Agents and methods for inhibiting the growth of Streptococcus anginosa.

Abstract

This invention provides a technology that can effectively suppress the proliferation of Streptococcus anginosus. According to this invention, the proliferation of Streptococcus anginosus can be suppressed in vivo. Furthermore, according to this invention, by suppressing the proliferation of Streptococcus anginosus in vivo, it is possible to contribute to the prevention and improvement of various diseases and ill health conditions in which this bacterium is involved in the onset or exacerbation of the disease, or in which an increase in this bacterium serves as an indicator of the onset or exacerbation of the disease. [Solution] A growth inhibitor for Streptococcus anginosa containing agarooligosaccharide as an active ingredient.

Description

Technical Field

[0001] The present invention relates to an agent and a method for suppressing the growth of Streptococcus anginosus.

Background Art

[0002] Streptococcus anginosus is a Gram-positive, non-spore-forming, non-motile facultative anaerobic coccus belonging to the genus Streptococcus. This bacterium normally resides in vivo such as the oral cavity, nasopharynx, gastrointestinal tract, urogenital tract, etc., and sometimes causes pathogens such as intraoral and head and neck infections, central nervous system infections such as brain abscess, bacteremia, infective endocarditis, intra-abdominal infections, pneumonia, empyema, skin and soft tissue infections, osteomyelitis, etc. (Non-Patent Document 1).

[0003] In addition, it has also been reported that Streptococcus anginosus is a pathogen of Aerobic Vaginitis (Non-Patent Document 2) and a pathogen that promotes gastritis and gastric cancer (Non-Patent Document 3). Furthermore, in recent years, it has been shown that Streptococcus anginosus is significantly more abundant in the feces of pancreatic cancer patients compared to the feces of controls and is useful as a marker for the detection of pancreatic cancer (Non-Patent Documents 4, 5). In addition, the inventors of the present application have reported that this bacterium is significantly more abundant in the feces of hepatocellular carcinoma patients compared to healthy individuals (Non-Patent Document 6).

Prior Art Documents

Non-Patent Documents

[0004]

Non-Patent Document 1

Non-Patent Document 2

[0005] As mentioned above, Streptococcus anginosus is a commensal bacterium in the body, but it can be said to be a pathogen involved in the onset or exacerbation of various diseases and ill health conditions, such as suppurative infections, aerobic vaginitis, gastritis, and gastric cancer. Therefore, the inventors of this invention considered that if the proliferation of this bacterium could be suppressed in the body, it would contribute to the prevention or improvement of diseases and ill health conditions in which this bacterium is involved in the onset or exacerbation.

[0006] Furthermore, as mentioned above, Streptococcus anginosus is abundant in the feces of patients with pancreatic ductal carcinoma and hepatocellular carcinoma, and this bacterium can be considered an indicator of these cancers. Therefore, the inventors of this invention believe that suppressing the number of this bacterium in the body could contribute to the prevention and improvement of pancreatic cancer and liver cancer.

[0007] In other words, the present invention aims to provide a technology that can effectively suppress the proliferation of Streptococcus anginosus. Furthermore, the present invention aims to provide a technology that can contribute to the prevention or improvement of various diseases and ill health conditions in which Streptococcus anginosus is involved in the onset or exacerbation of the disease, or in which an increase in this bacterium serves as an indicator of the onset or exacerbation of the disease. [Means for solving the problem]

[0008] As a result of diligent research, the present inventors have found that agarooligosaccharides, 3,6-anhydro-L-galactose, and oligosaccharides having 3,6-anhydro-L-galactose as a reducing end (in this invention, these may be collectively referred to as "active ingredients," or one or more of them) can suppress the growth of Streptococcus anginosus and reduce its relative presence in the microbial community. Based on these findings, the inventors have completed the following inventions.

[0009] (1) The first embodiment of the streptococcus anginosus growth inhibitor (sometimes referred to as "this agent") according to the present invention comprises agarooligosaccharide as an active ingredient.

[0010] (2) This agent may also be used to prevent or improve aerobic vaginitis. That is, the present invention also provides an agent for preventing or improving aerobic vaginitis, comprising one or more selected from agarooligosaccharide, 3,6-anhydro-L-galactose and oligosaccharides having it as a reducing end as an active ingredient.

