Agents and methods for inhibiting the proliferation of Clostridium perfringens
Agarooligosaccharides and 3,6-anhydro-L-galactose inhibit Clostridium perfringens growth, addressing pathogenic issues by reducing bacterial presence and toxin release, thus preventing diseases and avoiding antibiotic resistance.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- INA FOOD IND
- Filing Date
- 2024-12-26
- Publication Date
- 2026-07-08
AI Technical Summary
Clostridium perfringens, a bacterium present in various environments and living organisms, is a pathogenic microorganism causing diseases such as food poisoning, soft tissue infections, and diarrhea, and existing methods are inadequate in effectively suppressing its growth and associated health issues.
The use of agarooligosaccharides and 3,6-anhydro-L-galactose, or oligosaccharides with 3,6-anhydro-L-galactose as a reducing end, to inhibit the growth of Clostridium perfringens by reducing its presence in microbial communities both in vivo and in vitro.
Suppresses the growth of Clostridium perfringens, thereby preventing or improving diseases like food poisoning, soft tissue infections, and diarrhea by reducing bacterial presence and toxin release, and avoiding antibiotic resistance concerns.
Smart Images

Figure 2026113816000001_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to an agent and a method for suppressing the growth of Clostridium perfringens.
Background Art
[0002] Clostridium perfringens (sometimes referred to as "this bacterium" in the present invention) is a Gram-positive, spore-forming, non-motile, obligately anaerobic bacillus, also called Welch bacillus. This bacterium inhabits various environments such as soil in cultivated land, rivers, seas, sewage, and food, as well as the digestive tracts of humans and animals.
[0003] This bacterium is a resident in the living body regardless of health or illness, but produces as many as 23 types of toxins (the combination of toxins produced varies depending on the strain), and each toxin can cause the etiology of a specific disease. The toxins produced by this bacterium are excerpted from Sapplementary Table S1 of Non-Patent Document 1 and shown in FIG. 1. In addition, this bacterium has oxygen tolerance and can survive in an aerobic environment, generates a toxic gas (hydrogen sulfide), forms spores that can withstand extreme temperature conditions, and has the characteristic of rapid growth (optimal medium, generation time at 43°C is 8 - 12 minutes) (Non-Patent Document 1). From these facts, this bacterium is a pathogenic microorganism that requires great attention in public health.
[0004] For example, diseases in which this bacterium is involved in the onset or exacerbation include Clostridium soft tissue infections such as food poisoning (human food, feed) (Non-Patent Document 2) and gas gangrene (human, animal) (Non-Patent Documents 3, 4), non-food poisoning diarrhea such as antibiotic-associated diarrhea, necrotizing enteritis (human, poultry, bird, pig, calf, foal, goat), hemorrhagic enteritis (calf, foal, sheep), enterotoxemia (sheep, goat, cow), and other systemic and intestinal diseases (Non-Patent Document 1, Table 1 of Non-Patent Document 5, etc.).
Prior Art Documents
Non-Patent Documents
[0005] [Non-Patent Document 1] Raymond Kiu & Lindsay J. Hall, An update on the human and animal enteric pathogen Clostridium perfringens, Emerging Microbes & Infections (2018), 7:141, 1-15, DOI:10.1038 / s41426-018-0144-8 [Non-Patent Document 2] Chie Monma and Yoshinari Yanagawa, Department of Microbiology, Tokyo Metropolitan Institute of Public Health, "What is Clostridium perfringens infection?", published in IDWR 2006, No. 33, National Institute of Infectious Diseases, [online] [Retrieved November 13, 2024], Internet<URL:https: / / www.niid.go.jp / niid / ja / kansennohanashi / 324-c-perfringens-intro.html> [Non-Patent Document 3] Merck & Co., Inc., Kenilworth, NJ, USA, MSD Manual Professional Edition / 13. Infectious Diseases / Anaerobic Bacteria / Clostridium Soft Tissue Infections, Authors: Larry M. Bush, Maria T., Reviewed / Revised June 2023, [Retrieved November 13, 2024], Internet <URL: https: / / www.msdmanuals.com / ja-jp / professional / 13-%E6%84%9F%E6%9F%93%E6%80%A7%E7%96%BE%E6%82%A3 / %E5%AB%8C%E6%B0%97%E6%80%A7%E7%B4%B0%E8%8F%8C / %E3%82%AF%E3%83%AD%E3%82%B9%E3%83%88%E3%83%AA%E3%82%B8%E3%82%A6%E3%83%A0%E8%BB%9F%E9%83%A8%E7%B5%84%E7%B9%94%E6%84%9F%E6%9F%93%E7%97%87> [Non-Patent Document 4] Merck & Co., Inc., Kenilworth, NJ, USA, MSD Manual Home Edition / 16. Infectious Diseases / Bacterial Infections: Anaerobic Bacteria / Gas Gangrene, Author: Larry M. Bush, Review / Revised May 2021, [Retrieved November 13, 2024], Internet <URL: https: / / www.msdmanuals.com / ja-jp / home / 16-%E6%84%9F%E6%9F%93%E7%97%87 / %E7%B4%B0%E8%8F%8C%E6%84%9F%E6%9F%93%E7%97%87%EF%BC%9A%E5%AB%8C%E6%B0%97%E6%80%A7%E7%B4%B0%E8%8F%8C / %E3%82%AC%E3%82%B9%E5%A3%8A%E7%96%BD> [Non-Patent Document 5] Tomasz Grenda et al., Review Clostridium perfringens?Opportunistic Foodborne Pathogen, Its Diversity and Epidemiological Significance, Pathogens 2023, 12, 768. https: / / doi.org / 10.3390 / pathogens12060768, 1-12 [Overview of the project] [Problems that the invention aims to solve]
[0006] As mentioned above, this bacterium is a microorganism that is normally present in various environments and living organisms, but it is sometimes a pathogenic microorganism involved in the onset or exacerbation of various diseases and ill health conditions. Therefore, the inventors of this invention believed that if the growth of this bacterium could be suppressed, it would contribute to the prevention or improvement of diseases and ill health conditions in which this bacterium is involved in the onset or exacerbation of.
