Porous silicon material containing metal silicate salts for therapeutic agent delivery

Abstract

To provide compositions useful for controlled delivery of therapeutic agents, as well as methods for preparing and using them. [Solution] A composition useful for the controlled delivery of therapeutic agents, as well as methods for preparing and using them, is provided. The composition comprises an optionally oxidized porous silicon core, a layer on the surface of the porous silicon core comprising a metal silicate salt, and a therapeutic agent. The composition optionally further comprises one or more targeting agents and / or cell-permeable agents that enable particles to target and penetrate into cells or tissues of interest in a subject being treated.

Description

[Technical Field]

[0001] Cross-references to related applications This application claims the benefit of U.S. Provisional Application No. 62 / 322,782, filed on April 14, 2016, the disclosures of which are incorporated herein by reference throughout.

[0002] Government support This invention was made with government support under contract number R24EY022025-01 and authorization number NRSA 1F32CA177094-01 granted by the National Institutes of Health, authorization number DMR1210417 granted by the National Science Foundation, and cooperation agreement number HR0011-13-2-0017 granted by the Defense Advanced Research Projects Agency. The government may have certain rights in this invention. [Background technology]

[0003] Background of the Invention There is considerable interest in developing drug delivery systems that provide sustained and reliable release of therapeutic agents. Such systems can be designed to deliver therapeutic agents to any tissue of a subject requiring treatment. Depending on the target tissue, the drug delivery vehicle may be administered orally, mucosally, topically, by injection, or by inhalation. The release of the drug from the drug delivery vehicle within the tissue should be rapid enough to achieve therapeutically effective concentrations of the drug in the target tissue, while at the same time, the release should not be so large that the drug reaches toxic levels in the tissue or is wasted by degradation metabolism.

[0004] For unstable therapeutic agents, sustained and reliable delivery is even more challenging due to stability issues. Furthermore, targeted delivery of therapeutic agents to specific tissues may be desirable to increase the effectiveness of treatment in affected tissues and minimize side effects in unaffected tissues. The unique characteristics and environment of a given target tissue can also present both challenges and opportunities in the design of drug delivery systems.

[0005] Exemplary drug delivery media include liposomes, organic microspheres, drug-polymer conjugates, and inorganic carriers. Among inorganic carriers, inorganic nanoparticles have recently become attractive candidates for use in drug delivery systems due to their unique physicochemical properties, specifically their controllable size, shape, surface reactivity, and solubility. Examples of nanoparticles, including inorganic nanoparticles, that are usefully used as drug delivery media include calcium phosphate nanoparticles, carbon nanotubes, gold nanoparticles, graphene oxide nanoparticles, iron oxide nanoparticles, and mesoporous silica nanoparticles.

[0006] For example, Xue et al. (2009), Acta Biomater, Vol. 5, p. 1686, reported on the use of mesoporous calcium silicate for controlled adsorption and release of protein drugs. In this study, a calcium silicate precipitate was formed from a solution phase. The precipitate was treated with acid to create a mesoporous structure on the particle surface, thereby increasing the particle surface area, improving their bioactivity, and enhancing protein-to-surface interactions.

[0007] Salinas et al. (2001), J. Sol-Gel Sci. Techn. Vol. 21: p. 13, produced gel glasses containing calcium silicate gel glass using the sol-gel method. The properties of these materials were investigated in the presence of simulated body fluids using a dynamic assay model.

[0008] Wu et al. (2010) Adv. Mater. Vol. 22: p. 749 describes an acoustic chemical method without surfactants. Nanostructured mesoporous calcium silicate hydrate spheres were synthesized from a solution phase using a specific method. The physicochemical properties of these materials, including their ability as drug carriers, were evaluated.

[0009] Li et al. (2007) J. Biomed. Mater. Res. B.83B: p. 431 describes the template pathway. We report on the preparation of mesoporous amorphous calcium silicate from solution using [a specific method / library]. This substance was found to exhibit higher osteogenic activity in an in vitro model compared to conventional amorphous calcium silicate.

[0010] Wu et al. (2012) J. Mater. Chem. Vol. 22: p. 16801 describes filling the root apex of a tooth. This paper describes the use of bioactive mesoporous calcium silicate nanoparticles. The nanoparticles used in this study were synthesized by precipitation from solution using a cationic detergent template.

[0011] Kokubo et al. (2003), Biomaterials, Vol. 24, p. 2161, outlines the development of inorganic bioactive materials with improved mechanical properties for use as bone substitutes. Such materials include glass ceramics that can form amorphous calcium silicate intermediates on their surface during apatite deposition in the presence of pseudo-body fluids. Despite the above reports, there remains a need to develop improved compositions, methods, and systems for the delivery of therapeutic agents, specifically for the targeted delivery of therapeutic agents to diseased tissue. [Prior art documents] [Non-patent literature]

[0012] [Non-Patent Document 1] Xue et al. (2009) Acta Biomater. Vol. 5: p. 1686 [Non-Patent Document 2] Salinas et al. (2001) J. Sol-Gel Sci. Techn. 21: 13 [Non-Patent Document 3] Wu et al. (2010) Adv. Mater. 22: 749 [Non-Patent Document 4] Li et al. (2007) J. Biomed. Mater. Res. B. 83B: 431 [Non-Patent Document 5] Wu et al. (2012) J. Mater. Chem. 22: 16801 [Non-Patent Document 6] Kokubo et al. (2003) Biomaterials 24: 2161 [Summary of the Invention] [Means for Solving the Problems]

[0013] Gist of the Invention In one aspect, the present disclosure addresses these and other needs by providing a composition for delivering a therapeutic agent, comprising particles comprising a porous silicon core, a layer on the surface of the core comprising a metal silicate salt, and a therapeutic agent.

[0014] In some embodiments, the layer on the surface of the particles is formed by treating porous silicon precursor particles with an aqueous solution comprising a therapeutic agent and a metal salt, and more specifically, the aqueous solution comprises a metal salt at a concentration of at least 0.1 molar concentration.

[0015] In some embodiments, the layer on the surface of the particles comprises a divalent metal silicate salt such as calcium silicate.

[0016] In some embodiments, the porous silicon core has a diameter of about 1 nm to about 1 cm, and more specifically, the layer on the surface of the porous silicon core may have a thickness between 1 and 90 percent of the diameter of the core.

[0017] In embodiments, the particles are photoluminescent particles that can emit light in the range of 500 nm to 1000 nm.

[0018] In some embodiments, the porous silicon core includes an etched crystalline silicon material, such as an electrochemically etched crystalline silicon material or a chemically stain-etched crystalline silicon material. In some embodiments, the porous silicon core includes an etched microporous silicon material, such as an etched microporous silicon material containing multiple pores with an average pore diameter of up to approximately 1 nm. In other embodiments, the porous silicon core includes an etched mesoporous silicon material, such as an etched mesoporous silicon material containing multiple pores with an average pore diameter of approximately 1 nm to approximately 50 nm. In yet another embodiment, the porous silicon core includes an etched macroporous silicon material, such as an etched macroporous silicon material containing multiple pores with an average pore diameter of approximately 50 nm to approximately 1000 nm.

[0019] In some embodiments, the therapeutic agent is a negatively charged therapeutic agent, such as a low-molecular-weight drug, vitamin, contrast agent, protein, peptide, nucleic acid, oligonucleotide, aptamer, or a mixture thereof. In some embodiments, the porous silicon particles contain a targeting agent, a cell-permeable agent, or both a targeting agent and a cell-permeable agent. In some embodiments, the porous silicon core contains an oxidized porous silicon material.

[0020] In another embodiment, the Disclosure provides a pharmaceutical composition comprising any of the compositions and a pharmaceutically acceptable carrier.

[0021] In yet another aspect, the present disclosure relates to a method for preparing particles for the delivery of a therapeutic agent, Steps to prepare porous silicon precursor particles; The present invention provides a method comprising the step of treating porous silicon precursor particles with an aqueous solution containing a therapeutic agent and a metal salt.

[0022] In yet another embodiment, a method of treatment is provided, which includes administering the composition of the present disclosure to a subject requiring treatment. [Brief explanation of the drawing]

[0023] [Figure 1] Figure 1. Schematic diagram of an exemplary process for the preparation of siRNA-loaded calcium silicate-coated porous silicon nanoparticles (Ca-pSiNP-siRNA).

[0024] [Figure 2] Figures 2A–2E. Transmission electron microscope (TEM) images of pSiNP (Figure 2A), Ca-pSiNP (Figure 2B), and Ca-pSiNP-siRNA (Figure 2C) formulations. Scale bar is 200 nm. Figure 2D shows the cryogenic nitrogen adsorption-desorption isotherm of the pSiNP and Ca-pSiNP formulations. Figure 2E shows the photoluminescence emission spectrum (λex: 365 nm) obtained during the reaction of pSiNP with a 3M or 4M CaCl2 aqueous solution used to prepare the Ca-pSiNP formulation. Typical quantum confinement is indicated by a shift in the emission spectrum to blue as the porous silicon core thins. The growth of the electronically passivated surface layer and the suppression of non-radioactive recombination centers are evident in the strong increase in photoluminescence intensity observed as the reaction proceeds.

[0025] [Figure 3]Figure 3. Silencing of relative PPIB gene expression in Neuro-2a cells after treatment with siRNA against the PPIB gene (siPPIB), amination-laden porous Si nanoparticles (pSiNP) loaded with siPPIB (pSiNP-siPPIB), a pSiNP-siPPIB construct (Ca-pSiNP-siPPIB-DPNC) prepared in a bipeptide nanocomplex with a calcium silicate shell containing both cell-targeting peptides and cell-permeable peptides on the outer shell, a pSiNP-siPPIB-calcium silicate shell construct (Ca-pSiNP-siPPIB-mTP) containing only cell-permeable peptides on the outer shell, a pSiNP-siPPIB-calcium silicate shell construct (Ca-pSiNP-siPPIB-RVG) containing only cell-targeting peptides on the outer shell, and a pSi nanoparticle-calcium silicate shell construct (Ca-pSiNP-siLuc-DPNC) containing a negative control siRNA sequence against luciferase and containing both cell-targeting peptides and cell-permeable peptides on the outer shell. The name "7 days" indicates that the nanoparticle constructs were stored in ethanol at 4°C for 7 days prior to the experiment. The cell-permeable peptide is a myristoylated transporter (transportan), and the cell-targeting peptide is a domain derived from rabies virus glycopeptide (RVG), as described in the text. Statistical analysis was performed using Student's t-test (*p<0.01, **p<0.03).

[0026] [Figure 4]Figures 4A and 4B. Ex vivo fluorescence images of organs collected after intravenous injection of (1) saline as control, (2) Ca-pSiNP-siRNA-PEG, and (3) Ca-pSiNP-siRNA-DPNC. All siRNA constructs contained a covalently bound dy677 fluorophore. Figure 4A: Fluorescence image of damaged brain obtained using the Pearl Trilogy (Li-Cor) infrared imaging system. The green channel in the image corresponds to the 700 nm emission from dy677, integrating the bright-field image of brain tissue with the 700 nm emission. Figure 4B: Fluorescence images of all major organs acquired with the IVIS (Xenogen) imaging system in the Cy5.5 channel (λex / em: 675 / 694 nm).

[0027] [Figure 5] Figures 5A and 5B. Scanning electron microscope images and elemental (EDX) data for pSiNPs (Figure 5A) and Ca-pSiNPs (Figure 5B).

[0028] [Figure 6] Figure 6A. Powder X-ray diffraction spectra of pSiNP (lower dashed line) and Ca-pSiNP (upper solid line), as shown. The peaks in the diffraction pattern of Si nanoparticles are represented by the Miller indices hkl, which indicate the set of crystalline Si lattice planes responsible for those diffraction peaks. Figure 6B. Raman spectra of pSiNP (lower dashed line) and Ca-pSiNP (upper solid line). Figure 6C. Diffuse reflectance FTIR spectra of pSiNP (lower dashed line) and Ca-pSiNP (upper solid line). For clarity, the spectra are offset along the y-axis.

[0029] [Figure 7]Figure 7A. UV-Vis absorbance intensity (λ=405nm) of pSiNPs measured as a function of time in pH 9 buffer (triangles, dashed lines) and pH 9 solution of 3M or 4M in CaCl2 (circles, solid lines). The decrease in absorbance is due to the decomposition of the elemental Si core in the nanoparticles; silicon strongly absorbs light at 405nm, while SiO2 or silicate ions are transparent at this wavelength. Figure 7B. Cumulative percentage by mass of siRNA released as a function of time at 37°C in PBS buffer. pSiNP-NH2-siRNA formulations were prepared by first grafting an amine onto the pore wall of pSiNPs using 2-aminopropyldimethylethoxysilane (APDMES), followed by loading siRNA by 2 hours of solution exposure.

[0030] [Figure 8] Figure 8. Integrated photoluminescence intensity as a function of optical absorption (365 nm), used to calculate the quantum yield of the Ca-pSiNP formulation compared to the rhodamine 6G standard. Integrated photoluminescence represents the photoluminescence intensity-wavelength curve integrated between 500 and 980 nm. Photoluminescence intensity was measured using a QE-Pro (Ocean Optics) spectrometer with excitation λex = 365 nm and a 460 nm long-pass emission filter.

[0031] [Figure 9] Figure 9. Cytotoxicity of Ca-pSiNP constructs quantified by the calcein AM viability / death assay. Neuro2a cells were incubated triply with Ca-pSiNP in a 96-well plate. After 48 hours, each well was treated with the assay solution, and viability was quantified by fluorescence intensity measured relative to a standard.

