Method for producing cultures of Aspergillus oryzae
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- NAT AGRI & FOOD RES ORG
- Filing Date
- 2025-01-17
- Publication Date
- 2026-07-30
AI Technical Summary
【0011】 本発明によれば、乳由来液状成分を利用した麹菌の効率的な培養技術を提供することができる。本発明によれば、ホエイ等の乳製品産業の副産物を麹菌の培養に再利用でき、これらの廃棄量を減らすだけでなく食品、飼料等の産業において効率的に活用できる。また、乳由来液状成分から清澄な液相を得られるので、排水処理の効率化、廃棄処理のコスト削減を図ることができる。
Smart Images

Figure 2026123638000002 
Figure 2026123638000003 
Figure 2026123638000004
Abstract
Description
Technical Field
[0001] The present invention relates to a method for producing a culture of Aspergillus.
Background Art
[0002] When producing dairy products such as cheese and yogurt, various by-products are generated. Among them, liquid components such as whey and skim milk have the problem that it is difficult to perform waste treatment and purification treatment because they are in a liquid state. Among them, whey contains abundant nutrients including lactose, and this abundant nutrient has become a problem, resulting in high costs for waste treatment and a large burden on the environment.
[0003] On the other hand, Aspergillus is solid-cultured using agricultural products such as rice as a medium, and the "koji" containing a large amount of enzymes has been widely used in the brewing of foods and liquors.
[0004] Patent Document 1 describes that a koji production substrate can be produced by adding coagulants such as lactase, transglutaminase, and glucono-delta-lactone to milk processing products such as whey, and it can be used as a fermented seasoning that can exhibit the enzyme activity contained in koji. Patent Document 2 describes that acid whey and sweet whey can be added as a carbon source to an artificial medium when obtaining a filamentous fungus mat such as Aspergillus oryzae, and various useful components can be isolated from the filamentous fungus mat. Patent Document 3 describes a method of reducing lactose in its substrate (whey, whey permeate, acid whey, etc.) by bringing an enzyme having neutral lactase activity derived from the genus Lactobacillus into contact with a milk base, and using it for the preparation of low-lactose or lactose-free dairy products.
[0005] Non-Patent Document 1 describes a method of converting expired milk into fungal biomass and other metabolites using Aspergillus oryzae and Neurospora intermedia. Non-Patent Document 2 states that ethanol can be produced by yeast fermentation using lactose contained in whey as a raw material.
Prior Art Documents
[0006] [Patent Document 1] Japanese Patent Publication No. 2012-70680 [Patent Document 2] Japanese Patent Publication No. 2022-33772 [Patent Document 3] Special Publication No. 2022-524312 [Non-patent literature]
[0007] [Non-Patent Document 1] R.Thunuguntla et al.(2018)Sustainability,10,1940 [Non-Patent Document 2] D. Risner et al. (2018) J. Dairy Sci. 101, 2963-2973 [Overview of the project] [Problems that the invention aims to solve]
[0008] However, the technology described in Patent Document 1 requires the coagulation of milk or processed milk products. For coagulation to occur, the processed milk product must have a certain level of solid content. Processed milk products with low solid content (e.g., whey) require pretreatment such as concentration, making the process complicated, and there is a problem that coagulation may not occur. Furthermore, even if coagulation occurs and a koji-making base material is obtained, the koji mold may not grow sufficiently even after addition. The method described in Patent Document 2 merely lists whey as an example of a carbon source in the culture medium, and the method described in Patent Document 3 also decomposes the whey raw material to ethanol, and does not offer the idea of obtaining a modified whey product. In addition, in the method described in Patent Document 3, most of the glucose and galactose produced by lactase-mediated lactose decomposition remain in the milk base without being consumed, making it an insufficient method for processing milk-derived components. Moreover, Non-Patent Document 2 does not use koji mold, requires multiple processes such as pretreatment, fermentation, and distillation, and the operation is complicated, so it is not easy to put into practical use.
[0009] The present invention aims to provide a method for treating milk-derived liquid components that can be used for the treatment, reuse, and recycling of surplus or waste milk-derived liquid components. [Means for solving the problem]
[0010] The present invention provides the following [1] to [8]. [1] A method for producing a culture of Aspergillus oryzae, comprising decomposing lactose in a milk-derived liquid component containing lactose to produce glucose and galactose, or, after producing glucose and galactose, adding Aspergillus oryzae and culturing it, and separating the culture from the culture medium. [2] The breakdown of lactose is a breakdown using lactase, as described in [1]. [3] The method according to [1] or [2], wherein the koji mold has been introduced from outside the cell with at least one nucleic acid derived from a microorganism of the same genus and species as the host, and the koji mold is lactase-enhanced in that it expresses the lactase gene more highly than wild-type koji mold due to at least one of the introduced nucleic acids. [4] The method according to [3], wherein the lactase gene comprises a polynucleotide sequence encoding an amino acid sequence that has 70% or more identity with the amino acid sequence of Sequence ID No. 2 and has lactase activity. [5] The method according to [3] or [4], wherein the decomposition of lactose is performed by the lactase-enhanced koji mold. [6] The method according to any one of items [1] to [5], wherein the milk-derived liquid component is whey. [7] A method for producing food or feed, comprising decomposing lactose in a milk-derived liquid component containing lactose to produce glucose and galactose, or, after producing glucose and galactose, adding Aspergillus oryzae and culturing, and separating the culture from the culture medium to use as a raw material for food or feed. [8] A method for purifying wastewater, comprising decomposing lactose in a milk-derived liquid component containing lactose, which is wastewater, to produce glucose and galactose, or, after producing glucose and galactose, adding Aspergillus oryzae and culturing, separating the culture from the culture medium to obtain a liquid phase in which at least one of the biochemical oxygen demand and the soluble chemical oxygen demand is 6000 mg / L or less. [Effects of the Invention]