[0007] In other words, the present invention aims to provide a technology that can effectively suppress the growth of this bacterium. Furthermore, the present invention aims to provide a technology that can contribute to the prevention and improvement of various diseases and ill health conditions in which this bacterium is involved in the onset or exacerbation of the disease. [Means for solving the problem]
[0008] As a result of diligent research, the present inventors have found that agarooligosaccharides, 3,6-anhydro-L-galactose, and oligosaccharides having 3,6-anhydro-L-galactose as a reducing end (in this invention, these may be collectively referred to as "active ingredients," or one or more of them) can suppress the growth of this bacterium and reduce its relative presence in the microbial community. Based on this finding, the inventors have completed the following inventions.
[0009] (1) The first embodiment of the Clostridium perfringens growth inhibitor (sometimes referred to as "this agent") according to the present invention comprises agarooligosaccharide as an active ingredient.
[0010] (2) This drug may be used to prevent or improve one or more diseases selected from food poisoning, Clostridium soft tissue infection, non-food poisoning diarrhea, and necrotizing enterocolitis. That is, the present invention also provides an agent for preventing or improving one or more diseases selected from food poisoning, Clostridium soft tissue infection, non-food poisoning diarrhea, and necrotizing enterocolitis, comprising one or more selected from agarooligosaccharide, 3,6-anhydro-L-galactose, and oligosaccharides having it as a reducing end as an active ingredient.
[0011] (3) In the present invention, the agarooligosaccharide may contain agarobiose.
[0012] (4) The second aspect of this product contains 3,6-anhydro-L-galactose or an oligosaccharide having it at its reducing end as the active ingredient.
[0013] (5) A first aspect of the method for inhibiting the proliferation of Clostridium perfringens according to the present invention (sometimes referred to as "the Method") is a method for inhibiting the proliferation of Clostridium perfringens in vivo, comprising the step of administering one or more selected from agarooligosaccharides, 3,6-anhydro-L-galactose, and oligosaccharides having the same at their reducing end to a human or animal.
[0014] (6) A second aspect of the present method is a method for suppressing the proliferation of Clostridium perfringens in vitro, comprising the step of contacting a substance containing Clostridium perfringens with one or more selected from agarooligosaccharides, 3,6-anhydro-L-galactose and oligosaccharides having it at their reducing end.
[0015] (7) The method according to the first embodiment may be a method for preventing or improving one or more diseases selected from food poisoning, Clostridium perfringens in vivo, Clostridium soft tissue infection, non-food poisoning diarrhea, and necrotizing enterocolitis by suppressing the proliferation of Clostridium perfringens in vivo. That is, the present invention also provides a method for preventing or improving one or more diseases selected from food poisoning, Clostridium soft tissue infection, non-food poisoning diarrhea, and necrotizing enterocolitis, comprising the step of administering one or more selected from agarooligosaccharides, 3,6-anhydro-L-galactose, and oligosaccharides having it as a reducing end to a human or animal.
[0016] Furthermore, the present invention also provides a method for preventing or improving one or more diseases selected from food poisoning, Clostridium perfringens, non-food-toxic diarrhea, and necrotizing enterocolitis by suppressing the proliferation of Clostridium perfringens in vitro. That is, the present invention also provides a method for preventing or improving one or more diseases selected from food poisoning, Clostridium perfringens, non-food-toxic diarrhea, and necrotizing enterocolitis, comprising the step of contacting a substance containing Clostridium perfringens with one or more selected from agarooligosaccharides, 3,6-anhydro-L-galactose, and oligosaccharides having it at the reducing end.
[0017] The present invention may be implemented except for medical practices.
Advantages of the Invention
[0018] According to the present invention, the growth of Clostridium perfringens can be suppressed. Further, according to the present invention, by suppressing the growth of this bacterium, it is possible to contribute to the prevention and improvement of various diseases and unhealthy states in which this bacterium is involved in the onset and exacerbation.
[0019] For example, if the number of bacteria of this bacterium in a living body such as the digestive tract can be suppressed, it is possible to directly contribute to the prevention and improvement of diseases and unhealthy states (for example, food poisoning, non-food poisoning diarrhea, necrotizing enteritis, hemorrhagic enteritis, etc.) in which the toxin of this bacterium in the intestine is involved.
[0020] In addition, by suppressing the number of bacteria of this bacterium in a living body, the number of bacteria excreted from the living body into the environment can be suppressed. As a result, it is considered possible to suppress the number of bacteria invading living tissues through trauma, food, etc., and contribute to the prevention and improvement of diseases and unhealthy states (for example, food poisoning, soft tissue infections, etc.) caused by this bacterium.
[0021] Also, for example, if the number of bacteria of this bacterium can be suppressed outside a living body such as food or feed, the number of bacteria invading a living body through ingestion of the food or feed can be suppressed. Therefore, it is considered possible to contribute to the prevention and improvement of diseases and unhealthy states (for example, food poisoning, soft tissue infections, etc.) caused by this bacterium.
