Cells having a deletion in one or more of the KIR gene cluster region, LILR gene cluster region, and KLR gene cluster region, and a method for producing the same.

Abstract

This provides a method for investigating the HLA allele type-dependent regulation of NK cell function by KIR, LILR, and KLR. [Solution] This disclosure relates to deletions (particularly large deletions) in one or more regions of the KIR gene cluster region, the LILR gene cluster region, and the KLR gene cluster region. This disclosure provides cells having a deletion in one or more regions of the KIR gene cluster region, the LILR gene cluster region, and the KLR gene cluster region. This disclosure also provides cells containing a set of positive and negative markers within a 1000 kbp region including one or more regions of the KIR gene cluster region, the LILR gene cluster region, and the KLR gene cluster region.

Description

[Technical Field]

[0001] This disclosure relates to cells having a deletion in one or more of the KIR gene cluster region, the LILR gene cluster region, and the KLR gene cluster region, and to a method for producing the same. [Background technology]

[0002] Regions containing clusters of killer cell immunoglobulin-like receptor (KIR) genes and regions containing clusters of leukocyte immunoglobulin-like receptor (LILR) genes remain difficult to analyze even in 2022 due to their polymorphism and structural complexity, including the presence of repetitive sequences, and functional analysis of these genes has not been sufficiently performed (Non-Patent Literature 1 and 2). Furthermore, KIR and LILR, receptors expressed on the membrane surface of natural killer (NK) cells that activate or inactivate the cytotoxic function of NK cells in a HLA protein-dependent manner on target cells, function in a HLA type or allele-type dependent manner, but their interrelationships have often not been verified. KIR, LILR, and HLA are all known to frequently exhibit polymorphisms compared to normal genomic regions, and polymorphisms in KIR and LILR, as well as HLA polymorphisms, are known to be associated with diseases. While it has been suggested that this is due to HLA allele-type-dependent activation or inactivation of NK cells, the causal relationship has not been verified. Similar to KIR and LILR, killer cell lectin-like receptors (KLRs) are genes that perform HLA-dependent activation or inactivation of NK cells, but like KIR and LILR, their function has not been sufficiently analyzed.

[0003] Technologies have been developed to induce large-scale deletions in the genome. Patent document 1 and non-patent document 3 describe the acquisition of cells with deletions in the regions containing MLH1, p53, CD44, MET, and APP, respectively. [Prior art documents] [Patent Documents]

[0004] [Patent Document 1] WO2021 / 206054A [Non-patent literature]

[0005] [Non-Patent Document 1] Immunogenetics, 74:369-379, 2022 [Non-Patent Document 2] Journal of Human Genetics, 60:703-708, 2015 [Non-Patent Document 3] Nature Communication, 13:4219, 2022 [Overview of the Initiative]

[0006] Individual gene analysis was considered effective for verifying the HLA allele-type-dependent regulation of NK cell function by KIR, LILR, and KLR. However, this first requires the creation of cells lacking all three genes. It has been revealed that there are at least seven types of KIR, nine types of LILR, and six types of KLR genes, and in order to delete all of them, it is necessary to delete the entire region containing these repetitive sequences and complex structures.

[0007] This disclosure provides cells having a deletion in one or more of the KIR gene cluster region, the LILR gene cluster region, and the KLR gene cluster region, and a method for producing the same.

[0008] According to the present inventors, deletions of KIR genes located within the killer cell immunoglobulin-like receptor (KIR) gene cluster region, LILR genes located within the LILR gene cluster region, and KLR genes located within the killer cell lectin-like receptor (KLR) gene cluster region were induced in genomic DNA. This disclosure provides a method for suitably producing cells having such genomes. The present inventors have also revealed that silencing can occur with respect to negative selection markers during deletion cell selection. A method for producing cells that take silencing into account is also provided.

[0009] According to this disclosure, for example, the following inventions are provided. (1) Vertebrate cells comprising genomic DNA having a deletion, wherein the deletion is (i) A deletion of part or all of the KIR gene group located within the killer cell immunoglobulin-like receptor (KIR) gene cluster region in one or two alleles, wherein the part of the KIR gene group includes at least one connected region, and the connected region includes 50% or more of the KIR gene encoding genes contained in each of the regions, (ii) A deletion of part or all of the LILR gene group located within the leukocyte immunoglobulin-like receptor (LILR) gene cluster region in one or two alleles, wherein the part of the KIR gene group includes at least one connected region, and / or (iii) A deletion of part or all of the KLR gene group located within the killer cell lectin-like receptor (KLR) gene cluster region in one or two alleles, wherein the part of the KLR gene group includes at least one connected region, and the connected region includes 50% or more of the KLR gene encoding genes contained in each of the regions. cell. (2) The cell described in (1) above, wherein the deletion includes the deletion of the entire KIR gene group. (3) The cell according to (1) or (2) above, wherein the deletion includes a deletion of the entire leukocyte immunoglobulin-like receptor (LILR) gene group. (4) The cell according to (1) above, wherein the deletion includes at least a part of the KIR gene group and at least a part of the LILR gene group. (5) The cell according to (1) or (4) above, wherein the deletion includes a deletion of the entire KIR gene group and a deletion of the entire LILR gene group. (6) The cell according to (1) above, wherein the deletion includes a deletion of the entire KIR gene group on one allele. (7) The cell according to (1) or (6) above, wherein the deletion includes a deletion of the entire LILR gene group on one allele. (8) The cell according to (1) above, wherein the deletion includes at least a part of the KIR gene group and at least a part of the LILR gene group on one allele. (9) The cell according to (1) or (8) above, wherein the deletion includes a deletion of the entire KIR gene group on one allele and a deletion of the entire LILR gene group on one allele. (10) The cell according to (1) above, wherein the deletion includes a deletion of the entire KIR gene group on two alleles. (11) The cell according to (1) or (10) above, wherein the deletion includes a deletion of the entire LILR gene group on two alleles. (12) The cell according to (1) above, wherein the deletion includes at least a part of the KIR gene group and at least a part of the LILR gene group on two alleles. (13) The cell according to (1) or (12) above, wherein the deletion includes a deletion of the entire KIR gene group on two alleles and a deletion of the entire LILR gene group on one allele. (14) A method for producing an isolated cell in which two or more alleles of a chromosomal genome are modified, (a) introducing the following (i) and (ii) into an isolated cell (excluding a fertilized egg) containing two or more alleles to introduce a selection marker gene into each of the two or more alleles; (i) A genome modification system comprising a sequence-specific nucleic acid cleavage molecule that targets a target region in two or more alleles of the chromosomal genome and can cleave the target region, or a polynucleotide encoding the sequence-specific nucleic acid cleavage molecule, (ii) Two or more donor DNAs for selection markers, each having an upstream homology arm having a base sequence capable of homologous recombination with the base sequence upstream of the target region, and a downstream homology arm having a base sequence capable of homologous recombination with the base sequence downstream of the target region, and between the upstream homology arm and the downstream homology arm, including the base sequence of a selection marker gene for positive selection, the two or more donor DNAs for selection markers for positive selection each have a distinguishable different selection marker gene, the selection marker gene for positive selection is unique for each type of donor DNA for selection marker, and the number of types of donor DNA for selection marker is equal to or more than the number of alleles to be genome-modified, two or more donor DNAs for selection markers, wherein the selection marker gene for positive selection is a drug resistance gene, and each of the two or more donor DNAs for selection markers has, between the upstream homology arm and the downstream homology arm, a selection marker gene for positive selection, a marker gene for negative selection, and a target sequence, (b) After the step (a), by homologous recombination of different types of donor DNAs for selection markers with respect to the two or more alleles, respectively, distinguishable different unique selection marker genes are introduced into the two or more alleles, and a step of selecting an isolated cell that expresses all of the introduced distinguishable different selection marker genes for positive selection (step for positive selection), confirming the proportion of cells that undergo silencing of the expression of the negative expression marker in the selected cells; comprising when the proportion is below the reference value, (c) After the step (b), introducing the following (iii) and (iv) into the selected cells to introduce a donor DNA for recombination into the two or more alleles, (iii) A genome modification system comprising a sequence-specific nucleic acid cleavage molecule that targets the target sequence and can cleave the target sequence, or a polynucleotide encoding the sequence-specific nucleic acid cleavage molecule. (iv) Recombinant donor DNA containing a desired base sequence, comprising an upstream homology arm having a base sequence homologously recombinable with the base sequence upstream of the target region, and a downstream homology arm having a base sequence homologously recombinable with the base sequence downstream of the target region, (d) After step (c), a step of selecting cells that do not express the negative selection marker gene (a step for negative selection), Further including, method. (15) A cell population containing multiple cells, Each cell contains a set of positive and negative markers for each of its two alleles (for example, a locus containing a gene cluster). A positive-negative marker set includes positive selection markers and negative selection markers, wherein positive selection markers in the same cell are distinguishable from each other, and negative selection markers in the same cell are distinguishable from each other. A cell population in which the proportion of cells in which the negative selection marker is silenced is between 0.00001% and 10%. (16) A cell population including vertebrate cells, Each vertebrate cell contains a set of positive and negative markers in each of two alleles within a region of less than 500 kbp containing the killer cell immunoglobulin-like receptor (KIR) gene cluster region, and / or contains a set of positive and negative markers in each of two alleles within a region of less than 500 kbp containing the leukocyte immunoglobulin-like receptor (LILR) gene cluster region. A positive-negative marker set includes positive selection markers and negative selection markers, wherein positive selection markers in the same cell are distinguishable from each other, and negative selection markers in the same cell are distinguishable from each other. A cell population in which the proportion of cells in which the negative selection marker is silenced is 10% or less. (17) A composition comprising the cell population described in (16) above. (18) The composition described in (16) above, further comprising additional vertebrate cells.

[0010] The present invention includes, as an example, the following embodiments. By this method, cells having deletions of the KIR gene group and / or the KLR gene group can be produced. [1] A genome modification method that modifies two or more alleles of the chromosomal genome at an MHC gene locus (in particular a method that modifies two or more alleles of the chromosomal genome to delete a specific group of genes), (a) A step of introducing (i) and (ii) below into cells containing the chromosome, (i) A genome modification system comprising a sequence-specific nucleic acid cleavage molecule that targets a target region of the chromosomal genome, or a polynucleotide encoding the sequence-specific nucleic acid cleavage molecule. (ii) Two or more selection marker donor DNAs containing the base sequence of a selection marker gene between an upstream homology arm having a base sequence homologous to the base sequence adjacent to the upstream side of the target region and a downstream homology arm having a base sequence homologous to the base sequence adjacent to the downstream side of the target region, wherein the two or more selection marker donor DNAs each contain a different selection marker gene, and the number of types of selection marker donor DNAs is equal to or greater than the number of alleles targeted for genome modification, (b) A genome modification method comprising the step of selecting the cells after step (a) based on all of the selection marker genes contained in the two or more selection marker donor DNAs. [2] The genome modification method according to [1], wherein the selection marker gene is a positive selection marker gene, and step (b) is a step of selecting cells that express the same number of positive selection marker genes as the number of alleles. [3] The genome modification method according to [2], wherein the donor DNA for selection markers further has a negative selection marker gene between the upstream homology arm and the downstream homology arm. [4] (c) After step (b), a step of introducing recombinant donor DNA containing a desired base sequence into the cell between an upstream homology arm having a base sequence homologous to a base sequence adjacent to the upstream side of the target region and a downstream homology arm having a base sequence homologous to a base sequence adjacent to the downstream side of the target region; and (d) After step (c), a step of selecting cells that do not express the negative selection marker gene, according to [3]. [5] The genome modification method according to [3] or [4], wherein the positive selection marker gene is a drug resistance gene and the negative selection marker gene is a fluorescent protein gene. [6] The genome modification method according to any one of [1] to [5], wherein the sequence-specific nucleic acid cleavage molecule is a sequence-specific endonuclease. [7] The genome modification method according to [6], wherein the genome modification system comprises a Cas protein and a guide RNA having a base sequence homologous to the base sequence in the target region. [8] A genome modification kit for modifying two or more alleles of a chromosomal genome, comprising (i) and (ii) below. (i) A genome modification system comprising a sequence-specific nucleic acid cleavage molecule that targets a target region of the chromosomal genome, or a polynucleotide encoding the sequence-specific nucleic acid cleavage molecule. (ii) Two or more selection marker donor DNAs, each containing the base sequence of a selection marker gene between an upstream homology arm having a base sequence homologous to the base sequence adjacent to the upstream side of the target region and a downstream homology arm having a base sequence homologous to the base sequence adjacent to the downstream side of the target region, wherein the two or more selection marker donor DNAs each contain a different selection marker gene, and the number of types of selection marker donor DNAs is equal to or greater than the number of alleles targeted for genome modification. [9] The genome modification kit according to [8], wherein the selection marker gene is a positive selection marker gene.

[10] The genome modification kit according to [9], wherein the selection marker donor DNA further has a negative selection marker gene between the upstream homology arm and the downstream homology arm.

[11] The genome modification kit described in any one of [8] to

[10] , wherein the sequence-specific nucleic acid cleavage molecule is a sequence-specific endonuclease.

[12] A genome modification kit according to any one of [8] to

[11] , comprising a Cas protein and a guide RNA having a base sequence homologous to the base sequence in the target region.

[0011] The present invention includes, as an example, the following embodiments. By this method, cells having a deletion in one or more of the KIR gene cluster region, the LILR gene cluster region, and the KLR gene cluster region can be produced. [1] A method for producing cells in which two or more alleles of the chromosomal genome have been modified, (a) The steps of introducing (i) and (ii) below into cells containing two or more alleles to introduce a selection marker gene into each of the two or more alleles, (i) A genome modification system comprising a sequence-specific nucleic acid cleavage molecule capable of targeting and cleaving target regions in two or more alleles of the chromosomal genome, or a polynucleotide encoding the sequence-specific nucleic acid cleavage molecule. (ii) Two or more types of select marker donor DNA, each having an upstream homology arm having a base sequence homologously recombinable with the base sequence upstream of the target region and a downstream homology arm having a base sequence homologously recombinable with the base sequence downstream of the target region, and containing the base sequence of the select marker gene between the upstream homology arm and the downstream homology arm, wherein each of the two or more types of select marker donor DNA has a select marker gene that is distinguishable from each other, the select marker gene is unique to each type of select marker donor DNA, and the number of types of select marker donor DNA is equal to or greater than the number of alleles targeted for genome modification, (b) After step (a), a step of selecting cells that express all of the introduced, distinctly different, unique selection marker genes, by homologous recombination of different types of selection marker donor DNA with respect to the two or more alleles (a step for positive selection), Methods that include... [2] A method for modifying two or more alleles of a chromosomal genome, (a) The steps of introducing (i) and (ii) below into cells containing two or more alleles to introduce a selection marker gene into each of the two or more alleles, (i) A genome modification system comprising a sequence-specific nucleic acid cleavage molecule capable of targeting and cleaving target regions in two or more alleles of the chromosomal genome, or a polynucleotide encoding the sequence-specific nucleic acid cleavage molecule. (ii) Two or more types of select marker donor DNA, each having an upstream homology arm having a base sequence homologously recombinable with the base sequence upstream of the target region and a downstream homology arm having a base sequence homologously recombinable with the base sequence downstream of the target region, and containing the base sequence of the select marker gene between the upstream homology arm and the downstream homology arm, wherein each of the two or more types of select marker donor DNA has a select marker gene that is distinguishable from each other, the select marker gene is unique to each type of select marker donor DNA, and the number of types of select marker donor DNA is equal to or greater than the number of alleles targeted for genome modification, (b) After step (a), a step of selecting cells that express all of the introduced, distinctly different, unique selection marker genes, by homologous recombination of different types of selection marker donor DNA with respect to the two or more alleles (a step for positive selection), Methods that include... [3] The method according to [1] or [2] above, wherein the target region has a length of 5 kbp or more. [4] The method according to [3] above, wherein the target region has a length of 8 kbp or more. [5] Each of two or more selection marker donor DNAs has a selection marker gene for positive selection, a marker gene for negative selection, and a target sequence between the upstream homology arm and the downstream homology arm, wherein if the selection marker gene is used for both positive and negative selection, it does not need to have another selection marker gene for negative selection. (c) After step (b) above, a step of introducing (iii) and (iv) below into selected cells to introduce recombinant donor DNA into the two or more alleles, (iii) A genome modification system comprising a sequence-specific nucleic acid cleavage molecule that targets the target sequence and can cleave the target sequence, or a polynucleotide encoding the sequence-specific nucleic acid cleavage molecule. (iv) Recombinant donor DNA containing a desired base sequence, comprising an upstream homology arm having a base sequence homologously recombinable with the base sequence upstream of the target region, and a downstream homology arm having a base sequence homologously recombinable with the base sequence downstream of the target region, (d) After step (c), a step of selecting cells that do not express the negative selection marker gene (a step for negative selection), The method described in any of the above [1] to [4], further including the method described in any of [1] to [4]. [6] Each of two or more selection marker donor DNAs has a selection marker gene for positive selection, a marker gene for negative selection, and a target sequence between the upstream homology arm and the downstream homology arm, wherein if the selection marker gene is used for both positive and negative selection, it does not need to have another selection marker gene for negative selection. (c) After step (b) above, a step of introducing (iii) and (iv) below into selected cells to introduce recombinant donor DNA into the two or more alleles, (iii) A genome modification system comprising a sequence-specific nucleic acid cleavage molecule that targets the target sequence and can cleave the target sequence, or a polynucleotide encoding the sequence-specific nucleic acid cleavage molecule. (iv) Recombinant donor DNA containing a desired base sequence, comprising an upstream homology arm having a base sequence homologously recombinable with the base sequence upstream of the target region, and a downstream homology arm having a base sequence homologously recombinable with the base sequence downstream of the target region, (d) After step (c), a step of selecting cells that do not express the negative selection marker gene (a step for negative selection), The method described in [3] above, further comprising: [7] Each of two or more selection marker donor DNAs has a selection marker gene for positive selection, a marker gene for negative selection, and a target sequence between the upstream homology arm and the downstream homology arm, wherein if the selection marker gene is used for both positive and negative selection, it does not need to have another selection marker gene for negative selection. (c) After step (b) above, a step of introducing (iii) and (iv) below into selected cells to introduce recombinant donor DNA into the two or more alleles, (iii) A genome modification system comprising a sequence-specific nucleic acid cleavage molecule that targets the target sequence and can cleave the target sequence, or a polynucleotide encoding the sequence-specific nucleic acid cleavage molecule. (iv) Recombinant donor DNA containing a desired base sequence, comprising an upstream homology arm having a base sequence homologously recombinable with the base sequence upstream of the target region, and a downstream homology arm having a base sequence homologously recombinable with the base sequence downstream of the target region, (d) After step (c), a step of selecting cells that do not express the negative selection marker gene (a step for negative selection), The method described in [4] above, further comprising: [8] The method according to any one of [5] to [7] above, wherein the region between the upstream homology arm and the downstream homology arm of the recombinant donor DNA has a length of 5 kbp or more. [9] The method according to [6] or [7] above, wherein the region between the upstream homology arm and the downstream homology arm of the recombinant donor DNA has a length of 5 kbp or more.

[10] The method according to [7] above, wherein the region between the upstream homology arm and the downstream homology arm of the recombinant donor DNA has a length of 5 kbp or more.

[11] The method according to [8] above, wherein the region between the upstream homology arm and the downstream homology arm of the recombinant donor DNA has a length of 8 kbp or more.

