Cancer-targeting, virus-encoded, modifiable T (CATVERT) or NK cell (CATVERN) linkers

JP2026131714APending Publication Date: 2026-08-14RES INST AT NATIONWIDE CHILDRENS HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2026-06-02
Publication Date
2026-08-14

Smart Images

  • Figure 2026131714000054
    Figure 2026131714000054
  • Figure 2026131714000055
    Figure 2026131714000055
  • Figure 2026131714000056
    Figure 2026131714000056
Patent Text Reader

Abstract

To provide recombinant polynucleotides and vectors containing a modified (artificial) exon-intron-exon gene structure within an introduced gene, which undergoes splicing when expressed in target cells. [Solution] This disclosure provides a method or vector for expressing a gene for the treatment of a disease or condition, under external control as necessary. In some cases, the disease or condition is cancer. In some cases, the vector expresses a polypeptide (referred to herein as a “dimart”) that has the function of binding immune execution cells together with cancer cells to cause the killing of cancer cells.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Government support description This invention was made with government support under grant number W81XWH-19-1-0371, awarded by the Department of Defense. The government has certain rights to this invention.

[0002] Cross-reference of related applications This application claims priority to U.S. Provisional Application No. 62 / 808,264, filed on February 20, 2019, pursuant to Section 119(e) of the U.S. Patent Act, the entire contents of which are incorporated herein by reference. [Background technology]

[0003] Gene therapy, or gene transfer, is now a reality as a treatment for disease. In 2017, the FDA approved Luxturna, an adeno-associated virus (AAV) designed to stably express a normal copy of the RPE65 gene in retinal cells, for the treatment of congenital retinal dystrophy. In 2019, the FDA approved Zolgensma, an AAV designed to express SMN1 in motor neurons to treat spinal muscular atrophy. Ongoing clinical trials on the use of AAV vectors to replace gene function for other diseases, such as a miniversion of the dystrophin gene for Duchenne muscular dystrophy and factor VIII and factor IX genes for hemophilia A and B, have also yielded extremely promising results.

[0004] In all of the above examples, the goal is long-term gene expression to replace a missing or defective gene. However, in the treatment of time-limited diseases such as infectious diseases or cancer, gene therapy applications may only involve short-term expression of a transgene (the gene expressed as a therapeutic agent in gene therapy). Another exemplary example is the expression of the bacterial protein Cas9 to induce CRISPR / Cas9 gene editing, where only transient expression of Cas9 is ideal to minimize potential immune responses to Cas9 and to minimize off-target gene mutations. Another application would be a situation where gene therapy may cause undesirable side effects and it is desirable to inactivate the gene in question. In these cases, a method is needed to activate and / or suppress transgene expression.

[0005] Therefore, there is a need for novel methods that can activate transgene expression to utilize gene therapy platforms for short-term gene expression (weeks to months). An ideal system would place transgene expression under drug control, such that drug administration activates gene expression and discontinuation of the drug reverts to inactive gene expression. In such a scenario, drug administration is no longer required if side effects are present or if transgene expression is no longer needed. This disclosure satisfies this requirement and also provides relevant advantages. [Overview of the project] [Problems that the invention aims to solve]

[0006] This disclosure provides a method or vector for expressing a gene for the treatment of a disease or condition, under external control as necessary. In some cases, the disease or condition is cancer. In some cases, the vector expresses a polypeptide (referred to herein as a “dimart”) that has the function of binding immune execution cells together with cancer cells to cause the killing of the cancer cells.

[0007] Provided herein are recombinant polynucleotides or vectors comprising, or essentially consisting of, (a) a first polynucleotide sequence comprising a first portion of an open reading frame encoding a first antibody or its antigen-binding fragment; (b) a second polynucleotide sequence comprising a second portion of an open reading frame encoding a first antibody or its antigen-binding fragment; (c) a third polynucleotide sequence encoding a second antibody or its antigen-binding fragment; and (d) a gene-regulating polynucleotide sequence located between the first and second polynucleotides. In a further embodiment, the gene-regulating polynucleotide sequence comprises, or essentially consisting of, a splice donor site, an upstream intron, an exon containing more than one stop codon sequence in each of their reading frames, a downstream intron, and a splice acceptor site. In a further embodiment, the gene-regulating polynucleotide sequence comprises one or more binding sequences to an antisense oligonucleotide. In a further embodiment, the antisense oligonucleotide is a morpholino oligonucleotide. In a further embodiment, the binding sequence to the morpholino oligonucleotide comprises a polynucleotide sequence that is at least 95% identical to SEQ ID NO: 24 (AATATGATCCAACAATAGAGGTAAATCTTG) or SEQ ID NO: 25 (GATCCAACAATAGAGGTAAATCTTGTTTTA). In another embodiment, the stop codon comprises an oligonucleotide from the group TAA, TAG, or TGA. In a further embodiment, the stop codon sequence comprises the polynucleotide sequence TAAxTAGxTGAxTAGxTAAxTGAx (SEQ ID NO: 1) (where x is any nucleotide), or the stop codon sequence comprises the polynucleotide sequence TAATTAGTTGATTAGTTAATTGAT (SEQ ID NO: 2) or its equivalent. In another embodiment, the recombinant polynucleotide or vector encodes a bispecific or triplicate engager. In another embodiment, a bispecific cell engager is a bispecific engager.In another embodiment, a bispecific cell engager is a triplicate engager.

[0008] In a further embodiment, the first antibody or its antigen-binding fragment specifically binds to an activating antigen on an immune effector cell, and the second antibody or its antigen-binding fragment binds to a tumor antigen. In another embodiment, the first antibody or its antigen-binding fragment specifically binds to a tumor antigen, and the second antibody or its antigen-binding fragment binds to an activating antigen on an immune effector cell. In a further embodiment, the recombinant polynucleotide or vector also includes a fourth polynucleotide sequence encoding a third antibody or its antigen-binding fragment, and the third antibody or its antigen-binding fragment binds to an activating antigen or tumor antigen on an immune effector cell. In one embodiment, the immune effector cells include dendritic cells, natural killer ("NK") cells, macrophages, T cells, B cells, neutrophils, eosinophils, basophils, mast cells, or a combination thereof. In one embodiment, the immune effector cells are T cells. In another embodiment, the immune effector cells are NK cells. In another embodiment, the third antibody or its antigen-binding fragment binds to an activating antigen on an NK cell and induces an NK cell-mediated immune response.

[0009] In one embodiment, the activating antigen is a T cell surface molecule. In another embodiment, the activating antigen is an NK cell surface molecule. Non-limiting examples of activating antigens on immunoeffector cells include CD3, CD2, CD4, CD8, LFA1, CD45, NKG2D, NKp44, NKp46, NKp30, EphA2, DNAM, BT-H3, CD20, CD22, or combinations thereof.

[0010] In one embodiment, the dimart (e.g., a bispecific or trispecific cell engager) contains a polypeptide sequence that is at least 95% identical to any one of SEQ ID NOs. 7-10. In another embodiment, the polypeptide sequence encodes an antigen-binding fragment for CD3, CD2, CD4, CD8, LFA1, CD45, IL21R, NKG2D, NKp44, NKp46, NKp30, or DNAM. In another embodiment, the polypeptide sequence encodes an antigen-binding fragment for CD3, CD19, GD2, or NKG2D. In another embodiment, the polypeptide encodes a first antigen-binding fragment and a second antigen-binding fragment. In another embodiment, the first antigen-binding fragment binds to CD3 and the second antigen-binding fragment binds to CD19. In another embodiment, the first antigen-binding fragment binds to CD3 and the second antigen-binding fragment binds to GD2. In another embodiment, the first antigen-binding fragment binds to NKG2D and the second antigen-binding fragment binds to GD2.

[0011] In one embodiment, the dimart (e.g., a triplicate engager or antibody) comprises a first antigen-binding fragment, a second antigen-binding fragment, and a third antigen-binding fragment. In another embodiment, the triplicate engager or antibody comprises three antigen-binding fragments that bind to NKG2D, IL21R, and GD2, respectively. In a further embodiment, the triplicate engager or antibody comprises a polypeptide sequence that is at least 95% identical to SEQ ID NO: 11.

[0012] In one embodiment, the antigen-binding fragment that binds to IL-21R is IL-21. The amino acid sequence and cDNA sequence of IL-12 are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively. [ka]

[0013] In one embodiment, the antigen-binding fragment that binds to NKG2D includes MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, ULBP6, Rae-1α, Rae-1β, Rae-1γ, Rae-1δ, Rae-1ε, H60a, H60b, H60c, MULT1, or fragments thereof. In one embodiment, the antigen-binding fragment that binds to NKG2D is MICA or a fragment thereof. The amino acid and cDNA sequences of MICA are shown in SEQ ID NOs. 5 and 6, respectively. [ka]

[0014] In one embodiment, the MICA sequence includes a wide-type variant. In one embodiment, the MICA variant is a sequence variant of MUC-30 that contains a methionine mutation instead of alanine at position 129 of the wide-type MICA sequence. The amino acid sequence and cDNA sequence of the MUC-30 variant are shown in SEQ ID NO: 7 and SEQ ID NO: 8, respectively. [ka] [ka]

[0015] In a further embodiment, the pre-mRNA encoding a triplicate antibody is expressed when it is in contact with a morpholino oligonucleotide.

[0016] In one embodiment, the antigen-binding domain is a single-stranded variable fragment or an antibody.

[0017] In a further embodiment, the recombinant polynucleotide or vector comprises a polynucleotide sequence encoding a secreted peptide. In another embodiment, the recombinant polynucleotide or vector further comprises a polynucleotide sequence encoding a dimerization domain. In yet another embodiment, the recombinant polynucleotide or vector comprises a 5' inverse sequence (ITR) and a 3' ITR. In yet another embodiment, the vector comprises the sequences of SEQ ID NOs: 4, 6, 8, 12, 14, 16-23, 30-33 or 40-46. Non-limiting examples of such vectors include recombinant viral vectors, which include skeletal vectors selected as needed from the group of retroviral vectors, lentiviral vectors, mouse leukemia virus ("MLV") vectors, Epstein-Barr virus ("EBV") vectors, adenovirus vectors, herpesvirus ("HSV") vectors, adeno-associated virus ("AAV") vectors, AAV vectors, or self-complementary AAV vectors.

[0018] Recombinant polynucleotides or vectors can be contained within host cells, such as prokaryotic or eukaryotic cells.

[0019] Recombinant polynucleotides, vectors, and cells may be contained within compositions containing vectors and / or host cells and carriers, such as pharmaceutically acceptable carriers. Recombinant polynucleotides, vectors, and cells may be formulated for various modes of administration and may contain effective amounts of polynucleotides, vectors, and / or host cells effective against a patient, disorder, or disease, vector, and mode of administration. In one embodiment, the mode of administration is systemic or intravenous. In another embodiment, the administration is local administration by direct injection. In one embodiment, morpholino oligonucleotides are contacted simultaneously with or subsequently to the polynucleotide or vector, for example, by systemic or local injection. Alternatively, contact is prior to the polynucleotide or vector.

[0020] Recombinant polynucleotides or vectors are useful for treating various diseases or disorders. In one embodiment, a method for delivering a transgene is provided. This method comprises administering an effective amount of a recombinant polynucleotide or vector containing a transgene to cells, tissues, or patients to be treated. In one embodiment, an effective amount of morpholino oligonucleotide is administered to cells, tissues, or patients to be treated. Non-limiting examples of transgenes are provided and selected based on the purpose of this method. The cells or tissues may be mammalian, for example, human. In one embodiment, the morpholino oligonucleotide is contacted simultaneously with or following the vector. Alternatively, contact of the morpholino oligonucleotide is prior to the vector. In another embodiment, the vector is introduced into cells by translocation, infection, transformation, electroporation, injection, microinjection, or a combination thereof.

[0021] A method is provided for treating cancer in subjects requiring treatment. This method comprises, or essentially consists of, administering an effective amount of recombinant polynucleotides or vectors or cells as described herein to a subject. In a further method, the method further comprises administering an effective amount of morpholino oligonucleotides to a subject. In one embodiment, an effective amount of an anticancer agent is administered to a subject. Non-limiting examples of anticancer agents include anticancer peptides, polypeptides, nucleic acid molecules, small molecules, viral particles, or combinations thereof. In another embodiment, the vector is introduced into cells by translocation, infection, transformation, electroporation, injection, microinjection, or a combination thereof.

[0022] In one embodiment of the disclosed method, the virus particles are oncolytic HSV particles.

[0023] Further methods provided by this disclosure are methods for producing bispecific or triplicate antibodies in cells, comprising, essentially, or consisting of contacting cells containing the polynucleotide or vector described herein with an effective amount of morpholino oligonucleotide. In one embodiment, the morpholino oligonucleotide is contacted simultaneously with or following the vector; or, the contact of the morpholino oligonucleotide is prior to the polynucleotide or vector. In one embodiment, the morpholino oligonucleotide contains a sequence at least 95% identical to SEQ ID NO: 27 or 28. Non-limiting examples of bispecific antibodies contain a polypeptide sequence at least 95% identical to SEQ ID NO: 13 or 15. In one embodiment, the bispecific antibody is encoded by a polynucleotide sequence at least 95% identical to SEQ ID NO: 14, 16, 22, 23, 30-33 or 40-46. In another embodiment, the triplicate antibody contains a polypeptide sequence at least 95% identical to SEQ ID NO: 11. In one embodiment, the triplicate antibody is encoded by a polynucleotide sequence at least 95% identical to SEQ ID NO: 12.

[0024] In another embodiment, polynucleotides or vectors are introduced into cells by translocation, infection, transformation, electroporation, injection, microinjection, or a combination thereof. Non-limiting examples of cells include fibroblasts, skeletal cells, epithelial cells, muscle cells, nerve cells, endocrine cells, melanocytes, hematopoietic cells, or a combination thereof.

[0025] Further kits are provided that include one or more of the polynucleotides, vectors, cells, or compositions described herein, along with instructional material as appropriate. [Brief explanation of the drawing]

[0026] [Figure 1]Figure 1 shows a strategic overview of the general concept of splicing using 3-exon gene structures. Exons are denoted as 1, 2, or 3, and introns are represented by straight lines. Different splicing patterns are indicated by lowercase letters (a, b, c), and the resulting RNA structures are shown based on which of them is used. Oligonucleotides that can interfere with splice donor (1D, 2D) or acceptor (2A, 3A) sites are shown as short blue lines, and the expected expression of different possible RNA isoforms is indicated by "+" depending on which site is blocked by the oligonucleotide.

[0027] [Figure 2] Figure 2 outlines the strategy in Figure 1 using splice type 1, in which exon 2 is typically included in the gene transcript. While transcripts containing all three spliced ​​exons are expected to be dominant, transcripts with exon 1 fused to exon 3 are dominant in the presence of oligos blocking the exon 2 splice acceptor or donor site.

[0028] [Figure 3] Figure 3 outlines Strategy #1 for constructing an engineered intron-exon stop-intron within a transgene. Transcripts holding these introns are nonfunctional because the introns have immature stop codons and / or are outside the frame. The "a+b" transcript is nonfunctional due to the stop codon in exon 2. Only transcripts with exon 2 skipped (utilizing splice c) are functional, and these transcripts are low at baseline and activated by oligos that block the splice site on exon 2.

[0029] [Figure 4] Figure 4 shows a map of the transgene regulation of the strategies shown in Figure 1.

[0030] [Figure 5]Figure 5 illustrates a second strategy for creating an engineered intron-exon stop-intron within a transgene, utilizing a "type 2 splice" where exon 2 is normally excluded in cancer cells but present in normal cells. In this scenario, the exon-skipping oligo activates transgene expression (exon 1+3) in normal cells and, in certain off-target skipping of cellular genes, does not alter (or perhaps even increases) transgene expression, potentially as a "bonus" therapeutic effect.

[0031] [Figure 6] Figure 6 illustrates a third strategy for creating an engineered intron-exon stop-intron within a transgene, utilizing a "type 3 splice" where exon 2 is typically present in certain cancer cells but excluded in normal cells. In this scenario, normal cells have baseline high levels of active transgene (exons 1+3), and the exon-skipping oligo is activated in tumor cells.

[0032] [Figure 7] Figure 7 shows an exemplary CD3xGD2-HDD AAV construct.

[0033] [Figure 8] Figure 8 shows an illustrated representation of the assay for determining the structure and function of the dimart disclosed herein.

[0034] [Figure 9] Figure 9 shows SDS-PAGE of whole cell lysates from transfected 293T cells. Three constructs in Figure 7 containing secreted peptides, #1101, #1040, and #1124, retained less CD3xGD2-HDD dimart in transfected 293T cells compared to construct #1104 and the control pcDNA3-GFP construct.

[0035] [Figure 10]Figure 10 shows that the AAV vector secreted a CD3xGD2-HDD dimart that binds to and activates human T cells.

[0036] [Figure 11] Figure 11 shows the secreted CD3xGD2-HDD dimart that activates human T cells.

[0037] [Figure 12A] Figure 12A shows that the binding of CD3xGD2-HDD to T cells is dose-dependent.

[0038] [Figure 12B] Figure 12B shows a bar graph of the normalized median staining levels compared to an unstained control.

[0039] [Figure 13] Figure 13 shows an illustration of the binding assay of the CD3xGD2-HDD dimart against the anti-GD2 arm. This assay confirmed that both GD2 and CD3 binding are present on a single molecule.

[0040] [Figure 14] Figure 14 shows an exemplary CD3xGD2-HDD dymart coupled to both CD3 and GD2.

[0041] [Figure 15] Figure 15 shows a flowchart of an assay to determine whether CD3xGD2-HDD induces T cell-mediated killing of GD2+ target cells.

[0042] [Figure 16] Figure 16 shows that secreted CD3xGD2-HDD induces T cell killing in neuroblastoma cells.

[0043] [Figure 17]Figure 17 shows T cell-mediated cytotoxicity mediated by the CD3xGD2-HDD dimart, which is associated with GD2 expression.

[0044] [Figure 18A] Figure 18A shows a map of exemplary AAV constructs for testing CD19xCD3 dimart expression.

[0045] [Figure 18B] Figure 18B shows an exemplary CD19TransJoin genome structure. The elements of the transgene encoded by AAV are shown in the figure.

[0046] [Figure 18C] Figure 18C shows an illustration of CD19 dimarts interacting with cancer cells and T cells. CD19 dimarts are produced by cells containing CD19TransJoin. As shown in this figure, "Ca" represents cancer cells and "T" represents T cells.

[0047] [Figure 19] Figure 19 shows that the supernatant from cells transfected with an AAV CD19xCD3 construct containing a secretory sequence binds to and activates T cells.

[0048] [Figure 20] Figure 20 shows that the supernatant from cells transfused with an AAV vector containing secreted peptides activates human T cells.

[0049] [Figure 21] Figure 21 shows that AAV-secreted CD19xCD3 specifically binds to CD19, but does not bind to CD45.

[0050] [Figure 22A] Figure 22A shows that the binding of CD19xCD3 to T cells is dose-dependent.

[0051] [Figure 22B]Figure 22B shows a bar graph of the normalized median staining levels compared to an unstained control.

[0052] [Figure 23A] Figure 23A shows that the binding of CD19xCD3 to B cells is dose-dependent.

[0053] [Figure 23B] Figure 23B shows a bar graph of the normalized median staining levels compared to an unstained control.

[0054] [Figure 24] Figure 24 shows that CD3 dimarts activate T cells more effectively than anti-CD3 antibodies in anti-CD28 costimulation.

[0055] [Figure 25] Figure 25 shows that 293T cells yield the best transduction efficiency for the AAV8 vector.

[0056] [Figure 26] Figure 26 shows that the dimart concentration in the supernatant of AAV8-infected cells is dependent on the AAV dose and transduction efficiency.

[0057] [Figure 27] Figure 27 shows a single intravenous injection of CD19xCD3 TransJoin, which selectively removes B cells in humanized mice.

[0058] [Figure 28] Figure 28 shows a single intravenous injection of CD19xCD3 TransJoin that induces long-term B cell depletion in humanized mice.

[0059] [Figure 29] Figure 29 shows that a single intravenous injection of CD19xCD3 TransJoin eliminates CD19+ lymphoma in humanized mice.

[0060] [Figure 30] Figure 30 shows an overview of OncoSkip and TransSkip as described herein.

[0061] [Figure 31] Figure 31 shows that KRAS OncoSkip antisense morpholino induces exon skipping of endogenous KRAS in lung cancer cells.

[0062] [Figure 32] Figure 32 shows an exemplary AAV vector map of CD3xGD2-HDD TransSkip, showing inverted introns adjacent to exons inserted in the CD3xGD2-HDD dymart code sequence.

[0063] [Figure 33] Figure 33 shows an exemplary strategy for testing the activity of OncoSkip and TransSkip as described herein.

[0064] [Figure 34] Figure 34 shows the antisense morpholino that induces exon skipping in the CD3xGD2-HDD TransSkip transgene.

[0065] [Figure 35] Figure 35 shows KRAS OncoSkip inducing secreted expression of the CD3xGD2-HDD dimart in cells transfused with the CD3xGD2-HDD TransSkip AAV vector.

[0066] [Figure 36] Figure 36 shows that the exon skipping of CD3xGD2-HDD TransSkip by KRAS OncoSkip is an on-target effect.

[0067] [Figure 37]Figure 37 shows that the induction of CD3xGD2-HDD dimart expression determined by T cell binding is an on-target effect.

[0068] [Figure 38] Figure 38 shows an AAV genome map of exemplary TransSkip splice variants that reduce baseline TransSkip "leakage" but maintain inducible exon skipping.

[0069] [Figure 39] Figure 39 shows the CD3xGD2-HDD TransSkip splice variant K3, which removes the baseline but retains inducible exon skipping.

[0070] [Figure 40] Figure 40 shows CD3xGD2-HDD TransSkip variant K3, which does not show baseline dimart production but is more indicable by KRAS OncoSkip compared to other TransSkip variants tested.

[0071] [Figure 41] Figure 41 shows that OncoSkip-mediated induction of dimart expression from CD3xGD2-HDD TransSkip variants K3 and K5 is an on-target effect.

[0072] [Figure 42] Figure 42 shows that the secreted dimart induced by OncSkip from the AAV CD3xGD2-HDD TransSkip vector is functional in mediating T cell killing in neuroblastoma cells.

[0073] [Figure 43]Figure 43 shows that transgene exon skipping in cells infected with AV CD3xGD2-HDD TransSkip variant K3 is induced and on-target by KRAS OncoSkip.

[0074] [Figure 44A] Figure 44A shows an exemplary AAV genome map of the CD19xCD3 TransSkip splice variant.

[0075] [Figure 44B] Figure 44B shows an exemplary CD19 TransSkip genome structure. The elements of the transgene encoded by AAV are shown in the figure.

[0076] [Figure 44C] Figure 44C shows an illustration of CD19 dimarts interacting with cancer cells and T cells. CD19 dimarts are produced by cells containing CD19 TransSkip. As shown in this figure, "Ca" represents cancer cells and "T" represents T cells.

[0077] [Figure 45] Figure 45 shows that OncoSkip morpholinos KTS1 and KTS2 induce on-target exon skipping of CD19xCD3 TransSkip K1.

[0078] [Figure 46] Figure 46 shows that KRAS OncoSkip induces secreted expression of the CD19xCD3 dimart in cells transfected with the CD19xCD3 TransSkip K1 AAV vector.

[0079] [Figure 47] Figure 47 shows the CD19xCD3 TransSkip splice variant K3, which removes the baseline but retains inducible exon skipping.

[0080] [Figure 48] Figure 48 shows that the induction of CD19xCD3 dimart expression from CD19xCD3 TransSkip K3, determined by T cell binding, is an on-target effect.

[0081] [Figure 49] Figure 49 shows that the induction of CD19xCD3 dimart expression from CD19xCD3 TransSkip K3 is repeatable. [Modes for carrying out the invention]

[0082] Detailed explanation Embodiments provided herein are described in more detail below. However, aspects of this disclosure can be embodied in different forms and should not be construed as being limited to the embodiments described herein. Rather, these embodiments are provided to ensure that this disclosure is thorough and complete and fully conveys the scope of the invention to those skilled in the art. The terms used herein are for the purpose of describing specific embodiments only and are not intended to limit them.

[0083] Unless otherwise defined, all terms used herein (including technical and scientific terms) have the same meaning as those commonly understood by those skilled in the art. Terms as defined in commonly used dictionaries should be interpreted as having the same meaning as their meanings in the context of this application and related art, and should not be interpreted in an idealized or overly formal sense unless explicitly defined herein. Terms not explicitly defined below should be interpreted according to their general meanings.

[0084] The terms used herein are intended solely to describe specific embodiments and are not intended to limit the invention. All publications, patent applications, patents, and other references referenced herein are incorporated by reference in their entirety.

[0085] Unless otherwise stated, the implementation of this technology will utilize conventional techniques of tissue culture, immunology, molecular biology, microbiology, cell biology, and recombinant DNA, which belong to the art of this field.

[0086] Unless the context indicates otherwise, the various features of the Invention described herein are particularly intended to be used in any combination. Furthermore, this disclosure is also intended to allow any feature or combination of features described herein to be excluded or omitted in some embodiments. For example, where the specification states that a complex comprises components A, B, and C, it is particularly intended that any one of A, B, or C, or any combination thereof, may be omitted and excluded from the scope of the rights, either individually or in any combination.

[0087] Unless otherwise specified, all identified embodiments, features, and terms are intended to include both the enumerated embodiments, features, or terms and their bioequivalents.

[0088] All numerical notations, including ranges, such as pH, temperature, time, concentration, and molecular weight, are approximations that vary (+) or (-) by increments of 1.0 or 0.1, or by variations of + / -15%, + / -10%, + / -5%, or + / -2%, as appropriate. It should be understood that, although not always explicitly stated, all numerical notations are preceded by the term "approximately." It should also be understood that, although not always explicitly stated, the reagents described herein are merely illustrative, and that equivalent reagents are known in the art.

[0089] Throughout this disclosure, various publications, patents, and published patent specifications are referenced by identifying citations or by Arabic numerals. The complete citations of publications identified by Arabic numerals are provided immediately before the claims. The disclosures of these publications, patents, and published patent specifications are incorporated in their entirety by reference to more fully illustrate the state of the art in which the invention relates. definition

[0090] Unless otherwise stated, the implementation of this technique will utilize conventional techniques in organic chemistry, pharmacology, immunology, molecular biology, microbiology, cell biology, and recombinant DNA, which fall within the technical scope of this art. For example, Sambrook, Fritsch and Maniatis, Molecular Cloning: A Laboratory Manual, 2nd edition (1989); Current Protocols In Molecular Biology (FMAusubel et al., eds., (1987)); the series Methods in Enzymology (Academic). See Press, Inc.: PCR 2: A Practical Approach (MJ MacPherson, B.D. Hames and G.T. Raylor eds. (1995)), Harlow and Lane, eds. (1988) Antibodies, a Laboratory Manual, and Animal Cell Culture (RI Freshney, ed. (1987)).

[0091] As used in the description of this invention and in the appended claims, the singular forms "a," "an," and "the" are intended to also include the plural forms unless the context explicitly indicates otherwise.

[0092] Where used herein, the term “contains” is intended to mean that the compositions and methods include the elements described, but do not exclude other elements. Where used herein, the transitional phrase (and grammatical variation) “essentially from” should be interpreted as encompassing the enumerated materials or processes, as well as materials or processes that do not substantially affect the basic and novel characteristics of the enumerated embodiments. Accordingly, where used herein, the term “essentially from” should not be interpreted as equivalent to “contains.” “Consists of” means excluding other components in excess of trace amounts and substantial method processes for administering the compositions disclosed herein. The embodiments defined by each of these transitional terms fall within the scope of this disclosure.

[0093] As used herein, the term “about” when referring to a measurable value such as a quantity or concentration is intended to encompass variations of 20%, 10%, 5%, 1%, 0.5%, or even 0.1% of the specified quantity.

[0094] When used to describe any selection of components, ranges, dosage forms, etc. disclosed herein, the terms “acceptable,” “effective,” or “sufficient” are intended to mean that such components, ranges, dosage forms, etc. are appropriate for the purposes for which they are disclosed.

[0095] Furthermore, as used herein, “and / or” encompasses not only all possible combinations of one or more of the related listed items, but also, where interpreted selectively (“or”), the absence of any combination.

[0096] As used herein, the terms “adeno-associated virus” or “AAV” refer to a class of viruses belonging to the genus Dependparvovirus of the family Parvoviridae, in relation to this name. Several serotypes of this virus are known to be suitable for gene delivery, and all known serotypes can infect cells from various tissue types. At least 11 sequentially numbered AAV serotypes are known in the art. Non-limiting exemplary serotypes useful in the methods disclosed herein include any of the 11 serotypes, e.g., AAV2, AAV8, AAV9, or variant serotypes, e.g., AAV-DJ and AAV PHP.B. AAV particles contain three major viral proteins: VP1, VP2, and VP3. In one embodiment, AAV refers to serotypes AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV PHP.B, AAVrh74, or AAV-DJ (a chimera obtained by shuffling eight different AAV wild types).

[0097] In some cases, AAV serotypes preferentially target histological types. In some cases, the following chart shows exemplary histological types and the AAV serotypes that target each histological type. [Table 1]

[0098] As used herein, the term “cell” may refer to either a prokaryotic cell or a eukaryotic cell, which may be obtained, as appropriate, from the subject or a commercially available source.

[0099] "Eukaryotic cells" include all kingdoms of life except the Monera kingdom. Eukaryotic cells can be easily identified by their membrane-bound nucleus. Animals, plants, fungi, and protists are eukaryotes, that is, organisms whose cells are organized into complex structures by an internal membrane and cytoskeleton. The most characteristic membrane-bound structure is the nucleus. Unless otherwise specified, the term "host" includes eukaryotic hosts, such as yeast, higher plants, insects, and mammals. Non-limiting examples of eukaryotic cells or eukaryotic hosts include monkeys, cattle, pigs, mice, rats, birds, reptiles, and humans, such as HEK293 cells and 293T cells.

[0100] Prokaryotic cells, which typically lack a nucleus or any other membrane-bound organelle, are divided into two domains: bacteria and archaea. These cells can also contain genetic information in circular loops called episomes, in addition to chromosomal DNA. Bacterial cells are extremely small, roughly the size of animal mitochondria (about 1-2 μm in diameter and 10 μm in length). Prokaryotic cells are characterized by three main shapes: rod-shaped, spherical, and helical. Instead of undergoing the sophisticated replication process of eukaryotes, bacterial cells divide by binary fission. Examples include, but are not limited to, Bacillus bacteria, Escherichia coli, and Salmonella bacteria.

[0101] When applied to nucleic acid sequences, the term “coding” refers to a polynucleotide that, in its original form or when manipulated by methods well known to those skilled in the art, can be transcribed and / or translated to produce mRNA for polypeptides and / or fragments thereof. The antisense strand is the complement of such nucleic acid, and the coding sequence can be inferred from the antisense strand.

[0102] The terms “equivalent” or “biological equivalent” are used interchangeably when referring to specific molecules, biological or cellular materials, intended to have minimal homology while still maintaining the desired structure or function. Non-limiting examples of equivalent polypeptides include polypeptides having at least 60%, or at least 65%, or at least 70%, or at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identity with respect to a polypeptide sequence, or polypeptides encoded by a polynucleotide or its complement that hybridizes under high stringency conditions to a polynucleotide encoding such a polypeptide sequence, which in one embodiment encodes the reference polypeptide. High stringency conditions are described herein and incorporated herein by reference. Alternatively, the equivalent is a polypeptide encoded by a polynucleotide or its complement, having at least 70%, or at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 96%, or at least 97%, sequence identity, or at least 98%, or at least 99%, identity with respect to a reference polynucleotide, such as a wild-type polynucleotide or the referenced polynucleotide.