[0022] Also, for example, if the number of bacteria of this bacterium can be suppressed outside a living body such as the floor surface, wall surface, and various equipment in hospitals, elderly care facilities, animal breeding facilities, etc., the number of bacteria of this bacterium present in the environment can be suppressed. As a result, it is considered possible to suppress the number of bacteria invading and growing in trauma, food, etc., and through which they invade living tissues, and contribute to the prevention and improvement of diseases and unhealthy states (for example, food poisoning, soft tissue infections, etc.) caused by this bacterium.
[0023] In addition, the agarooligosaccharide used as an active ingredient in the present invention is an oligosaccharide made from agar, which has been ingested as a food since ancient times and has extremely high safety. Therefore, according to the present invention, the growth of Clostridium perfringens can be suppressed without any concerns about safety or side effects. In addition, since the presence of resistant bacteria has been reported in antibiotics such as tetracycline-based, macrolide-based, and lincomycin-based antibiotics for this bacterium (Non-Patent Document 1), the ability to suppress growth without relying on antibiotics is preferable for preventing the spread of resistant bacteria.
Brief Description of the Drawings
[0024] [Figure 1] It is a figure excerpting and quoting Supplementary Table S1 of Non-Patent Document 1, and it is a table summarizing the toxins produced by Clostridium perfringens, the genes encoding them, and the pathogenic mechanisms identified up to now (in 2018 when Non-Patent Document 1 was published). [Figure 2] It is a bar graph showing the turbidity (OD660) of the culture solution obtained by culturing Clostridium perfringens in the presence of sucrose (Suc) or agarooligosaccharide (AOS). In the figure, the plots indicate the measured values of each sample. [Figure 3] It is a table showing 20 types of microbial strains constituting the human commensal bacteria DNA cocktail (product name "DNA-Mock-003", lot 240101ND, NBRC). This table is quoted from the data sheet of the product (National Institute of Technology and Evaluation, HOME>Biotechnology>Microorganisms and Industrial Use>Microbiome>NBRC Human Commensal Microorganism Cocktail, [online][searched on July 29, 2024], Internet <URL: https: / / www.nite.go.jp / nbrc / industry / microbiome / cocktail20220113.html><URL: https: / / www.nite.go.jp / data / 000152907.pdf>). [Figure 4]This bar graph shows the turbidity (OD660) of culture media obtained by mixed culturing Clostridium perfringens with a human commensal bacterial DNA cocktail in the absence of agarooligosaccharides (Sample 1) or in the presence of agarooligosaccharides (Sample 2). In the figure, the plots show the measured values for each sample. [Modes for carrying out the invention]
[0025] The present invention will be described in detail below.
[0026] Agarooligosaccharides are even-numbered oligosaccharides consisting of repeating units of the disaccharide agarobiose, which is composed of D-galactose and 3,6-anhydro-L-galactose. Examples of agarooligosaccharides include the smallest unit, the disaccharide agarobiose, the tetrasaccharide agarotetraose, the hexasaccharide agarohexaose, the octasaccharide agarooctaose, and the decasaccharide agarodecaose. In the present invention, agarooligosaccharides contain at least one of these oligosaccharides, and may consist of one type or two or more types. For example, agarooligosaccharides may consist only of agarobiose, or they may contain agarooligosaccharides other than agarobiose. Examples of agarobiose content in agarooligosaccharides in this case include 1-100% by mass, 10-100% by mass, 20-100% by mass, 30-100% by mass, 40-100% by mass, and 50-100% by mass.
[0027] Agarooligosaccharides are oligosaccharides having 3,6-anhydro-L-galactose at their reducing end. Therefore, the active ingredient of the present invention may be 3,6-anhydro-L-galactose or an oligosaccharide having it at its reducing end. In this case, the number of sugars in the oligosaccharide can be exemplified by, for example, 2-8 sugars, 2-10 sugars, 2-12 sugars, etc.
[0028] Agarooligosaccharides can be commercially available (agar oligosaccharides), or they can be manufactured according to conventional methods. A common method for producing agarooligosaccharides is, for example, the hydrolysis of agar. Hydrolysis can be carried out using either acid or enzymes.
[0029] Examples of acid decomposition methods include using a solid acid as described in Japanese Patent Publication No. 4796697, using mineral acids such as sulfuric acid or hydrochloric acid, or using organic acids such as acetic acid or citric acid; any of these methods is acceptable. Acid decomposition yields even-numbered sugars having 3,6-anhydro-L-galactopyranose as the reducing end.
[0030] Furthermore, examples of enzymatic degradation methods include degradation by α-agarase and degradation by β-agarase. Using α-agarase, as with acid degradation, even-numbered sugars with 3,6-anhydro-L-galactopyranose at the reducing end can be obtained. Degradation by α-agarase can be carried out, for example, by the method described in Japanese Patent Application Publication H2-65789.
[0031] The hydrolyzed agar product may be used as is, as agarooligosaccharide, or it may be purified and its pH adjusted before use. Examples of purification methods include filtration using filter paper or activated carbon. The agarooligosaccharide solution obtained from the hydrolysis treatment may be used in liquid form, or, if necessary, it may be used in powder form by vacuum freeze-drying or other methods.