[12] A genome modification kit for modifying two or more alleles of a chromosomal genome, comprising (i) and (ii) below. (i) A genome modification system comprising a sequence-specific nucleic acid cleavage molecule capable of targeting and cleaving a target region of the chromosomal genome, or a polynucleotide encoding the sequence-specific nucleic acid cleavage molecule, (ii) Two or more types of select marker donor DNA, each having an upstream homology arm having a base sequence homologously recombinable with the base sequence upstream of the target region, and a downstream homology arm having a base sequence homologously recombinable with the base sequence downstream of the target region, with the base sequence of the select marker gene included between the upstream homology arm and the downstream homology arm, the two or more types of select marker donor DNA having mutually distinguishable select marker genes, the select marker gene being unique to each type of select marker donor DNA, and the number of types of select marker donor DNA being equal to or greater than the number of alleles targeted for genome modification.

[13] The kit described in

[12] above, wherein the target region has a length of 5 kbp or more.

[14] The kit described in

[13] above, wherein the target region has a length of 8 kbp or more.

[15] A kit according to any of

[12] to

[14] above, further comprising recombinant donor DNA.

[16] A kit according to any one of

[12] to

[15] above, wherein the region between the upstream homology arm and the downstream homology arm of the recombinant donor DNA has a length of 5 kbp or more.

[17] A kit according to any one of

[12] to

[16] above, wherein the region between the upstream homology arm and the downstream homology arm of the recombinant donor DNA has a length of 8 kbp or more.

[18] The kit according to

[12] above, wherein the target region has a length of 5 kbp or more, and the region between the upstream homology arm and the downstream homology arm of the recombinant donor DNA has a length of 5 kbp or more.

[19] The kit according to

[18] above, wherein the target region has a length of 8 kbp or more, and the region between the upstream homology arm and the downstream homology arm of the recombinant donor DNA has a length of 8 kbp or more.

[20] The method according to [5] above, wherein the recombinant donor DNA does not have a base sequence in the region between the upstream homology arm and the downstream homology arm of the recombinant donor DNA, and in the two or more alleles of the chromosomal genome obtained after modification, the upstream and downstream sequences of the target region are seamlessly linked without base insertions, substitutions, or deletions.

[21] The method according to [6] or [7] above, wherein the recombinant donor DNA has no base sequence in the region between the upstream homology arm and the downstream homology arm of the recombinant donor DNA, and in the two or more alleles of the chromosomal genome obtained after modification, the upstream and downstream sequences of the target region are seamlessly linked without base insertions, substitutions, or deletions.

[22] The method according to [3] above, wherein the two or more alleles of the chromosomal genome obtained after modification do not contain target sequences for site-directed recombinant enzymes.

[23] The method according to [4] above, wherein the two or more alleles of the chromosomal genome obtained after modification do not contain target sequences for site-directed recombinant enzymes.

[24] The method according to [5] above, wherein the two or more alleles of the chromosomal genome obtained after modification do not contain target sequences for site-directed recombinant enzymes.

[25] The method according to [6] or [7] above, wherein the two or more alleles of the chromosomal genome obtained after modification do not contain target sequences for site-directed recombinant enzymes.

[26] The method according to any of [1] to

[11] and

[20] to

[25] above, wherein single-cell cloning is not performed in the process up to selecting cells in which two or more alleles have been modified in step (b).

[27] A cell having two or more alleles on the chromosomal genome with respect to a target region, wherein the target region of each of the two or more alleles is deleted, and the upstream and downstream sequences of the target region are seamlessly linked without base insertions, substitutions, or deletions.

[28] The cell described in

[27] above, wherein the target region has a length of 5 kbp or more.

[29] The cells described in

[27] or

[28] above, which do not have a target sequence for site-directed recombinant enzymes in their genome.

[30] The method according to [6] or [7] above, wherein the region between the upstream homology arm and the downstream homology arm of the recombinant donor DNA has a length of 8 kbp or more.

[31] The kit according to

[15] above, wherein the recombinant donor DNA does not have a base sequence in the region between the upstream homology arm and the downstream homology arm of the recombinant donor DNA.

[0012] The present disclosure further provides the following invention: This method makes it possible to produce cells having a deletion in one or more of the KIR gene cluster region, the LILR gene cluster region, and the KLR gene cluster region. <1> A method for producing isolated cells in which two or more alleles of the chromosomal genome have been modified, (a) The steps of introducing the following (i) and (ii) into isolated cells containing two or more alleles (preferably excluding fertilized eggs) to introduce a selection marker gene into each of the two or more alleles, (i) A genome modification system comprising a sequence-specific nucleic acid cleavage molecule capable of targeting and cleaving target regions in two or more alleles of the chromosomal genome, or a polynucleotide encoding the sequence-specific nucleic acid cleavage molecule. (ii) Two or more selection marker donor DNAs, each having an upstream homology arm having a base sequence homologously recombinable with the base sequence upstream of the target region and a downstream homology arm having a base sequence homologously recombinable with the base sequence downstream of the target region, and including the base sequence of a selection marker gene for positive selection between the upstream homology arm and the downstream homology arm, wherein each of the two or more selection marker donor DNAs has a selection marker gene that is distinguishable from each other, the selection marker gene for positive selection is unique to each type of selection marker donor DNA, and the number of types of selection marker donor DNAs is equal to or greater than the number of alleles targeted for genome modification, wherein the selection marker gene for positive selection is preferably a drug resistance gene, and each of the two or more selection marker donor DNAs has a selection marker gene for positive selection, a marker gene for negative selection, and a target sequence between the upstream homology arm and the downstream homology arm, (b) After step (a), homologous recombination of different types of selection marker donor DNA is performed on each of the two or more alleles, thereby introducing distinctly different unique selection marker genes into each of the two or more alleles, and a step of selecting isolated cells that express all of the introduced distinctly different selection marker genes for positive selection (a step for positive selection), (c) After step (b) above, a step of introducing (iii) and (iv) below into selected cells to introduce recombinant donor DNA into the two or more alleles, (iii) A genome modification system comprising a sequence-specific nucleic acid cleavage molecule that targets the target sequence and can cleave the target sequence, or a polynucleotide encoding the sequence-specific nucleic acid cleavage molecule. (iv) Recombinant donor DNA containing a desired base sequence, comprising an upstream homology arm having a base sequence homologously recombinable with the base sequence upstream of the target region, and a downstream homology arm having a base sequence homologously recombinable with the base sequence downstream of the target region, (d) After step (c), a step of selecting cells that do not express the negative selection marker gene (a step for negative selection), Includes, Preferably, the target region has a length of 10 kbp or more. method. <2> A method for modifying two or more alleles of a chromosomal genome, (a) The steps of introducing the following (i) and (ii) into isolated cells containing two or more alleles (preferably excluding fertilized eggs) to introduce a selection marker gene into each of the two or more alleles, (i) A genome modification system comprising a sequence-specific nucleic acid cleavage molecule capable of targeting and cleaving target regions in two or more alleles of the chromosomal genome, or a polynucleotide encoding the sequence-specific nucleic acid cleavage molecule. (ii) Two or more selection marker donor DNAs, each having an upstream homology arm having a nucleotide sequence homologously recombinable with the nucleotide sequence upstream of the target region and a downstream homology arm having a nucleotide sequence homologously recombinable with the nucleotide sequence downstream of the target region, and including the nucleotide sequence of a selection marker gene for positive selection between the upstream homology arm and the downstream homology arm, wherein each of the two or more selection marker donor DNAs has a mutually distinguishable selection marker gene for positive selection, the selection marker gene for positive selection is unique to each type of selection marker donor DNA, and the number of types of selection marker donor DNAs is equal to or greater than the number of alleles targeted for genome modification, wherein the selection marker gene for positive selection is preferably a drug resistance gene, and each of the two or more selection marker donor DNAs has a selection marker gene for positive selection, a marker gene for negative selection, and a target sequence between the upstream homology arm and the downstream homology arm, (b) After step (a), a step of selecting isolated cells that express all of the introduced distinguishably distinct and unique selection marker genes, by homologous recombination of different types of selection marker donor DNA with respect to the two or more alleles (a step for positive selection); (c) After step (b), a step of introducing recombinant donor DNA into the two or more alleles by introducing (iii) and (iv) below into the selected cells; (iii) A genome modification system comprising a sequence-specific nucleic acid cleavage molecule that targets the target sequence and can cleave the target sequence, or a polynucleotide encoding the sequence-specific nucleic acid cleavage molecule. (iv) Recombinant donor DNA containing a desired base sequence, comprising an upstream homology arm having a base sequence homologously recombinable with the base sequence upstream of the target region, and a downstream homology arm having a base sequence homologously recombinable with the base sequence downstream of the target region, (d) After step (c), a step of selecting cells that do not express the negative selection marker gene (a step for negative selection), Includes, Preferably, the target region has a length of 10 kbp or more. method. <3> The target region has a length of 10kbp or more and 40kbp or less, as described above. <1> or <2> Methods used. <4> The target region has a length of 10kbp or more and 20kbp or less, <3> Methods used. <5> The upstream homology arm and the downstream homology arm are each 500 bp to 3,000 bp, <1> ~ <4> One of the methods described above. <6> The upstream homology arm and the downstream homology arm are each 500 bp to 3,000 bp, <3> Methods used. <7> The upstream homology arm and the downstream homology arm are each 500 bp to 3,000 bp, <4> Methods used. <8> The region between the upstream homology arm and the downstream homology arm of the recombinant donor DNA has a length of 5 kbp or more. <1> ~ <7> One of the methods described above. <9> The region between the upstream homology arm and the downstream homology arm of the recombinant donor DNA has a length of 5 kbp or more. <3> or <4> Methods used. <10> The region between the upstream homology arm and the downstream homology arm of the recombinant donor DNA has a length of 5 kbp or more. <4> Methods used. <11> The region between the upstream homology arm and the downstream homology arm of the recombinant donor DNA has a length of 8 kbp or more. <8> Methods used. <12> A genome modification kit for modifying two or more alleles of a chromosomal genome, comprising (i) and (ii) below, the above <1> or <2> A kit for use in the method described above. (i) A genome modification system comprising a sequence-specific nucleic acid cleavage molecule capable of targeting and cleaving a target region of the chromosomal genome, or a polynucleotide encoding the sequence-specific nucleic acid cleavage molecule, (ii) Two or more selection marker donor DNAs, each having an upstream homology arm having a base sequence homologously recombinable with the base sequence upstream of the target region, and a downstream homology arm having a base sequence homologously recombinable with the base sequence downstream of the target region, wherein the base sequence of a selection marker gene for positive selection is included between the upstream homology arm and the downstream homology arm, the two or more selection marker donor DNAs each have a mutually distinguishable positive selection marker gene, the positive selection marker gene is unique to each type of selection marker donor DNA, and the number of types of selection marker donor DNAs is equal to or greater than the number of alleles targeted for genome modification, Here, the selection marker gene is a drug resistance gene, and each of the two or more selection marker donor DNAs has a selection marker gene for positive selection, a marker gene for negative selection, and a target sequence between the upstream homology arm and the downstream homology arm. <13> The target region has a length of 10kbp or more and 40kbp or less, as described above. <12> The kit described above. <14> The target region has a length of 10kbp or more and 20kbp or less, <13> The kit described above. <15> The above further includes recombinant donor DNA. <12> ~ <14> A kit as described in any of the following: The recombinant donor DNA has an upstream homology arm having a base sequence that can homologously recombine with the base sequence upstream of the target region, and a downstream homology arm having a base sequence that can homologously recombine with the base sequence downstream of the target region. kit. <16> The region between the upstream homology arm and the downstream homology arm of the recombinant donor DNA has a length of 5 kbp or more. <15> The kit described above. <17> The region between the upstream homology arm and the downstream homology arm of the recombinant donor DNA has a length of 8 kbp or more. <15> or <16> The kit described above. <18> The target region has a length of 5 kbp or more, and the region between the upstream homology arm and the downstream homology arm of the recombinant donor DNA has a length of 5 kbp or more, <15> or <16> The kit described above. <19> The target region has a length of 8 kbp or more, and the region between the upstream homology arm and the downstream homology arm of the recombinant donor DNA has a length of 8 kbp or more, <18> The kit described above. <20> The recombinant donor DNA does not have a base sequence in the region between the upstream homology arm and the downstream homology arm of the recombinant donor DNA, and in the two or more alleles of the chromosomal genome obtained after modification, the upstream and downstream sequences of the target region are seamlessly linked without base insertions, substitutions, or deletions. <1> ~ <4> One of the methods described above. <21> The recombinant donor DNA does not have a base sequence in the region between the upstream homology arm and the downstream homology arm of the recombinant donor DNA, and in the two or more alleles of the chromosomal genome obtained after modification, the upstream and downstream sequences of the target region are seamlessly linked without base insertions, substitutions, or deletions. <3> or <4> Methods used. <22> In the two or more alleles of the chromosomal genome obtained after modification, the target sequences of site-directed recombinant enzymes are absent. <3> Methods used. <23> In the two or more alleles of the chromosomal genome obtained after modification, the target sequences of site-directed recombinant enzymes are absent. <4> Methods used. <24> In the two or more alleles of the chromosomal genome obtained after modification, the target sequences of site-directed recombinant enzymes are absent. <1> ~ <4> One of the methods described above. <25> In the two or more alleles of the chromosomal genome obtained after modification, the target sequences of site-directed recombinant enzymes are absent. <3> or <4> Methods used. <26> In step (b), single-cell cloning is not performed during the process of selecting cells in which two or more alleles have been modified. <1> ~ <11> , and <20> ~ <25> One of the methods described above. <27> The region between the upstream homology arm and the downstream homology arm of the recombinant donor DNA has a length of 8 kbp or more. <3> or <4> Methods used. <28> The recombinant donor DNA does not have a base sequence in the region between the upstream homology arm and the downstream homology arm of the recombinant donor DNA, <15> The kit described above. [Brief explanation of the drawing]

[0013] [Figure 1] This diagram illustrates the KLR gene cluster region in the human reference genome (hg38), a map of that region, and the location of the deletion region on that map. [Figure 2] This document presents a specific flow chart of the scheme for creating deletions in the KLR gene cluster region and the results of confirming deletion introduction in the resulting cells. [Figure 3] This diagram illustrates the map of KIR gene cluster regions in the human reference genome (hg38) and the location of deletion regions on that map. [Figure 4] The locations (regions 0 to 7) where the markers of this disclosure (positive-negative marker set) are introduced in the KIR gene cluster region are shown in the diagram. [Figure 5] The silencing of negative selection markers depending on the introduction site of the markers (positive-negative marker set) of this disclosure in the KIR gene cluster region is illustrated. [Figure 6] This document presents a specific flow chart of the scheme for creating deletions in the KIR gene cluster region and the results of confirming deletion introduction in the resulting cells. [Figure 7] This shows a map of the region including the KIR gene cluster region and its surrounding areas, as well as the location of the deletion region on that map. [Figure 8] This document presents a specific flow chart of the synthesis scheme for regions including the KIR gene cluster region and its surrounding areas, along with the results of confirming deletion introduction in the resulting cells. [Modes for carrying out the invention]

[0014] The term "cell" refers to the cells of an individual organism, including the cells of animals with an immune system (i.e., vertebrates). Cells can be, for example, mammalian cells, such as those of primates like humans; rodents like mice and rats; livestock like cattle, horses, sheep, llamas, camels, goats, and pigs; pets like dogs and cats; and birds like chickens.

[0015] The term "allele" refers to a set of base sequences present at the same locus on a chromosomal genome. In some embodiments, diploid cells have two alleles at the same locus, and triploid cells have three alleles at the same locus. In other embodiments, additional alleles may be formed by abnormal copies of chromosomes or abnormal additional copies of the locus. Mammalian cells, with the exception of special cells such as germ cells, are usually diploid and have two alleles at each gene locus.

[0016] The terms "genome modification" and "genome editing" are interchangeable and refer to inducing mutations at a desired location (target region) on the genome. Genome modification may include the use of sequence-specific nucleic acid cleavage molecules designed to cleave target region DNA. In a preferred embodiment, genome modification may include the use of nucleases engineered to cleave target region DNA. In a preferred embodiment, genome modification may include the use of nucleases engineered to cleave target sequences having a specific base sequence within the target region (e.g., TALENs or ZFNs). In a preferred embodiment, genome modification may include the use of restriction enzymes that have only one cleavage site in the genome, such as meganucleases (e.g., 16-base sequence-specific restriction enzymes (theoretically 4)) to cleave target sequences having a specific base sequence within the target region. 16 Restriction enzymes with 17-base sequence specificity (theoretically 4) (present at a ratio of one per base) 17 Restriction enzymes that have 18-base sequence specificity (theoretically 4 18Sequence-specific endonucleases, such as those present at a rate of one per base, can also be used. Typically, the use of site-specific nucleases induces double-strand breaks (DSBs) in the DNA of the target region, after which the genome is repaired by endogenous cellular processes such as homologous directed repair (HDR) and non-homologous end-joining repair (NHEJ). NHEJ is a repair method that joins the ends of double-strand breaks without using donor DNA, and insertions and / or deletions (indels) are frequently induced during repair. HDR is a repair mechanism that uses donor DNA, and it is also possible to introduce desired mutations into the target region. As for genome modification technologies, the CRISPR / Cas system is a preferred example.Examples of meganucleases include I-SceI, I-SceII, I-SceIII, I-SceIV, I-SceV, I-SceVI, I-SceVII, I-CeuI, I-CeuAIIP, I-CreI, I-CrepsbIP, I-CrepsbIIP, I-CrepsbIIIP, I-CrepsbIVP, I-TliI, I-PpoI, PI-PspI, F-SceI, F-SceII, F-SuvI, F-TevI, F-TevII, I-AmaI, I-AniI, I-ChuI, I-CmoeI, I-CpaI, I-CpaII, I-CsmI, I-CvuI , I-CvuAIP, I-DdiI, I-DdiII, I-DirI, I-DmoI, I-HmuI, I-HmuII, I-HsNIP, I-LlaI, I-MsoI, I-NaaI, I-Na nI, I-NclIP, I-NgrIP, I-NitI, I-NjaI, I-Nsp236IP, I-PakI, I-PboIP, I-PcuIP, I-PcuAI, I-PcuVI, I-Pg rIP, I-PobIP, I-PorI, I-PorIIP, I-PbpIP, I-SpBetaIP, I-ScaI, I-SexIP, I-SneIP, I-SpomI, I-SpomCP, I-SpomIP, I-SpomIIP, I-SquIP, I-Ssp68031, I-SthPhiJP, I-SthPhiST3P, I-SthPhiSTe3bP, I-TdeIP, I- TevI, I-TevII, I-TevIII, I-UarAP, I-UarHGPAIP, I-UarHGPA13P, I-VinIP, I-ZbiIP, PI-Mtul, PI-MtuHIP A meganuclease and its cleavage site (or recognition site) selected from the group consisting of PI-MtuHIIP, PI-PfuI, PI-PfuII, PI-PkoI, PI-PkoII, PI-Rma43812IP, PI-SpBetaIP, PI-SceI, PI-TfuI, PI-TfuII, PI-ThyI, PI-TliI, and PI-TliII, and functional derivative restriction enzymes thereof, preferably a meganuclease and its cleavage site (or recognition site) that is a restriction enzyme having sequence specificity of 18 bases or more, in particular a meganuclease and its cleavage site that does not cleave the cell genome at one or more locations, can be used.

[0017] The term "target region" refers to the genomic region that is the target of genome modification. "Deletion" includes deletions of one or more base pairs relative to the reference genome, and deletions of one or more genes. Deletions can be of 100 bp or larger, 200 bp or larger, 300 bp or larger, 400 bp or larger, 500 bp or larger, 600 bp or larger, 700 bp or larger, 800 bp or larger, 900 bp or larger, 1 kbp or larger, 10 kbp or larger, 50 kbp or larger, 100 kbp or larger, 200 kbp or larger, 300 kbp or larger, 400 kbp or larger, 500 kbp or larger, or 1 Mbp or larger or smaller. Deletions can be 1 Mbp or smaller. Deletions can be 700 kbp or smaller. Deletions can be 600 kbp or smaller. The deletion may be less than 500kbp. The deletion may be between 10kbp and 600kbp. The deletion may be between 100kbp and 600kbp. The deletion may be between 100kbp and 500kbp.

