Enzyme carrier, method for producing an enzyme carrier, and method for decomposing polyethylene terephthalate

Abstract

The present invention provides an enzyme carrier with high decomposition activity and high stability for polyethylene terephthalate, a method for producing the enzyme carrier, and a method for decomposing polyethylene terephthalate. [Solution] An enzyme carrier comprising a metal-organic structure consisting of a metal ion and an organic ligand, and an enzyme supported on the metal-organic structure, wherein the enzyme includes branch leaf compost cutinase or a variant thereof.

Description

[Technical Field]

[0001] The present invention relates to an enzyme carrier, a method for producing an enzyme carrier, and a method for decomposing polyethylene terephthalate. More specifically, the present invention relates to an enzyme carrier, a method for producing an enzyme carrier, and a method for decomposing polyethylene terephthalate that have high decomposition activity and high stability for polyethylene terephthalate. [Background technology]

[0002] Conventionally, plastics such as polyethylene terephthalate (PET) are produced and consumed in large quantities in modern society because they are inexpensive and easy to process. However, the amount of plastic that is recycled is still small, and most waste plastics are disposed of by landfill or incineration. Therefore, plastic decomposition technology using enzymes is attracting attention (Patent Documents 1-2). Patent Document 1 discloses a method for improving the activity of a PET-degrading enzyme, which is decomposed by acting on PET together with a surfactant using a PET-degrading enzyme consisting of a predetermined amino acid sequence. Patent Document 2 discloses a method for decomposing plastic products, which includes a step of depolymerizing PET using depolymerase under acidic conditions. [Prior art documents] [Patent Documents]

[0003] [Patent Document 1] International Publication No. 2018 / 1686679 [Patent Document 2] Special Publication No. 2024-519033 [Overview of the project] [Problems that the invention aims to solve]

[0004] However, the enzymes used in the methods described in Patent Documents 1 and 2 have low stability and cannot function over a long period of time. Therefore, the methods described in Patent Documents 1 and 2 are insufficient for industrial use. Furthermore, there is room for improvement in the decomposition activity of the enzymes used in the methods described in Patent Documents 1 and 2 regarding polyethylene terephthalate.

[0005] This invention has been made in view of the above-mentioned conventional inventions, and aims to provide an enzyme carrier, a method for producing the enzyme carrier, and a method for decomposing polyethylene terephthalate that have high decomposition activity and high stability for polyethylene terephthalate. [Means for solving the problem]

[0006] As a result of diligent research, the inventors of the present invention have found that the above problems can be solved by using a metal-organic structure consisting of a metal ion and an organic ligand, and supporting an enzyme on it, and have completed the present invention. That is, the enzyme carrier, method for producing the enzyme carrier, and method for decomposing polyethylene terephthalate of the present invention that solve the above problems mainly include the following components.

[0007] (1) An enzyme carrier comprising a metal-organic structure consisting of a metal ion and an organic ligand, and an enzyme supported on the metal-organic structure, wherein the enzyme includes branch leaf compost cutinase or a variant thereof.

[0008] With this configuration, the enzyme carrier exhibits high polyethylene terephthalate degradation activity and high stability. Therefore, the enzyme carrier can maintain polyethylene terephthalate degradation activity over a long period of time, making it suitable for industrial use.

[0009] (2) The enzyme carrier according to (1), wherein the enzyme is supported on the surface of the metal-organic structure in an immobilized state.

[0010] With this configuration, the enzyme carrier exhibits higher degrading activity and greater stability of polyethylene terephthalate.

[0011] (3) The enzyme carrier according to (1), wherein the enzyme is supported in a state of being immobilized inside the metal-organic structure.

[0012] According to such a configuration, the enzyme carrier has high decomposition activity for polyethylene terephthalate and high stability. Also, the manufacturing method of the enzyme carrier is simple.

[0013] (4) The enzyme carrier according to any one of (1) to (3), wherein the average particle diameter of the metal-organic structure is 2000 nm or less.

[0014] According to such a configuration, the enzyme carrier has higher decomposition activity for polyethylene terephthalate and higher stability.

[0015] (5) The enzyme carrier according to any one of (1) to (4), wherein the metal-organic structure is hydrophilic.

[0016] According to such a configuration, the enzyme carrier has higher decomposition activity for polyethylene terephthalate and higher stability.

[0017] (6) The enzyme carrier according to any one of (1) to (5), wherein the enzyme further contains MHETase. [[ID=z8]]

[0018] According to such a configuration, the enzyme carrier can not only decompose polyethylene terephthalate into mono(2-hydroxyethyl) terephthalate, but also further decompose mono(2-hydroxyethyl) terephthalate into ethylene glycol and terephthalic acid.

[0019] (7) The enzyme carrier according to (6), wherein the branched leaf compost cutinase or its mutant is supported in a state of being immobilized on the surface of the metal-organic structure, and the MHETase is supported in a state of being immobilized inside the metal-organic structure.

[0020] According to such a configuration, the enzyme carrier has higher polyethylene terephthalate degradation activity and higher stability.

[0021] (8) A method for producing an enzyme carrier, comprising a mixing step of mixing a first solution containing metal ions, a second solution containing an organic ligand, and an enzyme, wherein the enzyme includes a lignocellulose cutinase or a variant thereof.

[0022] According to such a configuration, an enzyme carrier in which an enzyme is supported on a metal-organic structure can be produced by a simple method. The obtained enzyme carrier has high polyethylene terephthalate degradation activity and high stability.

[0023] (9) The mixing step includes a first mixing step of mixing the first solution and the second solution to prepare a metal-organic structure composed of metal ions and an organic ligand, and a second mixing step of further mixing the enzyme with the obtained metal-organic structure. The method for producing an enzyme carrier according to (8).

[0024] According to such a configuration, an enzyme carrier in which an enzyme is supported on the surface of a metal-organic structure can be produced by a simple method. The obtained enzyme carrier has higher polyethylene terephthalate degradation activity and higher stability.

[0025] (10) The first solution is a zinc nitrate hexahydrate solution, the second solution is a 2-methylimidazole solution, the concentration of the zinc nitrate hexahydrate is 5 to 300 mM in the first solution, and the concentration of the 2-methylimidazole is 0.025 to 4.0 M in the second solution. The method for producing an enzyme carrier according to (8) or (9).

[0026] According to such a configuration, the obtained enzyme carrier has higher polyethylene terephthalate degradation activity and higher stability.

[0027] (11) A method for decomposing polyethylene terephthalate, comprising the step of decomposing polyethylene terephthalate into monohydroxyethyl terephthalate by contacting polyethylene terephthalate with an enzyme carrier described in any of (1) to (5).

[0028] This configuration allows for efficient decomposition of polyethylene terephthalate. Furthermore, due to the high stability of the enzyme carrier, this decomposition method is also suitable for industrial applications.

[0029] (12) A method for decomposing polyethylene terephthalate, comprising the step of contacting polyethylene terephthalate with the enzyme carrier described in (6) or (7) to decompose the polyethylene terephthalate into ethylene glycol and terephthalic acid.

[0030] This configuration allows for efficient decomposition of polyethylene terephthalate into mono(2-hydroxyethyl) terephthalate, and then further decomposition of mono(2-hydroxyethyl) terephthalate into ethylene glycol and terephthalic acid. Furthermore, due to the high stability of the enzyme carrier, this decomposition method is also suitable for industrial applications. [Effects of the Invention]

[0031] According to the present invention, it is possible to provide an enzyme carrier with high decomposition activity for polyethylene terephthalate and high stability, a method for producing the enzyme carrier, and a method for decomposing polyethylene terephthalate. [Brief explanation of the drawing]

[0032]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

[0033] <Enzyme carrier> The enzyme carrier of one embodiment of the present invention has a metal-organic framework composed of metal ions and an organic ligand, and an enzyme supported on the metal-organic framework. The enzyme includes a foliage compost cutinase or a variant thereof. Each will be described below.

[0034] (Metal-organic framework) The metal-organic framework is composed of metal ions and an organic ligand. The metal-organic framework supports an enzyme.

[0035] ·Metal ions The metal ions are not particularly limited. For example, the metal ions are transition metal ions or alkaline earth metal ions, etc. The transition metals are elements in Groups 3A, 4A, 5A, 6A, 7A, 8, 1B, and 2B of the periodic table, etc. Also, the metal ions are divalent or trivalent cations. The divalent metal ions are Ni , 2+ , 2+ , , 3+ , 3+ , , ,

[0036] , 2+ , 2+ , 2+ , 3+ ,

[0037] , , Zn 2+ , Cu 2+ , Co 2+ , Mg 2+ , Ca 2+ , Fe 2+ , Mn 2+ , etc. The trivalent metal ions are Fe 3+ , Al <00s0010>, Cr 3+ , Mn 3+ , etc. Among these, the metal ions are preferably Zn 2+ , Co 2+ , Ni 2+ , Cu 2+ , and more preferably Zn 2+ . The metal ions may be used in combination.

[0036] ·Organic ligand The organic ligand is not particularly limited. For example, the organic ligand is a compound having two or more coordination groups for coordination to the above-mentioned metal ions.

[0037] The organic ligands are not particularly limited. For example, organic ligands include imidazole ligands such as 2-methylimidazole, 2-ethylimidazole, 1H-imidazole, 4-nitroimidazole, and 2-mercaptoimidazole; triazole ligands such as 3-methyl-1H-1,2,4-triazole, 1,2,4-triazole, and 5-amino-1H-1,2,4-triazole; carboxylic acid ligands such as terephthalic acid (TPA), 1,3,5-benzenetricarboxylic acid (BTC), fumaric acid, and adipic acid; bipyridine ligands such as 4,4'-bipyridine (bpy), 2,2'-bipyridine (bpy), and 5,5'-dimethyl-2,2'-bipyridine; and porphyrin ligands such as tetrakis(4-carboxyphenyl)porphyrin (TCPP) and meso-tetraphenylporphyrin (TPP). Among these, the organic ligands are preferably 2-methylimidazole, 2-ethylimidazole, and 3-methyl-1H-1,2,4-triazole, as they allow for easy adjustment of affinity for water.

[0038] The metal-organic frameworks (MOFs) of this embodiment consist of the metal ions and organic ligands described above, and are porous materials formed by three-dimensional coordination bonding between the metal ions and organic ligands. The metal-organic framework has a framework in which the metal ions and organic ligands are cross-linked, and enzymes can be supported using this framework.

