not incorporated into the m, the likelihood of causing insertional mutagenesis is reduced.

[0275] AAV has a packaging limit of 4.5Kb or 4.75Kb. Alternatively, structures exceeding 4.75 KB can result in a significant decrease in virus production. For example, SpCas9 is quite large, with the gene itself exceeding 4.1Kb, and is packaged into AAV. This makes it difficult to perform the operation. Therefore, the embodiments of the present disclosure are shorter in length than the conventional Cas9. This includes the use of Cas9 as disclosed.

[0276] AAV can be AAV1, AAV2, AAV5, or any combination thereof. The type of AAV can be selected regarding the cells to be targeted, for example, brain or nerve cells. AAV serotypes 1, 2, 5, or hybrid capsids AAV1 for targeting cells You can choose AAV2, AAV5, or any combination thereof, and target cardiac tissue. When targeting, AAV4 can be selected. AAV8 is useful for delivery to the liver. A table of specific AAV serotypes for these cells can be found in Grimm, D. et al., J. It can be found in .Virol.82:5887-5911(2008).

[0277] Lentiviruses are complex retroviruses that can detect odor in both dividing and terminal cells. They infect and have the ability to express those genes. The most commonly known is lenticular HIV is a human immunodeficiency virus, and unlike other viruses, it has an envelope glycotangen. Using protein, a wide range of cell types can be targeted.

[0278] Lentiviruses can be prepared as follows: pCasES10(lentvirus) After cloning the virus transcription plasmid backbone, the day before transfection... In addition, a low-passage (p=5) HEK293FT was used, containing 10% fetal bovine serum and no antibiotics. Seeds were seeded at 50% confluence in a T-75 flask in DMEM. After 20 hours... Then, replace the culture medium with OptiMEM (serum-free) medium and perform transfection after 4 hours. The cells were then subjected to 10 μg of lentiviral transdermal plasmid (pCasES10) and Transfect using the following packaging plasmid: 5 μg of pMD2.G ( VSV-g pseudotype), and 7.5 μg of psPAX2 (gag / pol / re v / tat). Transfection is performed using a cationic lipid delivery agent (50 μl of Lipof 4 mL of Opti (containing 2000 μl of ectamine and 100 μl of Plus reagent) This can be done in MEM. After 6 hours, the culture medium contains 10% fetal bovine serum and antibiotics. Replace with serum-free DMEM. These methods use serum during cell culture, but without serum. This method is preferable.

[0279] Lentiviruses can be purified as follows: The viral supernatant is used after 48 hours. Collect the supernatant. First, remove the debris from the supernatant and filter out 0.45 μm low-protein-bound (PVDF). ) Filter through a filter. Then, in an ultracentrifuge, at 24,000 rpm for 2 hours. Spin. Resuspend the virus pellet in 50 μl of DMEM overnight at 4°C. Next Then, aliquot them and freeze them immediately at -80°C.

[0280] In another embodiment, a minimal non-primate wrench based on equine infectious anemia virus (EIAV) is used. Viral vectors are also intended. In another embodiment, RetinoStat(registered trademark) It is a lentiviral gene therapy vector based on equine infectious anemia virus, and is used for angiogenesis. It expresses the reproductive inhibitory proteins endostatin and angiostatin, which are used in the retina. It is intended to be delivered by injection. In another embodiment, autoinactivating lentil The use of an IlsuVector is intended.

[0281] Any RNA in the system, for example, guide RNA or Cas9 coding mRNA, is R It can be delivered in the form of NA. Cas9-coding mRNA is generated using in vitro transcription. It is possible. For example, Cas9 mRNA contains the following elements in a PCR cassette. It can be synthesized using: T7 promoter, any Kozak sequence (GC CACC), nuclease sequences, and 3'UTR derived from β-globin-poly(A) tail, etc. 3'UTR. The cassette can be used for transfer with T7 polymerase. Dopolynucleotides (e.g., gRNA) have a T7 promoter followed by the sequence "GG". , and transfer using in vitro transcription from a cassette containing guide polynucleotide sequences. You can also copy it.

[0282] To enhance expression and reduce potential toxicity, the Cas9 sequence and / or guide Nucleic acids can be modified using, for example, pseudo-U or 5-methylC, with one or more modified nucleos. It can be modified to include sid.

[0283] This disclosure, in some embodiments, includes methods for modifying cells or organisms. Cells are, It may be a prokaryotic or eukaryotic cell. The cell may be a mammalian cell. Many may be non-human primate, bovine, pig, rodent, or mouse cells. The modifications introduced into cells by base editors, compositions, and methods include antibodies and starch. Cells for improving the production of biological products such as alcohol or other desired cellular output. and the offspring of the cells can be altered. The modifications involved include changes that alter the biological products produced by cells and their offspring. It can be made possible.

[0284] The system may include one or more different vectors. In one embodiment, Cas9 is , expression of the desired cell type, preferably eukaryotic cells, preferably mammalian cells or human cells Therefore, codon optimization is performed.

[0285] Generally speaking, "codon optimization" refers to optimizing at least one codon in the natural sequence (for example, about 1 codon). or is greater than approximately 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more. The codons) are more frequently used in the host cell's genes while maintaining the natural amino acid sequence. Alternatively, by substituting with the most frequently used codon, expression in the target host cell can be achieved. This refers to the process of modifying nucleic acid sequences to enhance certain properties. Various species modify specific amino acids. It exhibits a specific bias towards certain codons. Codon bias (differences in codon usage between organisms) This often correlates with the efficiency of messenger RNA (mRNA) translation, and this is Next, in particular, the characteristics of the translated codon and specific transfer RNA (tRN) A) It is thought to depend on the availability of the molecule. The tRNA selected in cells The advantage generally reflects the codons most frequently used in peptide synthesis. Therefore, genes are optimized for optimal gene expression in a given organism based on codon optimization. It can be organized. A codon usage table can be found, for example, at www.kazusa.orjp / codon It can be easily obtained from the "Codon Usage Database" available (referenced July 9, 2002). These tables are adaptable and can be adapted in several ways. (Nakamura, Y.) ,et al.“Codon usage tabulated from the i international DNA sequence databases: sta tus for the year 2000” Nucl.Acids Res.28 See 292(2000). Specific sequences for expression in specific host cells. Computer algorithms for optimizing codons are also available, for example, Gene Forge (Aptagen; Jacobus, Pa.) is also available. In some embodiments, one or more codons in the sequence encoding the manipulated nuclease (For example, 1, 2, 3, 4, 5, 10, 15, 20, 25, 50 or more) The codon (or all codons) is the most frequently used codon for a particular amino acid. It corresponds to.

[0286] Packaging cells typically contain viral particles capable of infecting host cells. Used to form such cells. Adenoviruses are packaged into such cells. 293 cells, and psi.2 cells or PA31 cells for packaging retroviruses. It contains 7 cells. Viral vectors used in gene therapy are typically nucleic acid vectors. It is produced by creating a cell line that packages the virus particles into a vector. Typically, this involves the minimum amount of virus required for packaging and subsequent integration into a host. The expression cassette contains the sequence and other viral sequences for the polynucleotides that are expressed. It is replaced by the packaging cell line. The missing viral function is typically found in packaging cell lines. It is supplied in trans by [unclear]. For example, AAV vectors used in gene therapy are [unclear]. In terms of type, it is an AAV genome-derived IT necessary for packaging and integration into the host genome. It has only the R sequence. The viral DNA contains other AAV genes (i.e., rep and c). Package into a cell line containing a helper plasmid that encodes ap) but lacks an ITR sequence. It is possible to do this. Cell lines can be infected with adenovirus as a helper. - The virus replicates the AAV vector and produces the AAV gene derived from the helper plasmid. This can promote the process. In some cases, the helper plasmid lacks an ITR sequence. Therefore, it is not packaged in considerable quantities. Adenovirus contamination is, for example, Denoviruses can be reduced by heat treatment, to which they are more susceptible than AAVs.

[0287] Pharmaceutical composition Other aspects of this disclosure include gene editing systems (including, for example, synthetic gRNAs described herein). This relates to pharmaceutical compositions containing stems. The term "pharmaceutical composition" as used herein is... In some embodiments, it refers to a composition formulated for pharmaceutical use. The composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutically acceptable carrier is , including additional drugs (e.g., for specific delivery, increased half-life, or other therapeutic compounds) .

[0288] As used herein, the term “pharmaceutically acceptable carrier” means a compound that is carried within a body. From one site (e.g., delivery site) to another site (e.g., organ, tissue, or part of the body) Liquid or solid fillers, diluents, excipients, and products involved in transporting or shipping to Auxiliary agents (e.g., lubricants, magnesium talc, calcium stearate or stear Drugs such as zinc phosphate, or steric acid, or solvent mounting material. This refers to a scientifically acceptable material, composition, or vehicle. A pharmaceutically acceptable carrier is a pharmaceutically acceptable carrier. This means that it is "acceptable" in the sense that it is compatible with other components of the formulation, and is suitable for the target tissue. It is harmless (e.g., physiologically compatible, sterile, physiological pH, etc.).