[0018] The term "donor DNA" refers to DNA used to repair double-strand breaks in DNA, which is homologous to the DNA surrounding the target region. Donor DNA includes homology arms consisting of a base sequence upstream of the target region and a base sequence downstream of the target region (e.g., a base sequence adjacent to the target region). In this specification, a homology arm consisting of a base sequence upstream of the target region (e.g., a base sequence adjacent to the upstream side) may be referred to as an "upstream homology arm," and a homology arm consisting of a base sequence downstream of the target region (e.g., a base sequence adjacent to the downstream side) may be referred to as a "downstream homology arm." Donor DNA may include a desired base sequence between the upstream homology arm and the downstream homology arm. The length of each homology arm is preferably 300 bp or longer, and is usually around 500 to 3000 bp. The lengths of the upstream and downstream homology arms may be the same or different. If homologous recombination is successfully induced between the target region and donor DNA after sequence-dependent cleavage, the sequences between the upstream and downstream base sequences of the target region will be replaced with sequences from the donor DNA.

[0019] The "upstream" region of a target region refers to the DNA region located at the 5' end of the reference nucleotide strand in the double-stranded DNA of the target region. The "downstream" region refers to the DNA located at the 3' end of the reference nucleotide strand. If the target region contains a protein-coding sequence, the reference nucleotide strand is usually the sense strand. Generally, the promoter is located upstream of the protein-coding sequence. The terminator is located downstream of the protein-coding sequence.

[0020] The term "sequence-specific nucleic acid cleavage molecule" refers to a molecule that recognizes a specific nucleic acid sequence and can cleave the nucleic acid at that specific sequence. A sequence-specific nucleic acid cleavage molecule is a molecule that has the activity to cleave nucleic acids in a sequence-specific manner (sequence-specific nucleic acid cleavage activity).

[0021] The term "target sequence" refers to the DNA sequence in the genome that is targeted for cleavage by a sequence-specific nucleic acid cleavage molecule. When the sequence-specific nucleic acid cleavage molecule is a Cas protein, the target sequence refers to the DNA sequence in the genome that is targeted for cleavage by the Cas protein. When using the Cas9 protein as the Cas protein, the target sequence must be a sequence adjacent to the 5' end of a protospacer adjacent motif (PAM). Typically, the target sequence is selected from a sequence of 17 to 30 bases (preferably 18 to 25 bases, more preferably 19 to 22 bases, and even more preferably 20 bases) adjacent to the 5' end of a PAM. Known design tools such as CRISPR DESIGN (crispr.mit.edu / ) can be used to design the target sequence.

[0022] The term "Cas protein" refers to a CRISPR-associated protein. In a preferred embodiment, the Cas protein forms a complex with guide RNA and exhibits endonuclease activity or nickase activity. Examples of Cas proteins, though not particularly limited, include Cas9 protein, Cpf1 protein, C2c1 protein, C2c2 protein, and C2c3 protein. The Cas protein includes wild-type Cas proteins and their homologs (paralogs and orthologs), as well as their variants, insofar as they cooperate with guide RNA to exhibit endonuclease activity or nickase activity. In a preferred embodiment, the Cas protein is involved in a class 2 CRISPR / Cas system, and more preferably in a type II CRISPR / Cas system. A preferred example of a Cas protein is the Cas9 protein. Another preferred example of a Cas protein is the Cas3 protein.

[0023] The term "Cas9 protein" refers to the Cas protein involved in the type II CRISPR / Cas system. The Cas9 protein forms a complex with guide RNA and exhibits activity in cooperation with the guide RNA to cleave DNA in a target region. The Cas9 protein includes the wild-type Cas9 protein and its homologs (paralogs and orthologs), as well as their variants, as long as they possess the aforementioned activity. The wild-type Cas9 protein has a RuvC domain and an HNH domain as nuclease domains, but the Cas9 protein used herein may have either the RuvC domain or the HNH domain inactivated. Cas9 with either the RuvC domain or the HNH domain inactivated introduces single-strand breaks (nicks) into double-stranded DNA. Therefore, when using Cas9 with either the RuvC domain or the HNH domain inactivated to cleave double-stranded DNA, a modified system can be constructed in which target sequences for Cas9 are set for both the sense strand and the antisense strand, so that nicks in the sense strand and antisense difference occur at sufficiently close positions, thereby inducing double-strand breaks. The species from which the Cas9 protein originates is not particularly limited, but bacteria belonging to the genera Streptococcus, Staphylococcus, Neisseria, or Treponema are preferred examples. More specifically, Cas9 proteins derived from S. pyogenes, S. thermophilus, S. aureus, N. meningitidis, or T. denticola are preferred examples. In a preferred embodiment, the Cas9 protein is a Cas9 protein derived from S. pyogenes.

[0024] Information on the amino acid sequences and coding sequences of various Cas proteins can be obtained from various databases such as GenBank, UniProt, and Addgene. For example, the amino acid sequence of the Cas9 protein of S. pyogenes can be used from the one registered in Addgene as plasmid number 42230. An example of the amino acid sequence of the Cas9 protein of S. pyogenes is shown in Sequence ID No. 1.

[0025] The terms “guide RNA” and “gRNA” are used interchangeably and refer to RNA that can form a complex with the Cas protein and guide the Cas protein to a target region. In a preferred embodiment, the guide RNA includes CRISPR RNA (crRNA) and trans-activated CRISPR RNA (tracrRNA). crRNA is involved in binding to the target region on the genome, and tracrRNA is involved in binding to the Cas protein. In a preferred embodiment, the crRNA includes a spacer sequence and a repeat sequence, the spacer sequence binding to the complementary strand of the target sequence in the target region. In a preferred embodiment, the tracrRNA includes an anti-repeat sequence and a 3' tail sequence. The anti-repeat sequence has a sequence complementary to the repeat sequence of the crRNA and forms base pairs with the repeat sequence, and the 3' tail sequence typically forms three stem-loops. The guide RNA may be a single guide RNA (sgRNA) formed by ligating the 5' end of tracrRNA to the 3' end of crRNA, or it may be a separate RNA molecule with base pairings formed by repeat and anti-repeat sequences. In a preferred embodiment, the guide RNA is sgRNA.

[0026] The repeat sequences of crRNA and tracrRNA can be appropriately selected depending on the type of Cas protein, and those derived from the same bacterial species as the Cas protein can be used. For example, when using Cas9 protein derived from S. pyogenes, the length of the sgRNA can be approximately 50 to 220 nucleotides (nt), preferably 60 to 180 nt, and more preferably 80 to 120 nt. The length of the crRNA, including the spacer sequence, can be approximately 25 to 70 base pairs, preferably 25 to 50 nt. The length of the tracrRNA can be approximately 10 to 130 nt, preferably 30 to 80 nt. The repeat sequence of crRNA may be the same as that in the bacterial species from which the Cas protein originates, or it may have a portion of its 3' end removed. TracrRNA may have the same sequence as mature tracrRNA in the bacterial species from which the Cas protein originates, or it may be a truncated form obtained by cutting the 5' and / or 3' ends of the mature tracrRNA. For example, tracrRNA may be a truncated form obtained by removing approximately 1 to 40 nucleotide residues from the 3' end of mature tracrRNA. Alternatively, tracrRNA may be a truncated form obtained by removing approximately 1 to 80 nucleotide residues from the 5' end of mature tracrRNA. Furthermore, tracrRNA may be a truncated form obtained by removing approximately 1 to 20 nucleotide residues from the 5' end and approximately 1 to 40 nucleotide residues from the 3' end. Various crRNA repeat sequences and tracrRNA sequences have been proposed for sgRNA design, and those skilled in the art can design sgRNAs based on known techniques (e.g., Jinek et al. (2012) Science, 337, 816-21; Mali et al. (2013) Science, 339: 6121, 823-6; Cong et al. (2013) Science, 339: 6121, 819-23; Hwang et al. (2013) Nat. Biotechnol. 31: 3, 227-9; Jinek et al. (2013) eLife, 2, e00471).

[0027] The terms "protospacer adjacency motif" and "PAM" are used interchangeably and refer to the sequence recognized by the Cas protein during DNA cleavage by the Cas protein. The sequence and position of the PAM vary depending on the type of Cas protein. For example, in the case of the Cas9 protein, the PAM must be adjacent to the target sequence immediately after the 3' end. The PAM sequence corresponding to the Cas9 protein varies depending on the bacterial species from which the Cas9 protein originates. For example, the PAM corresponding to the Cas9 protein of S. pyogenes is "NGG", the PAM corresponding to the Cas9 protein of S. thermophilus is "NNAGAA", the PAM corresponding to the Cas9 protein of S. aureus is "NNGRRT" or "NNGRR(N)", the PAM corresponding to the Cas9 protein of N. meningitidis is "NNNNGATT", and the PAM corresponding to the Cas9 protein of T. denticola is "NAAAAC" ("R" is A or G; "N" is A, T, G or C).

[0028] The terms "spacer sequence" and "guide sequence" are used interchangeably and refer to sequences included in the guide RNA that can bind to the complementary strand of the target sequence. Typically, the spacer sequence is identical to the target sequence (except where T in the target sequence becomes U in the spacer sequence). In embodiments of the present invention, the spacer sequence may contain one or more nucleotide mismatches with respect to the target sequence. If it contains multiple nucleotide mismatches, the mismatches may be adjacent or distant. In a preferred embodiment, the spacer sequence may contain 1 to 5 nucleotide mismatches with respect to the target sequence. In a particularly preferred embodiment, the spacer sequence may contain one nucleotide mismatch with respect to the target sequence. In guide RNA, the spacer sequence is located at the 5' end of the crRNA.

[0029] The term "functionally linked" as used in relation to polynucleotides means that the first base sequence is positioned close enough to the second base sequence that the first base sequence can influence the second base sequence or a region under the control of the second base sequence. For example, functionally linked polynucleotides to a promoter mean that the polynucleotide is linked in such a way that it is expressed under the control of the promoter.

[0030] The term "expressible" refers to a state in which a polynucleotide can be transcribed within a cell into which it has been introduced. The term "expression vector" refers to a vector containing a target polynucleotide and equipped with a system that enables the expression of the target polynucleotide within the cell into which the vector is introduced. For example, a "Cas protein expression vector" means a vector that enables the expression of the Cas protein within the cell into which the vector is introduced. Similarly, a "guide RNA expression vector" means a vector that enables the expression of guide RNA within the cell into which the vector is introduced.

[0031] The term "unique sequence" refers to a distinctive sequence for which no other similar sequences exist. Specifically, it refers to a sequence for which an Identity value of 80% or more of its total length, determined by BLAT search, exists only once on the genome containing the unique sequence. More preferably, a unique sequence is one for which an Identity value of 75% or more of its total length, determined by BLAT search, exists only once on the genome containing the unique sequence. Even more preferably, a sequence is one for which an Identity value of 70% or more of its total length, determined by BLAT search, exists only once on the genome containing the unique sequence. Still more preferably, a sequence is one for which an Identity value of 65% or more of its total length, determined by BLAT search, exists only once on the genome containing the unique sequence. The term "unique sequence" can be used interchangeably with "distinctive sequence."

[0032] Killer cell immunoglobulin-like receptors (KIRs) are a family of transmembrane glycoproteins expressed on the cell membranes of natural killer (NK) cells and T cells. The human KIR gene cluster forms on chromosome 19q13.4 and is believed to contain 15 KIR genes and 2 pseudogenes. For example, in humans, the KIR gene cluster is located at hg38:chr19:54,724,497-54,866,731. KIRs can interact with major histocompatibility complex (MHC) class I on other cells to regulate the cytotoxic activity of those cells. KIRs are polymorphic, and their sequences are known to differ between individuals. The existence of clusters of similar genes and polymorphisms makes sequencing and selective recombination within these regions difficult. Therefore, much remains unknown about the function of KIR genes and polymorphisms. KIRs are named based on the number of extracellular immunoglobulin (Ig)-like domains and the length of their cytoplasmic tail (long: L, short: S, or pseudogene: P). For example, if there are two Ig-like domains and a long cytoplasmic tail, it is named KIR2DL1. The last 1 is an identification number to distinguish it from similar KIRs. KIRs are polymorphic, so polymorphism information can be added after the name. For example, KIR2DL1*0010101 has a seven-digit number separated by an asterisk to distinguish the allele. Most KIRs are repressive, but a small number have an immunoenhancing effect.

[0033] Killer cell lectin-like receptors (KLRs) are a family of transmembrane glycoproteins expressed on the cell membranes of natural killer (NK) cells and T cells. Human KLR genes form a cluster on chromosome 12p13.1. This cluster is located, for example, at hg38:chr12:10,308,078-10,451,156. KLRs can interact with major histocompatibility complex (MHC) class I on other cells to regulate the cytotoxic activity of those cells. The regulation of NK cell cytotoxic activity by KLRs is difficult to verify through individual analysis due to the expression diversity of KIR, LILR, and KLR in NK cells within vivo. Therefore, many aspects of the function of KLR genes and polymorphisms remain unclear.

[0034] Leukocyte immunoglobulin-like receptors (LILRs) are a family of transmembrane glycoproteins expressed on the cell membranes of natural killer (NK) cells, monocytes, macrophages, dendritic cells, B cells, and T cells. Human LILR genes form a cluster on chromosome 19q13.4. This cluster is located, for example, at hg38: chr19:54,217,096-54,668,016. LILRs can interact with major histocompatibility complex (MHC) class I on other cells to regulate the cytotoxic activity of those cells. LILRs are known to be polymorphic, with their sequences varying between individuals. The existence of clusters of similar genes and polymorphisms makes sequencing and selective recombination within these regions difficult. Therefore, much remains unknown about the function of LILR genes and their polymorphisms. The LILR includes a centromere-side LILR cluster and a telomere-side LILR. The centromere-side LILR includes LILRB3, LILRB5, LILRB2, LILRA3, and LILRA4 from the centromere side, while the telomere-side LILR includes LILRA2, LILRA1, LILRB1, and LILRB4 from the centromere side. Further telomere-side from the LILR, there is a KIR cluster region.

[0035] In this specification, a “chimeric antigen receptor” (CAR) is a chimeric molecule having an antigen-binding fragment of an antibody (in particular, scFv) and an activation domain for immune cells. A CAR is generally a molecule consisting of a linkage of scFv, an extracellular hinge domain, a transmembrane domain (e.g., CD8α or CD28), and an activation signaling domain (e.g., CD3ζ). CARs can be introduced into cells and expressed on the cell surface. Cells expressing CARs can be targeted for specific antigens. CARs can be introduced into immune cells, such as T cells or NK cells, to target these immune cells for cancer. While first-generation CARs consisted of a linkage of scFv, an extracellular hinge domain, a transmembrane domain (e.g., CD8α or CD28), and an activation signaling domain (e.g., CD3ζ), second-generation CARs further include a co-stimulatory molecule signaling domain for activation of the immune cells into which the CAR is introduced. Co-stimulatory factors such as CD28, 4-1BB, OX40, CD27, and ICOS are used as co-stimulatory molecular signaling domains. In third-generation CARs, multiple co-stimulatory factors are incorporated. Thus, improvements have been made to CARs to enable the sustained proliferation of CAR-introduced immune cells in vivo. It is preferable that all domains other than the scFv portion are derived from human proteins. When a CAR binds to a cell expressing a target antigen, it can activate the CAR-expressing cell.

[0036] In this specification, sequence identity (or homology) between nucleotide sequences or amino acid sequences is determined by juxtaposing the two nucleotide sequences or amino acid sequences, inserting gaps in the areas corresponding to insertions and deletions so that the corresponding nucleotides or amino acids match most closely, and then determining the proportion of matching nucleotides or amino acids relative to the entire nucleotide sequence or amino acid sequence, excluding the gaps in the resulting alignment. Sequence identity between nucleotide sequences or amino acid sequences can be determined using various homology search software known in the art. The sequence identity value of a nucleotide sequence is not particularly limited, but can be obtained, for example, by BLAT search, which is included in the known homology search software UCSC Genome Browser.

[0037] In this specification, when referring to the location of the human genome for convenience, the location in the hg38 genome sequence is used as the reference genome. hg38 is a reference genome released in December 2013 by the University of California, Santa Cruz (UCSC). A reference genome is a reference genome created by combining various genomes, and it does not mean that a human being possesses this genome. However, by comparing fragmentary sequence information decoded from the genomic DNA of a human individual with the reference genome, the decoded fragmentary sequence information can be linked together to construct a continuous sequence on a computer, thereby estimating the sequence of the genomic DNA of that human individual. In this way, the genomic DNA of individuals such as humans is usually decoded by associating the sequence of the genomic DNA of a human individual with the reference genome. Furthermore, a location or region corresponding to a specific location or region in the hg38 genome sequence means a location or region that is linked to that specific location or region in the genome of a different individual with a different specific sequence. Specifically, based on sequence identity, a location or region containing a characteristic sequence in that location or region corresponds to a specific location or region in the hg38 genome sequence. The corresponding location can be determined by aligning partial sequences of two genomic DNAs. Even if there are differences in the specific sequences, the correspondence between the two genomic DNAs can be determined by aligning sequences that have an orthologous relationship or sequence identity. In regions rich in paralogs resulting from gene duplication, simply determining sequence correspondences based on individual sequences may not be sufficient to determine the true correspondence between two genomes. This increases the difficulty of sequencing regions where similar sequences are concentrated. By seeking high sequence identity when determining corresponding sequences, the correspondence between two genomes can be clarified. Furthermore, if a specific region is a large region containing multiple genes, synteny can be considered. Synteny refers to the preservation of the physical positional relationships of orthologs on the genome. Synteny can occur between individuals and between organisms.Therefore, a specific region can be determined by considering synteny.

[0038] <Cells and compositions of this disclosure> This disclosure provides cells and compositions containing such cells. The cells may include cells at various developmental stages into various tissues. For example, the cells may be pluripotent cells (e.g., pluripotent stem cells such as embryonic stem cells and induced pluripotent stem cells), tissue stem cells (e.g., hematopoietic stem cells, mesenchymal stem cells, etc.), tissue progenitor cells, and terminally differentiated cells. The cells may be normal cells (e.g., non-tumor cells) or tumor cells. The cells may be immune cells or non-immune cells. Immune cells may be, for example, antigen-specific immune cells (e.g., T cells, B cells, NK cells, NKT cells, macrophages). Antigen-specific immune cells may have nucleic acids encoding antigen-specific receptors (e.g., T cell receptors and chimeric antigen receptors), or express such receptors on their cell surface.

[0039] In all aspects of this disclosure, the cell-containing composition may be in an unfrozen state, typically at a temperature of 0°C to 37°C, preferably 2°C to 8°C, or it may be in a frozen state. Freezing can be achieved, for example, by cooling a tube containing the composition in liquid nitrogen. Thawing can be performed in a warm bath (for example, in a warm bath at about 37°C).