[0011] According to the present invention, an efficient cultivation technology for Aspergillus oryzae using milk-derived liquid components can be provided. According to the present invention, by-products of the dairy industry, such as whey, can be reused for culturing Aspergillus oryzae, reducing waste volume and enabling efficient utilization in industries such as food and animal feed. Furthermore, since a clear liquid phase can be obtained from milk-derived liquid components, it is possible to improve the efficiency of wastewater treatment and reduce waste disposal costs. [Brief explanation of the drawing]
[0012] [Figure 1] Figure 1 shows the lacA gene (Locus tag AO090012000445; Sequence ID No. 1). [Figure 2] Figure 2 shows the amino acid sequence (Sequence ID 2) that can be estimated from the base sequence of Sequence ID 1. [Figure 3] Figure 3 is a diagram showing the nucleotide sequence (SEQ ID NO: 7) of the DNA fragment containing the lacA gene expression cassette prepared in Example 2. [Figure 4] Figure 4 is a graph showing the analysis results of the residual sugar concentration in whey under each condition of A: "without addition of wild-type lactase", B: "with addition of wild-type lactase", and C: "self-cloning strain". The measured values of the residual sugar concentration in each graph are the average values obtained by performing the same test twice. [Figure 5] Figure 5 is a graph showing the results of component analysis of the culture filtrate under each condition of pre-culture whey, "without addition of wild-type lactase" ("wild-type" in the figure), and "with addition of wild-type lactase" ("wild-type + lactase" in the figure). A, B, C, and D in Figure 5 represent BOD (mg / L), COD (mg / L), total nitrogen concentration (mg / L), and total phosphorus concentration (mg / L), respectively. The measured values of the residual sugar concentration in each graph are the average values obtained by performing the same test twice. [Figure 6] Figure 6 is a graph showing the results of component analysis of the culture filtrate under each condition of pre-culture whey, "without addition of wild-type lactase" ("wild-type" in the figure), and "self-cloning strain". A, B, C, and D in Figure 6 represent BOD (mg / L), COD (mg / L), total nitrogen concentration (mg / L), and total phosphorus concentration (mg / L), respectively. The measured values of the residual sugar concentration in each graph are the average values obtained by performing the same test twice. [Figure 7] Figure 7 is a graph showing the dry weights of the cells separated from the culture solutions of "without addition of wild-type lactase" ("wild-type" in the figure), "with addition of wild-type lactase" ("wild-type + lactase" in the figure), and "self-cloning strain" in Example 5.
Modes for Carrying Out the Invention
[0013] <1. Method for Producing a Culture of Aspergillus oryzae> The method for producing a culture of Aspergillus oryzae according to the present invention includes decomposing lactose in a liquid component derived from milk containing lactose to produce glucose and galactose, or after producing glucose and galactose making glucose and galactose and adding and culturing Aspergillus oryzae, and separating the culture in the culture solution from the culture solution.
[0014] (Liquid component derived from milk containing lactose) The liquid component derived from milk containing lactose may be a liquid component derived from the milk of livestock such as cows, sheep, goats, etc. For example, milk and whey can be mentioned, and whey is preferred. Since whey is a by-product during dairy product production, its reuse can be made more efficient. Whey is classified into cheese whey, yogurt whey, acid whey, sweet whey, demineralized whey, etc. depending on the raw materials, production methods, and processing methods, and any of them may be used. Also, the liquid component derived from milk may be a powder solid component (for example, whey powder, skim milk powder) dissolved in water. The liquid component derived from milk may be any one of the above alone or a combination of two or more.
[0015] (Lactase) Lactase is an enzyme that hydrolyzes lactose into glucose and galactose. The microorganism from which lactase is derived is not particularly limited. For example, it may be derived from Aspergillus oryzae such as Aspergillus genus (e.g., Aspergillus oryzae), or yeast such as Kluyveromyces genus (e.g., Kluyveromyces lactis). Also, lactase may be a commercially available product. Among these, as lactase, preferably, it may be derived from Aspergillus oryzae, more preferably, it may be derived from Aspergillus oryzae with enhanced lactase production described later. In the present invention, when lactase is derived from Aspergillus oryzae with enhanced lactase production, lactase may preferably be lactase produced by culturing a strain with enhanced lactase production by the method of the present invention. That is, in the method of the present invention, the decomposition of lactose described later is preferably decomposition by a strain with enhanced lactase production. Thereby, the effects of the present invention can be more easily and more effectively exhibited. Lactase may be used alone or in combination of two or more.
[0016] (Aspergillus oryzae) The koji mold used is preferably one that has been used in the production of foods (for example, fermented foods such as miso, soy sauce, mirin, vinegar, sake, awamori, shochu, and pickles). This is preferable because the method of the present invention can be used in the food or feed production method described later, and a safe food or feed can be obtained. As for such koji molds, those belonging to the genus Aspergillus are preferred, such as Aspergillus oryzae, Aspergillus niger, Aspergillus luchuensis, Aspergillus luchuensis var kawachii, Aspergillus kawachii, Aspergillus sojae, Aspergillus tamari, Aspergillus awamori, and Aspergillus glaucus. Of these, the genus Aspergillus is preferred, and Aspergillus oryzae (e.g., Aspergillus oryzae RIB40 strain) is preferred.