[0289] Some non-limiting materials that can serve as pharmaceutically acceptable carriers Examples include: (1) Sugars such as lactose, glucose, and sucrose (2) Starches such as corn starch and potato starch, (3) Carbonate Sodium xymethylcellulose, methylcellulose, ethylcellulose, microcrystalline cellulose (4) Tragantry powder (5) Malt, (6) Gelatin, (7) Magnesium stearate, Sodium lauryl sulfate (8) Lubricants such as um and talc, and excipients such as cocoa butter and suppository wax. (9) Peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and (10) Oils such as soybean oil, glycols such as propylene glycol, (11) Glycerin , sorbitol, mannitol, and polio such as polyethylene glycol (PEG) (12) Esters such as ethyl oleate and ethyl laurate, (13) Agar (14) Buffers such as magnesium hydroxide and aluminum hydroxide, (15) Argy (16) Pyrogen-free water, (17) Isotonic saline solution, (18) Ringer's solution (19) Ethyl alcohol, (20) pH buffer solution, (21) Polyester, polycarbonate (22) Polynates and / or polyacid anhydrides, (22) polypeptides and amino acids, etc. (23) serum alcohol such as ethanol, and (23) used in pharmaceutical preparations Other non-toxic, compatible substances. Wetting agents, colorants, release agents, coating agents, sweeteners, flavorings. Excipients, fragrances, preservatives, and antioxidants may also be present in the formulation. Terms such as "pharmaceutically acceptable carrier" and "vehicle" are interchangeable in this specification. It is used.

[0290] The pharmaceutical composition adjusts the pH of the formulation to a predetermined level that reflects the physiological pH (for example, approximately To maintain a pH range of approximately 5.0 to 8.0, it may contain one or more pH buffering compounds. pH buffering compounds used in aqueous liquid formulations are amino acids or mixtures of amino acids. (For example, histidine, or a mixture of amino acids such as histidine and glycine) It is possible. Alternatively, a pH buffering compound is preferably used to raise the pH of the formulation to a predetermined level (for example) For example, maintain the temperature in the range of approximately 5.0 to 8.0, and use a drug that does not chelate calcium ions. Examples of such pH buffering compounds include imidazole and acetate ions. These include, but are not limited to, pH buffering compounds that bring the pH of a formulation to a predetermined level. It may be present in any amount suitable for maintenance.

[0291] A pharmaceutical composition may also contain one or more osmotic regulators, i.e., the osmotic properties of the formulation (e.g., (Tension, osmorality, and / or osmotic pressure) and the blood flow and blood of the recipient individual. It may contain compounds that adjust the osmotic pressure to an acceptable level in liquid cells. Osmotic regulators include calcium i It may be a drug that does not chelate ON. Osmotic regulators adjust the osmotic properties of the formulation. It may be any compound known or available to those skilled in the art. Those skilled in the art will use in the formulation of the present invention The suitability of a given osmotic pressure regulator can be empirically determined. Suitable types of osmotic pressure regulators Examples of osmotic pressure regulators include salts (e.g., sodium chloride and sodium acetate). , sugars (e.g., sucrose, dextrose, and mannitol), amino acids (e.g., (glycine), and mixtures of one or more of these drugs and / or drug types. Examples include, but are not limited to, compound formulations. Osmotic regulators adjust the osmotic properties of a formulation. It may be present at any concentration sufficient to do so.

[0292] In some embodiments, the pharmaceutical composition is, for example, for gene editing, delivered to the target. It is formulated for this purpose. A preferred route for administering the pharmaceutical compositions described herein is the pharmacy Intracutaneous, subcutaneous, percutaneous, intradermal, intrafocal, intraarticular, intraperitoneal, intrabladder, transmucosal, gingival, intradental, intracochlear , intratympanic cavity, intra-organ, epidural, intrathecal cavity, intramuscular, intravenous, intravascular, intraosseous, intraosseous, periophthalmos, intratumors, Intracerebral and intraventricular administration are examples, but are not limited to, these.

[0293] In some embodiments, the pharmaceutical compositions described herein are administered topically to the disease site. In some embodiments, the pharmaceutical compositions described herein are administered by injection via catheter. It is administered to the target by means of a suppository or by an implant, implant This includes porous, non-porous materials such as sialastic membranes or fibers. It is a porous or gel-like substance.

[0294] In other embodiments, the pharmaceutical compositions described herein are delivered in a controlled-release system. In one embodiment, a pump can be used (for example, Langer, 19 90,Science 249:1527-1533;,Sefton,1989,CR C Crit.Ref.Biomed.Eng.14:201, Buchwald et al. al.,1980,Surgery 88:507, Saudek et al.,1 See 989, N.Engl.J.Med.321:574. In another embodiment... Polymer materials can be used. (For example, Medical Applica tions of Controlled Release(Langer and W ise eds., CRC Press, Boca Raton, Fla., 1974) ,Controlled Drug Bioavailability,Drug Pr oduct Design and Performance(Smolen and Ball eds., Wiley, New York, 1984), Ranger an d Peppas,1983,Macromol.Sci.Rev.Macromol. See Chem. 23:61. Also, see Levy et al., 1985, Sc. ience 228: 190, During et al., 1989, Ann. eurol.25:351, Howard et ah, 1989, J. Neurosu See rg.71:105). Other controlled emission systems include, for example, the above Lan This is discussed in GER.

[0295] In some embodiments, the pharmaceutical composition is administered intravenously or subcutaneously to a subject (e.g., a human). A composition suitable for administration is formulated according to a standard procedure. In some embodiments, it is administered by injection. The pharmaceutical composition for administration by means of is a sterile isotonic solution as a solubilizer, and These are local anesthetics such as lignocaine used to relieve pain at the injection site. Generally, the components are This refers to, for example, dry freeze-dried activator in a sealed container such as an ampoule or sachet indicating the amount of activator. Available as a dry powder or a water-free concentrate, separately or mixed together in unit dosage forms. They are supplied by either method. When the drug is administered by infusion, the drug is a sterile drug grate. The pharmaceutical composition may be dispensed using an injection bottle containing water or saline solution. If administered by means of injection, ensure that the components can be mixed before administration using sterile water or raw water for injection. Ampoule of saline solution may be provided.

[0296] Pharmaceutical compositions for systemic administration are liquids, such as sterile saline or Ringer's lactate solution. , or Hanks' solution. In addition, the pharmaceutical composition may be in solid form. It can be redissolved or suspended immediately before use. A lyophilized form is also intended. Pharmaceutical composition These are contained within lipid particles or vesicles (e.g., liposomes or microcrystals suitable for parenteral administration). It may be included. Particles are included in the composition as long as they are in a single layer (unilamella). These can be particles of any preferred structure, such as r) or multilayer (plurilamellar). The compound is a fusion lipid dioleoylphosphatidylethanolamine (DOPE), low "Stabilized plasmid lipid particles" containing cationic lipids at levels (5-10 mol%) (S Encapsulated in PLP and stabilized by polyethylene glycol (PEG) coating. (Zhang YPet ah, Gene Ther. 1999, 6: 14) See pages 38-47). Such particles and vesicles contain N-[1-(2,3-dioles]. [Oiloxy)propyl]-N,N,N-trimethylammonium methyl sulfate Alternatively, positively charged lipids such as "DOTAP" are particularly preferred. The manufacturing process is well known. For example, U.S. Patent No. 4,880,635 and No. 4,906,477. , No. 4,911,928, No. 4,917,951, No. 4,920,016, See also No. 4,921,757 (each of them is referred to herein by reference). (It is used in reference to...)

[0297] The pharmaceutical compositions described herein may be administered or packaged, for example, as unit doses. The term "unit dose" is used in reference to the pharmaceutical compositions of this disclosure, and is intended for use in reference to the subject matter. This refers to a physically separated unit suitable as a unit dose, and each unit contains the necessary diluent ( That is, it is calculated to produce the desired therapeutic effect in relation to the carrier or vehicle. It contains a predetermined amount of active substance.

[0298] Furthermore, the pharmaceutical composition may be provided as a pharmaceutical kit, (a) in lyophilized form. A container containing the compound of the present invention, and (b) a pharmaceutically acceptable diluent (e.g., the freezing agent of the present invention). Includes a second container containing a sterilized material used for reconstituting or diluting the dried compound. (Optional) Specifically, anything accompanying such a container is used in the manufacture, use, or sale of pharmaceuticals or biological products. This may also be a form of notification prescribed by a government agency that regulates sales, and this notification may be a human This reflects approval by the agency for manufacture, use, or sale for administration to [the target population / entity].