[0040] The cells of this disclosure may be iPS cells. The cells of this disclosure may be human cell-derived iPS cells (human iPS cells). The cells of this disclosure may be used after being differentiated into, for example, immune cells. Therefore, the cells of this disclosure may be immune cells (particularly iPS cell-derived immune cells). The immune cells may be one or more immune cells selected from the group consisting of, for example, T cells (e.g., CD4-positive T cells and CD8-positive T cells), natural killer T cells (NKT cells), natural killer cells (NK cells), regulatory T cells (Treg), αβT cells, γδT cells, and macrophages, and are preferably NK cells. The immune cells may have antigen-specific T cell receptors (TCRs). The immune cells may not express antigen-specific T cell receptors (e.g., they may have TCRα chain deficiency). The immune cells may express chimeric antagonist receptors (CARs). For example, immune cells may be T cells, NKT cells, NK cells, or γδT cells that express a CAR but do not necessarily express an antigen-specific TCR. The cells may be, for example, primary cells (e.g., primary immune cells). The cells may be, for example, cell lines (e.g., immune cell lines). The cells may be non-cancer cells. Cells expressing a CAR may express either or both of, for example, endogenous or exogenous interleukin-7 (IL-7) and endogenous or exogenous CCL19. Endogenous or exogenous IL-7 and endogenous or exogenous CCL19 are operably linked to a regulatory sequence, and cells expressing a CAR have either or preferably both of said IL-7 and CCL19. Cells expressing a CAR may also express endogenous or exogenous endo-β-D-glucuronidase (HPSE). These immune cells may have an autologous or allogeneic relationship with the target to which the cells are administered. Immune cells may also express endogenous or exogenous CD3. Furthermore, cells may or may not express one or more endogenous or exogenous factors selected from the group consisting of HLA-E, HLA-G, HACD16, 41BBL, CD3, CD4, CD8, CD47, CD137, CD80, PDL1, A2AR, CAR, and TCR.In one embodiment, the cells have nucleic acids encoding one or more endogenous or exogenous factors selected from the group consisting of HLA-E, HLA-G, CD16, 41BBL, CD3, CD4, CD8, CD47, CD137, CD80, PDL1, A2AR, CAR, and TCR, and the nucleic acids are operably linked to a regulatory sequence. In one embodiment, cells expressing CAR may be used in combination with antibody therapy. In this combination, the antibody target molecule (tumor antigen) may be knocked out in the CAR-expressing cells. In one embodiment, such tumor antigens include CD38 and CD52. Examples of anti-CD38 antibodies include daratumumab and isatuximab (the target disease may be, for example, multiple myeloma). An example of an anti-CD52 antibody is alemtuzumab (the target disease may be, for example, leukemia, lymphocytic leukemia, or chronic lymphocytic leukemia). In certain embodiments of cells (e.g., immune cells or non-immune cells), NLRC5 may also be knocked out, which may suppress the development of graft-versus-host disease (GVHD), for example. In certain embodiments of cells (e.g., immune cells or non-immune cells), a CAR or TCR may express a factor selected from the group consisting of PD1, CD52, CTLA4, dCK, GGH, HPRT, and β2-microglobulin. In a preferred embodiment, the cells of the disclosure have functional β2-microglobulin and / or functional CIITA. The cells of the disclosure may express, for example, an IL-15:IL15Rα fusion protein.

[0041] In one preferred embodiment, the cell contains genomic DNA having a deletion. In one preferred embodiment, the deletion is (i) A deletion of part or all of the KIR gene group located within the killer cell immunoglobulin-like receptor (KIR) gene cluster region in one or two alleles, wherein part of the KIR gene group includes at least one connected region. (ii) A deletion of part or all of the LILR gene group located within the leukocyte immunoglobulin-like receptor (LILR) gene cluster region in one or two alleles, wherein the part of the KIR gene group includes at least one connected region, and / or (iii) A deletion of part or all of the KLR gene group located within the killer cell lectin-like receptor (KLR) gene cluster region in one or two alleles, wherein part of the KLR gene group includes at least one connected region.

[0042] In one preferred embodiment, a portion of the KIR gene group includes 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, or 90% or more of the KIR gene encoding genes contained in the respective regions.

[0043] In one preferred embodiment, a portion of the LILR gene group includes 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, or 90% or more of the LILR gene encoding genes contained in the respective regions.

[0044] In one preferred embodiment, a portion of the KLR gene group includes 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, or 90% or more of the KLR gene encoding genes contained in the respective regions.

[0045] In one preferred embodiment, the deletion includes at least a portion of the KIR gene group and at least a portion of the KLR gene group in the region on the genome. The at least portion of the KIR gene group and at least a portion of the KLR gene group in the region on the genome may each constitute a continuous region on the genome. In one preferred embodiment, the deletion includes all of the KIR gene group and all of the KLR gene group in the region on the genome. The all of the KIR gene group and all of the KLR gene group in the region on the genome may constitute a continuous region on the genome.

[0046] In one preferred embodiment, the deletion includes at least a portion of the KIR gene group and at least a portion of the LILR gene group in the region of the genome. The portion of the KIR gene group and at least a portion of the LILR gene group in the region of the genome may each be a contiguous region, or the two regions may be a contiguous region as a whole. In one preferred embodiment, the deletion includes all of the LILR gene group and all of the KLR gene group in the region of the genome. In one preferred embodiment, the deletion includes the centromere-side LILR. In one preferred embodiment, the deletion includes the telomere-side LILR. In a more preferred embodiment, the deletion includes both the centromere-side LILR and the telomere-side LILR.

[0047] In one preferred embodiment, the deletion includes at least a portion of the KIR gene group, at least a portion of the LILR gene group, and at least a portion of the KLR gene group in the region of the genome. The at least a portion of the KIR gene group, at least a portion of the LILR gene group, and at least a portion of the KLR gene group in the region of the genome may each be a continuous region. The at least a portion of the KIR gene group and at least a portion of the LILR gene group in the region of the genome may as a whole be a continuous region. In one preferred embodiment, the deletion includes all of the KIR gene group, all of the LILR gene group, and all of the KLR gene group in the region of the genome.

[0048] In one preferred embodiment, the deletion includes a genomic region corresponding to hg38: chr19:54,217,096-54,941,711. This region encompasses both the KIR gene cluster region and the LILR gene cluster region.

[0049] In one preferred embodiment, cells with the deletion do not show a decrease in cell proliferation rate of 50% or more, 40% or more, 30% or more, 25% or more, 20% or more, 15% or more, 10% or more, or 5% or more compared to unmodified cells without the deletion, under normal culture conditions (e.g., under conditions suitable for culturing unmodified cells without the deletion). In one preferred embodiment, cells with the deletion do not show a decrease in viability of 25% or more, 20% or more, 15% or more, 10% or more, or 5% or more, under normal culture conditions (e.g., under conditions suitable for culturing unmodified cells without the deletion). If the cells have a drug resistance gene, a drug (in particular, a drug at an appropriate concentration used in normal selection) may be present.

[0050] In a preferred embodiment, the cell may include a nucleic acid insertion at a site having a deletion or other site. The nucleic acid may include a gene expression cassette, which includes a regulatory sequence and a gene operably linked to the regulatory sequence. The gene may be any target gene. The gene may be, for example, a chimeric antigen receptor (CAR) or a T cell receptor (TCR).

[0051] Chimeric inhibitory receptors may include, for example, a single-chain antibody (e.g., scFv) containing heavy and light chains, and an extracellular hinge domain (e.g., CD8), transmembrane domains (e.g., CD8α and CD28), synstimulatory signaling domains (4-1BB, CD28 and CD137), and an activation signaling domain (CD3ζ). This allows the chimeric inhibitory receptor to generate an activation signal to the cell upon binding to its target. Chimeric inhibitory receptors can bind to antigens expressed on cancer cells. Such antigens may be one or more selected from the group consisting of, for example, CD16, CD19, CD20, CD22, CD123, CD171, epidermal growth factor receptor (EGFR), particularly EGFRvIII, type 3 EGFR, de2-7EGFR and HER2, carcinoembryonic antigen (CEA), prostate stem cell antigen (PSCA), B cell maturation antigen (BCMA), CS1, NKG2D, NKp30, B7H6, MUC-16 (CA125), orphan receptor 1 for receptor tyrosine kinase (ROR-1), GD3, GM2, glypican-3 (GPC3), mesothelin, IL13R, c-KIT, c-MET, NY-ESO-1, WT1, MAGE-A3, MAGE-A4, MAGE-A10, HPV E6, HPV E7, CMV, AFP, PRAME, SSX2, KRAS, HER2, and PD-L1. Chimeric antigen receptors may also bind to, for example, protein-based tags. The antigen of scFv may be a fluorescent protein such as fluorescein isothiocyanate (FITC). This is because cancer cells can also be killed by binding an antibody labeled with a protein-based tag to cancer antigens on the surface of cancer cells, and then administering cells that express a chimeric antigen receptor that targets the tag.

[0052] TCRs can have antigen specificity. Antigen-specific TCRs can, for example, bind to cancer antigens. Antigen-specific TCRs include, for example, CD16, CD19, CD20, CD22, CD123, CD171, epidermal growth factor receptor (EGFR), especially EGFRvIII, type 3 EGFR, de2-7EGFR and HER2, carcinoembryonic antigen (CEA), prostate stem cell antigen (PSCA), B cell maturation antigen (BCMA), CS1, NKG2D, NKp30, B7H6, MUC-16 (CA125), and receptor cytosis. It may bind to one or more receptors selected from the group consisting of orphan receptor 1 for rosin kinase (ROR-1), GD3, GM2, glypican-3 (GPC3), mesothelin, IL13R, c-KIT, c-MET, NY-ESO-1, WT1, MAGE-A3, MAGE-A4, MAGE-A10, HPV E6, HPV E7, CMV, AFP, PRAME, SSX2, KRAS, HER2, and PD-L1. The TCR may be selected to match HLA.

[0053] Other target genes include genes encoding one or more immunosuppressive factors selected from the group consisting of CD47, CD24, CD200, PD-L1, IDO1, CTLA4-Ig, C1 inhibitor, IL-10, IL-35, FASL, Serpmb9, CC121, and Mfge8. Other target genes may be, for example, genes that produce therapeutic benefits. Therapeutic genes may be pro-inflammatory proteins, such as cytokines. Therapeutic genes may be anti-inflammatory proteins, such as cytokines. Other target genes may be, for example, suicide genes. Examples of suicide genes include thymidine kinase genes, particularly herpesvirus-derived thymidine kinase genes (HSVtk), cytotoxic signal receptors (e.g., diphtheria toxin receptor), and iCas9. Thymidine kinase genes phosphorylate ganciclovir to produce cytotoxic ganciclovir triphosphate. Furthermore, iCas9 (inducible caspase-9) is a protein in which its CARD is replaced by FKBP12, and it induces cell death in iCas9-expressing cells in the presence of tacrolimus derivatives (e.g., AP1903). Such suicide genes are useful when it is necessary to remove cells that evade the immune system (e.g., therapeutic cells) from the body.

[0054] In the insertion of a gene expression cassette into DNA, the positive and negative marker set can be removed in the presence of recombinant donor DNA containing the gene expression cassette. This allows the gene expression cassette to be inserted in place of a region where a large deletion has occurred.

[0055] The control sequence is, for example, a promoter. The promoter is not particularly limited, and various pol II-type promoters can be used. Examples of pol II-type promoters are not particularly limited, but include the CMV promoter, EF1 promoter (EF1α promoter), SV40 promoter, MSCV promoter, hTERT promoter, β-actin promoter, CAG promoter, CBh promoter, etc. The promoter may also be an inductive promoter. An inductive promoter is a promoter that can induce the expression of a polynucleotide functionally linked to the promoter only in the presence of an inductive factor that drives the promoter. Examples of inductive promoters include promoters that induce gene expression by heating, such as heat shock promoters. Inductive promoters also include promoters in which the inductive factor that drives the promoter is a drug. Examples of such drug-inductive promoters include cumate operator sequences, λ operator sequences (e.g., 12×λOp), and tetracycline-type inductive promoters. Examples of tetracycline-inducible promoters include promoters that drive gene expression in the presence of tetracycline or its derivatives (e.g., doxycycline), or reverse tetracycline-regulating transactivators (rtTAs). An example of a tetracycline-inducible promoter is the TRE3G promoter.

[0056] <Genome modification methods> In one embodiment, the present invention provides a genome modification method for modifying two or more alleles of a chromosomal genome. The genome modification method includes the following steps (a) and (b): (a) the step of introducing (i) and (ii) below into cells containing the chromosome; and (i) A genome modification system comprising a sequence-specific nucleic acid cleavage molecule that targets a target region of the chromosomal genome, or a polynucleotide encoding the sequence-specific nucleic acid cleavage molecule. (ii) Two or more selection marker donor DNAs containing the base sequence of a selection marker gene between an upstream homology arm having a base sequence homologous to the base sequence adjacent to the upstream side of the target region and a downstream homology arm having a base sequence homologous to the base sequence adjacent to the downstream side of the target region, wherein the two or more selection marker donor DNAs each contain a different selection marker gene, and the number of types of selection marker donor DNAs is equal to or greater than the number of alleles targeted for genome modification, (b) A step of selecting the cells after step (a) based on all the selection marker genes present in the two or more selection marker donor DNAs. In this embodiment, the selection marker genes may be unique to each type of selection marker donor DNA. In this embodiment, step (b) may also be a step of selecting cells that express all of the introduced uniquely distinct selection marker genes, after step (a), by homologous recombination of different types of selection marker donor DNAs with respect to the two or more alleles (a step for positive selection). The above method may also be a method for producing cells in which two or more alleles of the chromosomal genome have been modified.

[0057] The method described below (see, for example, International Publication No. 2021 / 206054) is useful as an efficient method for simultaneously introducing the same modification to two or more alleles of a chromosomal genome. For example, it is suitable for creating deletions of approximately 100kb to 500kb in a sequence-specific manner in a target chromosomal region and can be preferably used for the creation of the above-mentioned cells. This method can also be applied to the modification of haploid cells. This method can also be applied to cells in which there is only one allele of the HLA gene region on the genomic DNA.

[0058] In one embodiment, the present invention is a method for producing cells in which two or more alleles of the chromosomal genome have been modified, (a) The steps of introducing (i) and (ii) below into cells containing two or more alleles to introduce a selection marker gene into each of the two or more alleles, (i) A genome modification system comprising a sequence-specific nucleic acid cleavage molecule capable of targeting and cleaving target regions in two or more alleles of the chromosomal genome, or a polynucleotide encoding the sequence-specific nucleic acid cleavage molecule. (ii) Two or more types of select marker donor DNA, each having an upstream homology arm having a base sequence homologously recombinable with the base sequence upstream of the target region and a downstream homology arm having a base sequence homologously recombinable with the base sequence downstream of the target region, and containing the base sequence of the select marker gene between the upstream homology arm and the downstream homology arm, wherein each of the two or more types of select marker donor DNA has a select marker gene that is distinguishable from each other, the select marker gene is unique to each type of select marker donor DNA, and the number of types of select marker donor DNA is equal to or greater than the number of alleles targeted for genome modification, (b) After step (a), a step of selecting cells that express all of the introduced, distinctly different, unique selection marker genes, by homologous recombination of different types of selection marker donor DNA with respect to the two or more alleles (a step for positive selection), This could include methods such as:

[0059] (Step (a)) In step (a), (i) and (ii) are introduced into cells containing chromosomes.

[0060] The cells used in the genome modification method of this embodiment are not particularly limited and may be any cells having a haploid or diploid or more chromosomal genome. The cells may be diploid, triploid, or tetraploid or more. The cells are not particularly limited, but eukaryotic cells are an example. The cells may be plant cells, animal cells, or fungal cells. The animal cells are not particularly limited, but may be human, non-human mammals (for example, non-human primates such as monkeys, non-human mammals such as dogs, cats, cattle, horses, sheep, goats, llamas, and rodents), birds, reptiles, amphibians, fish, or other vertebrates.

[0061] The target region for genome modification can be any region on the genome that has one or more alleles. The size of the target region is not particularly limited. The genome modification method of this embodiment can modify regions of a larger size than conventional methods. The target region may be, for example, 10 kbp or larger. The target region may be, for example, 100 bp or larger, 200 bp or larger, 400 bp or larger, 800 bp or larger, 1 kbp or larger, 2 kbp or larger, 3 kbp or larger, 4 kbp or larger, 5 kbp or larger, 8 kbp or larger, 10 kbp or larger, 20 kbp or larger, 40 kbp or larger, 80 kbp or larger, 100 kbp or larger, 200 kbp or larger, 300 kbp or larger, 400 kbp or larger, 500 kbp or larger, 600 kbp or larger, 700 kbp or larger, 800 kbp or larger, 900 kbp or larger, or 1 Mbp or larger, or any of the above values ​​or less. In one embodiment, the target region is deleted in the modified cell.

[0062] <(i) Genome modification systems> A "genome modification system" refers to a molecular mechanism capable of modifying a desired target region. The genome modification system includes a sequence-specific nucleic acid cleavage molecule that targets a target region of the chromosomal genome, or a polynucleotide that encodes the said sequence-specific nucleic acid cleavage molecule.

[0063] The sequence-specific nucleic acid cleavage molecule is not particularly limited as long as it is a molecule that has sequence-specific nucleic acid cleavage activity, and may be a synthetic organic compound or a biomolecular compound such as a protein. Examples of synthetic organic compounds with sequence-specific nucleic acid cleavage activity include pyrrole-imidazole polyamides. Examples of proteins with sequence-specific site cleavage activity include sequence-specific endonucleases.

[0064] Sequence-specific endonucleases are enzymes that can cleave nucleic acids at a predetermined sequence. Sequence-specific endonucleases can cleave double-stranded DNA at a predetermined sequence. Examples of sequence-specific endonucleases are not limited to zinc finger nucleases (ZFNs), TALENs (Transcription activator-like effector nucleases), and Cas proteins, but are not limited to these.

[0065] ZFNs are artificial nucleases containing a nucleic acid cleavage domain conjugated to a binding domain containing a zinc finger array. Examples of cleavage domains include the cleavage domain of the type II restriction enzyme FokI. The design of zinc finger nucleases capable of cleaving target sequences can be carried out using known methods.

[0066] TALENs are artificial nucleases that contain a DNA-binding domain of a transcription activator-like (TAL) effector in addition to a DNA-cleaving domain (e.g., a FokI domain). Designing TALE constructs capable of cleaving target sequences can be done using known methods (e.g., Zhang, Feng et. al. (2011) Nature Biotechnology 29 (2)).

[0067] When a Cas protein is used as the sequence-specific nucleic acid cleavage molecule, the genome modification system includes a CRISPR / Cas system. That is, the genome modification system preferably includes a Cas protein and a guide RNA having a base sequence homologous to the base sequence in the target region. The guide RNA only needs to include a spacer sequence homologous to the sequence in the target region (target sequence). The guide RNA only needs to be able to bind to the DNA in the target region and does not need to have a sequence that is completely identical to the target sequence. This binding should be formed under physiological conditions in the cell nucleus. The guide RNA can, for example, include a mismatch of 0 to 3 bases with respect to the target sequence. The number of mismatches is preferably 0 to 2 bases, more preferably 0 to 1, and even more preferably no mismatches. The guide RNA can be designed based on known methods. The genome modification system is preferably a CRISPR / Cas system and preferably includes a Cas protein and a guide RNA. The Cas protein is preferably a Cas9 protein.

[0068] Sequence-specific endonucleases may be introduced into cells as proteins or as polynucleotides encoding them. For example, mRNA of the sequence-specific endonuclease may be introduced, or an expression vector for the sequence-specific endonuclease may be introduced. In the expression vector, the coding sequence of the sequence-specific endonuclease (sequence-specific endonuclease gene) is functionally linked to a promoter. The promoter is not particularly limited, and various pol II-type promoters can be used. Examples of pol II-type promoters are not particularly limited, but include the CMV promoter, EF1 promoter (EF1α promoter), SV40 promoter, MSCV promoter, hTERT promoter, β-actin promoter, CAG promoter, and CBh promoter.