[0032] [Figure 10]Figure 10. Schematic diagram showing the procedure for PEG modification and conjugation of the bipeptide to Ca-pSiNP-siRNA. The coupling agent 2-aminopropyldimethylethoxysilane (APDMES) was grafted onto the surface of the nanoparticles (calcium silicate and silica) to generate a pendant primary amine group (Ca-pSiNP-siRNA-NH2). A functional polyethylene glycol (PEG) linker was then conjugated to the primary amine on the Ca-pSiNP-siRNA-NH2 nanoparticles using the maleimide-poly(ethylene-glycol)-succinimidyl carboxymethyl ester (MAL-PEG-SCM) species. The succinimidyl carboxymethyl ester forms an amide bond with the primary amine. The distal end of the PEG chain contained a second functional group, maleimide. Maleimide forms a covalent bond with the cysteine ​​thiol, enabling the conjugation of neuron-targeting peptides (rabies virus glycoprotein) and cell-permeable peptides (myristoyl transporters).

[0033] [Figure 11] Figure 11A. Zeta potentials of nanoparticles (pSiNP, Ca-pSiNP, Ca-pSiNP-NH2, Ca-pSiNP-siPPIB, and Ca-pSiNP-siPPIB-NH2, as described in the text) dispersed in ethanol. Figure 11B. Size distribution of pSiNP and Ca-pSiNP-siPPIB-DPNC measured by dynamic light scattering (DLS).

[0034] [Figure 12] Figure 12. ATR-FTIR spectra of nanoparticle formulations (bottom to top): Ca-pSiNP-PEG, Ca-pSiNP-mTP, Ca-pSiNP-RVG, and Ca-pSiNP-DPNC, as well as peptides (mTP and FAM-RVG). Abbreviations for formulations mentioned in the text. For clarity, the spectra are offset along the y-axis.

[0035] [Figure 13]Figures 13A and 13B. Confocal microscopy images of Neuro2a cells treated with (A) Ca-pSiNP-siPPIB-DPNC and (B) Ca-pSiNP-siPPIB-RVG at 37°C for 2 hours. The intrinsic luminescence of silicon nanoparticles (originally red) is observed on the surface of cells treated with Ca-pSiNP-siPPIB-RVG (Figure 13B) and intracellularly in cells treated with Ca-pSiNP-siPPIB-DPNC (Figure 13A). DAPI nuclear staining (originally blue) is observed in the cell nuclei of both images. The signal from the FAM tag on the RVG domain (originally green) is even more dominant on the surface of cells treated with Ca-pSiNP-siPPIB-RVG (Figure 13B), and the overlap of silicon and FAM-RVG signals (originally yellow due to the red and green combination) is even more dominant intracellularly in cells treated with Ca-pSiNP-siPPIB-DPNC (Figure 13A). The scale bar is 20 μm.

[0036] [Figure 14] Figures 14A–14D. FACS analysis of Neuro2a cells treated with no particles (Figure 14A), Ca-pSiNP-siPPIB-RVG (Figure 14B), Ca-pSiNP-siPPIB-DPNC (Figure 14C), and Ca-pSiNP-siPPIB-DPNC loaded with Cy3-tagged siRNA (Figure 14D) as controls. The percentages shown below the plots represent the quantified proportion of cells transfected with FAM-RVG, Cy3-tagged siRNA, or a combination of FAM-RVG and Cy3-tagged siRNA. Statistical analysis was performed using Student's t-test (*p<0.04).

[0037] [Figure 15] Figure 15. Exemplary experimental procedure for targeted delivery of siRNA to injured brain in vivo. Six hours after injury, Ca-pSiNP-siRNA-PEG or Ca-pSiNP-siRNA-DPNC was injected. siRNA in each formulation was labeled with a dy677 fluorescent tag. After 1 hour of circulation, mice were sacrificed, perfused, and their organs were harvested and imaged.

[0038] [Figure 16] Figure 16. X-ray diffraction spectra of newly etched porous silicon microparticles (pSiMPs) sonicated for 24 hours with either 4M calcium chloride, 4M magnesium chloride, or pH 9 buffer.

[0039] [Figure 17] Figures 17A-17C. (A) Loading efficiency of rhodamine B (RhB) and ruthenium bipyridine (Ru(bpy)) using pH 9 buffer, 4M CaCl2, and 4M MgCl2 solutions. (B) Release profiles of rhodamine B and (C) Ru(bpy) from pSiMP after loading into pH 9 buffer, CaCl2, and MgCl2 solutions.

[0040] [Figure 18] Figures 18A-18B. Loading volume, drug release profile, and photoluminescence reduction profile of Ca-pSiNPs loaded with (A) chloramphenicol or (B) vancomycin. [Modes for carrying out the invention]

[0041] Detailed description of the invention composition containing porous silicon particles This disclosure provides, in one embodiment, compositions useful for the delivery of therapeutic agents. Such compositions are particularly useful for treating diseases or other conditions in which controlled release of therapeutic agents is desirable. For example, many diseases or conditions are favorably treated by the stable release of active therapeutic agents over a long period. Such treatment results in a more constant concentration of the therapeutic agent in the system than could be achieved by injection, oral formulation, or other typical delivery systems, thereby minimizing the potential toxic effects caused by the drug while maximizing therapeutic activity. By maintaining steady-state concentrations of the drug within a desired narrow therapeutic concentration range, controlled delivery systems also favorably reduce the frequency of injections required for a given treatment regimen and favorably reduce the waste of expensive therapeutic agents. The compositions are also useful for treating isolated cells or tissues, for example, by increasing intracellular or intra-tissue delivery of the therapeutic agent or improving drug stability over the course of treatment.

[0042] Porous silicon (pSi) typically refers to nanostructured silicon-containing materials formed by etching crystalline silicon wafers or other silicon-containing materials. See, for example, Anglin et al. (2008) Adv. Drug Deliv. Rev. Vol. 60:p. 1266, which is incorporated herein by reference throughout. Thus, as used herein, silicon-containing materials preferably include elemental silicon (including crystalline and polycrystalline silicon), but may also include polysiloxanes, silanes, silicones, siloxanes, or combinations thereof. Porous silicon refers to nanostructured materials arising directly from the etching process, and any derivatives thereof (silicon oxide or covalent bonds arising from further chemical modification of etched porous silicon). It should be considered to encompass both (such as silicon modified by...)

[0043] As mentioned herein, porous silicon is typically prepared by either electrochemical or chemical stain etching of silicon-containing materials. For example, in the case of electrochemical etching, the size and morphology of the pores can be adjusted to a desired extent by controlling the etching process, which involves controlling the current density, the type and concentration of dopants in the silicon wafer, the crystal orientation of the wafer, and the electrolyte concentration. Such adjustments can result in, for example, microporous, mesoporous, or macroporous silicon.

[0044] Porous silicon was originally developed for use in optoelectronic devices after its photoluminescent properties were discovered. Canham (1990) Appl. Phys. Lett. Vol. 57:1 Page 46. However, in recent years, pSi has attracted attention as a carrier for controlled drug release. Salonen et al. (2008) J. Pharm. Sci. Vol. 97: p. 632; Chhablani et al. (2013) Invest. Ophthalmol. Vis. Sci. Vol. 54: p. 1268; Kovalainen et al. (2012) Pharm. Res. Vol. 29: p. 837. Conventional silicon-based compositions, such as mesoporous silica, are obtained by solution-phase reactions, such as sol-gel or precipitation pathways, which offer little control over the microstructure of the resulting product. In contrast, significant control of the pSi microstructure is possible by adjusting the electrochemical etching parameters used in its synthesis. Martinez et al. (2013) Biomaterials Vol. 34: p. 8469; Hou et al. (2014) J. Control. Release Vol. 178: p. 46. Porous silicon oxidized at high temperatures in air. Porous silicon particles containing particles are used to deliver therapeutic agents to the eye. See, for example, PCT International Publications WO2006 / 050221A2 and WO2009 / 009563A2, which are incorporated herein by reference throughout for all purposes. Such particles have been shown to deliver drugs over long periods with low toxicity when injected intravitreously into rabbits.

[0045] Another useful property of pSi is its easily modifiable surface chemistry. For example, using methods such as thermal oxidation and thermal hydrosilylation, drug-based peyro Drug loading and release can be optimized according to the characteristics of the drug. (Salonen et al.) (2008) J. Pharm. Sci. Vol. 97: p. 632; Anglin et al. (2008) Adv. Drug Deliv. Rev. Vol. 60: p. 1266. It has been observed that certain chemistry can slow down the degradation of the pSi matrix or enhance the release of poorly soluble active pharmaceutical ingredients (APIs). Salonen et al. (2005) J. Control. Release Vol. 108: p. 362; Wang et al. (2010) Mol. Pharm. Vol. 7: p. 227. The functionalization of the surface of pSi particles can be controlled by various methods, for example, by separately modifying the walls inside the pores and the pore openings, as described in PCT International Publication WO2014 / 130998A1, which is incorporated herein by reference throughout.

[0046] Porous silicon is known to dissolve slowly in neutral pH aqueous solutions, such as normal bodily fluids, through a combination of oxidation of elemental Si and dissolution of the resulting silicic acid and ultimately orthosilicate. By controlling the rate and extent of this process, for example, by modifying the surface of pSi nanoparticles, the toxicity of the particles can be significantly minimized. For example, it has been shown that pSi nanoparticles injected intravitreously were non-toxic and safely present in the vitreous humor of rabbits for several months before being completely degraded and removed from the eye. Cheng et al. (2008) Br. J. Ophthalmol. 92:705; Nieto et al. (2013) Exp. Eye Res. 116:161. See also U.S. Patent Publication 2010 / 0196435. Teru.

[0047] Therefore, as will be described in more detail below, the particles and films of this disclosure are The specification includes a porous silicon core, which may also be referred to as a porous silicon "skeleton." In some embodiments, the porous silicon core includes an etched crystalline silicon material, more specifically an electrochemically etched crystalline silicon material or a chemically stain-etched crystalline silicon material. In embodiments, the porous silicon core includes an etched microporous silicon material, for example, a material containing multiple pores with an average pore diameter up to about 1 nm. In embodiments, the porous silicon core includes an etched mesoporous silicon material, for example, a material containing multiple pores with an average pore diameter of about 1 nm to about 50 nm. In embodiments, the porous silicon core includes an etched macroporous silicon material, for example, a material containing multiple pores with an average pore diameter of about 50 nm to about 1000 nm, or even larger.

[0048] In some embodiments, the porous silicon core of the particles and film has an open porosity of about 5% to about 95% relative to the total volume of the material. In more specific embodiments, the porous silicon has an open porosity of about 20% to about 80%, or about 40% to about 70%, relative to the total volume of the material. In some embodiments, the average pore diameter of the porous silicon of the composition is about 0.1 nm to about 1000 nm, about 0.1 nm to about 1 nm, about 0.1 nm to about 50 nm, about 1 nm to about 50 nm, about 1 nm to about 1000 nm, or about 50 nm to about 1000 nm. In some embodiments, the average pore diameter is at least about 0.1 nm, at least about 0.5 nm, at least about 1 nm, at least about 50 nm, or even greater. In some embodiments, the average pore diameter is up to about 1000 nm, up to about 100 nm, up to about 50 nm, up to about 1 nm, or even less.

[0049] The porous silicon core of this composition may be in the form of a film or particles. Specifically, the thickness of the particles and film is preferably in the range of about 5 nm to about 1000 microns, about 10 nm to about 100 microns, or about 100 nm to about 30 microns. Thus, the particles and film may have a thickness of at least about 5 nm, at least about 10 nm, at least about 100 nm, or even thicker. Similarly, the particles and film may have a thickness of up to about 1 mm, up to about 100 microns, up to about 30 microns, or even thinner. In embodiments where the porous silicon core is in the form of particles, the average diameter of the porous silicon core is preferably in the range of about 1 nm to about 1 cm, about 3 nm to about 1000 microns, about 10 nm to about 300 microns, about 10 nm to about 100 microns, or about 1 micron to about 50 microns. In some embodiments, the average particle diameter is at least about 1 nm, at least about 3 nm, at least about 10 nm, at least about 100 nm, at least about 1 micron, or greater. In some embodiments, the average particle diameter is up to about 1 cm, up to about 1000 microns, up to about 300 microns, up to about 100 microns, up to about 50 microns, or less.

[0050] In certain embodiments, the porous silicon core of the composition is at least partially oxidized. Oxidizing elemental silicon to silicon dioxide in the porous silicon compositions of the present disclosure may increase the stability of the composition, reduce its toxicity, and / or improve its solubility. Exemplary methods for oxidizing the porous silicon of the composition are given in detail below in the preparation methods. The oxidized porous silicon material obtained by any of those methods, whether fully or partially oxidized, has been found to be useful in the composition. In some cases, it may be desirable to oxidize the porous silicon core by substituting the chloride ions of the metal salts used in the preparation methods below with nitrate ions, nitrite ions, gluconate ions, or other suitable anions. Metal nitrate or metal nitrite salts can oxidize porous silicon more rapidly than metal chlorides due to the oxidizing properties of nitrate and nitrite ions. Fry et al. (2014) (Year) Chem. Mater. Vol. 26: p. 2758.

[0051] The term "porous silicon oxide" includes silicon and oxygen, and its general stoichiometric formula is SiO2. x It should be understood that "porous silicon" refers to a material in which x can range from a minimum of 0.01 to a maximum of 2, and that "porous silicon" refers to a material composed of elemental silicon (either crystalline or amorphous) whose surface contains hydrogen, oxygen, or carbon-containing chemical species. Furthermore, the terms "porous silicon" or "porous silicon oxide" refer to materials containing micropores, mesopores, macropores, or any combination of two or all three pore types. It should also be understood that the surface of a porous material, including the surface of the inner walls of the pores, may contain hydrogen, oxygen, or carbon-containing chemical species.