[0032] Agar is a dehydrated and dried mucilage extracted from red algae such as Gelidium and Gracilaria, and mainly contains the polysaccharides agarose and agaropectin. In addition to agar, other substances containing agarose and agaropectin can be used as raw materials for agarooligosaccharide production. Specifically, examples of such substances include solutions obtained by hot water extraction of red algae from families such as Gelidaceae, Gracilaceae, and Ixeriaceae, which are the raw materials for agar. Examples of red algae from the Gelidaceae family include Gastrodia elata, Orientalus japonica, Ophiopogon, Heliotropium spp., Gracilaria japonica, and Ixeriaceae; examples of red algae from the Gracilaceae family include Gracilaria japonica and Ophiopogon spp., and examples of red algae from the Ixeriaceae family include Ixeris spp. and Styrax japonica. These red algae can be used individually or in combination of two or more types.
[0033] The sugar composition of agarooligosaccharides can be confirmed by liquid chromatography, including high-performance liquid chromatography, as shown in the examples described later. Furthermore, this allows for the fractionation of agarooligosaccharides with desired sugar content, such as only agarobiose, only agarotetraose, or only agarohexaose, and the adjustment of the sugar composition of the agarooligosaccharides for use.
[0034] 3,6-Anhydro-L-galactose can be obtained from commercially available reagents, or it can be produced by conventional methods. An example of such a method is the method described in Japanese Patent No. 4007760. Specifically, 450 μL of a 100 mM aqueous solution of agarobiose is mixed with 50 μL of 10-fold concentrated phosphate-buffered saline and 50 μL of 10 units / μL of β-galactosidase phosphate-buffered saline solution, and the mixture is reacted at 37°C for 1 hour. 5 mL of a 1-butanol:ethanol = 1:1 mixture is added to this reaction solution, and insoluble matter is precipitated by centrifugation. The resulting supernatant is subjected to column chromatography using a silica gel column, with 1-butanol:ethanol:water = 5:5:1 as the eluent and chromatographed at 0.3 kg / cm² using a compressor. 2The mixture is pressurized and separated. By dividing the mixture into 7 mL fractions, for example, fractions 14 through 17 can be obtained, each containing high-purity 3,6-anhydro-L-galactose. These fractions are collected and dried under reduced pressure to obtain 3,6-anhydro-L-galactose.
[0035] "Inhibiting the growth" of Clostridium perflingens includes not only reducing the number of bacteria (decreasing their proportion in the bacterial community), but also maintaining the number of bacteria at a similar level, or, even if the number of bacteria increases, the increase is smaller compared to when the active ingredient of the present invention is not used. Furthermore, inhibiting growth and inhibiting the number of bacteria are synonymous.
[0036] Whether or not the growth of this bacterium can be inhibited can be confirmed by conventional methods. For example, if the bacterium is isolated, the active ingredient can be added to the culture medium, and the number of bacteria can be confirmed by turbidity testing or similar methods, compared to when the ingredient is not added.
[0037] Furthermore, if the bacterium has not been isolated (for example, in feces, saliva, vaginal secretions, nasal discharge, soil, river water, seawater, food, feed, a cocktail bacterial solution containing multiple bacterial species, or a human intestinal tract model), an example can be given of a method in which the whole genomic DNA of bacteria extracted from the sample is used as a template to amplify bacterial-derived 16S rDNA by polymerase chain reaction (PCR) in cases where the active ingredient of the present invention is administered and in cases where it is not administered. The amplified product is then decoded by next-generation sequencing (NGS), the bacterial species and abundance are identified based on a 16S database, the abundance ratio of the bacterium is determined, and the results are compared. In addition, quantitative PCR can be performed on the whole genomic DNA of bacteria using primers specific to the bacterium. When confirming the number of bacteria of the bacterium by PCR, since the amount of gene purified from the sample (purification efficiency) is not constant, it is preferable to calculate the proportion (abundance ratio, occupancy rate) of the bacterium to the total number of bacteria or the amount of template DNA and make a judgment based on that proportion.
[0038] When quantifying this bacterium by PCR, specific primers can be designed based on publicly available sequence information to identify a portion of the genomic DNA (conserved region) that is conserved in this bacterium but not in closely related species. For example, the genome of the reference strain of this bacterium, Clostridium perfringens JCM 1290, is publicly available under accession number GenBank: CP000246, and the DNA sequence (SEQ ID NO: 1) of the plc gene (the gene encoding α-toxin (phospholipase C)) has also been identified. Thus, this bacterium can also be quantified using primers specific to the sequence of the gene encoding the toxin of this bacterium.