[0299] In another embodiment, a manufactured product containing materials useful for treating the diseases described above (article o This includes f manufacture). In some embodiments, the manufactured product is a container and Includes labels. Suitable containers include, for example, bottles, vials, syringes, and test tubes. Examples include: Containers can be made from various materials such as glass or plastic. In some embodiments, the container holds a composition effective for treating the diseases described herein. It may have a sterile access port. For example, the container may have a piercing port accessible by a subcutaneous injection needle. It may be an intravenous infusion bag or vial having a topper. The activator in the composition is This is the compound of the present invention. In some embodiments, the label on or attached to the container is The composition indicates that it is used to treat a selected disease. The product contains phosphoric acid. A pharmaceutically acceptable buffered saline solution, such as Ringer's solution or dextrose solution. It may further include a second container containing a liquid. This is desirable from a commercial and user perspective. Other materials may further be included, other buffers, diluents, filters, needles, syringes, and This includes accompanying documents such as the instruction manual.

[0300] In some embodiments, a CRISPR system (e.g., Cas9 as described herein) is included. (m) is provided as part of a pharmaceutical composition. In some embodiments, the pharmaceutical composition is A fusion protein comprising any of the fusion proteins provided herein (e.g., LubCas9) (including nucleic acid base editors as described herein). In some embodiments, a pharmaceutical combination The product comprises one of the complexes provided herein. In some embodiments, a pharmaceutical combination The resulting product is an RNA guide nuclease that forms a complex with gRNA and cationic lipids (e.g. For example, it includes a ribonucleoprotein complex containing Cas9. In some embodiments, the pharmaceutical combination The products include gRNA, nucleic acid programmable DNA-binding proteins, cationic lipids, and Contains pharmaceutically acceptable excipients. The pharmaceutical composition optionally contains one or more additional therapeutic agents. It may contain therapeutic substances.

[0301] kit In one embodiment, the synthetic gRNA described herein is disclosed in the above methods and compositions. It may be provided in a kit containing one or more of the elements, and / or or can be produced. For example, the kit contains acceptor RNA, donor RNA, ligase, and may include suitable buffering reagents. Acceptor RNA, donor RNA, and ligase This may be any of the terms disclosed herein.

[0302] In some embodiments, the kit further includes a nucleic acid base editor.

[0303] In some embodiments, the kit utilizes one or more of the elements described herein. It contains one or more reagents for use in the process. The reagents are provided in any suitable container. It is possible. For example, a kit may provide one or more reaction or storage buffers. Reagents are, Available in a form suitable for use in a specific assay, or requiring the addition of one or more other components before use. It may be provided in the required form (e.g., concentrated or lyophilized form). The buffer is sodium carbonate. Thorium buffer, sodium bicarbonate buffer, borate buffer, Tris buffer, MOPS This includes, but is not limited to, buffers, HEPES buffers, and combinations thereof. It may be a buffer solution of any kind. In some embodiments, the buffer solution is alkaline. In its form, the buffer solution has a pH of approximately 7 to 10. In some embodiments, the kit is gas Insertion into the vector to operably link the id sequence and regulatory elements It contains one or more oligonucleotides corresponding to the guide sequence. In some embodiments, kit The formula contains homologous recombination template polynucleotides.

[0304] All publications, patent applications, patents, and other references mentioned herein are the exclusive rights of the author. The entire text is incorporated by reference. In addition, the materials, methods, and examples are illustrative only. It is not intended to be limited. Unless otherwise defined, the term used herein is... All technical and scientific terms are generally understood by those skilled in the art to which this invention pertains. It has the same meaning as to be interpreted as; a method similar to or equivalent to that described herein. The materials and methods can be used in carrying out or testing the present invention, but preferred methods and materials This is described herein. [Examples]

[0305] The following examples illustrate some preferred modes of fabrication and implementation of the present invention. However, these examples are for illustrative purposes only and are not intended to limit the scope of the invention. Please understand that this is not meant to be a diagram.

[0306] Example 1. Traditional RNA synthesis Traditional RNA synthesis involves the use of plasmid DNA and phosphoramidite chemistry (" This includes solid-phase synthesis using synthetic RNA. It also includes chemical synthesis and enzyme-based synthesis of synthetic RNA. A detailed comparison of the results is provided below.

[0307] directional Synthetic RNA is typically synthesized in the 3' to 5' direction. Regarding sgRNA, This is because most of the by-products have truncation in the 5' end spacer region. This means it leads to lower on-target editing.

[0308] substrate Chemical synthesis utilizes highly reactive monomers. These monomers reduce side reactions. To ensure that the functional group provides chemical protection and that the desired reaction occurs at the correct stage of the synthesis, To ensure that these monomers point to a common phosphoramidite functional group among them. And it is called "amidite". The chemical groups surrounding the phosphoramidite core are significantly It can be modified and does not need to be similar to naturally occurring nucleotides. Therefore, Chemical synthesis involves modified sugars, bases, skeletons, or functional groups that are not similar to natural nucleotides. It can be used to introduce more highly modified monomers.

[0309] Continuously Synthetic RNA is typically synthesized via sequence-controlled polymerization on a solid support. The synthesis is carried out in cycles, each containing various steps (see Figure 1). This procedure is as follows: It is designed to prevent unwanted nucleotide insertions or deletions as much as possible. Oligonucleotides that fail to be incorporated into the growing polymer at any stage will not be incorporated into the growing polymer. To prevent the sequence from extending beyond the position where it "failed" to be inserted, chemical It is "capped". "Coupling efficiency" is a term that refers to the overall efficiency of each cycle. This value depends greatly on the properties of the amidite, but also on the design of the apparatus or the scale of the reaction. It may also be affected by the ferrite core. Typical DNA coupling efficiency is approximately 98- The figure is 99.5%, and for DNA, it is generally higher than for RNA.

[0310] purification The oligo product is first deprotected and cleaved from the solid support before purification. In terms of type, electrophoretic separation (i.e., polyacrylamide gel electrophoresis or "PAGE") ), or more generally, column chromatography (i.e., HPLC) It is performed by either anion exchange or reversed-phase ion pair formation medium. The process is carried out using either stationary phase. Both methods increase as the length of the full-length product increases. Resolution is lost exponentially. The most common by-product in the mixture with purified FLP is full length This is particularly problematic because the product and its length are similar. Furthermore, GMP-grade materials are required. The large-scale synthesis required typically features lower coupling efficiencies, making it difficult to study the materials. Compared to the more commonly used small-scale synthesis used to produce it, the purity is lower. This leads to an increase in the number of adducts. Differences in coupling efficiency are most commonly due to the combination This is because as the scale of development increases, longer coupling times are required. Oligonucleotides with a length of approximately 100 nt (i.e., guide RNA used for base editing) are It is difficult to physically separate something that is only a few units short. This is due to these limitations. Therefore, the purity of gRNA derived from CMOs is most often obtained in the range of 50-90%. In a typical synthetic gRNA synthesis strategy, the majority of impurities, including the remaining 10-50%, are It contains deletions (mainly truncation products) and adducts in the pacer region. This type of impurity results in poor editing efficiency and / or off-target editing. It is likely.

[0311] Advantages of the modified process for producing long RNA High-purity, long RNA (e.g., 100 nucleotides or more) is produced through chemical synthesis. The methods include, for example, reducing off-target editing, highly efficient editing, and traditional compositing approaches. Compared to the increased purity, increased yield, reduced cost, and nucleation in synthesized RNA. It is desirable for several reasons, including the versatility of rheotide modification.

[0312] Modified chemosynthetic approaches to RNA production reduce off-target editing. This can result in a correlation between purity and off-target editing. Truncation products are expected to reduce both get edits and on-target edits. Regarding the main by-products, there is evidence suggesting the opposite. However, the adducts are off-target. It is highly likely that the amount of editing will increase.

[0313] Modified chemosynthetic approaches to RNA production may result in highly efficient editing. This means that, at least, most impurities (e.g., truncation) are active in editing. This is to reduce [the problem].

[0314] Modified chemosynthetic approaches for RNA production differ from traditional synthetic approaches. Compared to other methods, this can lead to increased purity. Increased purity of synthetic RNA can be used to treat human patients. This will likely make it easier to obtain regulatory approval for that use.

[0315] Modified chemosynthetic approaches for RNA production offer increased yield and lower costs. This can lead to a decrease. The yield of the synthetic RNA process is typically determined by the length of the synthetic RNA and It also decreases exponentially. Typically, 20-30% of the full-length product (FLP) is produced in the reaction. Although it is produced, only 3-5% of the theoretical yield is obtained after purification (therefore, it is produced in the reaction) >90% of the FLP is lost during purification. For example, 5 grams of GMP-grade FLP The cost for P (10 grams of material with 50% purity) is possible between $1 million and $2 million. It has the potential. If the majority of FLP can be isolated during purification, the production cost will be 5-1 It will decrease by a factor of 0, accompanied by an increase in purity.