[0052] Exemplary compositions containing porous silicon and methods for preparing such compositions are described in detail, for example, U.S. Patent Publications 2005 / 0042764; 2005 / 0009374; 2007 / 0148695; 2007 / 0051815; 2009 / 0208556; and 2010 / 0196435, each of which is incorporated herein by reference throughout.

[0053] In some embodiments, the porous silicon core of this disclosure is modified by covalent bonding. In specific embodiments, the covalent modification is located on the surface of the porous silicon core. Examples of porous silicon modified by surface modifications such as alkylation and especially thermal hydrosilylation are given in Cheng et al. (2008) Br. J. Ophthalmol. 92:705 and This is described in PCT International Publication No. WO2014 / 130998A1. Such substances have been found to exhibit good biocompatibility when used as a delivery system for therapeutic agents.

[0054] As described above, porous silicon is known to dissolve slowly in aqueous solutions at a neutral pH. The decomposition mechanism of porous silicon involves the oxidation of the silicon skeleton to form silicon oxide (Equation 1), and the subsequent dissolution of the resulting oxide phase to form water-soluble orthosilicic acid (Si(OH)4) or its analogues (Equation 2). See Sailor, Porous silicon in practice: preparation, characterization and applications. (John Wiley & Sons, 2012). [ka]

[0055] Advantageously, when silicic acid produced by the dissolution of porous silicon or porous silicon oxide is reacted with a high concentration of metal salt, an anion called "silicate ion" is produced, orthosilicate ion (SiO4) as specified herein.4- ), metasilicate ions (SiO3 2- It has been discovered that this results in the formation of insoluble metal salts, including ) or its congeners. While not intended to be theoretical, it is thought that the insoluble silicates act as a protective shell that prevents further dissolution of the porous silicon or porous silicon oxide skeleton. Furthermore, the formation of the insoluble salts acts to block the pore openings of the substance, allowing previously loaded material to become trapped within the pore. See Figure 1 for an example using siRNA therapeutics. It has been previously demonstrated that exposure of porous silicon to a solution containing relatively low concentrations of aqueous calcium and phosphate leads to the formation of a hydroxyapatite surface layer (Li et al. (1998) J. Am. Chem. Soc. 120: 11706), but the formation of insoluble silicates in the presence of high concentrations of metal salts has not been demonstrated, nor have these reactions demonstrated remarkable effectiveness in trapping substantial amounts of payload molecules. From cement chemistry, it has been shown that calcium oxide reacts with silica to form calcium silicate (Minet et al. (2006) J. Mater. Chem. Vol. 16: p. 1379), and that when homogeneous precursors such as silicate aqueous solutions and calcium ion solutions are mixed, precipitates and nanoparticles can be produced (Wu et al. (2012) J. Mater. Chem. Vol. 22: 16801 pages; Wu et al. (2010) Adv. Mater. Vol. 22: p. 749; Li et al. (2007) J. Biomed. Mater. Res. B. Vol. 83B: p. 431; Saravanapavan et al. (2003) J. Noncrystalline Solids Vol. 318: p. 1; Kokubo et al. (2003) Biomaterials While known from Vol. 24:p. 2161 and Salinas et al. (2001) J. Sol-Gel Sci. Techn. Vol. 21:p. 13, it has not been previously demonstrated that an aqueous solution of a metal salt reacted with nanostructured porous silicon can produce a core / shell nanostructure. Furthermore, the core / shell structure of this composition exhibits unique properties distinct from those of materials prepared by the homogeneous pathway described above, and the preparation method described herein advantageously allows for the loading and subsequent slow release of therapeutic agents. Moreover, the core-shell structure exhibits the intensity and duration of photoluminescence from the luminescent silicon domains of the porous silicon. The ability to enhance continuity has been demonstrated (Joo et al. (2014) Adv. Funct. Mater. In Volume 24, page 5688, it is demonstrated that these new shells bring about similar improvements to the intrinsic photoluminescence properties of porous silicon.

[0056] Accordingly, the porous silicon particles and films of this disclosure preferably include a layer on the surface of the porous silicon core, which contains a metal silicate salt. As described above, this layer may also be called a “shell” in some examples. In some embodiments, the metal silicate salt is a divalent, trivalent, or tetravalent metal silicate salt. More specifically, the metal silicate salt is a divalent metal silicate salt. For example, the divalent metal silicate salt may be calcium silicate, magnesium silicate, manganese silicate, copper silicate, zinc silicate, nickel silicate, platinum silicate, or barium silicate. In specific embodiments, the divalent metal silicate salt is calcium silicate or magnesium silicate. Even more specifically, the divalent metal silicate salt is calcium silicate. In other specific embodiments, the metal silicate salt is a trivalent or tetravalent metal silicate salt. Exemplary trivalent or tetravalent metal silicates useful in the porous silicon particles and films of this disclosure include zirconium silicate, titanium silicate, and bismuth silicate. In some embodiments, the layer on the surface of the porous silicon core includes a combination of metal silicate salts, wherein any combination of any of the exemplary metal silicate salts listed above is included.

[0057] Porous silicon or porous silicon oxide nanostructures are readily configured to receive therapeutic agents, diagnostic agents, or other beneficial substances (also called "payloads") (Salonen et al. (2008) J. Pharm. Sci. Vol. 97: p. 632; Anglin et al. (2008) Adv. Drug Deliv. Rev. Vol. 60: p. 1266), either before or after administration. Furthermore, if these payloads are released prematurely, it may be undesirable for the intended purpose. In addition, the degradation of porous silicon or porous silicon oxide under aqueous conditions can hinder sustained drug delivery (Salonen et al. (2008) J. Pharm. Sci. Vol. 97: p. 632; Anglin et al. (2008) Adv. Drug Deliv. Rev. Vol. 60: p. 1266), in vi Imaging in vitro or via vo (Joo et al. (2014) Adv. Funct. Mater.) Volume 24: 5688 pages; Gu et al. (2013) Nat. Commun. Volume 4: 2326 pages; Park et al. (2009) Nat. Mater. Vol. 8: p. 331), and applications with biosensors (Jane et al. (2009) Trends Biotechnol. Vol. 27: p. 230) have caused significant problems. Because this can occur, the inner core of silicon or silicon oxide (porous framework) is more stable than silicon oxide (Joo et al. (2014) Adv. Funct. Mater. Vol. 24: p. 5688) ), Titanium dioxide (Betty et al. (2011) Prog. Photovoltaics Vol. 19: p. 266; Li (2014) Biosens. Bioelectron. Vol. 55: p. 372), carbon (Tsang et al. (20 The synthesis of various "core-shell" structures, surrounded by a shell of a shell of a material (ACS Nano Vol. 6: 10546, 2012) or other kinetically stable material (Buriak (2002) Chem. Rev. Vol. 102: 1271), has been achieved. Under appropriate conditions, the formation of the shell can trap material previously loaded into the pore, resulting in the slow release of the formulation (Fry et al. (2014) Chem. Mater. Vol. 26: 2758). Fusible liposome-coated porous silicon nanoparticles containing a core-shell structure with a cargo molecule physically trapped within a porous silicon-containing core material are described in U.S. Provisional Application No. 62 / 190,705, filed July 9, 2015, and PCT International Publication No. WO2017 / 008059A1, both of which are incorporated herein by reference throughout.

[0058] The presence of metal ions such as calcium ions in this composition may be even more beneficial to the tissue because these ions can sequester any remaining fluoride ions that may be present in the formulation. The porous silicon and porous silicon oxide materials used in this composition are typically prepared by electrochemical etching in a fluoride-containing electrolyte, and this process may leave trace amounts of fluoride in the porous matrix (Ko Ynov et al. (2011) Adv. Eng. Mater. Vol. 13: B225). Fluorides can be highly toxic to tissues (especially sensitive tissues such as the eyes). However, the use of high concentrations of metal ions in core-shell synthesis, with calcium fluoride and other metal fluorides being very poorly soluble products in aqueous solutions, can provide the additional benefit of reacting with the fluoride remaining in the formulation, thereby neutralizing the fluoride and its harmful in vivo effects.

[0059] In some embodiments, the layer on the surface of the porous silicon core has a thickness of between 1 and 90 percent, between 5 and 60 percent, or between 10 and 40 percent of the average diameter or thickness of the core.

[0060] In a preferred embodiment, the metal silicate layer on the surface of the porous silicon core is chemically bonded to the porous silicon core.

[0061] The compositions of this disclosure further include therapeutic agents, preferably contained within etched pores of porous silicon particles or films. It should be understood that the term therapeutic agent should be broadly interpreted to encompass any agent that may have a therapeutic effect on a subject, tissue, or cell requiring treatment. Therapeutic agents include biopolymers such as nucleic acids, carbohydrates, and proteins, as well as lipids, and any other naturally occurring molecules, including primary and secondary metabolites. Therapeutic agents may also include any derivatives or otherwise modified forms of the above molecules that impart therapeutic activity. In fact, therapeutic agents may have partially or entirely non-natural structures. Therapeutic agents may be purified from natural sources, prepared using semi-synthetic methods, or prepared entirely by synthetic methods. Therapeutic agents may be provided in the form of pharmaceutically acceptable salts and may be formulated with pharmaceutically acceptable excipients or other agents that do not have a therapeutic effect. In some circumstances, it may be advantageous to combine one or more therapeutic agents in a single composition of this disclosure, or even in a single porous silicon particle or film.

[0062] The therapeutic agents usefully included in this composition include, but are not limited to, ACE inhibitors, actin inhibitors, analgesics, anesthetics, antihypertensives, antipolymerases, secretion inhibitors, and anti- Biomaterials, anticancer substances, anticholinergics, anticoagulants, anticonvulsants, antidepressants, antiemetics, antifungals, antiglaucoma solutes, antihistamines, antihypertensive agents, anti-inflammatory agents (NSAIDs, etc.), antimetabolites, antimitotics, antioxidants, antiparasitic drugs, antiparkinson's disease drugs, antiproliferative drugs (including antiangiogenic drugs), antiparasitic solutes, antipsychotics, antipyretics, antiseptics, antispasmodics, antivirals, calcium channel blockers, cell response modulators, chelating agents, chemotherapeutic agents, dopamine agonists, extracellular matrix components, fibrinolytic agents, free radical scavengers, hormones, hormone antagonists, hypnotics, immunosuppressants, immunotoxins, surface glycoprotein receptor inhibitors, microtubule inhibitors, miotics, muscle tensors, muscle relaxants, neurotoxins, neurotransmitters, opioids, prostaglandins, remodeling inhibitors, statins, steroids, thrombolytics, tranquilizers, blood vessels This includes dilators and / or vasospasm inhibitors.

[0063] In some embodiments, the therapeutic agent is a nucleic acid or nucleic acid analog, for example, but not limited to, deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), such as small interfering RNA (siRNA), messenger RNA (mRNA), transfer RNA (tRNA), microRNA (miRNA), small transient RNA (stRNA), small hairpin RNA (shRNA), modified mRNA (mmRNA), or an analog or combination thereof. In some embodiments, the therapeutic agent is a nucleic acid analog, for example, but not limited to, antisense nucleic acid, oligonucleotide, peptide nucleic acid (PNA), pseudo-complementary PNA The therapeutic agent is nucleotide PNA (pcPNA), locked nucleic acid (LNA), or a derivative or analog thereof. In a preferred embodiment, the therapeutic agent is siRNA.

[0064] Those skilled in the art will understand that, considering that negatively charged therapeutic agents such as nucleic acid drugs are formulated together with a layer of metal silicate on the surface of the pSi nanoparticles or nanofilm, the delivery of these agents in this composition may be advantageous. While not intended to be theoretical, the metallic component of the composition may neutralize the anionic charge of the nucleic acid therapeutic agent component, thereby improving the loading capacity of the material.

[0065] In some embodiments, the therapeutic agent is a protein or peptide, such as an antibody or protein biologic, a peptidomimetic, an aptamer, or a variant thereof.

[0066] In some embodiments, the therapeutic agent is an antibiotic such as lipopeptides (e.g., daptomycin), glycylcyclines (e.g., tigecycline), oxazolidinones (e.g., linezolid), ripialmycins (e.g., fidaxomicin), penicillins, cephalosporins, polymyxins, rifamycins, quinolones, sulfonamides, macrolides, lincosamides, tetracyclines, or glycopeptides (e.g., vancomycin).

[0067] In some embodiments, the therapeutic agent is a low-molecular-weight hydrophobic therapeutic agent. Many therapeutic agents, specifically hydrophobic therapeutic agents, are delivered more efficiently to biological systems in amorphous form. In fact, formulating hydrophobic therapeutic agents in amorphous form is considered a promising strategy for increasing solubility and thereby increasing bioavailability. However, because the amorphous form of an active drug has high internal energy, pure amorphous drugs usually rapidly recrystallize to a lower-energy crystalline state, which typically has low solubility. Therefore, it is desirable to formulate hydrophobic therapeutic agents so that the amorphous state is stabilized.

[0068] While not intended to be theoretically bound, it is believed that these porous silicon particles and films, specifically the pore surfaces of porous silicon materials with modified pore surfaces, can stabilize the amorphous form of therapeutic agents through strong molecular interactions between the drug and the pore surface. These interactions may prevent drug recrystallization, thereby enabling efficient drug release and potentially increasing bioavailability.

[0069] Therefore, examples of small molecule therapeutic agents that can be usefully incorporated into these particles and films include hydrophobic therapeutic agents. In specific embodiments, the hydrophobic agent is rapamycin, paclitaxel, daunorubicin, doxorubicin, or an analog of any of these agents. In preferred embodiments, the agent is rapamycin (also known as sirolimus) or a rapamycin analog. Non-limiting examples of rapamycin analogs include, for example, everolimus, zotarolimus, biolimus A9, temsirolimus, myolimus, novolimus, tacrolimus, or pimecrolimus.