[0103] Non-limiting examples of equivalent polynucleotides include polynucleotides having at least 60%, or at least 65%, or at least 70%, or at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 96% identity, or at least 97% sequence identity, or at least 98% identity, or at least 99% identity, with respect to a reference polynucleotide. Equivalents are also intended to be polynucleotides or their complements that hybridize with a reference polynucleotide under high stringency conditions.

[0104] A polynucleotide or polynucleotide region (or polypeptide or polypeptide region) having a certain percentage (e.g., 80%, 85%, 90%, or 95%) of "sequence identity" with respect to another sequence means that, when aligned, a comparison of the two sequences reveals that percentage of bases (or amino acids) are identical. Alignment and percentage homology or sequence identity can be determined using software programs known in the art, such as those described in Current Protocols in Molecular Biology (Ausubel et al., eds. 1987), Supplement 30, section 7.7.18, Table 7.7.1. In certain embodiments, initialization parameters are used for alignment. A non-limiting exemplary alignment program is BLAST, which uses initialization parameters. In particular, exemplary programs include BLASTN and BLASTP, which use the following initialization parameters. Genetic code = standard; filter = none; strand = both; cutoff = 60; expected value = 10; matrix = BLOSUM62; description = 50 sequences; sort = high score; database = non-redundant, GenBank + EMBL + DDBJ + PDB + GenBank CDS translation + SwissProtein + SPupdate + PIR. Details of these programs can be found at the following internet address: ncbi.nlm.nih.gov / cgi-bin / BLAST. Sequence identity and percent identity can be determined by incorporating them into clustalW (available at web address: genome.jp / tools / clustalw / , last accessed January 13, 2017).

[0105] "Homologie," "identity," or "similarity" refers to sequence similarity between two peptides or two nucleic acid molecules. Homologie can be determined by comparing the positions in each sequence that can be aligned for comparison. Molecules are homologous at a given position when the positions in the compared sequences are occupied by identical bases or amino acids. The degree of homology between sequences is a function of the number of matching or homologous positions shared by those sequences. "Unrelated" or "non-homologous" sequences share less than 40% identity or less than 25% identity with any of the sequences of this disclosure.

[0106] "Homologousity," "identity," or "similarity" can also refer to two nucleic acid molecules that form a hybrid under stringent conditions.

[0107] Hybridization refers to a reaction in which one or more polynucleotides react to form a stabilized complex via hydrogen bonds between the bases of nucleotide residues. Hydrogen bonding can occur by Watson-Crick base pairing, Hoogsteen bonding, or any other sequence-specific mode. The complex may consist of two strands forming a double-stranded structure, three or more strands forming a multi-stranded complex, a single self-hybridizing strand, or any combination thereof. Hybridization reactions may constitute a step in a larger process, such as initiating a PCR reaction or enzymatic cleavage of polynucleotides by a ribozyme.

[0108] Examples of stringent hybridization conditions include incubation temperatures of approximately 25°C to 37°C; hybridization buffer concentrations of approximately 6×sodium saline citrate (SSC) to 10×SSC; formamide concentrations of approximately 0% to 25%; and washing solutions of approximately 4×SSC to 8×SSC. Examples of moderate hybridization conditions include incubation temperatures of approximately 40°C to 50°C; buffer concentrations of approximately 9×SSC to 2×SSC; formamide concentrations of approximately 30% to 50%; and washing solutions of approximately 5×SSC to 2×SSC. Highly stringent hybridization refers to a state where the hybridization of oligonucleotides to the target sequence does not involve mismatches (i.e., complete complementarity). Examples of high-stringency conditions include incubation temperatures of approximately 55°C to 68°C; buffer concentrations of approximately 1×SSC to 0.1×SSC; formamide concentrations of approximately 55% to 75%; and washing solutions or deionized water of approximately 1×SSC and 0.1×SSC. Generally, the incubation time for hybridization is 5 minutes to 24 hours, with one, two or more washing steps, and the incubation time for washing is approximately 1, two or 15 minutes. SSC is 0.15M NaCl and 15mM citrate buffer. It is understood that equivalents of SSC using other buffer systems can be used.

[0109] As used herein, “expression” refers to the process by which a polynucleotide is transcribed into mRNA and / or the process by which the transcribed mRNA is subsequently translated into a peptide, polypeptide, or protein. If the polynucleotide is derived from genomic DNA, expression may include the splicing of mRNA in eukaryotic cells.

[0110] A “gene” refers to a polynucleotide containing at least one open reading frame (ORF) that can code for a specific polypeptide or protein after transcription and translation. A “gene product” or “gene expression product” refers to the amino acids (e.g., peptides or polypeptides) produced when a gene is transcribed and translated.

[0111] "Transcriptionally regulated" is a well-understood term in the art, indicating that the transcription of a polynucleotide sequence, typically a DNA sequence, depends on its functional linkage to elements that contribute to or promote transcription initiation. "Functionally linked" means that the polynucleotide is positioned so that it can function within the cell. In one embodiment, the present invention provides a promoter functionally linked to a downstream sequence.

[0112] The term "exon" refers to a nucleic acid sequence that contains a protein-coding sequence. Genes typically contain more than one exon, separated by introns present in between.

[0113] As used herein, the term “intron” refers to a nucleic acid sequence flanked by a splice donor site at the 5' end and a splice acceptor site at the 3' end. In some embodiments, introns are excluded or removed by splicing from RNA or mRNA sequences expressed from a vector containing introns.

[0114] The term "splice donor site" refers to the nucleic acid sequence or domain at the 5' end of an intron. In one embodiment, the splice donor site indicates the intron's boundary with the intron's start and / or immediately preceding coding sequence (or exon).

[0115] As used herein, the term “splice acceptor site” refers to the nucleic acid sequence or domain at the 3' end of an intron. In one embodiment, the splice acceptor site indicates the start of the intron and the boundary of the intron with the subsequent coding sequence-exon. In another embodiment, the splice acceptor site includes an intron branch point, which is the point where the 5' end of the intron is joined during the splicing process. In some embodiments, the splice acceptor sequence and the intron branch point are located adjacent to each other as a single unit. In some embodiments, the splice acceptor sequence and the intron branch point may be further separated by moving the branch point further 5' of the splice acceptor sequence.

[0116] As used herein, the term “splice site” refers to a sequence or domain of nucleic acid located at either the 5' or 3' end of an intron as defined above.

[0117] As used herein, the term “exon skipping” refers to the modification of premRNA splicing by targeting splice donor and / or acceptor sites within premRNA with one or more complementary antisense oligonucleotides. By blocking spliceosome access to one or more splice donor or acceptor sites, one or more complementary antisense oligonucleotides can prevent the splicing reaction, thereby causing the deletion of one or more exons from fully processed mRNA. In one embodiment, exon skipping is achieved in the nucleus during the maturation process of premRNA. This involves shielding key sequences involved in the splicing of a targeted exon by using an antisense oligonucleotide complementary to the splice donor sequence within the premRNA.

[0118] As used herein, the term “gene regulatory sequence” refers to a nucleic acid sequence capable of controlling the transcription, splicing, or modification of a gene, open reading frame, or exon or intron. The gene regulatory sequences of the present invention may include promoters, binding sites for antisense oligonucleotides, and / or enhancers. Therefore, placing a gene under the regulatory control of a promoter or regulatory element means arranging the gene such that its expression is controlled by the regulatory sequence(s). Thus, in constructing promoter-gene combinations, the promoter is preferably positioned upstream of the gene at a distance from the transcription start site that is approximately equal to the distance between the promoter and the gene it controls in its natural context. Variations in this distance may be tolerated without loss of promoter function. Similarly, with respect to a heterologous gene under its control, the preferred arrangement of regulatory elements, such as enhancers, reflects their native position with respect to the structural gene that the regulatory element natively controls. Enhancers, in contrast to promoter elements, are considered relatively unaffected by positional and orientational influences. In some embodiments, the gene regulatory sequence comprises one or more of a binding sequence to an antisense oligonucleotide, a binding sequence to doxycycline, or a polynucleotide sequence encoding a riboswitch. In some embodiments, the antisense oligonucleotide (ASO) comprises one or more modified nucleotides. In one embodiment, the antisense oligonucleotide is a morpholino oligonucleotide.

[0119] In some embodiments, the antisense oligonucleotides (ASOs) described herein include a length of about 8 to about 50 nucleotides. In some cases, the ASOs include a length of about 8 to about 30, about 8 to about 25, about 8 to about 20, about 8 to about 18, about 8 to about 15, about 10 to about 50, about 10 to about 30, about 10 to about 25, about 10 to about 20, about 10 to about 18, about 10 to about 15, about 12 to about 50, about 12 to about 30, about 12 to about 25, about 12 to about 20, about 12 to about 18, or about 12 to about 15 nucleotides. In some embodiments, the ASOs include a length of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40, or 50 nucleotides.

[0120] In some cases, ASOs contain one or more modified nucleotides. In some cases, ASOs contain about 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% modified nucleotides. In other examples, ASOs contain about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, or more modified nucleotides. In some cases, the modification is at the 2' hydroxyl group of the ribose moiety. In some cases, modifications include H, OR, R, halo, SH, SR, NH2, NHR, NR2, or CN, where R is the alkyl moiety. Exemplary alkyl moieties include, but are not limited to, halogens, sulfur, thiols, thioethers, thioesters, amines (primary, secondary, or tertiary), amides, ethers, esters, alcohols, and oxygen. In some cases, the alkyl moiety contains further modifications. In some cases, modifications include azo groups, keto groups, aldehyde groups, carboxyl groups, nitro groups, nitroso groups, nitrile groups, and heterocyclic groups (e.g., imidazole, hydride). The modified nucleotide may include a razino or hydroxylamino group, an isocyanate or cyanate group, or a sulfur-containing group (e.g., sulfoxide, sulfone, sulfide, and disulfide). In some cases, the alkyl moiety may further include heterosubstituted groups. In some cases, the carbon of the heterocyclic group may be substituted with nitrogen, oxygen, or sulfur. In some cases, heterocyclic substitutions may include, but are not limited to, morpholino, imidazole, and pyrrolidino. In some cases, the modification at the 2'-hydroxyl group may be a 2'-O-methyl modification or a 2'-O-methoxyethyl (2'-O-MOE) modification. In some cases, the modified nucleotide may be locked or cross-linked ribose modification (e.g., locked nucleic acid or LNA), ethylene nucleic acid (ENA) (e.g., 2'-4'-ethylene cross-linked nucleic acid), peptide nucleic acid, or morpholino. In some cases, the modified nucleotide may further include one or more inter-modified nucleotide bonds.Exemplary modified internucleotide bonds include phosphorothioates, phosphorodithioates, methylphosphonates, 5'-alkylenephosphonates, 5'-methylphosphonates, 3'-alkylenephosphonates, borontrifluorides, 3'-5' or 2'-5' linked boranophosphate and selenophosphates, phosphotriesters, thionoalkylphosphotriesters, phosphonic acid hydrogen bonds, alkylphosphonates, alkylphosphonothioates, arylphosphonothioates, phosphoroselenoates, phosphorodiselenoates, phosphinates, phosphoramidates, 3'-alkylphosphoramidates, aminoalkylphosphoramidates, thionophosphoramidates, phosphoropiperazidates, and phosphorani This includes, but is not limited to, rotioates, phosphoranilidates, ketones, sulfones, sulfonamides, carbonates, carbamates, methylenehydrazo, methylenedimethylhydrazo, formacetals, thioformacetals, oximes, methyleneiminos, methylenemethyliminos, thioamidates, bonds with riboacetyl groups, aminoethylglycine, silyl or siloxane bonds, for example, alkyl or cycloalkyl bonds of 1 to 10 carbon atoms that are saturated or unsaturated and / or substituted and / or contain heteroatoms, with or without heteroatoms, morpholino structures, amides, and polyamides, in which a base is directly or indirectly bonded to the aza nitrogen of the skeleton, and combinations thereof.

[0121] As used herein, the term “morpholino” refers to a polymer molecule having a base-supporting backbone capable of forming hydrogen bonds with polynucleotides. In some embodiments, the polymer on the morpholino lacks a pentose sugar backbone moiety, more specifically, a ribose backbone linked by phosphodiester bonds, which are typical of nucleotides and nucleosides. In one embodiment, the morpholino oligonucleotide contains a nitrogen ring. In another embodiment, the morpholino is a sterically pure oligonucleotide (see, for example, wavelifesciences.com, last accessed January 25, 2019) or a derivative thereof. In yet another embodiment, the morpholino contains a sequence that is at least 95% identical to a sterically pure polynucleotide.

[0122] In another embodiment, the morpholino comprises a structure of about 8 to about 50, about 8 to about 30, about 10 to about 50, about 10 to about 30, or about 12 to about 30 nucleotides, which includes a targeted nucleotide sequence complementary to a selected pre-treated mRNA or target region of pre-mRNA, such as an intron region of pre-mRNA. In another embodiment, the morpholino antisense oligonucleotide facilitates splicing of the target exon, resulting in a transcript lacking the target exon.

[0123] In some cases, antisense oligonucleotides (ASOs) are referred to herein as OncoSkip. As used herein, the term “OncoSkip” refers to an ASO designed to induce skipping of target exons during splicing of a target transgene, thereby inducing the expression of the target transgene. In some cases, the target transgene encodes a polypeptide that binds to a surface polypeptide (e.g., a surface receptor) of a target cell. In some cases, the target cell is a tumor cell or an immune cell. In some cases, the target transgene is an oncogene. In such examples, the use of OncoSkip induces skipping of target exons during splicing to induce the expression of the oncogene.

[0124] In some embodiments, the OncoSkip described herein comprises about 8 to about 50 nucleotides in length. In some cases, the OncoSkip comprises about 8 to about 30, about 8 to about 25, about 8 to about 20, about 8 to about 18, about 8 to about 15, about 10 to about 50, about 10 to about 30, about 10 to about 25, about 10 to about 20, about 10 to about 18, about 10 to about 15, about 12 to about 50, about 12 to about 30, about 12 to about 25, about 12 to about 20, about 12 to about 18, or about 12 to about 15 nucleotides in length. In some embodiments, the OncoSkip comprises 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40, or 50 nucleotides in length.

[0125] In some embodiments, OncoSkip contains one or more modified nucleotides, for example, about 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% modified nucleotides. In some cases, OncoSkip contains about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, or more modified nucleotides. In some cases, OncoSkip contains one or more morpholino-modified nucleotides. In some cases, OncoSkip contains about 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% morpholino-modified nucleotides. In some cases, OncoSkip contains approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40 or more morpholino-modified nucleotides.

[0126] In some cases, OncoSkip works in conjunction with TransSkip. As used herein, the term "TransSkip" refers to a recombinant vector (e.g., a recombinant viral vector such as an AAV vector) containing a transgene interrupted by an intron-exon-intron region, wherein the exon contains a stop codon that prevents the normal expression of the polypeptide encoded by the transgene. In some cases, the transgene is further encompassed by a construct containing a polynucleotide encoding a dimart. In some cases, together with OncoSkip, OncoSkip skips an exon from the intron-exon-intron region during splicing to produce mRNA that enables the expression of the polypeptide encoded by the transgene. In the absence of OncoSkip, transgene expression from TransSkip is stopped due to the presence of a stop codon in the intron-exon-intron region.

[0127] As used herein, the term “dimart” refers to an engineered protein molecule containing two or more single-stranded variable fragments (scFv) that recognize a surface polypeptide (e.g., a surface receptor) expressed on a cell, and that two cells are different. In some cases, a dimart targets two different cell types, e.g., cancer cells and immune cells, or two different immune cell types. Exemplary immune cell types include dendritic cells, natural killer (NK) cells, macrophages, T cells, B cells, monocytes, or neutrophils. In some cases, the immune cells are effector immune cells. In some cases, the effector immune cells are effector T(T) cells. eff Includes cells (also referred to herein as tumor-infiltrating T cells). Exemplary T eff The cells include CD8+ T cells and unregulated CD4+ helper T cells. In some cases, dimarts target cancer cells and effector immune cells. In some cases, dimarts target cancer cells and T effIt targets cells. In some cases, dimarts target two different cancer cells, for example, two different cancer cells from the same tumor.

[0128] In some cases, two or more scFvs of a dimart are linked by linkers. In some cases, the linkers are peptide linkers that facilitate the binding of each scFv to its respective target polypeptide. In some cases, the linkers consist of a series of poly-Ala, poly-Gly, or combinations thereof. In some cases, the peptide linkers, including poly-Ala linkers, poly-Gly linkers, or combinations of Ala and Gly, are each independently about 2 to 50 residues in length. In some cases, peptide linkers containing polyAla linkers, polyGly linkers, or combinations of Ala and Gly, independently have approximately 2 to 45 residues, approximately 4 to 45 residues, approximately 5 to 45 residues, approximately 8 to 45 residues, approximately 10 to 45 residues, approximately 15 to 45 residues, approximately 20 to 45 residues, approximately 30 to 45 residues, approximately 2 to 40 residues, approximately 4 to 40 residues, approximately 5 to 40 residues, approximately 8 to 40 residues, and approximately The lengths are approximately 10 to 40 residues, 15 to 40 residues, 20 to 40 residues, 30 to 40 residues, 2 to 30 residues, 4 to 30 residues, 5 to 30 residues, 8 to 30 residues, 10 to 30 residues, 15 to 30 residues, 20 to 30 residues, 2 to 20 residues, 4 to 20 residues, 5 to 20 residues, 8 to 20 residues, 10 to 20 residues, or 15 to 20 residues. In some cases, peptide linkers containing poly-Ala linkers, poly-Gly linkers, or combinations of Ala and Gly are independently approximately 2, 4, 5, 6, 8, 10, 12, 14, 15, 16, 18, 20, 25, 30, 35, 40, 45, or 50 residues in length.

[0129] In some cases, the linker is a (Gly4Ser)n linker, where n is an integer from 1 to 10. In some cases, n is an integer from 1 to 6, 1 to 4, or 1 to 3. In some cases, n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some cases, the linker is about 10 to about 50 amino acid residues long, and as needed, about 10 to about 30, about 10 to about 25, or about 10 to about 20 amino acid residues long. In some cases, the linker contains one or more non-natural amino acids.

[0130] In some cases, the dimart further contains additional polypeptides. In some cases, the additional polypeptides enhance the avidity of the dimart to target cells. In some cases, the additional polypeptides are the dimerization domain of human hepatocyte nuclear factor 1α (HNF1α). In some cases, HNF1α contains a polypeptide sequence having at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with MVSKLSQLQTELLAALLESGLSKEALIQALGE (SEQ ID NO: 47). In some cases, HNF1α is encoded by a polynucleotide having at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with ATGGTGAGCAAGCTGAGCCAGCTGCAGACCGAGCTGCTGGCCGCCCTGCTGGAGAGCGGCCTGAGCAAGGAGGCCCTGATCCAGGCCCTGGGCGAG (SEQ ID NO: 48). In some cases, additional polypeptides do not induce any additional immunogenicity or toxicity.

[0131] In some embodiments, a further polypeptide is linked to the remainder of the dimart by a linker. In some cases, the linker comprises GSGGAP. As used herein, the GSGGAP peptide is also referred to herein as a spacer. In some cases, the linker comprises TPLGDTTHTSG. In some cases, the peptide TPLGDTTHTSG is derived from the hinge region of IgG3.

[0132] As used herein, the term "TransJoin" refers to a recombinant vector (e.g., a recombinant viral vector such as an AAV vector) containing a polypeptide that encodes the dimart described herein but whose exon does not contain an intron-exon-intron region containing a stop codon. Therefore, TransJoin is different from TransSkip because it can express the dimart without requiring OncoSkip.

[0133] In some embodiments, the TransJoin described herein is optimized for the delivery of a dimart to target cells or tissues of interest. In some cases, the TransJoin comprises a promoter-enhancer pair, or a promoter-regulatory element pair, optimized for delivery and / or expression to target cells or tissues. In some cases, the TransJoin is optimized for constitutive expression of a dimart over a period of time (e.g., by a promoter-enhancer pair or a promoter-regulatory element pair). In some cases, the TransJoin is optimized for constitutive and stable expression of a dimart over a period of time (e.g., by a promoter-enhancer pair or a promoter-regulatory element pair). In some cases, the TransJoin comprises a promoter and a regulatory element, such as a woodchuck hepatitis virus (WHP) post-transcriptional regulatory element (WPRE), for enhanced expression, constitutive expression, stable expression, or a combination thereof.

[0134] In some embodiments, the TransJoin described herein includes a promoter-enhancer pair or a promoter-regulatory element pair optimized for balanced expression of a dimart in target cells or target tissues. In some cases, balanced expression refers to a range of expression above which toxicity is induced, but below which no therapeutic effect is produced. In some cases, the promoter-enhancer or promoter-regulatory element (e.g., WPRE) works in conjunction to balance the expression of the dimart to reach a target range. In some cases, balanced expression includes a broad range, for example, to give a broad therapeutic range to the dimart.

[0135] In some embodiments, the TransJoin described herein further comprises a secretory consensus sequence, as described below, optimized for balanced expression of the dimart in target cells or target tissues. In some cases, balanced expression refers to a range of expression above which toxicity is induced, but below which no therapeutic effect is observed. In some cases, the secretory consensus sequence acts in conjunction with a promoter, enhancer, regulatory element (e.g., WPRE) or a combination thereof to balance the expression of the dimart to reach a target range. In some cases, balanced expression includes a broad range, for example, to provide a broad therapeutic range for the dimart.

[0136] When used above, the period includes periods of 1 day, 2 days, 3 days, 4 days, 5 days, 7 days, 21 days, 28 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 8 months, 10 months, 1 year, 2 years, or periods exceeding that.

[0137] As used herein, the term “isolated” refers to a molecule, biologic, or cellular material that is substantially free from other materials.

[0138] As used herein, the term “functional” may be used to modify any molecule, biologic, or cellular material intended to achieve a specific, designated effect.

[0139] As used herein, the terms “nucleic acid sequence” and “polynucleotide” are used interchangeably to describe polymeric forms of nucleotides of any length, which are either ribonucleotides or deoxyribonucleotides. Therefore, these terms include, but are not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases or other natural, chemically or biochemically modified, unnatural, or derivatized nucleotide bases.

[0140] As used herein, the term “promoter” refers to any sequence that regulates the expression of a coding sequence, such as a gene. Promoters can be, for example, constitutive, inductive, repressive, or tissue-specific. A “promoter” is a regulatory sequence, which is a region of polynucleotide sequence where the initiation and rate of transcription are controlled. Promoters can contain genetic elements to which regulatory proteins and molecules, such as RNA polymerase and other transcription factors, can bind. Non-exclusive exemplary promoters include the Roussarcoma virus (RSV) LTR promoter (with the RSV enhancer, if applicable), the cytomegalovirus (CMV) promoter, the SV40 promoter, the dihydrofolate reductase promoter, the β-actin promoter, the phosphoglycerol kinase (PGK) promoter, the U6 promoter, or the EF1 alpha truncated (EFS) promoter.

[0141] In some embodiments, the promoter is an EF1 alpha shortened (EFS) promoter. In some cases, the EF1 alpha shortened (EFS) promoter is [ka] or equivalents thereof.

[0142] Further, non-limiting, exemplary promoters with certain target specificities, including but not limited to cytomegalovirus (CMV), human polypeptide chain elongation factor (EF1a), SV40, phosphoglycerate kinase (PGK), e.g., PGK1 (human or mouse), P5, Ubc, human beta-actin, CAG, TRE, UAS, Ac5, polyhedrin, CaMKIIa, Gal1, TEF1, GDS, ADH1, CaMV35S, ubiquitin (Ubi), e.g., ubiquitin C (UbiC), H1, U6, alpha-1-antitrypsin, splenic focal virus (SFFV), and chicken beta-actin (CBA), are provided below herein. Synthetic promoters may be used for ubiquitous or tissue-specific expression. Furthermore, virus-derived promoters, some of which are listed above, e.g., CMV, HIV, adenovirus, and AAV promoters, may be useful in the methods disclosed herein.

[0143] In some embodiments, the promoter is a tissue-specific promoter. In some cases, the tissue-specific promoter is an endogenous promoter or a promoter derived from a gene expressed exclusively in the target cell type. Exemplary tissue-specific promoters include, but are not limited to, liver-specific promoters such as ApoE / hAAT, LP1, and SV40 / hAlb (InvivoGen); photoreceptor-specific promoters such as human rhodopsin kinase (GRK1) and pyramidal arrestin (CAR); B-cell-specific promoters such as B29 (InvivoGen); hematopoietic cell-specific promoters such as the CD45 promoter and SV40 / CD45 from InvivoGen; muscle cell-specific promoters such as the desmin promoter (InvivoGen); pancreatic acinar cell-specific promoters such as the elastase-1 promoter (InvivoGen); endothelial cell-specific promoters such as the Flt-1 promoter (InvivoGen); and neuronal cell-specific promoters such as the SYN1 promoter (InvivoGen).

[0144] In some embodiments, the promoter is bound to an enhancer to increase transcription efficiency. Non-limiting examples of enhancers include RSV enhancers, CMV enhancers, and α-fetoprotein MERII enhancers.

[0145] An enhancer is a regulatory element that increases the expression of a target sequence. A “promoter / enhancer” is a polynucleotide containing a sequence that can provide both promoter and enhancer functions. For example, the terminal repeat sequence of a retrovirus contains both promoter and enhancer functions. An enhancer / promoter can be “endogenous,” “exogenous,” or “heterogeneous.” An “endogenous” enhancer / promoter is one that is naturally linked to a specific gene in the genome. An “exogenous” or “heterogeneous” enhancer / promoter is an enhancer / promoter that has been juxtaposed with a gene using genetic engineering (i.e., molecular biological techniques) so that the transcription of that gene is induced by the linked enhancer / promoter.

[0146] In some embodiments, the vectors used herein (e.g., viral vectors such as AAV vectors) further include one or more additional regulatory elements. Exemplary regulatory elements include, but are not limited to, transcription terminators, polyadenylation sites, and terminal inversion sequences (ITRs), such as 5'ITR and 3'ITR. In some cases, the regulatory elements include woodchuck hepatitis virus (WHP) post-transcriptional regulatory elements (WPREs). In some cases, the exemplary WPRE includes the nucleic acid sequence of SEQ ID NO: 50 or its equivalent. The sequence of SEQ ID NO: 50 is shown below:

[0147] [ka]

[0148] The terms “protein,” “peptide,” and “polypeptide” are used interchangeably and, in their broadest sense, refer to compounds of two or more subunits of an amino acid, amino acid analog, or peptide mimetic. Subunits may be linked by peptide bonds. In another embodiment, subunits may be linked by other bonds, such as esters, ethers, etc. A protein or peptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids that may constitute a protein sequence or peptide sequence. As used herein, the term “amino acid” refers to any natural and / or unnatural or synthetic amino acid, including glycine and both D and L optical isomers, amino acid analogs, and peptide mimetic.

[0149] As used herein, the term “vector” refers to a non-chromosomal nucleic acid containing an intact replicon that can replicate when placed in a cell, for example, through a transformation process. Vectors may be viral or nonviral. Viral vectors include retroviruses, adenoviruses, herpesviruses, baculoviruses, modified baculoviruses, papovaviruses, or other naturally occurring viruses that have been modified in a different way. Exemplary nonviral vectors for delivering nucleic acids include naked DNA; DNA alone or in combination with cationic polymers, or in combination with cationic lipids; anionic and cationic liposomes; DNA-protein complexes and particles containing DNA condensed with cationic polymers, possibly contained within liposomes, such as heterologous polylysine, oligopeptides of defined lengths, and polyethyleneimine; and the use of ternary complexes containing viruses and polylysine-DNA. In another embodiment, the vector is a recombinant viral vector comprising a skeletal vector selected from the group consisting of retroviral vectors, lentiviral vectors, mouse leukemia virus ("MLV") vectors, Epstein-Barr virus ("EBV") vectors, adenovirus vectors, herpesvirus ("HSV") vectors, or adeno-associated virus ("AAV") vectors. In another embodiment, the vector is an AAV vector, or a self-complementary AAV vector as needed.

[0150] A "viral vector" is defined as a recombinantly produced virus or viral particle containing polynucleotides to be delivered into a host cell, either in vivo, ex vivo, or in vitro. Examples of viral vectors include retroviral vectors, AAV vectors, lentiviral vectors, adenovirus vectors, and alphaviral vectors. Alphaviral vectors, such as Semliki forest virus-based vectors and Sindbis virus-based vectors, have also been developed for use in gene therapy and immunotherapy. See Schlesinger and Dubensky (1999) Curr. Opin. Biotechnol. 5:434-439 and Ying et al., (1999) Nat. Med. 5(7):823-827. In some cases, the viral vector is an AAV vector, such as AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV PHP.B, AAVrh74, or AAV-DJ. In some cases, the viral vector is AAVrh74. In some cases, AAVrh74 contains the vector sequence of GenBank accession number LP899424.1 (accessed on February 7, 2020).

[0151] In some embodiments, viral vectors (e.g., AAV vectors) have limited loading capacity. For example, AAV vectors have a loading capacity limit of 4.7 kb. Therefore, the combination of dimarts and promoters, enhancers, and other regulatory elements must be within this 4.7 kb capacity. In such examples, the promoters used herein are selected based on their nucleic acid length to enable the packaging of dimarts and other regulatory elements into viral vectors, such as AAV vectors. In some cases, the promoter for such use is SFFV, EF1α, PGK, UbiC, CMV, CBA, or EFS. In some cases, the promoter is EFS.

[0152] In another embodiment, the promoter is an inductive promoter. In certain relevant embodiments, the promoter is an inductive tetracycline promoter. The Tet-Off and Tet-On gene expression systems provide researchers with readily available regulated, high-level gene expression systems as described by Gossen & Bujard (1992; Tet-Off) and Gossen et al. (1995; Tet-On). In the Tet-Off system, gene expression is turned on when tetracycline (Tc) or doxycycline (Dox; a Tc derivative) is removed from the culture medium. In contrast, in the Tet-On system, expression is turned on by adding Dox. In either system, gene expression can be tightly regulated in response to changes in Tc or Dox concentration. The maximum expression levels in the Tet system are very high and comparable to the maximum levels obtained from potent constitutive mammalian promoters such as CMV (Yin et al., 1996). Unlike other inducible mammalian expression systems, gene regulation in the Tet system is highly specific, thus avoiding the complexity of interpreting results due to pleiotropy or nonspecific induction. In E. coli, the Tet repressor protein (TetR) negatively regulates the genes of the tetracycline-resistant operon on the Tn10 transposon. TetR blocks the transcription of these genes by binding to the tet operator sequence (tetO) in the absence of Tc. TetR and tetO provide the basis for regulation and induction for use in mammalian experimental systems. In the Tet-On system, the regulatory protein is based on a “reverse” Tet repressor (rTetR) created by a four-amino acid change in TetR (Hillen & Berens, 1994; Gossen et al., 1995). The resulting protein rtTA (reverse tTA is also called tetracycline-activating protein) is encoded by the pTet-On regulator plasmid.