[0069] The promoter may be an inductive promoter. An inductive promoter is a promoter that can induce the expression of a polynucleotide functionally linked to it only in the presence of an inductive factor that drives the promoter. Examples of inductive promoters include promoters that induce gene expression by heating, such as heat shock promoters. Inductive promoters also include promoters in which the inductive factor that drives the promoter is a drug. Examples of such drug-inductive promoters include Cumate operator sequences, λ operator sequences (e.g., 12×λOp), and tetracycline-based inductive promoters. Examples of tetracycline-based inductive promoters include promoters that drive gene expression in the presence of tetracycline or its derivatives (e.g., doxycycline), or reverse tetracycline-regulating transactivator (rtTA). An example of a tetracycline-based inductive promoter is the TRE3G promoter.

[0070] Any known expression vector can be used without particular restriction. Examples of expression vectors include plasmid vectors and viral vectors. When the sequence-specific endonuclease is a Cas protein, the expression vector may include a guide RNA coding sequence (guide RNA gene) in addition to the Cas protein coding sequence (Cas protein gene). In this case, it is preferable that the guide RNA coding sequence (guide RNA gene) is functionally configured as a pol III promoter. Examples of pol III promoters include mouse and human U6-snRNA promoters, human H1-RNase P RNA promoters, and human valine-tRNA promoters.

[0071] (ii) Donor DNA for selection markers Selective marker donor DNA is donor DNA used to knock in a selective marker into a target region. Selective marker donor DNA contains the base sequence of one or more selective marker genes between an upstream homology arm having a base sequence homologous to the adjacent base sequence upstream of the target region and a downstream homology arm having a base sequence homologous to the adjacent base sequence downstream of the target region.

[0072] The donor DNA for selection markers is not particularly limited, but may have lengths of, for example, 1kb or more, 2kb or more, 3kb or more, 4kb or more, 5kb or more, 6kb or more, 7kb or more, 8kb or more, 9kb or more, 9.5kb or more, or 10kb or more. The donor DNA for selection markers is not particularly limited, but may have lengths of, for example, 50kb or less, 45kb or less, 40kb or less, 35kb or less, 30kb or less, 25kb or less, 20kb or less, 15kb or less, 14kb or less, 13kb or less, 12kb or less, 11kb or less, 10kb or less, 9kb or less, 8kb or less, 7kb or less, 6kb or less, 5kb or less, or 4kb or less.

[0073] A "selection marker" refers to a protein that can be used to select cells based on whether or not it is expressed. A selection marker gene is a gene that codes for a selection marker. In a cell population containing both cells expressing and not expressing a selection marker, when selecting cells that express the selection marker, the selection marker is called a "positive selection marker" or "selection marker for positive selection." In a cell population containing both cells expressing and not expressing a selection marker, when selecting cells that do not express the selection marker, the selection marker is called a "negative selection marker" or "selection marker for negative selection." Selection markers being different from each other means that they can be distinguished from each other (for example, they are distinguishably different), meaning that they can be distinguished from each other at least in physiological properties such as the drug resistance properties or other physicochemical properties that the selection marker confers to cells into which it has been introduced. In other words, when selection markers are different from each other, it means that multiple different selection markers can be detected distinguishably from other selection markers, or that drugs can be selected distinguishably from other selection markers. Furthermore, the statement that the selection marker gene is unique to each type of selection marker donor DNA means that a selection marker gene present in one type of selection marker donor DNA is not present in any other type of selection marker donor DNA, or, if present in multiple types of donor DNA, it is configured so that it is not expressed simultaneously from two or more types of donor DNA. In this case, the two or more types of donor DNA may be identical except for the selection marker, or they may differ in the sequence and / or composition other than the selection marker.

[0074] Positive selection markers are not particularly limited as long as they allow for the selection of cells that express them. Examples of positive selection marker genes include drug resistance genes, fluorescent protein genes, luminescent enzyme genes, and chromogenic enzyme genes.

[0075] Negative selection markers are not particularly limited as long as they can select cells that do not express them. Examples of negative selection marker genes include suicide genes (such as thymidine kinase), fluorescent protein genes, luminescent enzyme genes, and chromogenic enzyme genes. If a negative selection marker gene is a gene that negatively affects cell survival (e.g., a suicide gene), it can be functionally linked to an inductive promoter. By functionally linking to an inductive promoter, the negative selection marker gene can be expressed only when it is desired to remove cells that possess the negative selection marker gene. If the negative selection marker gene is an optically detectable marker gene (visible marker gene) such as a fluorescence, luminescence, or chromogenic gene, and has little negative impact on cell survival, it may be constitutively expressed.

[0076] Examples of drug resistance genes include, but are not limited to, puromycin resistance genes, blastisidin resistance genes, geneticin resistance genes, neomycin resistance genes, tetracycline resistance genes, kanamycin resistance genes, zeosin resistance genes, hygromycin resistance genes, and chloramphenicol resistance genes. Examples of fluorescent protein genes include, but are not limited to, the green fluorescent protein (GFP) gene, the yellow fluorescent protein (YFP) gene, and the red fluorescent protein (RFP) gene. Examples of luminescent enzyme genes include, but are not limited to, the luciferase gene. Examples of chromogenic enzyme genes include, but are not limited to, the β-galactosidase gene, the β-glucuronidase gene, and the alkaline phosphatase gene. Examples of suicide genes include, but are not limited to, the herpes simplex virus thymidine kinase (HSV-TK) and inducible caspase 9.

[0077] The selection marker gene contained in the donor DNA for selection markers is preferably a positive selection marker gene. That is, cells expressing the selection marker can be selected as cells in which the selection marker gene has been knocked in.

[0078] The upstream homology arm has a sequence that can homologously recombine with the sequence upstream of the target region in the genome to be modified, for example, a sequence homologous to the sequence adjacent to the upstream side of the target sequence. The downstream homology arm has a sequence that can homologously recombine with the sequence upstream of the target region in the genome to be modified, for example, a sequence homologous to the sequence adjacent to the downstream side of the target sequence. The length and sequence of the upstream and downstream homology arms are not particularly limited, as long as they can homologously recombine with the surrounding region of the target region. The upstream and downstream homology arms do not necessarily have to be perfectly identical to the upstream or downstream sequence of the target region, as long as homologous recombination is possible. For example, the upstream homology arm can be a sequence that has 90% or more sequence identity (homology) with the sequence adjacent to the upstream side of the target region, and it is preferable that it has 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more sequence identity. For example, the downstream homology arm can be a sequence having 90% or more sequence identity (homology) with the adjacent base sequence downstream of the target region, and preferably has 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more sequence identity. Furthermore, the efficiency of allele modification can be further enhanced if at least one of the upstream homology arm and the downstream homology arm is closer to the cleavage site in the target region. Here, "close" may mean that the distance between the two sequences is 100 bp or less, 50 bp or less, 40 bp or less, 30 bp or less, 20 bp or less, or 10 bp or less.

[0079] In the donor DNA for selection markers, the selection marker gene is located between the upstream and downstream homology arms. This means that when the donor DNA for selection markers is introduced into cells along with the genome modification system described in (i) above, the selection marker gene is introduced into the target region via HDR (if this results in gene disruption, it is called gene knockout; if this results in the introduction of a desired gene, it is called gene knock-in, which allows for the knockout of one gene while simultaneously knocking in another).

[0080] The selection marker gene is preferably functionally linked to a promoter so that it is expressed under the control of an appropriate promoter. The promoter can be appropriately selected depending on the type of cell into which the donor DNA is introduced. Examples of promoters include the SRα promoter, SV40 initial promoter, retroviral LTR, CMV (cytomegalovirus) promoter, RSV (Rous sarcoma virus) promoter, HSV-TK (herpes simplex virus thymidine kinase) promoter, EF1α promoter, metallothionein promoter, and heat shock promoter. The donor DNA for the selection marker may have any regulatory sequences such as enhancers, poly(A) addition signals, or terminators.

[0081] The donor DNA for selection markers may have an insulator sequence. An "insulator" is a sequence that blocks or mitigates the influence of the adjacent chromosomal environment, ensuring or enhancing the independence of transcriptional regulation of the DNA sandwiched within that region. Insulators are defined by their enhancer blocking effect (the effect of blocking the influence of an enhancer on promoter activity by inserting it between an enhancer and a promoter) and their positional effect suppression effect (the effect of preventing the expression of a transgene from being affected by its position on the genome where it is inserted by sandwiching both sides of the transgene with insulators). The donor DNA for selection markers may have an insulator sequence between the upstream arm and the selection marker gene (or between the upstream arm and the promoter that controls the selection marker gene). The donor DNA for selection markers may have an insulator sequence between the downstream arm and the selection marker gene.

[0082] The donor DNA for the selection marker may be linear or circular, but is preferably circular. Preferably, the donor DNA for the selection marker is a plasmid. In addition to the above sequence, the donor DNA for the selection marker may contain any other sequence. For example, spacer sequences may be included between all or part of the sequences of the upstream homology arm, insulator, selection marker gene, and downstream homology arm.

[0083] In step (a), the cells are introduced with a number of selection marker donor DNAs equal to or greater than the number of alleles targeted for genome modification. Different types of selection marker donor DNAs have different (distinguishable) types of selection marker genes. In some embodiments, different types of selection marker donor DNAs do not have completely identical selection marker genes or sets. That is, the first type of selection marker donor DNA has the first type of selection marker gene, the second type of selection marker donor DNA has the second type of selection marker gene, the third type of selection marker donor DNA has the third type of selection marker gene, and so on for subsequent types of selection marker donor DNA. If there are two alleles targeted for genome modification, there are two or more types of selection marker donor DNAs. If there are three alleles targeted for genome modification, there are three or more types of selection marker donor DNAs. In some embodiments, a single selection marker donor DNA may have two or more mutually distinct (distinguishable) selection markers (even in this case, different types of selection marker donor DNA must have mutually distinct (distinguishable) types (e.g., unique) selection marker genes). In some embodiments, the selection marker donor DNA does not have site-directed recombinase recombinant sequences (e.g., loxP sequences and their variants that are recombined by Cre recombinase). Also, in some embodiments, the method of the present invention does not use site-directed recombinase and its recombinant sequences (e.g., loxP sequences and their variants that are recombined by Cre recombinase). When site-directed recombinase is used, one site-directed recombinase recombinant sequence usually remains in the edited genome. In contrast, in some embodiments, the modified genome of cells obtained by the method of the present invention does not have site-directed recombinase recombinant sequences (which are foreign).

[0084] The number of types of donor DNA for selection markers should be equal to or greater than the number of alleles targeted for genome modification, and there is no particular upper limit. By using as many or more types of donor DNA for selection markers as the number of alleles targeted for genome modification, two or more alleles can be stably modified. From the viewpoint of the selection operation in step (b) described below, the number of types of donor DNA for selection markers is preferably equal to or 1 to 2 more than the number of alleles targeted for genome modification, and more preferably equal to the number of alleles targeted for genome modification.

[0085] The method for introducing (i) and (ii) into cells is not particularly limited, and known methods can be used without particular restriction. Examples of methods for introducing (i) and (ii) into cells include, but are not limited to, viral infection, lipofection, microinjection, calcium phosphate, DEAE-dextran, electroporation, and particle gun. By introducing (i) and (ii) into cells, the DNA in the target region is cleaved by the sequence-specific nucleic acid cleavage molecule of (i), and then the selection marker in the selection marker donor DNA of (ii) is knocked into the target region by HDR. In this case, if two or more selection marker donor DNAs have the same upstream homology arm and downstream homology arm, they can be randomly knocked into two or more alleles of the target region. However, two or more donor DNAs for selection markers can modify each of the two or more alleles as long as they each have homology arm sequences that are homologously recombinable with the upstream and downstream sequences of the target regions of each of the two or more alleles; therefore, they do not need to have completely identical homology arm sequences. In some embodiments, the upstream and downstream homology arm sequences of two or more donor DNAs for selection markers may have sequences that are more identical to the upstream and downstream sequences of the target regions of each allele (for example, they may be optimized in this way).

[0086] In one embodiment, the donor DNA for selection markers has an upstream homology arm and a downstream homology arm, and between the upstream and downstream homology arms, it has a selection marker gene, which may further preferably have a target sequence of an endonuclease (a sequence-specific nucleic acid cleavage molecule), such as a meganuclease cleavage site. In this embodiment, in one preferred embodiment, the selection marker includes a selection marker gene for positive selection and a marker gene for negative selection. In another preferred embodiment, the selection marker includes a selection marker for positive selection, but does not necessarily include a separate negative selection marker gene. In one preferred embodiment, the selection marker gene for positive selection may also be used for negative selection, and such a marker gene is a visualization marker gene. A set of two or more selection marker donor DNAs is a combination of the above selection marker donor DNAs, and each has a selection marker gene for positive selection that is distinguishable from each other. The above set may further have target sequences of endonucleases (nucleotide sequence-specific nucleic acid cleavage molecules), such as meganuclease cleavage sites, and these target sequences may be different from each other, but it is preferable that they are the same (or can be cleaved by the same nucleotide sequence-specific nucleic acid cleavage molecule). The length of the selection marker donor DNA is as described above, but for example, it may be 5kbp or longer, 8kbp or longer, or 10kbp or longer.

[0087] (Step (b)) After step (a) above, step (b) is performed. In step (b), cells in which two or more alleles each have distinctly different selection marker genes or combinations thereof are introduced are selected based on the expression of said distinctly different selection marker genes. More specifically, in step (b), cells are selected in which two or more alleles each have distinctly different unique selection marker genes introduced by homologous recombination of different types of selection marker donor DNA, and which express all of the introduced distinctly different selection marker genes. In one embodiment, in step (b), cells are selected in which each allele has been modified by the introduction of different selection marker donor DNA, based on the expression of all selection marker genes present in the two or more selection marker donor DNAs that have been integrated into the chromosomal genome. In another embodiment, in step (b), cells are selected based on all of the selection marker genes present in the two or more selection marker donor DNAs. In one embodiment, step (b) selects cells in which each allele has been modified by the introduction of distinguishable selection marker donor DNA, based on the expression of all selection marker genes (positive selection marker genes) that are incorporated into the chromosomal genome and are present in the two or more selection marker donor DNAs. In one embodiment, the cells obtained in step (b) have different positive selection marker genes for each allele. In one embodiment, the cells obtained in step (b) have a common positive selection marker gene for each allele. Here, in one embodiment, single-cell cloning is not performed in step (b) {however, this may or may not include single-cell cloning after selecting cells in which two or more alleles have been modified in step (b)}. In one embodiment, cell selection in step (b) is performed based on the expression of multiple distinguishable positive selection marker genes introduced into each allele. In one embodiment, step (b) is not performed in a manner that estimates the number of modified alleles based on the expression intensity of a single selection marker gene (e.g., the expression intensity or fluorescence intensity of a fluorescent protein).When selecting cells using a method that estimates the number of modified alleles based on the strength of expression of a single selection marker gene, variations in gene expression levels occur in each cell, making it difficult to completely isolate cells with two or more modified alleles from cells with only one modified allele. Therefore, single-cell cloning becomes necessary in step (b).

[0088] Step (b) may involve selecting cells as appropriate, depending on the type of selection marker gene used in step (a). In this case, cells should be selected based on the expression of all selection marker genes used in step (a).

[0089] For example, if the selection marker gene is a positive selection marker gene, cells expressing all selection marker genes incorporated into (or already incorporated into) the chromosome genome to be modified can be selected. For example, cells expressing the same number of positive selection markers as the number of alleles to be modified can be selected. If the positive selection marker gene is a drug resistance gene, cells expressing the positive selection marker can be selected by culturing the cells in a medium containing the drug. If the positive selection marker gene is a fluorescent protein gene, a luminescent enzyme gene, or a chromogenic enzyme gene, cells expressing the positive selection marker can be selected by selecting cells that exhibit fluorescence, luminescence, or color development due to the fluorescent protein, luminescent enzyme, or chromogenic enzyme. In this process, if the same number of selection marker donor DNAs as the number of alleles to be modified are incorporated into the genome, that number of alleles are modified. In n-ploid cells, the number of alleles to be modified is n or less, and if the number of selection marker donor DNAs between n and n is incorporated into the genome, at least the alleles to be modified (two or more alleles) are modified. In one embodiment, the number of alleles to be modified is n, and this number of types of selection marker donor DNA are incorporated into the chromosomal genome, thereby modifying all alleles. In another embodiment, since this step uses the same number or more types of selection marker donor DNA as the number of alleles to be modified, the number of positive selection markers expressed by the cells means that this number of alleles have been reliably modified. From the viewpoint of improving the cell selection efficiency in step (b), it is preferable that the number of alleles to be modified is the same as the number of types of selection marker donor DNA.

[0090] As described above, in the genome modification method of this embodiment, by inducing HDR using n types of selection marker donor DNA to modify n alleles in n-ploid cells, cells in which all alleles have been modified can be efficiently obtained. Furthermore, since cells in which all alleles have been modified can be reliably obtained, even if the target region is large (e.g., 10 kbp or larger), cells in which the target region has been modified can be efficiently obtained. Therefore, large-scale genome modification becomes possible.

[0091] In one embodiment, in step (b), modified cells can be selected from a pool containing cells obtained in step (a) without cloning the cells. By omitting the cloning step, the time required for the step can be reduced. In one embodiment, the pool is 10 5 The above 10 6 The above 10 7 or more, or 10 8 The above cells may also be included.

[0092] (Optional process) The genome modification method of this embodiment may include any additional steps in addition to steps (a) and (b) described above. Examples of optional steps include steps (c) and (d) below: (c) After step (b), a step of introducing recombinant donor DNA containing a desired base sequence into the cell between an upstream homology arm having a base sequence homologous to the base sequence adjacent to the upstream side of the target region and a downstream homology arm having a base sequence homologous to the base sequence adjacent to the downstream side of the target region; and (d) A step of selecting cells that do not express the negative selection marker after step (c).

[0093] In some embodiments, the genome modification method of this embodiment may include any additional steps in addition to steps (a) and (b) described above. In some embodiments, the genome modification method of this embodiment or the method for obtaining cells with a modified genome may include two or more selection marker donor DNAs, each having a selection marker gene for positive selection, a separate marker gene for negative selection, and a target sequence between the upstream homology arm and the downstream homology arm, wherein if the selection marker gene is used for both positive and negative selection, it does not need to have the separate selection marker gene for negative selection, and for example, the method may include steps (c) and (d) below: (c) After step (b) above, a step of introducing (iii) and (iv) below into selected cells to introduce recombinant donor DNA into the two or more alleles, (iii) A genome modification system comprising a sequence-specific nucleic acid cleavage molecule that targets and can cleave the further target sequence, or a polynucleotide encoding the sequence-specific nucleic acid cleavage molecule. (iv) Recombinant donor DNA containing a desired nucleotide sequence, comprising an upstream homology arm having a nucleotide sequence homologously recombinable with the nucleotide sequence upstream of the target region, and a downstream homology arm having a nucleotide sequence homologously recombinable with the nucleotide sequence downstream of the target region {the recombinant donor DNA may or may not contain the desired nucleotide sequence between the upstream homology arm and the downstream homology arm}. (d) After step (c), a step of selecting cells that do not express the negative selection marker gene (a step for negative selection).

[0094] <Process (c)> Step (c) may be performed after step (b). In one embodiment, step (c) involves introducing recombinant donor DNA containing or not containing the desired nucleotide sequence between an upstream homology arm and a downstream homology arm into the cells selected in step (b). In one embodiment, step (c) involves introducing recombinant donor DNA containing the desired nucleotide sequence between an upstream homology arm having a nucleotide sequence homologous to the nucleotide sequence adjacent to the upstream side of the target region and a downstream homology arm having a nucleotide sequence homologous to the nucleotide sequence adjacent to the downstream side of the target region into the cells selected in step (b).