[0039] [SEQ ID NO: 1] plc gene (length 1197 nucleotides) derived from Clostridium perfringens JCM 1290 (Clostridium perfringens ATCC 13124), accession number: GenBank: CP000246 (genome): 48363-49559 (corresponding region of plc gene) atgaaaagaa agatttgtaa ggcgcttatt tgtgccgcgc tagcaactag cctatgggct ggggcatcaa ctaaagtcta cgcttgggat ggaaagattg atggaacagg aactcatgct atgattgtaa ctcaaggggt ttcaatctta gaaaatgatc tgtccaaaaa tgaaccagaa agtgtaagaa aaaacttaga gattttaaa gagaacatgc atgagcttca attaggttct acttatccag attatgataa gaatgcatat gatctatatc aagatcattt ctgggatcct gatacagata ataatttctc aaaggataat agttggtatt tagcttattc tatacctgac acagggggaat cacaataaag aaaattttca gcattagcta gatatgaatg gcaaagagga aactataaac aagctacatt ctatcttgga gaggctatgc actattttgg agatatagat actccatatc atcctgctaa tgtgcc gttgatagcg caggacatgt taagtttgag acttttgcag aggaaagaaa agaacagtat aaaaataaca cagcaggttg caaaactaat gaggctttt atactgatat cttaaaaaac aaagatttta atgcatggtc aaaagaatat gcaagaggtt ttgctaaaac aggaaaatca atatactata gtcatgctag catgagtcat agttgggatg attgggatta tgcagcaaag gtaactttag ctaactctca aaaaggaaca gcgggatata tttatagagatt cttacacgat gtatcagagg gtaatgatcc atcagttgga aagaatgtaa aagaactagt agcttacata tcaactagtg gtgagaaaga tgctggaaca gatgactacatgtattttgg aatcaaaaca aaggatggaa aaactcaaga atgggaaatg gacaacccag gaaatgattt tatgactgga agtaaagaca cttatacttt caaattaaaa gatgaaaatc taaaaattga tgatatacaa aatatgtgga ttagaaaaag aaaatataca gcattctcag atgcttataa gccagaaaac ataaagataa tagcaaatgg aaaagttgta gtggacaaag atataaacga gtggatttca ggaaattcaa cttataatat aaaataa
[0040] As mentioned above, Clostridium perfringens has been reported to be a pathogen causing food poisoning. Food poisoning caused by this bacterium is an infectious type of food poisoning that develops when a person consumes food containing a large amount of this bacterium, and the bacterium multiplies in the intestinal tract and produces and releases toxins (enterotoxins, CPE) when forming spores. The main symptoms are abdominal pain and diarrhea. Common causative foods include curry, soup, meatballs, char siu (roast pork), and boiled vegetables, and these foods are often left at room temperature for several hours to overnight after being cooked in large quantities. In cooked food, many coexisting bacteria are killed, but the heat-resistant spores of this bacterium survive. Reheating promotes spore germination and simultaneously expels oxygen contained in the food, creating favorable conditions for the growth of this bacterium. Furthermore, the optimal growth temperature for this bacterium is 43-47°C, which is higher than that of other bacteria, and its growth rate is also fast. Therefore, it is thought that it rapidly multiplies as cooked food cools (Non-Patent Document 2), exceeding the threshold for disease onset. Food poisoning caused by this bacterium has been reported to be caused by type A (producing α-toxin) and type F (producing α-toxin and CPE) (Non-Patent Documents 1, 5).
[0041] Therefore, if the growth of this bacterium can be suppressed in the body, the amount of toxins released in the intestines, such as α-toxin and CPE, can be reduced. Furthermore, if the growth of this bacterium can be suppressed in the body, the number of bacteria excreted from the body into the environment can be reduced, thereby reducing the number of bacteria that invade food and feed. Moreover, if the growth of this bacterium can be suppressed in food and feed by adding the active ingredient, the number of bacteria that invade the body when ingested can be reduced. From these points, it is thought that if the growth of this bacterium can be suppressed in or out of the body, it can contribute to the prevention or improvement of food poisoning. In other words, the active ingredient of the present invention can be used to prevent or improve food poisoning.
[0042] Furthermore, as mentioned above, this bacterium has been reported to be a pathogen of Clostridium soft tissue infections. Clostridium soft tissue infections are diseases in which Clostridium species infect the skin and muscle tissue, causing tissue damage. These include Clostridium cellulitis, Clostridium myositis, and Clostridium myonecrosis, which vary in severity. Clostridium perfringens is the most frequently occurring species involved in this disease. While this infection can occur spontaneously, it usually develops after trauma such as surgery or injury. This is because damaged soft tissue and deep wounds have poor blood flow and reduced oxygen levels, creating an environment suitable for the growth of anaerobic bacteria (Non-patent Literature 3, 4).
[0043] Clostridium cellulitis is a localized infection that occurs in wounds on the body surface. The infection spreads extensively along the fascial surface, often accompanied by a distinct crackling sound and massive gas production, but the toxicity is not as severe as extensive muscle necrosis, and there is little pain (Non-patent literature 3, 4).
[0044] Clostridium myositis is a purulent infection of the muscles without necrosis, characterized by edema and pain, and often by emphysema within the tissue. It is frequently seen in injectable drug users. Although systemic symptoms are not present, the infection can spread rapidly and progress to muscle necrosis (Non-patent documents 3, 4).
[0045] Clostridium myonecrosis (gas gangrene) is a rapidly spreading infection of the muscles, causing discoloration of the affected area, severe pain, blisters, tension edema, tenderness, foul-smelling wounds and pus discharge, crackling, fever, sweating, tachycardia, pallor, hypotension, toxic shock, acute renal failure, and sepsis. It is a serious disease with a 100% mortality rate if left untreated and a mortality rate of approximately 25% even with treatment (Non-Patent Documents 3, 4). Alpha-toxin and perfling lysin O (PFO) have been reported as toxins involved in myonecrosis (Non-Patent Documents 1, 5).
[0046] Therefore, if the proliferation of this bacterium can be suppressed in vivo, the amount of toxins released at the affected site, such as α-toxin and PFO, can be reduced. Furthermore, if the proliferation of this bacterium can be suppressed in vivo or in vitro, the number of bacteria excreted from the body into the environment or present in the environment can be suppressed, thereby suppressing the number of bacteria that invade the wound site. From these points, it is thought that if the proliferation of this bacterium can be suppressed in vivo or in vitro, it can contribute to the prevention or improvement of Clostridium soft tissue infections. In other words, the active ingredient of the present invention can be used to prevent or improve Clostridium soft tissue infections.