[0070] Covalently modified forms of rapamycin may be usefully included in this composition, without limitation. For example, U.S. Patents 4,316,885 and 5,118,678 report on carbamates of rapamycin. U.S. Patent 4,650,803 reports on water-soluble prodrugs of rapamycin. U.S. Patent 5,100,883 reports on fluorinated esters of rapamycin. U.S. Patent 5,118,677 reports on amide esters of rapamycin. U.S. Patent 5,130,307 reports on amino esters of rapamycin. U.S. Patent No. 5,346,893 reports on rapamycin sulfonates and sulfamates. U.S. Patent No. 5,194,447 reports on rapamycin sulfonylcarbamate. U.S. Patent No. 5,446,048 reports on rapamycin oxime. U.S. Patent No. 6,680,330 reports on rapamycin dialdehyde. U.S. Patent No. 6,677,357 reports on rapamycin 29-enol. U.S. Patent No. 6,440,990 reports on O-alkylated rapamycin derivatives. U.S. Patent No. 5,955,457 reports on water-soluble rapamycin esters. U.S. Patent No. 5,922,730 reports on alkylated rapamycin derivatives. U.S. Patent No. 5,637,590 reports on rapamycin amidinocarbamate. U.S. Patent No. 5,504,091 reports on rapamycin biotin ester. U.S. Patent No. 5,567,709 reports on rapamycin carbamate. U.S. Patent No. 5,362,718 reports on rapamycin hydroxy ester. These rapamycin derivatives, and others, may be included in this composition.

[0071] The amount of therapeutic agent incorporated into the composition of this disclosure is determined by the desired release profile, the therapeutic agent concentration required for the biological effect, and the length of time the therapeutic agent should be released for treatment. Except for the permissible amount of solution or dispersion viscosity for injection via a syringe needle or other suitable delivery device, there is no upper limit to the amount of therapeutic agent incorporated into the composition. The lower limit of the therapeutic agent incorporated into the composition is determined by the activity of the therapeutic agent and the length of time required for treatment. Specifically, in one embodiment of this disclosure, the composition is formulated to result in a one-month release of the therapeutic agent. In such an embodiment, the therapeutic agent is preferably present in about 0.1 wt% to about 50 wt%, preferably about 2 wt% to about 25 wt%, of the composition. Alternatively, in another embodiment of this disclosure, the composition is formulated to result in a three-month delivery of the therapeutic agent. In such an embodiment, the therapeutic agent is preferably present in about 0.1 wt% to about 50 wt%, preferably about 2 wt% to about 25 wt%, of the composition. Alternatively, in another embodiment of this disclosure, the composition is formulated to result in a six-month delivery of the therapeutic agent. In such embodiments, the therapeutic agent is preferably present in an amount of about 0.1 wt% to about 50 wt%, preferably about 2 wt% to about 25 wt%, of the composition. The composition releases the therapeutic agent contained therein at a controlled rate until the composition is completely dissolved.

[0072] In some embodiments, the therapeutic agent is not covalently bonded to the particles or film containing the porous silicon core. In some embodiments, the therapeutic agent is contained within the pores of the porous silicon core.

[0073] In certain embodiments, the composition for delivering the therapeutic agent of the Disclosure further comprises a targeting agent and / or a cell-permeable agent. In these embodiments, the particles of the composition are preferably sized to transport the therapeutic agent from the administration site to the site where the therapeutic effect is desired.

[0074] Therefore, targeting agents suitable for use in this disclosure include agents that can target particles of the composition to specific tissues within the subject being treated. Specifically, the targeting agent may include, for example, peptides or other portions that bind to cell surface components such as receptors or other surface proteins or lipids found on the targeted cells. Examples of suitable targeting agents are short-chain peptides, protein fragments, and complete proteins. Ideally, the targeting agent should not interfere with the uptake of particles by the targeted cells. In some embodiments, the targeting agent may contain 100 or fewer amino acids, for example, 50 or fewer amino acids, 30 or fewer amino acids, or further 10, 5, or 3 or fewer amino acids.

[0075] The targeting agent may be selected to target particles to a specific cell or tissue type, for example, particles can target muscle, brain, liver, pancreas, or lung tissue, or macrophages or monocytes. Alternatively, the targeting agent may be selected to target particles to specific cells within diseased tissue, such as tumor cells, diseased coronary artery cells, brain cells affected by Alzheimer's disease, bacterial cells, or viral particles. In preferred embodiments of this disclosure, the targeting agent is selective to neuronal tissue, such as brain tissue.

[0076] Specific examples of targeted drugs include muscle-specific peptides discovered through phage display that targets skeletal muscle (Flint et al. (2005) Laryngoscope 11 These include a 29-residue fragment of the rabies virus glycoprotein that binds to the acetylcholine receptor (Lentz (1990) J. Mol. Recognit. Vol. 3: p. 82), a fragment of a neurotrophic factor that targets that receptor to target neurons, and a secretin peptide that binds to the secretin receptor and can be used to target, for example, the bile duct and pancreatic epithelium in cystic fibrosis (Zeng et al. (2004) J. Gene Med. Vol. 6: p. 1247 and McKay et al. (2002) Mol. Ther. Vol. 5: p. 447). Alternatively, immunoglobulins and their variants, including scFv antibody fragments, can also be used as targeting agents that bind to specific antigens such as VEGFR or other surface proteins on the surface of the cells or tissues being targeted. Yet another alternative is that receptor ligands can be used as targeting agents that target particles to the surface of cells or tissues expressing the receptor being targeted. In certain embodiments, the targeting agent of the composition is a neuronal targeting agent, such as a peptide sequence derived from rabies virus glycoprotein (RVG).

[0077] The cell-permeable agents of this disclosure are also known as internal distribution agents or cell membrane distribution agents. In specific embodiments, the cell-permeable agents are cell-permeable peptides or proteins. These agents include a well-known class of relatively short-chain peptides (e.g., 5–30 residues, 7–20 residues (reside), or even 9–15 residues) that enable certain cell or viral proteins to cross the membrane, but other classes are also known. See, for example, Milletti (2012) Drug Discov. Today vol. 17: pp. 850. Exemplary peptides in the original class of cell-permeable peptides typically have a cationic charge due to the presence of relatively high levels of arginine and / or lysine residues, which are thought to facilitate the peptide's passage across the cell membrane. In some cases, the peptides have 5, 6, 7, 8, or more arginine and / or lysine residues. Exemplary cell-permeable peptides include penetratin or Antennapedia PTD and its variants, TAT, SynB1, SynB3, PTD-4, PTD-5, FHB Coat-(35-49), BMV Gag-(7-25), HTLV-II Rex-(4-16), D-Tat, R9-Tat, Transportan, MAP, SBP, F This includes various periodic sequences, including BP, MPG and their variants, Pep-1, Pep-2, and polyarginine, polylysine, and their variants. For further examples of cell-permeable peptides useful in this composition, see http: / / crdd.osdd.net / raghava / cppsite / index.html and http: / / cell-pen See etrating-peptides.org.

[0078] Several proteins, lectins, and other large molecules, such as plant and bacterial protein toxins including lysine, abrin, modeccin, diphtheria toxin, cholera toxin, anthrax toxin, thermolabic toxins, Pseudomonas aeruginosa exotoxin A (ETA), or fragments thereof, also exhibit cell-permeable properties and can be considered cell-permeable agents for the purposes of this disclosure. Other exemplary cell-permeable agents are all incorporated herein by reference throughout, Temsamani et al. (2004) Drug Disco. v. Today, Vol. 9: p. 1012; De Coupade et al. (2005) Biochem J. Vol. 390: Page 407; Saeaelik et al. (2004) Bioconjug. Chem. Vol. 15: Page 1246; Zhao et al. (2004) Med. Res. Rev. Vol. 24: p. 1; and Deshayes et al. (2005) Cell. Mol. Life Sci. Vol. 62: p. 1839.

[0079] In some embodiments, cell-permeable agents, such as cell-permeable peptides, may be derivatized, for example by acetylation, phosphorylation, lipidation, pegylation, and / or glycosylation, to improve the binding affinity of the agent, to improve the ability of the agent to be transported across the cell membrane, or to improve stability. In specific embodiments, cell-permeable agents are lipidized, for example by myristoylation, palmitoylation, or the attachment of other fatty acids having a chain length of 10 to 20 carbon atoms, preferably lauric acid and stearic acid, as well as by geranylation, geranylgeranylation, and other types of isoprenylation. In more specific embodiments, cell-permeable agents are myristoylated.

[0080] In specific embodiments, the cell-permeable agent is a transportan, and more specifically, a lipid-modified transportan. In even more specific embodiments, the cell-permeable agent is a myristoylated transportan.

[0081] In some embodiments, the compositions of this disclosure include both a targeting agent and a cell-permeable agent, while in other embodiments, they include either a targeting agent or a cell-permeable agent. For example, when the composition is used to treat an animal subject, such as a human subject, specifically when the treatment is a systemic treatment, it may be advantageous for the composition to include both a targeting agent and a cell-permeable agent. When the administration is made directly to a specific tissue of the animal subject, the composition may not need to include a targeting agent. When the composition is used for other purposes, such as targeting an extracellular target, the composition may not need to include a cell-permeable agent. In some cases, for example when the composition is administered directly to isolated cells or tissue, the composition may not need to include either a targeting agent or a cell-permeable agent, as those skilled in the art will understand.

[0082] An exemplary composition comprising porous silicon particles as described herein is incorporated herein by reference throughout Kang et al. (2016), Adv. Mater. 28:7962. Method for preparing porous silicon particles containing a metal silicate layer

[0083] In another embodiment, the Disclosure provides a method for preparing the porous silicon particles and films described above. Specifically, the Disclosure provides a method for loading and protecting one or more therapeutic agents in the pores and / or surface layers of such materials. In some embodiments, the method includes the steps of preparing porous silicon precursor particles or films, and treating the porous silicon precursor particles or films with an aqueous solution containing a therapeutic agent and a metal salt. In preferred embodiments, the method is applied to the treatment of porous silicon precursor particles.

[0084] The terms “precursor particles” or “precursor film” are used herein solely to distinguish the particles and films used in the preparation methods from the products produced by those methods.

[0085] In specific embodiments, the porous silicon precursor material used in this preparation method has the chemical and structural properties of the particles and film described above. For example, the porous silicon precursor material may have a thickness in the range of about 5 nm to about 1000 microns, about 10 nm to about 100 microns, or about 100 nm to about 30 microns. In embodiments where the quality is in the form of particles, the particles may have an average size in the range of approximately 1 nm to approximately 1 cm, approximately 3 nm to approximately 1000 microns, approximately 10 nm to approximately 300 microns, approximately 10 nm to approximately 100 microns, or approximately 1 micron to approximately 50 microns.

[0086] This porous silicon composition can be prepared from porous silicon precursor films and precursor particles by known methods. Generally, for example, Sailor, Porous silicon In practice: preparation, characterization and applications (John Wiley & Sons, 2012) and Qin et al. (2014) Part. Part. Syst. Char. 3 See Volume 1, page 252. Specifically, a silicon wafer may be electrochemically etched using, for example, a 3:1 48%-HF:EtOH solution at a current density appropriate to obtain a specified particle size, porosity, and pore size. The etched porous silicon layer can be removed from the wafer by applying low current density pulses, for example, in a thin aqueous HF solution. In the preparation of pSi nanoparticles (pSiNPs), perforation along the etched surface can be introduced by short, periodic high current pulses (e.g., 370 mA / cm², 0.4 sec) between long periods of low current etching (e.g., 40 mA / cm², 1.8 sec), thereby generating layers with alternating high and low porosity (Qin et al.). (2014) Part. Part. Syst. Char. Vol. 31: p. 252). The porous silicon layer can be removed from the wafer to form a film, and the independent film can be broken up, for example, by sonication overnight to generate monodisperse pSi nanoparticles. In the preparation of pSi nanoparticles (pSiMPs), for example, 20-100 mA / cm² 2 Etching currents in the range can be applied, for example, for periods of 4 seconds and 2.7 seconds per cycle, to form a composite sinusoidal structure with stopbands of approximately 450 and 560 nm. The independent films can be fractured by sonication for 5-7 minutes to produce pSi nanoparticles of the desired size (e.g., 20 × 60 × 60 μm).

[0087] It should be apparent to those skilled in the art that electrochemically etched porous silicon materials can be produced using other current-time waveforms. For example, a single constant current for a given period, or a sinusoidal current-time waveform, can be used in such a method. Alternatively, chemical stain etching can be used as an alternative to the electrochemical etching described above to produce porous silicon cores. See Sailor, *Porous silicon in practice: preparation, characterization and applications* (John Wiley & Sons, 2012). Yet another alternative is to use nanostructured silicon oxide. Porous silicon cores can be produced by chemical reduction. Batchelor et al. (2 See Silicon Vol. 4, p. 259 (2012). In stain etching, typically This method uses silicon powder instead of silicon wafers as the silicon precursor, and a chemical oxidizer instead of power to drive the electrochemical reaction.

[0088] In some embodiments, the porous silicon precursor material may be oxidized or partially oxidized. In specific embodiments, the porous silicon precursor material may be thermally oxidized at, for example, temperatures of at least 150°C, at least 200°C, at least 300°C, at least 400°C, at least 500°C, at least 600°C, at least 700°C, at least 800°C, or higher. In some embodiments, the porous silicon precursor material may be oxidized at temperatures of about 300°C to about 1000°C, about 400°C to about 800°C, or about 500°C to about 700°C. In preferred embodiments, thermal oxidation is carried out in air.