[0011] (3) This drug may also be used to prevent or improve gastritis or gastric cancer. That is, the present invention also provides a drug for preventing or improving gastritis or gastric cancer, comprising one or more selected from agarooligosaccharide, 3,6-anhydro-L-galactose and oligosaccharides having it as a reducing end as an active ingredient.

[0012] (4) This drug may also be used to prevent or improve pancreatic cancer. That is, the present invention also provides an agent for preventing or improving pancreatic cancer, comprising one or more selected from agarooligosaccharides, 3,6-anhydro-L-galactose, and oligosaccharides having this as a reducing end as an active ingredient.

[0013] (5) In the present invention, the agarooligosaccharide may contain agarobiose.

[0014] (6) The second aspect of this product contains 3,6-anhydro-L-galactose or an oligosaccharide having it at its reducing end as the active ingredient.

[0015] (7) The method for inhibiting the proliferation of Streptococcus anginosus according to the present invention (sometimes referred to as "this method") comprises the step of administering one or more selected from agarooligosaccharides, 3,6-anhydro-L-galactose, and oligosaccharides having it at the reducing end to a human or animal.

[0016] (8) The present invention may also be a method for preventing or improving aerobic vaginitis by suppressing the proliferation of Streptococcus anginosus in living organisms. That is, the present invention also provides a method for preventing or improving aerobic vaginitis, comprising the step of administering to a human or animal one or more selected from agarooligosaccharides, 3,6-anhydro-L-galactose and oligosaccharides having it as a reducing end.

[0017] (9) The present invention may also be a method for preventing or improving gastritis or gastric cancer by suppressing the proliferation of Streptococcus anginosus in living organisms. That is, the present invention also provides a method for preventing or improving gastritis or gastric cancer, comprising the step of administering one or more selected from agarooligosaccharides, 3,6-anhydro-L-galactose, and oligosaccharides having this as a reducing end to a human or animal.

[0018] (10) This method may be a method for preventing or improving pancreatic cancer by suppressing the growth of Streptococcus anginosus in a living body. That is, the present invention also provides a method for preventing or improving pancreatic cancer, which includes a step of administering to a human or an animal at least one selected from agar oligosaccharides, 3,6-anhydro-L-galactose, and an oligosaccharide having the same at its reducing end.

[0019] The present invention may be implemented excluding medical treatment.

Effects of the Invention

[0020] According to the present invention, the growth of Streptococcus anginosus can be suppressed in a living body. Further, according to the present invention, by suppressing the growth of Streptococcus anginosus in a living body, it is possible to contribute to the prevention and improvement of various diseases and unhealthy states in which this bacterium is involved in the onset and exacerbation, or an increase in this bacterium serves as an index for the onset and exacerbation.

[0021] In addition, the agar oligosaccharide used as an active ingredient in the present invention is an oligosaccharide made from agar, which has been ingested as a food since ancient times, and its safety is extremely high. Therefore, according to the present invention, the growth of Streptococcus anginosus can be suppressed without any concerns about safety and side effects.

Brief Description of the Drawings

[0022] [Figure 1] It is a bar graph showing the turbidity (OD660) of a culture solution obtained by culturing Streptococcus anginosus in the presence of sucrose (Suc) or agar oligosaccharide (AOS). In the figure, the plots indicate the measured values of each specimen. [Figure 2]This table shows the 20 microbial strains that make up the Human Commensal Microbial DNA Cocktail (product name "DNA-Mock-003", lot 240101ND, NBRC). This table was quoted from the product's datasheet (National Institute of Technology and Evaluation, HOME>Biotechnology>Microorganisms and Industrial Uses>Microbiome>NBRC Human Commensal Microbial Cocktail, [online] [Accessed July 29, 2024], Internet). <URL: https: / / www.nite.go.jp / nbrc / industry / microbiome / cocktail20220113.html><URL: https: / / www.nite.go.jp / data / 000152907.pdf> ). [Figure 3] This bar graph shows the turbidity (OD660) of culture media obtained by mixed culture of Streptococcus anginosa and a human commensal bacterial DNA cocktail in the absence of agarooligosaccharides (Sample 1) or in the presence of agarooligosaccharides (Sample 2). In the figure, the plots show the measured values ​​for each sample. [Modes for carrying out the invention]

[0023] The present invention will be described in detail below.