[0039] The average particle size of the metal-organic structure is not particularly limited. The average particle size of the metal-organic structure can be adjusted depending on the type and concentration of the metal ions and organic ligands used, and the manufacturing method. For example, the average particle size of the metal-organic structure is preferably 2000 nm or less, more preferably 1000 nm or less, and even more preferably 50 nm or less. Furthermore, the lower limit of the average particle size of the metal-organic structure is not particularly limited. When an enzyme is supported internally, the lower limit of the average particle size of the metal-organic structure can be appropriately determined according to the dimensions of the supported enzyme. On the other hand, when an enzyme is supported externally, the lower limit of the average particle size of the metal-organic structure may be the lowest possible size regardless of the dimensions of the enzyme. The average particle size of the metal-organic structure should be such that the metal-organic structure can be recovered. By having the average particle size of the metal-organic structure within the above range, the enzyme carrier exhibits higher polyethylene terephthalate degradation activity and greater stability. In this embodiment, the average particle size of the metal-organic structure can be measured by observation using a scanning electron microscope (SEM).

[0040] The affinity of a metal-organic structure for water is not particularly limited. The metal-organic structure may be hydrophilic or hydrophobic. Depending on the type of organic ligand, the metal-organic structure may exhibit hydrophilicity or hydrophobicity. For example, when the organic ligand is 2-methylimidazole, the metal-organic structure may exhibit hydrophobicity. On the other hand, when the organic ligand is 3-methyl-1H-1,2,4-triazole, the metal-organic structure may exhibit hydrophilicity.

[0041] In this embodiment, it is preferable that the metal-organic structure of the enzyme carrier is hydrophilic. This results in the enzyme carrier having higher polyethylene terephthalate degradation activity and greater stability.

[0042] In this embodiment, hydrophilicity or hydrophobicity can be distinguished by the contact angle, hydrophilicity index (HLB), partition coefficient (LogP), etc. Furthermore, the degree of hydrophilicity can also be adjusted, for example, by the extent to which nitrogen atoms (N) are contained within the five-membered ring of the ligand.

[0043] ·enzyme The enzyme includes branch and leaf compost cutinase or its variants, and has the activity to decompose polyethylene terephthalate.

[0044] Leaf-Branch Compost Cutinase (LCC) is an enzyme discovered in microorganisms present in compost. Like PETase, it is an enzyme that breaks down polyethylene terephthalate into mono(2-hydroxyethyl) terephthalate (MHET).

[0045] Furthermore, mutants of leaf compost cutinase are enzymes whose hydrolytic activity and thermal stability of PET are improved by mutating specific sites within the leaf compost cutinase enzyme. Mutants of leaf compost cutinase are not particularly limited. For example, LCC-ICCG is one such mutant.

[0046] Among these, LCC-ICCG is preferred as the mutant of leaf compost cutinase due to its superior hydrolytic activity and thermal stability of PET. LCC-ICCG is a mutant of leaf compost cutinase in which four amino acids at specific positions in the amino acid sequence are mutated to I (isoleucine), C (cysteine), C (cysteine), and G (glycine). By using LCC-ICCG as the mutant of leaf compost cutinase, the enzyme carrier exhibits high polyethylene terephthalate degradation activity and high stability.

[0047] The average molecular diameter of the enzyme is not particularly limited. For example, it is preferable that the average molecular diameter of the enzyme be 3 nm or larger. It is also preferable that the average molecular diameter of the enzyme be 50 nm or smaller.

[0048] In this embodiment, the enzyme carrier has an enzyme supported on a metal-organic structure. As a result, the enzyme carrier has high polyethylene terephthalate degradation activity and high stability. Furthermore, as will be described later, the enzyme carrier can be easily prepared by mixing it with the metal-organic structure after it has been prepared, or by mixing it with metal ions and organic ligands, thus the manufacturing method is simple.

[0049] The enzyme may be immobilized on the surface of the metal-organic structure or immobilized inside the metal-organic structure. Figure 1 is a schematic diagram of an enzyme support in which the enzyme is immobilized on the surface of the metal-organic structure. Figure 2 is a schematic diagram of an enzyme support in which the enzyme is immobilized inside the metal-organic structure. Among these, it is preferable that the enzyme is immobilized on the surface of the metal-organic structure. This results in an enzyme support with higher polyethylene terephthalate degradation activity and greater stability. The reason why an enzyme support with the enzyme immobilized on the surface of the metal-organic structure has higher polyethylene terephthalate degradation activity and greater stability than an enzyme support with the enzyme immobilized inside the metal-organic structure is thought to be because the catalytic site of the enzyme is more easily in contact with the amorphous region of polyethylene terephthalate.

[0050] The immobilization rate of the enzyme (cutinase or its variant) in the enzyme carrier is not particularly limited. For example, the higher the enzyme immobilization rate, the better; it is preferably 60% or more, and more preferably 80% or more, in the enzyme carrier. When the enzyme immobilization rate is within the above range, the enzyme carrier has high polyethylene terephthalate degradation activity and high stability.

[0051] The enzyme of this embodiment preferably includes MHETase in addition to branch leaf compost cutinase or its variant. MHETase is an enzyme that decomposes mono(2-hydroxyethyl) terephthalate (MHET), which is broken down from PET, into ethylene glycol and terephthalic acid.

[0052] Thus, the enzyme carrier of this embodiment, by further containing an enzyme including MHETase, can not only decompose polyethylene terephthalate into mono(2-hydroxyethyl) terephthalate, but also further decompose mono(2-hydroxyethyl) terephthalate into ethylene glycol and terephthalic acid. The resulting ethylene glycol and terephthalic acid are starting materials for the industrial production of polyethylene terephthalate. Therefore, the enzyme carrier of this embodiment is easily applicable to processes that decompose discarded polyethylene terephthalate into ethylene glycol and terephthalic acid, and then produce new polyethylene terephthalate, making it easy to recycle waste plastics industrially and efficiently.

[0053] In addition to burdock compost cutinase or its variants, if MHETase is also included, it is preferable that in this embodiment, burdock compost cutinase or its variants are immobilized on the surface of the metal-organic structure, and MHETase is immobilized inside the metal-organic structure. This results in an enzyme carrier with higher polyethylene terephthalate degradation activity and greater stability.

[0054] In addition to burdock compost cutinase or its variants, when MHETase is also included, the immobilization rate of MHETase in the enzyme carrier is not particularly limited. For example, the higher the MHETase immobilization rate, the better; it is preferably 60% or more, and more preferably 80% or more, in the enzyme carrier. When the MHETase immobilization rate is within the above range, the enzyme carrier has high polyethylene terephthalate degradation activity.

[0055] Furthermore, generally, when enzymes are mixed with organic solvents, the electrostatic repulsion between enzymes increases, causing precipitation and disrupting the enzyme's three-dimensional structure, which tends to reduce its catalytic activity. In addition, denaturing agents such as urea cleave the hydrogen bonds of enzymes, reducing their catalytic activity. However, in this embodiment, the enzyme support is supported on a metal-organic structure. Therefore, the enzyme is easily protected from the external environment, and its three-dimensional structure is less likely to change. As a result, this embodiment of the enzyme support exhibits excellent stability against various chemicals (e.g., urea, ethanol, DMSO, etc.).

[0056] As described above, the enzyme carrier of this embodiment exhibits high polyethylene terephthalate degradation activity and high stability. Therefore, the enzyme carrier can maintain polyethylene terephthalate degradation activity over a long period of time and is suitable for industrial use.

[0057] <Method for producing enzyme carriers> A method for producing an enzyme carrier according to one embodiment of the present invention includes a mixing step of mixing a first solution containing metal ions, a second solution containing an organic ligand, and an enzyme. The enzyme includes branch leaf compost cutinase or a variant thereof. Each of these will be described below.

[0058] (First solution) The first solution contains metal ions. The metal ions are the same as those described above in relation to the enzyme carrier embodiment.

[0059] Metal ions can be used dissolved in the first solution in the form of metal salts. The metal salts are chloride salts, nitrates, sulfates, etc., and may also be their hydrates. Among these, the metal salt is preferably a nitrate, more preferably zinc nitrate, and even more preferably zinc nitrate hexahydrate.

[0060] The solvent constituting the first solution is not particularly limited. For example, the solvent constituting the first solution may be water.

[0061] In the first solution, the concentration of the metal salt is preferably 5 mM or higher, more preferably 40 mM or higher, and even more preferably 120 mM or higher. Furthermore, in the first solution, the concentration of the metal salt is preferably 300 mM or lower, more preferably 280 mM or lower, and even more preferably 260 mM or lower. By having the metal salt concentration within the above range, the resulting enzyme carrier has higher polyethylene terephthalate degradation activity and higher stability.

[0062] In particular, when the first solution is a zinc nitrate hexahydrate solution, the concentration of zinc nitrate hexahydrate in the first solution is preferably 5 mM or higher, more preferably 40 mM or higher, and even more preferably 120 mM or higher. Furthermore, the concentration of zinc nitrate hexahydrate in the first solution is preferably 300 mM or lower, more preferably 280 mM or lower, and even more preferably 260 mM or lower. By having the concentration of zinc nitrate hexahydrate within the above range, the resulting enzyme carrier has higher polyethylene terephthalate degradation activity and higher stability.

[0063] (Second solution) The second solution contains an organic ligand, which is the same as that described above in relation to the enzyme carrier embodiment.

[0064] The organic ligand can be used dissolved in the second solution. The solvent constituting the second solution is not particularly limited. For example, the solvent constituting the second solution may be methanol, ethanol, 2-propanol, butanol, acetonitrile, tetrahydrofuran, N,N-dimethylformamide (DMF), N,N-diethylformamide (DEF) dimethyl sulfoxide (DMSO), water, or mixtures thereof. Among these, water is preferred for the second solution.

[0065] In the second solution, the concentration of the organic ligand is preferably 0.025 M or higher, more preferably 0.2 M or higher, and even more preferably 0.6 M or higher. Furthermore, in the second solution, the concentration of the organic ligand is preferably 4.0 M or lower, more preferably 3.0 M or lower, and even more preferably 2.5 M or lower. By having the concentration of the organic ligand within the above range, the resulting enzyme carrier exhibits higher polyethylene terephthalate degradation activity and greater stability.

[0066] In particular, when the second solution is an aqueous solution of 2-methylimidazole, the concentration of 2-methylimidazole in the second solution is preferably 0.025 M or higher, more preferably 0.2 M or higher, and even more preferably 0.6 M or higher. Furthermore, the concentration of 2-methylimidazole in the second solution is preferably 4.0 M or lower, more preferably 3.0 M or lower, and even more preferably 2.5 M or lower. By having the concentration of 2-methylimidazole within the above range, the resulting enzyme carrier exhibits higher polyethylene terephthalate degradation activity and greater stability.