[0017] -Lactase-enhanced koji mold- In the present invention, lactase-enhanced koji mold can preferably be used as the koji mold. Lactase-enhanced koji mold is a koji mold in which at least one nucleic acid derived from a microorganism of the same genus and species as the host has been introduced from outside the cell, and at least one of the introduced nucleic acids causes the lactase gene to be expressed at a higher level than wild-type koji mold. Normally, wild-type Aspergillus oryzae has low lactase activity; therefore, when using wild-type Aspergillus oryzae in this invention, it is preferable to use lactase that does not originate from the Aspergillus oryzae used separately. However, by using Aspergillus oryzae with enhanced lactase production, it is possible to decompose lactose, a liquid component derived from milk, without using separate lactase.
[0018] -Lactase gene- The lactase (lacA) gene is registered in the Gene Bank (Locus tag AO090012000445), and an example is the nucleotide sequence of SEQ ID NO: 1 (Figure 1). From the nucleotide sequence of SEQ ID NO: 1, the amino acid sequence of SEQ ID NO: 2 can be predicted, and the lacA gene may be a gene containing a polynucleotide sequence that has 70% or more identity with the amino acid sequence of SEQ ID NO: 2 (Figure 2) and has lactase activity equivalent to that of the protein having the amino acid sequence of SEQ ID NO: 2. Examples of such identity include 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, and 99.5% or more.
[0019] In the present invention, preferably, lactase-enhanced Aspergillus oryzae that highly expresses the lacA gene can be used by introducing at least one nucleic acid derived from a microorganism of the same genus and species as the host from outside the cell. Examples of nucleic acids to be introduced include the lacA gene derived from a microorganism of the same genus and species as the host, a promoter that increases the expression of the lacA gene, or a combination thereof. As a result, the lacA gene is highly expressed in Aspergillus oryzae, and lactose in milk-derived liquid components can be efficiently degraded. As the promoter, it is preferable to use a promoter derived from a microorganism of the same genus and species as the host. This means that the modified microorganism does not need to undergo safety review regarding genetic modification and can be used for food or feed applications. Modification of a microorganism in a genomic region (e.g., promoter, coding region, 3' untranslated region) derived from a microorganism of the same genus and species is sometimes called "self-cloning".
[0020] -Self-cloning- Self-cloning in this invention refers to altering the properties of a host organism using only the DNA of a microorganism belonging to the same taxonomic species as the host (in recombinant DNA technology, this refers to a living cell into which DNA is transferred; the same applies hereinafter). Safety assessments regarding the use of genetically modified organisms as food or feed, or their release into the environment, require the preparation of extensive and detailed experimental data, and the assessment process is lengthy, resulting in enormous costs. However, as indicated in the laws and regulations [(1) Procedures for safety review of foods and additives using recombinant DNA technology (excerpt) (Ministry of Health and Welfare Notification No. 233 of 2000) https: / / www.mhlw.go.jp / file / 06-Seisakujouhou-11130500-Shokuhinanzenbu / 1_11.pdf, (2) Ministerial Ordinance concerning the Standards for Ingredients of Feeds and Feed Additives http: / / www.famic.go.jp / ffis / feed / hourei / sub1_seibunkikaku.html, (3) Enforcement Regulations of the Act on the Conservation of Biological Diversity through Regulations on the Use of Genetically Modified Organisms, etc. (Ministry of Finance, Ministry of Education, Culture, Sports, Science and Technology, Ministry of Health, Labour and Welfare, Ministry of Agriculture, Forestry and Fisheries, Ministry of Economy, Trade and Industry, Ministry of the Environment Ordinance No. 1 of 2003) http: / / www.env.go.jp / press / files / jp / 108458.pdf], microorganisms improved by self-cloning can be used industrially without undergoing safety review of genetically modified organisms, thus eliminating the need for costs associated with safety review. Furthermore, when genetically modified microorganisms are used industrially, thorough sterilization is required after culturing, which incurs significant costs. On the other hand, microorganisms improved through self-cloning can be treated as non-genetically modified microorganisms, thus eliminating the need for sterilization costs.
[0021] In the present invention, self-cloning is preferred as a method for introducing at least one nucleic acid derived from a microorganism of the same genus and species as the host into Aspergillus oryzae from outside the cell. Examples of self-cloning include substitution or insertion of a promoter derived from a microorganism of the same genus and species as the host into the promoter region of the lacA gene on the microbial genome, substitution or insertion of a lacA gene derived from a microorganism of the same genus and species as the host into the downstream region of the promoter on the microbial genome, introduction into the microorganism of a gene expression cassette (which may have a selection marker gene attached) combining a promoter derived from a microorganism of the same genus and species as the host and a lacA gene derived from a microorganism of the same genus and species as the host, and combinations thereof. The introduction of a gene expression cassette combining a promoter derived from a microorganism of the same genus and species as the host and a lacA gene derived from a microorganism of the same genus and species as the host is preferred. Examples of self-cloning methods include homologous recombination, genome editing (e.g., CRISPR-Cas9, TALEN), and vector introduction.
[0022] The promoter can be selected according to the purpose; for example, a high-expression promoter, i.e., a promoter that increases the expression level, can be selected. By using a high-expression promoter, the expression level of the lacA gene can be increased. Another example of a promoter is one that is specifically expressed under certain conditions. This allows for precise control of the timing and conditions of lacA gene expression and protein production. Examples of promoters include, but are not limited to, the following: the tef1 promoter; promoters of the α-amylase gene or glucoamylase gene (Yoji Hata et al., Jyokyo, 93, 12, 922-931, 1998; Toshiki Minesato, Chemistry and Biology, 38, 12, 831-838, 2000); promoters of the superoxide desmutase gene, cytochrome P-450 gene, catalase gene, ATPase gene, or histone gene (Patent No. 3792467); and artificial promoters that duplicate the base sequence called region III, which is naturally present in Aspergillus oryzae (Toshiki Minesato, Chemistry and Biology, 38, 12, 831-838, 2000).