[0024] Agarooligosaccharides are even-numbered oligosaccharides consisting of repeating units of the disaccharide agarobiose, which is composed of D-galactose and 3,6-anhydro-L-galactose. Examples of agarooligosaccharides include the smallest unit, the disaccharide agarobiose, the tetrasaccharide agarotetraose, the hexasaccharide agarohexaose, the octasaccharide agarooctaose, and the decasaccharide agarodecaose. In the present invention, agarooligosaccharides contain at least one of these oligosaccharides, and may consist of one type or two or more types. For example, agarooligosaccharides may consist only of agarobiose, or they may contain agarooligosaccharides other than agarobiose. Examples of agarobiose content in agarooligosaccharides in this case include 1-100% by mass, 10-100% by mass, 20-100% by mass, 30-100% by mass, 40-100% by mass, and 50-100% by mass.

[0025] Agarooligosaccharides are oligosaccharides having 3,6-anhydro-L-galactose at their reducing end. Therefore, the active ingredient of the present invention may be 3,6-anhydro-L-galactose or an oligosaccharide having it at its reducing end. In this case, the number of sugars in the oligosaccharide can be exemplified by, for example, 2-8 sugars, 2-10 sugars, 2-12 sugars, etc.

[0026] Agarooligosaccharides can be commercially available (agar oligosaccharides), or they can be manufactured according to conventional methods. A common method for producing agarooligosaccharides is, for example, the hydrolysis of agar. Hydrolysis can be carried out using either acid or enzymes.

[0027] Examples of acid decomposition methods include using a solid acid as described in Japanese Patent Publication No. 4796697, using mineral acids such as sulfuric acid or hydrochloric acid, or using organic acids such as acetic acid or citric acid; any of these methods is acceptable. Acid decomposition yields even-numbered sugars having 3,6-anhydro-L-galactopyranose as the reducing end.

[0028] Furthermore, examples of enzymatic degradation methods include degradation by α-agarase and degradation by β-agarase. Using α-agarase, as with acid degradation, even-numbered sugars with 3,6-anhydro-L-galactopyranose at the reducing end can be obtained. Degradation by α-agarase can be carried out, for example, by the method described in Japanese Patent Application Publication H2-65789.

[0029] The hydrolyzed agar product may be used as is, as agarooligosaccharide, or it may be purified and its pH adjusted before use. Examples of purification methods include filtration using filter paper or activated carbon. The agarooligosaccharide solution obtained from the hydrolysis treatment may be used in liquid form, or, if necessary, it may be used in powder form by vacuum freeze-drying or other methods.

[0030] Agar is a dehydrated and dried mucilage extracted from red algae such as Gelidium and Gracilaria, and mainly contains the polysaccharides agarose and agaropectin. In addition to agar, other substances containing agarose and agaropectin can be used as raw materials for agarooligosaccharide production. Specifically, examples of such substances include solutions obtained by hot water extraction of red algae from families such as Gelidaceae, Gracilaceae, and Ixeriaceae, which are the raw materials for agar. Examples of red algae from the Gelidaceae family include Gastrodia elata, Orientalus japonica, Ophiopogon, Heliotropium spp., Gracilaria japonica, and Ixeriaceae; examples of red algae from the Gracilaceae family include Gracilaria japonica and Ophiopogon spp., and examples of red algae from the Ixeriaceae family include Ixeris spp. and Styrax japonica. These red algae can be used individually or in combination of two or more types.

[0031] The sugar composition of agarooligosaccharides can be confirmed by liquid chromatography, including high-performance liquid chromatography, as shown in the examples described later. Furthermore, this allows for the fractionation of agarooligosaccharides with desired sugar content, such as only agarobiose, only agarotetraose, or only agarohexaose, and the adjustment of the sugar composition of the agarooligosaccharides for use.

[0032] 3,6-Anhydro-L-galactose can be obtained from commercially available reagents, or it can be produced by conventional methods. An example of such a method is the method described in Japanese Patent No. 4007760. Specifically, 450 μL of a 100 mM aqueous solution of agarobiose is mixed with 50 μL of 10-fold concentrated phosphate-buffered saline and 50 μL of 10 units / μL of β-galactosidase phosphate-buffered saline solution, and the mixture is reacted at 37°C for 1 hour. 5 mL of a 1-butanol:ethanol = 1:1 mixture is added to this reaction solution, and insoluble matter is precipitated by centrifugation. The resulting supernatant is subjected to column chromatography using a silica gel column, with 1-butanol:ethanol:water = 5:5:1 as the eluent and chromatographed at 0.3 kg / cm² using a compressor. 2 The mixture is pressurized and separated. By dividing the mixture into 7 mL fractions, for example, fractions 14 through 17 can be obtained, each containing high-purity 3,6-anhydro-L-galactose. These fractions are collected and dried under reduced pressure to obtain 3,6-anhydro-L-galactose.