[0095] Recombinant donor DNA Recombinant donor DNA may contain the desired nucleotide sequence to be knocked in. The desired nucleotide sequence is not particularly limited. For example, if the purpose of genome modification is to knock out the function of a gene contained in a target region, a nucleotide sequence in which part or all of the nucleotide sequence of the target region is deleted can be used as the desired nucleotide sequence. Also, if an exogenous gene is to be incorporated into the target region, a nucleotide sequence containing that gene can be used as the desired nucleotide sequence. The size of the desired nucleotide sequence is not particularly limited and can be any size. The desired base sequence can be, for example, 10 bp or larger, 20 bp or larger, 40 bp or larger, 80 bp or larger, 200 bp or larger, 400 bp or larger, 800 bp or larger, 1 kbp or larger, 2 kbp or larger, 3 kbp or larger, 4 kbp or larger, 5 kbp or larger, 6 kbp or larger, 7 kbp or larger, 8 kbp or larger, 9 kbp or larger, 10 kbp or larger, 15 kbp or larger, 20 kbp or larger, 40 kbp or larger, 80 kbp or larger, 100 kbp or larger, or 200 kbp or larger. The method of this embodiment allows for efficient selection of cells in which the desired base sequence has been knocked into two or more alleles. Therefore, even large DNAs of, for example, 5 kbp or larger, 8 kbp or larger, or 10 kbp or larger can be knocked in. The recombinant donor DNA may be, for example, shorter in length than the selection marker donor DNA.

[0096] The upstream and downstream homology arms of the recombinant donor DNA may be the same as or different from those of the selection marker donor DNA. For convenience, the upstream and downstream homology arms included in the selection marker donor DNA may be referred to as the "first upstream homology arm" and the "first downstream homology arm," and the upstream and downstream homology arms included in the recombinant donor DNA may be referred to as the "second upstream homology arm" and the "second downstream homology arm." The length and sequence of the second upstream and second downstream homology arms are not particularly limited, for example, as long as they are homologously recombinable with the first upstream homology arm or a region upstream thereof, and homologously recombinable with the first downstream homology arm or a region downstream thereof (in some embodiments, their length and sequence are not particularly limited as long as they are homologously recombinable with the region surrounding the target region). After recombination with recombinant donor DNA, it is permissible for some of the base sequence of the selective marker donor DNA to remain on the genome, but preferably, the base sequence of the selective marker donor DNA is completely removed from the genome by recombination with the recombinant donor DNA. Various genes carried on the selective marker donor DNA are removed by recombination with the recombinant donor DNA. In some embodiments, this allows two or more alleles of a cell to be replaced by the recombinant donor DNA. In some embodiments, the recombinant donor DNA may have a desired base sequence, so that a cell in which two or more alleles have been modified will have the desired base sequence in the modified alleles.

[0097] In recombinant donor DNA, the desired base sequence is located between the second upstream homology arm and the second downstream homology arm. If the recombinant donor DNA contains a foreign gene, it is preferable that the foreign gene is functionally ligated to the promoter. The recombinant donor DNA may have any regulatory sequences such as enhancers, poly(A) addition signals, or terminators. Furthermore, if the recombinant donor DNA contains a foreign gene, it may have insulator sequences upstream and downstream of the foreign gene. In one embodiment, the recombinant donor DNA includes a spacer sequence between the second upstream homology arm and the second downstream homology arm. In one embodiment, when removing cells that have a negative selection marker gene contained in the selection marker donor DNA, if a gene identical (or indistinguishable) to the said gene is expressed under conditions in which its toxicity is exerted, it is not possible to select cells in which homologous recombination has occurred with the recombinant donor DNA. Therefore, the recombinant donor DNA is configured such that, when cells possessing the negative selection marker gene of the selection marker donor DNA are removed, the same (or indistinguishable) gene as that gene is not expressed under conditions in which its toxicity is exerted. For example, in one embodiment, the recombinant donor DNA does not have a negative selection marker gene and a second target sequence between the second upstream homology arm and the second downstream homology arm.

[0098] It is preferable that the recombinant donor DNA is introduced into the cells together with (i) above. By introducing the recombinant donor DNA into the cells together with (i) above, the DNA in the target region is cleaved by the sequence-specific nucleic acid cleavage molecule in (i) above, and then the desired base sequence in the recombinant donor DNA is knocked into the target region by HDR. Since the cells into which the recombinant donor DNA is introduced in this step are the cells selected in step (b), the base sequence of the selection marker donor DNA has been knocked into the target region. Therefore, the target sequence of the genome modification system in (i) is the base sequence contained in the target region after the selection marker donor DNA knock-in. For convenience, the target sequence of the genome modification system in step (a) may be referred to as the "first target sequence," and the target sequence of the genome modification system in step (c) may be referred to as the "second target sequence." The second target sequence can be any sequence contained in the target region of the cell after step (b). In some embodiments, the second target sequence in the selection marker donor DNA may be a sequence that does not exist on the genome of the cell in question. In one embodiment, the second target sequence in the selection marker donor DNA is a sequence not present in the cell's genome and is distinct from other sequences to the extent that it does not cleave other genomic sequences due to off-target reactions. In another embodiment, the second target sequence in the selection marker donor DNA may be a meganuclease cleavage site not present in the genome. In yet another embodiment, the second target sequence is a region other than the negative selection marker gene in step (d). Naturally, the recombinant donor DNA is configured such that homologous recombination by the recombinant donor DNA is not significantly inhibited. If the first target sequence remains in the target region of the cell after step (b) or if the first target sequence is reintroduced by the selection marker donor DNA, the second target sequence may be the same as or different from the first target sequence.

[0099] Recombinant donor DNA does not need to contain a base sequence between the upstream homology arm and the downstream homology arm, but it may contain a base sequence of 10 bp or less, 20 bp or less, 30 bp or less, 40 bp or less, 50 bp or less, 60 bp or less, 70 bp or less, 80 bp or less, 90 bp or less, 100 bp or less, 200 bp or less, 300 bp or less, 400 bp or less, 500 bp or less, 600 bp or less, 700 bp or less, 800 bp or less, 900 bp or less, or 1 kbp or less between the upstream and downstream homology arms. Recombinant donor DNA may contain a base sequence of 1 kbp or more, 2 kbp or more, 3 kbp or more, 4 kbp or more, 5 kbp or more, 6 kbp or more, 7 kbp or more, 8 kbp or more, 9 kbp or more, or 10 kbp or more between the upstream and downstream homology arms.

[0100] Recombination donor DNA contains, or does not contain, one or more or all of, selected from the group consisting of a selection marker gene, a target sequence for site-directed recombinant enzyme, a gene encoding a physiologically active factor, a gene encoding a cytotoxic factor, and a promoter sequence between the upstream homology arm and the downstream homology arm.

[0101] In step (c), recombinant donor DNA is introduced into the cells selected in step (b). The cells selected in step (b) have a selection marker gene knocked into the target region. Step (c) can also be described as a step of removing the selection marker gene that has been knocked into the target region or replacing it with a desired base sequence.

[0102] (Step (d)) After step (c), step (d) may be performed. In step (d), cells that do not express the negative selection marker are selected.

[0103] When performing step (d), the donor DNA for selection markers used in step (a) may each contain a positive selection marker gene and a negative selection marker gene. That is, the donor DNA for selection markers used in step (a) may contain a positive selection marker gene and a negative selection marker gene between the upstream homology arm and the downstream homology arm. The positional relationship between the positive selection marker gene and the negative selection marker gene is not particularly limited; the positive selection marker gene may be upstream of the negative selection marker gene, or vice versa. When the donor DNA for selection markers contains a positive selection marker gene and a negative selection marker gene, a nucleotide sequence encoding a self-cleaving peptide or an IRES (internal ribozyme entry site) sequence may be interposed between the positive selection marker gene and the negative selection marker gene. By interposing these sequences, the positive selection marker gene and the negative selection marker gene can be expressed independently from a single promoter. Examples of 2A peptides include 2A peptide derived from foot-and-mouth disease virus (FMDV) (F2A), 2A peptide derived from equine rhinitis A virus (ERAV) (E2A), 2A peptide derived from Porcine teschovirus (PTV-1) (P2A), and 2A peptide derived from Thosea asigna virus (TaV) (T2A).

[0104] Alternatively, the same selection marker gene may be used as a positive selection marker in step (a) and as a negative selection marker in step (d). For example, if the selection marker gene is a marker gene involved in fluorescence or color development such as a fluorescent protein gene, a luminescent enzyme gene, or a chromogenic enzyme gene (visualization marker gene), then in step (a), cells exhibiting fluorescence, emission, or color development due to the expression of the fluorescent protein, luminescent enzyme, or chromogenic enzyme may be selected, and in step (c), cells in which these fluorescence, emission, or color development have disappeared may be selected. The case where the same selection marker gene serves as both a positive and negative selection marker is also included when the selection marker donor DNA further contains a negative selection marker in addition to the positive selection marker.

[0105] The negative selection marker gene may be different or the same for each type of donor DNA used as a selection marker. Using a common negative selection marker gene simplifies the cell selection process in step (d).

[0106] Step (d) should involve selecting cells appropriately according to the type of negative selection marker gene used in step (a). In this case, cells that do not express any of the negative selection marker genes used in step (a) should be selected.

[0107] For example, when the negative selection marker gene is a visualization marker gene such as a fluorescent protein gene, a luminescent enzyme gene, or a chromogenic enzyme gene, cells in which the visualization marker such as fluorescence, luminescence, or chromogenesis has disappeared may be selected. When the negative selection marker gene is a suicide gene, cells that do not express the negative selection marker can be selected by culturing the cells in a medium containing a drug that exhibits toxicity due to the expression of the suicide gene. For example, when using the thymidine kinase gene as a suicide gene, the cells may be cultured in a medium containing ganciclovir. The disappearance of the expression of the negative selection marker gene means that the negative selection marker gene integrated into the target region in step (a) has been replaced with a polynucleotide containing the desired base sequence of the donor DNA for recombination. At this time, it is considered that the replacement of the polynucleotide occurs throughout the entire base sequence knocked in in step (a). Therefore, by selecting cells in which the expression of the negative selection marker gene has disappeared, cells in which the base sequence knocked in in step (a) has been replaced with the desired base sequence of the donor DNA for recombination can be efficiently selected. The negative selection marker gene such as a suicide gene may be operably linked to an inducible promoter, and the cells are cultured in the presence of a drug that drives the inducible promoter so that the negative selection marker gene is expressed under conditions where its toxicity is exerted, whereby cells that do not express the negative selection marker can be selected. In this case, the negative selection marker gene may be a gene encoding a cytotoxin (e.g., ricin and diphtheria toxin) that causes toxicity to cells only when expressed.

[0108] In one aspect, in step (d), from the pool containing the cells obtained in step (c), without cloning the cells, cells in which two or more alleles have been modified (cells in which the negative selection marker gene is absent) can be selected. In one aspect, the above pool contains 10 5 or more, 10 6 or more, 10 7 or more, or 10 8 or more cells.

[0109] As described above, by performing steps (c) and (d), cells in which all alleles have been modified to the desired sequence can be efficiently obtained. Furthermore, since cells in which all alleles have been modified can be reliably obtained, even if the desired base sequence is large in size (e.g., 10 kbp or more), cells in which the base sequence has been knocked into the target region can be efficiently obtained. In one embodiment, by performing steps (c) and (d), the target region is deleted in all alleles of the cell, and the sequences before and after the deletion (i.e., the sequences in which the upstream homology arm and downstream homology arm undergo homologous recombination, respectively) are seamlessly linked without one or more selected from the group consisting of base insertions, substitutions, and deletions (e.g., without base insertions, substitutions, and deletions). In another embodiment, in the obtained cells, the base sequences on the upstream and downstream sides of the deleted region are seamlessly linked.

[0110] Furthermore, if the number of viable cells is small or no viable cells are obtained in step (b), it is shown that the upstream homology arm and the target region removed from the genome by homologous recombination contain genes that affect cell proliferation or survival. Therefore, it is possible to investigate whether the target region contains genes that affect cell proliferation or survival. In this case, by changing the design positions of the upstream and downstream homology arms, the genes that are removed from the genome by homologous recombination can be changed to identify genes that affect cell proliferation or survival. Therefore, the present invention allows step (e) to be performed after step (b). That is, step (e) includes identifying genes that affect cell proliferation or survival by narrowing the target region and reducing the number of genes removed from the genome in step (b) if the number of viable cells is small or no viable cells are obtained. If the target region contains only one gene, it is shown that this gene is a gene that affects cell proliferation or survival. Then, if a gene that affects cell proliferation or survival has been identified, step (f) can be performed. Step (f) includes knocking in a gene that affects the proliferation or survival of the identified cells into another region of the genome (e.g., a safe harbor region) {recombinant donor DNA may be used for the knock-in}. This expands the region removed by the method of the present invention (extending the target region upstream and / or downstream). The low number of viable cells can be confirmed by comparing it with the number of cells obtained when steps (a) and (b) are performed on a region that does not affect cell survival or proliferation. In some embodiments, step (a) may not target a region that would cause loss of cell proliferation or survival. The present invention includes, for example, knocking in a desired gene into the chromosomal region (i) or a region other than (i) (e.g., a safe harbor region) of the genomic DNA of a cell having a deletion in the chromosomal region of (i).Such cells have a deletion in the chromosomal region (i) and a genome having a gene encoding the desired gene in the chromosomal region (i) or in a region other than (i) (e.g., the region (ii) above and the safe harbor region having the deletion).

[0111] In one embodiment, cells are provided having a genome having a deletion in a region of the entire allele of the genome (or two alleles in the case of diploidy) (for example, a deletion of a region up to 1 Mb, or 500 kb or less, 450 kb or less, 400 kb or less, 350 kb or less, or 300 kb or less), which includes a region containing some, or preferably all, of the gene groups encoding KIR and / or KLR (sometimes referred to as the KIR gene group and the KLR gene group, respectively). In this embodiment, the readability of the genome is improved and / or the targeting efficiency of the genes in the genome (e.g., KIR genes or KLR genes) can be increased by deleting repetitive sequences due to similar sequences. Cells having such deletions may also have insertions of endogenous or exogenous genes. The inserted genes are preferably operably linked to a regulatory sequence.

[0112] In one embodiment, with respect to the deletion, the region containing the gene group encoding KIR may further include a surrounding region. This surrounding region may include, for example, LILRB1 and / or LILRB4. This surrounding region may include, for example, one, two, or three selected from the group consisting of FCAR, NCR1, and NRRP7.

[0113] In one embodiment, the deletion is a region containing the KIR gene group, and the size of the deletion is not particularly limited, but is for example 140kbp-500kbp, 200kbp-500kbp, 300kbp-500kbp, 140kbp-400kbp, 200kbp-400kbp, or 300kbp-400kbp.

[0114] In one embodiment, the deletion is a region containing the KLR gene group, and the size of the deletion is not particularly limited, but is for example 140kbp-500kbp, 200kbp-500kbp, 300kbp-500kbp, 140kbp-400kbp, 200kbp-400kbp, or 300kbp-400kbp.

[0115] In one embodiment, the cell has a deletion, the deletion including part or all of the region containing the KLR gene cluster (e.g., the region corresponding to hg38:chr12:10,308,078-10,451,156). In one embodiment, the cell has a deletion, the deletion including part or all of the region containing the KIR gene cluster (e.g., the region corresponding to hg38:chr19:54,724,497-54,866,731). In one embodiment, the cell has a deletion, the deletion including part or all of the region containing the KIR gene cluster (e.g., the region corresponding to hg38:chr19:54,630,354-54,944,284).

[0116] Targeting of the gene clusters encoding KIR, LILR, and KLR can be performed on unique sequences for each. The clusters containing these genes are located within a region of approximately 150kbp to 450kbp. Therefore, it is necessary to find at least one unique sequence within this region. By targeting and cleaving this unique sequence, genome modification of the region becomes possible, and the positive-negative marker set can be introduced. In one preferred embodiment, in cells into which the positive-negative marker set has been introduced, one specific cleavage site is made on each side of the region to be deleted. Therefore, one unique sequence is required on each side of the region to be deleted.

[0117] A positive-negative marker set includes a set of multiple nucleic acids containing combinations of positive and negative selection markers, where the positive and negative selection markers in one nucleic acid are distinguishable from the positive and negative selection markers in other nucleic acids during selection. For example, the first combination includes green fluorescent protein (GFP) and the puromycin resistance gene (Puro), and the second combination includes red fluorescent protein (RFP) and the blasticidin resistance gene (Blst), where GFP and RFP are negative selection markers and distinguishable during selection by flow cytometry, and Puro and Blst are positive selection markers and distinguishable during drug selection. Preferably, the positive selection marker is a drug resistance gene, and preferably the negative selection marker is a gene encoding a fluorescent protein. Positive-negative marker sets are typically expected to be introduced at corresponding positions (especially identical positions) on two alleles of genomic DNA. By inducing specific cuts at the modification site in the cells to be edited in the presence of a selection marker donor DNA containing a set of positive and negative markers, and then performing drug selection, clones can be obtained in which different drug resistance genes are inserted into each allele. In this case, it is not necessary to induce large deletions of 1 kbp or more, 2 kbp or more, 3 kbp or more, 4 kbp or more, 5 kbp or more, 6 kbp or more, 7 kbp or more, 8 kbp or more, 9 kbp or more, or 10 kbp or more. Subsequently, in the presence of recombinant donor DNA, a large DNA deletion can be induced by a second recombination by introducing one or more specific cuts near the region containing the positive and negative marker set, preferably two cuts flanking the positive and negative marker set. The junction region of the DNA after deletion will have the sequence that was present in the recombinant donor DNA. In this way, deletions can be produced exactly as designed at the single-nucleotide level without using site recombinases, and the sequence of the DNA after deletion will also be the designed sequence.After the second recombination, cells with deletions can be effectively selected by expressing negative selection markers. If the cells are diploid, clones that express only one negative selection marker have a deletion in only one allele, while clones that do not express any negative selection markers have deletions in all alleles.

[0118] The following examples demonstrate that certain gene loci can induce silencing of the expression of a negative selection marker in a positive-negative marker set. Silencing may occur uniformly in all cells or only in some cells. When silencing occurs only in some cells, the presence of silencing cells, even if only a small proportion, poses a significant obstacle to negative selection. Specifically, in negative selection, approximately 1 in 10,000 clones are truly selected (hit clones). However, if expression is stopped even in a very small number of cells due to silencing, it becomes extremely difficult to obtain truly selected clones, as the result is a large number of false negatives. For example, suppose silencing of the negative selection marker occurs in 1% of cells. This would result in 100 false negative clones in 10,000 cells. As mentioned above, only one truly selected clone is included. Therefore, starting from 10,000 cells, we end up with a mixture of 100 false negative clones and one truly selected clone. When clones that are negative for the selection marker are obtained, only 1 in 101 clones will be truly selected, making silencing a major obstacle in negative selection. Thus, even if silencing occurs in only a very small number of cells, it has a significant impact on negative selection.

[0119] Therefore, this disclosure provides a method for detecting whether such silencing is occurring. For example, if silencing is occurring, a set of positive-negative markers can be introduced to another site, and if silencing is not occurring, negative selection can be performed.

[0120] In one embodiment, a method for detecting whether silencing of a negative selection marker is occurring in a set of positive and negative markers is: Prepare cells that have a set of positive and negative markers, each allele of a specific gene locus, containing a positive selection marker and a negative selection marker, where the positive selection marker is distinguishably different for each allele, and the negative selection marker is distinguishably different for each allele. The expression level of the negative selection marker in the cells is measured to determine the percentage of cells in which silencing occurs in relation to the expression of the negative selection marker, This includes, where the positive selection marker is preferably a drug resistance gene, and the negative selection marker is preferably a gene encoding a fluorescent protein.