[0316] Finally, a modified chemosynthetic approach to RNA production uses enzymatic synthesis. It is impossible to specifically introduce modified nucleotides and chemical functional groups. It can make power possible.

[0317] Example 2: A ligation-based approach to RNA synthesis The ligation-based approach described in this embodiment uses one or more RNA fragments. Next, ligation is performed to produce full-length guide RNA (gRNA). One or more R The preparation of NA fragments is more efficient, especially because it allows for better separation of by-products, resulting in higher gRNA levels. This enables a high yield after purification.

[0318] One aspect of the ligation-based approach is the dual-gas used in biology. The hematoma formed between the crRNA and tracrRNA molecules that make up the idRNA system. Using Rix (known as Repeat Anti-Repeat Helix), two synthesis This will serve as a template for enzymatic ligation of RNA. This is shown in Figure 2.

[0319] In some embodiments, the length and arrangement composition of this helix are appropriate non-covalent bonds. Promotes association and optimal ligation region for enzymes compatible with RNA ligation. They are modified to create positions. A nucleotide length of 5 to 50 nucleotides corresponds to these types of associations. This is desirable. In some embodiments, the donor nucleic acid base is C and the acceptor is A. In some cases, enzyme ligation can be more efficient. In some embodiments, non-covalent bonding The Tm (melting temperature) of the associated RNA is greater than 0°C, and is 1°C, 2°C, 3°C, 4°C, 5°C. ℃, 6℃, 7℃, 8℃, 9℃, 10℃, 11℃, 12℃, 12℃, 14℃, 15℃, 16 The temperature is 17°C, 18°C, 19°C, 20°C, or higher. For example, the stem length is , promotes the formation of stem loops above the temperature at which ligation is performed, and ligation It can be modified to a length sufficient to avoid the self-structure of non-conforming elements. As further examples... The variability of the spacer sequence can lead to base pairing that does not match ligation. This is possible, but this is because the spacer sequence is complementary to the donor sequence before being combined with it. This can be avoided by adding oligonucleotides that have a column.

[0320] In some embodiments, RNA containing a tracrRNA sequence has a phosphate at its 5' end. It is synthesized with (called the "donor") and then converted by one of several ligases The 3' end of the second RNA containing the variable protospacer region (called the "acceptor") It is ligated to (the tracrRNA sequence). In some embodiments, it includes a tracrRNA sequence. RNA is synthesized such that a portion of the tracrRNA contains a phosphate at its 5' end. It can be done.

[0321] This approach allows for two forms of ligation (Panel A(1) in Figure 3). (2) and (3), both of these are found within the stem-loop region. The first form of Egation occurs within the hairpin terminal loop, which is the natural site of T4 RNA ligase 1. The second form of ligation involves T4 RNA ligase 2 and DNA ligase. It occurs naturally within the double helix. One of the advantages of this form of ligation is, Due to the significant difference in elution times between the fusion gRNA and the fragment impurities, the fragment impurities are easily removed. It is removable (Panel B in Figure 3).

[0322] Another ligation-based approach of the present invention is via a non-templated approach. This involves ligation of two or more RNA fragments. In this approach, the donor molecule The 3'-hydroxyl at the 3' end is chemically blocked or removed (e.g., dideoxylin Cleotide, enzyme (e.g., T4 RNA ligase 1) properly connects the two molecules. It catalyzes the ligation process. Generally, this ligation strategy is preferred at higher concentrations.

[0323] The ligation approach described in this example combines nucleic acid sections with each other. The class of enzymes that combines these enzymes is called ligase. The advantage of using such ligase is The ligatures between the resulting RNA fragments are indistinguishable from those of naturally occurring RNA or DNA. Ligases function on RNA or DNA and carry out reactions with high efficiency.

[0324] In some embodiments, the RNA fragments intended for ligation are first and second By using nucleic acid templates that have complementarity to two RNA fragments, ligation The reaction can be brought into physical proximity. This template is specified in this specification. Then, it is called a sprint. A sprint is caused by a specific ligase, for example, T4 RNA ligase. Incomplete base pairing is used to generate loops suitable for ligation by gauze 1. It can be designed. In some embodiments, the sprint combines two or more RNA fragments. It is used for that purpose.

[0325] In some embodiments, RNA fragments form base pairs with each other before the ligation reaction. This approach can be met by doing so. This approach is referred to as "self-template" in this specification. This is called "self-template formation." Ligation of RNA fragments using the self-template formation approach. Possible stem loop positions to choose for the omission include loop or oligo One example is a helix containing a short stem loop (e.g., a self-templated nick). It can be done. Sprints, overhangs, and blunt ends can also include nicks, and bulges It can also be used (see Figure 5).

[0326] In some embodiments, the ligation reaction involves the prior physical assembly of RNA sections. It can proceed with high yield without needing to do so. Considering this, the selected ly Gational responses do not require the use of sprints or self-templates.

[0327] Figure 5 shows a different ligation approach of the present invention.

[0328] Using the ligation-based approach described herein, various ligations The design is being investigated (Figure 6). As shown in Figure 6, one of these designs is S This involves ligation of two RNA fragments within the loop of the Tem loop (Figure 6, Panel B). Another design involves ligation in the helix of the stem loop (Panel C in Figure 6). ).

[0329] These ligation strategies are described as follows: Other reports on the synthesis of sgRNAs used to form natural phosphate ligations in other regions This differs from the chemical ligation strategy that is being proposed. It uses a segmented synthetic approach. The advantage is that, compared to full-length sgRNA, the shorter sections of RNA yield higher purity after purification. It can be produced at a certain degree. In some embodiments, the 5' acceptor is the smallest RNA cleavage. It consists of a single unit (30-50 nucleotides), and therefore reaches high levels before ligation. It can be purified. The 3' donor is terminated with the phosphate necessary for synthesis, Therefore, only the full-length fragment is incorporated into the full-length product (i.e., truncation is based (Not of quality.)

[0330] gRNAs with more than 100 nucleotides, such as pegRNA or Cas12b gRNA. This advantage increases when considering NA. The type of enzyme ligation is very high The yield is high (>80%), and the oligonucleotide starting material is ligated with high selectivity. It can be separated from the processed product, ensuring that the total product is extremely pure. Furthermore, These types of enzymatic ligation are relatively inexpensive and easy to scale.

[0331] Example 3: Exemplary ligation-based RNA synthesis protocol An exemplary protocol for the synthesis of synthetic RNA is provided below.

[0332] 1. Stem size and ligation location (loop or helix) i) Use Requirements for the natural substrate of the ligase used (e.g., loop-versus-helix design) and ii) Bisection determined using a thermodynamic algorithm for RNA double-strand stability The selection is based on the affinity of the child helix.

[0333] 2. RNA fragments are synthesized using standard phosphoramidite chemistry. 3'RN Fragment A (donor) contains the terminal 5' phosphate, which is included in the final step of synthesis. .

[0334] 3. Purify the RNA fragments by HPLC (the fragments are then subjected to anion exchange chromatography). - Use either AEX (Aerospace Exposure) or ion-pair reversed-phase chromatography (IP-RP). (It can also be purified by this method.)

[0335] 4. Annealing: Each oligonucleotide (0.01-1 mM) is mixed with annealing buffer. Combine with (25 mM KCl, 0.025 mM EDTA). Heat at 80°C for 0.5-5 Heat for 1 minute, then cool to 25°C at a rate of 0.1°C / second.

[0336] 5. Ligation: Add RNA ligase buffer to 1X concentration (at 20-37°C). 50 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT, 1 mM A Achieve TP (pH 7.5). 5-10U of T4 RNA ligase (1 / nmol) of phosphate. Add the 5' end of the compound. Incubate overnight at a temperature of 20-37°C. Add 0.5M EDTA. Then it stops.

[0337] 6. Calculation by ion-pair reversed-phase chromatography (IP-RP) (and potentially AEX). The manufacturing process is used.

[0338] 7. SYBR Safe-stained 6% PAGE-D gel and IP-RP HPLC Analysis by [source].

[0339] Figure 7 shows an example of the results of a ligation experiment. In this ligation, the reactants This consists of a 10 μM donor fragment, a 10 μM acceptor fragment, and 1 × T4 RNA ligase 2. It contains reaction buffer (NEB) and 20 units of T4 RNA ligase 2, and is prepared at 37°C. The procedure was performed. Panel A in Figure 7 shows the sequence used in the ligation experiment. The results of the spectrometry are shown in panel C of Figure 7. The full-length product was detected by HPLC, and the full-length product RNA acceptors and donor fragments were also detected by HPLC from the material.