[0033] "Inhibiting the growth" of Streptococcus anginosus includes not only reducing the number of bacteria (decreasing their proportion in the microbial community), but also maintaining the number of bacteria at a similar level, or, even if the number of bacteria increases, the increase is smaller compared to when the active ingredient of the present invention is not used. Furthermore, inhibiting growth and inhibiting the number of bacteria are synonymous.

[0034] Whether or not the growth of Streptococcus anginosus can be inhibited can be confirmed by conventional methods. For example, if the bacterium is isolated, the active ingredient can be added to the culture medium, and the number of bacteria can be checked by turbidity analysis or similar methods, compared to when the ingredient is not added.

[0035] Furthermore, if Streptococcus anginosus is not isolated (for example, in feces, saliva, vaginal secretions, nasal discharge, a cocktail bacterial solution containing multiple bacterial species, or a human intestinal tract model), an example can be given of a method in which, for instance, the whole genomic DNA of bacteria extracted from the sample is used as a template to amplify bacterial-derived 16S rDNA by polymerase chain reaction (PCR), the amplification product is decoded by next-generation sequencing (NGS), the bacterial species and abundance are identified based on a 16S database, the abundance ratio of this bacterium is determined, and the results are compared, for example, when the active ingredient of the present invention is administered and when it is not administered. In addition, quantitative PCR can be performed on the whole genomic DNA of bacteria using primers specific to Streptococcus anginosus. When confirming the number of this bacterium by PCR, since the amount of gene purified from the sample (purification efficiency) is not constant, it is preferable to calculate the proportion (abundance ratio, occupancy rate) of this bacterium to the total number of bacteria or the amount of template DNA and make a judgment based on that proportion.

[0036] When quantifying Streptococcus anginosus by PCR, specific primers can be designed based on publicly available sequence information to identify a portion of the genomic DNA (the conserved region of this bacterium) that is conserved in this bacterium but not in closely related species. For example, the genome of Streptococcus anginosus DSM 20563 is publicly available under accession number GenBank: AFIM01000064.1.

[0037] As a protected region of this bacterium, for example, Non-Patent Literature 6 identifies a partial sequence of the DNA sequence (SEQ ID NO: 1) of the N-acetylneuraminic acid lyase (nanA) gene possessed by this bacterium. Then, as specific primers for this bacterium, a forward primer (SEQ ID NO: 2) corresponding to positions 425-446 in SEQ ID NO: 1 and a reverse primer (SEQ ID NO: 3) corresponding to positions 526-548 in SEQ ID NO: 1 are used (Non-Patent Literature 6; METHODS, Primer design). In other words, Non-Patent Literature 6 quantifies Streptococcus anginosus by quantifying a partial sequence of the nanA gene. In the present invention, this bacterium can also be quantified using such specific primers.

[0038] [Sequence ID 1] nanA gene (length 645 nucleotides) from Streptococcus anginosus DSM 20563, accession number: GenBank: AFIM01000064.1 (genome): 39668-40312 (corresponding region of nanA gene) tcatttatat ttgttaaaaa tgttctccat gataggcaat tgcaaaaatc ctaaggctgc aaagccgaca aatacaaaaa gagtaaagcc tagcagcaac acaaatcctg aactagagag gaaaaagatg attgtagcta ataaggctat tatcaaaaag aaccacggga aatgtaaact taccatgatc agtcccgttt gtaatagatc ttttaccgtc atttcaaact tagctgccaa aggatagaca cataaaaata gcaaactagc aaaaatgatg acgccgatac aggttgcttt taacatttga aatggcattg tttcatgctt ccaaaaaagc aggaggtcaa atagactgat acctacaatg ctgagttcta gcaaaccaag tttgaaaccg accttccaat ttttcctaaa tgcctgcaca taggttgctg ttacttttat gcgtcgcgaa tctctgatga caaacaaagt ttcatacaag ctaattttgg caataccaat cgtaacaagt ggtagacaag acaaaagaaa gatgaggttc acagtcacca aatctaatat tttctcacat attctcataa agaaattatc tgtatcaaat atacttcgta ttaactgcga acctctcttt tccat