[0121] A method for detecting whether silencing of a negative selection marker is occurring in a set of positive and negative markers is: The system may further include determining that silencing is occurring if the percentage of cells undergoing silencing exceeds a certain threshold, and determining that silencing is not occurring or that negative selection is possible if the percentage of cells undergoing silencing is below the threshold.

[0122] This disclosure also provides a method for determining whether a negative choice is possible, A method is provided which includes evaluating that silencing is occurring when the percentage of cells undergoing silencing exceeds a reference value, and determining that negative selection is possible when the percentage of cells undergoing silencing is below the reference value.

[0123] This disclosure also provides the following methods: A method for producing isolated cells in which two or more alleles of the chromosomal genome have been modified, (a) The steps of introducing (i) and (ii) below into isolated cells containing two or more alleles (excluding fertilized eggs) to introduce a selection marker gene into each of the two or more alleles, (i) A genome modification system comprising a sequence-specific nucleic acid cleavage molecule capable of targeting and cleaving target regions in two or more alleles of the chromosomal genome, or a polynucleotide encoding the sequence-specific nucleic acid cleavage molecule. (ii) Two or more selection marker donor DNAs, each having an upstream homology arm having a nucleotide sequence homologously recombinable with the nucleotide sequence upstream of the target region and a downstream homology arm having a nucleotide sequence homologously recombinable with the nucleotide sequence downstream of the target region, and containing the nucleotide sequence of a selection marker gene for positive selection between the upstream homology arm and the downstream homology arm, wherein the two or more selection marker donor DNAs for positive selection each have mutually distinguishable selection marker genes, the selection marker genes for positive selection are unique to each type of selection marker donor DNA, and the number of types of selection marker donor DNAs is equal to or greater than the number of alleles targeted for genome modification, wherein the selection marker gene for positive selection is a drug resistance gene, and each of the two or more selection marker donor DNAs has a selection marker gene for positive selection, a marker gene for negative selection, and a target sequence between the upstream homology arm and the downstream homology arm, (b) After step (a), homologous recombination of different types of selection marker donor DNA is performed on each of the two or more alleles, thereby introducing distinctly different unique selection marker genes into each of the two or more alleles, and a step of selecting isolated cells that express all of the introduced distinctly different selection marker genes for positive selection (a step for positive selection), To determine the percentage of cells in which the expression of negative expression markers is silenced in selected cells, Includes, If the percentage is below the standard value, (c) After step (b) above, a step of introducing (iii) and (iv) below into selected cells to introduce recombinant donor DNA into the two or more alleles, (iii) A genome modification system comprising a sequence-specific nucleic acid cleavage molecule that targets the target sequence and can cleave the target sequence, or a polynucleotide encoding the sequence-specific nucleic acid cleavage molecule. (iv) Recombinant donor DNA containing a desired base sequence, comprising an upstream homology arm having a base sequence homologously recombinable with the base sequence upstream of the target region, and a downstream homology arm having a base sequence homologously recombinable with the base sequence downstream of the target region, (d) After step (c), a step of selecting cells that do not express the negative selection marker gene (a step for negative selection), Further including, Method. The above silencing is not particularly limited, but may be observed in regions where selective expression regulation occurs in gene cluster regions (e.g., regions where allelic exclusion occurs, e.g., immunoglobulin (Ig) genes, Igκ and λ light chain genes, olfactory receptor genes, vomeronasal receptor V1R gene, T cell receptor genes, etc.). In this embodiment, isolated cells selected in the positive selection step can be allowed to grow, and the proportion of cells that undergo silencing can be confirmed after proliferation. In a preferred embodiment, if the proportion exceeds a threshold value, it may be indicated that negative selection is not easily achieved by silencing. Then, after the positive selection steps in (a) and (b) above, the selected cells can be grown to obtain the following cell populations: In a certain embodiment, a cell population including cells (e.g., vertebrate cells, e.g., mammalian cells, e.g., human cells), Each cell contains a set of positive and negative markers in each of the two alleles within a region of less than 500 kbp that includes a gene cluster region. A positive-negative marker set includes positive selection markers and negative selection markers, wherein positive selection markers in the same cell are distinguishable from each other, and negative selection markers in the same cell are distinguishable from each other. A cell population in which the proportion of cells in which the negative selection marker is silenced is 10% or less (or below the reference value). In the said cell population, the proportion of silenced cells is 1 × 10⁻⁶ -7 % or more, 1 x 10 -6 % or more, 1 x 10 -5% or more, 0.00001% or more, 0.00002% or more, 0.00003% or more, 0.00004% or more, 0.00005% or more, 0.00006% or more, 0.00007% or more, 0.00008% or more, 0.00009% or more, 0.001% or more, 0.002% or more, 0.003% or more, 0.004% or more, 0.005% or more, 0.006% or more, 0.007% or more, The percentage may be 0.008% or more, 0.009% or more, 0.01% or more, 0.02% or more, 0.03% or more, 0.04% or more, 0.05% or more, 0.06% or more, 0.07% or more, 0.08% or more, 0.09% or more, 0.1% or more, 0.2% or more, 0.3% or more, 0.4% or more, 0.5% or more, 0.6% or more, 0.7% or more, 0.8% or more, 0.9% or more, or 1% or more. In one embodiment, the percentage of silenced cells is 1 × 10⁻⁶ -7 It can be %~5%. 1 × 10 -7 It can be between % and 1%. In some embodiments, the percentage of silenced cells may be between 0.00001% and 5%, 4%, 3%, 2%, or 1%. In some embodiments, the percentage of silenced cells may be between 0.0001% and 2%. In some embodiments, the percentage of silenced cells may be between 0.001% and 2%. In some embodiments, the percentage of silenced cells may be between 0.001% and 2%. In some embodiments, the percentage of silenced cells may be between 0.01% and 2%. In some embodiments, the percentage of silenced cells may be between 0.1% and 2%. In some embodiments, the percentage of silenced cells may be between 0.1% and 1%. While it is generally considered possible to confirm deletions in approximately 100 to 1000 cells, a smaller percentage of silenced cells is preferable to reduce the number of cells to be checked. Furthermore, for example, if silencing is unavoidable, the selected cells may be subjected to a negative selection process (however, in negative selection, it may be necessary to check whether deletions have occurred in more clones in order to eliminate false negatives from negative selection marker-negative cells), but for example, the selected cells may not be subjected to (or it may be decided not to be subjected to) a subsequent negative selection process.

[0124] The lower the standard value, the better. For example, 10% or less, 5% or less, 4% or less, 3% or less, 2% or less, 1% or less, 0.9% or less, 0.8% or less, 0.7% or less, 0.6% or less, 0.5% or less, 0.4% or less, 0.3% or less, 0.2% or less, 0.1% or less, 0.09% or less, 0.08% or less, 0.07% or less, 0.06% or less, 0.05% or less, 0.04% or less, 0.03% or less, 0.02% or less, 0.01% or less, 0.009% or less, 0.008% or less, 0.007% or less, 0.006% or less, 0.005% or less, 0.004% or less, 0.003% or less, 0.002% or less, 0.001% or less, 0.0009% or less, 0.0008% or less, 0.0007% or less, 0.0006% or less, 0.0005% or less, 0.0004% or less, 0.0003% or less, 0.0002% or less, 0.0001% or less, 0.00009% or less, 0.00008% or less, 0.00007% or less, 0.00006% or less, 0.00005% or less, 0.00004% or less, 0.00003% or less, 0.00002% or less, or 0.00001% or less, 1 × 10 -5 % or less, 1 x 10 -6 % or less, or 1 × 10 -7 It can be less than %.

[0125] If the percentage of silenced cells is n% (where n is a number in the range of 0 to 100) and the probability of generating a hit clone (or its predicted value) is m%, then n / m is 500 or less, 400 or less, 300 or less, 200 or less, 100 or less, 90 or less, 80 or less, 70 or less, 60 or less, 50 or less, 40 or less, 30 or less, 20 or less, 10 or less, 9 or less, 8 or less, 7 or less, 6 or less, 5 or less, 4 or less, 3 or less, 2 or less, 1 or less, 0.9 or less, 0.8 or less, The baseline values ​​can be set to be 0.7 or less, 0.6 or less, 0.5 or less, 0.4 or less, 0.3 or less, 0.2 or less, 0.1 or less, 0.09 or less, 0.08 or less, 0.07 or less, 0.06 or less, 0.05 or less, 0.04 or less, 0.03 or less, 0.02 or less, 0.01 or less, 0.009 or less, 0.008 or less, 0.007 or less, 0.006 or less, 0.005 or less, 0.004 or less, 0.003 or less, 0.002 or less, or 0.001 or less. Based on experience, it should be assumed that m% is approximately 0.01%, and n should be determined by comparing the effort of screening with the effort of identifying other low n values ​​(under this assumption, it can be assumed that there is one hit clone for every n × 100).

[0126] The method of the present invention may further include selecting cells having deletions of the above-mentioned gene group from cells that do not express a negative selection marker. The deletion of the gene group can be determined by analyzing the DNA sequence. For example, whether or not a deletion of the gene group has occurred in the DNA can be determined by the size of the amplification product obtained by PCR, the size of the restriction enzyme fragment, or the sequence determination by sequencing.

[0127] The modified cells of this disclosure can be obtained in the manner described above.

[0128] In one embodiment, the cell has a set of positive and negative markers within the KIR gene cluster region and / or within the KLR gene cluster region. In one preferred embodiment, the cell has no deletions within the KIR gene cluster region and has a set of positive and negative markers within the KLR gene cluster region. In one preferred embodiment, the cell has a deletion of some or all of the KIR gene group within the KIR gene cluster region and has a set of positive and negative markers within the KLR gene cluster region. In one preferred embodiment, the cell has a set of positive and negative markers within the KIR gene cluster region and no deletions within the KLR gene cluster region. In one preferred embodiment, the cell has a set of positive and negative markers within the KIR gene cluster region and a deletion of some or all of the KLR gene group within the KLR gene cluster region. In one preferred embodiment, the cell has a set of positive and negative markers within both the KIR gene cluster region and the KLR gene cluster region. When a set of positive and negative markers exists at one locus, the positive and negative selection markers introduced into each of the two alleles are distinguishably different from each other. However, when they exist at two or more loci, the positive and negative selection markers introduced into any allele of any locus are distinguishably different from any other positive and negative selection markers.Cells having the above positive-negative marker set preferably have a silencing rate of negative selection markers of 5% or less, 4% or less, 3% or less, 2% or less, 1% or less, 0.9% or less, 0.8% or less, 0.7% or less, 0.6% or less, 0.5% or less, 0.4% or less, 0.3% or less, 0.2% or less, 0.1% or less, 0.09% or less, 0.08% or less, 0.07% or less, 0.06% or less, 0.05% or less, 0.04% or less, 0.03% or less, 0.02% or less, 0.01% or less, 0.009% or less, 0.008% or less, 0.007% or less, 0.00 6% or less, 0.005% or less, 0.004% or less, 0.003% or less, 0.002% or less, 0.001% or less, 0.0009% or less, 0.0008% or less, 0.0007% or less, 0.0006% or less, 0.0005% or less, 0.0004% or less, 0.0003% or less, 0.0002% or less, 0.0001% or less, 0.00009% or less, 0.00008% or less, 0.00007% or less, 0.00006% or less, 0.00005% or less, 0.00004% or less, 0.00003% or less, 0.00002% or less, or 0.00001% or less, 1 × 10. -5 % or less, 1 x 10 -6 % or less, or 1 × 10 -7 It can be less than %.

[0129] In one embodiment, a cell population is provided, wherein in one embodiment, the cells have a set of positive and negative markers within the KIR gene cluster region and / or the KLR gene cluster region, and the proportion of cells in which the negative selection marker for any allele is silenced is 1% or less. In one embodiment, the cells are provided, wherein the cells have a set of positive and negative markers within the KIR gene cluster region, and the proportion of cells in which the negative selection marker for any allele is silenced is 1% or less. In one embodiment, the cells have a set of positive and negative markers within the KLR gene cluster region, and the proportion of cells in which the negative selection marker for any allele is silenced is 1% or less.

[0130] In one embodiment, a population of cells is provided, where each cell contains a set of positive and negative markers on two alleles within a region of 500 kbp or less (or 450 kb or less, 400 kb or less, 350 kb or less, 300 kb or less, 250 kb or less, or 200 kbp or less) containing a killer cell immunoglobulin-like receptor (KIR) gene cluster region, and / or contains a set of positive and negative markers on two alleles within a region of 500 kbp or less (or 450 kb or less, 400 kb or less, 350 kb or less, 300 kb or less, 250 kb or less, or 200 kbp or less) containing a killer cell lectin-like receptor (KLR) gene cluster region. A positive-negative marker set includes positive choice markers and negative choice markers, wherein the included positive choice markers are distinguishable from each other, and the included negative choice markers are distinguishable from each other. The percentage of cells in the cell population in which the negative selection marker is silenced is 5% or less, 4% or less, 3% or less, 2% or less, 1% or less, 0.9% or less, 0.8% or less, 0.7% or less, 0.6% or less, 0.5% or less, 0.4% or less, 0.3% or less, 0.2% or less, 0.1% or less, 0.09% or less, 0.08% or less, 0.07% or less, 0.06% or less, 0.05% or less, 0.04% or less, 0.03% or less, 0.02% or less, 0.01% or less, 0.009% or less, 0.008% or less, 0.007% or less, 0.006% or less, 0.0 0.5% or less, 0.004% or less, 0.003% or less, 0.002% or less, 0.001% or less, 0.0009% or less, 0.0008% or less, 0.0007% or less, 0.0006% or less, 0.0005% or less, 0.0004% or less, 0.0003% or less, 0.0002% or less, 0.0001% or less, 0.00009% or less, 0.00008% or less, 0.00007% or less, 0.00006% or less, 0.00005% or less, 0.00004% or less, 0.00003% or less, 0.00002% or less, or 0.00001% or less, 1 × 10 -5 % or less, 1 x 10 -6 % or less, or 1 × 10 -7 It is less than %.

[0131] Cells containing a set of positive and negative markers can be preferably used to induce deletion (and substitution) of the region containing the set of positive and negative markers. The size and location of the deletion can be determined by the cleavage site of the target DNA and the design of the recombinant donor DNA. Whether the deletion or substitution occurs can also be determined by the design of the recombinant donor DNA. The sequence between the upstream and downstream homology arms of the recombinant donor DNA replaces the region to be deleted in the resulting cell. If the sequence between the upstream and downstream homology arms is absent, a complete region deletion occurs; if the sequence exists between the upstream and downstream homology arms, the deleted region is replaced by the sequence between those upstream and downstream homology arms. In this way, cells containing a set of positive and negative markers can be preferably used for further genetic engineering. However, it is desirable that the proportion of cells in which the negative selection marker is silenced be below a certain threshold in order to facilitate the selection of deletion cells. In particular, since the above region is a region in which silencing can occur, those skilled in the art will understand that it is important to keep the proportion of silenced cells small.

[0132] In all embodiments, the cells are vertebrate cells, preferably human cells.

[0133] The modified cells of this disclosure may be included, for example, in a composition (particularly in an aqueous composition). The composition may further contain, in addition to the cells, water, salts, and additives (e.g., pH adjusters, isotonic agents, dispersants, etc.).

[0134] If the cells are pluripotent cells, then the pluripotent cells and a composition containing the pluripotent cells are provided. The pluripotent cells can be used after being differentiated into the desired cells. For example, they can be used after being differentiated into immune cells (e.g., NK cells or T cells). Genetic modification may be easier in pluripotent cells than in differentiated cells, in which case the modification to be conferred to the differentiated cells may be performed in the pluripotent cells or at other differentiation stages. If the immune cells are NK cells, then genetic modification can be conferred to hematopoietic stem cells or common lymphocyte progenitor cells, and NK cells, as well as at the differentiation stage between any two of these.

[0135] The cells of this disclosure may further have deletions of some or all of HLA class I and / or class II. Since silencing did not occur in the HLA region, it is thought that clones with deletions of some or all of the HLA region can be obtained by negative selection using a negative selection marker inserted into that region. [Examples]

[0136] We attempted large-scale deletions of the KIR and LILR gene loci, which are immune system receptors and possess sequence polymorphisms, repeat polymorphisms, and copy number polymorphisms, as well as the KLR gene locus. The KLR gene is expressed in natural killer (NK) cells and is involved in regulating their ability to damage target cells; therefore, its expression can be problematic in NK cell transplantation therapy. The KIR gene is expressed in NK cells and several T cell subsets and is involved in the regulation of KIR-expressing cell activity by target cells. Many KIRs are repressive, and their expression can be problematic in NK cell or T cell transplantation therapy. Furthermore, these genes possess sequence polymorphisms and copy number polymorphisms, making their sequencing difficult even with current sequencing technology. Therefore, the creation of deletion cells from these gene loci, and haploid cells for these loci, is considered beneficial.

[0137] Example 1: Deletion of the KLR gene cluster region Figure 1 shows a map of the human KLR gene locus. The KLR gene forms a cluster on chromosome 12 (p13.2) (Figure 1). The cluster region is located at hg38:chr12:10,308,078-10,451,156 and has a length of approximately 143kb. We attempted deletion of a target region (hg38:chr12:10,301,563-10,454,767) that is approximately 153kb long and includes the entire cluster.

[0138] iPS cells were used as the cells. Large-scale deletions were created based on the method disclosed in WO2021 / 206054A. Specifically, first, distinctly different selection markers (positive-negative marker sets) were introduced into each of the two alleles within the deletion region. Specifically, the first marker included green fluorescent protein (GFP) and the puromycin resistance gene (Puro), and the second marker included red fluorescent protein (RFP) and the blasticidin resistance gene (Blst). GFP and RFP are negative selection markers, and these were inserted into their respective alleles. GFP and RFP are distinguishable during selection by flow cytometry, while Puro and Blst are positive selection markers and are distinguishable during drug selection.

[0139] (1) Introduction of a positive-negative marker set Cell preparation: iPS cells were seeded in 24-well plates pre-coated with iMatrix-511 diluted 150-fold in DPBS. StemFit AK02N (10 μM Y-27632) was used as the culture medium.

[0140] Marker insertion: 300 ng of gRNA / Cas9 expression plasmid for marker insertion sequence cleavage, 100 ng of donor plasmid (GFP-Puro), and 100 ng of donor plasmid (RFP-Blst) were introduced into cells plated in 24-well plates. The donor plasmid (GFP-Puro) contained a gene encoding green fluorescent protein (GFP) operably linked to the EF1 promoter and a gene encoding puromycin resistance (Puro), a drug resistance gene. GFP and Puro were linked via a T2A sequence. The donor plasmid (RFP-Blst) contained a gene encoding red fluorescent protein (RFP) operably linked to the EF1 promoter and a gene encoding blasticidin resistance (Blst), a drug resistance gene. RFP and Blst were linked via a T2A sequence. Details are as shown in Example 1 and Figure 1 of WO2021 / 206054. In this specification, the markers loaded onto the donor plasmid are referred to as a positive-negative marker set, and cells into which the positive-negative marker set has been introduced are called positive-negative marker set-introduced cells. Positive-negative marker set-introduced cells are also referred to as first-stage cells.

[0141] Drug Selection and Expansion Culture: The obtained cells were seeded in 6-well plates, and drug selection was performed on the cells in the presence of puromycin and blasticidin. StemFit® AK02N (containing 1 μM puromycin and 10 μM blasticidin) was used as the drug selection medium. As a result, the surviving cells after drug selection were resistant to both drugs, i.e., cells possessing both the puromycin resistance gene and the blasticidin resistance gene. Theoretically, such cells arise when the puromycin resistance gene is introduced into one allele of the gRNA-targeted region, and the blasticidin resistance gene is introduced into the other allele. Expansion culture of the surviving cells was performed to obtain cells with a positive-negative marker set. Cells with a positive-negative marker set were cloned as needed. The cells were cloned by harvesting one colony at a time from the surviving cells after drug selection and growing the cells.