[0153] In related embodiments, the vector further comprises, essentially consists of, or comprises a nucleic acid encoding a tetracycline-activated protein and a promoter that modulates the expression of the tetracycline-activated protein.

[0154] Other inducible systems useful in the vectors, isolated cells, viral packaging systems and methods described herein include modulation with ecdysone, estrogen, progesterone, chemical inducers of dimerization, and isopropyl-β-D1-thiogalactopyranoside (EPTG).

[0155] As used herein, the terms “recombinant expression system” or “recombinant vector” refer to one or more genetic constructs for the expression of a particular genetic material formed by recombination.

[0156] A “gene delivery vehicle” is defined as any molecule capable of delivering inserted polynucleotides into a host cell. Examples of gene delivery vehicles include liposomes, micelles, biocompatible polymers including natural and synthetic polymers; lipoproteins; polypeptides; polysaccharides; lipopolysaccharides; artificial viral envelopes; metallic particles; and other recombinant vehicles typically used in the art for expression in various eukaryotic and prokaryotic hosts, as well as for simple protein expression and for gene therapy.

[0157] The polynucleotides disclosed herein can be delivered to cells or tissues using gene delivery vehicles. As used herein, “gene delivery,” “gene transfer,” and “transduction” refer to the introduction of exogenous polynucleotides (sometimes called “transgenes”) into host cells, regardless of the method used for introduction. Such methods include various well-known techniques such as vector-mediated gene transfer (e.g., viral infection / transduction, or by various other protein-based or lipid-based gene delivery complexes), as well as techniques that facilitate the delivery of “naked” polynucleotides (e.g., electroporation, “gene gun” delivery, and various other techniques used for the introduction of polynucleotides). The introduced polynucleotides may be maintained stably or transiently in host cells. Stable maintenance typically requires that the introduced polynucleotides contain an origin of replication compatible with the host cell, or be incorporated into a host cell replicon such as an extrachromosomal replicon (e.g., a plasmid) or into the chromosomes of the nucleus or mitochondria. Many vectors, known in the art and described herein, are known to be able to mediate the introduction of genes into mammalian cells.

[0158] A plasmid is an extrachromosomal DNA molecule that can replicate independently of chromosomal DNA. Plasmids are often circular and double-stranded. Plasmids provide mechanisms for horizontal gene transfer within microbial populations, typically offering advantages in selection under specific environmental conditions. Plasmids can carry genes that confer resistance to naturally occurring antibiotics in competitive ecological niches, or the proteins they produce can act as toxins under similar circumstances.

[0159] Plasmids used in genetic engineering are called plasmid vectors. Many plasmids are commercially available for this purpose. The gene to be replicated is inserted into a copy of the plasmid, which contains a multiple cloning site (MCS, or polylinker), a short region containing several commonly used restriction sites that facilitate the insertion of the gene that makes cells resistant to a particular antibiotic and a DNA fragment at this location. Another primary use of plasmids is to produce large quantities of protein. In this case, researchers grow bacteria containing a plasmid with the gene of interest. Just as bacteria produce proteins that confer antibiotic resistance, bacteria can also be induced to produce large quantities of protein from the inserted gene.

[0160] In embodiments where gene transfer is mediated by a DNA viral vector such as adenovirus (Ad) or adeno-associated virus (AAV), the vector construct refers to a polynucleotide containing the viral genome or a portion thereof, and the transgene. Adenoviruses (Ad) are a relatively well-characterized and homogeneous group of viruses, including more than 50 serotypes. Adenoviruses do not require integration into the host cell genome. Recombinant Ad-derived vectors have also been constructed, particularly those that reduce the likelihood of generating recombinant and wild-type viruses. Such vectors are commercially available from sources such as Takara Bio USA (Mountain View, CA), Vector Biolabs (Philadelphia, PA), and Creative Biogene (Shirley, NY). Wild-type AAV has high infectivity and specificity, and is integrated into the host cell genome. See Wold and Toth (2013) Curr. Gene. Ther. 13(6):421-433, Hermonat & Muzyczka (1984) Proc. Natl. Acad. Sci. USA 81:6466-6470, and Lebkowski et al. (1988) Mol. Cell. Biol. 8:3988-3996.

[0161] Vectors containing both a promoter and a cloning site within which polynucleotides can be functionally linked are well known in this field. Such vectors can transcribe RNA in vitro or in vivo, and Agilent It is commercially available from sources such as Technologies (Santa Clara, Calif.) and Promega Biotech (Madison, Wis.). To optimize expression and / or transcription in vitro, it may be necessary to remove, add, or modify the 5' and / or 3' untranslated portions of the clone to remove any extra, potentially inappropriate, alternative translation start codon or other sequence that could interfere with or reduce expression at either the transcriptional or translational level. Alternatively, to enhance expression, the consensus ribosome binding site can be inserted immediately 5' of the start codon.

[0162] As used herein, the terms “engager,” “engager molecule,” or “activating antigen” refer to molecules secreted by cells that can activate immune cells. In certain embodiments, an engager specifically activates immune effector cells according to the domains present in the engager. Examples of cells that secrete engagers include, but are not limited to, T cells, NK cells, NKT cells, CAR-T cells, mesenchymal stem cells (MSCs), neural stem cells, hematopoietic stem cells, or mixtures thereof. In other embodiments, immune effector cells include dendritic cells, natural killer ("NK") cells, macrophages, T cells, B cells, or combinations thereof.

[0163] The terms “antigen-recognition domain” or “antigen-binding domain” refer to a portion of an engager molecule that recognizes an antigen. In certain embodiments, the antigen may be any kind of molecule, including but not limited to proteins, carbohydrates, and / or synthetic molecules.

[0164] As used herein, the terms “activating antigen” or “activating domain” refer to a portion of an engager molecule that interacts with immune cells and induces positive or negative immunomodulatory signals. Examples of positive immunomodulatory signals include signals that induce cell proliferation, cytokine secretion, or cytolytic activity. Examples of negative immunomodulatory signals include signals that inhibit cell proliferation, inhibit the secretion of immunosuppressive factors, or induce cell death.

[0165] As used herein, the term “naturally occurring immune cells” refers to immune cells that are naturally present in the immune system. Examples include, but are not limited to, T cells, NK cells, NKT cells, B cells, and dendritic cells.

[0166] As used herein, the term “manipulated immune cells” refers to genetically modified immune cells.

[0167] As used herein, the term "T cell" includes naive T cells, CD4+ T cells, CD8+ T cells, memory T cells, activated T cells, anergie T cells, resistant T cells, chimeric B cells, and antigen-specific T cells.

[0168] As used herein, the term “antibody” means not only intact antibody molecules but also fragments of antibody molecules that retain immunogenic binding ability. Such fragments are also well known in the art and are regularly used both in vitro and in vivo. Therefore, as used herein, the term “antibody” means not only intact immunoglobulin molecules but also the well-known active fragments F(ab')2 and Fab. Fab fragments lacking F(ab')2 and the Fc fragment of the intact antibody are removed from circulation more rapidly and may result in less nonspecific tissue binding of the intact antibody (Wahl et al., J. Nucl. Med. 24:316-325 (1983)). The antibodies of the present invention include whole native antibodies, monoclonal antibodies, human antibodies, humanized antibodies, camelized antibodies, multispecific antibodies, bispecific antibodies, chimeric antibodies, Fab, Fab', single-stranded V-region fragments (scFv), single-domain antibodies (e.g., nanobody and single-domain camel antibodies), V NAR The antibodies include fragments, bispecific T cell engager (BiTE) antibodies, minibodies, disulfide-linked Fv (sdFv), and anti-idiotype (anti-Id) antibodies, intrabodies, fusion polypeptides, unconventional antibodies, and any of the antigen-binding fragments described above. In particular, the antibodies include immunoglobulin molecules and immunologically active fragments of immunoglobulin molecules, i.e., molecules containing antigen-binding sites. The immunoglobulin molecules may be of any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2), or subclass.

[0169] In a particular embodiment, the antibody is a glycoprotein comprising at least two heavy (H) chains and two light (L) chains interconnected by disulfide bonds. Each heavy chain has a heavy chain variable region (V in this specification). H (Abbreviated as) and heavy chain steady state (C H The heavy chain constant region consists of three domains, CH1, CH2, and CH3. Each light chain is composed of a light chain variable region (V in this specification). Labbreviated as) and the light chain constant C L region. The light chain constant region consists of one domain C L region. V H and V L regions can be further subdivided into hypervariable regions called complementarity-determining regions (CDRs) in which more conserved regions called framework regions (FRs) are interspersed. Each V H and V L is composed of three CDRs and four FRs arranged in the following order from the amino terminus to the carboxy terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains contain binding domains that interact with antigens. The constant regions of antibodies can mediate the binding of immunoglobulins to host tissues or factors including various cells of the immune system (e.g., effector cells) and the first component of the classical complement system (Clq). As used interchangeably herein, the terms "antigen-binding portion," "antigen-binding fragment," or "antigen-binding region" of an antibody refer to the region or portion of the antibody that binds to an antigen and confers antigen specificity to the antibody, and antigen-binding proteins, e.g., fragments of an antibody, include one or more fragments of an antibody that retain the ability to specifically bind to an antigen (e.g., a peptide / HLA complex). It has been shown that the antigen-binding function of an antibody can be performed by fragments of a full-length antibody. Examples of antigen-binding portions included within the term "antibody fragment" of an antibody include V L V H C L and a Fab fragment which is a monovalent fragment consisting of the CHI domain; an F(ab)2 fragment which is a bivalent fragment containing two Fab fragments linked by disulfide bridges in the hinge region; an Fd fragment consisting of the V<00​​​​​​​​​​Antibodies and antibody fragments may originate, whole or in part, from mammals (e.g., humans, non-human primates, goats, guinea pigs, hamsters, horses, mice, rats, rabbits, and sheep) or non-mammalian antibody-producing animals (e.g., chickens, ducks, geese, snakes, and caudates). Antibodies and antibody fragments may be produced within animals or outside of animals, such as from yeast or phages (e.g., as a single antibody or antibody fragment, or as part of an antibody library).

[0171] Furthermore, the two domains of the Fv fragment, V L and V H These are encoded by separate genes, but they can be recombined using the V method. L and V H These can be linked by synthetic linkers, which allow them to be constructed as a single protein chain in which the regions pair up to form a monovalent molecule. These are known as single-stranded Fv (scFv), see, for example, Bird et al., Science 242:423-426 (1988) and Huston et al., Proc. Natl. Acad. Sci. 85:5879-5883 (1988). These antibody fragments are obtained using conventional techniques known to those skilled in the art, and the fragments are screened for utility, just as with intact antibodies.

[0172] "Isolated antibodies" or "isolated antigen-binding proteins" are identified, isolated, and / or recovered from components of their natural environment. "Synthetic antibodies" or "recombinant antibodies" are generally produced using recombinant techniques or peptide synthesis techniques known to those skilled in the art.

[0173] As used herein, the terms “single-stranded variable fragment” or “scFv” are used with respect to V H :V L A heavy chain (V) of immunoglobulin (e.g., mouse or human) covalently linked to form a heterodimer. H ) and light chain (V LIt is a fusion protein of the variable region of ). Heavy chain (V H ) and light chain (V L ) are directly connected, or V H The N-terminus of V L The C-terminus of, or V H The C-terminus of V L The N-terminus is linked by a linker (e.g., approximately 10, 15, 20, or 25 amino acids) encoding a peptide to which it connects. The linker is typically rich in glycine for flexibility and also rich in serine or threonine for solubility. The linker can link the heavy chain variable region and the light chain variable region of the extracellular antigen-binding domain.

[0174] Despite the removal of the constant region and the introduction of a linker, the scFv protein retains the specificity of the original immunoglobulin. Single-chain Fv polypeptide antibodies are described by Huston et al. (Proc. Nat. Acad. Sci. USA, 85:5879-5883 (1988)), V H and V L It can be expressed from nucleic acids containing the sequence encoding it. See also U.S. Patents 5,091,513, 5,132,405, and 4,956,778 and U.S. Patent Publications 20050196754 and 20050196754. Inhibitory antagonist scFvs have been described (e.g., Zhao et al., Hybridoma(Larchmt) 27(6):455-51 (2008); Peter et al., J Cachexia Sarcopenia Muscle (2012); Shieh et al., J. Imunol, 183(4):2277-85 (2009); Giomarelli et al., Thromb Haemost See 97(6):955-63(2007); Fife et al., J Clin Invst 116(8):2252-61(2006); Brocks et al., Immunotechnology 3(3):173-84(1997); Moosmayer et al., Ther Immunol 2(10):31-40(1995). Agonist scFvs with stimulating activity have been described (see, for example, Peter et al., J Biol Chem 25278(38):36740-7(2003); Xie et al., Nat Biotech 15(8):768-71(1997); Ledbetter et al., Crit Rev Immunol 17(5-6):427-55(1997); Ho et al., Bio Chim Biophys Acta 1638(3):257-66(2003)).

[0175] As used herein, "F(ab)" refers to a fragment of an antibody structure that binds to an antigen, is monovalent, and lacks an Fc region. For example, an antibody digested by the enzyme papain produces two F(ab) fragments and an Fc fragment (e.g., a heavy (H) chain constant region; an Fc region that does not bind to the antigen).

[0176] As used herein, "F(ab')2" refers to an antibody fragment produced by pepsin digestion of a whole IgG antibody, which has two antigen-binding (ab') (bivalent) regions, each (ab 1 The ) region contains two distinct amino acid chains, namely a portion of the H chain and a light (L) chain linked by a disulfide bond to bind the antigen, with the remaining H chain portion linked together. The "F(ab')2" fragment can be divided into two individual Fab' fragments.

[0177] As used herein, "CDR" is defined as the complementarity-determining region amino acid sequence of an antibody, which is the hypervariable region of the immunoglobulin heavy and light chains. For example, Kabat et al., Sequences of Proteins of Immunological Interest, 4th USD Department of Health and See Human Services, National Institutes of Health (1987). Generally, antibodies contain three heavy chains and three light chain CDRs or CDR regions within their variable region. The CDRs provide the majority of the contact residues for the antibody's binding to the antigen or epitope. In certain embodiments, the CDR regions are represented using the Kabat system (Kabat, EA et al., Sequences of Proteins of Immunological Interest, Fifth Edition, USD Department of Health and Human Services, NIH Publication No. 91-3242 (1991)).

[0178] As used herein, the term "affinity" refers to a measure of binding strength. While not theoretically bound, affinity refers to the antibody binding site. The affinity depends on the tightness of the stereochemical compatibility between the antibody and the antigenic determinant, the size of the contact area between them, and the distribution of charged and hydrophobic groups. Affinity also includes the term "avidity," which refers to the strength of antigen-antibody binding after the formation of a reversible complex (e.g., monovalent or polyvalent). Methods for calculating the affinity of an antibody to an antigen are known in the art and include the use of binding experiments to calculate affinity. Antibody activity in a functional assay (e.g., flow cytometry assay) also reflects antibody affinity. Antibodies and affinity can be phenotypically characterized and compared using a functional assay (e.g., flow cytometry assay). Nucleic acid molecules useful in the subject matter of this disclosure include any nucleic acid molecules encoding polypeptides or fragments thereof. In certain embodiments, nucleic acid molecules useful in the subject matter of this disclosure include nucleic acid molecules encoding antibodies or their antigen-binding moieties. Such nucleic acid molecules do not need to be 100% identical to the endogenous nucleic acid sequence, but typically exhibit substantial identity. Polynucleotides having "substantial homology" or "substantial identity" with an endogenous sequence can typically hybridize with at least one strand of a double-stranded nucleic acid molecule. "Hybridizing" means a pair of complementary polynucleotide sequences (e.g., the genes described herein) or parts thereof that form a double-stranded molecule under various stringency conditions. (See, for example, Wahl, G.M. and S.B. Berger, Methods Enzymol. 152:399 (1987); Kimmel, A.M. Methods Enzymol. 152:507 (1987)).

[0179] The terms “substantially homologous” or “substantially identical” mean a polypeptide or nucleic acid molecule that exhibits at least 50% or more homology or identity with a reference amino acid sequence (e.g., any of the amino acid sequences described herein) or nucleic acid sequence (e.g., any of the nucleic acid sequences described herein). For example, such a sequence is homologous or identical at the amino acid level or nucleic acid level to a sequence used for comparison (e.g., a wild-type or natural sequence) by at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 96%, or about 97%, or about 98%, or about 99%. In some embodiments, a substantially homologous or substantially identical polypeptide includes one or more amino acid substitutions, insertions, or deletions compared to a sequence used for comparison. In some embodiments, substantially homologous or substantially identical polypeptides contain one or more non-natural amino acids or amino acid analogs, including D-amino acids and retroinverso amino acids, to replace homologous sequences.

[0180] Sequence homology or sequence identity is typically measured using sequence analysis software (e.g., the Sequence Analysis Software Package, BLAST, BESTFIT, GAP, or PILEUP / PRETTYBOX programs from Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705). Such software matches identical or similar sequences by assigning a degree of homology to various substitutions, deletions, and / or other modifications. An exemplary approach to determining the degree of identity can be to use the BLAST program, e -3 and e-100 The probability scores between these points show closely related sequences.

[0181] As used herein, the term “analog” refers to a structurally related polypeptide or nucleic acid molecule that has the function of a reference polypeptide or nucleic acid molecule.

[0182] As used herein, the term “conservative sequence modification” refers to an amino acid modification that does not significantly affect or alter the binding properties of the engineered receptor of the Disclosure, including its amino acid sequence (e.g., the extracellular antigen-binding domain of the engineered receptor). Conservative modifications may include amino acid substitutions, additions, and deletions. Modifications can be introduced into the human scFv of the engineered receptor of the Disclosure by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Amino acids can be classified into groups based on their physicochemical properties, such as charge and polarity. A conservative amino acid substitution is the replacement of an amino acid residue with an amino acid from the same group. For example, amino acids can be classified by charge: positively charged amino acids include lysine, arginine, and histidine; negatively charged amino acids include aspartic acid and glutamic acid; and neutrally charged amino acids include alanine, asparagine, cysteine, glutamine, glycine, isoleucine, leucine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. Furthermore, amino acids can be classified by polarity: polar amino acids include arginine (basic polarity), asparagine, aspartic acid (acidic polarity), glutamic acid (acidic polarity), glutamine, histidine (basic polarity), lysine (basic polarity), serine, threonine, and tyrosine, while nonpolar amino acids include alanine, cysteine, glycine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, and valine. Thus, one or more amino acid residues within a CDR region can be replaced with other amino acid residues from the same group, and the altered antibody can be tested for retained function (i.e., the function described in (c) to (1) above) using the functional assays described herein. In certain embodiments, one or fewer, two or fewer, three or fewer, four or five or fewer residues within a specified sequence or CDR region are altered.

[0183] As used herein, the term “ligand” refers to a molecule that binds to a receptor. In particular, ligands bind to receptors on other cells, enabling intercellular recognition and / or interaction.

[0184] As used herein, the terms “costimulatory signaling domain” or “costimulatory domain” refer to a portion of an engineered receptor containing the intracellular domain of a costimulatory molecule. A costimulatory molecule is a cell surface molecule other than an antigen receptor or Fc receptor that provides a second signal required for the efficient activation and function of T lymphocytes when bound to an antigen. Examples of such costimulatory molecules include ligands that specifically bind CD27, CD28, 4-1BB (CD137), OX40 (CD134), CD30, CD40, PD-1, ICOS (CD278), LFA-1, CD2, CD7, LIGHT, NKD2C, B7-H2, and CD83. Thus, while this disclosure provides exemplary costimulatory domains derived from CD28 and 4-1BB, other costimulatory domains are intended for use with the engineered receptors described herein. By including one or more costimulatory signaling domains, the efficacy and expansion of T cells expressing the engineered receptor can be enhanced. The intracellular signaling domain and the co-stimulatory signaling domain can be tandemly linked to the carboxyl terminus of the transmembrane domain in any order.

[0185] As used herein, the terms “chimeric costimulatory receptor” or “CCR” refer to a chimeric receptor that binds to an antigen and delivers a costimulatory signal, but does not deliver a T cell activation signal.

[0186] The terms “bispecific antibody” or “trispecific antibody” refer to an antibody having two different antigen-binding regions (bispecific antibody) or three different antigen-binding regions (trispecific antibody). In some embodiments, bispecific antibodies include antibody formats (or antibody structures) such as those disclosed in Figure 2 of Brinkmann et al., “The making of bispecific antibodies”, MABS9(2):182-212 (2017) or in Figure 2 of Labrijn et al., “Bispecific antibodies: a mechanistic review of the pipeline”, Nature Reviews 18:585-608 (2019).

[0187] In some embodiments, at least one antigen-binding region of a bispecific or trispecific antibody binds to an activating antigen on an immunoeffector cell. This can be understood as binding to different targets, but also includes binding to different epitopes within a single target. Non-limiting examples of activating antigens include, but are not limited to, CD3, CD2, CD4, CD8, CD19, LFA1, CD45, NKG2D, NKp44, NKp46, NKp30, DNAM, B7-H3 (CD276), CD20, CD22, or combinations thereof. Non-limiting examples of bispecific antibodies include, but are not limited to, CD3xCD19, CD3xGD2, CD3xEphA2, and NKG2DxGD2 antibodies.

[0188] In one embodiment, the dimart comprises a bispecific antibody. In some cases, the dimart comprises a bispecific T-cell engager ("BiTE") antibody, a bispecific killer cell engager ("BiKE") antibody, or other bispecific antibodies described herein, such as those associated with different immune cells. In another embodiment, the dimart comprises a trispecific antibody. In some cases, the dimart comprises a trispecific T-cell engager ("TriTE") antibody or a trispecific killer cell engager ("TriKE") antibody, or other trispecific antibodies described herein, such as those associated with different immune cells.

[0189] As used herein, the term “bispecific T cell engager” or “BiTE” refers to a bispecific monoclonal antibody comprising a first antigen-binding fragment that binds to a T cell receptor and a second antigen-binding fragment that binds to tumor cells via a tumor-specific molecule. As used herein, the term “triplespecific T cell engager” (“TiTE” or “TriTE”) refers to a triplicate monoclonal antibody comprising a first antigen-binding fragment that binds to a T cell engager, a second antigen-binding fragment that binds to tumor cells via a tumor-specific molecule, and a third antigen-binding fragment that binds to a T cell engager or cytokine T cell activation domain. Tumor-specific molecules, in one embodiment, include tumor antigens selected from ephrin type A receptor 2 (EphA2), interleukin (IL)-13r alpha 2, EGFR VIII, PSMA, EpCAM, GD2 or GD3, fucosyl GM1, PSCA, PLAC1, sarcoma breakpoint, Wilms tumor 1, alpha-fetoprotein (AFP), carcinoembryonic antigen (CEA), CA-125, MUC-1, epithelial tumor antigen (ETA), tyrosinase, melanoma-associated antigen (MAGE), hematologic differentiation antigen, surface glycoprotein, ganglioside (GM2), growth factor receptor, stromal antigen, vascular antigen, receptor tyrosine kinase-like orphan receptor 1 (ROR1), mesothelin, CD38, CD123, human epidermal growth factor receptor 2 (HER2), B cell maturation antigen (BCMA), fibroblast-activating protein (FAP) alpha, or combinations thereof. Examples of BiTEs include, but are not limited to, blinatumomab (MT103) and solitomab (MT110).

[0190] As used herein, the term “bispecific killer engager” or “BiKE” refers to a bispecific monoclonal antibody comprising a first antigen-binding fragment that binds to a natural killer (NK) cell engager domain and a second antigen-binding fragment that binds to tumor cells via a tumor-specific molecule. As used herein, the term “triplespecific NK cell engager” (“TiKE” or “TriKE”) refers to a triplicate monoclonal antibody comprising a first antigen-binding fragment that binds to an NK cell engager, a second antigen-binding fragment that binds to tumor cells via a tumor-specific molecule, and a third antigen-binding fragment that binds to an NK cell engager or cytokine NK cell activation domain. The NKG2DxIL21RxGD2 antibody is one exemplary TriKE antibody. Examples of NK cell engager domains include CD16, CD16 + CD2, CD16 + DNAM and CD16 + Examples of ligands or molecules that bind to NKp46 include, but are not limited to, IL-15, IL-12, IL-18, IL-21, or other NK cell-enhancing cytokines, chemokines, and / or activating molecules. The NK-engaging domain may include any portion that binds to and / or activates NK cells, and / or blocks the inhibition of NK cells. In some embodiments, the NK-engaging domain may include an antibody that selectively binds to components on the surface of NK cells. In other embodiments, the NK-engaging domain may include a ligand or small molecule that selectively binds to components on the surface of NK cells.

[0191] In some embodiments, the NK engaging domain can selectively bind to receptors located at least partially on the surface of NK cells. In certain embodiments, the NK engaging domain can perform the function of binding to NK cells, thereby spatially bringing NK cells closer to targets to which the targeting domain selectively binds. However, in certain embodiments, the NK engaging domain can selectively bind to receptors that activate NK cells, and therefore also has an activating function. As described above, activation of the CD16 receptor can induce antibody-dependent cell-mediated cytotoxicity. Therefore, in certain embodiments, the NK engaging domain can include at least a portion of an anti-CD16 receptor antibody effective in selectively binding to the CD16 receptor. In other embodiments, the NK engager cell domain can interfere with mechanisms that inhibit NK cells. In such embodiments, the NK engager domain can include, for example, anti-PDl / PDLl, anti-NKG2A, anti-TIGIT, anti-killer immunoglobulin receptor (KIR), and / or any other inhibitory blockade domains.

[0192] In certain embodiments, cells (including immune cells) are genetically modified by an engager molecule comprising at least an antigen-recognition domain and an activation domain, and optionally a domain for inhibiting cytokines, costimulatory domains, and / or negative regulatory molecules of T cell activation. The antigen-recognition domain of the engager molecule binds to one or more molecules present in and / or on target cells, or secreted by target cells. In certain embodiments, target cells are cancer cells, including at least solid tumor cells. Once the engager molecule binds to the target molecule, the engager molecule can activate cells that express the molecule recognized by the activation domain. The engager molecule can activate cells that have been genetically modified by the engager molecule, or it can activate cells that have not been genetically modified.

[0193] Depending on the desired effect, activation can result in positive or negative signals. Examples of positive signals include signals that induce cell proliferation, cytokine secretion, or cytolytic activity. Examples of negative signals include signals that inhibit T cell proliferation, inhibit the secretion of immunosuppressive factors, or induce cell death.

[0194] In certain embodiments, immune cells that secrete engager molecules can redirect resident (naturally endemic to a particular individual) immune cells towards cancer cells.

[0195] Embodiments of this disclosure provide delivery of modified immune cells that secrete engager molecules to an individual (known to have or suspected to have cancer, including certain cancers) that requires delivery of modified immune cells that secrete engager molecules, as opposed to delivery of engager molecules only to the individual (in the absence of production by modified immune cells). In this disclosure, the individual receives modified immune cells that enable the production of engager molecules. In certain embodiments, the cells produce immunostimulatory cytokines, proliferate antigen-specifically, kill appropriate target cells, redirect bystander immune cells (including at least T cells or NK cells) to cancer cells, secrete engager molecules upon activation, and / or are locally or systemically effective against cancer. Figure 3 shows an example of modified T cells or NK cells that secrete engager molecules. Certain T cells or NK cells may produce engagers that can target the same cancer cell-specific antigens, but since NK cells do not express CD3, the activation domains for T cells or NK cells must be different. Examples of activation domains for NK cells include, for example, at least CD16, NKG2D, or NKp30.

[0196] Gene delivery vehicles also include DNA / liposome complexes, mice, and targeted viral protein-DNA complexes. Liposomes, including targeted antibodies or fragments thereof, can be used in the methods disclosed herein. In addition to the delivery of polynucleotides to cells or cell populations, other non-limiting techniques of protein translocation make it possible to directly introduce the proteins described herein into cells or cell populations, or to enhance the expression and / or increase the activity of the proteins disclosed herein, such as culture conditions.

[0197] As used herein, the terms “signal peptide” or “signal polypeptide” refer to the amino acid sequence typically present at the N-terminal end of a newly synthesized secreted or membrane polypeptide or protein. A “signal peptide” or “signal polypeptide” acts to guide a polypeptide to a specific cellular location, for example, across the cell membrane, into the cell membrane, or into the nucleus. In some embodiments, the signal peptide is removed after localization. Examples of signal peptides are well known in the art. Non-limiting examples are described in U.S. Patents 8,853,381, 5,958,736, and 8,795,965.

[0198] As used herein, the terms “viral capsid” or “capsid” refer to the proteinaceous shell or coat of a viral particle. The capsid functions to encapsulate, protect, transport, and release the viral genome into a host cell. Capsids are generally composed of oligomeric structural subunits of proteins (“capsid proteins”). As used herein, the term “encapsulated in a capsid” means enclosed within a viral capsid.

[0199] As used herein, the term “helper” with respect to a virus or plasmid refers to a virus or plasmid used to provide additional components necessary for the replication and packaging of viral particles, such as modified AAVs, or recombinant viral particles, as disclosed herein. Components encoded by a helper virus may include any genes required for virion construction, capsid formation, genome replication, and / or packaging. For example, a helper virus may encode enzymes necessary for the replication of a viral genome. Non-limiting examples of helper viruses and plasmids suitable for use with AAV constructs include pHELP (plasmid), adenovirus (virus), or herpesvirus (virus).

[0200] As used herein, the term "AAV" is a standard abbreviation for adeno-associated virus. Adeno-associated viruses are single-stranded DNA parvoviruses that replicate only in cells that have been given specific functions by co-infecting helper viruses. General information and reviews of AAV can be found, for example, in Carter, 1989, Handbook of Parvoviruses, Vol. 1, pp. 169–228 and Berns, 1990, Virology, pp. 1743–1764, Raven Press, (New York). Since it is well known that the various serotypes are very closely related structurally, functionally, and even at the genetic level, it is quite foreseeable that the same principles described in these reviews may be applicable to further AAV serotypes that have been characterized since the publication date of these reviews. (See, for example, Blacklowe, 1988, pp. 165-174 of Parvoviruses and Human Disease, JR Pattison, ed.; and Rose, Comprehensive Virology 3:1-61 (1974)). For example, all AAV serotypes clearly exhibit very similar replication characteristics mediated by homologous rep genes, and all possess three related capsid proteins, such as those expressed in AAV2. The degree of relevance is further suggested by heteroduplex analysis revealing extensive cross-hybridization between serotypes along genome length and the presence of similar self-annealing segments at the ends corresponding to “terminal inversion sequences” (ITRs). Similar infectivity patterns also suggest that replication function in each serotype is under similar regulatory control.

[0201] As used herein, “AAV vector” refers to a vector containing one or more adjacent AAV terminal repeat sequences (ITRs) of a polynucleotide (or transgene) of interest. Such AAV vectors can be replicated and packaged into infectious viral particles when present in a host cell transfected with a vector encoding and expressing rep and cap gene products.

[0202] An "AAV virion," "AAV virus particle," or "AAV vector particle" refers to a viral particle consisting of at least one AAV capsid protein and a polynucleotide AAV vector encapsulated by the capsid. If the particle contains a different type of polynucleotide (i.e., a polynucleotide other than the wild-type AAV genome, such as a transgene to be delivered to a mammalian cell), it is usually referred to as an "AAV vector particle" or simply an "AAV vector." Since such vectors are contained within AAV vector particles, the production of AAV vector particles necessarily involves the production of AAV vectors.