[0039] ≪Primers for amplifying the conserved region of the nanA gene in this bacterium≫ [SEQ ID NO. 2] Forward primer; 5'-CGCAGTTGGCAGGTGTAGCTCT-3' [SEQ ID NO: 3] Reverse primer; 5'- CCAAGTGCTGCAAAGGTTTGAAT -3'

[0040] As mentioned above, Streptococcus anginosus has been reported to be a pathogen of aerobic vaginitis (Non-Patent Literature 2). Non-Patent Literature 2 comprehensively analyzed the microbiome of vaginal secretions from women with aerobic vaginitis, bacterial vaginitis, and healthy women. It showed that Streptococcus anginosus was hardly present in either bacterial vaginitis or healthy women, while it accounted for the largest proportion in women with aerobic vaginitis (Figure 6). It also showed that when this bacterium was co-cultured with vaginal epithelial cells and subjected to an LDH assay, it caused lysis of the epithelial cells (Figures 8, 9).

[0041] Therefore, if the proliferation of Streptococcus anginosus in the body can be suppressed, the number of pathogens in individuals susceptible to aerobic vaginitis or in patients with aerobic vaginitis can be reduced, thus contributing to the prevention or improvement of aerobic vaginitis. In other words, the active ingredient of the present invention can be used to prevent or improve aerobic vaginitis.

[0042] Furthermore, as mentioned above, Streptococcus anginosus has been reported to be a pathogen that promotes gastritis and gastric cancer (Non-Patent Literature 3). Non-patent document 3 investigated the proportion of this bacterium in the gastric mucosa at each stage of gastric cancer formation and found that it was greater in atrophic gastritis and intestinal metaplasia than in superficial gastritis, and was greatest at the gastric cancer stage (Figure 1). When mice were infected with this bacterium orally every three days, acute gastritis developed in 2 weeks (Figure 1) and chronic gastritis developed in 3 months (Figure 2). Gastric cancer formation progresses from atrophy to metaplasia and dysplasia, and gastritis is a major risk factor. In mice infected with this bacterium, atrophy of gastric parietal cells was observed 9-12 months after infection, and gastric mucosal metaplasia and mild dysplasia were observed 12 months after infection. This bacterium was present at high density in the areas of metaplasia and dysplasia (Figure 3). In the gastric tissue of mice infected with this bacterium, the expression of the tight junction proteins CLDN18 and OCLN decreased, and the barrier function was impaired (Figure 3). 3) The metaplasia and decreased expression of tight junction proteins were similarly observed when germ-free mice were infected with this bacterium, suggesting that this bacterium can promote gastric cancer formation on its own (Figure 4). In mice in which mouse gastric cancer cells YTN16 were subcutaneously transplanted and this bacterium was injected at the same site, and in mice in which YTN16 was injected into the gastric serosa and this bacterium was orally administered, the weight of the tumors increased significantly (Figure 5). When this bacterium was infected in a mouse model of MNU-induced gastric cancer, the number, size, and degree of dysplasia of tumors increased, and cancer progression was promoted (Figure 5). It is also suggested that the surface protein TMPC of this bacterium binds to the ANXA2 receptor on gastric epithelial cells, causing the bacterium to form colonies in the gastric mucosa (Figure 6), and that it promotes cancer formation through activation of the MAPK signaling pathway (Figure 7).

[0043] Therefore, if the proliferation of Streptococcus anginosus in the body can be suppressed, the number of pathogens in individuals who are susceptible to gastritis or gastric cancer, or in patients with such conditions, can be reduced, thus contributing to the prevention or improvement of gastritis and gastric cancer. In other words, the active ingredient of the present invention can be used to prevent or improve gastritis and gastric cancer.

[0044] Furthermore, as mentioned above, Streptococcus anginosus has been reported to be an indicator of pancreatic cancer (Non-Patent Documents 4, 5). Non-patent Literature 5 presents the results of a study in which saliva and fecal samples obtained from 47 Japanese pancreatic cancer patients and 235 control cases were analyzed by shotgun metagenomic sequencing, and 18 oral bacteria and 30 intestinal bacteria (including Streptococcus anginosus) that were increased or decreased in pancreatic cancer patients were identified (Figure 1D). The study also showed that the increases in the intestinal bacteria V atypica, V parvula, S anginosus, and S oralis, and the decreases in F prausnitzii, were similar to those observed in cohort studies of Spanish pancreatic cancer patients (57 patients, 50 control cases) and German pancreatic cancer patients (44 patients, 32 control cases) (Figure 4B). Furthermore, S anginosus was significantly increased compared to controls in intraductal papillary mucinous neoplasms (IPMN), a risk factor for pancreatic cancer (Figure 3B).