[0023] As for the koji mold, one type as described above may be used alone, or a combination of two or more types may be used. It is preferable to add Aspergillus oryzae to the system as a culture containing spores (seed koji). Seed koji can be prepared according to conventional methods; for example, it can be prepared by culturing Aspergillus oryzae in a culture medium containing yeast extract, etc.
[0024] (Decomposition of lactose in milk-derived liquid components) In the method of the present invention, the decomposition of lactose in the milk-derived liquid component may be carried out, for example, by using lactase. Decomposition using lactase can be carried out, for example, by adding an effective amount of lactase to the milk-derived liquid component. On the other hand, the breakdown of lactose may also be carried out by lactase-enhanced Aspergillus oryzae. The decomposition is preferably carried out until, for example, 80% or more by mass, 90% or more by mass, 95% or more by mass, or 98% or more of the lactose in the milk-derived liquid component is decomposed. Alternatively, the decomposition is preferably carried out until, for example, the glucose content in the system becomes 0-5 g / L, 0-3 g / L, 0-2 g / L, or 0-1 g / L. Alternatively, the decomposition is preferably carried out until, for example, the galactose content in the system becomes 0-30 g / L, 0-25 g / L, 0-15 g / L, 0-5 g / L, 0-2 g / L, or 0-1.5 g / L.
[0025] The lactose concentration in the milk-derived liquid component is not particularly limited, as long as the amount of koji mold used per 1 g of lactose satisfies the numerical range described below. For example, the lactose concentration in the milk-derived liquid component may be preferably 0.1 g / L or more, or 1 g / L or more, more preferably 10 g / L or more, and even more preferably 20 g / L or more. This allows for more efficient cultivation of koji mold. The upper limit may be preferably 500 g / L or less, more preferably 300 g / L or less, and even more preferably 100 g / L or less. This allows for the separation of a clearer liquid phase from the milk-derived liquid component, which is more suitable for improving the efficiency of wastewater treatment and reducing waste disposal costs. Therefore, the lactose concentration in the milk-derived liquid component may preferably be 0.1 to 500 g / L, or 1 to 500 g / L, more preferably 10 to 300 g / L, and even more preferably 20 to 100 g / L.
[0026] The total nitrogen concentration in the milk-derived liquid component is preferably 50 to 3000 mg / L, or 100 to 2000 mg / L, more preferably 200 to 1800 mg / L, and even more preferably 500 to 1500 mg / L. This allows the effects of the present invention to be exhibited more favorably. The total nitrogen concentration can be measured by conventional methods, such as those described in the examples of this specification.
[0027] Furthermore, the total phosphorus concentration in the milk-derived liquid component may preferably be 10 to 2000 mg / L, or 50 to 1800 mg / L, more preferably 100 to 1500 mg / L, and even more preferably 300 to 1000 mg / L. This allows the effects of the present invention to be exhibited more favorably. The total phosphorus concentration can be measured by conventional methods, such as those described in the examples of this specification.
[0028] The amount of lactase used is not particularly limited, as long as it is an amount that can break down lactose in the milk-derived liquid component. For example, per 1 g of lactose in the milk-derived liquid component, it is preferably 0.1 mg or more, or 1 mg or more, more preferably 2 mg or more, and even more preferably 5 mg or more. The upper limit is preferably 50 mg or less, more preferably 20 mg or less, and even more preferably 10 mg or less. Therefore, the amount of lactase used may be, for example, preferably 0.1 to 50 mg, or 1 to 50 mg, more preferably 2 to 20 mg, and even more preferably 5 to 10 mg per 1 g of lactose in the milk-derived liquid component. This allows the effects of the present invention to be exhibited more favorably.
[0029] On the other hand, the decomposition of lactose in the milk-derived liquid component may be carried out, for example, by lactase-enhanced Aspergillus oryzae. By using lactase-enhanced Aspergillus oryzae, the addition of lactase can be omitted, and lactose decomposition and Aspergillus oryzae culture can be carried out simultaneously. However, even when using lactase-enhanced Aspergillus oryzae, it is still permissible to add lactase.
[0030] (Addition and cultivation of Aspergillus oryzae) In the method of the present invention, lactose in a milk-derived liquid component containing lactose is decomposed to produce glucose and galactose, or after producing glucose and galactose, Aspergillus oryzae is added and cultured. As a result, Aspergillus oryzae can consume the glucose and galactose derived from the lactose in the milk-derived liquid component and grow. The amount of Aspergillus oryzae added is not particularly limited, as long as it is an amount that can decompose the lactose in the milk-derived liquid component and consume the glucose and galactose produced thereby. For example, the amount of Aspergillus oryzae added may be such that the final concentration of Aspergillus oryzae in the culture system is preferably OD600 = 0.0001 or more, 0.001 or more, 0.005 or more, or 0.01 or more, more preferably 0.05 or more. The upper limit may preferably be an amount that is 0.3 or less, more preferably 0.1 or less. Therefore, for example, the amount of koji mold added may be such that the final concentration of koji mold in the culture system is preferably OD600 = 0.0001 to 0.3, 0.001 to 0.3, 0.005 to 0.3, or 0.01 to 0.3, more preferably 0.05 to 0.1. This allows the effects of the present invention to be exhibited more favorably.
[0031] Culturing is preferably carried out by aeration culture, such as shaking culture. Shaking culture is preferably carried out at 80 rpm or higher, more preferably at 100 rpm or higher, and even more preferably at 110 to 400 rpm. This allows the effects of the present invention to be exhibited more favorably. Furthermore, jar fermenters or bioreactors that can simultaneously aerate and agitate the culture medium may be used for cultivation. The degree of aeration and agitation can be adjusted as appropriate.