[0340] Example 4: Differences between the described approach and the previous method In particular, the previously described ligation approach involves unnatural interactions between fragment RNA molecules. It depends on the linkage and / or through the use of azide-alkyne cyclization reactions. Do not couple smaller RNA molecules to sgRNA via non-natural tyrazole ligation. Which non-templated ligation approach is used, the ligation of this invention The ligation approach differs from the previously described RNA ligation approach. The use of unnatural couplings as described above is because unnatural couplings are desirable in biological systems. It has several drawbacks, including the possibility of having negative effects.

[0341] The ligation approach described herein is also applicable to other versions of "Crick Chemistry". Alternatively, before combining RNA fragments into full-length sgRNA using other chemical biocombination methods This is also different from the chemical ligation strategy used (see Figure 4). It combines RNA fragments. Other previously described approaches for this include amide-ligation chemistry (for example) Using amide coupling of 18-atom linkers and self-template One example is the formation of sgRNA. The previous approach is for at least the following reasons It is more disadvantageous. i) The chemical group used for ligation is the same as the present invention as described herein. Unlike the incorporation of phosphates, the likelihood of incorporation in high yield is low. ii) The previously used linkage is unnatural and significantly larger than that of natural phosphodiester linkages. Due to these limitations, the previously described RNA ligation approach loses its effectiveness. This could potentially lead to further regulatory burdens.

[0342] Example 5: Comparison of sgRNA production-ligases In this embodiment, two structures, namely one in which ligation occurs in the loop, are present. On the other hand, the other evaluates the structure in which ligation occurs in the stem (Figure 3) and which rigger We determined which ligase yielded the highest yield of sgRNA products. We used T4 RNA ligase 1. Used for ligation in the stem, and T4 RNA ligase 2 for ligation in the stem. It was used for that purpose.

[0343] Panel A of Figure 3 shows the two locations for the evaluated enzyme ligation. (i) (ii) a stem loop, and (ii) a helix. In both cases, this stem loop The section was extended and used to assemble the sections for enzymatic ligation. Panel B in Figure 3 shows the removal of RNA fragments that were not ligated after ligation. To that end, a representative model demonstrating that the final purification step, including HPLC, can be performed. A rough sample is shown. Purification of RNA fragments from the full-length product is possible.

[0344] Overcoming the challenges that limit the purity and final (post-purification) yield of synthetic RNA, chemical And developing a process for synthesizing a single guide RNA using an enzymatic combination strategy. This approach was launched. This approach uses LONGEST (enzyme and autotemplate) Nucleic acid guide ligation, ligation of nucleic acid guides using enzymes and se This is called lf-templating, where two or more partially complementary synthetic RNAs are used by an enzyme to refract A ligation-based approach is used. In one embodiment, In physics, the dual-guide RNA system used by SpCas9 constitutes the system. A helix (repeat anti-repeat helix) is located between the crRNA and tracrRNA molecules. A (known as 'x') is formed, and the enzymatic ligation of two synthetic RNAs is template It is then ligated (Figure 3). The length and sequence composition of this helix are suitable for non-covalent association. It promotes RNA ligation and compatibility without reducing the activity of the RNP complex. It can be modified to create the optimal ligation site for the enzyme. tracrRN RNA containing most of the A sequence is synthesized with a phosphate at its 5' end (called donor). (It will be discovered), this is due to either T4 RNA ligase 1 or T4 RNA ligase 2 This refers to the 3' end of the second RNA containing the variable protospacer region (called the acceptor). It is ligated to ). Along with this approach, there are two forms of ligation. As illustrated (Figure 3), the first is inside the terminal loop of the hairpin (substrate of T4 RNA ligase 1) The second is intra-double strand (substrate for T4 RNA ligase 2 and DNA ligase).

[0345] In these experiments, both T4 RNA ligase 1 and T4 RNA ligase 2 were used. Rabina evaluated the design of donor / acceptor RNA fragments. The protozoa of these gRNAs The pacer was alpha1. Compared to T4 RNA ligase 1, T4 RNA ligase 1 Gauze 2 was determined to have produced the highest yield and the fewest by-products. "Compared to the gRNA design, only two bases are added to the final sgRNA product, here We also found a donor / acceptor design that produces a quantitative yield of sgRNA under the conditions we investigated. Ta.

[0346] Experimental conditions. All reactions containing T4 RNA ligase 2 require 10 μM donor and 10 μM a Xceptor, 1×T4 RNA ligase 2 reaction buffer, and 20 units of T4 RNA ligase The mixture contained gauze 2. All reactions were carried out at 37°C for 15 hours.

[0347] In the case of reaction with T4 RNA ligase 1, all reactions require 10 μM donor, 10 μM acceptor, NEB reaction buffer, 1 mM ATP, and 20 units of T4 RN It contained A ligase 1. Some reactions also involved 25% (weight / volume) of PEG800. It contained 0. The reaction was carried out at 25°C for 15 hours.

[0348] All reactions were carried out in a thermocycle at 50 μL. The complex before ligation. To form it, first, the solution containing all components except the ligase is heated to 70°C, For T4 RNA ligase 2 or T4 RNA ligase 1, respectively, at 37°C or The temperature was slowly cooled to 25°C at a rate of 0.1°C / second.

[0349] RNA donor and RNA acceptor design - T4 RNA ligase 1 and T4 R NA Ligauze 2 It consists of RNA acceptor 1 (Acp-01) and RNA donor 1 (Dnr-1). The stem ligation design was evaluated first. Post-ligation helical of tetraloop. The upper helix has a total of 14 base pairs (L) with a mixed GCAU content. The complex before ergization contained 10 base pairs between the fragments (Panel A in Figure 8). The reaction yielded high yields and detected a detectable amount of anisotropy in samples containing T4 RNA ligase 2. There were few or no fragments (Panel B in Figure 8). Ligauze and Dnr-01 Alternatively, a control reaction (not shown) using only Acp-01 did not show the formation of side reactions. Ta.

[0350] The designs of other RNA donors and RNA acceptors that were evaluated were RNA acceptors Helix ligation settings for RNA donor 2 (Acp-02) and RNA donor 2 (Dnr-2) The total was calculated. The helix after ligation had an upper helix with a mixed GCAU content. The reaction contained 14 base pairs in Rix (Panels A and B in Figure 9). The yield was lower (approximately 60%) than that obtained with T4 RNA ligase 2. A control reaction (not shown) using only (phosphorylated) Dnr-02 results in the formation of a side reaction. This demonstrated that (cyclization of Dnr-02 is possible with T4 RNA ligase 1). T4 RNA Ligase 2 requires a double-stranded complex, therefore Ac in the presence of T4 RNA ligase 2 The reaction between p-02 and Dnr-02 did not form a product. These results were obtained from these experiments. The data suggests that T4 RNA ligase 2 may be preferable to T4 RNA ligase 1. This suggests that the remaining data was generated using T4 RNA ligase 2.

[0351] RNA donor and RNA acceptor design - GC content and stem nucleotide length Impact Compared to the earlier Dnr-01 / Acp-01 tetraloop design, it shares the following features: Two RNA constructs were evaluated: i) higher GC content in the upper and lower stems. ii) A shorter upper stem (panels A-D in Figure 10). The lower stem is Cas It is understood to interact with 9, but previous reports indicated that of the four bases of the U track It has been shown that these three can be replaced by GC base pairs. We evaluated the sgRNAs and found that they were active, but their activity was not consistent with standard sgRNA design. It was found to be lower than that of other things.

[0352] The data shows that the ligase reaction between Acp-03 and Dnr-03 is productive. This demonstrated high-yield synthesis and compatibility. The reaction using gauze is productive, as indicated by the loss of the Dnr-04 peak. It appeared to be moving towards completion. The Acp / Dnr-04 system is 7 base pairs shorter but still It is productive and represents a significant improvement over the Acp / Dnr-01 system.

[0353] Studies using gRNA in which the U-track of the bottom stem is partially replaced with GC base pairs. Edits in Acp / Dnr-03 and Acp / Dnr-04 (as shown) Following the result of the reduction, the U-track of the bottom stem was not changed, and the upper stem was shortened. The design including the element was evaluated (Figure 11). Formed from the ligation of Acp / Dnr-03. Designed to have an upper stem sequence similar to that of the sgRNA (Acp / Dnr-06). I also investigated, and the ligation site is located 1 bp further away from the tetraloop. It was placed there.