[0089] In certain embodiments, the porous silicon precursor material of this method may be oxidized in solution, for example, by suspending the porous silicon material in a solution containing an oxidizing agent. For example, the solution used to oxidize the porous silicon material may be water, borate, tris(hydroxymethyl)aminomethane, dimethyl sulfoxide, nitrate, or any of the above. It may also contain other suitable oxidizing agents or combinations of drugs.

[0090] As previously described, the solutions used to prepare the compositions typically contain metal salts. In specific embodiments, the solutions contain a metal salt at a concentration of at least 0.1 molar, 0.3 molar, 0.5 molar, 1 molar, 2 molar, 3 molar, or higher molar concentrations. In some specific embodiments, the metal salt is a divalent, trivalent, or tetravalent metal salt. More specifically, the metal salt is a divalent metal salt. For example, the divalent metal salt may be a calcium salt, magnesium salt, manganese salt, copper salt, zinc salt, nickel salt, platinum salt, or barium salt. In specific embodiments, the divalent metal salt is a calcium salt or a magnesium salt. Even more specifically, the divalent metal salt is a calcium salt. In other specific embodiments, the metal salt is a trivalent or tetravalent metal salt. Exemplary trivalent or tetravalent metal salts useful in the preparation methods of this disclosure include zirconium salts, titanium salts, and bismuth salts. In some embodiments, the preparation method utilizes a combination of metal salts, comprising any combination of any of the exemplary metal salts listed above. In some embodiments, the step of treating porous silicon precursor particles or film with an aqueous solution containing the therapeutic agent and metal salts is carried out in a single step.

[0091] In some embodiments, the therapeutic agent used to treat porous silicon particles or films is one of the therapeutic agents described in detail above. For example, the agent may be a small molecule drug, a vitamin, a contrast agent, a protein, a peptide, a nucleic acid, an oligonucleotide, an aptamer, or a mixture thereof. More specifically, the therapeutic agent may be an oligonucleotide such as DNA, RNA, siRNA, or microRNA. In embodiments where the therapeutic agent is an oligonucleotide, the therapeutic agent may preferably be a ribonucleotide, or even more preferably siRNA.

[0092] The preparation method may further include the step of conjugating porous silicon precursor particles or a film with a targeting agent. More specifically, the targeting agent may be a neuronal targeting agent or one of the specific targeting agents described above. Alternatively, the preparation method may further include the step of conjugating porous silicon precursor particles with a cell permeability agent, more specifically, a lipidized peptide or one of the specific cell permeability agents described above. In specific embodiments, the preparation method may further include the step of conjugating porous silicon precursor particles with a targeting agent and a cell permeability agent. Exemplary targeting agents and cell permeability agents are described in detail above. Pharmaceutical composition

[0093] In another embodiment, the Disclosure provides a pharmaceutical composition comprising a particle- or film-containing composition of the Disclosure and a pharmaceutically acceptable carrier. The pharmaceutical composition may be in unit dosage forms such as tablets, capsules, sprinkle capsules, granules, powders, syrups, suppositories, or injections. The composition may be present in a transdermal delivery system, such as a skin patch.

[0094] The term "pharmaceutically acceptable" is used herein to mean these compounds, substances, compositions, and / or dosage forms that, within the bounds of appropriate medical judgment, are suitable for use in contact with the tissues of animal subjects, including human subjects, without excessive toxicity, irritation, allergic response, or other problems or complications, and that meet a reasonable benefit-to-risk ratio.

[0095] The term "pharmaceutically acceptable carrier," as used herein, means a carrier that transports or delivers the particle-containing composition from one organ or body part to another organ or body part. This refers to pharmaceutically acceptable substances, compositions, or media, such as liquid or solid fillers, diluents, excipients, solvents, or encapsulants, that are involved. Each carrier must be “acceptable” in the sense that it is compatible with the other components of the formulation and is not harmful to the patient, as understood by those skilled in the art. Some examples of substances that can function as pharmaceutically acceptable carriers include: (1) sugars such as lactose, glucose, and sucrose; (2) starches such as corn starch and potato starch; (3) cellulose, and its derivatives such as sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; (4) tragacanth powder; (5) malt; (6) gelatin; (7) talc; (8) excipients such as cocoa butter and suppository waxes; (9) peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and dyes. (10) Oils such as vinegar oil; glycols such as propylene glycol; (11) Polyols such as glycerin, sorbitol, mannitol, and polyethylene glycol; (12) Esters such as ethyl oleate and ethyl laurate; (13) Agar; (14) Buffers such as magnesium hydroxide and aluminum hydroxide; (15) Alginic acid; (16) Water free of pyrogens; (17) Isotonic saline; (18) Ringer's solution; (19) Ethyl alcohol; (20) Phosphate buffer solution; and (21) Other non-toxic suitable substances used in pharmaceutical formulations. Remington: The Science and See Practice of Pharmacy, 20th edition (edited by Alfonso R. Gennaro), 2000. When the therapeutic agent of this composition is nucleic acid, specifically ribonucleic acid, the pharmaceutically acceptable carrier is preferably substantially free of nucleases such as ribonucleases.

[0096] Pharmaceutical compositions comprising the particle-containing compositions of this disclosure may be administered to a subject by any of several routes of administration, including, for example, oral (e.g., aqueous or non-aqueous or suspension of the drug, tablets, boluses, powders, granules, or pastes applied to the tongue); sublingual; transanal, transrectal, or transvaginal (e.g., as pessaries, creams, or foams); parenteral (including intramuscular, intravenous, subcutaneous, or intrathecal, e.g., as sterile solutions or suspensions); nasal; intraperitoneal; subcutaneous; transdermal (e.g., as patches applied to the skin); or topical (e.g., as creams, ointments, or sprays applied to the skin). The compositions may be formulated for inhalation. In certain embodiments, the particle-containing compositions of this disclosure may simply be dissolved or suspended in sterile water. Details of suitable administration routes and compositions can be found, for example, in U.S. Patent Nos. 6,110,973; 5,763,493; 5,731,000; 5,541,231; 5,427,798; 5,358,970; and 4,172,896, as well as the patents cited herein.

[0097] When used herein, the terms "parenteral administration" and "administered parenterally" mean, but are not limited to, methods of administration other than enteral and topical administration, usually by injection, including intravenous, intramuscular, intraarterial, intrathecal, intracapsular, orbital, cardiac, intradermal, and peritoneal administration. This includes internal, transtracheal, subcutaneous, subepidermal, intra-articular, subcapsular, subarachnoid, intraspinal, and intrasternal injections and infusions. Treatment method

[0098] The composition has proven particularly useful in a method by which the delivery of therapeutic agents is brought about under controlled and beneficial conditions. For example, as described above with respect to the pharmaceutical composition, the method may be useful in the delivery of therapeutic agents orally, sublingually, transanally, transrectally, transvaginally, parenterally, transnasally, intraperitoneally, subcutaneously, percutaneously, or topically by inhalation or any other suitable mode of administration, as will be understood by those skilled in the art. In a preferred embodiment, the treatment method targets the therapeutic agent to neuronal tissue, specifically the brain.

[0099] As described above, the compositions of this disclosure may be luminescent, and this property means that these Monitoring of subjects administered with the composition can be facilitated. Therefore, in some embodiments, the treatment method further includes a step of monitoring the subject or tissue isolated from the subject. Given the photoluminescent properties of some of the compositions of this disclosure, in certain embodiments, the monitoring step is an optical monitoring step.

[0100] It will be readily apparent to those skilled in the art that other appropriate modifications and alterations can be made to the compositions, methods, and applications described herein without departing from the scope of the present invention or any of its embodiments. While the present invention has been described in detail above, it will be more clearly understood by referring to the following examples, which are included herein for illustrative purposes only and are not intended to limit the invention. [Examples]

[0101] Self-encapsulated porous silicon-calcium silicate core-shell nanoparticles for targeted siRNA delivery to damaged brains We present a one-step procedure for simultaneously loading and protecting high concentrations of siRNA in porous silicon nanoparticles (pSiNPs). Treatment of pSiNPs with an aqueous solution containing siRNA and calcium chloride generates a core-shell nanostructure consisting of siRNA-loaded pSiNP cores (Ca-pSiNPs) permeated with a calcium silicate surface layer. The source of silicate in this shell lies in the local dissolution of the pSi matrix. While we do not intend to be bound by theory, it is understood that in solutions containing high concentrations of calcium(II) ions, the formation of Ca2SiO4 occurs mainly on the nanoparticle surface and is self-limiting. Therefore, it is understood that the insoluble calcium silicate shell slows the degradation of the pSiNP core, extends the delivery of the siRNA payload, and results in more effective gene knockdown in vitro and in vivo. Perhaps due to the electronic passivation properties of the silicate shell, the formation of the calcium silicate shell increases the external quantum yield of photoluminescence from the porous silicon core from 0.1 to 21%. The binding of two functional peptides—one derived from rabies virus glycoprotein (RVG) as a neuron-targeting peptide and the other from myristoylated transportan (mTP) as a cell-penetrating portion—to Ca-pSiNPs produces constructs that demonstrate improved gene silencing in vitro and improved delivery in vivo.

[0102] A significant limitation in the efficacy of small molecule, protein, and nucleic acid-based therapeutics is bioavailability. Molecules with low solubility may not enter the bloodstream or other body fluids at therapeutically effective concentrations (Muller et al. (2001) Adv. Drug Deliver. Rev. 47:3; Kataoka et al. (2012) Pharm. Res. -Dordr. 29:1485; Kipp (2004) Int. J. Pharm. 284:109), while more soluble therapeutics may be rapidly cleared from the circulatory system by various biological processes before reaching the intended tissue (Chonn et al. (1992) J. Biol. Chem. 267:18759). Pirollo et al. (2008) Trends Biotechnol. Vol. 26: p. 552; Gabizon et al. (198 (8 years) P. Natl Acad. Sci. USA Vol. 85: p. 6949). Loading therapeutic agents into porous or hollow nanostructures is emerging as a means of controlling the concentration-time relationship of drug delivery and thereby improving therapeutic efficacy. Lou et al. (2008) Adv. Mater. Vol. 20 :3987 pages; Anglin et al. (2008) Adv. Drug Deliver. Rev. 60:1266 pages. Much research on nanostructured supports for drugs has focused on "soft" particles, e.g., liposomes and polymer conjugates (Gu et al. (2011) Chem. Soc. Rev. 40:3638). Page; Nishiyama et al. (2006) Pharmacol. Therapeut. Vol. 112: p. 630), or More rigid porous inorganic materials, such as mesoporous silicon or silicon oxide (Park et al. (2009) Nat. Mater. Vol. 8: p. 331; Wu et al. (2008) ACS Nano Vol. 2: Page 2401; Godin et al. (2010) J. Biomed. Mater. Res. A 94a:123 Based on page 6). Mesoporous silicon and silicon oxides are well-studied inorganic and biodegradable materials for drug delivery applications. Anglin et al. (2008) Adv. Drug. Deliver. Rev. 60: 1266; Meng et al. (2010) J. Am. Chem. Soc. Vol. 132: 12690 pages; Meng et al. (2010) ACS Nano Vol. 4: 4539 pages; Patel et al. (2008) J. Am. Chem. Soc. Vol. 130: 2382 pages; Lu et al. (2007) Small Vol. 3: 1341 pages; Shabir et al. (2011) Silicon-Neth Vol. 3: 173 pages; Wang et al. (2010) Mol. Pharmaceut Vol. 7: 2232 pages; Kashanian et al. (2010) Acta Biomater Vol. 6: 3566 pages; Canham et al., U.S. Patent Publication No. 2015 / 0352211; Jiang et al. (2009) Phys. Status Solidi. A Vol. 206: 1361 pages; Fan et al. (2009) Phys. Status Solidi. A Volume 206: Page 1322; Salonen et al. (2008) J. Pharm. Sci. US Vol. 97: p. 632; Sailor et al. (2012) Adv. Mater. Vol. 24: p. 3779; Ruoslahti et al. (2010) J. Cell. Biol. Vol. 188: p. 759.

[0103] The mechanism of degradation of porous silicon (pSi) is understood to involve the oxidation of the silicon core to form silicon oxide, followed by the hydrolysis of the resulting oxide phase into water-soluble orthosilicic acid (Si(OH)4) or its congeners. Sailor et al. (2012) Adv. Mater. 24: 3779. To prevent the rapid degradation of pSi nanoparticles, the internal core of pSi is made of more stable silicon oxide (Joo et al. (2014) Adv. Funct. Mater. 24; 5688). ;Ray et al. (2009) J. Appl. Phys. Vol. 105: pp. 074301), titanium dioxide (Betty et al. (2011) Prog. Photovoltaics Vol. 19: p. 266; Li et al. (2014) Biosens. Bioelectron. Vol. 55: p. 372; Jeong et al. (2014) ACS Nano Vol. 8: p. 2977), carbon (Tsang et al. (2012) ACS Nano Vol. 6: p. 10546; Zhou et al. (2000) Chem. Phys. Lett. Vol. 332: p. 215; Gao et al. (2009) Phys. Chem. Chem. Phys. Vol. 11: p. 11101) or other kinetically stable substances (Buriak (2002) Chem. Surrounded by layers or shells (Rev. 102, p. 1271) Various "core-shell" type structures have been synthesized. Core-shell structures are an attractive platform for slow release of drug delivery formulations because the shell can be synthesized in conjunction with drug loading to more effectively trap therapeutic agents within the nanostructure. Fry et al. (2014) Chem. Mater. 26: 2758. Furthermore, the ability of core-shell structures to improve the intensity and persistence of photoluminescence from the luminescent silicon domain of pSi has been demonstrated (Joo et al. (2014) Adv. Funct. Mater. 24: 5688), thereby enabling the imaging of drug delivery features in nanomaterials. And self-reporting is added.