[0047] Furthermore, as mentioned above, this bacterium has been reported to be a pathogen of non-foodborne diarrhea. Non-foodborne diarrhea is a disease distinct from food poisoning, characterized mainly by severe and prolonged symptoms, and includes antibiotic-associated diarrhea (AAD) and sporadic diarrhea (SD). Clinical symptoms include abdominal pain, prolonged diarrhea (from 3 days to several weeks), and bloody stools. AAD occurs in 5-25% of patients who have received broad-spectrum antibiotics. While Clostridium difficile and S. aureus are also thought to be involved in AAD, it is estimated that Clostridium perflingens type F (producing α-toxin and CPE) is the causative agent in 15% of all cases. As for the toxin, CPE is frequently found in patients with diarrhea but not in healthy individuals, and has therefore been reported to be the causative agent of non-foodborne diarrhea caused by this bacterium. Type F of this bacterium has also been reported to be involved in SD. This strain of AAD has been reported to have higher adhesion to Caco-2 intestinal cells compared to other foodborne pathogens, which is thought to be due to the production of sialidase (NanI). The spore-forming ability of this bacterium may also be a contributing factor to the persistence and recurrence of this disease (Non-Patent Literature 1).
[0048] Therefore, if the growth of this bacterium can be suppressed in vivo, the amount of toxins released in the intestines, such as CPE, can be reduced. Furthermore, if the growth of this bacterium can be suppressed in vivo or in vitro, the number of bacteria excreted from the organism into the environment or present in the environment can be suppressed, thereby suppressing the number of bacteria that enter the organism through various routes such as drinking water, food, and feed. From these points, it is thought that if the growth of this bacterium can be suppressed in vivo or in vitro, it can contribute to the prevention or improvement of non-food-toxic diarrhea. In other words, the active ingredient of the present invention can be used to prevent or improve non-food-toxic diarrhea.
[0049] Furthermore, as mentioned above, this bacterium has been reported to be a pathogen of necrotizing enterocolitis. Necrotizing enterocolitis is a disease in which a part of the intestine dies. Necrotizing enterocolitis caused by Clostridium perfringens was seen in adult humans under the poor sanitary and malnourished conditions of the postwar period, but is now mainly seen in premature infants. In animals, it has also been reported in poultry, horses, and pigs. The toxins considered to be the causative agents differ in each type of enterocolitis. For example, NetB and TpeL are involved in necrotizing enterocolitis in poultry, CPE, β2 toxin, NetE, NetF, and NetG in necrotizing enterocolitis in horses, β toxin in hemorrhagic enterocolitis in pigs, and β toxin and CPE have been reported to be involved in postwar human necrotizing enterocolitis, with the involvement of β2 toxin suggested in necrotizing enterocolitis of premature infants (Non-Patent Literature 1).
[0050] Therefore, if the growth of this bacterium can be suppressed in vivo, the amount of toxins released in the intestines, such as NetB, TpeL, CPE, β2 toxin, NetE, NetF, NetG, and β toxin, can be reduced. Furthermore, if the growth of this bacterium can be suppressed in vivo or in vitro, the number of bacteria excreted from the organism into the environment or present in the environment can be suppressed, thereby suppressing the number of bacteria that enter the organism through various routes such as drinking water, food, and feed. From these points, it is thought that if the growth of this bacterium can be suppressed in vivo or in vitro, it can contribute to the prevention or improvement of necrotizing enterocolitis. In other words, the active ingredient of the present invention can be used to prevent or improve necrotizing enterocolitis.
[0051] The active ingredient of the present invention can be used, for example, in a form administered to humans or animals. More specific forms of use can be appropriately determined depending on the recipient, application site, purpose of use, etc. For example, the method and route of administration only need to ensure that the active ingredient reaches the site where Clostridium perfringens resides. Specifically, examples include oral ingestion, nasal administration, placement under the tongue (sublingual) or between the gums and cheek, rectal (transrectal) or vaginal (transvaginal) insertion.
[0052] The dosage of the active ingredient can also be appropriately set according to the target person, the site of administration, the form of the product, its use, etc. Specific examples of dosages for adults include: 0.01 mg / kg body weight or more, 0.1 mg / kg body weight or more, 1 mg / kg body weight or more, 5 mg / kg body weight or more, 10 mg / kg body weight or more, 1000 mg / kg body weight or less, 800 mg / kg body weight or less, 600 mg / kg body weight or less, 400 mg / kg body weight or less, 200 mg / kg body weight or less, 100 mg / kg body weight or less, and 10 mg / kg body weight or less per day.
[0053] The active ingredient may be used as is in the form of food, beverages, supplements, pharmaceuticals, quasi-drugs, animal feed, etc., or it may be used as a raw material for food, beverages, supplements, pharmaceuticals, quasi-drugs, animal feed, etc., in combination with other ingredients. These products can be manufactured using the active ingredient as a raw material by methods known to those skilled in the art.
[0054] The active ingredient of the present invention can also be used in a form that comes into contact with a substance containing the bacterium. More specific forms of use can be appropriately determined depending on the object to be contacted (application location) and the purpose of use. For example, the object (application location) may be food or feed in which the bacterium lives and can proliferate in an anaerobic environment. Other examples include floors, walls, equipment, and furnishings of facilities used by persons, livestock, or poultry at high risk of the aforementioned diseases. The method of contact only needs to ensure that the active ingredient reaches the part where the bacterium lives. Specifically, examples include adding a solid or liquid active ingredient to food or beverages, spraying a liquid containing the active ingredient, or attaching an impregnated sheet to facilities and equipment.