[0354] The data shows that the reaction using ligase between Acp-05 and Dnr-05 is Acp / D It demonstrated that it is productive, similar to the nr-04 reaction system, and in these early designs Higher GC content in the lower stem loop (at least Alpha-1 Protospace) It was shown that it is not necessary for quantitative reactions (using sir). Acp-06 and Dnr-06 and The reaction using ligase between them was also productive. The upper stem loop was ligase Because it was similar to Acp / Dnr-03, where only the position of the genital area changed, these The results show that the ligation site, located at least 3 base pairs away from the tetraloop, is efficient. This demonstrates that ligation is possible. The Acp / Dnr-06 system has a single additional Because it only contains base pairs, minimal changes to the "standard" sgRNA design yield high yields. We demonstrated its suitability for rate synthesis.

[0355] We examine "standard" sgRNA designs and check if they are compatible with ligation. (Figure 12). The upper stem loop contains only four base pairs, so the ligation part The position was included exactly two base pairs away from the tetraloop. Acp in the presence of ligase The reaction between -07 and Dnr-07 yielded a low yield (Figure 13). Further side reactions also occurred. This further demonstrates that well-associated double strands are useful for high-yield reactions.

[0356] Furthermore, using the same donor fragment (Dnr-05), the relationship between the donor and acceptor fragments was investigated. Two different protospacer sequences that change only in the protospacer sequence not required for self-assembly. RNA ligation with acceptor fragments (Acp-05 and Acp-05_v2) The reaction was performed. This involved using a universal donor in combination with various acceptor fragments. This illustrates the concepts used.

[0357] RNA donor and RNA acceptor design - the effect of RNA concentration on reaction productivity We conducted studies to evaluate the effect of RNA concentration on reaction productivity. In this study, Acp / Dnr-05 and Acp / Dnr-6 were used. Compared to Acp / Dnr-6, 05 has a more stable acceptor / donor double strand. These studies have shown that the concentrations of both fragments are related to the production of sgRNA. It was evaluated as such (Figure 13). The data was found to have a more stable A / D double helix. This demonstrates that higher concentrations of substrate enable higher yields.

[0358] Based on this data, a concentration of 1 mg / ml or higher may be suitable for manufacturing. The temperature of the ligation reaction will also affect the data (all the actuals described here) (Note that the experiment was conducted at 37°C). T4 RNA ligase 2 was found at 20°C. It has also been shown to be effective. Figure 13 shows that the yield is maximized at approximately 80%. However, this is due to the absorption of the starting material, which does not match the ligation that comes from the donor fragment. This may be because there are by-products such as truncation that contribute to it, and therefore this value is an underestimation. It could be an evaluation.

[0359] Thermodynamic effects on sgRNA production Under the tested conditions, (formed by increasing length and / or GC content) The thermodynamically more stable double helix (which is used) provided higher yields to a certain extent, but the standard These changes to the "quasi" design were not necessary to form the product, and 60% still It is obtained by doing so. However, much higher yields can be achieved with only moderate modifications. The advantage of this is that both 1 and 10 additional bp provide similar yields, while the upper helix The yield of a "standard" sgRNA design with 4 bp is only 1 bp more in the upper helix. As can be seen from the results, which are significantly lower than when using p (AD-06), Since it approaches the limit with just one additional bp, it doesn't expand linearly.

[0360] It is noteworthy that all the studies described here were conducted at 37°C, and this T4 RNA Gauze 2 can tolerate lower temperatures, and if so, it can withstand temperatures above the "standard" 4 bp. It is highly likely that higher yields are possible at lower temperatures with Rix. Changing the conditions alters the energy theory of the association. Therefore, RNA design is affected. This objective is achieved using various parameters, including those that are external or inherent. This is possible. These conditions include, for example, changes in reaction temperature and RNA concentration.

[0361] conclusion These data are used to design the fragments and ligases used in the LONGEST approach. A method was established. In particular, T4 RNA ligase 2 yielded a higher yield than T4 RNA ligase 1. It was found that it produces a high amount of RNA with few side effects. Furthermore, T4 RNA ligase 2 is It accepts a double-stranded substrate having a ligation site three or more base pairs away from the tetraloop. It was also found that it could be included. Furthermore, it yielded high yields compared to those with standard sgRNA designs. A fragment design containing only one additional base pair (Acp / Dnr-06) was also found. (102 nucleotides vs. 100 nucleotides, respectively). Further research is needed in this system. To evaluate the Acp / Dnr-06 design in terms of editing activity and reaction scale-up. The purpose is to achieve this.

[0362] Example 6: Tolerance to skeletal modifications and temperature tolerance Tolerance for skeletal modifications Various fragments were analyzed to determine tolerance for skeletal modifications. The following fragments were analyzed: i) Complete RNA, ii) Containing a 2'O-methyl group and a phosphorothioate group at the end Those typically referred to as "terminal MODs," as well as iii) ligation sites Including modifications (both 5' donor nucleotide and 3' acceptor nucleotide), A sequence containing 48 nucleotides (48%) modified with a 2'O-methyl group. Acp Two sets of modified guides based on the / Dnr-05 and Acp / Dnr-6 designs were tested. The data from these studies were compiled (AD_09 and AD_08, respectively). The data from these studies are shown in Figure 14. This is shown in Nell A and B. These data, as a whole, indicate the success of the extensively modified fragments. It's showing a hidden reaction.

[0363] Tolerance to temperature sgRNA was produced at either 20°C or 37°C. The data obtained from these experiments The results showed that the reaction was productive at all the temperatures tested. The finding that it also functions at temperatures indicates that the reaction is robust and works at temperatures that facilitate manufacturing. This demonstrates that it is possible.

[0364] Example 7: Base editing in cells The base editing activity of the purified product against specific gene targets in mammalian cells This was successfully implemented in Acp-05 and Dnr- 05, Acp-06 and Dnr-06, and the counter-response of Acp-08 and Dnr-08 The results were obtained using DA-05, DA-06, and AD-08 from the response. (Figure 15). For these studies, target sites in fibroblasts were identified using an adenine base editor (AB). E) and three guide RNAs synthesized using the autotemplated ligation method ( Edited using one of the following: AD-08, AD-05, or AD-06.

[0365] Example 8: Cas12b guide RNA Cas12b sgRNA can be synthesized using the method disclosed herein. Figure 16 shows Bacillus hisashii, bhCas12b sgRNA. This is a schematic diagram showing an example Cas12b sgRNA and its associated sequence and structure. Various features, including various secondary structures such as tetraloops, are available in the desired Cas12b sgR. It can be used as a target for splitting and ligating to produce NAs.

[0366] Figure 16 shows the splitting of sgRNA according to the method described herein, followed by the subsequent lysatellite Various exemplary locations where gates can be targeted are shown. Figure 16 shows a variable protospacer. The secondary structure of bhCas12b sgRNA, containing both the - region and the invariant region, is shown. Labels A, B, and C are hairpins that can be targeted as sites for splitting sgRNA. The loop structure is shown. The double strand of hairpin labeled as C is this tetraloop Cas Because it does not come into contact with the protein, it is extended at the proximal position of the loop, affecting the donor and acceptor. This can promote hybridization.

[0367] array Table 4 (below) shows the arrangements referenced in the examples and corresponding drawings. [Table 4]

[0368] mN indicates a nucleotide with a 2'OMe modification, and N* indicates a 3'phosphothioe modification. This shows a nucleotide with a modification, where "p" indicates the position where the phosphate group is located.

[0369] Equivalents and range Those skilled in the art will recognize many equivalents to the specific embodiments of the present invention described herein. This can be confirmed by either being aware of it or simply by using standard experiments. The scope of the patent is not intended to be limited to the above description, but rather to include the following patents. As stated in the scope of the claim.

Claims

1. The first RNA is brought into contact with the second RNA. The first RNA and the second RNA are complementary to at least five RNAs It contains a cleotide, and the contact described above forms a stem structure or a stem-loop structure. to, The ligation enzyme then processes the first RNA and the second RNA, (i) Ligation within the stem structure, or (ii) Ligation at the end of the stem structure, thereby the stem structure Forming a loop at the end, Methods that include...

2. The aforementioned contact forms a stem structure, and the ligation enzyme, the stem The first RNA and the second RNA are ligated at the ends of the structure, thereby The method according to claim 1, wherein a loop is formed at the end of the stem structure.

3. The aforementioned contact forms a stem-loop structure, and the ligation enzyme, The first RNA and the second RNA are ligated within the stem of the stem-loop structure. The method according to claim 1.

4. The ligation enzymes are T4 RNA ligase 1, T4 RNA ligase 2, and Rt cB ligase, heat-stable 5'App DNA / RNA ligase, ElectroLiga se, T4 DNA ligase, T3 DNA ligase, T7 DNA ligase, Taq DNA ligase, SplintR ligase E. coli DNA ligase, 9°N DN A-ligase, CircLigase, CircLigase II, DNA ligase I, Prior claim selected from the group consisting of DNA ligase III and DNA ligase IV. The method described in any one of the items.