[0104] Disclosed in this embodiment is a one-step procedure for simultaneously loading and protecting high concentrations of siRNA in pSi nanoparticles (pSiNPs) by precipitation of a calcium silicate shell at the same time as drug loading. Without limiting the invention, it is understood that the source of silicate in the shell originates from the local dissolution of the pSi matrix, and in solutions containing high concentrations of calcium(II) ions, the formation of Ca2SiO4 has been found to occur primarily on the surface of the nanoparticles and to be self-limiting. If the calcium ion solution also contains siRNA, the oligonucleotide becomes trapped within the porous nanostructure during shell formation. Again, without limiting the invention, it is understood that the insoluble calcium silicate shell delays the degradation of the porous silicon core and the release of siRNA. The porous Si core exhibits intrinsic photoluminescence due to quantum confinement effects, and the shell formation process has been found to result in an increase in external quantum yield from 0.1 to 21%, likely due to the electronic passivation properties of the silicate shell. To demonstrate the potential of this system for gene delivery, calcium silicate-coated pSiNPs (Ca-pSiNPs) were modified by silanol chemistry to conjugate two functional peptides: one for neuronal targeting and the other for cell permeability. The resulting constructs showed significantly improved genetic delivery in vitro. It exhibits silencing efficacy and can be delivered to target tissue in vivo.

[0105] As illustrated in Figure 1, a thin oxide layer is formed on the Si core by the gentle oxidation of porous Si particles (in an aqueous medium). Once formed, the oxide layer is hydrated and solubilized, releasing Si(OH)4 into the solution. 2+ And siRNA diffuses into the pore, Ca 2+ The ions react locally with high concentrations of Si(OH)4 to form a precipitate that traps the siRNA payload within the nanostructure.

[0106] pSiNPs with an average size of 180 ± 20 nm (by dynamic light scattering) were prepared as described previously. Qin et al. (2014) Part. Part. Syst. Char. 31:252. Ori The siRNA payload was loaded and encapsulated into the porous nanostructure in one step by stirring in an aqueous solution containing oligonucleotides and high concentrations (3 M or 4 M) of CaCl2. The presence of silicon, calcium, and oxygen in the resulting siRNA-loaded calcium silicate-capped pSiNPs (Ca-pSiNP-siRNA) was confirmed by energy-dispersive X-ray (EDX) analysis (Figs. 5A and 5B). No residual chloride was detected. The amount of oxygen in the pSiNPs increased measurably upon reaction with the Ca 2+ solution, demonstrating that the pSiNPs were oxidized during the reaction.

[0107] Empty pSiNPs before calcium ion treatment, Ca 2+ pSiNPs (Ca-pSiNP) after treatment with, and siRNA loading and Ca 2+ pSiNPs (Ca-pSiNP-siRNA) after treatment with (Figs. 2A - 2C) by transmission electron microscopy (TEM) showed that the reaction with Ca 2+ generated a characteristic coating. Based on elemental analysis and considering the low solubility of calcium silicate (Medinagonzales et al. (1988) Fert. Res. 16:3), although not bound by theory, the capping material is proposed to be a mixed phase of calcium disilicate (Ca2SiO4) or calcium orthosilicate, metasilicate, and silicon oxide. No crystalline calcium silicate phase or silicon oxide phase was observed by powder X-ray diffraction (XRD), but residual crystalline Si was observed in the XRD spectrum (Fig. 6A), Raman spectrum (characteristic Si - Si lattice mode at 520 cm -1 ), Fig. 6B) and FTIR spectrum (Fig. 6C). Nitrogen adsorption - desorption isotherm analysis showed that upon conversion of pSiNPs to Ca-pSiNP, the total pore volume decreased by 80% (1.36 ± 0.03 cm 3From / g to 0.29±0.04cm 3 The study showed a decrease in ( / g) (Figure 2D). Previous studies have shown that when oxygen is incorporated into the silicon core, oxidation of pSi can lead to a decrease in pore volume due to swelling of the pore wall, and this process can result in effective trapping of the payload within the pore. Sailor et al. (2012) Adv. Mater. 24:3779; Fry et al. (2014) Chem. Mater. 26:2758.

[0108] Optical absorption measurements, used to determine the amount of elemental silicon in solution, showed that in the absence of calcium ions, approximately 40% of pSiNPs degraded within 80 minutes in pH 9 buffer. However, in 3M or 4M CaCl2 solutions (even at pH 9), only about 10% degradation was observed over the same period (Figure 7A). The calcium silicate shell also prevented the release of the siRNA cargo; the Ca-pSiNP-siRNA formulation showed approximately five times slower release under physiological conditions (pH 7.4 buffer, 37°C) compared to a formulation in which the siRNA was held in the pSiNP by electrostatic means (pSiNP modified with surface amine groups, pSiNP-NH2, Figure 7B). Thus, the trapping reaction effectively encapsulated the siRNA payload and protected the pSi core from subsequent oxidation and hydrolysis in aqueous media.

[0109] Photoluminescence spectra obtained at various time points during the reaction between pSiNP and CaCl2 solution showed a gradual increase in intensity (Figure 2E). Furthermore, photoluminescence The peak wavelength of sense blue shifted as the reaction progressed. Both of these phenomena (increase in photoluminescence intensity and blue shift in the photoluminescence spectrum) indicate the growth of a passivated surface layer on silicon nanocrystals. Joo et al. (2014) Adv. Funct. Mater. Vol. 24: 5688; Petrovakoch et al. (1992) Appl. Phys. Lett. Volume 61: Page 943; Sa'ar (2009) J. Nanophotonics Volume 3: Pages 032501. The observed blue shift is typical of quantum-confined silicon nanoparticles, and their emission wavelength is strongly size-dependent, exhibiting a blue shift as the quantum-confined silicon domain decreases. Joo et al. (2015) ACS Nano 9: 6233. The photoluminescence emission quantum yield (external) of pSiNP-calcium silicate core-shell structure (Ca-pSiNP) was 21% (λ ex =365nm, Figure 8).

[0110] In vitro cytotoxicity screening on cultured Neuro-2a (mouse neuroblastoma) cells did not show significant cytotoxicity of Ca-pSiNP formulations at nanoparticle concentrations up to 50 μg / mL (Figure 9). Therefore, the system was loaded with targeting and therapeutic payloads for gene silencing studies (the loading procedure is schematically described in Figure 10). A small interfering RNA (siRNA) capable of silencing the endogenous gene (peptidyl prolyl isomerase B, PPIB) was selected to test the ability of calcium silicate chemicals to retain, protect, and deliver therapeutic payloads for in vivo studies. Loading pSiNPs with siRNA against PPIB in the presence of 3M CaCl2 (siPPIB) resulted in an siRNA content of approximately 20 wt% in the resulting nanoparticles (Ca-pSiNP-siRNA). The morphology of the Ca-pSiNP-siRNA construct appeared similar to that of the drug-free Ca-pSiNP preparation by TEM (Figure 2C), but the surface charge (zeta potential, Figure 11A) of the Ca-pSiNP-siRNA was negative, not positive. The positive zeta potential of the drug-free Ca-pSiNP preparation was due to excess Ca on the particle surface. 2+ The ion-induced, negatively charged siRNA payload neutralizes these charges to the extent that it creates an overall negative zeta potential within the Ca-pSiNP-siRNA construct.

[0111] To achieve targeted delivery and intracellular transport of siRNA therapeutics, tissue-targeting peptides and cell-permeable peptides were then grafted onto the calcium silicate shell of the Ca-pSiNP-siRNA construct. A PEG linker was used to conjugate both of these peptides and improve systemic circulation (Figure 10). First, the chemical coupling agent 2-aminopropyldimethylethoxysilane (APDMES) was grafted onto the nanoparticle surface to generate pendant primary amine groups (Ca-pSiNP-siRNA-NH2). Sailor et al. (2012) Adv. Mater. 24:3779. Due to the primary amine groups on the outermost surface of the nanoparticles, the zeta potential became further positive after the APDMES reaction of either the Ca-pSi-NH2 or Ca-pSiNP-siRNA-NH2 formulation (Figure 11A). Next, a functional polyethylene glycol (PEG) species was grafted onto Ca-pSiNP-siRNA-NH2 via these primary amines using the maleimide-poly(ethylene-glycol)-succinimidyl carboxymethyl ester (MAL-PEG-SCM) species. Joo et al. (2015) ACS Nano 9: 6233. Succinimidyl carboxymethyl ester forms an amide bond with the primary amine, thus providing a convenient means of conjugating PEG to amination nanoparticles. The distal end of the PEG chain contained a second functional group, maleimide. Maleimide forms a covalent bond with a thiol, enabling the binding of targeting and cell-permeable peptides. Here, two peptide species called "mTP," myr-GWTLNSAGYLLGKINLKALAALAKKIL(GGCC) (SEQ ID NO: 1) and a rabies virus-derived peptide called "FAM-RVG," 5FAM-(CCGG)YTIWMPENPRPGTPCDIFTNSRGKRASNG (SEQ ID NO: 2), were prepared and conjugated into a Ca-pSiNP-siRNA-PEG formulation via the reaction of a maleimide group with the cysteine ​​thiol of the related peptide. Here, "5FAM" refers to a biomolecule (λ ex / λ emFluorescently labeled 5-carboxyfluorescein is an amine-reactive fluorophore commonly used to label (495 / 518 nm).

[0112] Cell-permeable peptides (CPPs), such as transporters (TPs), have proven to be promising adjuvants for siRNA delivery. Incorporating CPPs into nanoparticles can increase endocytosis escape after internal migration, thereby enhancing siRNA knockdown efficiency. However, CPPs lack cell-type specificity. To overcome this drawback, CPPs are combined with cell-specific targeting peptides to produce what are known as tandem peptides, and these constructs have been shown to be highly efficient siRNA delivery agents. Ren et al. (2012) ACS Nano 6: 8620. In this example, a cell-permeable transporter peptide was conjugated to a myristoyl group containing a hydrophobic 13-carbon aliphatic chain to enhance the hydrophobic interaction between the peptide and the cell membrane lipid bilayer (mTP). Ren et al. (2012) (Year) Sci. Transl. Med. Vol. 4: 147ra112. Cell targeting function is in This was achieved using peptide sequences derived from rabies virus glycoprotein (RVG), which demonstrated effective neuronal cell targeting efficiency both in vitro and in vivo. (Alvarez-Erviti et al. (2011) Nat. Biotechnol. 29:341; Lentz (1990) J.) Mol. Recognit. Vol. 3: p. 82; Kumar et al. (2007) Nature Vol. 448: p. 39. When both RVG and mTP peptides were conjugated to Ca-pSiNP, a bipeptide nanocomplex, referred to here as "Ca-pSiNP-DPNC," was formed. Control nanoparticles containing only mTP or RVG peptides were also prepared and named Ca-pSiNP-mTP or Ca-pSiNP-RVG, respectively, in this specification.

[0113] Approximately 0.086 mg of RVG was conjugated with 1 mg of Ca-pSiNP-siRNA-PEG and its relative fluorescence was determined by FAM labeling. For the Ca-pSiNP-siRNA-DPNC construct, approximately 0.037 mg of RVG and an equivalent amount of mTP were conjugated. The Fourier transform infrared (FTIR) spectrum of Ca-pSiNP-DPNC showed all characteristic peaks of Ca-pSiNP-mTP and Ca-pSiNP-RVG (Figure 12). The mean diameter of the Ca-pSiNP-siPPIB-DPNC construct was 220 nm (DLS Z-mean, based on intensity), representing an increase compared to the 40 nm pSiNP starting material. No significant aggregates were observed in the DLS data (Figure 11B).

[0114] The Ca-pSiNP-siPPIB-DPNC construct resulted in a 52.8% knockdown of PPIB gene activity in Neuro-2a cells compared to the untreated control (Figure 3). To rule out the possibility that gene silencing was caused by the toxicity of the nanocomplex, a similar formulation loaded with a negative control siRNA against the luciferase gene (siLuc) was tested, but no statistically significant difference was observed compared to the untreated control. As a further control, the gene silencing efficiency of nanoparticles containing only cell-permeable peptides or cell-targeting peptides was tested (Ca-pSiNP-siPPIB-mTP and Ca-pSiNP-siPPIB-RVG, respectively). Both of these constructs showed some observable knockdown of PPIB gene expression (27.1–28.9% compared to the untreated control), but the silencing effect was greater with the bipeptide nanoparticle Ca-pSiNP-siPPIB-DPNC compared to either peptide system individually (p<0.03). In the case of Ca-pSiNP-siPPIB-mTP, the gene knockdown observed in vitro is not expected to translate into in vivo activity because the cell permeability effect of mTP lacks cell type specificity. On the other hand, silencing by Ca-pSiNP-siPPIB-RVG is due to more effective cell localization in vitro resulting from the specific binding of the RVG sequence to Neuro-2a cells. Free siPPIB (not contained in nanoparticles) and naked pSiNP (Ca-pSiNP) Further controls using siPPIB loaded without topping chemistry, targeting peptides, or cell-permeable peptides did not show statistically significant knockdown. Furthermore, the nanoconstructs were isolated and stored in ethanol at 4°C for 7 days, still retaining their PPIB gene knockdown efficiency (Figure 3).