[0203] In some embodiments, AAV is a replication-deficient parvovirus whose single-stranded DNA genome is approximately 4.7 kb long and contains two 145-nucleotide terminal inversion sequences (ITRs). Multiple serotypes of AAV exist. The nucleotide sequences of the genomes of AAV serotypes are publicly known. For example, the complete genome of AAV-1 is available under GenBank accession number NC_002077. The complete genome of AAV-2 is available under GenBank accession number NC_001401 and in Srivastava et al., J. Virol., 45:555-564 (1983). The complete genome of AAV-3 is available under GenBank accession number NC_1829. The complete genome of AAV-4 is available under GenBank accession number NC_001829. The genome of AAV-5 is available under GenBank accession number AF085716. The complete genome of AAV-6 is available under GenBank accession number NC_001862. At least portions of the AAV-7 and AAV-8 genomes are available under GenBank accession numbers AX753246 and AX753249, respectively. The AAV-9 genome is available in Gao et al., J. Virol., 78:6381-6388 (2004). The AAV-10 genome is available in Mol. Ther., 13(1):67-76 (2006). The AAV-11 genome is available in Virology, 330(2):375-383 (2004). The sequence of the AAV rh.74 genome is available in U.S. Patent No. 9,434,928, incorporated herein by reference. U.S. Patent No. 9,434,928 also provides sequences of the capsid protein and the self-complementary genome. In one embodiment, the genome is a self-complementary genome. The cis-acting sequences that direct viral DNA replication (rep), capsid inclusion / packaging, and host cell chromosome integration are contained within the AAV ITR. Three AAV promoters (named p5, pl9, and p40 relative to their map locations) drive the expression of two AAV internal open reading frames that encode the rep and cap genes.Two rep promoters (p5 and pi9), coupled with alternative splicing of a single AAV intron (at nucleotides 2107 and 2227), result in the production of four rep proteins (rep78, rep68, rep52, and rep40) from the rep gene. The rep proteins possess multiple enzymatic properties that ultimately contribute to the replication of the viral genome. The cap gene is expressed from the p40 promoter and encodes three capsid proteins: VP1, VP2, and VP3. Alternative splicing and a non-consensus translation initiation site are involved in the production of the three related capsid proteins. A single consensus polyadenylation site is located at map position 95 of the AAV genome. The life cycle and genetics of AAV are outlined in Muzyczka, Current Topics in Microbiology and Immunology, 158:97-129 (1992).

[0204] AAV possesses unique characteristics that make it attractive, for example, as a vector for delivering foreign DNA to cells in gene therapy. AAV infection of cells in culture is non-cytotoxic, and natural infection in humans and other animals is asymptomatic. Furthermore, AAV infects many mammalian cells and can target many different tissues in vivo. Additionally, AAV can transduce slowly dividing and non-dividing cells and persist as a transcriptionally active nuclear episome (extrachromosomal element) for virtually the entire lifespan of these cells. Since the AAV proviral genome is inserted as cloned DNA in a plasmid, the construction of a recombinant genome is feasible. Furthermore, since signals directing AAV replication and genomic capsid formation are contained within the ITR of the AAV genome, some or all of the approximately 4.3 kb inside the genome (encoding the replication and structural capsid proteins, rep-cap) can be replaced with foreign DNA. To generate AAV vectors, the rep and cap proteins can be supplied in trans. Another important characteristic of AAV is that it is a very stable and robust virus. AAV readily withstands the conditions used to inactivate adenoviruses (56°C to 65°C for several hours), making low-temperature storage of AAV less important. AAV can even be freeze-dried. Finally, cells infected with AAV are not resistant to co-infection.

[0205] Multiple studies have demonstrated long-term (>1.5 years) recombinant AAV-mediated protein expression in muscle. See Clark et al., Hum Gene Ther, 8:659-669 (1997); Kessler et al., Proc Nat. Acad Sc. USA, 93:14082-14087 (1996); and Xiao et al., J Virol, 70:8098-8108 (1996). See also Chao et al., Mol Ther, 2:619-623 (2000) and Chao et al., Mol Ther, 4:217-222 (2001). Furthermore, because muscles are highly angiogenic, recombinant AAV transduction resulted in the appearance of the transgene product in systemic circulation after intramuscular injection, as described by Herzog et al., Proc Natl Acad Sci USA, 94:5804-5809 (1997) and Murphy et al., Proc Natl Acad Sci USA, 94:13921-13926 (1997). In addition, Lewis et al., J Virol, 76:8769-8775 (2002) demonstrated that skeletal muscle fibers possess the cellular factors necessary for the correct glycosylation, folding, and secretion of antibodies, indicating that muscles can stably express secreted protein therapeutics. The AAV DNA in the rAAV genome may originate from any AAV serotype from which recombinant viruses can be induced, including but not limited to AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV PHP.B, AAVrh74, and AAV-DJ. The construction of pseudotyped rAAVs is disclosed, for example, in International Publication No. 01 / 83692. Other types of rAAV variants, such as rAAVs with capsid mutations, are also being considered. See, for example, Marsic et al., Molecular Therapy, 22(11):1900-1909 (2014). Nucleotide sequences of various AAV serotype genomes are publicly known in the art.

[0206] As used herein, the term “external” with respect to a viral capsid protein refers to the surface, domain, region, or end of the capsid protein that faces outward in an assembled viral capsid. The term “internal” with respect to a viral capsid protein refers to the surface, domain, region, or end (amino or carboxyl terminus) of the capsid protein that faces inward in an assembled viral capsid. As used with respect to an assembled viral capsid, the term “internal” refers to the space enclosed by the capsid inside the viral capsid and the inward-facing surface of the capsid exposed to this enclosed space. The internal space may contain nucleic acids such as the viral genome, viral proteins, proteins of the host or packaging cell, and any other components or factors that are packaged or encapsulated in the capsid during replication, virion assembly, capsid formation, and / or packaging.

[0207] As used herein, the term "label" means a directly or indirectly detectable compound or composition that is directly or indirectly conjugated to a composition to be detected, such as a polynucleotide or a protein such as an antibody, in order to produce a "labeled" composition. The term also includes sequences conjugated to polynucleotides that provide a signal upon expression of the inserted sequence, such as green fluorescent protein (GFP). A label can be detectable alone (e.g., a radioisotope label or a fluorescent label), or in the case of an enzyme label, can catalyze a chemical change in a substrate compound or composition that is detectable. A label can be suitable for small-scale detection or can be more suitable for high-throughput screening. Thus, suitable labels include, but are not limited to, radioisotopes, fluorescent dyes, chemiluminescent compounds, dyes, and proteins including enzymes. A label can simply be detected or can be quantified. A response that is simply detected generally includes a response whose presence is merely confirmed, whereas a response that is quantified generally includes a response having a quantifiable (e.g., numerically reportable) value such as intensity, polarization, and / or other characteristics. In a luminescence or fluorescence assay, a detectable response can be generated directly using a luminophore or fluorophore associated with an assay component that is actually involved in the binding, or indirectly using a luminophore or fluorophore associated with another (e.g., reporter or indicator) component.

[0208] Examples of luminescent labels that generate a signal include, but are not limited to, bioluminescence and chemiluminescence. A detectable luminescent response generally includes a change or occurrence of a luminescence signal. Suitable methods and luminophores for labeling assay components are known in the art and are described, for example, in Haugland, Richard P. (1996) Handbook of Fluorescent Probes and Research Chemicals (6th ed.). Examples of luminescence probes include, but are not limited to, aequorin and luciferase.

[0209] Examples of suitable fluorescent labels include, but are not limited to, fluorescein, rhodamine, tetramethylrhodamine, eosin, erythrosin, coumarin, methylcoumarin, pyrene, Malacite Green, stilbene, Lucifer Yellow, Cascade Blue™, and Texas Red. Other suitable optical dyes are described in Haugland, Richard P. (1996) Handbook of Fluorescent Probes and Research Chemicals (6th ed.).

[0210] In another aspect, the fluorescent label is provided with a functional group to facilitate covalent attachment to a cellular component present in or on the surface of a cell or tissue, such as a cell surface marker. Suitable functional groups include, but are not limited to, isothiocyanate groups, amino groups, haloacetyl groups, maleimide, succinimidyl esters, and halogenated sulfonyls, all of which can be used to attach the fluorescent label to a second molecule. The choice of the functional group of the fluorescent label depends on the attachment site to either a linker, a drug, a marker, or a second labeling agent.

[0211] Attachment of the fluorescent label can be done directly to the cellular component or compound or via a linker. Suitable binding pairs used when indirectly linking the fluorescent label to an intermediate include, but are not limited to, antigen / antibody, such as rhodamine / anti-rhodamine, biotin / avidin, and biotin / streptavidin.

[0212] The term “solid support” refers to a non-aqueous surface such as a “culture plate,” “gene chip,” or “microarray.” Such gene chips or microarrays can be used for diagnostic and therapeutic purposes by many techniques known to those skilled in the art. In one technique, oligonucleotides are attached and sequenced on a gene chip to determine the DNA sequence by a hybridization approach, such as those outlined in U.S. Patents 6,025,136 and 6,018,041. The polynucleotides of the present invention can be modified into probes, which can then be used for the detection of gene sequences. Such techniques are described, for example, in U.S. Patents 5,968,740 and 5,858,659. As described by Kayem et al., U.S. Patent 952,172 and Kelley et al., (1999) Nucleic Acids Res. 27:4830-4837, probes can also be attached to or mounted on an electrode surface for the electrochemical detection of nucleic acid sequences.

[0213] "Composition" is intended to mean a combination of an active polypeptide, polynucleotide, or antibody with another compound or composition that is inactive (e.g., a detectable label) or active (e.g., a gene delivery vehicle).

[0214] A "pharmaceutical composition" comprises a combination of an active polynucleotide, polynucleotide, or antibody and an inactive or active carrier such as a solid support, and is intended to make the composition suitable for in vitro, in vivo, or ex vivo diagnostic or therapeutic applications.

[0215] As used herein, the term “pharmaceutically acceptable carrier” encompasses any standard pharmaceutically acceptable carrier, including phosphate-buffered saline, water, and emulsions such as oil / water or water / oil emulsions, as well as various types of wetting agents. Compositions may also contain stabilizers and preservatives. For examples of carriers, stabilizers, and adjuvants, see Martin (1975) Remington's Pharm. Sci., 15th Ed. (Mack Publ. Co., Easton).

[0216] As used herein, the term “cancer” includes solid tumors and hematological malignancies. Exemplary solid tumors include, but are not limited to, bladder cancer, bone cancer, brain cancer (e.g., glioblastoma), breast cancer, colorectal cancer, esophageal cancer, eye cancer, head and neck cancer, kidney cancer, lung cancer, melanoma, mesothelioma, ovarian cancer, pancreatic cancer, prostate cancer, or stomach cancer. Exemplary hematological malignancies include acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), follicular lymphoma (FL), diffuse large B-cell lymphoma (DLBCL), mantle cell lymphoma (MCL), Waldenström macroglobulinemia, multiple myeloma, extranodal marginal zone B-cell lymphoma, nodal marginal zone B-cell lymphoma, Burkitt lymphoma, and non-Burkitt hypertension. This includes, but is not limited to, grade B-cell lymphoma, mediastinal primary B-cell lymphoma (PMBL), immunoblastic large cell lymphoma, progenitor B-lymphoblastic lymphoma, B-cell prelymphoblastic leukemia, lymphoplasmacytic lymphoma, splenic marginal zone lymphoma, plasmacytogenic myeloma, plasmacytoma, mediastinal (thymic) large B-cell lymphoma, intravascular large B-cell lymphoma, primary exudative lymphoma, or lymphomatoid granulomatosis. In some cases, the cancer is metastatic (e.g., metastatic solid tumor or metastatic hematological malignancy). In some cases, the cancer is recurrent or refractory (e.g., recurrent or refractory solid tumor or recurrent or refractory hematological malignancy).

[0217] In some embodiments, cancer is characterized by upregulated expression of fibroblast-activating protein (FAP) (the amino acid sequence of human FAP is disclosed in GenPept accession number I38593, accessed February 10, 2020). FAP, also known as FAP-alpha and prolyl endopeptidase FAP, is a membrane-bound glycoprotein and part of the dipeptidyl peptidase (DPP) family. FAP possesses both post-proline exopeptidase and gelatinase activity. In some cases, cancers characterized by upregulated expression of FAP (FAP-positive cancers) include, but are not limited to, bone cancer, brain cancer, breast cancer, colorectal cancer, esophageal cancer, gastric cancer, liver cancer, lung cancer, oral cancer, ovarian cancer, pancreatic cancer, parathyroid cancer, and kidney cancer. In some cases, FAP-positive cancers include high levels of fibrosis. In some cases, this level is compared to equivalent cancers in which FAP is not upregulated. In further examples, this level is compared to the fibrosis level of a normal subject.

[0218] In some cases, the dimarts described herein bind to the extracellular portion of FAP-alpha. In some cases, the dimarts bind to human FAP-alpha (e.g., to the extracellular portion of FAP-alpha having GenPept accession number I38593 or its equivalent). In some cases, the dimarts bind to FAP-alpha and immune cell targets, e.g., cell surface polypeptides expressed on T cells or NK cells. In some cases, the dimarts bind to FAP-alpha and, if necessary, to immune cell targets (e.g., cell surface polypeptides expressed on T cells or NK cells) for the treatment of FAP-positive cancers, including pancreatic cancer, and, if necessary, FAP-positive cancers characterized by high levels of fibrosis.

[0219] In some embodiments, cancer is characterized by the expression and / or upregulation of B-cell maturation antigen (BCMA) (also known as tumor necrosis factor receptor superfamily member 17, TNFRSF17, and BCM), a cell surface receptor of the TNF receptor superfamily. In some cases, the amino acid sequence of human BCMA is disclosed in GenPept accession number BAB60895.1 (accessed February 10, 2020). In some cases, cancer characterized by BCMA expression and / or upregulation is myeloma (or multiple myeloma).

[0220] In some cases, the dimarts described herein bind to the extracellular portion of BCMA. In some cases, the dimarts bind to human BCMA (e.g., the extracellular portion of BCMA having GenPept accession number BAB60895.1 or its equivalent). In some cases, the dimarts bind to BCMA and immune cell targets, such as cell surface polypeptides expressed on T cells or NK cells. In some cases, for the treatment of myeloma, the dimarts bind to BCMA and, if necessary, to immune cell targets (e.g., cell surface polypeptides expressed on T cells or NK cells).

[0221] In some embodiments, cancer is characterized by the expression or upregulation of epidermal growth factor receptor (EGFR) variants, such as EGFR variant III (EGFRvIII). EGFRvIII refers to a mutation in EGFR, including a deletion in exons 2–7 of the EGFR gene. In some cases, cancers characterized by the expression or upregulation of EGFRvIII (EGFRvIII-positive cancers) include, but are not limited to, glioblastoma, bladder cancer, breast cancer, colorectal cancer, esophageal cancer, head and neck squamous cell carcinoma (HNSCC), lung cancer, melanoma, ovarian cancer, peripheral nerve sheath tumor (PNST), prostate cancer, sarcoma, and thyroid cancer.

[0222] In some cases, the dimarts described herein bind to the extracellular fraction of EGFRvIII. In some cases, the dimarts bind to the extracellular fraction of human EGFRvIII. In some cases, the dimarts bind to EGFRvIII and immune cell targets, such as cell surface polypeptides expressed on T cells or NK cells. In some cases, the dimarts bind to EGFRvIII and, if necessary, to immune cell targets (such as cell surface polypeptides expressed on T cells or NK cells) for the treatment of EGFRvIII-positive cancers, and glioblastoma, if necessary.

[0223] In some embodiments, cancers are characterized by upregulation of human epidermal growth factor receptor 2 (HER2), also known as HER2 / neu, receptor tyrosine-protein kinase erbB-2, CD340, and ERBB2. In some cases, the amino acid sequence of human HER2 is disclosed in GenPept accession number NP-004439.2 (accessed February 10, 2020). In some cases, HER2-positive cancers include, but are not limited to, breast cancer, ovarian cancer, gastric cancer, colorectal cancer, pancreatic cancer, and endometrial cancer.

[0224] In some cases, the dimarts described herein bind to the extracellular portion of HER2. In some cases, the dimarts bind to the extracellular portion of human HER2 (e.g., including the amino acid sequence shown in GenPept accession number NP-004439.2 or its equivalent). In some cases, the dimarts bind to HER2 and immune cell targets, such as cell surface polypeptides expressed on T cells or NK cells. In some cases, the dimarts bind to HER2 and, if necessary, to immune cell targets (e.g., cell surface polypeptides expressed on T cells or NK cells) for the treatment of HER2-positive cancers, and breast cancer, if necessary.

[0225] In some embodiments, cancers are characterized by upregulation of CD123, also known as the interleukin-3 receptor or IL-3RA. In some cases, the amino acid sequence of human CD123 is disclosed in GenPept accession number NP_002174.1 (accessed February 10, 2020). In some cases, CD123-positive cancers include, but are not limited to, acute myeloid leukemia (AML), acute lymphoblastic leukemia (ALL), blastic plasmacytoid dendritic cell neoplasm, and hairy cell leukemia.

[0226] In some cases, the dimarts described herein bind to the extracellular portion of CD123. In some cases, the dimarts bind to the extracellular portion of human CD123 (e.g., including the amino acid sequence shown in GenPept accession number NP-002174.1 or its equivalent). In some cases, the dimarts bind to CD123 and immune cell targets, such as cell surface polypeptides expressed on T cells or NK cells. In some cases, the dimarts bind to CD123 and, if necessary, to immune cell targets (e.g., cell surface polypeptides expressed on T cells or NK cells) for the treatment of CD123-positive cancers, and optionally AML.

[0227] In some embodiments, cancers are characterized by upregulation of CD38, also known as ADP-ribosylcyclase 1 or ADPRC1. In some cases, the amino acid sequence of human CD38 is disclosed in GenPept accession number BAA18966.1 (accessed February 10, 2020). In some cases, CD38-positive cancers include, but are not limited to, multiple myeloma, acute myeloid leukemia, prostate cancer, and lung cancer.

[0228] In some cases, the dimarts described herein bind to the extracellular portion of CD38. In some cases, the dimarts bind to the extracellular portion of human CD38 (e.g., including the amino acid sequence shown in GenPept accession number BAA18966.1 or its equivalent). In some cases, the dimarts bind to CD38 and immune cell targets, such as cell surface polypeptides expressed on T cells or NK cells. In some cases, the dimarts bind to CD38 and, if necessary, to immune cell targets (e.g., cell surface polypeptides expressed on T cells or NK cells) for the treatment of CD38-positive cancers, and optionally AML.

[0229] In some embodiments, cancers are characterized by upregulation of mesothelin (also known as MSLN). In some cases, the amino acid sequence of human mesothelin is disclosed in GenPept accession number AAV87530.1 (accessed February 10, 2020). In some cases, mesothelin-positive cancers include, but are not limited to, mesothelioma, pancreatic cancer, ovarian cancer, endometrial cancer, cholangiocarcinoma, gastric cancer, lung adenocarcinoma, and pediatric acute myeloid leukemia.

[0230] In some cases, the dimarts described herein bind to the extracellular portion of mesothelin. In some cases, the dimarts bind to the extracellular portion of human mesothelin (e.g., including the amino acid sequence shown in GenPept accession number AAV87530.1 or its equivalent). In some cases, the dimarts bind to mesothelin and immune cell targets, such as cell surface polypeptides expressed on T cells or NK cells. In some cases, the dimarts bind to mesothelin and, if necessary, to immune cell targets (e.g., cell surface polypeptides expressed on T cells or NK cells) for the treatment of mesothelin-positive cancers, and mesothelioma.

[0231] In some embodiments, the cancer is characterized by upregulation of interleukin-13 receptor alpha (IL13R alpha). In some cases, IL13R alpha includes IL13R alpha 1 (IL13Rα1) and IL13R alpha 2 (IL13Rα2). In some cases, the amino acid sequence of human IL13Rα1 is disclosed in GenPept accession number P78552.1 (accessed on February 10, 2020). In some cases, the amino acid sequence of human IL13Rα2 is disclosed in GenPept accession number Q14627.1 (accessed on February 10, 2020). In some cases, IL13R alpha-positive cancers include, but are not limited to, brain cancer (e.g., glioblastoma) and renal cell carcinoma (RCC).

[0232] In some cases, the dimer described herein binds to the extracellular portion of IL13R alpha. In some cases, the dimer binds to the extracellular portion of human IL13R alpha (including, for example, the amino acid sequences shown in GenPept accession numbers P78552.1, Q14627.1 or their equivalents). In some cases, the dimer binds to IL13R alpha and a cell surface polypeptide expressed on an immune cell target, such as a T cell or NK cell. In some cases, the dimer binds to IL13R alpha and, optionally, an immune cell target (e.g., a cell surface polypeptide expressed on a T cell or NK cell) for the treatment of IL13R alpha-positive cancers, optionally brain cancer.

[0233] In some embodiments, the cancer is characterized by upregulation of B7-H3, also known as CD276, an immune checkpoint member. In some cases, the amino acid sequence of human B7-H3 is disclosed in GenPept accession number CAE47548.1 (accessed on February 10, 2020). In some cases, B7-H3-positive cancers include, but are not limited to, lung cancer (e.g., non-small cell lung cancer), breast cancer, prostate cancer, renal cell carcinoma, brain cancer, pancreatic cancer, kidney cancer, stomach cancer, ovarian cancer, melanoma and thyroid cancer.

[0234] In some cases, the dimarts described herein bind to the extracellular portion of B7-H3. In some cases, the dimarts bind to the extracellular portion of human B7-H3 (e.g., including the amino acid sequence shown in GenPept accession number CAE47548.1 or its equivalent). In some cases, the dimarts bind to B7-H3 and T cell or NK cell targets, e.g., cell surface polypeptides expressed on T cells or NK cells. In some cases, the dimarts bind to B7-H3 and, if necessary, to T cell or NK cell targets (e.g., cell surface polypeptides expressed on T cells or NK cells) for the treatment of B7-H3-positive cancers, including lung cancer (e.g., non-small cell lung cancer), breast cancer, prostate cancer, renal cell carcinoma, brain cancer, pancreatic cancer, kidney cancer, gastric cancer, ovarian cancer, melanoma, or thyroid cancer.

[0235] In some embodiments, cancer is characterized by upregulation of neurotrophic tyrosine kinase, receptor tyrosine kinase-like orphan receptor 1 (ROR1), also known as receptor-associated 1 or NTRKR1. In some cases, the amino acid sequence of human ROR1 is disclosed in GenPept accession number NP_005003 (accessed February 10, 2020). In some cases, ROR1-positive cancers include, but are not limited to, breast cancer, lung cancer, gastric cancer, ovarian cancer, chronic lymphocytic leukemia (CLL), and acute lymphoblastic leukemia (ALL).

[0236] In some cases, the dimarts described herein bind to the extracellular portion of ROR1. In some cases, the dimarts bind to the extracellular portion of human ROR1 (e.g., including the amino acid sequence shown in GenPept accession number NP_005003 or its equivalent). In some cases, the dimarts bind to ROR1 and immune cell targets, such as cell surface polypeptides expressed on T cells or NK cells. In some cases, the dimarts bind to ROR1 and, if necessary, to immune cell targets (e.g., cell surface polypeptides expressed on T cells or NK cells) for the treatment of ROR1-positive cancers, including breast cancer, lung cancer, gastric cancer, ovarian cancer, CLL, or ALL.

[0237] In some embodiments, cancers are characterized by upregulation of ephrin receptor 2 (EphA2), also known as EPH receptor A2, tyrosine protein kinase receptor ECK, or epithelial cell receptor protein tyrosine kinase. In some cases, the amino acid sequence of human EphA2 is disclosed in GenPept accession number NP_004422.2 (accessed February 10, 2020). In some cases, EphA2-positive cancers include, but are not limited to, breast cancer, bladder cancer, prostate cancer, skin cancer, lung cancer, ovarian cancer, brain cancer, mesothelioma, thyroid cancer, colorectal cancer, gastric cancer, esophageal cancer, endometrial cancer, cervical cancer, pancreatic cancer, melanoma, renal cell carcinoma, and liver cancer.

[0238] In some cases, the dimarts described herein bind to the extracellular portion of EphA2. In some cases, the dimarts bind to the extracellular portion of human EphA2 (e.g., including the amino acid sequence shown in GenPept accession number NP_004422.2 or its equivalent). In some cases, the dimarts bind to EphA2 and immune cell targets, such as cell surface polypeptides expressed on T cells or NK cells. In some cases, the dimarts bind to EphA2 and, if necessary, to immune cell targets (e.g., cell surface polypeptides expressed on T cells or NK cells) for the treatment of EphA2-positive cancers, including breast cancer, bladder cancer, prostate cancer, skin cancer, lung cancer, ovarian cancer, brain cancer, mesothelioma, thyroid cancer, colorectal cancer, gastric cancer, esophageal cancer, endometrial cancer, cervical cancer, pancreatic cancer, melanoma, renal cell carcinoma, or liver cancer.

[0239] In some embodiments, cancer is B-cell leukemia or B-cell lymphoma. Exemplary B-cell leukemias include B-cell chronic lymphocytic leukemia (or B-cell small lymphocytic lymphoma); acute lymphoblastic leukemia, mature B-cell type; B-cell pre-lymphoblastic leukemia; progenitor B-lymphoblastic leukemia; and hairy cell leukemia. In some cases, B-cell leukemia, B-cell lymphoma, or a combination thereof is characterized by elevated expression of CD20 and / or CD22 on B cells. In some cases, the dimarts described herein bind to CD20 or CD22. In some cases, the dimarts bind to CD20 expressed on B cells. In some cases, the dimarts bind to CD22 expressed on B cells. In some cases, the dimarts further bind to another cellular target, such as a cell surface polypeptide expressed on cancer cells or a cell surface polypeptide expressed on T cells or NK cells. In some cases, the dimart binds to CD20 or CD22 for the treatment of B-cell leukemia or B-cell lymphoma, and, if necessary, to another cellular target (e.g., cell surface polypeptide expressed on cancer cells or cell surface polypeptide expressed on T cells or NK cells).

[0240] As used herein, “first-line treatment” includes primary treatment for subjects, and, if applicable, subjects with cancer. In some cases, under cancerous circumstances, cancer is primary cancer. In other cases, cancer is metastatic or recurrent cancer. In some cases, first-line treatment includes chemotherapy. In other cases, first-line treatment includes radiotherapy. Those skilled in the art will readily understand that different first-line treatments may be applicable to different types of cancer.

[0241] As used herein, second-line treatment encompasses treatments used after discontinuation of primary or first-line treatment. Third-line, fourth-line, or fifth-line treatments encompass subsequent treatments. As indicated by naming convention, third-line treatment encompasses the treatment sequence when primary and second-line treatments are discontinued.

[0242] The “subject” of a diagnosis or treatment is a cell, an animal such as a mammal, or a human. The subject is not limited to a specific species and includes non-human animals that are the subject of diagnosis or treatment, such as those that are the target of infection or animal models, e.g., rodents such as monkeys, rats, mice, and chinchillas; canids such as dogs; rabbits and other rabbit-like animals; livestock; sport animals; and pets. Human patients are also included in this term.

[0243] The term “tissue” is used herein to mean the tissue of a living or dead organism, or any tissue derived from or designed to mimic a living or dead organism. Tissues can be healthy, diseased, and / or have genetic variations. Biological tissue can include any single tissue (e.g., a collection of cells that can be interconnected) or a group of tissues that make up an organ, part, or region of the body of an organism. Tissues can consist of homogeneous cellular material, or they can be complex structures, such as those found in a region of the body including the chest, which may include, for example, lung tissue, skeletal tissue, and / or muscular tissue. Exemplary tissues include, but are not limited to, tissues derived from the liver, lungs, thyroid gland, skin, pancreas, blood vessels, bladder, kidneys, brain, bile ducts, duodenum, abdominal aorta, iliac veins, heart, and intestines (including any combination thereof).

[0244] As used herein, the terms “specifically bind to,” “specifically bind to,” or “specifically target” mean a polypeptide or fragment thereof that recognizes and binds to a biological molecule of interest (e.g., a polypeptide), but substantially does not recognize or bind to other molecules in a sample containing or expressing a tumor antigen, such as a biological sample.

[0245] As used herein, “treatment” of a disease in a subject means (1) preventing the onset of symptoms or disease in a subject that is predisposed to or has not yet shown symptoms of the disease; (2) inhibiting or halting the development of the disease; or (3) reducing or causing a regression of the disease or its symptoms. As understood in the art, “treatment” is an approach to obtain a beneficial or desired outcome, including clinical outcomes. In this art, beneficial or desired outcomes may include, but are not limited to, one or more of the following, whether detectable or undetectable: relief or reduction of one or more symptoms; reduction of the degree of a condition (including disease); a stabilized (i.e., non-worsening) state of a condition (including disease); delay or slowing of a condition (including disease); progression, reduction or remission of a condition (including disease); and a state and remission (whether partial or complete). In one embodiment, the term “treatment” excludes prevention.

[0246] As used herein, the term “effective dose” is intended to mean an amount sufficient to achieve the desired effect. In the context of therapeutic or prophylactic application, the effective dose depends on the type and severity of the condition in question, as well as the characteristics of the individual subject, such as general health, age, sex, weight, and tolerance to the pharmaceutical composition. In the context of gene therapy, in some embodiments, the effective dose is sufficient to bring about partial or complete restoration of the function of a deficient gene in the subject. In other embodiments, the effective dose of recombinant polynucleotides, vectors, or AAV virus particles is sufficient to bring about gene expression in the subject. In some embodiments, the effective dose is the amount required to increase galactose metabolism in a subject that requires increased galactose metabolism. Those skilled in the art can determine an appropriate dose depending on these and other factors.

[0247] In some embodiments, the effective dose depends on the magnitude and nature of the application of the problem. The effective dose also depends on the nature and sensitivity of the object of interest and the method used. Those skilled in the art can determine the effective dose based on these and other considerations. Depending on the embodiment, the effective dose may consist of one or more doses of the composition.

[0248] As used herein, the terms “administer” or “dosage” are intended to mean the delivery of a substance to an object such as an animal or a human. Administration can be carried out in a single dose, continuously or intermittently throughout the course of treatment. The most effective means of administration and methods for determining the dosage are known to those skilled in the art and vary depending on the composition used for treatment, the purpose of treatment, and the age, health, or sex of the object being treated. Single or multiple doses may be administered, and the dose levels and patterns are selected by the physician performing the treatment or, in the case of pets and animals, by the veterinarian performing the treatment. Appropriate drug formulations and methods for administering drugs are known in the art. The route of administration can also be determined, and methods for determining the most effective route of administration are known to those skilled in the art and vary depending on the composition used for treatment, the purpose of treatment, the health status or disease stage of the object being treated, and the target cells or tissues. Non-restrictive routes of administration include intravenous, intra-arterial, intramuscular, intracardiac, intrathecal, subventricular, epidural, intracerebral, intraventricular, subretinal, intravitreous, intra-articular, intraocular, intraperitoneal, intrauterine, intradermal, subcutaneous, transdermal, transmucosal, and inhalation.