[0032] The culture temperature is not particularly limited, as long as it is a temperature at which the Aspergillus oryzae can consume the galactose and glucose produced by lactose decomposition. However, it is preferably the optimal temperature for the Aspergillus oryzae, preferably above 20°C to 40°C, and more preferably 25°C to 37°C. This allows the effects of the present invention to be exhibited more favorably.
[0033] The culture time is not particularly limited, but it should be as long as it allows the koji mold to consume the galactose and glucose produced by lactose decomposition. Preferably, it should be 1 day or more, more preferably 2 days or more, or 3 days or more, and even more preferably 5 days or more, or 7 days or more. The upper limit is until no lactose, galactose, glucose, or any of these sugars remain in the milk-derived liquid component, preferably 14 days or less, and more preferably 10 days or less. The culture time can be adjusted by changing the amount of lactase or koji mold used. By increasing the amount of lactase and / or koji mold used, lactose can be broken down more efficiently, thus shortening the culture time.
[0034] (Isolation of cultures) In the method of the present invention, after culturing Aspergillus oryzae, the culture product in the culture medium is separated from the culture medium.
[0035] Methods for separating the culture from the culture medium include, for example, extraction and purification (e.g., filtration and centrifugation). Of these, purification is preferred, and more preferably, filtration.
[0036] According to the method of the present invention, the lactose content in the liquid phase of the culture medium relative to the milk-derived liquid component before culturing can be preferably 20% by mass or less, more preferably 10% by mass or less, or 5% by mass or less, even more preferably 2% by mass or less, below the detection limit, or 0% by mass.
[0037] Furthermore, according to the method of the present invention, the galactose concentration (solid content) in the liquid phase of the culture medium can be reduced to preferably 30 g / L or less, 25 g / L or less, or 15 g / L or less, more preferably 5 g / L or less, 2 g / L or less, or 1.5 g / L or less, and even more preferably to below the detection limit or 0 g / L.
[0038] Furthermore, according to the method of the present invention, the glucose concentration (solid content) in the liquid phase of the culture medium can be preferably 5 g / L or less, or 3 g / L or less, more preferably 2 g / L or less, or 0.5 g / L or less, and even more preferably below the detection limit, or 0 g / L.
[0039] Furthermore, according to the method of the present invention, at least one of the biochemical oxygen demand (BOD) and soluble chemical oxygen demand (COD) of the liquid phase of the culture medium can be preferably 6000 mg / L or less, more preferably 5500 mg / L or less, or 5000 mg / L or less, and even more preferably 4500 mg / L or less, or 3000 mg / L or less. BOD can be measured according to JIS K 0102-1 18 Biochemical oxygen demand (BOD) and JIS K 0102-1 21.2 Iodine titration method. COD can be measured according to JIS K0102-1 17.2 Oxygen consumption by acidic potassium permanganate (CODMn).
[0040] Furthermore, according to the method of the present invention, the total nitrogen concentration in the liquid phase of the culture medium can be reduced to preferably 70% by mass or less, more preferably 60% by mass or less, even more preferably 55% by mass or less, or 50% by mass or less, relative to the milk-derived liquid component before culturing. The total nitrogen concentration can be measured in accordance with JIS K 0102 45 Total Nitrogen.
[0041] Furthermore, according to the method of the present invention, the total phosphorus concentration in the liquid phase of the culture medium can be reduced to preferably 10% by mass or less, more preferably 8% by mass or less, and even more preferably 7% by mass or less, relative to the milk-derived liquid component before culturing. The total phosphorus concentration can be measured in accordance with JIS K 0102 46.3 Total Phosphorus.
[0042] <2. Method for producing food or feed using liquid components derived from milk> According to the method of the present invention, koji mold that has transferred nutrients from a milk-derived liquid component can be efficiently obtained. As mentioned above, koji mold has experience being used in food production and as animal feed, so the method of the present invention is useful in the production of food or animal feed because it can efficiently obtain koji mold with high safety as a raw material.
[0043] In the production method of the present invention, lactose in a milk-derived liquid component containing lactose is broken down to produce glucose and galactose, or after producing glucose and galactose, koji mold is added and cultured, and the cultured product in the culture medium is separated from the culture medium and used as a raw material for food or animal feed.
[0044] The milk-derived liquid component, lactase, koji mold, culture conditions, and isolation method that can be used in the production method of the present invention are the same as those described above in item <1. Method for producing koji mold culture>. Furthermore, in the production method of the present invention, from the viewpoint of obtaining safer food or feed, the koji mold may preferably be a koji mold that has been used in the production of food, and from the viewpoint of obtaining a larger amount of koji mold, it may more preferably be the lactase-enhanced koji mold described above.
[0045] <3. Methods for purifying waste liquid> In the wastewater purification method of the present invention, lactose in a milk-derived liquid component containing lactose, which is the wastewater, is decomposed to produce glucose and galactose, or, after producing glucose and galactose, koji mold is added and cultured, and the culture is separated from the culture medium to obtain a liquid phase in which at least one of the biochemical oxygen demand and the soluble chemical oxygen demand is 6000 mg / L or less.
[0046] According to the purification method of the present invention, the sugar content, such as lactose, in the milk-derived liquid component, as well as at least one of BOD and COD, can be reduced by culturing Aspergillus oryzae. Therefore, the disposal costs of the milk-derived liquid component after use, and the environmental burden caused by disposal, can be reduced.