[0067] (enzyme) The enzyme is the same as that described above in relation to the embodiment of the enzyme carrier.

[0068] The method for producing the enzyme carrier in this embodiment allows for the production of the enzyme carrier by a simple method of mixing the first solution, the second solution, and the enzyme. The resulting enzyme carrier exhibits high polyethylene terephthalate decomposition activity and high stability.

[0069] The mixing method is not particularly limited. For example, the mixing method may be a method of simultaneously mixing the first solution, the second solution, and the enzyme (the first method), or it may be a method including a first mixing step of mixing the first solution and the second solution to produce a metal-organic structure consisting of metal ions and organic ligands, and a second mixing step of further mixing the enzyme with the obtained metal-organic structure (the second method).

[0070] • Method 1 The first method involves simultaneously mixing the first solution, the second solution, and the enzyme. The mixing can be carried out by conventionally known methods; for example, the first solution, the second solution, and the enzyme can be placed in a reaction vessel at room temperature and stirred with a stirrer. The stirring time is not particularly limited. For example, the stirring time can range from 15 minutes to 1 hour.

[0071] In the first method, the mixing ratio of the first solution, the second solution, and the enzyme is not particularly limited as long as it is a mixing ratio that can yield an enzyme carrier in which the enzyme is immobilized inside a metal-organic structure. For example, by mixing 2 mL of a 40 mM zinc nitrate hexahydrate solution, 2 mL of a 1.6 M 2-methylimidazole solution, and 800 μg of LCC-ICCG, an enzyme carrier in which the enzyme is immobilized inside a metal-organic structure can be obtained.

[0072] The method for separating the obtained enzyme carrier is not particularly limited. For example, the enzyme carrier can be separated by centrifuging the mixed solution after stirring, removing the supernatant, and resuspending it in water.

[0073] According to the first method, an enzyme carrier in which the enzyme is immobilized inside a metal-organic structure is obtained. The first method is very simple because the enzyme carrier can be obtained in a single mixing step. In this embodiment, whether or not the enzyme is immobilized inside the metal-organic structure can be determined by labeling the enzyme with an appropriate fluorescent labeling reagent (for example, FITC-I) and observing the fluorescence image by irradiating it with excitation light at a wavelength of 473 nm using a confocal laser microscope (FV10, manufactured by Olympus Corporation).

[0074] • Second method The second method includes a first mixing step of mixing a first solution and a second solution to produce a metal-organic structure consisting of metal ions and organic ligands, and a second mixing step of further mixing an enzyme with the obtained metal-organic structure.

[0075] In the first mixing step, the first solution and the second solution are mixed to produce a metal-organic structure consisting of metal ions and organic ligands. Mixing can be carried out by conventionally known methods; for example, the first and second solutions can be placed in a reaction vessel at room temperature and stirred with a stirrer. The stirring time is not particularly limited. For example, the stirring time can be 15 minutes to 1 hour.

[0076] In the first mixing step, the mixing ratio of the first solution and the second solution is not particularly limited as long as it is a mixing ratio that can yield a metal-organic structure consisting of metal ions and organic ligands. For example, a metal-organic structure consisting of metal ions and organic ligands can be obtained by mixing 2 mL of a 40 mM zinc nitrate hexahydrate solution and 2 mL of a 1.6 M 2-methylimidazole solution.

[0077] The method for separating the obtained metal-organic structures is not particularly limited. For example, the metal-organic structures can be separated by centrifuging the mixed solution after stirring, removing the supernatant, and resuspending it with water.

[0078] In the second mixing step, the obtained metal-organic structure and the enzyme are mixed. Mixing can be carried out by conventionally known methods; for example, the metal-organic structure and the enzyme can be placed in a reaction vessel at room temperature and stirred with a stirrer. The stirring time is not particularly limited. For example, the stirring time can be 15 minutes to 1 hour.

[0079] In the second mixing step, the mixing ratio of the metal-organic structure and the enzyme is not particularly limited, as long as it is a mixing ratio that can be obtained in which an enzyme carrier with the enzyme immobilized on the surface of the metal-organic structure is obtained. For example, by mixing 4 mL of the metal-organic structure obtained above with 2 mL of 800 μg of LCC-ICCG, an enzyme carrier with the enzyme immobilized on the surface of the metal-organic structure can be obtained.

[0080] The method for separating the obtained enzyme carrier is not particularly limited. For example, the enzyme carrier can be separated by centrifuging the mixed solution after stirring, removing the supernatant, and resuspending it in water.

[0081] According to the second method, an enzyme carrier is obtained in which the enzyme is immobilized on the surface of a metal-organic structure. The obtained enzyme carrier has higher polyethylene terephthalate degradation activity and higher stability. In this embodiment, whether or not the enzyme is immobilized on the surface of the metal-organic structure can be determined by labeling the enzyme with an appropriate fluorescent labeling reagent (for example, FITC-I) and observing the fluorescence image by irradiating it with excitation light at a wavelength of 473 nm using a confocal laser microscope (FV10, manufactured by Olympus Corporation).

[0082] As described above, the method for producing the enzyme carrier of this embodiment allows for the simple production of an enzyme carrier in which an enzyme is supported on a metal-organic structure. The obtained enzyme carrier exhibits high decomposition activity of polyethylene terephthalate and high stability.

[0083] <Method for decomposing polyethylene terephthalate> (When using an enzyme carrier containing branch and leaf compost cutinase or its variants) A method for decomposing polyethylene terephthalate according to one embodiment of the present invention includes the step of decomposing polyethylene terephthalate into monohydroxyethyl terephthalate by contacting the polyethylene terephthalate with an enzyme carrier. The enzyme carrier comprises a metal-organic structure consisting of a metal ion and an organic ligand, and an enzyme supported on the metal-organic structure. The enzyme includes leaf compost cutinase or its variants. Each of these will be described below.

[0084] The decomposition method of this embodiment uses branch and leaf compost cutinase or a variant thereof as the enzyme. The branch and leaf compost cutinase or its variant is the same as that described above in relation to the embodiment of the enzyme carrier.

[0085] The reaction temperature is not particularly limited. Branch and leaf compost cutinase or its variants may exhibit polyethylene terephthalate decomposition activity at relatively high temperatures. Therefore, the reaction temperature is preferably 50°C or higher, and more preferably 55°C or higher. Furthermore, the reaction temperature is preferably 70°C or lower, and more preferably 65°C or lower. Decomposition of polyethylene terephthalate proceeds easily when the reaction temperature is within the above range.

[0086] The reaction time is not particularly limited. The reaction time is also influenced by the crystalline state of the polyethylene terephthalate to be decomposed, and the decomposition of crystalline polyethylene terephthalate tends to take a relatively long time.

[0087] Regarding pH, leaf compost cutinase or its variants exhibit decomposition activity in a weakly basic environment. Therefore, a pH of 7.8 or higher is preferable, and a pH of 8 or higher is more preferable. Furthermore, a pH of 8.7 or lower is preferable, and a pH of 8.4 or lower is more preferable. When the pH is within the above range, the decomposition of polyethylene terephthalate proceeds easily.

[0088] The method for adjusting the pH within the above range is not particularly limited. For example, the pH can be adjusted by using a buffer such as phosphate buffer or Tris buffer.

[0089] To improve the decomposition efficiency of the polyethylene terephthalate being processed, it is preferable that the polyethylene terephthalate be in the form of a thin film or fine particles. This increases the surface area, which can improve the decomposition efficiency.

[0090] Furthermore, the polyethylene terephthalate to be treated may be subjected to pretreatment such as heat treatment to reduce its crystallinity. In addition, the surface of the polyethylene terephthalate to be treated may be activated by alkaline treatment, and the hydrophobicity of the surface may be adjusted by coexisting with a surfactant.

[0091] As described above, according to the decomposition method of this embodiment, polyethylene terephthalate is decomposed to obtain mono(2-hydroxyethyl) terephthalate. In this embodiment, whether or not mono(2-hydroxyethyl) terephthalate has been obtained can be determined by measuring the absorbance at a wavelength of 244 nm. Furthermore, the enzyme carrier used in this embodiment is highly stable. Therefore, the decomposition method of this embodiment is also suitable for industrial use.

[0092] (When using a branch and leaf compost cutinase or its variants, and an enzyme carrier containing MHETase) A method for decomposing polyethylene terephthalate according to one embodiment of the present invention includes the step of contacting polyethylene terephthalate with an enzyme carrier to decompose the polyethylene terephthalate into ethylene glycol and terephthalic acid. The enzyme carrier comprises a metal-organic structure consisting of a metal ion and an organic ligand, and an enzyme supported on the metal-organic structure. The enzyme includes twig leaf compost cutinase or its variants, and MHETase. Each of these will be described below.

[0093] The decomposition method of this embodiment uses branch and leaf compost cutinase or its variants, and MHETase as enzymes. Branch and leaf compost cutinase or its variants, and MHETase are the same as those described above in relation to the enzyme carrier embodiment. The polyethylene terephthalate to be treated is also the same as those described above in relation to the enzyme carrier embodiment.

[0094] The reaction temperature is not particularly limited. The reaction temperature should be appropriately selected to facilitate the decomposition of polyethylene terephthalate.

[0095] The reaction time is not particularly limited. The reaction time should be appropriately selected to allow for the efficient decomposition of polyethylene terephthalate.

[0096] The pH should be appropriately selected to facilitate the decomposition of polyethylene terephthalate.

[0097] The method for adjusting the pH within the above range is not particularly limited. For example, the pH can be adjusted by using a buffer solution such as a phosphate buffer or a Tris buffer.

[0098] According to the decomposition method of this embodiment, polyethylene terephthalate is decomposed to obtain mono(2-hydroxyethyl) terephthalate, and then ethylene glycol and terephthalic acid can be obtained from the obtained mono(2-hydroxyethyl) terephthalate. The obtained ethylene glycol and terephthalic acid are starting materials in the industrial production of polyethylene terephthalate. Therefore, the enzyme carrier of this embodiment can easily decompose waste polyethylene terephthalate into ethylene glycol and terephthalic acid, and then is easily applicable to the process of newly producing polyethylene terephthalate, and can easily recycle waste plastics industrially and efficiently. In this embodiment, whether ethylene glycol and terephthalic acid are obtained can be grasped by evaluating the absorption near a wavelength of 240 to 244 nm in the absorbance measurement of PET decomposition products such as mono(2-hydroxyethyl) terephthalate and terephthalic acid. In addition, the enzyme carrier used in this embodiment has high stability. Therefore, the decomposition method of this embodiment is also suitable for industrial use.