[0249] Form for implementing this disclosure Cancer is the second leading cause of death globally, with an estimated 9.6 million deaths in 2018. Many different types of cancer treatments exist that are in clinical development and commercially available, such as immunotherapy, hormone therapy, targeted drug therapy, adoptive cell therapy, and chemotherapy. While progress has been made in many therapeutic areas, challenges remain regarding factors such as half-life and toxicity that affect treatment efficacy. For example, oncolytic virus-based therapies offer targeted delivery of payloads to the target tumor microenvironment. However, these tumors... Cerebral lytic viruses express their packing material within tumor cells, inducing a cytotoxic effect, thereby limiting packing material expression to at most a few days, often only a few hours. Therefore, multiple doses are required to achieve sustained and long-lasting therapeutic effects, but this increases toxicity and leads to adverse immune responses. Adoptive cell therapies, such as chimeric antigen receptor (CAR)-T cell therapy, offer personalized treatment options for those suffering from cancer. However, some of the most common side effects of CAR-T cell therapy include cytokine release syndrome; neurological events such as encephalopathy, aphasia, seizures, and balance disorders; neutropenia; and anemia. Furthermore, the preparation of CAR-T cells involves several weeks of culture and proliferation before administration, a time that can be critical, especially for patients with advanced cancer.

[0250] In certain embodiments, a method for delivering a therapeutic transgene (e.g., a dimart disclosed herein) using a gene therapy vector is disclosed herein. In some embodiments, the gene therapy vector provides stable and sustained expression of the therapeutic transgene (e.g., a dimart). In further embodiments, the gene therapy vector provides constitutive expression. In further embodiments, the gene therapy vector provides regulated expression. In some cases, the gene therapy vector is transduced into normal cells (e.g., into organ cells such as hepatocytes or into muscle cells). In some cases, a single dose of the gene therapy vector is sufficient to induce stable and sustained expression of the therapeutic transgene (e.g., a dimart). In further cases, the gene therapy vector provides continuous and long-term expression of a therapeutic transgene (e.g., a dimart) that exerts long-term pressure on cancer cells.

[0251] In certain embodiments, a method for delivering a therapeutic transgene (e.g., a dimart) using TransJoin is disclosed herein. In some cases, TransJoin provides constitutive expression of the therapeutic transgene (e.g., a dimart). In some cases, TransJoin provides sustained, stable, and long-term expression of the therapeutic transgene (e.g., a dimart). In some cases, long-term expression includes periods of about one week, two weeks, three weeks, four weeks, one month, two months, three months, four months, five months, six months, eight months, ten months, one year, or longer. In some cases, TransJoin is transduced into normal cells (e.g., into organ cells such as hepatocytes or into muscle cells). In some cases, a single dose of TransJoin is sufficient to induce stable and sustained expression of the therapeutic transgene (e.g., a dimart). In further cases, TransJoin provides continuous and long-term expression of the therapeutic transgene (e.g., a dimart) that exerts long-term pressure on cancer cells.

[0252] In certain embodiments, novel methods for activating transgene expression (e.g., dimarts disclosed herein) that can be used as a gene therapy platform for regulated expression, such as short-term gene expression (e.g., several weeks to several months, and further, as needed, one week, two weeks, three weeks, four weeks, one month, two months, three months, four months, five months, six months, eight months, or longer) are disclosed herein. In some cases, this method utilizes TransSkip. In one embodiment, transgene expression is placed under the control of a drug or external agent (e.g., OncoSkip) such that the administration of the drug or agent modulates (activates or inactivates) the gene expression. On the other hand, the absence or discontinuation of the administration of the drug or agent reverts the gene expression to its original state before administration. For example, if a drug or agent can activate gene expression, and side effects are present, or if transgene expression is no longer needed, discontinuation of administration can inactivate the gene expression, thereby minimizing any side effects that may exist. In some cases, TransSkip is transduced into normal cells (e.g., organ cells such as hepatocytes or muscle cells). In some cases, a single dose of TransSkip is sufficient to induce stable and sustained expression of a therapeutic transgene (e.g., dimart). In further cases, TransSkip provides regulated but continuous expression of a therapeutic transgene (e.g., dimart) that exerts long-term pressure on cancer cells.

[0253] Exon skipping is a technique used to treat certain genetic disorders that involve defects in short regions of a gene. DNA mutations result in damaged proteins, either because the wrong amino acids appear in the protein, or because the DNA mutation produces a stop mutation resulting in a cleaved protein, or because the DNA mutation alters the reading frame and produces both. Mammalian genes are typically encoded in exons, i.e., they are divided into multiple gene segments (exons) that are spliced ​​together during mRNA processing. Therefore, the DNA mutations (base pair changes or deletions) underlying many diseases are contained within a single exon. If that exon is skipped and not included in the final spliced ​​mRNA, the mutated region is not included in the final protein. The protein may be shorter and missing some parts, but the protein may still be "in frame" and retain some of its function.

[0254] For example, Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are the most common childhood forms of muscular dystrophy and are caused by genetic defects in the DMD gene, which encodes dystrophin, a muscle protein required for the interaction between the cytoskeleton and the extracellular matrix to maintain the stability of muscle fibers during contraction. DMD mutations in the dystrophin gene are characterized by frameshift insertions or deletions or nonsense point mutations, resulting in a lack of functional dystrophin. BMD mutations generally preserve the reading frame and allow for the synthesis of partially functional dystrophin. Exon skipping-based therapies have converted out-of-frame mutations present in DMD patients into in-frame mutations that partially encode functional dystrophin. In 2016, the FDA approved eteplirsen® (Sarepta Therapeutics), the first exon-skipping drug for Duchenne muscular dystrophy with mutations in exon 51 of the dystrophin gene. When this drug (a modified, short sequence of DNA, also called an oligo) is administered, exon 51 is "skipped," restoring a nearly full-length, more functional protein. Similar techniques are being developed to skip exons in other dystrophin exons, as well as exons in other disease-causing genes.

[0255] In contrast to exon skipping, this disclosure utilizes transgene activation in gene therapy applications. Most, if not all, gene therapy approaches currently use the complementary (cDNA) sequence of a gene. That is, the gene sequence of the transgene consists only of the coding sequence (exons only) and contains no intervening (intron) sequences. Therefore, the gene does not undergo RNA splicing.

[0256] This disclosure and technology utilize intervening sequences containing splice donor and acceptor sites as well as RNA spliceosome binding sites to enable a transgene to undergo normal exon splicing. Thus, a “reverse-engineered” (artificial) exon-intron-exon gene structure is provided within the transgene, which undergoes splicing when expressed in target cells. However, splicing is regulated based on the principle of exon skipping. In one embodiment, a deliberately inserted exon containing a stop codon in the middle of the gene regulates gene expression; i.e., the artificial structure allows for normal functional transgene expression only when that exon is skipped. In one embodiment, the functional transgene encodes an antibody. In another embodiment, the antibody is a bispecific or trispecific antibody (e.g., a dimart). In yet another embodiment, the antibody (e.g., a dimart) is a bispecific T cell engager (BiTE), a bispecific NK cell engager (BiKE), a trispecific T cell engager (TriTE), or a trispecific NK cell engager (TriKE).

[0257] In a further embodiment, the degree and type of splicing are modified by cell type, as many genes typically undergo alternative splicing, which is sometimes altered depending on the cell type. Furthermore, splicing is sometimes altered in certain cancer cells (some exons of certain genes may be included in or excluded in normal cells compared to cancer cells). This technique can leverage these features to achieve different transgene control in normal cells compared to cancer cells. Also, antibodies encoded by functional transgenes, such as bispecific or triplicate antibodies, can be used to treat cancer. Thus, in one embodiment, the modulation of transgene splicing in this disclosure provides a method for treating cancer.

[0258] Embodiment of a structure In certain embodiments, polynucleotides or vectors are provided herein that comprise, or essentially consist of, (a) a first polynucleotide sequence comprising a first portion of an open reading frame encoding a first polypeptide; (b) a second polynucleotide sequence comprising a second portion of the open reading frame encoding the first polypeptide; (c) a third polynucleotide sequence encoding the second polypeptide; and (d) a gene regulatory polynucleotide sequence located between the first and second polynucleotides. In some cases, the first polypeptide binds to a surface polypeptide (e.g., a surface receptor) of a first target cell, and the second polypeptide binds to a surface polypeptide (e.g., a surface receptor) of a second target cell. In some cases, the first and second target cells are different. For example, the first target cell may be a tumor cell and the second target cell may be an immune cell. In a second example, the first target cell may be an immune cell and the second target cell may be a tumor cell. In the third example, the first target cell may be a first immune cell, the second target cell may be a second immune cell, and the first immune cell may be of a different cell type than the second immune cell. In the fourth example, the first target cell may be a first cancer cell, the second target cell may be a second cancer cell, and the first and second cancer cells may originate from the same type of cancer, for example, associated with the same genetic defect or of the same histological type.

[0259] In some embodiments, the first polypeptide is a first antibody or its conjugated fragment, and the second polypeptide is a second antibody or its conjugated fragment. In some cases, polynucleotides or vectors are provided herein that include, or are essentially, from (a) to (d), a first polynucleotide sequence comprising (a) a first portion of an open reading frame encoding the first antibody or its antigen-binding fragment; (b) a second polynucleotide sequence comprising a second portion of an open reading frame encoding the first antibody or its antigen-binding fragment; (c) a third polynucleotide sequence encoding the second antibody or its antigen-binding fragment; and (d) a gene-regulating polynucleotide sequence located between the first and second polynucleotides. Complements to polynucleotides are also provided. In one embodiment, the polynucleotides, their complements, and / or vectors are detectably labeled. In some cases, the first antibody binds to a first target, and the second antibody binds to a second target. In some cases, the first target is a surface polypeptide (e.g., a surface receptor) on a first cell, and the second target is a surface polypeptide (e.g., a surface receptor) on a second cell. In some cases, the first and second target cells are different. For example, the first target cell may be a tumor cell, and the second target cell may be an immune cell. In the second example, the first target cell may be an immune cell, and the second target cell may be a tumor cell. In the third example, the first target cell may be a first immune cell, and the second target cell may be a second immune cell, and the first immune cell is a different cell type from the second immune cell. In the fourth example, the first target cell is a first cancer cell, and the second target cell is a second cancer cell, and the first and second cancer cells originate from the same type of cancer, e.g., associated with the same genetic defect or of the same histological type. In some cases, the first target is the first epitope, and the second target is the second epitope, with both epitopes located on the same antigen. In some cases, the first and second antibodies have different amino acid sequences.In one embodiment, polynucleotides are contained within a gene expression vector, non-limiting examples of such vectors include plasmids, DNA viral vectors, or gene delivery vehicles.

[0260] In some embodiments, vectors for use in gene therapy are also disclosed herein, comprising a first polynucleotide sequence encoding a first antibody or its antigen-binding fragment, and a second polynucleotide sequence encoding a second antibody or its antigen-binding fragment. Complements of polynucleotides are also provided. In one embodiment, the polynucleotides, their complements, and / or vectors are detectably labeled. In some cases, the first antibody binds to a first target, and the second antibody binds to a second target. In some cases, the first target is a surface polypeptide (e.g., a surface receptor) on a first cell, and the second target is a surface polypeptide (e.g., a surface receptor) on a second cell. In some cases, the first target cell and the second target cell are different. For example, the first target cell may be a tumor cell, and the second target cell may be an immune cell. In a second example, the first target cell may be an immune cell, and the second target cell may be a tumor cell. In the third example, the first target cell may be a first immune cell, the second target cell may be a second immune cell, and the first immune cell is a different cell type from the second immune cell. In the fourth example, the first target cell is a first cancer cell, the second target cell is a second cancer cell, and the first and second cancer cells originate from the same type of cancer, for example, associated with the same genetic defect or of the same histological type. In some cases, the first target is a first epitope, the second target is a second epitope, and both epitopes reside on the same antigen. In some cases, the first and second antibodies have different amino acid sequences.

[0261] In a further embodiment, the gene-regulating polynucleotide sequence comprises a splice donor site, an upstream intron, an exon containing a stop codon sequence in all three reading frames, a downstream intron, and a splice acceptor site. In a further embodiment, the gene-regulating polynucleotide sequence comprises one or more binding sequences for antisense oligonucleotides. In a further embodiment, the antisense oligonucleotide is morpholino. In a further embodiment, the binding sequence for morpholino oligonucleotides comprises a polynucleotide sequence that is at least 95% identical to SEQ ID NO: 24 (AATATGATCCAACAATAGAGGTAAATCTTG) or SEQ ID NO: 25 (GATCCAACAATAGAGGTAAATCTTGTTTTA), or at least 96%, or at least 97%, or at least 98%, or at least 99% identical to them. In one embodiment, the morpholino oligonucleotide comprises a polynucleotide sequence that is at least 95% identical to SEQ ID NO: 27 (CAAGATTTACCTCTATTGTTGGATCATATT) or SEQ ID NO: 28 (TAAAACAAGATTTACCTCTATTGTTGGATC), or at least 96%, or at least 97%, or at least 98%, or at least 99% identical to each of these. Splice donor sites and splice acceptor sites are well known in the art. Those skilled in the art know the sequences of splice donor sites and splice acceptor sites, for example, consensus sequences. An exemplary splice site consensus sequence for the U2 intron is the 5' splice site MAG- GT It can contain RAGT, where M is A or C, R is A or G, the underlined nucleotide indicates that "GT" is invariant, and the dash "-" indicates a splice site. The 3' splice site for the U2 intron is C AG -G is possible, underlined nucleotides indicate that "AG" is invariant, and a dash "-" indicates a splice site. Further examples of consensus splice site sequences include, but are not limited to, the following:

[0262] p53 Exon 10 5' splice site (donor): CAG-gtgagt, where the dash "-" indicates the splice site;

[0263] Brd2 exon 3 5'ss:AAG-gtgagt, where the dash "-" indicates the splice location;

[0264] BRCA1 exon 22 5' splice site: CAG-gtaagt, where the dash "-" indicates the splice site;

[0265] SMN1 exon-1 5'ss:CAG-gtgagg, where the dash "-" indicates the splice location;

[0266] BRD2 3' splice site acceptor intron 1 (lowercase) / exon 2 (uppercase): cccatctttacag-GCTCCC, where the dash "-" indicates the splice site;

[0267] BCL-X 3' Splice acceptor intron 2 (lowercase) / exon 3 (uppercase): tctctccctgcag-GATACT, where the dash "-" indicates the splice site;

[0268] Fibronectin 3' splice acceptor intron 28 (lowercase) / exon 29 (uppercase): ctttttcatacag-GAGGAA, where a dash "-" indicates the splice site;

[0269] Survival 3' Splice acceptor intron 2 (lowercase) / exon 3 (uppercase): tctttatttccagGCAAAG, where dash "-" indicates the splice site.

[0270] In some embodiments, the splice site consensus sequence is obtained from / / science.umd.edu / labs / mount / RNAinfo / matrices.html.

[0271] In some embodiments, the stop codon comprises an oligonucleotide from the group TAA, TAG, or TGA. In further embodiments, the stop codon sequence comprises the polynucleotide sequence TAAxTAGxTGAxTAGxTAAxTGAx (SEQ ID NO: 1) (where x is any nucleotide), or the stop codon sequence comprises the polynucleotide sequence TAATTAGTTGATTAGTTAATTGAT (SEQ ID NO: 2). In further embodiments, the gene regulatory polynucleotide comprises a polynucleotide sequence that is at least 95% identical to SEQ ID NO: 2, or at least 96%, or at least 97%, or at least 98%, or at least 99% identical to SEQ ID NO: 2.

[0272] In a further embodiment, the first antibody or its antigen-binding fragment specifically binds to an activating antigen on an immune effector cell, and the second antibody or its antigen-binding fragment binds to a tumor antigen. In another embodiment, the first antibody or its antigen-binding fragment specifically binds to a tumor antigen, and the second antibody or its antigen-binding fragment binds to an activating antigen on an immune effector cell. In a further embodiment, the vector also includes a fourth polynucleotide sequence encoding a third antibody or its antigen-binding fragment, the third antibody or its antigen-binding fragment binding to an activating antigen or tumor antigen on an immune effector cell. In one embodiment, the immune effector cell includes dendritic cells, natural killer ("NK") cells, macrophages, T cells, B cells, or a combination thereof. Non-limiting examples of immune effector cells include T cells or NK cells.

[0273] Non-limiting examples of activating antigens on immune effector cells include CD3, CD2, CD4, CD8, CD19, LFA1, CD45, NKG2D, NKp44, NKp46, NKp30, DNAM, or combinations thereof.

[0274] Non-exclusive examples of target antigens on antigen-presenting cells include, but are not limited to, B7-H3 (CD276).

[0275] Non-exclusive examples of target antigens on B cells include, but are not limited to, CD20 and CD22.

[0276] Non-limiting examples of tumor antigens include ephrin type A receptor 2 (EphA2), interleukin (IL)-13r alpha 2, EGFR VIII, PSMA, EpCAM, GD3, fucosyl GM1, PSCA, PLAC1, sarcoma breakpoint, Wilms tumor 1, alpha-fetoprotein (AFP), carcinoembryonic antigen (CEA), CA-125, MUC-1, epithelial tumor antigen (ETA), tyrosinase, melanoma-associated antigen (MAGE), hematopoietic differentiation antigen, surface glycoprotein, ganglioside (GM2), growth factor receptor, stromal antigen, vascular antigen, receptor tyrosine kinase-like orphan receptor 1 (ROR1), mesothelin, CD38, CD123, human epidermal growth factor receptor 2 (HER2), B cell maturation antigen (BCMA), fibroblast-activating protein (FAP) alpha, or one or more combinations thereof. Further examples are found in the Art and are incorporated herein by reference, for example. In another embodiment, the recombinant vector expresses a premRNA encoding a dimart described herein. In some cases, when the premRNA is in contact with a morpholino oligonucleotide, the dimart is a bispecific or trispecific antibody. Non-limiting examples of dimarts are those of the following group: bispecific T cell engagers (BiTEs) or bispecific NK cell engagers (BiKEs); and trispecific antibodies include trispecific T cell engagers (TriTEs) or trispecific NK cell engagers (TriKEs). In one embodiment, the trispecific antibody comprises a first antibody or its antigen-binding fragment and a second antibody or its antigen-binding fragment.

[0277] In one embodiment, the dimart (e.g., a bispecific or trispecific cell engager) comprises a polypeptide sequence having at least 95% sequence identity with SEQ ID NO: 11, and optionally at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with SEQ ID NO: 11. In another embodiment, the polypeptide sequence encodes an antigen-binding fragment for CD3; CD2; CD4; CD8; CD19; lymphocyte function-associated antigen 1 (LFA1); CD45; interleukin 21 receptor (IL21R); natural killer group 2 member D (NKG2D); innate cytotoxicity receptors (NCRs) such as NKp44, NKp46, or NKp30; or DNAX accessory molecule-1 (DNAM or DNAM-1; also known as CD226 or platelet and T cell activating antigen 1 (PTA1)). In another embodiment, the polypeptide sequence encodes an antigen-binding fragment for CD3, CD19, GD2, or NKG2D. In yet another embodiment, the polypeptide encodes a first antigen-binding fragment and a second antigen-binding fragment. In another embodiment, the first antigen-binding fragment binds to CD3 and the second antigen-binding fragment binds to CD19. In yet another embodiment, the first antigen-binding fragment binds to CD3 and the second antigen-binding fragment binds to GD2. In yet another embodiment, the first antigen-binding fragment binds to NKG2D and the second antigen-binding fragment binds to GD2.

[0278] In one embodiment, the triplicate engager or antibody comprises a first antigen-binding fragment, a second antigen-binding fragment, and a third antigen-binding fragment. In another embodiment, the triplicate engager or antibody comprises three antigen-binding fragments that bind to NKG2D, IL21R, and GD2, respectively. In a further embodiment, the triplicate engager or antibody comprises a polypeptide sequence having at least 95% sequence identity with SEQ ID NO: 11, or at least 96%, or at least 97%, or at least 98%, or at least 99% sequence identity with SEQ ID NO: 11.

[0279] In one embodiment, the antigen-binding fragment that binds to IL-21R is IL-21. The amino acid sequence and cDNA sequence of IL-12 are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively. In one embodiment, the antigen-binding fragment that binds to NKG2D includes MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, ULBP6, Rae-1α, Rae-1β, Rae-1γ, Rae-1δ, Rae-1ε, H60a, H60b, H60c, MULT1, or fragments thereof. In one embodiment, the antigen-binding fragment that binds to NKG2D is MICA (SEQ ID NO: 5) or a fragment thereof or an equivalent thereof.

[0280] In one embodiment, the MICA sequence includes a wide-type variant. In one embodiment, the MICA variant is a sequence variant of wild-type MICA (e.g., the wild-type MICA sequence shown in SEQ ID NO: 5). In another embodiment, the MICA variant is a sequence variant of MUC-30 (SEQ ID NO: 7), which contains a methionine mutation instead of alanine at position 129 of the wide-type MICA sequence (MICA-129Met). The MICA variant equivalent (MICA-129Met) retains the methionine mutation at position 129 of wild-type MICA. In another embodiment, a bispecific or triplicate specificity engager or antigen-binding fragment of an antibody is separated by a linker sequence. One embodiment of the linker sequence includes GGGGSGGGGSGGGGS (SEQ ID NO: 9) or its equivalent, or consists essentially of SEQ ID NO: 9 or its equivalent, or consists of SEQ ID NO: 9 or its equivalent. The linker sequence is encoded by the polynucleotide sequence GGCGGCGGCGGCAGCGGCGGCGGCAGCGGCGGCGGCGGCAGC (SEQ ID NO: 10) or an equivalent thereof. In one embodiment, the two antigen-binding fragments separated by the linker sequence are IL21 and MICA (e.g., wild-type MICA or MICA variants such as MUC-30 or MICA-129Met), or fragments thereof, or equivalents thereof. In another embodiment, the two antigen-binding fragments separated by the linker sequence are GD2 and MICA (e.g., wild-type MICA or MICA variants such as MUC-30 or MICA-129Met), or fragments thereof, or equivalents thereof. In yet another embodiment, the linker is inserted between the antigen-binding fragments of any of the following triple-specific engagementrs. IL21-MICA129-GD2 MICA129-IL21-GD2 GD2-IL21-MICA129 GD2-MICA129-IL21 IL21-MICA / V129M-GD2-HDD MICA / V12M-IL21-GD2-HDD GD2-IL21-MICA129-HDD GD2-MICA129-IL21-HDD

[0281] In another embodiment, the dimart (e.g., a bispecific or tripspecific engager) includes a secretion consensus sequence (also referred to herein as sec0A). In some cases, the secretion consensus sequence (sec0A) includes at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with respect to MWWRLWWLLLLLLLLWPMVWA (SEQ ID NO: 51), or consists of SEQ ID NO: 51. In some cases, sec0A is encoded by a polynucleotide or its equivalent containing ATGTGGTGGAGACTGTGGTGGCTGCTGCTGCTGCTGCTGCTGCTGTGGCCCATGGTGTGGGCC (SEQ ID NO: 52).

[0282] In some cases, the secretory consensus sequence further includes 1, 2, 3, 4 or more residues at the C-terminus of the sequence. In some cases, 1, 2, 3, 4 or more residues are residues with aliphatic side chains (e.g., Ala, Met, Ile, Val, or Leu). In some cases, 1, 2, 3, 4 or more residues are Ala residues, Gly residues, Val residues, Ile residues, or combinations thereof. In some cases, 1, 2, 3, 4 or more residues are Ala residues, Gly residues, Val residues, or combinations thereof. In some cases, 1, 2, 3, 4 or more residues are Ala residues, Gly residues, or combinations thereof. In some cases, the secretory consensus sequence further includes 1, 2, 3, 4 or more Ala residues at the C-terminus of the sequence. In some cases, the secretory consensus sequence further includes 1, 2, 3, 4 or more Gly residues at the C-terminus of the sequence. In some cases, the secretory consensus sequence further includes 1, 2, 3, 4 or more Val residues at the C-terminus of the sequence. In some cases, the secretory consensus sequence further includes 1, 2, 3, 4 or more Ile residues at the C-terminus of the sequence.

[0283] In some cases, the secretory consensus sequence further includes one, two, or three residues with aliphatic side chains (e.g., Ala, Met, Ile, Val, or Leu). In some cases, the one, two, or three residues are Ala residues, Gly residues, Val residues, Ile residues, or a combination thereof. In some cases, the one, two, or three residues are Ala residues, Gly residues, Val residues, or a combination thereof. In some cases, the one, two, or three residues are Ala residues, Gly residues, or a combination thereof. In some cases, the secretory consensus sequence further includes one, two, or three Ala residues at the C-terminus of the sequence. In some cases, the secretory consensus sequence further includes one, two, or three Gly residues at the C-terminus of the sequence. In some cases, the secretory consensus sequence further includes one, two, or three Val residues at the C-terminus of the sequence. In some cases, the secretory consensus sequence further includes one, two, or three Ile residues at the C-terminus of the sequence.

[0284] In some cases, the secretory consensus sequence further includes one or two residues with aliphatic side chains (e.g., Ala, Met, Ile, Val, or Leu). In some cases, the one or two residues are Ala residues, Gly residues, Val residues, Ile residues, or a combination thereof. In some cases, the one or two residues are Ala residues, Gly residues, Val residues, or a combination thereof. In some cases, the one or two residues are Ala residues, Gly residues, or a combination thereof. In some cases, the secretory consensus sequence further includes one or two Ala residues at the C-terminus of the sequence. In some cases, the secretory consensus sequence further includes one or two Gly residues at the C-terminus of the sequence. In some cases, the secretory consensus sequence further includes one or two Val residues at the C-terminus of the sequence. In some cases, the secretory consensus sequence further includes one or two Ile residues at the C-terminus of the sequence.

[0285] In some cases, the secretory consensus sequence further includes one residue with an aliphatic side chain (e.g., Ala, Met, Ile, Val, or Leu). In some cases, the one residue is Ala, Gly, Val, or Ile. In some cases, the secretory consensus sequence further includes one Ala at the C-terminus of the sequence. In some cases, the secretory consensus sequence further includes one Gly at the C-terminus of the sequence. In some cases, the secretory consensus sequence further includes one Val at the C-terminus of the sequence. In some cases, the secretory consensus sequence further includes one Ile at the C-terminus of the sequence.

[0286] In some cases, the secretory consensus sequence further includes one or two Ala residues at the C-terminus of the consensus sequence, and such sequences are called secreton 1A (or sec1A) with one Ala at the C-terminus and secreton 2A (or sec2A) with two Ala residues at the C-terminus. In some cases, sec1A contains at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with MWWRLWWLLLLLLLLWPMVWAA (SEQ ID NO: 53). In some cases, sec1A is encoded by a polynucleotide containing ATGTGGTGGAGACTGTGGTGGCTGCTGCTGCTGCTGCTGCTGCTGTGGCCCATGGTGTGGGCCGCC (SEQ ID NO: 54) or its equivalent. In some cases, sec2A contains at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with MWWRLWWLLLLLLLLWPMVWAAA (SEQ ID NO: 55). In some cases, sec2A is encoded by a polynucleotide containing ATGTGGTGGAGACTGTGGTGGCTGCTGCTGCTGCTGCTGCTGCTGTGGCCCATGGTGTGGGCCGCCGCC (SEQ ID NO: 56) or its equivalent.

[0287] In some embodiments, secretory consensus sequences modulate the expression and / or secretion of dimarts. In some cases, secretory consensus sequences (e.g., sec1A or sec2A) enhance the expression and / or secretion of dimarts. In some cases, secretory consensus sequences (e.g., sec1A or sec2A) modulate (e.g., enhance) dimart expression by about 1x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x, 20x, 50x or more. In some cases, secretory consensus sequences (e.g., sec1A or sec2A) modulate (e.g., enhance) dimart secretion by about 1x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x, 20x, 50x or more.

[0288] In some embodiments, the dimarts described herein (e.g., triple-specific engagementrs) include secretory consensus sequences (e.g., sec0A, sec1A, or sec2A), IL21 sequences (e.g., SEQ ID NO: 3), MICA sequences (e.g., wild-type sequences, MUC-30, or MICA-129Met), anti-GD2 peptide sequences, or one or more equivalents thereof. In some cases, the dimarts (e.g., triple-specific engagementrs) include secreton 1A sequences, IL21 sequences, MICA129 sequences, anti-GD2 peptide sequences, or one or more equivalents thereof. In one embodiment, the dimarts (e.g., triple-specific engagementrs) include secreton 1A-linker-IL21-linker-MICA129-linker-anti-GD2 peptides, or one or more equivalents thereof. In one embodiment, the dimarts (e.g., triple-specific engagementrs) include the polypeptide sequence of SEQ ID NO: 11.

[0289] Sequence ID 11 [ka] or equivalent.

[0290] In one embodiment, a dimart (e.g., a triple-specific engagementr) is encoded by the sequence of sequence number 12. Sequence ID 12 [ka] [ka] or equivalent.

[0291] In one embodiment, the dimart (e.g., a bispecific engagementr) comprises a secreton 1A sequence (sec1A), a CD3 sequence, and an anti-GD2 peptide sequence, or one or more equivalents thereof. In one embodiment, the bispecific engagementr comprises the polypeptide sequence of Sequence ID No. 13 arranged as sec1A-anti-CD3-linker-anti-GD2-HDD. The sec1A portion is underlined. The anti-CD3 portion is bold. The anti-GD2 portion is underlined and italicized. The gray shaded area represents the HDD portion, which comprises the bold HDD peptide, a lowercase hinge region upstream of the HDD peptide, and a lowercase spacer region downstream of the HDD peptide. Sequence ID 13 [ka] or equivalent.

[0292] In another embodiment, the dimart (e.g., a bispecific engagementr) comprises a sec1A sequence, an anti-CD3 sequence, and an anti-GD2 peptide sequence, or one or more equivalents thereof, and in one embodiment is encoded by the sequence of Sequence ID No. 14. Sequence ID 14 [ka] [ka] or equivalent.

[0293] In another embodiment, the dimart (e.g., a bispecific engagementr) includes a secreton 1A sequence, an anti-CD19 sequence, and an anti-CD3 sequence arranged as sec1A-anti-CD19-linker-anti-CD3. The bispecific engagementr includes the polypeptide sequence of SEQ ID NO: 15. The sec1A portion is underlined. Sequence ID 15 [ka] or equivalent.

[0294] In another embodiment, the dimart (e.g., a bispecific engagementr) comprises a secreton 1A sequence, an anti-CD19 sequence, and an anti-CD3 sequence, or one or more equivalents thereof, arranged as sec1A-anti-CD19-linker-anti-CD3. In one embodiment, it is encoded by the polynucleotide sequence of SEQ ID NO: 16. Sequence ID 16 [ka] or equivalent.

[0295] In some embodiments, the dimart contains a secretory signal called secreton AA (sec2A). In some cases, the dimart contains secreton AA tandem-linked to an amino acid sequence derived from blinatumomab (targeting CD3 and CD19). In some cases, secreton AA-blinatumomab (or sec2A-CD19xCD3) contains the polypeptide sequence of Sequence ID No. 29, with the secreton AA portion underlined. Sequence ID 29 [ka] or equivalent.

[0296] In some embodiments, the dimart containing sec2A-CD19xCD3 is encoded by the polynucleotide sequence of SEQ ID NO: 30. Sequence ID 30 [ka] [ka] or equivalent.

[0297] In some embodiments, the dimart comprises a secreton A (sec1A) sequence, CD19, and CD3, or one or more equivalents thereof, arranged in sec1A-CD19xCD3. In one embodiment, it is encoded by the polynucleotide sequence of SEQ ID NO: 31. Sequence ID 31 [ka] [ka] or equivalent.