[0055] The content of active ingredients in various products and aqueous solutions can also be appropriately set according to the form and use of the product. Specifically, examples of content can be, for example, 0.0001% by mass or more, 0.001% by mass or more, 0.01% by mass or more, 0.1% by mass or more, 100% by mass or less, 90% by mass or less, 80% by mass or less, 70% by mass or less, 60% by mass or less, 50% by mass or less, 40% by mass or less, 35% by mass or less, 30% by mass or less, 10% by mass or less, 5% by mass or less, etc.
[0056] The present invention will be described below based on examples. However, the technical scope of the present invention is not limited to the features shown in these examples. [Examples]
[0057] <Example 1> Preparation of agarooligosaccharides 50g of agar ("Ultra Agar AX-30" by Ina Food Industry Co., Ltd.) was added to 1000g of purified water and heated to dissolve. Then, 2g of concentrated sulfuric acid was added and the mixture was stirred at 90°C for 3 hours. After adjusting the pH to 3.5 with sodium hydroxide, the mixture was treated with activated carbon and then filtered through filter paper to collect the filtrate. This was further filtered through a 0.1μm pore size filter to collect the filtrate, and then powdered by vacuum freeze-drying to obtain agarooligosaccharide powder.
[0058] The composition of the prepared agarooligosaccharide was measured using high-performance liquid chromatography (Prominence® HPLC system (Shimadzu Corporation)). The measurement conditions were as follows: two columns (TSKgel® α-2500, Tosoh Corporation) connected in series, solvent H2O, flow rate 0.3 mL / min, temperature 60°C, elution, and detection by RI (differential refraction). The results were as follows. In this example, the composition containing the following 2-10 sugars is referred to as "agarooligosaccharide (AOS)". Disaccharide (agarobioses): 31.5% by mass Tetrasaccharide (agarotetraose): 30.1% by mass Hexasaccharide (agarohexaose): 21.2% by mass Octasaccharide (agarooctaose): 11.6% by mass Decasaccharide (agarodecaose): 5.6% by mass
[0059] <Example 2> Inhibitory effect on the growth of Clostridium perfringens: Evaluation by turbidity (1)Culture conditions etc. The culture medium used was RF medium (*), which was a modified version of Brain-Heart Infusion medium (Thermo Scientific). Anaerobic culture was performed by static culture at 37°C using the anaerobic culture kit "Anelopack" (Mitsubishi Gas Chemical). *RF medium composition: 1L Brain-Heart Infusion medium, 5g yeast extract, 5g K2HPO4, 8g glucose, 0.5g L-cysteine hydrochloride, 1g Tween 80, 0.005g hemin, 0.002g vitamin K1, 0.001g resazurin sodium, 0.025g acetate, 0.01g MgSO2·7H2O, pH 6.8.
[0060] (2) Culturing in the presence of agarooligosaccharides Clostridium perfringens JCM 1290 (a strain that produces phospholipase C (α-toxin). Reference strain. Microbial Materials Development Laboratory, BioResource Research Center, RIKEN) (sometimes referred to as "CP strain") was cultured anaerobically in RF medium for 23.5 hours, and this was used as the starter culture. On the other hand, two types of culture media were prepared: RF medium to which glucose was added to a final concentration of 1.0% by mass (Sample 1), and RF medium to which glucose and agarooligosaccharide were added to a final concentration of 0.5% by mass and 1.0% by mass, respectively (Sample 2). These were used as the main culture media. After dispensing 0.3 mL / well of each main culture medium into Deep Well Plates (AxyGen Scientific, CA, USA), 20 μL of the 50-fold diluted starter culture was inoculated into each well, and the cultures were cultured anaerobically for 23 hours (main culture). Hereinafter, the culture solutions prepared using Sample 1 or Sample 2 will be referred to as Sample 1 and Sample 2.
[0061] (3) Measurement of bacterial count by turbidity method 20 μL of the culture medium after the main culture was collected and diluted 10-fold by adding 180 μL of water. The transmittance of light at a wavelength of 660 nm in the diluted culture medium was measured using a microplate reader (Wako SUNRISE Rainbow) and the turbidity (OD660) was calculated (primary measurement). The RF medium was also diluted 10-fold and measured similarly to calculate the turbidity (diluted medium turbidity). After subtracting the diluted medium turbidity from the primary measurement, this result was multiplied by 10 to obtain the turbidity of the culture medium. The average value of 8 samples was calculated for each sample. Statistical analysis between groups was performed using the Mann-Whitney U test with the medical statistical analysis software GraphPad Prism (GraphPad Software), and a P<0.05 was considered statistically significant. The results are shown in Figure 2.
[0062] As shown in Figure 2, the turbidity (OD660) of the culture medium was 1.77 for sample 1 (main culture in AOS-free medium), while that of sample 2 (main culture in AOS-1.0% medium) was 0.07, which was significantly lower than that of sample 1 (P=0.0022). In other words, the turbidity of the Clostridium perfringens culture medium decreased in the presence of agarooligosaccharides. From these results, it is clear that agarooligosaccharides can suppress the growth of Clostridium perfringens.
[0063] <Example 3> Inhibitory effect on the proliferation of Clostridium perfringens: Evaluation by abundance ratio (1) Culturing in the presence of agarooligosaccharides The culture conditions were as described in Example 2(1). The CP strain was cultured anaerobically in RF medium for 23.5 hours to obtain the CP seed liquor. In addition, a human commensal bacteria DNA cocktail (product name "DNA-Mock-003", lot 240101ND, National Institute of Technology and Evaluation Biotechnology Center (NBRC)) (sometimes referred to as the "cocktail strain") was cultured anaerobically in RF medium for 23.5 hours to obtain the cocktail seed liquor. The cocktail strain is a mixture of 20 microbial strains from the NBRC, as shown in Figure 3, with equal amounts of each strain's genomic DNA copy number. These 20 strains are known to inhabit the human intestines, oral cavity, skin, etc. Cocktail strains have been confirmed to have a detection rate of approximately 5% per strain in evaluation by shotgun sequencing (Tourlousse, DM, Narita, K., Miura, T. et al. Characterization and demonstration of mock communities as control reagents for accurate human microbiome community measurements. Microbiology Spectrum, 10(2): e01915-21.).