[0142] (2) Two cuts in the genome and flow cytometry Cell preparation: iPS cells were seeded in 24-well plates pre-coated with iMatrix-511 diluted 150-fold in DPBS. StemFit AK02N (10 μM Y-27632) was used as the culture medium.

[0143] gRNA / Cas9 introduction: Two gRNAs were prepared, each targeting one end of the deletion region. 62.5 ng of gRNA (left), 62.5 ng of gRNA (right), and 750 μg of Cas9 protein were introduced into cells plated in a 24-well plate. After 24 hours, the culture medium was changed.

[0144] Flow cytometry: After introducing gRNA / Cas9 and culturing for 5-7 days, GFP-negative and RFP-negative cells were selected using a flow cytometer. These cells were then seeded individually into 96-well plates and allowed to grow. This method allows for the acquisition of cells in which the region containing the positive-negative marker set introduction area is deleted in both alleles.

[0145] (3) Genotyping PCR Genome purification: 2 × 10 5 We collected cells with a certain degree of mutation and purified their genomes. The primers used for genotyping are shown in Table 1. PCR was performed using a standard method. Guide RNAs shown in Table 2 were used for marker insertion. Guide RNAs shown in Table 3 were used for the formation of large deletions.

[0146] [Table 1]

[0147] [Table 2]

[0148] [Table 3]

[0149] The KLR gene cluster region is located at position 10,308,078-10,451,156 on chromosome 12 in the gh38 reference genome (hg38: chr12:10,308,078-10,451,156) (see Figure 1). In this case, we attempted a large-scale deletion of a broader region encompassing this cluster region. The positive and negative marker set was inserted into the deletion region. Specifically, it was introduced into the KLRD1 gene (more specifically, between hg38: chr12:10,307,328 and 10,307,329) (see Figures 1 and 2). This insertion was obtained by inducing specific cleavage in the KLRD1 gene in the presence of select marker donor DNA containing the positive and negative marker sets, and then culturing cells in the presence of puromycin and blasticidin. The insertion was confirmed by junction PCR. Specifically, amplification of Puro(L) and Puro(R) in Figure 2, as well as amplification of Blst(L) and Blst(R), were confirmed. Amplification can be obtained when insertion is present. According to Figure 2, amplification bands were confirmed at the predetermined positions in each case, and insertion of the selection markers was confirmed.

[0150] Next, in the presence of recombinant donor DNA, two specific cleavages were introduced, flanking the KLR gene cluster region. After culturing, GFP-negative and RFP-negative cells were obtained by flow cytometry. Junction PCR was performed on the obtained GFP-negative and RFP-negative cells to confirm that the entire KLR gene cluster region was deleted. No amplification of any KLR gene was observed by junction PCR, and clones that showed amplification only by junction PCR were identified as clones with large-scale deletions. As shown in Figure 2, clones 2, 7, and 8 were clones in which the entire KLR gene cluster region was deleted.

[0151] In cells into which the above positive-negative marker set was introduced in both alleles, specific cleavage was introduced at two locations flanking the entire KLR cluster region in the presence of recombinant donor DNA. Subsequently, cells were obtained in which one of the GFP and RFP markers was positive and the other was negative. This resulted in cells in which a large deletion occurred in only one allele, while the KLR cluster region remained in the other allele. Such cells appear to be useful for sequencing the KLR gene cluster.

[0152] Example 2: Induction of large-scale deletion of KIR gene cluster region In one of the clones obtained in Example 1 in which the entire KLR gene cluster region was deleted, we attempted to further delete the entire KIR gene cluster region. The KIR gene cluster is located at hg38:chr19:54,724,497-54,866,731. The hg38:chr19:54,716,420-54,870,769 region, which encompasses the entire above cluster region, was deleted (see Figure 3).

[0153] The KIR gene cluster region was found to be a region that induces silencing in gene expression. Initially, we attempted to introduce DNA encoding a fluorescent protein into this cleavage region using KIR#0 guide RNA (see Figure 4). However, due to silencing, approximately 13.0% of the cells became GFP-negative, even though the marker was thought to have been inserted. Cells removed from both alleles (GFP-negative) from a cell population possessing the positive-negative marker set can be obtained with a probability of approximately 1 in 10,000. If 1% of GFP-negative cells occur in 10,000 cells possessing the positive-negative marker set in both alleles, this alone would result in 100 GFP-negative cells being included as false negatives. The presence of 1% GFP-negative cells makes it difficult to obtain one deletion cell per 10,000 cells. Therefore, 13% silencing makes screening for deletion cells almost impossible. In contrast, silencing was 0% in cells into which the GFP-encoding gene was introduced into the HLA region. Therefore, it is understood that the KIR region is a difficult-to-edit region that exhibits a silencing effect.

[0154] Therefore, we attempted to introduce positive-negative marker sets at various locations, as shown in Figure 4. As a result, as shown in Figure 5, in cells where the positive-negative marker set was inserted in region 2, 0.68% of cells became GFP-negative, in region 3, 0.87% became GFP-negative, and in region 6, 0.72% became GFP-negative, with the remaining cells dying. Cell death is a phenomenon that can theoretically occur when silencing is strong (drug resistance genes are not expressed at all). Thus, the KIR gene cluster produced a silencing effect.

[0155] Through diligent investigation, we discovered a region with a weak silencing effect between the KIR2DL1 and KIR3DL4 genes, and were able to obtain cells in which a positive-negative marker set was introduced (see Figure 6). Furthermore, we introduced specific cleavage at two locations flanking the entire KIR gene cluster region, inducing deletion of the entire region. As a result, we obtained a group of cells that showed amplification in the band that is amplified only when the entire region is deleted (see Figure 6).

[0156] In cells into which the above positive-negative marker set was introduced in both alleles, specific cleavage was introduced at two locations flanking the entire KIR cluster region in the presence of recombinant donor DNA. Subsequently, cells were obtained in which one of the GFP and RFP markers was positive and the other was negative. This resulted in cells in which a large deletion occurred in only one allele, while the KIR cluster region remained in the other allele. Such cells appear to be useful for sequencing the KIR gene cluster.

[0157] Furthermore, as shown in Figure 7, it was found that the silencing effect was acceptable even when a positive-negative marker set was introduced between hg38: chr19:54,939,860 and 54,939,861. Cells into which the positive-negative marker set had been introduced were obtained. The above region contains the gene group shown in Figure 8 (for example, in addition to KIR, LILRB1, LILRB4, FCAR, NCR, and NPRP7). Next, a deletion was induced in the entire region encompassing these genes. The positive-negative marker set was inserted into the NPRP7 gene. The insertion was confirmed by junction PCR against Puro and Blst (see Figure 8). In addition, specific cuts were introduced at both ends of a 314 kbp region in the presence of recombinant donor DNA containing the deleted sequence, thereby deleting these regions. When junction PCR was performed on the obtained cells, bands of the expected size were confirmed, indicating that the deletion had been introduced (see Figure 8).

[0158] In the above examples, no particular effect was observed on cell survival, cell undifferentiation, or cell proliferation due to the deletion of the region. Therefore, the obtained cells can be proliferated, differentiated, and used for further applications.

[0159] In the above embodiment, it became clear that silencing occurred particularly in the KIR gene cluster region and the LILR gene cluster region, which could adversely affect the implementation of the negative selection process. Thus, in order to implement the negative selection process in regions where silencing occurs, it is preferable to select a region with the weakest possible silencing (preferably one in which the percentage of silenced cells is 1% or less, 0.1% or less, or 0.01% or less), and then perform the negative selection process. On the other hand, in the above embodiment, it was found that subsequent deletion could be induced if the silencing problem was avoided. Thus, in this embodiment, a modification scheme applicable to gene regions that undergo silencing in general was established, as well as a method for deleting specific gene cluster regions.

[0160] Sequence List SEQ ID NO: 1 (GGAACAAGTGGAGATGAGTGG, DNA, synthetic construct) SEQ ID NO: 2 (GGCCTTCCATCTGTTGCT, DNA, synthetic construct) SEQ ID NO: 3 (GACATCGGCAAGGTGTGG, DNA, synthetic construct) SEQ ID NO: 4 (TCTCAGTGCAGGTTTTGCTC, DNA, synthetic construct) SEQ ID NO: 5 (GGAACAAGTGGAGATGAGTGG, DNA, synthetic construct) SEQ ID NO: 6 (TGTAATCTTCTCTGTCGCTACTTC, DNA, synthetic construct) SEQ ID NO: 7 (TGCACCAGATTGTTTTGTGT, DNA, synthetic construct) SEQ ID NO: 8 (TCTCAGTGCAGGTTTTGCTC, DNA, synthetic construct) SEQ ID NO: 9 (TAGGAAAGCGCCAAGTCTGT, DNA, synthetic construct) SEQ ID NO: 10 (AGTGGGTTCCTCAACCTGTG, DNA, synthetic construct) SEQ ID NO: 11 (GGGCAGAGAAGGTGGAGAGT, DNA, synthetic construct) SEQ ID NO: 12 (TCACATGGACAACAAAACCA, DNA, synthetic construct) SEQ ID NO: 13 (AGGAAAACAGAAGCCATAGTGT, DNA, synthetic construct) SEQ ID NO: 14 (GGATGACTGGGGAACTTGTAG, DNA, synthetic construct) SEQ ID NO: 15 (CCAACAAAAATCCACCCTACA, DNA, synthetic construct) SEQ ID NO: 16 (TTGGAAGCGCCTTGAAAC, DNA, synthetic construct) SEQ ID NO: 17 (GGCCTGCAAACTCTCTTCC, DNA, synthetic construct) SEQ ID NO: 18 (GCAGCATTTCCTTTTCTCCA, DNA, synthetic construct) SEQ ID NO: 19 (CAGGCCAGCAAACTCTCTTC, DNA, synthetic construct) SEQ ID NO: 20 (GCAGCATTTCCTTTTCTCCA, DNA, synthetic construct) SEQ ID NO: 21 (GGAACAGTGCGAAAGGAGAG, DNA, synthetic construct) SEQ ID NO: 22 (AGGCAGCAACGAAAACCTAA, DNA, synthetic construct) SEQ ID NO: 23 (CCTTCCATGCTGACTTTGCT, DNA, synthetic construct) SEQ ID NO: 24 (GGCCTTCCATCTGTTGCT, DNA, synthetic construct) SEQ ID NO: 25 (GACATCGGCAAGGTGTGG, DNA, synthetic construct) SEQ ID NO: 26 (AAAGGGAATCAGGAAAACACAA, DNA, synthetic construct) SEQ ID NO: 27 (CCTTCCATGCTGACTTTGCT, DNA, synthetic construct) SEQ ID NO: 28 (TGTAATCTTCTCTGTCGCTACTTC, DNA, synthetic construct) SEQ ID NO: 29 (TGCACCAGATTGTTTTGTGT, DNA, synthetic construct) SEQ ID NO: 30 (AAAGGGAATCAGGAAAACACAA, DNA, synthetic construct) SEQ ID NO: 31 (GATTGGGTGCCTCAAATGTC, DNA, synthetic construct) SEQ ID NO: 32 (AATGACGTGGCTTTCTATTGG, DNA, synthetic construct) SEQ ID NO: 33 (CTGTCCAGAGGCGAAGAGAG, DNA, synthetic construct) SEQ ID NO: 34 (GGCCTTCCATCTGTTGCT, DNA, synthetic construct) SEQ ID NO: 35 (GACATCGGCAAGGTGTGG, DNA, synthetic construct) SEQ ID NO: 36 (TGAGTTTGGTGTTTGAGAGCA, DNA, synthetic construct) SEQ ID NO: 37 (CTGTCCAGAGGCGAAGAGAG, DNA, synthetic construct) SEQ ID NO: 38 (TGTAATCTTCTCTGTCGCTACTTC, DNA, synthetic construct) SEQ ID NO: 39 (TGCACCAGATTGTTTTGTGT, DNA, synthetic construct) SEQ ID NO: 40 (TGAGTTTGGTGTTTGAGAGCA, DNA, synthetic construct) SEQ ID NO: 41 (CACAAATGAGCCCCTCCTAA, DNA, synthetic construct) SEQ ID NO: 42 (GTACCCTGCAAAACCCAAAA, DNA, synthetic construct) SEQ ID NO: 43 (ACGTGAATGAGGCGTCCAAGTGG, DNA, synthetic construct) SEQ ID NO: 44 (GCTCAGGACGCTAAGGAAAGAGG, DNA, synthetic construct) SEQ ID NO: 45 (TTGTGAACCCCGACATGTATAGG, DNA, synthetic construct) SEQ ID NO: 46 (CACAGATGCAACCATCGTTGGGG, DNA, synthetic construct) SEQ ID NO: 47 (TTCGGTGTCACTATCGTCATAGG, DNA, synthetic construct) SEQ ID NO: 48 (CTGGAAAATAGTCCGAAGAAAGG, DNA, synthetic construct) SEQ ID NO: 49 (ACCTCCCAGACCCGATTCCGCGG, DNA, synthetic construct) SEQ ID NO: 50 (GCAGCAGCCGATCTACGTAAGGG, DNA, synthetic construct) SEQ ID NO: 51 (CAGCCCACACGGGGACCTACAGG, DNA, synthetic construct) SEQ ID NO: 52 (TGTTAAGTGTGCGGTAGTTATGG , DNA, synthetic construct) SEQ ID NO: 53 (ggctgtttcagaaactaccgtgg, DNA, synthetic construct) SEQ ID NO: 54 (AACCCCTTCATGCCTTAACCTGG, DNA, synthetic construct) SEQ ID NO: 55 (CGTGTCTCCGTCTAAATCCTTGG , DNA, synthetic construct) SEQ ID NO: 56 (GACTCAGAGATTTGTTCCCGGGG, DNA, synthetic construct) SEQ ID NO: 57 (TGTTCCATCCACCGAGATAGGGG, DNA, synthetic construct)

Claims

1. Vertebrate cells comprising genomic DNA having a deletion, wherein the deletion is (i) A deletion of part or all of the KIR gene group located within the killer cell immunoglobulin-like receptor (KIR) gene cluster region in one or two alleles, wherein the part of the KIR gene group includes at least one connected region, and the connected region includes 50% or more of the KIR gene encoding genes contained in each of the regions. (ii) A deletion of part or all of the LILR gene group located within the leukocyte immunoglobulin-like receptor (LILR) gene cluster region in one or two alleles, wherein the part of the KIR gene group includes at least one connected region, and / or (iii) A deletion of part or all of the KLR gene group located within the killer cell lectin-like receptor (KLR) gene cluster region in one or two alleles, wherein the part of the KLR gene group includes at least one connected region, and the connected region includes 50% or more of the KLR gene encoding genes contained in each of the regions. cell.

2. The cell according to claim 1, wherein the deletion includes the deletion of the entire KIR gene group.

3. The cell according to claim 1 or 2, wherein the deletion comprises a deletion of the entire leukocyte immunoglobulin-like receptor (LILR) gene group.

4. The cell according to claim 1, wherein the deletion includes at least a portion of the KIR gene group and at least a portion of the LILR gene group.

5. The cell according to claim 1 or 4, wherein the deletion includes the deletion of the entire KIR gene group and the deletion of the entire LILR gene group.

6. The cell according to claim 1, wherein the deletion includes the deletion of the entire KIR gene group in one allele.

7. The cell according to claim 1 or 6, wherein the deletion includes a deletion of the entire LILR gene group in one allele.

8. The cell according to claim 1, wherein the deletion includes at least a portion of the KIR gene group and at least a portion of the LILR gene group in one allele.

9. The cell according to claim 1 or 8, wherein the deletion includes the deletion of the entire KIR gene group in one allele and the deletion of the entire LILR gene group in one allele.

10. The cell according to claim 1, wherein the deletion includes a deletion of the entire KIR gene group in two alleles.

11. The cell according to claim 1 or 10, wherein the deletion includes a deletion of the entire LILR gene group in two alleles.

12. The cell according to claim 1, wherein the deletion includes at least a portion of the KIR gene group and at least a portion of the LILR gene group in two alleles.

13. The cell according to claim 1 or 12, wherein the deletion includes the deletion of the entire KIR gene group in two alleles and the deletion of the entire LILR gene group in one allele.

14. A method for producing isolated cells in which two or more alleles of the chromosomal genome have been modified, (a) The steps of introducing (i) and (ii) below into isolated cells containing two or more alleles (excluding fertilized eggs) to introduce a selection marker gene into each of the two or more alleles, (i) A genome modification system comprising a sequence-specific nucleic acid cleavage molecule capable of targeting and cleaving target regions in two or more alleles of the chromosomal genome, or a polynucleotide encoding the sequence-specific nucleic acid cleavage molecule. (ii) Two or more selection marker donor DNAs, each having an upstream homology arm having a nucleotide sequence homologously recombinable with the nucleotide sequence upstream of the target region and a downstream homology arm having a nucleotide sequence homologously recombinable with the nucleotide sequence downstream of the target region, and containing the nucleotide sequence of a selection marker gene for positive selection between the upstream homology arm and the downstream homology arm, wherein the two or more selection marker donor DNAs for positive selection each have mutually distinguishable selection marker genes, the selection marker genes for positive selection are unique to each type of selection marker donor DNA, and the number of types of selection marker donor DNAs is equal to or greater than the number of alleles targeted for genome modification, wherein the selection marker gene for positive selection is a drug resistance gene, and each of the two or more selection marker donor DNAs has a selection marker gene for positive selection, a marker gene for negative selection, and a target sequence between the upstream homology arm and the downstream homology arm, (b) After step (a), homologous recombination of different types of selection marker donor DNA with respect to the two or more alleles is performed, thereby introducing distinctly different unique selection marker genes into each of the two or more alleles, and a step of selecting isolated cells that express all of the introduced distinctly different selection marker genes for positive selection (a step for positive selection), To determine the percentage of cells in which the expression of negative expression markers is silenced in selected cells, Includes, If the percentage is below the standard value, (c) After step (b) above, a step of introducing (iii) and (iv) below into selected cells to introduce recombinant donor DNA into the two or more alleles, (iii) A genome modification system comprising a sequence-specific nucleic acid cleavage molecule that targets the target sequence and can cleave the target sequence, or a polynucleotide encoding the sequence-specific nucleic acid cleavage molecule. (iv) Recombinant donor DNA containing a desired base sequence, comprising an upstream homology arm having a base sequence homologously recombinable with the base sequence upstream of the target region, and a downstream homology arm having a base sequence homologously recombinable with the base sequence downstream of the target region, (d) After step (c), a step of selecting cells that do not express the negative selection marker gene (a step for negative selection), Further including, method.

15. A group of cells containing multiple cells, Each cell contains a set of positive and negative markers for each of the two alleles. A positive-negative marker set includes positive selection markers and negative selection markers, wherein positive selection markers in the same cell are distinguishable from each other, and negative selection markers in the same cell are distinguishable from each other. A cell population in which the proportion of cells in which the negative selection marker is silenced is between 0.00001% and 10%.

16. A cell population including vertebrate cells, Each vertebrate cell contains a set of positive and negative markers in each of two alleles within a region of 500 kbp or less that includes the killer cell immunoglobulin-like receptor (KIR) gene cluster region, and / or contains a set of positive and negative markers in each of two alleles within a region of 500 kbp or less that includes the leukocyte immunoglobulin-like receptor (LILR) gene cluster region. A positive-negative marker set includes positive choice markers and negative choice markers, wherein the included positive choice markers are distinguishable from each other, and the included negative choice markers are distinguishable from each other. A cell population in which the proportion of cells in which the negative selection marker is silenced is 10% or less.

17. A composition comprising the cell population described in claim 16.

18. A composition according to claim 17, comprising further vertebrate cells.

Images