[0298] In some embodiments, the dimart comprises a secreton (sec0A) sequence, CD19 and CD3, or one or more equivalents thereof, arranged as sec0A-CD19xCD3 in one embodiment and encoded by the polynucleotide sequence of Sequence ID No. 32. Sequence ID 32 [ka] [ka] or equivalent.

[0299] In some embodiments, the dimart comprises CD19 and CD3 sequences without a secreton sequence, arranged as CD19xCD3, or equivalents of one or both thereof, and in one embodiment, is encoded by the polynucleotide sequence of SEQ ID NO: 33. Sequence ID 33 [ka] [ka] or equivalent.

[0300] In one embodiment, the bispecific T cell engager comprises a polypeptide sequence that is at least 95% identical to either SEQ ID NO: 12 or 13, or at least 96%, or at least 97%, or at least 98%, or at least 99% identical. In one embodiment, the triplicate antibody comprises a first antibody or its antigen-binding fragment, a second antibody or its antigen-binding fragment, and a third antibody or its antigen-binding fragment. In a further embodiment, the triplicate antibody comprises a polypeptide sequence that is at least 95% sequence-identical to SEQ ID NO: 11, or at least 96%, or at least 97%, or at least 98%, or at least 99% sequence-identical to SEQ ID NO: 11.

[0301] In a further embodiment, the recombinant polynucleotide expresses a premRNA encoding a triplicate antibody when this premRNA is in contact with a morpholino oligonucleotide.

[0302] In one embodiment, the antigen-binding domain is a single-chain variable fragment of an antibody.

[0303] In a further embodiment, the recombinant polynucleotide or vector further comprises a polynucleotide sequence encoding a secreted peptide. In another embodiment, the vector further comprises a polynucleotide sequence encoding a dimerization domain. In another embodiment, the vector comprises a 5' inverse sequence (ITR) and a 3'ITR. In another embodiment, the vector comprises the sequences of SEQ ID NOs. 4, 6, 8, 12, 15, 16, 30-33 or their equivalents, or polynucleotides, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identity. Non-limiting examples of vectors include recombinant viral vectors, which include skeletal vectors selected as needed from the group of retroviral vectors, lentiviral vectors, mouse leukemia virus ("MLV") vectors, Epstein-Barr virus ("EBV") vectors, adenovirus vectors, herpesvirus ("HSV") vectors, adeno-associated virus ("AAV") vectors, AAV vectors, or self-complementary AAV vectors. These are labeled detectably as needed. Complements of polynucleotides, also labeled detectably as needed, are provided.

[0304] Recombinant polynucleotide vectors can be contained within host cells, such as prokaryotic or eukaryotic cells. Cells can be used to recombinantly express or replicate polynucleotides by culturing cells containing the polynucleotides under conditions that allow for polynucleotide replication and, if necessary, polynucleotide expression. The polynucleotides and / or expression products are isolated from the cell culture as needed.

[0305] The present invention also provides a viral packaging system comprising a vector having a pramid, virus-derived backbone as described above, a packaging plasmid, and an envelope plasmid. The packaging plasmid contains a nucleoside, a capsid, and a matrix protein. Examples of packaging plasmids are also described in the patent documents, for example, U.S. Patents 7,262,049; 6,995,258; 7,252,991 and 5,710,037. The system also includes a plasmid encoding an envelope protein provided by the envelope plasmid.

[0306] This disclosure also provides suitable packaging cell lines. In one embodiment, the packaging cell line is the HEK-293 cell line. Other suitable cell lines are known in the art and are described, for example, in U.S. Patents 7,070,994; 6,995,919; 6,475,786; 6,372,502; 6,365,150 and 5,591,624.

[0307] The present invention further provides a method for producing AAV particles, which includes, or essentially consists of, transducing a packaging cell line with a viral system under conditions suitable for packaging a viral vector, as described above. Such conditions are known in the art and are briefly described herein. The viral particles can be isolated from the cell supernatant by methods known to those skilled in the art, for example, by centrifugation. Such isolated particles are further provided by the present invention.

[0308] The present invention further provides isolated AAV virus particles prepared by this method. The virus particles contain, or essentially consist of, or comprise the polynucleotides described herein.

[0309] host cell Further provided are isolated cells or populations of cells comprising, or essentially derived from, isolated polynucleotides, viral particles, vectors, and packaging systems, as described above and incorporated herein by reference. In one embodiment, the isolated cells are a packaging cell line.

[0310] Isolated cells or populations of cells containing, or essentially consisting of, the polynucleotide sequences described herein are also provided.

[0311] The isolated cells described herein may be cells of any of the species of mice, rats, rabbits, monkeys, cattle, sheep, pigs, dogs, cats, farm animals, sporting animals, pets, horses, and primates, and in particular may be human cells.

[0312] The vector and cells may be contained within a composition containing the vector and / or host cells and a carrier, such as a pharmaceutically acceptable carrier. The vector and cells may be formulated for various modes of administration and may contain an effective amount of the vector and / or host cells effective against the patient, disorder or disease, the vector and mode of administration. In one embodiment, the mode of administration is systemic or intravenous. In another embodiment, the administration is local by direct injection. In one embodiment, the morpholino oligonucleotide is contacted simultaneously with or following the vector. Alternatively, the morpholino oligonucleotide is contacted before the vector.

[0313] How to use Polynucleotides and vectors are useful for treating various diseases or disorders. In one embodiment, a method for delivering a transgene is provided. This method comprises administering an effective amount of a polynucleotide or vector containing the transgene to cells, tissues, or patients to be treated. In one embodiment, an effective amount of an antisense oligonucleotide (e.g., morpholino oligonucleotide) is administered to cells, tissues, or patients to be treated. Non-limiting examples of transgenes are provided and selected based on the purpose of this method. The cells or tissues may be mammalian, e.g., human. In one embodiment, the antisense oligonucleotide (e.g., morpholino oligonucleotide) is contacted simultaneously with or following the vector. Alternatively, contact with the morpholino oligonucleotide is prior to the vector. In another embodiment, the vector is introduced into cells by translocation, infection, transformation, electroporation, injection, microinjection, or a combination thereof.

[0314] Methods for treating cancer in subjects requiring treatment are also provided herein. These methods include, or essentially consist of, administering an effective amount of a recombinant viral vector or cells described herein to a subject. In a further embodiment, the method further includes administering an effective amount of an antisense oligonucleotide (e.g., morpholino oligonucleotide) to a subject. In one embodiment, an effective amount of an anticancer agent is administered to a subject. Non-limiting examples of anticancer agents include anticancer peptides, polypeptides, nucleic acid molecules, small molecules, viral particles, or combinations thereof. In another embodiment, the vector is introduced into cells by translocation, infection, transformation, electroporation, injection, microinjection, or a combination thereof. The treatment may be administered as first-line, second-line, third-line, fourth-line, or fifth-line treatment. The treatment may be adjuvant therapy or in combination with other cancer therapies.

[0315] In one embodiment of the disclosed method, the virus particles are oncolytic HSV particles.

[0316] Administration Administration of the recombinant polynucleotides and / or vectors (e.g., AAV), viral particles, or compositions of this disclosure may be carried out in a single dose, continuously or intermittently, throughout the course of treatment. Administration may be made by any suitable mode of administration, including but not limited to intravenous, intra-arterial, intramuscular, intracardiac, intrathecal, subventricular, epidural, intracerebral, intraventricular, subretinal, intravitreous, intra-articular, intraocular, intraperitoneal, intrauterine, intradermal, subcutaneous, transdermal, transmucosal, and inhalation. In some cases, the mode of administration may include parenteral administration. In one embodiment, the recombinant polynucleotide or vector or composition is administered by intramuscular or intravenous injection. In another embodiment, the recombinant polynucleotide or vector or composition is administered systemically. In another embodiment, the recombinant polynucleotide or vector or composition is administered parenterally by injection, infusion, or implantation.

[0317] Methods for determining the most effective means of administration and dosage are known to those skilled in the art and vary depending on the composition used for treatment, the purpose of treatment, and the subject being treated. Single or multiple doses may be administered at dose levels and patterns selected by the physician performing the treatment. Note that the dosage may be affected by the route of administration. Appropriate drug formulations and methods for administering drugs are known in the art. Non-limiting examples of such appropriate dosages may range from a minimum of 1E+9 vector genomes to a maximum of 1E+17 vector genomes per dose.

[0318] In some embodiments of the methods described herein, the number of viral particles (e.g., AAV) administered to the subject is about 10 9 ~about 10 17 This is within the range. In certain embodiments, about 10 10 ~about 10 16 pieces, about 10 10 ~about 10 15 pieces, about 10 10 ~about 10 12 pieces, about 1011 ~about 10 13 pieces, about 10 11 ~about 10 12 pieces, about 10 11 ~about 10 14 pieces, about 10 11 ~about 10 15 pieces, about 10 11 ~about 10 16 pieces, about 5×10 11 ~about 5×10 12 pieces or about 10 12 ~about 10 13 pieces of virus particles are administered to the subject. In some cases, about 10 11 ~about 10 12 pieces of virus particles are administered to the subject. In some cases, about 10 13 ~about 10 15 pieces of virus particles are administered to the subject. In some cases, about 10 9 ~about 10 12 pieces of virus particles are administered to the subject. In some cases, about 10 9 ~about 10 11 pieces of virus particles are administered to the subject. In some cases, the amount of virus particles administered is based on the body weight of the subject. Those skilled in the art will understand that the total amount delivered to the subject is about 10 9 ~about 10 17 pieces of virus particles, and if necessary, about 10 10 ~about 10 16 pieces, about 10 10 ~about 10 15 pieces, about 10 10 ~about 10 12 pieces, about 10 11 ~about 10 13 pieces, about 10 11 ~about 10 12 pieces, about 10 11 ~about 10 14 pieces, about 10 11 ~about 10 15 pieces, about 10 11 ~about 10 16 pieces, about 5×10 11 ~about 5×10 12 pieces or about 10 12 ~about 10 13Understand a method of modulating the amount of viral particles delivered such that it falls within the range of individual viral particles. In some cases, the subject is a pediatric subject (e.g., a subject under 18 years of age). In some cases, about 10 9 ~ about 10 12 particles, about 10 10 ~ about 10 12 particles, about 10 11 ~ about 10 12 particles or about 10 9 ~ about 10 10 viral particles are administered to a pediatric subject.

[0319] In a further aspect, the viral particles and compositions of the present disclosure can be administered in combination with other treatments, such as approved treatments suitable for cancer and its related disorders or conditions.

[0320] The success of a treatment and / or repair is determined when one or more of the following are detected: a reduction or improvement in one or more of the symptoms of the disease, disorder or condition of the treated subject; a decrease in the degree of the subject's disease, disorder or condition; a stable (i.e., not worsening) state of the disease, disorder or condition; a delay or slowing in the progression of the disease, disorder or condition; and an improvement or alleviation of the disease, disorder or condition. In some embodiments, the success of a treatment is determined by detecting the presence of a repaired target polynucleotide in one or more cells, tissues or organs isolated from the subject. In some embodiments, the success of a treatment is determined by detecting the presence of a polypeptide encoded by a repaired target polynucleotide in one or more cells, tissues or organs isolated from the subject.

[0321] Kit The drugs, vectors, or compositions described herein may, in some embodiments, be assembled into pharmaceutical, diagnostic, or research kits to facilitate their use in therapeutic, diagnostic, or research applications. In some embodiments, the kits of this disclosure include one or more of the modified viral capsid proteins, isolated polynucleotides, vectors, host cells, recombinant viral particles, recombinant expression systems, modified AAVs, modified cells, isolated tissues, compositions, or pharmaceutical compositions described herein.

[0322] In some embodiments, the kit further includes instructions for use. Specifically, such a kit may contain one or more of the agents described herein, along with instructions describing the intended use and the proper use of these agents. As an example, in one embodiment, the kit may include instructions for mixing one or more of the components of the kit, and / or for isolating and mixing samples and applying them to a subject. In certain embodiments, the agents in the kit are pharmaceutical formulations and dosages suitable for a particular use and method of administering the agents. Kits for research purposes may contain components in appropriate concentrations or amounts for performing a variety of experiments.

[0323] Kits may be designed to facilitate the use of the methods described herein and may take many forms. Each composition in a kit may be provided in liquid form (e.g., in solution) or solid form (e.g., dry powder), where applicable. In certain cases, some of the compositions may be configurable or otherwise treatable (e.g., to an active form) by the addition of a suitable solvent or other type (e.g., water or cell culture medium), which may or may not be provided with the kit. In some embodiments, the compositions may be provided in a preservation solution (e.g., a cryopreservation solution). Non-limiting examples of preservation solutions include DMSO, paraformaldehyde, and CryoStor® (Stem Cell Technologies, Vancouver, Canada). In some embodiments, the preservation solution contains a certain amount of a metalloproteinase inhibitor.

[0324] As used herein, “Instructions” can define elements of instruction and / or encouragement, and typically include written instructions on or accompanying the packaging of the claimed method, recombinant vector, or composition. Instructions may also include any oral or electronic instructions provided in any format that clearly indicates to the user that such instructions should be associated with the kit, such as audiovisual (e.g., videotape, DVD, etc.), internet, and / or web-based means of communication. In some embodiments, written instructions are in a format prescribed by a government agency regulating the manufacture, use, or sale of a pharmaceutical or biological product, and such instructions may also reflect approval by an agency for manufacture, use, or sale for animal administration.

[0325] In some embodiments, the kit contains any one or more of the components described herein in one or more containers. Thus, in some embodiments, the kit may include a container for containing the drug described herein. The drug may be in liquid, gel, or solid (powder) form. The drug may be aseptically prepared, packaged in syringes, and shipped refrigerated. Alternatively, it may be contained in vials or other storage containers. A second container may contain other aseptically prepared drugs. Alternatively, the kit may contain activators that have been pre-mixed and shipped in syringes, vials, tubes, or other containers. The kit may have one or more or all of the components necessary to administer the drug to a subject, such as syringes, topical application devices, or IV needle tubes and pouches.

[0326] The treatments described herein can be combined with appropriate diagnostic techniques to identify and select patients for such treatment.

[0327] Manufacturing method Further methods provided by this disclosure include methods for producing bispecific or triplicate antibodies in cells, comprising contacting cells containing the vector described herein with an effective amount of morpholino oligonucleotide. In one embodiment, the morpholino oligonucleotide comprises a polynucleotide sequence that is at least 95% identical to SEQ ID NO: 27 (CAAGATTTACCTCTATTGTTGGATCATATT) or SEQ ID NO: 28 (TAAAACAAGATTTACCTCTATTGTTGGATC) or each of their equivalents. In one embodiment, the morpholino oligonucleotide is contacted simultaneously with or following the vector, or the contact of the morpholino oligonucleotide is prior to the vector. Non-limiting examples of bispecific antibodies include polypeptide sequences that are at least 95% identical to either SEQ ID NO: 13 and 15, or at least 96%, or at least 97%, or at least 98%, or at least 99% sequence identity to either SEQ ID NO: 13 and 15. In another embodiment, the triplicate antibody comprises a polypeptide sequence that is at least 95% identical to SEQ ID NO: 11, or at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 11.

[0328] In another embodiment, the vector is introduced into cells by translocation, infection, transformation, electroporation, injection, microinjection, or a combination thereof. Non-limiting examples of cells include fibroblasts, skeletal cells, epithelial cells, muscle cells, nerve cells, endocrine cells, melanocytes, hematopoietic cells, or a combination thereof.

[0329] Furthermore, a kit containing one or more of the vectors, cells, or compositions described herein is provided, along with instructions or materials as needed.

[0330] Specific Embodiments There are several methods for modulating gene expression through the principle of exon skipping.

[0331] In one embodiment, at least three exons are required to allow exon skipping in this strategy. In a three-exon structure, there are two splice donor sites and two splice acceptor sites, as shown in Figure 1. The first donor site is spliced ​​to either the first acceptor site ("a" in Figure 1) or the second acceptor site ("c" in Figure 1). The second donor site can only be spliced ​​to the second acceptor site ("b" in Figure 1). Thus, depending on whether splicing does not occur, only one splice event occurs (a, b, or c), or two splices occur (a+b), there are five possible RNA structures that can arise from such a three-exon / two-intron structure.

[0332] Typically, sequence-specific oligonucleotides ("oligos") are constructed that specifically interfere with each splicing event, either at the splice donor or acceptor site, or at the binding site to one of the spliceosome components (sometimes in the center of an intron). In this embodiment, as shown in Figure 1, each oligo is classified as a 1-donor (1D), 2-acceptor (1A), 2-donor (2D), or 3-acceptor (3D) based on whether it interferes with a donor or acceptor.

[0333] For example, due to alternative splicing or interference by oligos, exon 2 of a gene is skipped in cancer cells but remains in normal cells. In this embodiment, a normal gene containing the skipped exon is not expressed in cancer cells but expresses a protein in normal cells. The sequence of the intron adjacent to exon 2 in this construct can be used to reproduce the same splicing pattern in the transgene. As a result, constructs containing a transgene in a typical intron-exon-intron structure that is spliced ​​in both normal and tumor cells maintain relatively efficient splicing and result in high levels of fully spliced ​​transcripts (utilizing exons 1+2+3, splice a+b). Furthermore, if the oligo blocks the splicing of intron a or intron b (or both), exon 2 is skipped, producing a transcript that fuses exon 1 with exon 3. Thus, the relative expected abundances of “theoretically possible” transcripts shown in Figure 1 are modified in Figure 2 to show transcripts that may be abundant.

[0334] In one embodiment, based on the splicing concept described above, oligonucleotides and “exon skipping” techniques are used to switch a transgene from a transcript containing exons 1, 2, and 6 to a transcript containing exons 1 and 3. Thus, the construct or vector produces a functional polypeptide encoded by a transcript having exon 1 fused to exon 3. In one embodiment, the stop codon is manipulated to be functionally linked to exon 2 so that transcription stops at the stop codon before translation of exon 3, without interference by oligonucleotides to skip (skin) exon 2. An immature stop codon results in a non-functional transcript containing exons 1, 2, and 3. In one embodiment, the stop codon is placed in all three reading frames to ensure a complete stop. The ribosome stops translating the transcript after the stop codon, which includes exon 3. In this case, the baseline of the non-functional transcript (exons 1+2+3) switches to the functional transcript (exons 1+2), as illustrated in Figure 3.

[0335] In that case, constructing such a transgene is fairly straightforward, but an intron-exon-stop-intron structure that is appropriately "spliced ​​in" under normal circumstances is selected. The intron-exon-stop-intron can be manipulated using a sequence adjacent to a normally spliced ​​exon and cloned to a specific site in the transgene that brings the splice donor and acceptor consensus sequences into the adjacent bases. The exon should be carefully selected because the exon in the normal gene from which the sequence is extracted is also skipped. For example, the intron-exon-intron can be derived from a spliced ​​DNA viral gene, in which case the normal cellular gene is expected to remain unaffected. Alternatively, if the gene therapy application is against cancer, one might consider utilizing an intron-exon-intron boundary from an oncogene that may result in an incomplete oncogene. Such strategies leverage off-target skipping of cellular genes as a potentially "bonus" therapeutic effect.

[0336] Some exons are differentially regulated in cancer cells compared to normal cells. For example, splice 2 exons are "splice-in" in normal cells but excluded from the same gene in certain cancer cells. In such cases, using the intron-exon-intron boundary of the splice 2 exon in the construct (see Figure 4) results in different baseline and skipped expression of the transgene between normal and cancer cells, as shown in Figure 5. Since the manipulated exon STOP is usually absent in cancer cells, the transgene is activated in cancer cells but not in normal cells (Figure 5). Such exons can be used to selectively express a transgene in cancer cells and prevent its expression in normal cells even when exon skipping is completely absent. Such a scenario may be desirable for, for example, toxin genes or prodrug enzymes. Skipping exon 2 using oligos can activate the transgene in normal cells and increase its expression in cancer cells if baseline skipping in cancer cells is less than 100%.

[0337] Conversely, splice type 3 exons are eliminated in normal cells but "spliced ​​in" in certain cancer cells. Therefore, using this modified splicing of exons yields results opposite to those of splice type 2, as shown in Figure 6.

[0338] In summary, strategies for achieving the following regarding the control of transgene expression in gene therapy are disclosed.

[0339] Strategy #1: Activation of transgene expression depends on the administration of exon-skipping oligonucleotides. This effect is observed in both normal and cancer cells.

[0340] Strategy #2: In the absence of drugs or externally added agents, activation of transgene expression is typically high in certain cancer cells (only in certain cancers) and low in normal cells. This application can be used for cancer-selective expression in cancers with appropriately regulated splicing. Administration of exon-skipping oligonucleotides activates expression in normal cells in addition to specific cancer cells.

[0341] Strategy #3: Activation of transgene expression is high in normal cells but low in certain cancer cells. Administration of exon-skipping oligonucleotides activates expression in those cancer cells.

[0342] The principle of controllable gene expression can be applied to any gene therapy application, but gene therapy for cancer treatment is a specific application. In this embodiment, a therapeutic agent expressed in and secreted from normal cells can be activated when needed via the administration of an appropriate exon-skipping oligonucleotide.

[0343] For these purposes, the applicant designed an intron-exonSTOP-intron cassette from exon 1 of the KRAS gene as an example of a construct of Strategy #1 for insertion into a transgene of interest to achieve controllable gene expression. Oligonucleotides that induce exon skipping are selected for therapeutic applications.

[0344] In one embodiment, the applicant utilizes the structure of the KRAS gene, one of the most commonly mutated genes in cancer. Since KRAS is not an enzyme and apparently does not have a drug-binding pocket on its surface, it has not been possible to target it with drugs. Therefore, to the best of the applicant's knowledge, this skipping technique is the first method for targeting KRAS in cancer. For these purposes, the applicant's construct utilizes the first exon of KRAS in the 5' untranslated region, with the ATG start codon for protein translation located inside the second exon. (Thus, the second exon is often called exon 1 and the first exon is exon 0.) Because the ATG start codon is missing, an oligo that induces exon skipping of the ATG-containing exon results in a transcript that is not translated properly.

[0345] KRAS-based Intron-Exon STOP-Intron According to the Genbank sequence (NCBI reference sequence: NG_007524.1, last accessed February 20, 2019), the exons of KRAS are located at 4990..5170, 10526..10647, 28509..28687, 30148..30307, ​​and 46010..51132, with cDNA binding at 10537..10647, 28509..28687, 30148..30307, ​​and 46010..46126.

[0346] The first ATG in a normal KRAS gene is located at position 10537.

[0347] The exons to skip are between 10526 and 10647 (122 bp).

[0348] The construct includes a false version with a stop codon in each reading frame.

[0349] In one embodiment, in the case of the KRAS1 exon, the shaded and underlined nucleotides (including ATG of KRAS) are replaced with stop codons. [ka]

[0350] Exemplary stop codons are TAA, TAG, and TGA. In one embodiment, all three reading frames are: TAA x TAG x TGA (where x is any nucleotide).

[0351] To design all three stop codons to appear twice in a row, a stop codon can be inserted. Furthermore, an 11-base pair repeat can be avoided by using the sequence:TAAxTAGxTGAxTAGxTAAxTGAx(24bp)(SEQ ID NO: 1) (where x is any nucleotide). A specific embodiment is as follows:TAATTAGCTGAGTAGATAAGTGAT(SEQ ID NO: 2). As a result, one embodiment containing the exon Kras1STOP (the stop codon is underlined) is as follows: [ka] .

[0352] The typical upstream intron is located at 5171-10525 (5,355 bp) of the NCBI reference sequence NG_007524.1: "gtacg...ataag", with the remainder of the upstream intron indicated as "...".

[0353] The typical downstream intron is 10648~28508 (17,861 bp) of the NCBI reference sequence NG_007524.1: "gtaaa...ctcag", and the remaining portion of the downstream intron is indicated as "...".

[0354] In one embodiment, the upstream and downstream ends of both introns contain approximately 75 base pairs ("bps"). In one embodiment, the upstream intron sequence is as follows: [ka] .

[0355] In one embodiment, the downstream intron sequence is as follows: [ka] .

[0356] Therefore, in one embodiment, the following sequence is an intron-exon Kras1STOP-intron sequence (sequences without highlighting are upstream introns, gray sequences are introns containing the STOP sequence, and underlined sequences are downstream introns). [ka] [ka]

[0357] In one embodiment, it is possible to induce exon skipping, thereby adding a series of oligos that span the junction at the exon-downstream intron boundary. Exon-skipping oligos tend to be 20-30 base pairs long and antisense to DNA.

[0358] In one embodiment, the morpholino binding site is the intron-exonSTOP-intronmorpholino site (SEQ ID NO: 26) derived from Kras1. The sequence of the K1ExonStopIntron3' junction is listed below (exons are shown in gray and introns are underlined): [ka] .

[0359] The applicant fabricated and tested two morpholino binding sites, called KTS1 (SEQ ID NO: 24) and KTS2 (SEQ ID NO: 25). The KTS1 morpholino sequence contains the sequence of SEQ ID NO: 27. The KTS2 morpholino sequence contains the sequence of SEQ ID NO: 28. The applicant used the KTS2 morpholino reversed sequence (SEQ ID NO: 29) as a negative control. [ka]

[0360] In some cases, the splice donor site is A / C AG. *** Includes GT A / G AGT (SEQ ID NO: 34), *** The symbol '' indicates the exon-intron boundary and also shows the insertion site of the intron-exon STOP-intron sequence.

[0361] In some cases, the splice acceptor is (Py)XCAG *** Includes GG / T (Sequence ID 35), *** The symbol '' indicates an intron-exon boundary.

[0362] In some cases, exemplary splice donor sites for inserting intron-exon STOP-intron sequences include AAG-GG (SEQ ID NO: 36), CAG-GG (SEQ ID NO: 37), AAG-GT (SEQ ID NO: 38), or CAG-GT (SEQ ID NO: 39), where "-" indicates the insertion site.

[0363] CATAAVERT structure cancer( C ancer) targeting ( Ta (rgeted) AAV Expression ( e xpressed,)adjustment( r egulated) T To construct the (CATAAVERT) linker (also known as "TransSkip"), an intron-exon Kras1STOP-intron sequence is inserted into the coding region that generates the consensus splice donor and acceptor sites. In one embodiment, a vector containing the modified CATAAVERT expresses CD3 and GD2.

[0364] In another embodiment, the vector includes a sequence encoding the secreton-AA-CD3xGD2-HDD dimart. For this construct, the sequence of the secreton-AA-CD3xGD2-HDD dimart includes all potential sites (highlighted in gray) for inserting an intron-exon Kras1 stop-intron to generate a consensus splice donor / acceptor (inserting the sequence 1 or more 5 bp after the third potential site), and provides the following: [ka] [ka]

[0365] In one embodiment, an insertion occurs at the upstreammost site to minimize the length of the CD3xGD2 dimart translated before the stop codon (underlined sequences are splice junctions retained in mRNA when introns are spliced, double-underlined sequences are splice donor sites at the start of upstream intron sequences, gray sequences are exons containing the STOP sequence, and bold sequences are downstream introns). In some cases, this sequence is referred to as the CD3xGD2K1 dimart: [ka] [ka] [ka] .

[0366] In some cases, the upstream splicing factor binding site is modified (modified regions are shown in italics and bold). Underlined sequences are splice junctions retained in mRNA when introns are spliced, double-underlined sequences are splice donor sites at the start of the upstream intron sequence, gray sequences are exons containing the STOP sequence, and bold sequences are downstream introns. In some cases, this sequence is referred to as the CD3xGD2K2 dimart: [ka] [ka] .

[0367] In some cases, the CD3xGD2 dimart construct contains one or more further modifications in the polynucleotide sequence. In some cases, the CD3xGD2 dimart construct is sec2A-CD3xGD2-HDD-K3, and the sequence of sec2A-CD3xGD2-HDD-K3 is shown as Sequence ID No. 41. Underlined sequences are splice junctions retained in mRNA when an intron is spliced, double-underlined sequences are splice donor sites at the start of an upstream intron sequence, gray sequences are exons containing a STOP sequence, and bold sequences are downstream introns. Sequence ID 41 [ka] [ka] [ka]

[0368] In some cases, the CD3xGD2 dimart construct is sec2A-CD3xGD2-HDD-K4, and the sequence of sec2A-CD3xGD2-HDD-K4 is shown as Sequence ID No. 42. Underlined sequences are splice junctions retained in mRNA when introns are spliced, double-underlined sequences are splice donor sites at the start of upstream intron sequences, gray sequences are exons containing STOP sequences, and bold sequences are downstream introns. Sequence ID 42 [ka] [ka]

[0369] In some cases, the CD3xGD2 dimart construct is sec2A-CD3xGD2-HDD-K5, and the sequence of sec2A-CD3xGD2-HDD-K5 is shown as Sequence ID No. 43. Underlined sequences are splice junctions retained in mRNA when introns are spliced, double-underlined sequences are splice donor sites at the start of upstream intron sequences, gray sequences are exons containing STOP sequences, and bold sequences are downstream introns. Sequence ID 43 [ka] [ka] [ka]

[0370] In some embodiments, the dimarts described herein include a CD3 sequence, a CD19 sequence, and optionally a secreton sequence. In some cases, the dimart includes a CD3xCD19 construct, shown in Sequence ID No. 44, which highlights all potential sites for inserting an intron-exon-Kras1 stop-intron sequence to generate a consensus splice donor / acceptor site. Each potential insertion site is highlighted in gray. Sequence ID 44 [ka] [ka]

[0371] In some cases, the insertion occurs at the most upstream site. In some cases, the dimart further includes a secreton sequence. In some cases, the CD3xCD19 construct is sec1A-CD3xCD19-K1, its sequence shown as Sequence ID No. 45. As shown below, underlined sequences are splice junctions retained in mRNA when introns are spliced, italicized and bold sequences are upstream intron sequences, gray sequences are exons containing STOP sequences, and bold sequences are downstream introns. Sequence ID 45 [ka] [ka]

[0372] In some cases, the CD3xCD19 construct is sec1A-CD3xCD19-K3, and its sequence is shown as Sequence ID No. 46. As shown below, underlined sequences are splice junctions retained in mRNA when introns are spliced, italicized and bold regions are modified regions of upstream splicing factor binding sites, gray sequences are exons containing STOP sequences, and bold sequences are downstream introns. Sequence ID 46 [ka] [ka] [Examples]

[0373] These examples are provided for illustrative purposes only and do not limit the scope of the claims provided herein. [Example 1] Generating a CD3xGD2-HDD dymart using exemplary CD3xGD2-HDDTransJoins

[0374] Map of an exemplary AAV construct for testing CD3xGD2-HDD expression.

[0375] As proof of principle, we expressed a previously described bispecific molecule targeting human CD3 on T cells and the disialoganglioside GD2 on neuroblastoma and other types of cancer cells. As reported by Ahmed et al., OncoImmunology, 4:4, e989776, DOI:10.4161 / 2162402X.2014.989776, this bispecific protein has amino acid sequences of heavy and light variable regions for human CD3 derived from clone OKT3, fused to an scFv construct for GD2 derived from clone 5F11 by a short linker (L) linked as a dimer by an HNF1a dimerizing domain (HDD) (using the format for single-chain variable fragments, scFv). To reverse engineer the optimal human DNA coding sequence for CD3xGD2-HDD, we used the vectorbuilder.com codon optimization tool ( / / en.vectorbuilder.com / tool / codon-optimization.html). The obtained DNA sequence, beginning with the ATG start codon, was synthesized and cloned downstream of the chicken-actin-β-globin promoter (CAGp) in an adenovirus-associated virus expression cassette containing a terminal inversion sequence derived from AAV2. Based on the finding that alanine enhances secretion in response to protein, three other versions were created containing a consensus secretion signaling domain ("secrecon," based on Barash et al., Biochem Biophys Res Commun. 2002;294:835-842) downstream of the ATG start site and ending with 0, 1, or 2 alanine molecules (Gueler-Gane et al., PLoS ONE 11(5):e0155340.doi:10.1371 / journal.pone.0155340). The proteins derived from these constructs were called heterodimer scFv or dimarts. Figure 7 shows four exemplary CD3xGD2-HDD dimart constructs.