[0045] Therefore, if the proliferation of Streptococcus anginosus in the body can be suppressed, the number of indicator microorganisms for pancreatic cancer in individuals at risk of developing pancreatic cancer or in patients with pancreatic cancer can be reduced, thus contributing to the prevention or improvement of pancreatic cancer. In other words, the active ingredient of the present invention can be used to prevent or improve pancreatic cancer.

[0046] The active ingredient of the present invention can be used, for example, in a form administered to humans or animals. More specific forms of use can be appropriately determined depending on the recipient, application site, purpose of use, etc. For example, the method and route of administration only need to ensure that the active ingredient reaches the site where Streptococcus anginosus lives. Specifically, examples include oral ingestion, nasal drops, placement under the tongue (sublingual) or between the gums and cheek, rectal (transrectal) or vaginal (transvaginal) insertion.

[0047] The dosage of the active ingredient can also be appropriately set according to the target person, the site of administration, the form of the product, its use, etc. Specific examples of dosages for adults include: 0.01 mg / kg body weight or more, 0.1 mg / kg body weight or more, 1 mg / kg body weight or more, 5 mg / kg body weight or more, 10 mg / kg body weight or more, 1000 mg / kg body weight or less, 800 mg / kg body weight or less, 600 mg / kg body weight or less, 400 mg / kg body weight or less, 200 mg / kg body weight or less, 100 mg / kg body weight or less, and 10 mg / kg body weight or less per day.

[0048] The active ingredient may be used as is in the form of food, beverages, supplements, pharmaceuticals, quasi-drugs, animal feed, etc., or it may be used as a raw material for food, beverages, supplements, pharmaceuticals, quasi-drugs, animal feed, etc., in combination with other ingredients. These products can be manufactured using the active ingredient as a raw material by methods known to those skilled in the art.

[0049] The amount of active ingredients in a product can also be set appropriately depending on the form and use of the product. Specifically, examples of amounts that can be set include 0.0001% by mass or more, 0.001% by mass or more, 0.01% by mass or more, 0.1% by mass or more, 100% by mass or less, 90% by mass or less, 80% by mass or less, 70% by mass or less, 60% by mass or less, 50% by mass or less, 40% by mass or less, 35% by mass or less, 30% by mass or less, 10% by mass or less, and 5% by mass or less.

[0050] The present invention will be described below based on examples. However, the technical scope of the present invention is not limited to the features shown in these examples. [Examples]

[0051] <Example 1> Preparation of agarooligosaccharides 50g of agar ("Ultra Agar AX-30" by Ina Food Industry Co., Ltd.) was added to 1000g of purified water and heated to dissolve. Then, 2g of concentrated sulfuric acid was added and the mixture was stirred at 90°C for 3 hours. After adjusting the pH to 3.5 with sodium hydroxide, the mixture was treated with activated carbon and then filtered through filter paper to collect the filtrate. This was further filtered through a 0.1μm pore size filter to collect the filtrate, and then powdered by vacuum freeze-drying to obtain agarooligosaccharide powder.

[0052] The composition of the prepared agarooligosaccharide was measured using high-performance liquid chromatography (Prominence® HPLC system (Shimadzu Corporation)). The measurement conditions were as follows: two columns (TSKgel® α-2500, Tosoh Corporation) connected in series, solvent H2O, flow rate 0.3 mL / min, temperature 60°C, elution, and detection by RI (differential refraction). The results were as follows. In this example, the composition containing the following 2-10 sugars is referred to as "agarooligosaccharide (AOS)". Disaccharide (agarobioses): 31.5% by mass Tetrasaccharide (agarotetraose): 30.1% by mass Hexasaccharide (agarohexaose): 21.2% by mass Octasaccharide (agarooctaose): 11.6% by mass Decasaccharide (agarodecaose): 5.6% by mass

[0053] <Example 2> Inhibitory effect on the growth of Streptococcus anginosa: Evaluation by turbidity (1)Culture conditions etc. The culture medium used was RF medium (*), which was a modified version of Brain-Heart Infusion medium (Thermo Scientific). Anaerobic culture was performed by static culture at 37°C using the anaerobic culture kit "Anelopack" (Mitsubishi Gas Chemical). *RF medium composition: 1L Brain-Heart Infusion medium, 5g yeast extract, 5g K2HPO4, 8g glucose, 0.5g L-cysteine ​​hydrochloride, 1g Tween 80, 0.005g hemin, 0.002g vitamin K1, 0.001g resazurin sodium, 0.025g acetate, 0.01g MgSO2·7H2O, pH 6.8.