Examples

[0099] Hereinafter, the present invention will be described more specifically by way of examples. The present invention is not limited to these examples in any way. Unless otherwise specified, “%” means “mass %”.

[0100] <Preparation of enzyme (LCC-ICCG)> (1) Preparation of insert The sequence information of pUCFa / LCC-ICCG (the underlined part is the sequence information of LCC-ICCG) commissioned to FASMAC for synthesis is shown below. <Sequence information of pUCFa / LCC-ICCG> 5'-TTTCCCTTAACGACGCTCTTCCGATCTGAT GGAGATATACATATGATGCAGTCCAATCCGTATCAACGTGGGCCAAATCCTACACGCTCAGCCTTAACGGCAGATGGGCCGTTTTCTGTCGCGACCTATACGGTCAGTCGCCTGAGCGTTTCGGGGTTTGGTGGCGGCGTGATCTACTATCCCACCGGCACGAGCCTGACCTTTGGTGGCATTGCGATGTCCCCAGGTTATACCGCCGATGCGAGTTCACTGGCGTGGCTCGGACGTCGTCTTGCCTCTCATGGCTTCGTAGTTCTGGTGATCAACACCAACAGTCGCTTCGATGGACCTGATAGCCGTGCATCCCAACTGTCTGCAGCTCTGAACTACCTTCGCACGTCGAGCCCGTCTGCCGTTCGTGCGCGTTTGGATGCCAATCGGCTGGCAGTTGCGGGCCATAGCATGGGAGGTGGCGGGACTTTACGCATTGCCGAACAGAACCCGAGCCTGAAAGCTGCTGTTCCGCTGACACCATGGCATACCGACAAGACGTTCAATACCAGTGTTCCGGTGCTGATCGTAGGGGCCGAAGCCGATACTGTCGCTCCTGTGTCGCAACACGCGATTCCGTTCTACCAGAACTTACCGAGCACTACGCCCAAAGTGTATGTCGAGTTGTGCAACGCGTCACACATTGCGCCAAACTCGAATAATGCGGCAATTAGCGTGTATACCATCTCGTGGATGAAACTCTGGGTGGACAATGACACTCGCTATCGCCAGTTTCTGTGCAACGTGAACGATCCGGCATTGTGTGACTTTCGCACCAACAATCGCCACTGTCAGGGCGGTGGTCATCATCACCACCATCATTGAGGATCCGGCTGCTAA ATCAGATCGGAAGAGCACACGTCTGAACTC-3' Using this plasmid as a template, PCR was performed using the primers listed in Table 1 below, with the PCR mixture of the following formulation, and under the following conditions to amplify the LCC-ICCG gene as an insert.

[0101] [Table 1]

[0102] (PCR mixture) PrimeSTAR Max Premix (2x) 25μL Forward primer (2 μM) 5 μL Reverse primer (2 μM) 5 μL Plasmid DNA (0.1 ng / μL) 10 μL 5 μL of ultrapure water Total 50 μL

[0103] (PCR conditions) Using a MiniAmp Plus thermal cycler (MiniAmp Plus, manufactured by Applied Biosystems), one cycle consisted of "98°C for 10 seconds (thermal denaturation), 55°C for 5 seconds (annealing), and 72°C for 8 seconds (extension reaction)," and this was repeated 35 times.

[0104] (2) Preparation of linearized vectors Using pET11a / PAE1888 as a template, PCR was performed using the primers listed in Table 2 below, with the following PCR mixture formulation, and under the following conditions to linearize the plasmid vector.

[0105] [Table 2]

[0106] (PCR mixture) PrimeSTAR Max Premix (2x) 25μL Forward primer (2 μM) 5 μL Reverse primer (2 μM) 5 μL Plasmid DNA (0.05 ng / μL) 10 μL 5 μL of ultrapure water Total 50 μL

[0107] (PCR conditions) Using a MiniAmp Plus thermal cycler (MiniAmp Plus, manufactured by Applied Biosystems), one cycle consisted of "98°C for 10 seconds (thermal denaturation), 55°C for 5 seconds (annealing), and 72°C for 28 seconds (extension reaction)," and this was repeated 35 times.

[0108] (3) In-Fusion Cloning Using the insert and linearization vector, a reaction mixture was prepared with the following composition, and in-fusion cloning was performed by incubation at 50°C for 15 minutes to construct a plasmid in which the LCC-ICCG gene insert was inserted into the vector pET-11a.

[0109] (In-Fusion cloning mixture) 5×In-Fusion HD Enzyme Premix 2.00μL Insert (85.3 ng / μL) 0.54 μL Lynealization vector (42.9 ng / μL) 3.59 μL 3.87 μL of ultrapure water Total 10.00 μL

[0110] (4) Transformation of E. coli DH5α 100 μL of E. coli DH5α was mixed with 50 μL of the reaction mixture after in-fusion cloning. The mixture was left to stand on ice for 20 minutes, then heated at 42°C for 45 seconds. It was then rapidly cooled on ice for 2 minutes. Afterward, 400 μL of LB liquid medium was added, and the mixture was cultured at 37°C at 140 rpm with shaking for 1 hour. Following incubation, 500 μL of the culture solution was spread onto LBA plate medium using a cone-large rod, and transformed colonies were obtained by culturing overnight at 37°C.

[0111] (5) Plasmid extraction To LB liquid medium, 100 mg / mL ampicillin solution was added in a volume of 1 / 1000 relative to the medium volume. The colonies obtained above were then inoculated and cultured overnight at 37°C with shaking. A FastGene Plasmid Mini Kit was used to extract plasmid DNA from the bacterial cells. 5 mL of the culture medium was transferred to a 15 mL tube, and the supernatant was removed by centrifugation at 10,000 rpm for 2 minutes. 400 μL of mP1 was added, the bacterial suspension was resuspended by vortexing, and 400 μL of mP2 was added. After inversion and mixing, the cells were incubated at room temperature for 2 minutes to lyse. 600 μL of mP3 was added, the lysate was inverted and mixed until clear, and insoluble matter was precipitated by centrifugation at 13,000 rpm for 3 minutes. A spin column was placed in a collection tube, the clear supernatant was dispensed into the spin column, and the filtrate was discarded after centrifugation at 13,000 rpm for 30 seconds. 400 μL of mP4 was added to the spin column, centrifuged at 13,000 rpm for 30 seconds, and the filtrate was discarded. Then, 600 μL of mP5 was added to the spin column, centrifuged again at 13,000 rpm for 30 seconds, and the filtrate was discarded. After drying the membrane by centrifuging at 13,000 rpm for 2 minutes, the collection tube was discarded and a new 1.5 mL microtube was placed in the spin column. 50 μL of mP6 was added to the membrane, incubated for 2 minutes, and then the plasmid DNA solution was recovered by centrifuging at 13,000 rpm for 2 minutes.

[0112] (6) Transformation into E. coli BL21-CodonPlus(DE3)-RIPL 100 μL of E. coli BL21-CodonPlus(DE3)RIPL was mixed with 2 μL of the plasmid DNA prepared above, allowed to stand on ice for 20 minutes, and then heated at 42°C for 45 seconds. Further quenching was performed on ice for 2 minutes. Then, 400 μL of LB liquid medium was added, and the mixture was cultured at 37°C at 140 rpm with shaking for 1 hour. After culturing, 500 μL of the culture solution was spread onto LBA plate medium using a cone-large rod, and transformed colonies were obtained by culturing overnight at 37°C.

[0113] (7) Mass culture and expression induction of recombinant Escherichia coli After adding 100 mg / mL ampicillin solution to LB medium at a volume of 1 / 1000 relative to the medium volume, colonies cultured on a plate were inoculated into LB medium using a platinum loop, and cultured with shaking at 37°C and 140 rpm. When the optical density (OD) at a wavelength of 600 nm reached 0.4-0.8, IPTG solution was added to the culture medium to a final concentration of 0.1 mM, and then cultured with shaking at 18°C ​​and 140 rpm for 24 hours to induce enzyme expression.

[0114] (8) Bacterial collection and cell disruption The culture medium was centrifuged at 5,000 rpm for 15 minutes to collect the cells. The obtained cells were suspended and washed with physiological saline (0.85% NaCl aqueous solution), and then centrifuged again under the same conditions to wash the cells. Subsequently, 30 mM Tris-HCl buffer (pH 8.3) containing 300 mM NaCl and 10 mM imidazole, four times the wet weight of the cells, was added to suspend the cells. The cells were then subjected to lysation using an ultrasonic generator for 2 minutes, followed by standing on ice for 2 minutes. This procedure was repeated three times to perform cell lysation. The lysate was centrifuged (10,000 × g, 10 minutes), and the supernatant was collected.

[0115] (9) Purification using Ni Sepharose High Performance column The Ni Sepharose High Performance column was washed by passing 200 mL of Elix water through it. Nickel atoms were coordinated to the column with 50 mL of 50 mM NiSO4 solution, and then washed again with 200 mL of Elix water. The column was then equilibrated with 20 mM Tris-HCl buffer (pH 8.3) containing 100 mL of 300 mM NaCl. After that, the cell-treated enzyme solution was passed through the column to adsorb the enzyme, and unbound proteins were removed with 20 mM Tris-HCl buffer (pH 8.3) containing 100 mL of 300 mM NaCl. Finally, the enzyme was eluted with 20 mM Tris-HCl buffer (pH 8.3) containing 0.5 M imidazole and 300 mM NaCl. Elution was performed using a linear gradient method, and the eluate was collected with a fraction collector.

[0116] (10) SDS-PAGE The eluate fractionated with a fraction collector and an equal volume of the 2× sample buffer solution shown below were mixed, and the resulting solution was heat-treated on an aluminum block bath at 90°C for 10 minutes to obtain the sample protein solution.