[0064] The CP seed liquor was diluted 25-fold, and the cocktail seed liquor was diluted 10-fold. These were then mixed in equal volumes to create the mixed seed liquor. Two types of culture media were prepared: RF medium (Sample 1) and RF medium to which agarooligosaccharide was added to a final concentration of 0.5% by mass (Sample 2). These were used as the main culture media. 0.4 mL of each culture medium was dispensed into Deep Well Plates (AxyGen Scientific, CA, USA) per well, and 20 μL of the mixed seed liquor was inoculated into each well. Anaerobic culture was then performed for 23.5 hours (main culture). Hereinafter, the culture solutions obtained using Sample 1 and Sample 2 will be referred to as Sample 1 and Sample 2, respectively.
[0065] (2) Measurement of bacterial count by turbidity method The turbidity (OD660) of the culture medium after the main culture was measured using the method described in Example 2(3). However, the average value of turbidity was calculated as the average of four samples for each sample. The results are shown in Figure 4. As shown in Figure 4, the turbidity (OD660) of the culture medium was 3.33 for sample 1 (main culture in RF medium) and 1.90 for sample 2 (main culture in AOS 0.5% medium), and there was no significant difference between the two (p=0.1339). In other words, there was no significant difference in the total number of bacteria in the presence of agarooligosaccharides compared to the absence of agarooligosaccharides.
[0066] (3) Comprehensive analysis of the bacterial flora The culture medium after the initial culture was diluted 10-fold, and 0.5 mL was taken and incubated at 70°C for 10 minutes. Subsequently, it was disrupted using zirconia beads in a FastPrep FP100A instrument (MP Biomedicals) at 4300 rpm for 2 minutes. This was then centrifuged at 15000 rpm for 1 minute, and the supernatant was collected to obtain total bacterial DNA. Using the total bacterial DNA as a template, PCR was performed using the universal primers of Sequence ID No. 2 and 3 below to amplify the V3-V4 region of bacterial 16S rDNA (Takahashi S, et al., (2014) Development of a Prokaryotic Universal Primer for Simultaneous Analysis of Bacteria and Archaea Using Next-Generation Sequencing. PLoS ONE 9(8): e105592. Published: August 21, 2014). Forward primer (Pro341F): 5'-CCTACGGGNBGCASCAG-3' (SEQ ID NO: 2) Reverse primer (Pro805R): 5'-GACTACNVGGGTATCTAATCC-3' (SEQ ID NO: 3)
[0067] Next, the nucleotide sequences of the PCR amplification products were decoded using next-generation sequencing (NGS). NGS was performed using the paired-end sequencing method (2 × 300 bp) with the Illumina MiSeq platform (Illumina) and MiSeq Reagent Kit ver. 3 (Illumina). The decoded nucleotide sequences were analyzed using the EzBioCloud 16S database and the 16S microbiome pipeline (EzBioCloud 16S-based MTP app, https: / / www.EZbiocloud.net) to identify the species at the classification level and determine their relative abundance (occupancy rate). The relative abundance was calculated as a percentage of the total number of reads for each bacterial species. This NGS analysis was performed by Biotechnology Research Institute Co., Ltd.
[0068] As a result, the abundance of Clostridium perfringens was 70.60% in sample 1 (main culture in RF medium), compared to 0.00% in sample 2 (main culture in AOS 0.5% medium). In other words, in the presence of agarooligosaccharides, the abundance of Clostridium perfringens was reduced to almost zero. From these results, it became clear that agarooligosaccharides can suppress the growth of Clostridium perfringens even in a bacterial community environment where a considerable amount of other bacterial species are present.
Claims
1. A growth inhibitor for Clostridium perfringens, containing agarooligosaccharide as the active ingredient.
2. The agent according to claim 1, used to prevent or improve one or more diseases selected from food poisoning, Clostridium soft tissue infection, non-food poisoning diarrhea, and necrotizing enterocolitis.
3. The agent according to claim 1 or claim 2, wherein the agarooligosaccharide is an agarooligosaccharide containing agarobiose.
4. A growth inhibitor for Clostridium perfringens, comprising 3,6-anhydro-L-galactose or an oligosaccharide having it at its reducing end as an active ingredient.
5. A method for inhibiting the proliferation of Clostridium perfringens in vivo (excluding medical procedures), comprising the step of administering one or more oligosaccharides selected from agarooligosaccharides, 3,6-anhydro-L-galactose, and oligosaccharides having 3,6-anhydro-L-galactose as a reducing end to a human or animal.
6. A method for inhibiting the growth of Clostridium perfringens in vitro, comprising the step of contacting one or more oligosaccharides selected from agarooligosaccharides, 3,6-anhydro-L-galactose, and oligosaccharides having 3,6-anhydro-L-galactose as a reducing end, with a substance containing Clostridium perfringens.
7. The method according to claim 5 or 6 (excluding medical procedures), which is a method for preventing or improving one or more diseases selected from food poisoning, Clostridium soft tissue infection, non-food poisoning diarrhea, and necrotizing enterocolitis.