[0054] (2) Culturing in the presence of agarooligosaccharides Streptococcus anginosus JCM 12993 (Microbial Materials Development Laboratory, BioResource Research Center, RIKEN) (sometimes referred to as "SA strain") was cultured anaerobically in RF medium for 23.5 hours, and this was used as the starter culture. On the other hand, two types of culture media were prepared: RF medium to which sucrose was added to a final concentration of 0.5% by mass (Sample 1), and RF medium to which agarooligosaccharide was added to a final concentration of 0.5% by mass (Sample 2). These were used as the main culture media. After dispensing 0.4 mL of the main culture media into Deep Well Plates (AxyGen Scientific, CA, USA), 20 μL of the 10-fold diluted starter culture was inoculated into each well, and the cultures were cultured anaerobically for 44 hours (main culture). Hereinafter, the culture solutions obtained using Sample 1 and Sample 2 will be referred to as Sample 1 and Sample 2.

[0055] (3) Measurement of bacterial count by turbidity method 20 μL of the culture medium after the main culture was collected and diluted 10-fold by adding 180 μL of water. The transmittance of light at a wavelength of 660 nm in the diluted culture medium was measured using a microplate reader (Wako SUNRISE Rainbow) and the turbidity (OD660) was calculated (primary measurement). The RF medium was also diluted 10-fold and measured similarly to calculate the turbidity (diluted medium turbidity). After subtracting the diluted medium turbidity from the primary measurement, this result was multiplied by 10 to obtain the turbidity of the culture medium. The average value of 8 samples was calculated for each sample. Statistical analysis between groups was performed using the Mann-Whitney U test with the medical statistical analysis software GraphPad Prism (GraphPad Software), and a P<0.05 was considered statistically significant. The results are shown in Figure 1.

[0056] As shown in Figure 1, the turbidity (OD660) of the culture medium was 2.09 for sample 1 (main culture in sucrose-containing medium), while that of sample 2 (main culture in AOS 0.5% medium) was 0.10, which was significantly lower than that of sample 1. In other words, the turbidity of the Streptococcus anginosus culture medium decreased in the presence of agarooligosaccharides. From these results, it became clear that agarooligosaccharides can suppress the growth of Streptococcus anginosus.

[0057] <Example 3> Inhibitory effect on the proliferation of Streptococcus anginosa: Evaluation by abundance ratio (1) Culturing in the presence of agarooligosaccharides The culture conditions were as described in Example 2(1). The SA strain was cultured anaerobically in RF medium for 23.5 hours to obtain the SA strain mother liquor. In addition, a human commensal bacteria DNA cocktail (product name "DNA-Mock-003", lot 240101ND, National Institute of Technology and Evaluation Biotechnology Center (NBRC)) (sometimes referred to as the "cocktail strain") was cultured anaerobically in RF medium for 23.5 hours to obtain the cocktail strain mother liquor. The cocktail strain is a mixture of 20 microbial strains from the NBRC, as shown in Figure 2, with equal amounts of each strain's genomic DNA copy number. These 20 strains are known to inhabit the human intestines, oral cavity, skin, etc. Cocktail strains have been confirmed to have a detection rate of approximately 5% per strain in evaluation by shotgun sequencing (Tourlousse, DM, Narita, K., Miura, T. et al. Characterization and demonstration of mock communities as control reagents for accurate human microbiome community measurements. Microbiology Spectrum, 10(2): e01915-21.).

[0058] SA seed liquor and cocktail seed liquor were each diluted 10-fold and then mixed in equal volumes to prepare a mixed seed liquor. Two types of culture media were prepared: RF medium (Sample 1) and RF medium to which agarooligosaccharide was added to a final concentration of 0.5% by mass (Sample 2). These were used as the main culture media. After dispensing 0.4 mL / well of each culture medium into Deep Well Plates (AxyGen Scientific, CA, USA), 20 μL of the mixed seed liquor was inoculated into each well, and the cultures were incubated anaerobically for 23.5 hours (main culture). Hereinafter, the cultures prepared using Sample 1 and Sample 2 will be referred to as Sample 1 and Sample 2, respectively.