[0047] The milk-derived liquid component, lactase, Aspergillus oryzae, culture conditions, and separation method that can be used in the purification method of the present invention are the same as those described above in item <1. Method for producing Aspergillus oryzae culture>. Furthermore, in the purification method of the present invention, from the viewpoint of further reducing the environmental burden and disposal costs at the time of disposal, the Aspergillus oryzae may preferably be the lactase-enhanced Aspergillus oryzae described above. [Examples]
[0048] The present invention will be described below with reference to examples. The following examples are not intended to limit the present invention.
[0049] [Example 1] Selection of genes involved in lactose metabolism Aspergillus oryzae strain RIB40 (NBRC100959) was used as a representative strain of Aspergillus oryzae. The genome of strain RIB40 is registered in the official nucleotide sequence database, Genbank. Among the genes present in the genome of strain RIB40, the gene registered as Locus tag AO090012000445 (Sequence ID 1, Figure 1) was assumed to be a lactase gene involved in lactose metabolism, and the study was conducted. The amino acid sequence encoded by the gene of Sequence ID 1 is Sequence ID 2 (Figure 2). Sequence ID 2 was searched against the Genebank nr database using BLAST, and the only sequence that perfectly matched with both Query cover and Per. Ident at 100% was the sequence of strain RIB40 itself.
[0050] [Example 2] Preparation of DNA fragments containing lactase gene expression cassette (Composition of culture medium for Aspergillus oryzae) Yeast extract (powder, Difco Laboratories) 1% (w / v), peptone (Difco Laboratories) 2% (w / v), and D-glucose (Fujifilm Wako Pure Chemical Industries) 2% (w / v) were dissolved in pure water to prepare the YPD liquid medium, which was used in the following examples.
[0051] (Preparation of high-expression promoter and lactase gene genomic DNA fragments derived from Aspergillus oryzae) YPD liquid medium was added to a plastic tube, and RIB40 strain was cultured. Genomic DNA was extracted from the resulting bacterial cells. ISOPLANT (Nippon Gene Co., Ltd.) was used for genomic DNA extraction. Using the obtained genomic DNA as a template, PCR was performed with primers consisting of the nucleotide sequences of SEQ ID NOs: 3 (TAATCCACATGCAGCGGCCGCtctagatagcgagagtaaaaaaaaaaaaaga) and 4 (gcagcaacagagaggagcttcatGCtttgaaggtggtgcgaactt). The tef1 promoter region, which has been reported as a high-expression promoter of Aspergillus oryzae, was amplified to obtain PCR fragments (Kitamoto N. et al. Appl. Microbiol. Biotechnol 50, 85-92 (1998)). Similarly, PCR was performed using genomic DNA as a template with primers consisting of the nucleotide sequences of SEQ ID NOs. 5 (atgaagctcctctctgttgct) and 6 (TACATACGGGACACAGCCATTTACACAATTGGCGCGCCttttcaatgattgagaatcatttattcctaggt), and the lactase gene of SEQ ID NO. 1 and its 3' untranslated region were amplified to obtain PCR fragments. These PCR fragments were subjected to electrophoresis on an agarose gel, and the DNA fragments were excised from the gel and purified using the QIAEX II Gel extraction kit (Qiagen Co., Ltd.). These purified DNA fragments were designated as "tef1 promoter purified fragment" and "lactase gene / 3' untranslated region purified fragment," respectively.
[0052] (Preparation of vector fragments) Furthermore, pPTRI (Takara Bio Inc.) was used as the transformation vector for Aspergillus oryzae. pPTRI was cleaved with the restriction enzyme NdeI (Nippon Gene Inc.). After electrophoresis on an agarose gel, the cleaved fragments were excised from the gel and purified using the QIAEX II Gel extraction kit to obtain DNA fragments. These were used as the purified pPTRI vector fragments.
[0053] (Composition of culture medium for expression cassette preparation) A medium containing 1% (w / v) tryptone, 0.5% (w / v) yeast extract, and 1% (w / v) sodium chloride was prepared as LB liquid medium. To this, 15 g / L of agar and 100 μg / mL of sodium ampicillin were added to prepare ampicillin-containing LB agar medium, which was used in the following examples.
[0054] (Creation of DNA fragments including expression cassettes) The purified fragments of the tef1 promoter, lactase gene / 3' untranslated region, and pPTRI vector were mixed with Gibson Assembly Master mix (New England Biolab Japan Co., Ltd.) and reacted at 50°C for 60 minutes. This reaction mixture was mixed with transformation bacteria (NEB 5-alpha Competent E. coli (High Efficiency), New England Biolab Japan Co., Ltd.), and transformation was carried out according to the manual.
[0055] Transformed E. coli were cultured on ampicillin-containing LB agar for approximately 18 hours to obtain grown colonies. DNA extracted from these colonies was used as a PCR template to confirm that an expression cassette consisting of the tef1 promoter, lactase gene, and 3' untranslated region was inserted into the pPTRI vector. These colonies were cultured in LB liquid medium, and the vector DNA was purified from the resulting E. coli cells using the QIAprep Spin Miniprep Kit (Qiagen Co., Ltd.). The sequence of the expression cassette consisting of the tef1 promoter, lactase gene, and 3' untranslated region introduced into this vector DNA was confirmed to be the desired sequence by nucleotide sequence analysis and PCR. Furthermore, using the restriction enzyme MfeI (New England Biolab Japan Co., Ltd.), a DNA fragment containing the expression cassette consisting of the tef1 promoter, lactase gene, and 3' untranslated region, as well as the pyrithiamine resistance marker gene originally present on the vector, was cleaved. This DNA fragment was purified using ethanol precipitation to obtain a purified DNA fragment containing the expression cassette. The base sequence of the DNA fragment containing the expression cassette is sequence number 7 (Figure 3).