[0117] (Composition of sample buffer) 0.5M Tris-HCl buffer (pH 6.8) 2.5mL 2-Mercaptoethanol 1 mL 10% SDS 4mL Sucrose 1g Bromophenol Blue 1 mg Elix water up to 10mL

[0118] A gel plate was assembled, and the separation gel, prepared according to the composition shown below, was poured in up to 80% capacity. Elix water was then layered on top and left to stand at room temperature. After the gel solidified, the Elix water was discarded, the prepared concentrated gel was poured in, a comb was inserted, and the gel was left to stand at room temperature to solidify, thus preparing the gel for SDS-PAGE. The gel was placed in an electrophoresis tank and filled with the prepared electrophoresis buffer. The comb was removed from the gel, and 10 μL of the sample protein solution was placed in the lane. The electrophoresis tank was connected to a power supply, and electrophoresis was performed for 60 minutes with a current of 25 mA per gel. After electrophoresis, the gel was removed, shaken in Elix water for 5 minutes, and washed. The Elix water was discarded, the gel was immersed in Rapid CBB and shaken for 30 minutes to stain it. The stained gel was immersed in Elix water overnight to decolorize the background dye. (Composition of the separation gel (mL)) Elix water 6.25 3M Tris-HCl buffer (pH8.8) 1.86 30% acrylamide / bis-35 solution 6.25 10% SDS 0.150 10% APS 0.075 TEMED 0.0075 Total 14.59 (Composition of concentrated gel (mL)) Elix water 4.49 0.47M Tris-HCl buffer (pH8.8) 2.00 30% acrylamide / bis-350 solution 0.750 10% SDS 0.150 10% APS 0.100 TEMED 0.006 Total 7.50

[0119] (11) Concentration of enzyme solution and replacement of buffer solution The fraction in which the band of LCC-ICCG could be confirmed by SDS-PAGE was collected, concentrated by centrifugation at 4,000×g for 10 minutes using VIVA SPIN TURBO 15, and the buffer was replaced twice with 20 mM Tris-HCl buffer (pH 8.3). This enzyme solution was used as the purified enzyme (mutant of foliage compost cutinase, LCC-ICCG).

[0120] <Preparation of enzyme (LCC)> (1) Preparation of insert The sequence information of pUCFa / LCC (the underlined part is the sequence information of LCC) commissioned for synthesis by FASMAC is shown below. <Sequence information of pUCFa / LCC> 5'-TTTCCCTTAACGACGCTCTTCCGATCTGAT GGAGATATACATATGATGCAGTCCAATCCGTATCAACGTGGGCCAAATCCTACACGCTCAGCCTTAACGGCAGATGGGCCGTTTTCTGTCGCGACCTATACGGTCAGTCGCCTGAGCGTTTCGGGGTTTGGTGGCGGCGTGATCTACTATCCCACCGGCACGAGCCTGACCTTTGGTGGCATTGCGATGTCCCCAGGTTATACCGCCGATGCGAGTTCACTGGCGTGGCTCGGACGTCGTCTTGCCTCTCATGGCTTCGTAGTTCTGGTGATCAACACCAACAGTCGCTTCGATTATCCTGATAGCCGTGCATCCCAACTGTCTGCAGCTCTGAACTACCTTCGCACGTCGAGCCCGTCTGCCGTTCGTGCGCGTTTGGATGCCAATCGGCTGGCAGTTGCGGGCCATAGCATGGGAGGTGGCGGGACTTTACGCATTGCCGAACAGAACCCGAGCCTGAAAGCTGCTGTTCCGCTGACACCATGGCATACCGACAAGACGTTCAATACCAGTGTTCCGGTGCTGATCGTAGGGGCCGAAGCCGATACTGTCGCTCCTGTGTCGCAACACGCGATTCCGTTCTACCAGAACTTACCGAGCACTACGCCCAAAGTGTATGTCGAGTTGGACAACGCGTCACACTTTGCGCCAAACTCGAATAATGCGGCAATTAGCGTGTATACCATCTCGTGGATGAAACTCTGGGTGGACAATGACACTCGCTATCGCCAGTTTCTGTGCAACGTGAACGATCCGGCATTGAGTGACTTTCGCACCAACAATCGCCACTGTCAGGGCGGTGGTCATCATCACCACCATCATTGAGGATCCGGCTGCTAA ATCAGATCGGAAGAGCACACGTCTGAACTC-3' Using this plasmid as a template, PCR was performed under the following conditions using the primer described in Table 3 below and the PCR mixture with the following formulation to amplify the LCC gene as an insert.

[0121]

Table 3

[0122] (PCR mixture) PrimeSTAR Max Premix (2×) 25 μL Forward primer (2 μM) 5 μL Reverse primer (2 μM) 5 μL Plasmid DNA (0.1 ng / μL) 10 μL 5 μL of ultrapure water Total 50 μL

[0123] (PCR conditions) Using a MiniAmp Plus thermal cycler (MiniAmp Plus, manufactured by Applied Biosystems), one cycle consisted of "98°C for 10 seconds (thermal denaturation), 55°C for 5 seconds (annealing), and 72°C for 8 seconds (extension reaction)," and this was repeated 35 times.

[0124] (2) Preparation of linearized vectors Using pET11a / PAE1888 as a template, PCR was performed using the primers listed in Table 4 below, with the following PCR mixture formulation, and under the following conditions to linearize the plasmid vector.

[0125] [Table 4]

[0126] (PCR mixture) PrimeSTAR Max Premix (2x) 25μL Forward primer (2 μM) 5 μL Reverse primer (2 μM) 5 μL Plasmid DNA (0.05 ng / μL) 10 μL 5 μL of ultrapure water Total 50 μL

[0127] (PCR conditions) Using a MiniAmp Plus thermal cycler (MiniAmp Plus, manufactured by Applied Biosystems), one cycle consisted of "98°C for 10 seconds (thermal denaturation), 55°C for 5 seconds (annealing), and 72°C for 28 seconds (extension reaction)," and this was repeated 35 times.

[0128] (3) In-Fusion Cloning Using the insert and linearization vector, a reaction mixture was prepared with the following composition, and in-fusion cloning was performed by incubation at 50°C for 15 minutes to construct a plasmid in which the LCC gene insert was inserted into the vector pET-11a.

[0129] (In-Fusion cloning mixture) 5×In-Fusion HD Enzyme Premix 2.00μL Insert (85.3 ng / μL) 0.54 μL Lynealization vector (42.9 ng / μL) 3.59 μL 3. Total 10.00 μL

[0130] (4) Transformation of E. coli DH5α 100 μL of E. coli DH5α was mixed with 50 μL of the reaction mixture after in-fusion cloning. The mixture was left to stand on ice for 20 minutes, then heated at 42°C for 45 seconds. It was then rapidly cooled on ice for 2 minutes. Afterward, 400 μL of LB liquid medium was added, and the mixture was cultured at 37°C at 140 rpm with shaking for 1 hour. Following incubation, 500 μL of the culture solution was spread onto LBA plate medium using a cone-large rod, and transformed colonies were obtained by culturing overnight at 37°C.

[0131] (5) Plasmid extraction To LB liquid medium, 100 mg / mL ampicillin solution was added in a volume of 1 / 1000 relative to the medium volume. The colonies obtained above were then inoculated and cultured overnight at 37°C with shaking. A FastGene Plasmid Mini Kit was used to extract plasmid DNA from the bacterial cells. 5 mL of the culture medium was transferred to a 15 mL tube, and the supernatant was removed by centrifugation at 10,000 rpm for 2 minutes. 400 μL of mP1 was added, the bacterial suspension was resuspended by vortexing, and 400 μL of mP2 was added. After inversion and mixing, the cells were incubated at room temperature for 2 minutes to lyse. 600 μL of mP3 was added, the lysate was inverted and mixed until clear, and insoluble matter was precipitated by centrifugation at 13,000 rpm for 3 minutes. A spin column was placed in a collection tube, the clear supernatant was dispensed into the spin column, and the filtrate was discarded after centrifugation at 13,000 rpm for 30 seconds. 400 μL of mP4 was added to the spin column, centrifuged at 13,000 rpm for 30 seconds, and the filtrate was discarded. Then, 600 μL of mP5 was added to the spin column, centrifuged again at 13,000 rpm for 30 seconds, and the filtrate was discarded. After drying the membrane by centrifuging at 13,000 rpm for 2 minutes, the collection tube was discarded and a new 1.5 mL microtube was placed in the spin column. 50 μL of mP6 was added to the membrane, incubated for 2 minutes, and then the plasmid DNA solution was recovered by centrifuging at 13,000 rpm for 2 minutes.

[0132] (6) Transformation into E. coli BL21-CodonPlus(DE3)-RIPL 100 μL of E. coli BL21-CodonPlus(DE3)RIPL was mixed with 2 μL of the plasmid DNA prepared above, allowed to stand on ice for 20 minutes, and then heated at 42°C for 45 seconds. Further quenching was performed on ice for 2 minutes. Then, 400 μL of LB liquid medium was added, and the mixture was cultured at 37°C at 140 rpm with shaking for 1 hour. After culturing, 500 μL of the culture solution was spread onto LBA plate medium using a cone-large rod, and transformed colonies were obtained by culturing overnight at 37°C.

[0133] (7) Mass culture and expression induction of recombinant Escherichia coli After adding 100 mg / mL ampicillin solution to LB medium at a volume of 1 / 1000 relative to the medium volume, colonies cultured on a plate were inoculated into LB medium using a platinum loop, and cultured with shaking at 37°C and 140 rpm. When the optical density (OD) at a wavelength of 600 nm reached 0.4-0.8, IPTG solution was added to the culture medium to a final concentration of 0.1 mM, and then cultured with shaking at 18°C ​​and 140 rpm for 24 hours to induce enzyme expression.

[0134] (8) Bacterial collection and cell disruption The culture medium was centrifuged at 5,000 rpm for 15 minutes to collect the cells. The obtained cells were suspended and washed with physiological saline (0.85% NaCl aqueous solution), and then centrifuged again under the same conditions to wash the cells. Subsequently, 30 mM Tris-HCl buffer (pH 8.3) containing 300 mM NaCl and 10 mM imidazole, four times the wet weight of the cells, was added to suspend the cells. The cells were then subjected to lysation using an ultrasonic generator for 2 minutes, followed by standing on ice for 2 minutes. This procedure was repeated three times to perform cell lysation. The lysate was centrifuged (10,000 × g, 10 minutes), and the supernatant was collected.

[0135] (9) Purification using Ni Sepharose High Performance column The Ni Sepharose High Performance column was washed by passing 200 mL of Elix water through it. Nickel atoms were coordinated to the column with 50 mL of 50 mM NiSO4 solution, and then washed again with 200 mL of Elix water. The column was then equilibrated with 20 mM Tris-HCl buffer (pH 8.3) containing 100 mL of 300 mM NaCl. After that, the cell-treated enzyme solution was passed through the column to adsorb the enzyme, and unbound proteins were removed with 20 mM Tris-HCl buffer (pH 8.3) containing 100 mL of 300 mM NaCl. Finally, the enzyme was eluted with 20 mM Tris-HCl buffer (pH 8.3) containing 0.5 M imidazole and 300 mM NaCl. Elution was performed using a linear gradient method, and the eluate was collected with a fraction collector.