[0059] (2) Measurement of bacterial count by turbidity method The turbidity (OD660) of the culture medium after the main culture was measured using the method described in Example 2(3). However, the average turbidity was calculated by averaging the values ​​of four samples for each sample. The results are shown in Figure 3. As shown in Figure 3, the turbidity (OD660) of the culture medium was 3.19 for sample 1 (main culture in RF medium) and 1.86 for sample 2 (main culture in AOS-containing medium), and there was no significant difference between the two (ns). In other words, there was no significant difference in the total number of bacteria in the presence of agarooligosaccharides compared to the absence of agarooligosaccharides.

[0060] (3) Comprehensive analysis of the bacterial flora The culture medium after the initial culture was diluted 10-fold, and 0.5 mL was taken and incubated at 70°C for 10 minutes. Subsequently, it was disrupted using zirconia beads in a FastPrep FP100A instrument (MP Biomedicals) at 4300 rpm for 2 minutes. This was then centrifuged at 15000 rpm for 1 minute, and the supernatant was collected to obtain total bacterial DNA. Using the total bacterial DNA as a template, PCR was performed using the universal primers of Sequence ID No. 4 and 5 below to amplify the V3-V4 region of bacterial 16S rDNA (Takahashi S, et al., (2014) Development of a Prokaryotic Universal Primer for Simultaneous Analysis of Bacteria and Archaea Using Next-Generation Sequencing. PLoS ONE 9(8): e105592. Published: August 21, 2014). Forward primer (Pro341F): 5'-CCTACGGGNBGCASCAG-3' (SEQ ID NO: 4) Reverse primer (Pro805R): 5'-GACTACNVGGGTATCTAATCC-3' (SEQ ID NO: 5)

[0061] Next, the nucleotide sequences of the PCR amplification products were decoded using next-generation sequencing (NGS). NGS was performed using the paired-end sequencing method (2 × 300 bp) with the Illumina MiSeq platform (Illumina) and MiSeq Reagent Kit ver. 3 (Illumina). The decoded nucleotide sequences were analyzed using the EzBioCloud 16S database and the 16S microbiome pipeline (EzBioCloud 16S-based MTP app, https: / / www.EZbiocloud.net) to identify the species at the classification level and determine their relative abundance (occupancy rate). The relative abundance was calculated as a percentage of the total number of reads for each bacterial species. This NGS analysis was performed by Biotechnology Research Institute Co., Ltd.

[0062] As a result, the abundance of Streptococcus anginosus was 14.69% in sample 1 (main culture in RF medium), compared to 0.00% in sample 2 (main culture in AOS-containing medium). In other words, in the presence of agarooligosaccharides, the abundance of Streptococcus anginosus was reduced to almost zero. From these results, it became clear that agarooligosaccharides can suppress the growth of Streptococcus anginosus even in a bacterial community environment where a considerable amount of other bacterial species are present.

Claims

1. A growth inhibitor for Streptococcus anginosus, containing agarooligosaccharide as the active ingredient.

2. The agent according to claim 1, used to prevent or improve aerobic vaginitis.

3. The agent according to claim 1, used to prevent or improve gastritis or gastric cancer.

4. The agent according to claim 1, used to prevent or improve pancreatic cancer.

5. The agent according to claim 1 or claim 2, wherein the agarooligosaccharide is an agarooligosaccharide containing agarobiose.

6. A growth inhibitor for Streptococcus anginosus, comprising 3,6-anhydro-L-galactose or an oligosaccharide having it at its reducing end as an active ingredient.

7. A method for inhibiting the proliferation of Streptococcus anginosus in vivo (excluding medical procedures), comprising the step of administering one or more oligosaccharides selected from agarooligosaccharides, 3,6-anhydro-L-galactose, and oligosaccharides having 3,6-anhydro-L-galactose as a reducing end to a human or animal.

8. The method according to claim 7, which is a method for preventing or improving aerobic vaginitis.

9. The method according to claim 7, which is a method for preventing or improving gastritis or gastric cancer.

10. The method according to claim 7, which is a method for preventing or improving pancreatic cancer.

Images