[0376] Assay for determining the structure and function of dimarts.

[0377] 293T cells were transduced with an AAV expression vector (or control), and the supernatant was collected and stored. The supernatant was tested for the presence of the correct-sized protein on electrophoresis (SDS-PAGE), binding to CD3 by a binding competition assay using flow cytometry, T cell activation by flow cytometry, and tumor cell killing when co-incubated with T cells. See Figure 8 for an illustrated representation of the assays used to determine the structure and function of the dimart disclosed herein.

[0378] Three constructs containing secreted peptides show lower levels of CD3xGD2-HDD dimarts retained within cells.

[0379] Total cell lysates of 293T cells transfected with different AAV CD3xGD2-HDD expression plasmids were collected 48 hours after transfection. Polyacrylamide electrophoresis (PAGE) was performed using 50 ug of total protein per lane, and the gels were stained with Ponceau S. The results showed that construct #1104, lacking the secretory sequence, showed more protein, while all three constructs with the secretory sequence showed less protein. Controls included cells alone or cells transfected with the control plasmid (pcDNA3-GFP). KDa, kilodalton; Sec, secretory domain; GFP, green fluorescent protein; MW, molecular weight. See Figure 9.

[0380] Only the supernatant from cells transfected with the AAV CD3xGD2-HDD construct containing secretory sequences binds to and activates T cells.

[0381] The supernatant was tested for binding to and activation of human T cells. Binding was determined by competition with a fluorescently labeled anti-CD3 antibody pre-bound to T(Jurkat) cells. Stained cells showed CD3 positivity in 77.6%, 79.24%, and 78.7% (Q2+Q3) of the control groups (DMEM, Ctrl, GFP), and 77.7% from AAV vector #1104 lacking the secretory peptide. In contrast, binding of the fluorescently labeled anti-CD3 antibody was reduced to 2.15%, 3.67%, and 3.99% (Q2+Q3) of the supernatant from cells transfected with each vector containing the secretory peptide. Furthermore, cells were co-stained with anti-CD69 as a marker of T cell activation. The control group and AAV vector #1104 all showed less than 13.4% CD69 positivity (Q1+Q2), while the three different secretion-containing AAV vectors showed CD69 positivity ranging from 58.87% to 68.5%. See Figure 10.

[0382] Detailed method: Jurkat2e5 cells / well were seeded in 400 μl of RPMI + 10% FBS into a 24-well plate, and then 100 μl of supernatant (20% of the total culture) from 293 T transfected cells was added to each well. After 48 hours of incubation, Jurkat cells were centrifuged and washed once with PBS, and then stained with PE-anti-hCD69 (1:100) and PerCP-anti-hCD3e (1:300#OKT3) on ice for 30 minutes. After washing with FACS buffer, each sample was fixed in 1% PFA and analyzed by flow cytometry. DMEM is the medium added to Jurkat only, Ctrl is the supernatant added from untransfected 293 T cells, and GFP is the supernatant added from 293 T cells transfected with a GFP-expressing AAV plasmid.

[0383] Only the supernatant from cells transfused with AAV vectors containing secreted peptides activates human T cells.

[0384] Human T (Jurkat) cells were incubated with supernatant from 293 T cells transfected with various AAV vectors, stained for CD69 with PE-labeled antibody, and examined under fluorescence microscopy. See Figure 11, where the left panel is phase contrast and the right panel is fluorescence. Neither the EGFP vector control nor the secretory peptide-less vector #1104 showed positive staining, but the other three vectors showed high levels of staining (red). Detailed methods: Jurkat2e5 cells / well were seeded in 400 μl of RPMI + 10% FBS into a 24-well plate, and then 100 μl of supernatant from 293 T transfected cells (20% of the total culture) was added to each well. After 48 hours of incubation, Jurkat cells were centrifuged, washed once with PBS, and then stained with phycoerythrin (PE)-anti-hCD69 (1:100) on ice for 30 minutes. After washing with FACS buffer, each sample was fixed in 1% PFA for 5 minutes. Scale bar: 100 μm.

[0385] The binding of CD3xGD2-HDD to T cells is dose-dependent.

[0386] We incubated varying amounts of supernatant from 293T cells transfected with AAV plasmids containing different secreted peptides and tested their competition with peridinin chlorophyll protein complex (PerCP) conjugate anti-hCD3 on JurkatT cells. See Figure 12A, where the left panel shows the FACS plot and the right panel shows the median number of staining levels. Gray shading in the left panel indicates unstained cells, and the dark gray lines in each panel indicate the most stained cells without supernatant addition. Figure 12B shows a bar graph of the median staining levels normalized against an unstained control.

[0387] Detailed method: Jurkat2e5 cells / well were seeded in 400 μl of RPMI + 10% FBS into a 24-well plate, and then 10 μl, 25 μl, 50 μl, or 100 μl of supernatant (2–20% of the total culture) from 293T translocation cells was added to each well. After 24 hours of incubation, Jurkat cells were centrifuged and washed once with PBS, then stained with PerCP-anti-hCD3e (1:300#OKT3) on ice for 30 minutes. After washing with FACS buffer, each sample was fixed in 1% PFA for 5 minutes and analyzed by flow cytometry. Sec = secreted peptide, A = alanine.

[0388] Binding assay of CD3xGD2-HDD dimart to the anti-GD2 arm, and confirmation that both GD2 and CD3 binding are present on a single molecule.

[0389] The binding of CD3xGD2-HDD to GD2 was indirectly measured by first incubating the supernatant derived from 293T plasma transfer cells with either GD2-positive or GD2-negative cells, and then repeating the CD3 T cell binding competition assay. The GD2-binding protein should be absorbed by GD2-positive cells but not by GD2-negative cells, resulting in a loss of competition for T cell binding. This assay was designed to confirm that GD2 binding is co-bound to CD3 binding, in other words, that a single molecule exhibits bispecificity. See Figure 13 for an illustration of the binding assay.

[0390] The CD3xGD2-HDD combines both CD3 and GD2.

[0391] As shown in Figure 13, supernatants derived from 293T cells transfected with the #1101 CD3xGD2-HDD AAV vector were collected and pre-incubated with GD2-positive SK-N-Be(2) or GD2-negative Raji cells. After centrifugation and washing, a binding competition assay was performed against CD3 T(Jurkat) cells.

[0392] Figure 14 shows an exemplary CD3xGD2-HDD dimart that binds to both CD3 and GD2. The gray shading in the upper panel with black outlines represents unstained Jurkat T cells, and the dark gray lines represent Jurkat T cells fully stained for CD3 without the addition of supernatant. Sample Jurkat_cd3e showed fully competitive CD3 binding when using supernatant without pre-incubation, and nearly overlapped with supernatant pre-incubated with GD2-negative Raji cells. In contrast, sample Jurkat_cd3e sknbe2 showed loss of competition when the supernatant was pre-incubated with GD2-positive SK-N-Be(2) neuroblastoma cells, confirming that the same molecule binds to both CD3 and GD2.

[0393] An assay to determine whether CD3xGD2-HDD induces T cell-mediated killing of GD2+ target cells.

[0394] Figure 15 shows a flowchart of an assay to determine whether CD3xGD2-HDD induces T cell-mediated killing of GD2+ target cells. As shown in Figure 15, GD2+ neuroblastoma (SK-N-Be(2)) cells are seeded in wells, followed by seeding of supernatant from primary human T cells (purchased from StemExpress) and 293 T cells transfected with AAV vectors. Cell viability is assessed using CellTiter-Glo from Promega (Madison, WI).

[0395] The secreted CD3xGD2-HDD induces T cell killing in neuroblastoma cells.

[0396] The assay shown in Figure 15 was used to test cytotoxicity of human T cells + supernatant (derived from 293 T cells transfected with various AAV vector plasmids) against GD2+SK-N-Be(2) neuroblastoma cells. A T cell to target cell ratio of 10:1 was used. Cell viability was assayed after 48 hours in co-culture. No recognizable cytotoxicity was observed when using supernatant from cells transfected with constructs expressing an unrelated dimart (CD19xCD3) or a vector lacking the secretory peptide (#1104) compared to supernatant from untransfected cells ("no dimart") (Figure 16). In contrast, supernatant from cells transfected with each of the secretory peptide-containing vectors induced statistically significant cytotoxicity (p<0.001), killing 25–30% of cells (Figure 16).

[0397] T cell-mediated cytotoxicity mediated by the CD3xGD2-HDD dimart is associated with GD2 expression.

[0398] To assess the sensitivity of neuroblastoma cell lines to cytotoxicity by human T cells combined with the supernatant from AAV vector #1101 (upper panel of Figure 17), their GD2 expression was measured by flow cytometry (lower graph of Figure 17; the shaded curves represent isotype controls). CHP-134 cells showed the highest cytotoxicity and the highest GD2 expression. [Example 2] Generation of a CD19xCD3 dimart using exemplary CD19xCD3TransJoins

[0399] Map of exemplary AAV constructs for testing CD19xCD3 dimart expression.

[0400] The FDA-approved protein therapy known as blinatumomab, a so-called bispecific T-cell engager (BiTE), was designed to target human CD19 on B-cell malignancies and human CD3 on T cells. Using the publicly available amino acid sequence of blinatumomab ( / / www.drugbank.ca / drugs / DB09052), and further using the vectorbuilder.com codon optimization tool ( / / en.vectorbuilder.com / tool / codon-optimization.html), we reverse-engineered the optimal human DNA coding sequence for CD19xCD3. The resulting DNA sequence, starting with the ATG start codon, was synthesized and cloned downstream of the chicken-actin-β-globin promoter (CAGp) in an adenovirus-associated virus expression cassette with a terminal inversion sequence derived from AAV2. Based on the finding that alanine enhances secretion in response to protein, we constructed three other versions containing a consensus secretory signaling domain ("secrecon," based on Barash et al., Biochem Biophys Res Commun. 2002;294:835-842) downstream of the ATG initiation site and ending with 0, 1, or 2 alanine molecules (Gueler-Gane et al., PLoS ONE 11(5):e0155340.doi:10.1371 / journal.pone.0155340). Proteins derived from these constructs were called heterodimers scFv or dimates. Figures 18A and 18B show five exemplary CD19xCD3 constructs.

[0401] Figure 18C shows an illustration of CD19 dimarts interacting with cancer cells and T cells. CD19 dimarts are produced by cells containing CD19TransJoin. When administered to a subject, for example intravenously, AAV TransJoin (e.g., AAV CD19 TransJoin as shown in this figure) enters normal cells such as liver or muscle cells and expresses the polypeptide encoded by AAV TransJoin. The secretory signal peptide is cleaved during secretion, leaving an active dimart that binds cancer cells (Ca) at one end and T immune cells at the other end.

[0402] Only the supernatant from cells transfected with the AAV CD19×CD2 construct containing the secretory sequence binds to and activates T cells.

[0403] The supernatant was tested for binding to and activation of human T cells. Binding was determined by competition with a fluorescently labeled anti-CD3 antibody pre-bound to human T(Jurkat) cells. Stained cells showed CD3 positivity in 77.6%, 79.24%, and 78.7% (Q2+Q3) of the control groups (DMEM, Ctrl, GFP), and 79.4% from vector #1323 lacking the secretory peptide. In contrast, binding of the fluorescently labeled anti-CD3 antibody was reduced to 23.88%, 18.59%, and 30.76% (Q2+Q3) of the supernatant from cells transfected with each vector containing the secretory peptide. Furthermore, cells were co-stained with anti-CD69 as a marker of T cell activation. The control group and #1323 all showed less than 13.38% CD69 positivity (Q1+Q2), while the three different secretion-containing vectors showed 63.9%, 67.3%, and 66.6% CD69 positivity (Figure 19).

[0404] Detailed method: Jurkat2e5 cells / well were seeded in 400 μl of RPMI + 10% FBS into a 24-well plate, and then 100 μl of supernatant (20% of the total culture) from 293 T transfected cells was added to each well. After 48 hours of incubation, Jurkat cells were centrifuged and washed once with PBS, and then stained with PE-anti-hCD69 (1:100) and PerCP-anti-hCD3e (1:300#OKT3) on ice for 30 minutes. After washing with FACS buffer, each sample was fixed in 1% PFA and analyzed by flow cytometry. DMEM is the medium added to Jurkat only, Ctrl is the supernatant added from untransfected 293 T cells, and GFP is the supernatant added from 293 T cells transfected with a GFP-expressing AAV plasmid.

[0405] Only the supernatant from cells transfused with AAV vectors containing secreted peptides activates human T cells.

[0406] Human T (Jurkat) cells were incubated with supernatant from 293 T cells transfected with various AAV vectors, stained for CD69 with PE-labeled antibodies, and examined under fluorescence microscopy. See Figure 20; the left panel is phase contrast, and the right panel is fluorescence. Neither the EGFP vector control nor the secretory peptide-less AAV vector #1323 showed positive staining, but the other three vectors showed high levels of staining (red).

[0407] Detailed method: Jurkat2e5 cells / well were seeded in 400 μl of RPMI + 10% FBS into a 24-well plate, and then 100 μl of supernatant (20% of the total culture) from 293 T plasma transfer cells was added to each well. After 48 hours of incubation, Jurkat cells were centrifuged and washed once with PBS, and then stained with phycoerythrin (PE)-anti-hCD69 (1:100) on ice for 30 minutes. After washing with FACS buffer, each sample was fixed in 1% PFA for 5 minutes. Scale bar: 100 μm.

[0408] AAV-secreted CD19xCD3 specifically binds to CD19, but not to CD45.

[0409] Using a binding competition assay, we determined whether the supernatant from transfused 293T cells containing the AAV vector interfered with the staining of Epstein-Barr virus (EBV)-transferred human B cells by two different antibodies: one staining the B cell marker CD19 and the other staining the panleukocyte marker CD45.

[0410] Cells in the three control groups (DMEM, Ctrl, and GFP) showed positive staining (Q1+Q2) for CD19 at 93%, 93.1%, and 93.2%, respectively. Supernatants from cells transfused with AAV vector #1323, which lacked secretory peptides, did not compete for staining and showed 93.2% positivity for CD19 (see Figure 21). In contrast, each of the AAV vectors containing secretory peptides competed to reduce CD19 signaling to 33.33%, 31.07%, and 35.88%, respectively. Note that the cutoff was set so that unstained cells showed 14.58% positivity for CD19, suggesting that the supernatants from cells transfused with these three AAV vectors competed to reduce staining to twice the background level. In contrast, none of the vectors competed for CD45 staining, being 78.89%, 79.14%, and 78.32% positive (Q2+Q3) in the three controls, 82.9% positive in the vector lacking secretory peptides, and 80.5%, 78.5%, and 79.4% positive using supernatant from cells transfected with the other three vectors.

[0411] Detailed method: B cells transformed with EBV called NB122R (Gene Ther. 2013 / July;20(7):761-9.doi:10.1038 / gt.2012.93) were seeded in 24-well plates at 2e5 cells / well in 400 μl of RPMI + 10% FBS, and then 100 μl of supernatant (2–20% of the total culture) from 293T translocation cells was added to each well. After 24 hours of incubation, the cells were centrifuged and washed once with PBS, and then stained with PEcy7-anti-hCD45 (1:100) and APC-anti-hCD19 (1:300) on ice for 30 minutes. After washing with FACS buffer, each sample was fixed in 1% PFA for 5 minutes and then flow cytometry analysis was performed. DMEM is the medium added to Jurkat only, Ctrl is the supernatant added from untransferred 293T cells, and GFP is the supernatant added from 293T cells transfused with a GFP-expressing AAV plasmid.

[0412] The binding of CD19xCD3 to T cells is dose-dependent, and vectors containing a single alanine downstream of the secretory peptide consensus sequence perform better than other vectors tested.

[0413] Varying amounts of supernatant from 293T cells transfected with AAV plasmids containing different secreted peptides were incubated and tested for competition with peridinine chlorophyll protein complex (PerCP) conjugate anti-hCD3 on Jurkat T cells. See Figure 22A, where the left panel shows the FACS plot and the right panel shows the median number of staining levels. Gray shading in each of the left panels represents unstained cells, and the dark gray line in each of the left panels represents the most stained cells without the addition of supernatant. Figure 22B shows a bar graph of median staining levels normalized against unstained controls. Vector #1325, with a single alanine downstream of the secreted peptide consensus sequence, showed the greatest competition compared to other vectors tested and was selected for further experimentation.

[0414] Detailed method: Jurkat2e5 cells / well were seeded in 400 μl of RPMI + 10% FBS into a 24-well plate, and then 10 μl, 25 μl, 50 μl, or 100 μl of supernatant (2–20% of the total culture) from 293T translocation cells was added to each well. After 24 hours of incubation, Jurkat cells were centrifuged and washed once with PBS, then stained with PerCP-anti-hCD3e (1:300#OKT3) on ice for 30 minutes. After washing with FACS buffer, each sample was fixed in 1% PFA for 5 minutes and analyzed by flow cytometry. MFI = mean fluorescence intensity, Sec = secreted peptide, A = alanine.

[0415] The binding of CD19xCD3 to B cells is dose-dependent, and vectors containing a single alanine downstream of the secretory peptide consensus sequence are superior compared to other vectors tested.

[0416] Varying amounts of supernatant from 293 T cells transfected with AAV plasmids containing different secreted peptides were incubated and tested for competition with allophycocyanin (APC) conjugate anti-hCD19 on human B cells. See Figure 23A, where the left panel shows the FACS plot and the right panel shows the median number of staining levels. Gray shading in each of the left panels represents unstained cells, and the dark gray lines in each of the left panels represent the most stained cells without the addition of supernatant. Figure 23B shows a bar graph of the median staining levels normalized against an unstained control. Vector #1325, with a single alanine at the end of the secreted peptide, showed the greatest competition, consistent with the results for T cell binding shown in Figures 22A and 22B, and was selected for further experimentation.

[0417] Detailed method: NB122R human B cells were seeded in 24-well plates at a rate of 2e5 cells / well in 400 μl of RPMI + 10% FBS. Then, 10 μl, 25 μl, 50 μl, or 100 μl of supernatant (2–20% of the total culture) from 293T translocation cells was added to each well. After 24 hours of incubation, cells were centrifuged and washed once with PBS, then stained with APC-anti-hCD19 (1:300) on ice for 30 minutes. After washing with FACS buffer, each sample was fixed in 1% PFA for 5 minutes and analyzed by flow cytometry. MFI = mean fluorescence intensity, Sec = secreted peptide, A = alanine.

[0418] CD3 dimarts activate T cells via anti-CD28 costimulation more effectively than anti-CD3 antibodies.

[0419] Human T(Jurkat) cells were co-incubated with either the supernatant from 293T cells transfected with anti-CD28 antibody and AAV vector (left panel of Figure 24) or an increasing dose of anti-CD3 antibody (right panel of Figure 24). Cell mRNA was collected, and quantitative reverse transcriptase polymerase chain reaction (RT-PCR) was performed on IL-2 (upper panel of Figure 24) and IL-8 (lower panel of Figure 24) mRNA. Expression was calculated by comparing it to housekeeping mRNA, GAPDH. Only the supernatant from cells transfected with AAV vector constructs containing secretory domains showed superior stimulation of at least one gene compared to controls (gfp, 293t) and vector constructs lacking secretory domains (#1104 for CD3xGD2-HDD and #1323 for CD19xCD3).

[0420] 293T cells yield the highest transduction efficiency for AAV8.

[0421] Four different cell lines were infected with two different concentrations of AAV8 expressing green fluorescent protein (GFP) at an infection efficiency (MOI) of 1e4 or 1e5 genome copies (gc) using a medium containing 2% fetal bovine serum. GFP signaling was evaluated by fluorescence microscopy 48 hours after viral infection. See Figure 25. AML-12: normal mouse hepatocytes; 293T: human fetal kidney cells transformed with SV40-T antigen; H441-CRM: human lung cancer cells with KRAS mutations; SK-N-Be(2): NMYC-amplified human neuroblastoma cells.

[0422] The dimart concentration in the supernatant of AAV8-infected cells is dependent on the AAV dose and transduction efficiency.

[0423] T(Jurkat) binding assays were performed on supernatants derived from 293 T cells and H441 cells transfected with TransJoin vectors or AAV-GFP controls. Gray shading in the panels represents unstained control cells, and dark gray lines in each panel represent T cells fully stained with anti-CD3 antibody (see Figure 26). The CD19xCD3 dimart appeared to be far more effective than the CD3xGD2-HDD dimart in competition for binding, but this effect was dose-dependent (higher MOI shifted the curve further to the left) and was not observed in cell lines with low AAV8 transduction efficiency (H441 cells). MOI, infection efficiency.

[0424] A single intravenous injection of CD19xCD3 TransJoin selectively removes B cells in humanized mice.

[0425] Immunodeficient mice (NSG-SGM3, Jackson Labs) were purchased, irradiated, and intravenously injected with human CD34+ hematopoietic stem cells. By 12 weeks, the mice showed engraftment of human blood cells, including T and B lymphocytes, by flow cytometry of peripheral blood. As shown in Figure 27, mice were administered single injections of CD19xCD3 TransJoin (AAV8-Sec1A-CAG-193, vector #1325 packaged in an AAV8 capsid) at various doses, and blood was analyzed by flow cytometry for human lymphocytes collected at various time points. Low doses (5e9 and 5e10 vector genome (vg) / kilogram (kg) body weight) were ineffective, but higher doses (5e11 and 5e12 vg / kg) were sufficient to eliminate circulating B cells without affecting CD4+ T cells or CD8+ T cells.

[0426] A single intravenous injection of CD19xCD3 TransJoin induces long-term B cell depletion in humanized mice.

[0427] Humanized mice were treated with a single dose of CD19xCD3 AAV8 TransJoin, followed by measurement of lymphocyte subsets in the blood. Long-term selective B cell depletion was observed in all mice analyzed, as long as these mice remained alive, as shown in Figure 28 for a single mouse.

[0428] This study demonstrates that a single intravenous injection of CD19xCD3 TransJoin eliminates CD19+ lymphoma in humanized mice.

[0429] Human CD19+ Raji cells (derived from a patient with Burkitt lymphoma) were transplanted into the flanks of two humanized mice, and 250 mm 3We waited until the tumors reached a size exceeding [a certain threshold]. Then, we injected the control AAV virus AAVGFP into the tail vein of one animal and CD19xCD3 AAV8 TransJoin into the tail vein of a second animal. The tumors in the control mice eventually grew rapidly, requiring euthanasia. The tumors in the TransJoin-treated mice grew slowly and then eventually shrank almost completely. See Figure 29. Although the animals had to be sacrificed due to symptoms of graft-versus-host disease, a known consequence in humanized mice, this experiment demonstrates proof of the principle that a single TransJoin injection can treat cancer. [Example 3] Simultaneously, the use of OncoSkip and TransSkip to target oncogene expression and activate therapeutic transgene expression.

[0430] An overview of OncoSkip and TransSkip as described herein.

[0431] OncoSkip is an antisense morpholino that induces exon skipping of oncogenes. In some embodiments, OncoSkip is designed as an antisense morpholino that induces exon skipping of key exons in oncogenes (left side of Figure 30). For proof of principle, we used KRAS (exons 1, 2, and 3, represented by black-gold-gray on the left side of Figure 30) and tested a morpholino containing an ATG start site (shown as a small light gray bar above the oncogene in Figure 30) designed to skip KRAS exon 2 so that normal expression of the oncogene is reduced. A derivative of the same exon to be skipped is then constructed but mutated to include multiple stop codons within each reading frame, along with adjacent intron sequences. The new intron-exon (stop)-intron is then inserted into the transgene coding sequence at sites that reshape the donor and acceptor splice sites so that the normal coding sequence is interrupted. In the presence of antisense morpholino (small, thin gray bars over oncogenes), newly inserted exons are skipped, and the coding sequence is rejoined to produce a functional product. A class of AAV vectors containing genes interrupted by intron-exon-intron sequences is called TransSkip viruses, and a class of morpholino designed to downregulate oncogenes is called OncoSkip.

[0432] KRAS OncoSkip antisense morpholino induces exon skipping of endogenous KRAS in lung cancer cells.

[0433] Lung cancer cell lines A549 and H441 (not shown) were incubated with KTS1 and KTS2 OncoSkip antisense morpholino, as well as a reverse control morpholino for KTS2. Both KTS1 and KTS2 were designed to bind to the 3-prime terminus of the exon-intron junction of KRAS exon 2, inducing exon 2 skipping because exon 2 contains the ATG start site. The presence of exon 2 was then analyzed by reverse transcriptase RT-PCR for endogenous KRAS mRNA, using PCR with primers present in exon 1 (forward) and exon 2 (reverse). A primer in exon 4 was used as a control for total KRAS mRNA. A dose-dependent decrease in transcripts containing exon 2 ("exon 1+2") was observed with both OncoSkip morpholino. See Figure 31.

[0434] AAV vector map of CD3xGD2-HDD TransSkip showing inverted introns adjacent to exons inserted in the CD3xGD2-HDD dymart code sequence.

[0435] We synthesized a 3-prime sequence of the human intron (Ki1) upstream of KRAS exon 2, a derivative of KRAS exon 2 (STOP) mutated with multiple stop codons in all three reading frames, and a 5-prime sequence of the human intron (Ki) downstream of KRAS exon 2, and cloned a cassette into the gene sequence encoding the GD2 dimart at specific sequences that reproduce consensus splice donor and acceptor sites. See Figure 32. When the new STOP exon is spliced ​​into the transcript, no functional dimart is produced. When cells are exposed to antisense morpholino that binds the 3-prime exon-intron junction, the STOP exon is skipped and full-length dimart mRNA is expressed. An antisense morpholino designed to induce exon 2 skipping simultaneously alters the mRNA splicing of the TransSkip transgene, resulting in the expression of the full-length dimart in transduced cells. Since exon 2 contains the KRAS ATG start codon, the KRAS sequence was selected to reduce or eliminate innate KRAS expression in cancer cells.

[0436] Exemplary strategies for testing the activity of OncoSkip and TransSkip.

[0437] As shown in Figure 33, cell pellets and supernatants were collected from 293T cells transduced with the AAV dimart vector. mRNA was isolated from the cell pellet and subjected to reverse transcriptase RT-PCR to determine the extent to which artificial exons in the transgene were spliced ​​into the mRNA. The supernatant for dimart expression was analyzed by T cell binding assays and killing assays.

[0438] Antisense morpholino induces exon skipping in the CD3xGD2-HDD TransSkip transgene.

[0439] 293T cells were transfused with CD3xGD2-HDD dimart plasmid #1042. Cells were harvested 48 hours after transfusion for total RNA isolation. Approximately 1 ug of RNA was used for RT-PCR. Lane #9 shows full-length transgene RNA between unspliced ​​primers using the DNA plasmid as a template; see Figure 34. Lanes 7 and 8, as well as the control lane, are without antisense morpholino, indicating that the majority of transcripts contain internal exons (stripped rectangles). A few transcripts with exon exclusion (smallest band) are present, suggesting that this construct has some "leakage" of activated transcripts. Inclusion of either morpholino (KTS1, KTS2) dose-dependently reduces the proportion of inactivated exon-containing transcripts (219 bp) and increases activated transcripts (97 bp) that exclude exons.

[0440] KRAS OncoSkip induces secreted expression of the CD3xGD2-HDD dimart in cells transfected with the CD3xGD2-HDD TransSkip AAV vector.

[0441] The supernatant was collected from transfused 293 T cells and tested for T cell binding (interference with fluorescently labeled anti-CD3 antibody). As shown in Figure 35, the gray lines in the upper panel represent unstained T(Jurkat) cells, and the dark gray lines in the upper panel represent T cells fully stained with anti-CD3 antibody. As a positive control, the supernatant from cells transfused with constitutively expressed CD3xGD2-HDD TransJoin#1011 competed almost completely with anti-CD3 staining. The supernatant from cells transfused with CD3xGD2-HDD TransSkip#1042 showed intermediate competition consistent with some "leakage" of exon-skipped dimart mRNA, which was further induced with either OncoSkip morpholino (KTS1, KTS2).

[0442] Exon skipping of CD3xGD2-HDD TransSkip using KRAS OncoSkip is an on-target effect.

[0443] Exon skipping induced by the targeted antisense morpholino KTS2 was compared to morpholino containing the same bases but with the sequence reversed (Figure 36). KTS2 induced exon skipping to nearly 100% of transcripts (97 bp), while the reversed control morpholino was ineffective compared to the Endoporter-only (carrier for morpholino) control.

[0444] The induction of CD3xGD2-HDD dimart expression, determined by T cell binding, is an on-target effect.

[0445] The supernatants from 293 T cells transfected with CD3xGD2-HDD TransJoin (positive control) and CD3xGD2-HDD TransSkip, incubated with or without various antisense morpholinos, were collected and subjected to human T(Jurkat) cell binding assays by flow cytometry (competition for binding of fluorescently labeled anti-CD3 antibody). See Figure 37, in which the gray lines in the upper panel represent unstained T cells, and the dark gray lines in the upper panel represent fully stained T cells. The line indicating #1101 CD3xGD2-HDD TransJoin is a nearly completely competitive signal obtained from constitutively expressed GD3 TransJoin. As previously mentioned, the supernatant from CD3xGD2-HDD TransSkip transfected cells showed slight competition at baseline (#1042 CD3xGD2-HDD TransSkip, no morpholino), which was not altered by the control morpholino (CD3xGD2-HDD TransSkip + "KTS2-Invert ctl"), but was induced to compete with more signaling by the on-target "OncoSkip" morpholino, KTS2 (CD3xGD2-HDD TransSkip + KTS2).

[0446] AAV genome maps of exemplary TransSkip splice variants were constructed and tested to reduce baseline TransSkip "leakage" while maintaining inducible exon skipping.

[0447] Splicing variants of TransSkip were manipulated to reduce baseline exon skipping observed with CD3xGD2-HDD TransSkip. To increase transgene expression, the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) downstream of the coding sequence was used. Due to AAV packaging size constraints, shorter promoters were needed to include the WPRE sequence; therefore, a new series of vectors were constructed using promoters derived from a short form of the human eukaryotic translation elongation factor 1α1 promoter (EFSp). Variants were constructed by altering specific base pairs in the U2 cofactor (U2AF) binding site located in the polypyrimidine track at the 3-prime terminus of the first intron (Ki1-5). See Figure 38.

[0448] The CD3xGD2-HDD TransSkip splice variant K3 removes the baseline but preserves inductive exon skipping.

[0449] 293T cells were transfused with a novel panel of five different CD3xGD2-HDD TransSkip constructs with and without KTS2 antisense "OncoSkip" morpholino, and compared to "Endo only" controls that had a morpholino carrier but no morpholino. mRNA transcripts were analyzed by reverse transcriptase RT-PCR to identify different phenotypes. As shown in Figure 39, variant K4 had a baseline exon skipping level similar to (or slightly higher than) K1, and its skipping inducibility was superior to K1. Variants K2, K3, and K5 did not effectively show baseline skipping. Of these three, variant K3 was the most capable of inducing exon skipping.