[0056] The tef1 promoter, lactase gene, and 3' untranslated region contained in Sequence ID No. 7 were subjected to homology searches with the genomic DNA of Aspergillus oryzae using BLAST. As a result, all components completely matched the registered nucleotide sequences derived from Aspergillus oryzae, confirming that they all originate from Aspergillus oryzae. The pyrithiamine resistance gene contained in Sequence ID No. 7 was obtained from a pyrithiamine-resistant mutant strain of Aspergillus oryzae (Japanese Patent Publication No. 2000-308491), and its nucleotide sequence is derived from Aspergillus oryzae.
[0057] [Example 3] Introduction of an expression cassette into the Aspergillus genome (Composition of culture medium for Aspergillus oryzae) A pH 6.5 medium containing 6.0 g of sodium nitrate, 0.52 g of potassium chloride, 1.52 g of potassium dihydrogen phosphate, 10 g of glucose, 0.49 g of magnesium sulfate heptahydrate, 0.001 g of ferrous sulfate heptahydrate, 0.0088 g of zinc sulfate heptahydrate, 0.0004 g of copper sulfate pentahydrate, 0.0001 g of sodium tetraborate decahydrate, and 0.00005 g of ammonium heptamolybdate tetrahydrate was prepared as Czapek-Dox (CD) medium, and 20 g of agar was added to 1 L of CD medium to prepare CD agar medium.
[0058] (Creation of self-cloning strains of the lactase gene in Aspergillus oryzae) Following the manual of pPTRI (Takara Bio Inc.), protoplasts of the host strain RIB40 were prepared, and a purified DNA fragment containing the expression cassette described in Example 2 was introduced into the RIB40 strain. The RIB40 strain with the introduced DNA fragment was cultured on CD agar medium containing pyrithiamine at a final concentration of 0.1 μg / mL. Colonies that grew on this pyrithiamine-containing CD agar medium were further cultured on liquid CD medium containing pyrithiamine at a final concentration of 0.1 μg / mL. Subsequently, the cultured cells were collected by centrifugation, and genomic DNA was extracted using ISOPLANT. PCR was used to confirm that the expression cassette containing the pyrithiamine resistance gene, tef1 promoter, lactase gene, and 3' untranslated region had been introduced into the genome. Since all the base sequences constituting the introduced DNA are derived from the same Aspergillus oryzae as the host, this genetic modification can be considered self-cloning. The resulting strain was designated as the lactase gene self-cloning strain (hereinafter referred to as the "self-cloning strain").
[0059] [Example 4] Preparation of Aspergillus oryzae spore suspension The Aspergillus oryzae strain RIB40 was cultured on CD agar medium for 4-6 days, and the self-cloning strain was cultured on pyrithiamine-containing CD agar medium. Spores formed on the medium were collected with a sterile cotton swab and suspended in an aqueous solution containing 1 g of Tween80 and 4 g of sodium chloride per liter to prepare a spore suspension. The spore suspension was diluted as needed and placed in a plastic cuvette, and the optical density (OD600) at a wavelength of 600 nm was measured using a spectrophotometer. Based on the results, the spore concentration was adjusted so that the OD600 of the spore suspension was approximately 7.
[0060] [Example 5] Reduction of whey sugar concentration by culturing Aspergillus oryzae Whey was obtained from a dairy manufacturer in Japan. The whey was dispensed into 500 mL Erlenmeyer flasks, 50 mL each.
[0061] 500 μL each of spore suspensions of the RIB40 strain and the self-cloning strain, prepared using the method described above, were added to this flask (final concentration of Aspergillus oryzae: OD600 = 0.07). These experimental conditions were designated as "without wild-type lactase" and "self-cloning strain," respectively. In addition, 20 mg of Aspergillus oryzae-derived lactase powder (Fujifilm Wako Pure Chemical Industries, Ltd.) (8 mg per 1 g of lactose in whey) was added to the RIB40 strain spore suspension and designated as "with wild-type lactase" (Table 1).
[0062] Each flask was capped with a breathable silicone cap, and culture was performed at 30°C and 120 rpm with shaking. Four flasks were prepared for each of the following: "without wild-type lactase," "with wild-type lactase," and "self-cloning strain." Two of these flasks were cultured for 3 days, and the remaining two for 7 days. A shaking incubator TB-25R-2FS (Takasaki Kagaku Co., Ltd.) was used for the culture.
[0063] [Table 1]
[0064] After the culture was complete, each culture medium and the pre-culture whey were filtered through a Miracross filter to collect the liquid portion. Amberlite IR-120B (Organo Corporation) was added to this culture filtrate to adsorb cations, and the supernatant was centrifuged at 15,000 rpm for 40 seconds. The supernatant was filtered through a 0.22 μm filter, and the residual sugar concentration was analyzed using high-performance liquid chromatography (HPLC). For HPLC analysis, an LC-VP system (Shimadzu Corporation) equipped with a RID-10A suggestive refractive index detector (Shimadzu Corporation) was used. An HPX-87H column (300 × 7.8 mm, BIO-RAD) was used as the column, 14 mM sulfuric acid as the mobile phase, and the flow rate was 0.7 mL / min. LabSolutions version 5.73 (Shimadzu Corporation) was used for data analysis. 1% (w / v) aqueous solutions of lactose, glucose, and galactose were used as standard solutions, and the concentrations of each sugar in the culture medium were calculated.