[0136] (10) SDS-PAGE The eluate fractionated with a fraction collector and an equal volume of the 2× sample buffer solution shown below were mixed, and the resulting solution was heat-treated on an aluminum block bath at 90°C for 10 minutes to obtain the sample protein solution.

[0137] (Composition of sample buffer) 0.5M Tris-HCl buffer (pH 6.8) 2.5mL 2-Mercaptoethanol 1 mL 10% SDS 4mL Sucrose 1g Bromophenol Blue 1 mg Elix water up to 10mL

[0138] A gel plate was assembled, and the separation gel, prepared according to the composition shown below, was poured in up to 80% capacity. Elix water was then layered on top and left to stand at room temperature. After the gel solidified, the Elix water was discarded, the prepared concentrated gel was poured in, a comb was inserted, and the gel was left to stand at room temperature to solidify, thus preparing the gel for SDS-PAGE. The gel was placed in an electrophoresis tank and filled with the prepared electrophoresis buffer. The comb was removed from the gel, and 10 μL of the sample protein solution was placed in the lane. The electrophoresis tank was connected to a power supply, and electrophoresis was performed for 60 minutes with a current of 25 mA per gel. After electrophoresis, the gel was removed, shaken in Elix water for 5 minutes, and washed. The Elix water was discarded, the gel was immersed in Rapid CBB and shaken for 30 minutes to stain it. The stained gel was immersed in Elix water overnight to decolorize the background dye. (Composition of the separation gel (mL)) Elix water 6.25 3M Tris-HCl buffer (pH8.8) 1.86 30% acrylamide / bis-35 solution 6.25 10% SDS 0.150 10% APS 0.075 ​ Total 14.59 (Composition of concentrated gel (mL)) Elix water 4.49 0.47M Tris-HCl buffer (pH8.8) 2.00 30% acrylamide / bis-350 solution 0.750 10% SDS 0.150 10% APS 0.100 ​ Total 7.50

[0139] (11) Concentration of enzyme solution and replacement of buffer solution The fraction in which the LCC band was confirmed by SDS-PAGE was collected, concentrated by centrifugation at 4,000 × g for 10 minutes using a VIVA SPIN TURBO 15, and then buffered twice with 20 mM Tris-HCl buffer (pH 8.3). This enzyme solution was used as the purified enzyme (a mutant of leaf compost cutinase, LCC).

[0140] <Fabrication of hydrophobic metal-organic structure ZIF-8> (Construction of ZIF-8-1) Two mL of a 40 mM zinc nitrate hexahydrate solution and two mL of a 1.6 M 2-methylimidazole solution were mixed and stirred with a stirrer for one hour to obtain a white precipitate. The mixture was then centrifuged at 10,000 rpm for 10 minutes, and the supernatant was removed to remove unreacted zinc ions, nitrate ions, and 2-methylimidazole. The resulting white precipitate was resuspended in two mL of ultrapure water to prepare the metal-organic structure ZIF-8-1. The obtained ZIF-8-1 was hydrophobic, and observation by scanning electron microscopy (SEM) and transmission electron microscopy (TEM) revealed an average particle size of approximately 1 μm and a rhombic dodecahedron structure.

[0141] (Construction of ZIF-8-2) ZIF-8-2 was prepared using the same method as ZIF-8-1, except that 200 μL of 245 mM zinc nitrate hexahydrate solution and 2 mL of 2.45 M 2-methylimidazole solution were used, and the stirring time was changed to 5 minutes. The resulting ZIF-8-2 was hydrophobic, and observation by scanning electron microscopy (SEM) and transmission electron microscopy (TEM) revealed that it had an average particle size of approximately 100 nm and was rhombic dodecahedron-shaped.

[0142] <Example 1> Two mL of 40 mM zinc nitrate hexahydrate solution, two mL of 1.6 M 2-methylimidazole solution, and 800 μg of LCC-ICCG were mixed and stirred with a stirrer for one hour to obtain a yellowish-white precipitate. The mixture was then centrifuged at 10,000 rpm for 10 minutes, and the supernatant was removed to remove unreacted zinc ions, nitrate ions, 2-methylimidazole, and unreacted LCC-ICCG. The resulting yellowish-white precipitate was resuspended in two mL of ultrapure water to prepare enzyme carrier 1, in which LCC-ICCG was immobilized inside ZIF-8-1. The obtained enzyme carrier 1 was hydrophobic, and observation by scanning electron microscopy (SEM) and transmission electron microscopy (TEM) revealed an average particle size of approximately 1 μm and a rhomboidohedron structure.

[0143] <Example 2> Enzyme carrier 2 with different average particle sizes was prepared in the same manner as in Example 1, except that 200 μL of 245 mM zinc nitrate hexahydrate solution and 2 mL of 2.45 M 2-methylimidazole solution were used, and the stirring time was changed to 5 minutes. The obtained enzyme carrier 2 was hydrophobic, and observation by scanning electron microscopy (SEM) and transmission electron microscopy (TEM) revealed that it had an average particle size of approximately 100 nm and was rhomboidohedral.

[0144] <Example 3> 4 mL of the metal-organic structure ZIF-8-1 and 800 μg of LCC-ICCG were mixed and incubated for 15 minutes. The mixture was then centrifuged at 10,000 rpm for 10 minutes, and the supernatant was removed to remove unimmobilized LCC-ICCG. The resulting precipitate was resuspended in 2 mL of ultrapure water to prepare enzyme carrier 3, on which LCC-ICCG was immobilized on the surface of ZIF-8-1. The resulting enzyme carrier 3 was hydrophobic, and observation by scanning electron microscopy (SEM) and transmission electron microscopy (TEM) revealed that it had an average particle size of approximately 1 μm and was rhomboidocodahedron-shaped.

[0145] <Example 4> Enzyme carriers 4 with different average particle sizes were prepared using the same method as in Example 3, except that the metal-organic structure was changed to ZIF-8-2. The obtained enzyme carriers 4 were hydrophobic, and observation by scanning electron microscopy (SEM) and transmission electron microscopy (TEM) revealed that they had an average particle size of approximately 100 nm and were rhomboidohedral.

[0146] <Fabrication of hydrophilic metal-organic structure MAF-7> (Construction of MAF-7-1) Two mL of 40 mM zinc nitrate hexahydrate solution, two mL of 800 mM 3-methyl-1H-1,2,4-triazole solution (Hmtz), and eighty-eight μL of 10% aqueous ammonia were mixed and stirred with a stirrer for one hour to obtain a white precipitate. The mixture was then centrifuged at 10,000 rpm for 10 minutes, and the supernatant was removed to eliminate unreacted zinc ions, nitrate ions, and Hmtz. The resulting white precipitate was resuspended in two mL of ultrapure water to prepare the metal-organic structure MAF-7-1. The obtained MAF-7-1 was hydrophilic, and observations using a scanning electron microscope (SEM) and transmission electron microscope (TEM) revealed an average particle size of approximately 2 μm and a rhombic dodecahedron structure.

[0147] (Construction of MAF-7-2) MAF-7-2 was prepared using the same method as MAF-7-1, except that the amount of 10% ammonia water was changed to 20 μL, resulting in MAF-7-2 with a different average particle size. The obtained MAF-7-2 was hydrophilic, and observation by scanning electron microscopy (SEM) and transmission electron microscopy (TEM) revealed that it had an average particle size of approximately 50 nm and was rhomboidohedral.

[0148] <Example 5> Two mL of 40 mM zinc nitrate hexahydrate solution, two mL of 800 mM HMTz solution, eighty μL of 10% aqueous ammonia, and eighty hundred μg of LCC-ICCG were mixed and stirred with a stirrer for one hour to obtain a yellowish-white precipitate. The mixture was then centrifuged at 10,000 rpm for ten minutes, and the supernatant was removed to remove unreacted zinc ions, nitrate ions, HMTz, and unreacted LCC-ICCG. The resulting yellowish-white precipitate was resuspended in two mL of ultrapure water to prepare enzyme carrier 5, in which LCC-ICCG was immobilized inside MAF-7-1. The obtained enzyme carrier 5 was hydrophilic, and observation by scanning electron microscopy (SEM) and transmission electron microscopy (TEM) revealed an average particle size of approximately two μm and a rhomboidopahedron shape.

[0149] <Example 6> Enzyme carrier 6 with a different average particle size was prepared using the same method as for enzyme carrier 5, except that the amount of 10% ammonia water was changed to 20 μL. The obtained enzyme carrier 6 was hydrophilic, and observation with a scanning electron microscope (SEM) and a transmission electron microscope (TEM) revealed that it had an average particle size of approximately 50 nm and was rhomboidohedral.

[0150] <Example 7> 4 mL of the metal-organic structure MAF-7-1 and 800 μg of LCC-ICCG were mixed and incubated for 15 minutes. The mixture was then centrifuged at 10,000 rpm for 10 minutes, and the supernatant was removed to remove unimmobilized LCC-ICCG. The resulting precipitate was resuspended in 2 mL of ultrapure water to prepare enzyme carrier 7, on which LCC-ICCG was immobilized on the surface of MAF-7-1. The resulting enzyme carrier 7 was hydrophilic, and observation by scanning electron microscopy (SEM) and transmission electron microscopy (TEM) revealed an average particle size of approximately 2 μm and a rhomboidocodahedron structure.

[0151] <Example 8> Enzyme carriers 8 with different average particle sizes were prepared using the same method as in Example 7, except that the metal-organic structure was changed to MAF-7-2. The obtained enzyme carriers 8 were hydrophobic, and observation by scanning electron microscopy (SEM) and transmission electron microscopy (TEM) revealed that they had an average particle size of approximately 100 nm and were rhombic dodecahedrons.

[0152] The obtained enzyme carriers 1-8 were subjected to enzyme activity measurement, polyethylene terephthalate (PET) degradation evaluation, and stability evaluation using the following methods.