[0115] Consistent with its even higher knockdown efficiency, confocal microscopy images showed that the Ca-pSiNP-siPPIB-DPNC formulation had greater affinity for Neuro-2a cells than the Ca-pSiNP-siPPIB-RVG formulation (Figures 13A and 13B). The Ca-pSiNP-siPPIB-DPNC formulation had approximately half the number of fluorescent FAM marker molecules on its surface compared to Ca-pSiNP-siPPIB-RVG. Even with lower FAM fluorescence signals per particle, Neuro-2a cells treated with Ca-pSiNP-siPPIB-DPNC showed a greater FAM signal compared to the RVG-only formulation due to the greater cellular affinity of this bipeptide construct. Ca-pSiNP is visible in fluorescence microscopy images due to intrinsic photoluminescence from the quantum-confined Si domains of the nanoparticles. In cells treated with Ca-pSiNP-siPPIB-DPNC, the Si signal co-localizes with the signal from the FAM label on the RVG targeting peptide, resulting in a combined signal in the cytosol indicating intracellular migration. The cytoaffinity of these two nanoparticle constructs was further quantified by fluorescence-activated cell sorting (FACS) analysis (Figures 14A-14D), and this data shows that the bipeptide nanoparticles were more efficient at targeting Neuro-2a cells than nanoparticles containing only the RVG peptide (51.4±5.6% vs. 36.4±5.6% for Ca-pSiNP-siPPIB-DPNC and Ca-pSiNP-siPPIB-RVG, respectively (P<0.04)). Separate fluorescent labeling on the RVG peptide and on the siPPIB in Ca-pSiNP-siPPIB-DPNC demonstrated that 65.9±8.7% of the cells contained both RVG and siPPIB (Figure 14D). These results support the hypothesis that conjugating both RVG and mTP into nanoparticles results in greater cell affinity, and consequently, a stronger gene knockdown effect.

[0116] Since having both cell-permeable and cell-targeting peptides on the same nanoparticle (Ca-pSiNP-siPPIB-DPNC) results in the strongest gene knockdown in vitro, this combination was tested for in vivo gene delivery. This in vivo model included permeable brain injury in mice. In mice injected with Ca-pSiNP-siRNA-DPNC, a significant amount of siRNA accumulated at the brain injury site (Figure 4). Mice (n=3) showed twice the fluorescence intensity associated with the siRNA payload compared to the fluorescence background of control mice injected with saline. The observed effectiveness of targeting with the bipeptide Ca-pSiNP-siRNA-DPNC was statistically greater compared to untargeted nanoparticle Ca-pSiNP-siRNA-PEG (p<0.02). Mice injected with the untargeted Ca-pSiNP-siRNA-PEG construct showed some siRNA fluorescence signals in the brain compared to uninjected control mice, likely due to passive leakage to the injury site.

[0117] In summary, this study demonstrates a self-encapsulation chemical procedure that allows for the loading of oligonucleotides into biodegradable and inherently photoluminescent nanoparticles. Significant amounts of siRNA can be loaded (>20% by mass) and retain the payload for therapeutic timescales. The calcium silicate shell is readily modifiable with cell-targeting (RVG peptide derived from rabies virus glycoprotein) and cell-permeable (myristolated transporter) peptides, as well as combinations of the two peptides, and the calcium silicate chemical possesses the ability to retain and protect the siRNA payload, improving in vitro. This results in targeted cell targeting and gene knockdown. Multivalent core-shell nanoparticles circulate and deliver the siRNA payload to brain injury in viable mice, while dual-targeting nanoparticles show improved siRNA delivery in an in vivo brain injury model compared to non-targeting nanoparticles. Experiment Section

[0118] Preparation of porous silicon nanoparticles: pSiNPs were prepared according to the published "perforation etching" procedure. Qin et al. (2014) Part. Part. Syst. Char. Vol. 31: p. 252 Highly boron-doped p ++ A silicon wafer (approximately 1 mΩ-cm resistivity, 100 mm diameter, Virginia Semiconductor, Inc.) was anodically etched in an electrolyte consisting of 48% aqueous HF:ethanol in a 3:1 (v:v) ratio. The etching waveform was 46 mA cm⁻¹. -2 A low current density of 1.818 seconds is applied, followed by 365 mA cm⁻¹. -2 A higher current density pulse was applied for 0.363 seconds, consisting of a square wave. This waveform was repeated 140 times to produce a layered porous silicon (pSi) film with thin, highly porosity "perforations" repeated approximately every 200 nm through the porous layer. 3.4 mA cm⁻¹ was applied in a solution containing 48% aqueous HF:ethanol in a 1:20 (v:v) ratio. -2 The film was removed from the silicon substrate by applying a current density of 250 seconds. The independent pSi film was immersed in deionized water and sonicated for approximately 12 hours to break it down into nanoparticles with an average (Z-average, based on intensity) diameter of 180 nm (Figure 11B).

[0119] Preparation of calcium silicate-coated siRNA-loaded porous silicon nanoparticles (Ca-pSiNP-siRNA): 2.25 g of solid CaCl2 (MW: 110.98, anhydrous, Spectrum) in a 4 M stock solution of calcium chloride (CaCl2). The solution was prepared by adding (chemicals) to 5 mL of RNAse-free water. The solution was centrifuged to remove the precipitate and stored at 4°C before use. For oligonucleotide loading, PPIB(1), PPIB(2), and three double-stranded siRNA constructs for luciferase knockdown were synthesized by Dharmacon Inc. using a 3'-dTdT overhang. Ambardekar et al. (2011) Biomaterials vol. 32: 1404; Waite et al. (2009) BMC Biotechnol. vol. 9: 3 Page 8. For PPIB genes against siRNA (siPPIB), siPPIB(1) and siPPIB(2) were obtained, respectively. Using a 1:1 mixture of siPPIB(1):siPPIB(2), a wide range of PPIB genes were covered for siPPIB(1) on the siRNA sequence sense 5'-CAA GUU CCA UCG UGU CAU C dTdT-3' (SEQ ID NO: 3) and antisense 5'-GAU GAC ACG AUG GAA CUU G dTdT-3' (SEQ ID NO: 4), and for siPPIB(2) on the sense 5'-GAA AGA GCA UCU AUG GUG A dTdT-3' (SEQ ID NO: 5) and antisense 5'-UCA CCA UAG AUG CUC UUU C dTdT-3' (SEQ ID NO: 6). The luciferase gene for siRNA (siLuc) was obtained on the siRNA sequence sense 5'-CUU ACG CUG AGU ACU UCG A dTdT-3' (SEQ ID NO: 7) and antisense 5'-UCG AAG UAC UCA GCG UAA G dTdT-3' (SEQ ID NO: 8). pSiNPs (1 mg) were dispersed in oligonucleotide solution (150 μL, 150 μM in siRNA) and added to CaCl2 stock solution (850 μL). This mixture was stirred for 60 minutes and purified by sequential dispersion into RNAse-free water, 70% ethanol, and 100% ethanol / centrifugation therefrom. To analyze siRNA loading efficiency, the supernatant from each centrifugation step was collected and assayed for free siRNA using a NanoDrop2000 spectrophotometer (Thermo Scientific, ND-2000). As a control, Ca-pSiNPs without siRNA were prepared in the same manner as above, but without the addition of siRNA.

[0120] Peptide conjugation to Ca-pSiNP: As-prepared Ca-pSiNP-siRNA, Ca-pSiNP, or pSiNP sample (1 mg) was suspended in anhydrous ethanol (1 mL), and an aliquot (20 μL) of aminopropyldimethylethoxysilane (APDMES) was added. The mixture was stirred for 2 hours. Subsequently, the aminated nanoparticles (Ca-pSiNP-siRNA-NH2, Ca-pSiNP-NH2, or pSiNP-NH2) were purified three times by centrifugation from the anhydrous ethanol to remove unbound APDMES. A 200 μL solution of either maleimide-PEG-succinimidyl carboxymethyl ester (MAL-PEG-SCM, MW: 5,000, Laysan Bio Inc., 5 mg / mL in ethanol) or methoxy-PEG-succinimidyl α-methylbutanoate (mPEG-SMB, Mw: 5,000, NEKTAR, 5 mg / mL in ethanol), a heterofunctional linker, was added to amination nanoparticles (1 mg per 100 μL) and stirred for 2 hours. Unbound PEG linker molecules were removed from the PEGylated nanoparticles (Ca-pSiNP-siRNA-PEG or Ca-pSiNP-PEG) by three centrifuges from ethanol. For the peptide-conjugated formulations, one of the following two peptide constructs was used: mTP consisting of a myristoyl group (myr) covalently bonded by an amide linkage to the N-terminal glycine residue on the peptide sequence myr-GWTLNSAGYLLGKINLKALAALAKKIL(GGCC)(SEQ ID NO: 1), or FAM-RVG consisting of 5-carboxyfluorescein (5-FAM) bonded by an amide linkage to the N-terminal cysteine ​​residue on the peptide sequence 5-FAM(CCGG)YTIWMPENPRPGTPCDIFTNSRGKRASNG(SEQ ID NO: 2). Both of these constructs were obtained from CPC Scientific Inc. (1 mg / mL in RNAse-free water).For the synthesis of Ca-pSiNP bipeptide nanocomplexes (Ca-pSiNP-DPNC or Ca-pSiNP-siRNA-DPNC), 50 μL of each peptide solution (mTP and FAM-RVG) was added to 100 μL of Ca-pSiNP-PEG in ethanol, incubated at 4°C for 4 hours, purified three times by centrifugation, immersed in ethanol, and stored at 4°C before use. For the synthesis of single peptide-conjugated Ca-pSiNP (Ca-pSiNP-siRNA-mTP or Ca-pSiNP-siRNA-RVG) control samples, 100 μL of the peptide solution (mTP or FAM-RVG) was added to 100 μL of Ca-pSiNP-siRNA-PEG in ethanol, respectively. Subsequent work-up was the same as described above for the Ca-pSiNP-siRNA-DPNC constructs.

[0121] Characterization: Transmission electron microscope (TEM) images were obtained using the JEOL-1200 EX II instrument. Scanning electron microscope (SEM) images and energy-dispersive X-ray (EDX) data were obtained using the FEI XL30 field emission instrument. Hydrodynamic size and zeta potential were measured by dynamic light scattering (DLS, Zetasizer ZS90, Malvern Instruments). Steady-state photoluminescence spectra (λ) were obtained using an Ocean Optics QE-Pro spectrometer with a 460 nm long-pass emission filter. ex A quantum yield was obtained at λ=365nm. Quantum yield measurements were performed using ethanol standard (QY95%) compared with rhodamine 6G. All solutions used for quantum yield measurements had a photoabsorption value of less than 0.1 at λ=365nm. Photoluminescence intensity in the wavelength range of 500–980nm was integrated and plotted against absorbance (Figure 8). Nitrogen adsorption / desorption isotherms were obtained for dry particles at a temperature of 77K using a Micromeritics ASAP2020 instrument. Fourier transform infrared (FTIR) spectra were recorded using a Thermo Scientific Nicolet 6700 FTIR instrument. Raman spectra were obtained using a Renishaw inVia Raman microscope with a 532nm laser excitation source.

[0122] In vitro experiment: Mouse Neuro-2a neuroblastoma cells (ATCC, CCL-1 31) were cultured in Eagle's Minimum Essential Medium (EMEM) containing 10% fetal bovine serum (FBS). The cytotoxicity of the synthesized nanoparticles was evaluated using the Molecular Probes Live / Dead Viability / Cytotoxicity Kit (Molecular Probes, Invitrogen). Yee et al. (2006) Adv. Ther. Vol. 23: p. 511. This kit includes two probes and live cell staining (λ ex / λ em Calcein AM and dead cell staining (λ = 494 / 517 nm) ex / λ em Ethidium homodimer-1 (EthD-1) for 528 / 617 nm was used. Neuro-2a cells (3000 cells / well) were triple-treated with nanoparticles in a 96-well plate. After 48 hours, each well was washed and treated with an assay solution consisting of 4 μM EthD-1 and 2 μM calcein AM in Dulbecco's phosphate-buffered saline. After incubation in the assay solution at room temperature for 45 minutes, the well plates were read using a fluorescence plate reader (Gemini XPS spectrofluorometer, Molecular Devices, Inc.) at excitation, emission, and cutoff wavelengths of 485 / 538 / 515 nm and 544 / 612 / 590 nm, respectively. A total of 15 wells per treatment group were evaluated and plotted as a percentage of the untreated control fluorescence intensity.

[0123] Neuro-2a cells treated with nanoparticles were visualized using a confocal microscope (Zeiss LSM 710 NLO) with a 40x oil immersion objective lens. The cells were seeded onto coverslips (BD Biocoat Collagen Coverslip, 22 mm), incubated with nanoparticles for 2 hours, washed three times with PBS, fixed with 4% paraformaldehyde, and mounted after nucleus staining with DAPI (Thermo Fisher). Scientific, Prolong Diamond Antifade Mountant with DAPI). Neuro-2a cells treated with nanoparticles were quantified, and cell affinity and siRNA delivery efficiency were demonstrated by FACS analysis (LSR Fortessa).

[0124] To investigate the knockdown efficiency in vitro, PPIB mRNA expression was examined using real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR, Stratagene Mx3005P qPCR system) analysis. Neuro-2a cells were plated in a 24-well plate (4 × 10⁶ cells per well). 4 Cells were seeded and incubated with siRNA-loaded nanoparticles at a concentration corresponding to 100 nM siRNA. After 48 hours, cells were harvested and total RNA was isolated according to the manufacturer's protocol (Qiagen, Valencia, CA). The isolated RNA was transcribed into cDNA according to the manufacturer's protocol (Bio-Rad, iScript cDNA Synthesis Kit). The synthesized cDNA was subjected to qPCR analysis using SYBR Green PCR Master Mix. The primer sequences for PPIB as target mRNA amplification and HPRT as reference mRNA amplification are listed below. PPIB forward: GGAAAGACTGTTCCAAAAACAGTG (SEQ ID NO: 9), PPIB reverse: GTCTTGGTGCTCTCCACCTTCCG (SEQ ID NO: 10); HPRT forward: GTCAACGGGGGACATAAAAG (SEQ ID NO: 11), HPRT reverse: CAACAATCAAGACATTCTTTCCA (SEQ ID NO: 12). All procedures were performed in triple replication.