5. The method according to claim 2, wherein the ligation enzyme is T4 RNA ligase 1.

6. The method according to claim 3, wherein the ligation enzyme is T4 RNA ligase 2.

7. The first and / or second RNA is chemically synthesized, as per any of the prior claims. The method described in item 1.

8. The first RNA is clustered regularly intersper sed short palindromic repeat (CRISPR) RNA ( crRNA) and the second RNA is trans-activating RNA (tracrRNA) The method according to any one of the prior claims.

9. The method according to any one of the prior claims, wherein guide RNA (gRNA) is produced.

10. The first RNA and / or the second RNA are chemically synthesized, prior claim The method described in any one of the items.

11. The first and / or second RNA is synthesized enzymatically according to claims 1 to 9. The method described in either of the above terms.

12. The first RNA and the second RNA are ligated with a ligation enzyme. This creates a phosphodiester linkage between the first RNA and the second RNA. , the method according to any one of the prior claims.

13. The nucleotides of the first RNA and / or the second RNA form a non-covalent association. The method according to any one of the prior claims, which is operated to enable

14. The stem-loop has a length of approximately 2 to 50 nucleotides, as per any of the prior claims. The method described in item 1.

15. The first RNA and the second RNA have complete complementarity, The method according to any one of the prior claims, comprising an RNA nucleotide.

16. The first RNA and the second RNA have complete complementarity, and at least three, four The method according to claim 14, comprising 5, 6, or 7 consecutive RNA nucleotides.

17. The RNA nucleotide having complete complementarity is located in the upper stem and / or lower stem. The method according to claim 15 or 16, which exists in Mu.

18. The first RNA and the second RNA At least 5, 6, or 7 complementary elements in the lower stem formed by A The method according to any one of the prior claims, comprising a sequence of RNA nucleotides.

19. The first RNA and the second RNA are complementary in the upper stem, Each comprises 4 to 14 consecutive RNA nucleotides, as described in any one of the prior claims. The method.

20. The first RNA and the second RNA are complementary in the upper stem of four The method according to claim 19, comprising a continuous RNA nucleotide.

21. The first and second RNAs are complementary in the upper stem, and consist of five consecutive The method according to claim 19, comprising RNA nucleotides.

22. The first and second RNAs are complementary in the upper stem, with seven consecutive The method according to claim 19, comprising RNA nucleotides.

23. The first and second RNAs are complementary in the upper stem, forming 14 consecutive The method according to claim 19, comprising RNA nucleotides.

24. The first and second RNAs are complementary in the lower stem, with seven consecutive The method according to any one of the prior claims, comprising an RNA nucleotide.

25. The first RNA and / or the second RNA are used for the ligation enzyme. A method according to any one of the prior claims, which is operated to create an igation site. 。

26. The aforementioned stem loops are 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 , or the method according to any one of the prior claims, comprising a loop of 16 nucleotides 。

27. The method according to any one of the prior claims, wherein the stem loop includes a tetraloop.

28. The method according to claim 16, wherein the loop comprises seven nucleotides.

29. Ligating the first RNA and the second RNA is the loop or The ligases are located at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 base pairs apart. The method according to any one of claims 26 to 28, which occurs in the area of ​​the body.

30. The ligation site is located two or three base pairs from the loop, as described in claim 29. Method of loading.

31. Ligating the first RNA and the second RNA from the bulge is Even if not present, ligesi are found in 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 base pairs. A method according to any one of the prior claims, which occurs in the area of ​​the prior art.

32. Ligating the first RNA and the second RNA is the bulge The ligation site occurs at 3, 4, 5, or 11 base pairs, as described in claim 31. The method.

33. The first RNA and / or the second RNA are produced enzymatically, according to the prior claim. The method described in any one of the items.

34. The first RNA can form a 3' base pair with a portion of the second RNA. The method according to any one of the prior claims, including a column.

35. The first RNA comprises a phosphate at its 5' end, as described in any one of the prior claims. Method of loading.

36. The method according to claim 35, wherein the first RNA is a donor RNA.

37. The second RNA includes a variable protospacer region, according to any one of the prior claims. Method of description.

38. The method according to claim 37, wherein the second RNA is an acceptor RNA.

39. The first RNA comprises adenosine triphosphate at its 5' end, according to claim 35. method.

40. Approximately 8 to 50 nucleotides are complementary, and the first RNA and the second RNA The method according to any one of the prior claims, which enables base pairing between them.

41. The method according to claim 40, wherein the 8 to 50 nucleotides are partially complementary.

42. The 8 to 50 nucleotides are approximately 50% to 99% complementary, as described in claim 41. The method.

43. The method according to claim 41, wherein the 8 to 50 nucleotides are completely complementary.

44. The first and second RNAs have different nucleotide lengths, according to the prior claims. The method described in either of the above terms.

45. The first RNA has about 20 to 100 nucleotides, according to claim 44. method.

46. The second RNA has about 20 to 70 nucleotides, any of the prior claims The method described in item 1.

47. The method according to any one of the prior claims, wherein base pairing occurs in the lower stem.

48. The seven nucleotides are complementary in the lower stem and are preceding the first RNA. The method according to claim 47, which enables base pairing with the second RNA.

49. The method according to claim 47 or 48, wherein the base pairing occurs in the upper stem.

50. Two nucleotides are complementary in the upper stem and are preceding the first RNA. The method according to claim 49, which enables base pairing with the second RNA.

51. The aforementioned gRNA has approximately 100 nucleotides, approximately 125 nucleotides, and approximately 150 nucleotides. A length of approximately 175 nucleotides, approximately 200 nucleotides, or more than approximately 200 nucleotides. The method according to any one of claims 9 to 50, having the characteristic.

52. The aforementioned gRNA is an elongation guide RNA, a prime editor guide RNA (pegRNA). ), or Cas12a guide RNA, Cas12b guide RNA, Cas12c guide RNA, Cas12d, guide RNA, Cas12e guide RNA, Cas12f guide RNA, Cas12g guide RNA, Cas12h guide RNA, Cas12i guide RNA Cas12 guide RNA such as NA, Cas12j guide RNA, or Cas12k guide RNA. The method according to any one of the prior claims, wherein the guide RNA is a guide RNA.

53. The gRNA is located in the spacer, lower stem, bulge, upper stem, nexus, and The method according to any one of the prior claims, comprising one or more of the appins.

54. The first RNA and the second RNA are in a ratio of approximately 0.5:1, 0.6:1, and 0.7:

1. 、０．８：１、０．９：１、１：１、１：０．９、１：０．８、１：０．７、１：０．６ The method according to any one of the prior claims, or the method according to any one of the prior claims, wherein the two are present in a ratio of 1:0.

5.

55. The aforementioned gRNA is approximately 50%, approximately 55%, approximately 60%, approximately 65%, approximately 70%, approximately 75%, and Produced with yields of 80%, approximately 85%, approximately 90%, approximately 95%, approximately 99%, or higher. The method according to any one of the prior claims.

56. The gRNA yielded 50%, 55%, 60%, and 65% of the conventional synthesis method. , improving by 70%, 75%, 80%, 85%, 90%, 95%, 99% or more A method according to any one of the prior claims, which is produced.

57. To provide a first RNA containing a 5'-monophosphate, To provide a second RNA, Oligonucleated RNA having partial complementarity with the first RNA and the second RNA A rheotide, wherein the complementarity of the oligonucleotide is the first and second RNAs. To provide oligonucleotides that enable base pairing with, A ligase that catalyzes ligation between the first RNA and the second RNA is provided. To provide, and therefore to produce synthetic gRNA, A method for producing synthetic guide RNA (gRNA) including [the specified element].

58. A method for producing synthetic guide RNA (gRNA), To provide a first RNA containing a 5'-monophosphate, To provide a second RNA containing a blocked 3' end, The present invention provides a ligase that catalyzes ligation between the first RNA and the second RNA. A method comprising producing the synthetic gRNA.

59. The first RNA is a transactivating RNA (tracrRNA), and the second is RNA clustered regularly interspersed sh ort palindromic repeat (CRISPR) RNA (crRNA) The method according to claim 57 or 58.

60. The method according to claim 57, wherein the oligonucleotide is approximately 100 nucleotides long. 。

61. To provide two or more RNA fragments, The oligonucleotide having partial complementarity to the two or more RNA fragments Therefore, the complementarity of the oligonucleotide is such that it forms base pairs with the two or more RNA fragments. To provide oligonucleotides that enable, The present invention provides a ligase that catalyzes ligation between two or more RNA fragments, and therefore The production of the aforementioned synthetic guide RNA, A method for producing synthetic guide RNA (gRNA) including [the specified element].