[0153] <Enzyme activity measurement> Activity measurements were performed using a reaction solution with the following composition. 920 μL of Elix water, 50 μL of 500 mM Tris-HCl buffer (pH 8.3), and 10 μL of enzyme solution were added to a test tube and heated at 60°C for 2 minutes. Then, 20 μL of 50 mM p-nitrophenyl butyrate solution was added to the cell and stirred. The increase in absorbance over 1 minute was measured using a spectrophotometer at a wavelength λ = 405 nm. This was used as the standard measurement condition. Under these activity measurement conditions, the enzyme reacted with 1 μmol of p-nitrophenyl butyrate per minute (millimolecular extinction coefficient ε = 18.6 mM). -1 ·cm -1 The amount oxidized was defined as 1 unit and calculated accordingly. (Composition of the mixture used for activity measurement) 50 mM p-nitrophenylbutyrate 20 μL (final concentration 1 mM) 50 μL of 500 mM Tris-HCl buffer (pH 8.3) (final concentration 25 mM) 10 μL of enzyme ​ Total 1000 μL · Total activity (units) = (Increase in absorbance (ΔA) × Total enzyme volume (mL)) / (18.6 × Volume of enzyme solution in the reaction solution (mL)) · Specific activity (units / mg) = Total activity (units) / (Protein concentration (mg / mL) × Total enzyme solution volume (mL))

[0154] <Protein concentration measurement by Bradford method> A calibration curve was prepared using 2 mg / mL bovine serum albumin (BSA) of known concentration as a standard solution, and the protein concentration was calculated using this. For 4 μL of the standard solution and the enzyme solution, 200 μL of Coomassie Plus Protein Assay Reagent was added dropwise, and the absorbance at 595 nm was measured. The total activity and specific activity of the enzyme were calculated from the results of the activity measurement and protein quantification.

[0155] <Polyethylene terephthalate (PET) degradation evaluation> A 1.5 mL tube was filled with 100 mM HEPES buffer (pH 8.2) containing 2.5 mM CaCl2 and an amorphous PET film (φ=4.5 mm). The enzyme was added and incubated at 60°C for 96 hours. After incubation, the PET film was removed and washed sequentially with 5% SDS, ultrapure water, and 70% ethanol. The surface of the PET film was then observed using a scanning electron microscope (SEM). The absorbance of the reaction solution at a wavelength of 244 nm was measured, and the amount of PET degradation product was calculated. The results are shown in Figures 3 to 12. Figure 3 is an SEM image of the PET used for the polyethylene terephthalate degradation evaluation. Figures 4 to 11 are SEM images of the PET after polyethylene terephthalate degradation evaluation using enzyme carriers 1 to 8 from Examples 1 to 8. Figure 12 is a graph showing the amount of PET degradation when polyethylene terephthalate degradation evaluation was performed using enzyme carriers 1 to 8 from Examples 1 to 8. Furthermore, Table 5 below shows the amount of PET decomposition when polyethylene terephthalate decomposition was evaluated using enzyme carriers 1 to 8 of Examples 1 to 8.

[0156] [Table 5]

[0157] <Stability Evaluation> Each of the three chemicals (dimethyl sulfoxide (DMSO), ethanol, and 6M urea) was mixed with the enzyme carrier solution (Enzyme carrier 8 from Example 8) in a 1:4 (volume ratio) ratio and allowed to stand at room temperature for 1 hour. Then, PET degradation was evaluated using the same method as described above, and the amount of PET degradation was measured. Maximum activity was set to 100%, and relative activity (%) was determined. For comparison (Comparative Example 1), a stability evaluation was also performed using an enzyme (LCC-ICCG) instead of the enzyme carrier. The results are shown in Figure 13. Figure 13 is a graph showing the stability evaluation results for enzyme carrier 8 from Example 8 and the enzyme from Comparative Example 1. Table 6 below shows the stability evaluation results (residual activity) for enzyme carrier 8 from Example 8 and the enzyme from Comparative Example 1.

[0158] [Table 6]

[0159] As a result of the polyethylene terephthalate (PET) degradation evaluation, as shown in Figures 3 to 11, all of the enzyme carriers 1 to 8 of the present invention exhibited excellent degradation activity against PET before degradation treatment (see Figure 3). In particular, as shown in Figure 12, enzyme carriers 2, 4, 6, and 8 of Examples 2, 4, 6, and 8, in which the size of the metal-organic structure was nano-sized, showed superior PET degradation activity compared to enzyme carriers 1, 3, 5, and 7 of Examples 1, 3, 5, and 7, in which the size of the metal-organic structure was micro-sized. Furthermore, when using the same size and immobilization position, the hydrophilic enzyme carriers 5 to 8 of Examples 5 to 8 tended to show superior PET degradation activity compared to the hydrophobic enzyme carriers 1 to 4 of Examples 1 to 4. Moreover, when using the same size, enzyme carriers 3, 4, 7, and 8 of Examples 3, 4, 7, and 8, in which the enzyme was immobilized on the surface of the metal-organic structure, showed superior PET degradation activity compared to enzyme carriers 1, 2, 5, and 6 of Examples 1, 2, 5, and 6, in which the enzyme was immobilized inside the metal-organic structure.

[0160] Furthermore, as shown in Figure 13, the stability evaluation results showed that the enzyme carrier 8 of Example 8 of the present invention exhibited excellent stability to various organic solvents and maintained its decomposition activity because the enzyme was immobilized on a metal-organic structure.

[0161] <Example 9> An enzyme carrier 9 was prepared by immobilizing LCC on the surface of MAF-7-1 using the same method as in Example 7, except that LCC-ICCG was replaced with LCC. The obtained enzyme carrier 9 was hydrophilic, and observation by scanning electron microscopy (SEM) and transmission electron microscopy (TEM) revealed that it had an average particle size of approximately 2 μm and was rhomboidohedral.

[0162] <Enzyme preparation (MHETase)> (1) Extraction of genomic DNA 200 μL of 802 medium was added to a dry Ideonella sakaiensis sample, pipetted several times, and then the bacterial suspension was inoculated into the 802 medium and cultured with shaking at 30°C for 5 days. Genomic DNA was extracted from the bacterial cells using NncleoSpin® Microbial DNA. 5 mL of the culture medium was transferred to a 15 mL tube, and the bacterial cells were collected by centrifugation at 6,000 rpm for 10 minutes, after which the supernatant was removed. 100 μL of Buffer BE was added to the bacterial cell pellet, and the suspension was resuspended by vortexing. After transferring to an NncleoSpin Bead Tube Type B, 40 μL of Buffer MG and 10 μL of Proteinase K were added, and the cells were disrupted using a shaking lysator. Subsequently, the cells were centrifuged at 11,000 × g for 30 seconds, 600 μL of Buffer MG was added, and vortexing was performed for 3 seconds. After centrifugation at 11,000×g for 30 seconds, the supernatant was added to an NncleoSpin Microbial DNA Column set in a collection tube and centrifuged again at 11,000×g for 30 seconds. After discarding the filtrate, the column was placed in a new collection tube, 500 μL of Buffer BW was added, and it was centrifuged at 11,000×g for 30 seconds. After discarding the filtrate, 500 μL of Buffer B5 was added and it was centrifuged at 11,000×g for 30 seconds, and the filtrate was discarded. After drying the membrane by centrifugation at 11,000×g for 30 seconds, the collection tube was discarded and a new 1.5 mL microtube was placed in the column. The genomic DNA solution was recovered by adding 100 μL of Buffer BE to the membrane, incubating for 1 minute, and then centrifuging at 11,000×g for 30 seconds.

[0163] (2) Preparation of inserts Using the extracted genomic DNA as a template, the MHETase gene (ISF6_0224) was amplified as an insert by performing PCR using the primers shown in Table 7 below under the following conditions.

[0164] [Table 7]

[0165] (PCR mixture) PrimeSTAR Max Premix (2x) 25μL Forward primer (2 μM) 5 μL Reverse primer (2 μM) 5 μL Genomic DNA (15 ng / μL) 10 μL ​ Total 50 μL

[0166] (PCR conditions) Using a MiniAmp Plus thermal cycler (MiniAmp Plus, manufactured by Applied Biosystems), one cycle consisted of "98°C for 10 seconds (thermal denaturation), 55°C for 5 seconds (annealing), and 72°C for 8 seconds (extension reaction)," and this was repeated 35 times.

[0167] (3) Preparation of linearized vectors Using pET-22b as a template, PCR was performed using the primers listed in Table 8 below, with the following PCR mixture formulation, and under the following conditions to linearize the plasmid vector.

[0168] [Table 8]

[0169] (PCR mixture) PrimeSTAR Max Premix (2x) 25μL Forward primer (2 μM) 5 μL Reverse primer (2 μM) 5 μL Plasmid DNA (0.05 ng / μL) 10 μL ​ Total 50 μL

[0170] (PCR conditions) Using a MiniAmp Plus thermal cycler (MiniAmp Plus, manufactured by Applied Biosystems), one cycle consisted of "98°C for 10 seconds (thermal denaturation), 55°C for 5 seconds (annealing), and 72°C for 29 seconds (extension reaction)," and this was repeated 35 times.

[0171] (4) In-Fusion Cloning Using the insert and linearization vector, a reaction mixture was prepared with the following composition, and in-fusion cloning was performed by incubation at 50°C for 15 minutes to construct a plasmid in which the MHETase gene, which was the insert, was inserted into the vector pET-22b.

[0172] (In-Fusion cloning mixture) 5×In-Fusion HD Enzyme Premix 2.00μL Insert (43.7 ng / μL) 0.54 μL Lyneilization vector (30.6 ng / μL) 3.59 μL ​ Total 10.00 μL

[0173] (5) Transformation of E. coli DH5α 100 μL of E. coli DH5α was mixed with 50 μL of the reaction mixture after in-fusion cloning. The mixture was left to stand on ice for 20 minutes, then heated at 42°C for 45 seconds. It was then rapidly cooled on ice for 2 minutes. Afterward, 400 μL of LB liquid medium was added, and the mixture was cultured at 37°C at 140 rpm with shaking for 1 hour. Following incubation, 500 μL of the culture solution was spread onto LBA plate medium using a cone-large rod, and transformed colonies were obtained by culturing overnight at 37°C.

[0174] (6) Plasmid extraction To LB liquid medium, 100 mg / mL ampicillin solution was added in a volume of 1 / 1000 relative to the medium volume. The colonies obtained above were then inoculated and cultured overnight at 37°C with shaking. A FastGene Plasmid Mini Kit was used to extract plasmid DNA from the bacterial cells. 5 mL of the culture medium was transferred to a 15 mL tube, and the supernatant was removed by centrifugation at 10,000 rpm for 2 minutes. 400 μL of mP1 was added, the bacterial suspension was resuspended by vortexing, and 400 μL of mP2 was added. After inversion and mixing, the cells were incubated at room temperature for 2 minutes to lyse. 600 μL of mP3 was added, the lysate was inverted and mixed until clear, and insoluble matter was precipitated by centrifugation at 13,000 rpm for 3 minutes. A spin column was placed in a collection tube, the clear supernatant was dispensed into the spin column, and the filtrate was discarded after centrifugation at 13,000 rpm for 30 seconds. 400 μL of mP4 was added to the spin column, centrifuged at 13,000 rpm for 30 seconds, and the filtrate was discarded. Then, 600 μL of mP5 was added to the spin column, centrifuged again at 13,000 rpm for 30 seconds, and the filtrate was discarded. After drying the membrane by centrifuging at 13,000 rpm for 2 minutes, the collection tube was discarded and a new 1.5 mL microtube was placed in the spin column. 50 μL of mP6 was added to the membrane, incubated for 2 minutes, and then the plasmid DNA solution was recovered by centrifuging at 13,000 rpm for 2 minutes.