[0125] In vivo experiments: All animal experiments were conducted under protocols approved by the MIT Institutional Animal Care and Use Committees (IACUC) and the Sanford Burnham Prebys Medical Discovery Institute Committee on Animal Use and Care. The experimental animals used in this study All housing and care for objects are covered by the NIH Guide for the Care and We followed the Use of Laboratory Animals in Research (NIH Guideline for the Care and Use of Laboratory Animals in Research) (see Document 180F22) and all requirements and regulations issued by the USDA (including, as an amendment, regulations for implementing the Animal Welfare Act (PL89-544) (see Document 18-F23)). The in vivo model involved penetrating brain injury in mice. First, a 5 mm diameter portion of the skull on the right hemisphere of the mouse was removed. Wounds were induced using a 3x3 grid 21-gauge needle, yielding a total of nine wounds, each 3 mm deep. After injury induction, the skull was replaced (Figure 15). Six hours after injury, the mice were injected with a nanoparticle construct via the tail vein. To quantify the delivery efficiency of siRNA cargo to the targeting injury site, Dy677-labeled (λ) em siRNA (700 nm) was loaded onto Ca-pSiNP-PEG and Ca-pSiNP-DPNC, and each of these formulations was injected into separate mice. After 1 hour of circulation, the mice were perfused and organs were harvested.

[0126] Fluorescence images of the collected organs were taken using conventional IVIS200, xenogen, and Pearl. Obtained using Trilogy's Li-Cor imaging system.

[0127] Statistical Analysis: All data presented herein are expressed as mean ± standard error of the mean. Significance testing was performed using a two-tailed Student's t-test. Unless otherwise indicated, p < 0.05 was considered statistically significant. Alternative porous silicon metal silicate core-shell particles

[0128] Alternative core-shell particle structures are also being prepared for further investigation and characterization. Figure 16 shows the X-ray diffraction spectra of porous silicon microparticles (pSiMPs) produced by sonication of electrochemically etched porous silicon particles in solutions of 4M calcium chloride, 4M magnesium chloride, and pH 9 buffer. The X-ray diffraction spectra of pSiMPs treated with pH 9 buffer show no significant peaks, indicating that the pSiMPs are mostly oxidized. Particles formed from magnesium chloride show little to no decomposition or oxidation, instead exhibiting a strong spectrum of crystalline silicon. This observation suggests a stronger and more stable magnesium-silicon interaction that may occur, either due to electrostatic adsorption of the metal or amorphous silicate formation. Particles formed from calcium chloride show some peaks from crystalline silicon, as well as more peaks that may arise from crystalline calcium silicate bonding. However, compared to particles formed from magnesium, the peaks are much weaker, likely as a result of thinner or less uniform shell formation around the silicon matrix.

[0129] The pore structures of pSiMP (pH 9 buffer), Mg-pSiMP, and Ca-pSiMP were characterized by nitrogen adsorption / desorption isotherm analysis (Table 1). While further oxidation of crystalline silicon was not possible for thermally oxidized pSiMP, the formation of calcium and magnesium layers within the pore was observed by a significant decrease in pore volume. [Table 1]

[0130] As described above, anionic molecules, including siRNA, microRNA, and calcein, can be loaded onto porous silicon particles with loading efficiencies exceeding 20 wt% during calcium silicate formation due to favorable electrostatic interactions. Loading and release of cationic or zwitterionic molecules such as Ru(bpy), chloramphenicol, vancomycin, and rhodamine B on porous silicon particles have also been evaluated. In particular, the loading efficiencies of zwitterionic (rhodamine B) or cationic (Ru(bpy)) molecules are lower than those of anionic molecules, but they exhibit longer-lasting release due to a trapping mechanism (Figures 17A-17C). The loading efficiency, release kinetics, and photoluminescence profiles of Ca-pSiNPs loaded with the antibiotics chloramphenicol and vancomycin are shown in Figures 18A-18B. The incorporated drug molecules were released gradually under physiological conditions and correlated with a photoluminescence decrease profile, although the release kinetics were somewhat slower than the photoluminescence decrease profile.

[0131] All patents, patent publications, and other published references referenced herein are incorporated herein by reference in whole, as if each were incorporated individually and specifically by reference.

[0132] While specific examples are provided, the above description is illustrative and not limiting. One or more features of any of the embodiments described above may be combined in any way with one or more features of any other embodiments of the invention. Furthermore, many variations of the invention will become apparent to those skilled in the art by examining this specification. Accordingly, the scope of the invention should be determined by referring to the appended claims together with the entire scope of their equivalents.

[0133] According to a preferred embodiment of the present invention, for example, the following is provided: (Section 1) Particles containing a porous silicon core; A layer on the surface of the porous silicon core containing a metal silicate salt; and Therapeutic drugs A composition for delivering a therapeutic agent, including [a specific compound / component]. (Section 2) The composition according to item 1, wherein the layer on the surface of the particles is formed by treating porous silicon precursor particles with an aqueous solution containing the therapeutic agent and a metal salt. (Section 3) The composition according to item 2, wherein the aqueous solution contains a metal salt at a concentration of at least 0.1 molars. (Section 4) The composition according to item 1, wherein the layer on the surface of the particles contains a divalent metal silicate. (Section 5) The composition according to item 4, wherein the layer on the surface of the particles contains calcium silicate. (Section 6) The composition according to item 1, wherein the porous silicon core has a diameter of about 1 nm to about 1 cm. (Section 7) The composition according to item 6, wherein the layer on the surface of the porous silicon core has a thickness between 1 and 90 percent of the diameter of the core. (Section 8) The composition according to item 1, wherein the particles are photoluminescent particles. (Section 9) The composition according to item 8, wherein the particles emit light in the range of 500 nm to 1000 nm. (Section 10) The composition according to item 1, wherein the porous silicon core comprises an etched crystalline silicon material. (Section 11) The composition according to item 10, wherein the porous silicon core comprises an electrochemically etched crystalline silicon material. (Section 12) The composition according to item 10, wherein the porous silicon core comprises a chemically stain-etched crystalline silicon material. (Section 13) The composition according to item 1, wherein the porous silicon core comprises an etched microporous silicon material. (Section 14) The composition according to item 13, wherein the etched microporous silicon material comprises a plurality of pores with an average pore diameter of up to approximately 1 nm. (Section 15) The composition according to item 1, wherein the porous silicon core comprises an etched mesoporous silicon material. (Section 16) The composition according to item 15, wherein the etched mesoporous silicon material contains a plurality of pores with an average pore diameter of approximately 1 nm to approximately 50 nm. (Section 17) The composition according to item 1, wherein the porous silicon core comprises an etched macroporous silicon material. (Section 18) The composition according to item 17, wherein the etched macroporous silicon material comprises a plurality of pores with an average pore diameter of approximately 50 nm to approximately 1000 nm. (Section 19) The composition according to item 1, wherein the therapeutic agent is a low molecular weight drug, a vitamin, a contrast agent, a protein, a peptide, a nucleic acid, an oligonucleotide, an aptamer, or a mixture thereof. (Section 20) The composition according to item 19, wherein the therapeutic agent is a negatively charged therapeutic agent. (Section 21) The composition according to item 20, wherein the therapeutic agent is an oligonucleotide. (Section 22) The composition according to item 21, wherein the oligonucleotide is DNA, RNA, siRNA, or microRNA. (Section 23) The composition according to item 22, wherein the oligonucleotide is RNA. (Section 24) The composition according to item 23 above, wherein the RNA is siRNA. (Section 25) The composition according to item 1, wherein the particles contain a targeting agent. (Section 26) The composition according to item 25, wherein the targeting agent is a neuron targeting agent. (Section 27) The composition according to item 1, wherein the particles contain a cell-permeable agent. (Section 28) The composition according to item 27, wherein the cell-permeable agent is a lipidized peptide. (Section 29) The composition according to item 1, wherein the particles comprise a targeting agent and a cell-permeable agent. (Item 30) The composition according to item 1, wherein the porous silicon core comprises an oxidized porous silicon substance. (Section 31) The composition according to item 30, wherein the oxidized porous silicon material is oxidized at a temperature exceeding 150°C. (Section 32) The composition according to item 30, wherein the oxidized porous silicon material is oxidized in air. (Item 33) The composition according to item 30, wherein the oxidized porous silicon material is oxidized in solution by a reaction using a chemical oxidizing agent. (Section 34) The composition according to item 33, wherein the chemical oxidizing agent is water, borate, tris(hydroxymethyl)aminomethane, dimethyl sulfoxide, or nitrate. (Section 35) A pharmaceutical composition comprising the composition described in any one of items 1 to 34 above and a pharmaceutically acceptable carrier. (Section 36) A method for preparing particles for the delivery of a therapeutic agent, Steps to prepare porous silicon precursor particles; The step of treating the porous silicon precursor particles with an aqueous solution containing the therapeutic agent and a metal salt. A method that includes this. (Section 37) The method according to item 36, wherein the aqueous solution contains a metal salt at a concentration of at least 0.1 molars. (Section 38) The method according to item 36, wherein the metal salt is a divalent metal salt. (Section 39) The method according to item 38, wherein the metal salt is a calcium salt. (Section 40) The method according to item 36, wherein the porous silicon precursor particles have a diameter of about 1 nm to about 1 cm. (Section 41) The particles formed from the above process are on the surface of the porous silicon precursor particles. The method according to item 40, comprising a layer of metal salt having a thickness between 1 and 90 percent of the diameter of the precursor particles. (Section 42) The method according to item 36, wherein the particles formed from the above process are photoluminescent particles. (Section 43) The method according to item 42, wherein the particles formed from the above process emit light in the range of 500 nm to 1000 nm. (Section 44) The method according to item 36, wherein the porous silicon precursor particles include an etched crystalline silicon material. (Section 45) The method according to item 44, wherein the porous silicon precursor particles include an electrochemically etched crystalline silicon material. (Section 46) The method according to item 44, wherein the porous silicon precursor particles include a chemically stain-etched crystalline silicon material. (Section 47) The method according to item 36, wherein the porous silicon precursor particles include an etched microporous silicon material. (Section 48) The method according to item 47, wherein the etched microporous silicon material contains multiple pores with an average pore diameter of up to approximately 1 nm. (Section 49) The method according to item 36, wherein the porous silicon precursor particles include an etched mesoporous silicon material. (Section 50) The method according to item 49, wherein the etched mesoporous silicon material contains multiple pores with an average pore diameter of approximately 1 nm to approximately 50 nm. (Section 51) The method according to item 36, wherein the porous silicon precursor particles include an etched macroporous silicon material. (Section 52) The method according to item 51, wherein the etched macroporous silicon material includes a plurality of pores with an average pore diameter of approximately 50 nm to approximately 1000 nm. (Section 53) The method according to item 36, wherein the therapeutic agent is a low molecular weight drug, a vitamin, a contrast agent, a protein, a peptide, a nucleic acid, an oligonucleotide, an aptamer, or a mixture thereof. (Section 54) The method according to item 53, wherein the therapeutic agent is a negatively charged therapeutic agent. (Section 55) The method according to item 54, wherein the therapeutic agent is an oligonucleotide. (Section 56) The method according to item 55, wherein the oligonucleotide is DNA, RNA, siRNA, or microRNA. (Section 57) The method according to item 56 above, wherein the oligonucleotide is RNA. (Section 58) The method according to item 57 above, wherein the RNA is siRNA. (Section 59) A step of binding the porous silicon particles to a targeting agent, wherein the binding step occurs before or after the processing step. The method described in item 36 above, further comprising: (Section 60) The method according to paragraph 59, wherein the bonding step is after the processing step. (paragraph 61) The method according to item 59 above, wherein the targeting agent is a neuron targeting agent. (Section 62) A step of binding the porous silicon particles to a cell-permeable agent, wherein the binding step occurs before or after the processing step. The method described in item 36 above, further comprising: (Section 63) The method according to paragraph 62, wherein the bonding step occurs after the processing step. (paragraph 64) The method according to item 62, wherein the cell-permeable agent is a lipid-modified peptide. (Section 65) A step of binding the porous silicon precursor particles to a targeting agent and a cell-permeable agent, wherein the binding step is either before or after the processing step. The method described in item 36 above, further comprising: (Section 66) The method according to item 36, wherein the porous silicon precursor particles include an oxidized porous silicon substance. (Section 67) The method according to item 66, wherein the oxidized porous silicon material is oxidized at a temperature exceeding 150°C. (Section 68) The method according to item 66, wherein the oxidized porous silicon material is oxidized in air. (Section 69) The method according to item 66, wherein the oxidized porous silicon material is oxidized in solution by a reaction using a chemical oxidizing agent. (Section 70) The method according to item 69, wherein the chemical oxidizing agent is water, borate, tris(hydroxymethyl)aminomethane, dimethyl sulfoxide, or nitrate. (Section 71) A method of treatment, comprising administering the composition described in any one of items 1 to 34 above to a subject requiring treatment. (Section 72) The method according to item 71 above, wherein the administration is by parenteral administration. (Section 73) The method according to item 71, wherein the administration targets neuronal tissue. (Section 74) The method according to item 71, further comprising the step of monitoring the subject or tissue isolated from the subject. (Section 75) The method according to item 74, wherein the monitoring step is an optical monitoring step.

Claims

[Claim 1] The need to develop an improved composition for the delivery of therapeutic agents.

Images