62. The two or more RNA fragments are located at the overhang, blunt end, or bulge. The method according to claim 61, wherein the method is gaited.

63. Guide RNA (gRN) synthesized by the method described in any one of claims 1 to 62 A) Or prime editing guide RNA (pegRNA).

64. Targeted transcriptional activation, targeted transcriptional repression, targeted epigenetic modification, and This is a method for targeted genome modification, wherein the method is (a) synthetic guide RNA (gRNA) as defined in any one of the prior claims (b) At least one CRISPR / Cas protein, or the nucleus encoding it acid This includes introducing it into eukaryotic cells. The interaction between (a) and (b) and the target sequence in chromosomal DNA is targeted transcriptional activity Sexualization, targeted transcriptional repression, targeted epigenetic modification, or targeted genome A method that brings about modification.

65. A method for targeted RNA modification, wherein the method is (a) synthetic guide RNA (gRNA) as defined in any one of the prior claims (b) At least one CRISPR / Cas protein, or the nucleus encoding it acid This includes introducing it into eukaryotic cells. The interaction between (a) and (b) and RNA expressed by chromosomal DNA is the same as the stain A method for modifying the RNA expressed by chromophore DNA.

66. The RNA expressed by the chromosomal DNA is messenger RNA (mRNA). The method according to claim 65, which is as follows.

67. The aforementioned CRISPR / Cas proteins include Cas9, Cpf1, SaCas, and Cas1.

2. A choice between Cas13 or a modified version thereof, claims 64-6 The method described in any one of item 6.

68. To produce synthetic guide RNA (gRNA) according to any one of claims 1 to 67 The method.

69. The second RNA can form a 3' base pair with a portion of the first RNA. The method according to claim 68, including a column.

70. The second RNA comprises a variable protospacer region, as described in claim 68 or 69. The method.

71. The first RNA contains a phosphate at its 5' end, any one of claims 68 to 70. The method described in section [section number].

72. The aforementioned contact forms a stem-loop structure, and the ligation enzyme, The first RNA and the second RNA are ligated within the stem of the stem-loop structure. The method according to any one of claims 68 to 71.

73. The method according to claim 72, wherein the ligation enzyme is T4 RNA ligase 2. 。

74. The method according to claim 73, wherein the stem loop includes a GC base pair in the upper stem. 。

75. The upper stem is identical to CGAUACGACAGAAC by at least approximately 80%. The method according to claim 74, comprising a nucleotide sequence that is sexual.

76. The upper stem is a nucleoty that has at least approximately 80% identity with respect to CGCCG. The method according to claim 74, comprising a D array.

77. The upper stem is a nucleus that has at least approximately 80% identity with respect to CGGCCGC. The method according to claim 74, comprising an ocid sequence.

78. The upper stem is a nucleoty that has at least approximately 80% identity with respect to CGCGC. The method according to claim 74, comprising a D array.

79. The upper stem is a nucleotide that has at least about 80% identity with respect to CGAU. The method according to claim 74, comprising an array.

80. The method according to claim 72, wherein the stem loop includes a GC base pair in the lower stem. 。

81. The method according to any one of claims 68 to 79, wherein the lower stem does not contain a GC base pair. 。

82. The method according to any one of claims 68 to 81, wherein the upper stem does not contain a GC base pair. 。

83. The upper stem has at least 1, 2, 3, 4, 5 or 6, 7, 8, 9, 10, 11 Or the method according to any one of claims 68 to 81, comprising 12 GC base pairs.

84. The method according to claim 83, wherein the upper portion of the stem contains two GC nucleotides.

85. Ligation of the first and second RNAs is at least 60%, 7 Claims 68-84 yield a total product yield of 0%, 80%, 90%, or more than 95%. The method described in any one of the items.

86. Ligating the first and second RNAs results in at least about 60% The method according to claim 85, which yields a yield.

87. The gRNA is produced in an amount of at least 1 gram, according to claims 1 to 63 or 68. The method described in any one of paragraphs 86.

88. Large scales, at least 5 grams, 10 grams, 20 grams, 30 grams, 40 grams Lamb, 50 grams, 60 grams, 70 grams, 80 grams, 90 grams, or 100 grams The method according to claim 87, comprising rum.

89. The gRNA is produced in an amount of less than 1 gram, according to claims 1 to 63 or 68 to 88. The method described in any one of the items.

90. The aforementioned gRNA was present in amounts of approximately 0.05 grams, 0.1 grams, 0.2 grams, 0.3 grams, and 0. 4 grams, 0.5 grams, 0.6 grams, 0.7 grams, 0.8 grams, or 0.9 grams The method according to claim 89, which is produced in an amount of g.

91. The above method yields a purity of approximately 50%, 60%, 70%, 80%, 90%, or more than 90% in g The method according to any one of claims 68 to 90, which produces RNA.

92. The first RNA is synthesized in the 3' to 5' direction, any one of claims 68 to 91. The method described in section [section number].

93. The second RNA is synthesized in the 3' to 5' direction, any one of claims 68 to 92. The method described in section [section number].

94. The aforementioned gRNA has approximately 100 nucleotides, approximately 125 nucleotides, and approximately 150 nucleotides. A length of approximately 175 nucleotides, approximately 200 nucleotides, or more than approximately 200 nucleotides. The method according to any one of claims 68 to 93, having the characteristic.

95. The aforementioned loops are 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, and The method according to any one of claims 68 to 94, wherein the nucleotide comprises 16 nucleotides.

96. The method according to claim 95, wherein the loop is a tetraloop.

97. The method according to claim 95, wherein the loop comprises seven nucleotides.

98. Ligating the first RNA and the second RNA is the loop or any of claims 68 to 97, which occur at ligation sites that are at least about three base pairs apart The method described in item 1.

99. The ligation region is 1, 2, 3, 4, 5, 6, or 10 bases from the loop. The method according to claim 98.

100. Claims 1 to 63, wherein the first and / or second RNA comprises one or more skeletal modifications. Or the method described in any one of items 68 to 99.

101. If one or more of the aforementioned skeletal modifications include 2'O-methyl or phosphorothioate modifications, The method described in claim 100.

102. The one or more skeletal modifications are 2'-O-methyl3'-phosphorothioate, 2'O-methyl Chill, 2'-ribo-3'-phosphorothioate, deoxy, or 5'-phosphate modification The method according to claim 100, which is selected from among the.

103. Claim 101 or 102, wherein one or more of the modifications are present at the ligation site. Methods used.

104. The one or more modifications described above are present in the donor RNA and / or acceptor RNA. The method according to claim 103.

105. The 3' and / or 5' ends of the donor RNA have one or more skeletal modifications. The method according to claim 104.

106. The 3' and / or 5' ends of the acceptor RNA have one or more skeletal modifications. The method according to claim 104.

107. The claim that the concentration of the first and / or second RNA is about 1 g / L to 5 g / L. The method described in any one of items 1 to 63 or 68 to 106.

108. The claim 107, wherein the concentration of the first and / or second RNA is about 1 g / L method.

109. The concentration of the first and / or second RNA is approximately 3 g / L, as described in claim 107. Method of loading.

110. The first RNA contains a phosphate at its 5' end and the second RNA contains a variable protospacer region. A preceding RNA comprising the first and second RNAs, wherein the first and second RNAs are linked by a non-covalent bond. A composition produced by the method described in any one of the claims.

111. The first RNA contains a phosphate at its 5' end and the second RNA contains a variable protospacer region. Claim 1, comprising RNA, wherein the first and second RNAs are bound to a ligase. A composition produced by the method described in any one of items 103.

112. The composition according to claim 111, wherein the ligase is T4 RNA ligase 2.

113. Nucleochi has at least approximately 80% identity with CGAUACGACAGAAC. A composition comprising RNA containing a sequence.

114. Claim 113, wherein the nucleotide sequence is identical to CGAUACGACAGAAC. The composition described above.

115. RNA containing a nucleotide sequence that is at least approximately 80% identical to CGCCG. A composition containing the following:

116. The composition according to claim 115, wherein the nucleotide sequence is identical to that of CGCCG.

117. R containing a nucleotide sequence that is at least approximately 80% identical to CGGCCGC A composition containing NA.

118. The composition according to claim 117, wherein the nucleotide sequence is identical to CGGCCGC. 。

119. RNA containing a nucleotide sequence that is at least approximately 80% identical to CGCGC. A composition containing the following:

120. The composition according to claim 119, wherein the nucleotide sequence is identical to that of CGCGC.

121. A kit comprising the composition according to any one of claims 110 to 120.

122. The first RNA containing the transactivating RNA (tracrRNA) sequence, variable protospension A kit containing a second RNA including a ligase region.

123. The kit according to claim 122, wherein the ligase is T4 RNA ligase 2.

Images