[0175] (7) Transformation into E. coli BL21-CodonPlus(DE3)-RIPL 100 μL of E. coli BL21-CodonPlus(DE3)RIPL was mixed with 2 μL of the plasmid DNA prepared above, allowed to stand on ice for 20 minutes, and then heated at 42°C for 45 seconds. Further quenching was performed on ice for 2 minutes. Then, 400 μL of LB liquid medium was added, and the mixture was cultured at 37°C at 140 rpm with shaking for 1 hour. After culturing, 500 μL of the culture solution was spread onto LBA plate medium using a cone-large rod, and transformed colonies were obtained by culturing overnight at 37°C.

[0176] (8) Mass culture and expression induction of recombinant Escherichia coli After adding 100 mg / mL ampicillin solution to LB medium at a volume of 1 / 1000 relative to the medium volume, colonies cultured on a plate were inoculated into LB medium using a platinum loop, and cultured with shaking at 37°C and 140 rpm. When the optical density (OD) at a wavelength of 600 nm reached 0.4-0.8, IPTG solution was added to the culture medium to a final concentration of 0.1 mM, and then cultured with shaking at 18°C ​​and 140 rpm for 24 hours to induce enzyme expression.

[0177] (9) Bacterial collection and cell disruption The culture medium was centrifuged at 5,000 rpm for 15 minutes to collect the cells. The obtained cells were suspended and washed with physiological saline (0.85% NaCl aqueous solution), and then centrifuged again under the same conditions to wash the cells. Subsequently, 50 mM Tris-HCl buffer (pH 8.3) containing 1 M urea in an amount four times the wet weight of the cells was added to suspend the cells. The cells were then subjected to lysation using an ultrasonic generator for 2 minutes, followed by standing on ice for 2 minutes. This procedure was repeated three times to perform cell lysation. The lysate was centrifuged (10,000 × g, 10 minutes), and the precipitate was suspended in 50 mM Tris-HCl buffer (pH 8.3) containing 6 M urea and 1 mM DTT. The solution was incubated overnight at 4°C to solubilize it. The solubilized solution was centrifuged at 10,000 × g for 10 minutes, and the supernatant was collected.

[0178] (10) Purification using Ni Sepharose High Performance column The Ni Sepharose High Performance column was washed by passing 200 mL of Elix water through it. Nickel atoms were coordinated to the column with 50 mL of 50 mM NiSO4 solution, and then the column was washed again with 200 mL of Elix water. The column was then equilibrated with 50 mM Tris-HCl buffer (pH 8.3) containing 100 mL of 1 M urea. Subsequently, the cell-treated enzyme solution, diluted 10-fold with 50 mM Tris-HCl buffer (pH 8.3), was passed through the column to adsorb the enzyme. Unbound proteins were then removed using 50 mM Tris-HCl buffer (pH 8.3) containing 100 mL of 6 M urea and 20 mM imidazole. Finally, the enzyme was eluted using 50 mM Tris-HCl buffer (pH 8.3) containing 0.5 M imidazole and 6 M urea. Elution was performed using a linear gradient method, and the eluate was collected with a fraction collector.

[0179] (11) SDS-PAGE The eluate fractionated with a fraction collector and an equal volume of the 2× sample buffer solution shown below were mixed, and the resulting solution was heat-treated on an aluminum block bath at 90°C for 10 minutes to obtain the sample protein solution.

[0180] (Composition of sample buffer) 0.5M Tris-HCl buffer (pH 6.8) 2.5mL 2-Mercaptoethanol 1 mL 10% SDS 4mL Sucrose 1g Bromophenol Blue 1 mg Elix water up to 10mL

[0181] A gel plate was assembled, and the separation gel, prepared according to the composition shown below, was poured in up to 80% capacity. Elix water was then layered on top and left to stand at room temperature. After the gel solidified, the Elix water was discarded, the prepared concentrated gel was poured in, a comb was inserted, and the gel was left to stand at room temperature to solidify, thus preparing the gel for SDS-PAGE. The gel was placed in an electrophoresis tank and filled with the prepared electrophoresis buffer. The comb was removed from the gel, and 10 μL of the sample protein solution was placed in the lane. The electrophoresis tank was connected to a power supply, and electrophoresis was performed for 60 minutes with a current of 25 mA per gel. After electrophoresis, the gel was removed, shaken in Elix water for 5 minutes, and washed. The Elix water was discarded, the gel was immersed in Rapid CBB and shaken for 30 minutes to stain it. The stained gel was immersed in Elix water overnight to decolorize the background dye. (Composition of the separation gel (mL)) Pure water 6.25 3M Tris-HCl (pH8.8) buffer 1.86 30% acrylamide / bis-35 solution 6.25 10% SDS 0.150 10% APS 0.075 ​ Total 14.59 (Composition of concentrated gel (mL)) Elix water 4.49 0.47M Tris-HCl (pH8.8) buffer 2.00 30% acrylamide / bis-350 solution 0.750 10% SDS 0.150 10% APS 0.100 ​ Total 7.50

[0182] (12) Refolding The fraction in which the MHETase band was confirmed was collected, placed in a dialysis tube, and immersed in 50 mM Tris-HCl buffer (pH 7.0) containing 10 times the volume of 200 mM L-arginine and 50 mM CaCl2, and dialysis was performed for 1 hour. After refreshing the buffer and performing dialysis for 2 hours, the buffer was refreshed again and dialysis was performed overnight. Finally, after refreshing the buffer and performing dialysis for 6 hours, the enzyme solution in the tube was collected.

[0183] (13) Concentration of enzyme solution and replacement of buffer solution The refolded solution was concentrated by centrifugation at 4,000 × g for 10 minutes using a VIVA SPIN TURBO 15, and the buffer was replaced twice with 50 mM Tris-HCl buffer (pH 8.3). This enzyme solution was used as the purified enzyme (MHETase).

[0184] <Example 10> 2 mL of 40 mM zinc nitrate hexahydrate solution, 2 mL of 800 mM Hmtz solution, 10 μL of 10% aqueous ammonia, and MHETase were mixed and stirred with a stirrer for 3 minutes to obtain a yellowish-white precipitate. The mixture was then centrifuged at 10,000 rpm for 10 minutes, and the supernatant was removed to remove unreacted zinc ions, nitrate ions, Hmtz, and unencapsulated MHETase. The resulting yellowish-white precipitate was resuspended in 2 mL of ultrapure water, mixed with LCC-ICCG, incubated for 15 minutes, and then centrifuged at 10,000 rpm for 10 minutes, and the supernatant was removed to remove unimmobilized LCC-ICCG. The resulting precipitate was resuspended in 2 mL of ultrapure water to prepare an enzyme carrier 10 in which LCC-ICCG was immobilized on the surface of MAF-7-1 and MHETase was immobilized inside MAF-7-1. The obtained enzyme carrier 10 was hydrophilic, and observations using a scanning electron microscope (SEM) and a transmission electron microscope (TEM) revealed that it had an average particle size of approximately 2 μm and was rhomboid dodecahedron shaped.

[0185] <Evaluation of 1-week decomposition of polyethylene terephthalate (PET)> A 1.5 mL tube was filled with 100 mM HEPES buffer (pH 8.2) containing 2.5 mM CaCl2 and an amorphous PET film (φ=4.5 mm). The enzyme was added and incubated at 60°C for 96 hours. After incubation, the PET film was removed and washed sequentially with 5% SDS, ultrapure water, and 70% ethanol. The surface of the PET film was then observed using a scanning electron microscope (SEM). The absorbance of the reaction solution at a wavelength of 244 nm was measured, and the amount of PET degradation products was calculated. Figure 14 is a graph showing the time course of PET degradation products when polyethylene terephthalate was degraded over one week using enzyme carriers 9-10 from Examples 9 and 10. As a reference example 1, a case in which only LCC was used instead of enzyme carriers 9-10 from Examples 9-10 is shown.

[0186] As shown in Figure 14, the enzyme carriers of Examples 9-10 showed PET resolution over a long period of one week. On the other hand, Reference Example 1 showed a decrease in PET resolution after 3 days.

Claims

1. The system comprises a metal-organic structure consisting of metal ions and organic ligands, and an enzyme supported on the metal-organic structure. The enzyme is an enzyme carrier containing branch and leaf compost cutinase or a variant thereof.

2. The enzyme carrier according to claim 1, wherein the enzyme is supported on the surface of the metal-organic structure in an immobilized state.

3. The enzyme carrier according to claim 1, wherein the enzyme is supported in an immobilized state inside the metal-organic structure.

4. The enzyme carrier according to any one of claims 1 to 3, wherein the average particle size of the metal-organic structure is 2000 nm or less.

5. The enzyme carrier according to any one of claims 1 to 3, wherein the metal-organic structure is hydrophilic.

6. The process includes a mixing step of mixing a first solution containing metal ions, a second solution containing an organic ligand, and an enzyme. The method for producing an enzyme carrier includes the enzyme, which is kutinase from composted branches or a variant thereof.

7. The aforementioned mixing step is A first mixing step involves mixing the first solution and the second solution to produce a metal-organic structure consisting of metal ions and organic ligands, A method for producing an enzyme carrier according to claim 6, comprising a second mixing step of further mixing the enzyme with the obtained metal-organic structure.

8. The first solution is a zinc nitrate hexahydrate solution, The second solution is a 2-methylimidazole solution, The concentration of the zinc nitrate hexahydrate in the first solution is 5 to 300 mM. The method for producing an enzyme carrier according to claim 6 or 7, wherein the concentration of 2-methylimidazole in the second solution is 0.025 to 4.0 M.

9. A method for decomposing polyethylene terephthalate, comprising the step of decomposing polyethylene terephthalate into monohydroxyethyl terephthalate by contacting polyethylene terephthalate with an enzyme carrier according to any one of claims 1 to 3.

Images