[0065] [result] The residual sugar concentrations in whey under each condition—"without wild-type lactase," "with wild-type lactase," and "self-cloning strain"—are shown in Figure 4. Figure 4A shows that when Aspergillus oryzae is cultured in whey, the sugar concentration hardly changes under conditions without lactase addition, indicating that very little sugar is consumed in the culture medium. On the other hand, Figure 4B shows that when lactase is added to the whey, the sugar content in the culture medium is significantly reduced by culturing Aspergillus oryzae. Furthermore, Figure 4C shows that when a self-cloning strain is cultured, the sugar content is significantly reduced, similar to the results in Figure 4B, and after 7 days, almost no sugar remains in the culture medium. The results in Figures 4A and 4B suggest that the addition of lactase is very important for Aspergillus oryzae to consume the sugars in whey.
[0066] [Example 6] Reduction of BOD, COD, total nitrogen concentration, and total phosphorus concentration of whey by culturing Aspergillus oryzae. After sterilizing the pre-culture whey and the culture filtrates from Example 5 in an autoclave, BOD, COD, total nitrogen concentration, and total phosphorus concentration were measured. BOD was measured according to JIS K 0102-1 18 Biochemical Oxygen Demand (BOD) and JIS K 0102-1 21.2 Iodine Titration Method. COD was measured according to JIS K0102-1 17.2 Oxygen Consumption by Acidic Potassium Permanganate (COD) Mn The measurements were conducted in accordance with the following standards: Total phosphorus concentration was measured according to JIS K 0102 46.3 Total Phosphorus. Total nitrogen concentration was measured according to JIS K 0102 45 Total Nitrogen. The measurements were outsourced to the Environmental Research Center Co., Ltd. (Tsukuba City, Ibaraki Prefecture).
[0067] [result] The results of component analysis of whey before culture and culture filtrates with and without wild-type lactase were compared (Figure 5). From the results in Figures 5A and 5B, it was clear that adding lactase when culturing wild-type Aspergillus oryzae in whey significantly reduced the BOD and COD of the whey. The BOD and COD of the whey before culture were 39,000 mg / L and 38,000 mg / L, respectively, but under the condition of "with wild-type lactase added," both BOD and COD were significantly reduced to below 5,000 mg / L after 7 days of culture. Furthermore, from the results in Figures 5C and 5D, it was clear that culturing wild-type Aspergillus oryzae also significantly reduced the concentrations of nitrogen and phosphorus in the whey. These results suggest that culturing Aspergillus oryzae in whey with added lactase can significantly reduce the cost of whey wastewater treatment.
[0068] Next, the results of component analysis of the culture filtrates of whey before culture, and of the cultures without wild-type lactase and of the self-cloned strain were compared (Figure 6). From the results in Figures 6A and 6B, it was clear that culturing the self-cloned strain in whey significantly reduced the BOD and COD of the whey. The BOD and COD of the whey before culture were 39,000 mg / L and 38,000 mg / L, respectively, but it was clear that culturing the self-cloned strain for 7 days drastically reduced both BOD and COD to below 5,000 mg / L. Furthermore, from the results in Figures 6C and 6D, it was clear that culturing the self-cloned strain also significantly reduced the concentrations of nitrogen and phosphorus in the whey. These results suggest that culturing a self-cloned strain that highly expresses the lactase gene in whey can significantly reduce the cost of whey wastewater treatment.
[0069] [Example 7] Dry weight of the microbial cells obtained by filtration and isolation after culturing koji mold in whey. The dry weight of bacterial cells isolated from the culture media of Example 5, specifically "without wild-type lactase," "with wild-type lactase," and "self-cloning strain," was measured. The results are shown in Figure 7.
[0070] [result] Compared to the "no wild-type lactase added" group, the "with wild-type lactase added" group after culturing showed a 1.63-fold increase in cell mass, and the self-cloning strain after culturing showed a 1.65-fold increase. Although the reason is not entirely clear, it is presumed that by breaking down lactose in the whey to produce glucose and galactose, or by culturing Aspergillus oryzae after producing glucose and galactose, the Aspergillus oryzae consumed the glucose and galactose, allowing nutrients from the whey to be transferred to the Aspergillus oryzae. From these findings, it has become clear that the method of the present invention allows for the more efficient acquisition of Aspergillus oryzae that can be used in the production of food and feed.
Claims
1. A method for producing a culture of Aspergillus oryzae, comprising decomposing lactose in a milk-derived liquid component containing lactose to produce glucose and galactose, or, after producing glucose and galactose, adding Aspergillus oryzae and culturing, and separating the culture from the culture medium.
2. The method according to claim 1, wherein the breakdown of lactose is performed using lactase.
3. The method according to claim 1, wherein the Aspergillus oryzae is a lactase-enhanced Aspergillus oryzae in which at least one nucleic acid derived from a microorganism of the same genus and species as the host is introduced from outside the cell, and the lactase gene is expressed more highly than that of wild-type Aspergillus oryzae due to at least one of the introduced nucleic acids.
4. The method according to claim 3, wherein the lactase gene comprises a polynucleotide sequence encoding an amino acid sequence that has 70% or more identity with the amino acid sequence of Sequence ID No. 2 and has lactase activity.
5. The method according to claim 3 or 4, wherein the decomposition of lactose is performed by the lactase-enhanced koji mold.
6. The method according to claim 1 or 2, wherein the milk-derived liquid component is whey.
7. A method for producing food or feed, comprising: decomposing lactose in a milk-derived liquid component containing lactose to produce glucose and galactose; or, after producing glucose and galactose, adding Aspergillus oryzae and culturing the culture; and separating the culture from the culture medium for use as a raw material for food or feed.
8. A method for purifying wastewater, comprising decomposing lactose in a milk-derived liquid component containing lactose, which is wastewater, to produce glucose and galactose, or, after producing glucose and galactose, adding Aspergillus oryzae and culturing, separating the culture from the culture medium to obtain a liquid phase in which at least one of the biochemical oxygen demand and the soluble chemical oxygen demand is 6000 mg / L or less.