[0450] The CD3xGD2-HDD TransSkip variant K3 does not show baseline dimart production, but is most inducible by KRAS OncoSkip.

[0451] Using a T(Jurkat) cell binding assay, a panel of CD3xGD2-HDD TransJoin splice variants was tested for the production of secreted CD3xGD2-HDD dimart expression with or without KRAS KTS2 OncoSkip antisense morpholino (far right). As shown in Figure 40, in each of the right panels, the gray lines represent unstained T cells, the dark gray represents fully stained T cells, the blue represents constitutively expressed CD3xGD2-HDD TransJoin, and the green represents each CD3xGD2-HDD TransSkip without OncoSkip ("Endo only"). Sequences show the polypyrimidine U2AF binding site with the manipulated gray base pair variant (underlined and italicized) compared to the wild-type KRAS intron sequence (K1). The upper band in the RT-PCR gel is the transcript containing the exon, and the lower band is the transcript with the skipped exon. Variants K1 and K4 show some detectable baseline exon skipping and significant baseline dimart expression by RT-PCR (green, far right), whereas variants K2, K3, and K5 all show no baseline exon skipping by RT-PCR and no dimart expression due to binding competition (green, far right). All three of these variants show small amounts of inducible exon skipping by RT-PCR expression in the presence of the KRAS antisense morpholino OncoSkip KTS2 and show varying degrees of dose-dependent dimart expression in the presence of KRAS OncoSkip (light purple and dark purple represent low and high concentrations, respectively). Variant K3 appeared to be the most inducible, so K3 was selected as a lead construct for further study.

[0452] OncoSkip-mediated induction of dimart expression from CD3xGD2-HDD TransSkip variants K3 and K5 is an on-target effect.

[0453] RT-PCR and T(Jurkat) binding assays were repeated using CD3xGD2-HDD TransSkip variants K2, K3, and K5, with "inverted KTS2" antisense morpholino included as a control. See Figure 41. Inverted KTS2 contains the same nucleotide bases as KTS2 except that the order is reversed. Inverted KTS2 failed to induce exon skipping in both K3 and K5 (lower band on the gel), while the correct KTS2 sequence induced exon skipping in both K3 and K5 (neither of the K2 variants induced exon skipping). In the T cell binding assay for dimart expression (far right panel), gray represents unstained T cells, dark gray represents fully stained T cells, blue represents constitutively expressed CD3xGD2-HDD TransJoin, purple represents cells with KRAS OncoSkip KTS2 (lighter colors indicate lower levels, darker colors indicate higher levels), and yellow represents the reverse KTS2 control. The dimart protein assay is consistent with RT-PCR; none of the morpholino assays induced dimart expression from the K2 variant, only KTS2 OncoSkip induced dimart expression from the K3 and K5 variants, while the reverse control did not.

[0454] The secreted dimart induced by OncoSkip from the AAV CD3xGD2-HDD TransSkip vector is functional in mediating T cell killing in neuroblastoma cells.

[0455] Cytotoxicity of human T cells against GDS2+SK-N-Be(2) neuroblastoma cells was tested with and without KRAS OncoSkip KTS2, using supernatant from 293 T cells transfected with various AAV CD3xGD2-HDD TransSkip variants (Figure 42). A 10:1 T cell-to-target cell ratio was used. Cells were assayed for viability after 48 hours in co-culture. Results were normalized to supernatant from non-transfected cells. CD3xGD2-HDD TransSkip variants K1 and K4 showed cytotoxicity in the absence of KRAS OncoSkip KTS2, consistent with baseline exon skipping, and showed further inducible cytotoxicity with the use of K4. CD3xGD2-HDD TransSkip variant K2 showed neither baseline nor inducible cytotoxicity, consistent with its known efficient splicing and exon transduction. In contrast, CD3xGD2-HDD TransSkip variants K3 and K5 did not show baseline effects, but did show inducible cytotoxicity, and the K3 variant was dose-dependent.

[0456] Transgene exon skipping in cells infected with the AAV CD3xGD2-HDD TransSkip variant K3 is induced and on-target by KRAS OncoSkip.

[0457] Exon skipping in association with AAV virus infection was investigated to determine whether it reflected what had been observed in other studies with AAV plasmid translocation. CD3xGD2-HDD TransSkip variants K1 and K3 were packaged in AAV8, and exon translocation ("inactivation") and elimination ("activation") were analyzed by RT-PCR 48 hours after AAV infection of 293T cells. Cells were incubated with or without antisense morpholino KRAS OncoSkip KTS2 or with an inverse control ("InvtKTS2 Ctl") ("Endo only"). As shown in Figure 43, the AAV GD2 K1 variant exhibited exon skipping at baseline by vector plasmid, which was further induced by KRAS OncoSkip KTS2 but not by the control. In contrast, exon skipping was not observed at baseline with the K3 variant, but it was observed to be induced with OncoSkip KTS2 (both alone and in complex with the carrier "Vivo-KTS2"). Conversely, exon skipping was not induced at baseline with the control morpholino.

[0458] AAV genome map of CD19xCD3 TransSkip splice variants.

[0459] Based on findings from the CD3xGD2-HDD TransSkip study, where variant K3 showed a lower baseline compared to K1 but still demonstrated inducible dimart expression, we constructed K1 and K3 intron variants inserted into the CD19xCD3 dimart transgene. Similar to the GD2 series, a downstream WPRE of the coding sequence was used to increase transgene expression, requiring the use of a shorter promoter, EFSp. Ki, a sequence derived from a portion of the KRAS intron. STOP, exon 2 from KRAS mutated to include a stop codon in all three reading frames. CD19xCD3 For illustrative examples of TransSkip structures, see Figures 44A and 44B.

[0460] Figure 44C shows an illustration of the CD19 dimart interacting with cancer cells and T cells. The CD19 dimart is produced by cells containing CD19 TransSkip. When administered to a subject, for example, intravenously, AAV TransSkip (e.g., AAV CD19 TransSkip as shown in this figure) enters normal cells such as liver or muscle cells, but does not express the polypeptide because the exons containing introns and stop codons are inserted into the normal coding sequence of the transgene. In the presence of an antisense polynucleotide that induces exon skipping (e.g., morpholino antisense oligonucleotide), the mRNA transcript treated with the antisense oligonucleotide contains the complete transgene that is not interrupted by the STOP exon. Under these circumstances, the polypeptide is synthesized and secreted, and the secretory signal peptide is cleaved during secretion, leaving an active dimart that binds cancer cells (Ca) at one end and T immune cells at the other end.

[0461] OncoSkip morpholino KTS1 and KTS2 induce on-target exon skipping of CD19xCD3 TransSkip K1.

[0462] As shown in Figure 45, 293T cells were transtransfected with an AAV vector containing CD19xCD3 TransJoin (positive control, #1325) and CD19xCD3 TransSkip K1 (#1098) with or without co-incubation with a control morpholino (lane #3) or two different KRAS OncoSkip morpholinos (lanes 1 and 2) (lane #4). CD19xCD3 TransSkip K1 showed some baseline exon skipping (presence of lower “activation” bands in lanes 3 and 4), consistent with our findings with the corresponding construct for CD3xGD2-HDD TransSkip. These results demonstrate that the engineered TransSkip design functions similarly with multiple different transgenes.

[0463] KRAS OncoSkip induces secreted expression of the CD19xCD3 dimart in cells transfused with the CD19xCD3 TransSkip K1 AAV vector.

[0464] The supernatant was collected from transfused 293 T cells and tested for T cell binding (interference with fluorescently labeled anti-CD3 antibody). As shown in Figure 46, the gray lines in the upper panel represent unstained T(Jurkat) cells, and the dark gray lines in the upper panel represent T cells fully stained with anti-CD3 antibody. As a positive control, the supernatant from cells transfused with constitutively expressed CD19xCD3 TransJoin #1325 competed for anti-CD3 staining (#1325). The supernatant from cells transfused with CD19xCD3 TransSkip #1098 in the presence of a morpholino control showed some baseline competition (KTS2 reverse ctl) consistent with "leaking" of exon-skipped dimart mRNA, which was further induced by either OncoSkip morpholino (KTS1; KTS2) to levels achieved by constitutive CD19xCD3 TransJoin.

[0465] The CD19xCD3 TransSkip splice variant K3 removes the baseline but preserves inductive exon skipping.

[0466] As shown in Figure 47, 293 T cells were transfused with K1 and K3 CD19xCD3 TransSkip constructs with and without KTS2 antisense "OncoSkip" morpholino or control morpholino ("InvtKTS2 Ctl") and compared to an "Endo only" control that had a morpholino carrier but no morpholino. mRNA transcripts were analyzed by reverse transcriptase RT-PCR. Consistent with the corresponding CD3xGD2-HDD TransJoin construct, variant K1 showed baseline exon skipping. In contrast, variant K3 did not show skipping in baseline skipping ("Endo only") or in the morpholino control. With KTS2 OncoSkip containing the K3(#1168) variant, skipping was observed and confirmed by analyzing protein expression via a T cell binding assay.

[0467] The induction of CD19xCD3 dimart expression from CD19xCD3 TransSkip K3, determined by T cell binding, is an on-target effect.

[0468] Supernatants were collected from 293 T cells transfected with CD3xGD2-HDD TransJoin (positive control) and CD19xCD3 TransSkip, incubated with or without various antisense morpholinos, and human T(Jurkat) cell binding assays were performed by flow cytometry (competition for binding of fluorescently labeled anti-CD3 antibody). As shown in Figure 48, in each of the upper panels, gray represents unstained T cells, dark gray represents fully stained T cells, pink represents fully stained T cells in the presence of supernatant from untransfected 293 T cells, and blue represents signals competed for by supernatant from cells transfected with constitutively expressed CD19xCD3 TransJoin#1073. All supernatants derived from CD19xCD3 TransSkip K1#11166 showed high expression comparable to that of the positive control CD19xCD3 TransJoin at baseline and with control morpholino, demonstrating that this construct is not suitable for regulating gene expression. In contrast, consistent with our experience with CD3xGD2-HDD TransSkip, the CD19xCD3 TransSkip variant K3#1168 did not show baseline expression (green) or expression induced by control morpholino (light orange and dark orange, "IntCtl"), but showed dose-dependent expression induced by KRAS OncoSkip morpholino KTS2 (light purple and dark purple).

[0469] Induction of CD19xCD3 dimart expression from CD19xCD3 TransSkip K3 is repeatable.

[0470] Exon skipping assays and T cell binding assays were repeated to confirm the absence of leakage and the presence of inducible activity by K3 CD19xCD3 TransSkip, compared to K1 CD19xCD3 TransSkip (Figure 49). See also Figure 48.

[0471] Embodiment

[0472] Embodiment 1: A vector for use in gene therapy, comprising a first polynucleotide sequence encoding a first antibody or its antigen-binding fragment, and a second polynucleotide sequence encoding a second antibody or its antigen-binding fragment.

[0473] Embodiment 2: The vector according to Embodiment 1, wherein the vector is a recombinant vector.

[0474] Embodiment 3: The vector according to Embodiment 1 or 2, wherein the vector is a viral vector.

[0475] Embodiment 4: The vector according to any one of Embodiments 1 to 3, wherein the viral vector is a retroviral vector.

[0476] Embodiment 5: The vector according to any one of Embodiments 1 to 4, wherein the viral vector is an adenovirus vector, an adeno-associated virus (AAV) vector, a lentivirus vector, a mouse leukemia virus ("MLV") vector, an Epstein-Barr virus ("EBV") vector, or a herpesvirus ("HSV") vector.

[0477] Embodiment 6: The vector according to any one of Embodiments 1 to 5, wherein the AAV vector is AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV PHP.B, AAVrh74, or AAV-DJ vector.

[0478] Embodiment 7: The vector according to Embodiment 6, wherein the AAV vector is AAVrh74 (GenBank accession number LP899424.1).

[0479] Embodiment 8: A vector according to any one of Embodiments 1 to 7, wherein a first antibody or its antigen-binding fragment specifically binds to an activating antigen on an immune effector cell, and a second antibody or its antigen-binding fragment binds to a tumor antigen.

[0480] Embodiment 9: A vector according to any one of Embodiments 1 to 7, wherein a first antibody or its antigen-binding fragment specifically binds to a tumor antigen, and a second antibody or its antigen-binding fragment binds to an activating antigen on an immune effector cell.

[0481] Embodiment 10: The vector according to any one of Embodiments 1 to 9, further comprising a third polynucleotide sequence encoding a third antibody or an antigen-binding fragment thereof, wherein the third antibody or the antigen-binding fragment binds to an activating antigen or tumor antigen on an immune effector cell.

[0482] Embodiment 11: The vector according to any one of Embodiments 8 to 10, wherein the immune effector cells include dendritic cells, natural killer ("NK") cells, macrophages, T cells, or B cells.

[0483] Embodiment 12: The vector according to any one of Embodiments 8 to 11, wherein the immune effector cells are T cells or NK cells.

[0484] Embodiment 13: A vector according to any one of Embodiments 8 to 12, wherein the activating antigen on immunoeffector cells includes CD3, CD2, CD4, CD8, CD19, LFA1, CD45, NKG2D, NKp44, NKp46, NKp30, DNAM, B7-H3, CD20, CD22, or a combination thereof.

[0485] Embodiment 14: A vector according to any one of Embodiments 8 to 13, wherein the tumor antigen comprises one or more of the following: ephrin type A receptor 2 (EphA2), interleukin (IL)-13r alpha 2, EGFR VIII, PSMA, EpCAM, GD3, fucosyl GM1, PSCA, PLAC1, sarcoma breakpoint, Wilms tumor 1, alpha-fetoprotein (AFP), carcinoembryonic antigen (CEA), CA-125, MUC-1, epithelial tumor antigen (ETA), tyrosinase, melanoma-associated antigen (MAGE), hematologic differentiation antigen, surface glycoprotein, ganglioside (GM2), growth factor receptor, stromal antigen, vascular antigen, receptor tyrosine kinase-like orphan receptor 1 (ROR1), mesothelin, CD38, CD123, human epidermal growth factor receptor 2 (HER2), B cell maturation antigen (BCMA), fibroblast-activating protein (FAP) alpha, or a combination thereof.

[0486] Embodiment 15: A vector according to any one of Embodiments 1 to 14, wherein a first antibody or its antigen-binding fragment and a second antibody or its antigen-binding fragment form a dimart.

[0487] Embodiment 16: The vector according to Embodiment 15, wherein the dimart is a bispecific antibody.

[0488] Embodiment 17: The vector according to Embodiment 15, wherein the dimart is a triply specific antibody.

[0489] Embodiment 18: The vector according to Embodiment 15 or 16, wherein the bispecific antibody contains a polypeptide sequence that is at least 95% identical to either SEQ ID NO: 13 or 15.

[0490] Embodiment 19: The vector according to Embodiment 15 or 17, wherein the triplicate antibody contains a polypeptide sequence that is at least 95% identical to SEQ ID NO: 11.

[0491] Embodiment 20: The vector according to any one of Embodiments 1 to 19, wherein the vector further comprises a polynucleotide sequence encoding a secreted peptide.

[0492] Embodiment 21: The vector according to Embodiment 20, wherein the secreted peptide comprises a secretion consensus sequence.

[0493] Embodiment 22: The vector according to Embodiment 20 or 21, wherein the secretion consensus sequence has at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 51.

[0494] Embodiment 23: The vector according to Embodiment 20 or 21, wherein the secretion consensus sequence consists of Sequence ID No. 51.

[0495] Embodiment 24: The vector according to any one of Embodiments 20 to 23, wherein the secretion consensus sequence is encoded by a polynucleotide or its equivalent containing SEQ ID NO: 52.

[0496] Embodiment 25: The vector according to any one of Embodiments 20 to 24, wherein the secretory consensus sequence further comprises 1, 2, 3, 4 or more residues at the C-terminus of the sequence.

[0497] Embodiment 26: The vector according to any one of Embodiments 20 to 25, wherein the secretory consensus sequence further comprises 1, 2, 3, 4 or more Ala residues at the C-terminus of the sequence.

[0498] Embodiment 27: The vector according to any one of Embodiments 20 to 26, wherein the secretory consensus sequence further comprises one, two, or three Ala residues at the C-terminus of the sequence.

[0499] Embodiment 28: The vector according to any one of Embodiments 20 to 27, wherein the secretory consensus sequence further comprises two Ala residues at the C-terminus of the sequence.

[0500] Embodiment 29: The vector according to Embodiment 28, wherein the secretion consensus sequence contains at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 55, or consists of SEQ ID NO: 55.

[0501] Embodiment 30: The vector according to Embodiment 28 or 29, wherein the secretion consensus sequence is encoded by a polynucleotide or its equivalent containing SEQ ID NO: 56.

[0502] Embodiment 31: The vector according to any one of Embodiments 20 to 30, wherein the secretory consensus sequence further comprises one Ala residue at the C-terminus of the sequence.

[0503] Embodiment 32: The vector according to Embodiment 31, wherein the secretion consensus sequence contains at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 53, or consists of SEQ ID NO: 53.

[0504] Embodiment 33: The vector according to Embodiment 31 or 32, wherein the secretion consensus sequence is encoded by a polynucleotide or its equivalent containing SEQ ID NO: 54.

[0505] Embodiment 34: The vector according to any one of Embodiments 1 to 33, wherein the secretion consensus sequence modulates the expression and / or secretion of the dimart.

[0506] Embodiment 35: The vector according to any one of Embodiments 1 to 34, wherein the secretion consensus sequence enhances the expression and / or secretion of the dimart.

[0507] Embodiment 36: The vector according to any one of Embodiments 1 to 35, wherein the vector further comprises a polynucleotide sequence encoding a dimerization domain.

[0508] Embodiment 37: The vector according to Embodiment 36, wherein the dimerization domain comprises a dimerization domain of human hepatocyte nuclear factor 1α (HNF1α).

[0509] Embodiment 38: The vector according to Embodiment 37, wherein the dimerization domain of HNF1α comprises a polypeptide sequence having at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 47.

[0510] Embodiment 39: The vector according to any one of Embodiments 1 to 38, wherein the vector further comprises a promoter.

[0511] Embodiment 40: The vector according to Embodiment 39, wherein the promoter is a constitutive promoter.

[0512] Embodiment 41: The vector according to Embodiment 39 or 40, wherein the promoter is a tissue-specific promoter.

[0513] Embodiment 42: A vector according to any one of Embodiments 39 to 41, wherein the promoter comprises a Rous sarcoma virus (RSV) LTR promoter, a cytomegalovirus (CMV) promoter, an SV40 promoter, a dihydrofolate reductase promoter, a β-actin promoter, a phosphoglycerol kinase (PGK) promoter, a U6 promoter, an EF1 alpha truncated (EFS) promoter, a phosphoglycerate kinase (PGK) promoter, a ubiquitin C (UbiC) promoter, an alpha-1-antitrypsin promoter, a splenic focal virus (SFFV) promoter, or a chicken β-actin (CBA) promoter.

[0514] Embodiment 43: The vector according to any one of Embodiments 39 to 42, wherein the promoter is an EFS or equivalent containing Sequence ID No. 49 as optional.

[0515] Embodiment 44: The vector according to any one of Embodiments 1 to 43, wherein the vector further includes an enhancer.

[0516] Embodiment 45: The vector according to Embodiment 44, wherein the enhancers are an RSV enhancer, a CMV enhancer, and an α-fetoprotein MERII enhancer.

[0517] Embodiment 46: The vector according to any one of Embodiments 1 to 45, wherein the vector further comprises one or more further modulating elements.

[0518] Embodiment 47: A vector according to any one of Embodiments 1 to 46, comprising a woodchuck hepatitis virus (WHP) post-transcriptional modifier element (WPRE), and optionally a modifier element comprising SEQ ID NO: 50 or its equivalent.

[0519] Embodiment 48: The vector according to any one of Embodiments 1 to 47, wherein the vector comprises a 5' terminal inversion sequence (ITR) and a 3'ITR.

[0520] Embodiment 49: The vector according to any one of Embodiments 1 to 48, wherein the vector comprises the sequence described in Sequence IDs 4, 6, 8, 12, 14, 16-23, 30-33, or 40-46.

[0521] Embodiment 50: The composition comprises the vector described in any one of Embodiments 1 to 49, a carrier, and optionally a pharmaceutically acceptable carrier.

[0522] Embodiment 51: The composition according to Embodiment 50, wherein the composition is formulated for systemic administration.

[0523] Embodiment 52: The composition according to Embodiment 50, wherein the composition is formulated for topical administration.

[0524] Embodiment 53: The composition according to any one of Embodiments 50 to 52, wherein the composition is formulated for parenteral administration.

[0525] Embodiment 54: A method for treating cancer in a subject requiring treatment for cancer, comprising administering to the subject an effective amount of a vector according to any one of Embodiments 1 to 49 or a pharmaceutical composition according to any one of Embodiments 50 to 53, wherein the vector expresses a therapeutic anti-cancer antibody or an antigen-binding fragment thereof.

[0526] Embodiment 55: The method according to Embodiment 54, further comprising administering an anticancer drug to the subject.

[0527] Embodiment 56: The method according to Embodiment 55, wherein the anticancer agent comprises an active substance selected from peptides, polypeptides, nucleic acid molecules, small molecules, viral particles, or combinations thereof.

[0528] Embodiment 57: The method according to Embodiment 56, wherein the virus particles are oncolytic HSV particles.

[0529] Embodiment 58: The method according to any one of Embodiments 54 to 57, wherein the subject is a mammal.

[0530] Embodiment 59: The method according to any one of Embodiments 54 to 58, wherein the subject is a human.

[0531] Embodiment 60: A method for producing a bispecific or triplicate antibody in cells, comprising contacting the cells with a vector described in any one of Embodiments 1 to 49.

[0532] Embodiment 61: The method according to Embodiment 60, wherein contact includes translocation, infection, transformation, electroporation, injection, microinjection, or a combination thereof.

[0533] Embodiment 62: The method according to Embodiment 60 or 61, wherein the cells include fibroblasts, skeletal cells, epithelial cells, muscle cells, nerve cells, endocrine cells, melanocytes, hematopoietic cells, or a combination thereof.

[0534] Embodiment 63: The method according to any one of Embodiments 60 to 62, wherein the bispecific antibody comprises a polypeptide sequence that is at least 95% identical to SEQ ID NO: 13 or 15.

[0535] Embodiment 64: The method according to any one of Embodiments 60 to 62, wherein the triplicate antibody contains a polypeptide sequence that is at least 95% identical to SEQ ID NO: 11.

[0536] Embodiment 65: The method according to any one of Embodiments 60 to 62, wherein the bispecific antibody is encoded by a polynucleotide sequence that is at least 95% identical to SEQ ID NOs. 14, 16, 22, 23, 30-33 or 40-46.

[0537] Embodiment 66: The method according to any one of Embodiments 60 to 62, wherein the triplicate antibody is encoded by a polynucleotide sequence that is at least 95% identical to SEQ ID NO: 12.

[0538] Embodiment 67: A kit comprising a vector according to any one of Embodiments 1 to 49 or a pharmaceutical composition according to any one of Embodiments 50 to 53.

[0539] Embodiment 68: The kit of Embodiment 67, further including instructional materials. Equal parts

[0540] While this disclosure has been described in relation to the embodiments described above, it should be understood that the foregoing description and examples are intended to illustrate, and not limit, the scope of this disclosure. Other aspects, advantages, and modifications that fall within the scope of this disclosure will be apparent to those skilled in the art.

[0541] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art. All nucleotide sequences provided herein are written in the 5' to 3' direction.

[0542] The embodiments described herein as exemplary may be successfully implemented in the absence of any one or more elements or limitations not specifically disclosed herein. Therefore, terms such as “comprising,” “including,” and “containing” should be read broadly and without limitation. Furthermore, the terms and expressions used herein are descriptive, not restrictive, and there is no intention in the use of such terms and expressions to exclude any equivalents of the shown and described features or any part thereof, and it is acknowledged that various modifications are possible within the scope of this disclosure.

[0543] Therefore, while this disclosure is specifically disclosed by particular embodiments and features that may be present as needed, it should be understood that modifications, improvements, and variations of the embodiments disclosed herein can be used by those skilled in the art, and that such modifications, improvements, and variations are considered to be within the scope of this disclosure. The materials, methods, and examples provided herein are representative of particular embodiments and are illustrative, and are not intended to be limitations on the scope of this disclosure.

[0544] The scoped nature of this disclosure is described broadly and comprehensively herein. Each of the narrower species and subgroups belonging to the general disclosure also forms part of this disclosure. This includes the comprehensive description of this disclosure by provisos or negative limitations that remove any subject matter from a genus, whether or not the deleted material is specifically cited herein.

[0545] Furthermore, if any feature or aspect of the present disclosure is described in terms of the Markush group, a person skilled in the art will recognize that embodiments of the present disclosure may also be described in terms of any individual component or subgroup of components of the Markush group. In certain embodiments, for example, the following items are provided: (Item 1) A polynucleotide or vector, (a) a first polynucleotide sequence comprising a first portion of an open reading frame encoding a first polypeptide; (b) a second polynucleotide sequence comprising the second portion of the open reading frame encoding the first polypeptide; (c) A third polynucleotide sequence encoding the second polypeptide; (d) a gene regulatory polynucleotide sequence located between the first polynucleotide and the second polynucleotide; A polynucleotide or vector containing a polynucleotide. (Item 2) The polynucleotide or vector according to item 1, wherein the gene regulatory polynucleotide sequence comprises a splice donor site, an upstream intron, an exon containing more than one stop codon sequence in each reading frame, a downstream intron, and a splice acceptor site. (Item 3) The polynucleotide or vector according to item 1 or 2, wherein the gene regulatory polynucleotide sequence comprises one or more polynucleotide sequences encoding antisense oligonucleotides, doxycycline, or riboswitches. (Item 4) The polynucleotide or vector according to any one of items 1 to 3, wherein the antisense oligonucleotide is a morpholino oligonucleotide. (Item 5) The polynucleotide or vector according to item 4, wherein the binding sequence to the morpholino oligonucleotide comprises a polynucleotide sequence that is at least 95% identical to sequence number 24 or 25. (Item 6) The polynucleotide or vector according to item 4, wherein the morpholino oligonucleotide contains a polynucleotide sequence that is at least 95% identical to SEQ ID NO: 27 or 28. (Item 7) The aforementioned stop codon, Oligonucleotides belonging to the group TAA, TAG, or TGA; The polynucleotide sequence TAAxTAGxTGAxTAGxTAAxTGAx(SEQ ID NO: 1) (where x is any nucleotide); or The polynucleotide sequence TAATTAGTTGATTAGTTAATTGAT (SEQ ID NO: 2) or its equivalent; A polynucleotide or vector as described in item 2, including the polynucleotides or vectors described in item 2. (Item 8) The polynucleotide or vector according to any one of items 1 to 7, wherein the gene regulatory polynucleotide contains a polynucleotide sequence that is at least 95% identical to SEQ ID NO: 21. (Item 9) A polynucleotide or vector according to any one of items 1 to 8, wherein the first polypeptide is a first antibody or its antigen-binding fragment, and the second polypeptide is a second antibody or its antigen-binding fragment. (Item 10) The polynucleotide or vector according to any one of items 1 to 9, wherein the first antibody or its antigen-binding fragment specifically binds to an activating antigen on an immune effector cell, and the second antibody or its antigen-binding fragment binds to a tumor antigen. (Item 11) A polynucleotide or vector according to any one of items 1 to 9, wherein the first antibody or its antigen-binding fragment specifically binds to a tumor antigen, and the second antibody or its antigen-binding fragment binds to an activating antigen on an immune effector cell. (Item 12) A polynucleotide or vector according to any one of items 1 to 11, further comprising a fourth polynucleotide sequence encoding a third antibody or its antigen-binding fragment, wherein the third antibody or the antigen-binding fragment binds to an activating antigen or tumor antigen on an immune effector cell. (Item 13) The aforementioned immune effector cells include dendritic cells, natural killer ("NK") cells, macrophages, T cells, B cells, or a combination thereof, as described in any one of items 10 to 12, the polynucleotide or vector. (Item 14) The polynucleotide or vector according to any one of items 10 to 12, wherein the immune effector cells are T cells or NK cells. (Item 15) The polynucleotide or vector according to any one of items 10 to 12, wherein the activating antigen on the immune effector cells comprises CD3, CD2, CD4, CD8, CD19, LFA1, CD45, NKG2D, NKp44, NKp46, NKp30, DNAM, B7-H3, CD20, CD22, or a combination thereof. (Item 16) The aforementioned tumor antigens include ephrin type A receptor 2 (EphA2), interleukin (IL)-13r alpha 2, EGFR VIII, PSMA, EpCAM, GD3, fucosyl GM1, PSCA, PLAC1, sarcoma breakpoint, Wilms tumor 1, alpha-fetoprotein (AFP), carcinoembryonic antigen (CEA), CA-125, MUC-1, epithelial tumor antigen (ETA), tyrosinase, melanoma-associated antigen (MAGE), blood differentiation antigen, surface glycoprotein, ganglioside (GM2), growth factor receptor, stromal antigen, vascular antigen, receptor tyrosine kinase-like orphan receptor 1 (ROR1), mesothelin, CD38, CD123, human epidermal growth factor receptor 2 (HER2), B cell maturation antigen (BCMA), and fibroblast. Polynucleotides or vectors as described in any one of items 10-12, comprising one or more of cellular activation protein (FAP) alpha or combinations thereof. (Item 17) A polynucleotide or vector according to any one of items 1 to 16, wherein the vector is a recombinant vector, optionally a viral vector, and the premRNA encoding the dimart can express the premRNA when it is in contact with an antisense oligonucleotide, optionally a morpholino oligonucleotide. (Item 18) The polynucleotide or vector described in item 17, wherein the dimart is a bispecific antibody. (Item 19) The polynucleotide or vector described in item 17, wherein the dimart is a triplicate antibody. (Item 20) The polynucleotide or vector according to item 18 or 19, wherein the bispecific antibody or the triplicate antibody comprises the first antibody or its antigen-binding fragment and the second antibody or its antigen-binding fragment. (Item 21) The polynucleotide or vector according to item 18, wherein the bispecific antibody contains a polypeptide sequence that is at least 95% identical to either SEQ ID NO: 13 or 15. (Item 22) A polynucleotide or vector according to any one of items 1 to 21, wherein the vector expresses the premRNA encoding a triplicate antibody when the premRNA is in contact with an antisense oligonucleotide, and optionally with a morpholino oligonucleotide. (Item 23) The polynucleotide or vector according to item 22, wherein the triplicate antibody comprises the first antibody or its antigen-binding fragment, the second antibody or its antigen-binding fragment, and the third antibody or its antigen-binding fragment. (Item 24) The aforementioned triplicate antibody is at least at the same time as SEQ ID NO: 11. A polynucleotide or vector as described in item 22, containing at least 95% identical polypeptide sequences. (Item 25) A polynucleotide or vector according to any one of items 1 to 24, wherein the first antibody and the second antibody are each independently single-stranded variable fragments. (Item 26) A polynucleotide or vector as described in any one of items 1 to 25, further comprising a secretory peptide, and optionally a polynucleotide sequence encoding a secretory consensus sequence. (Item 27) A polynucleotide or vector as described in any one of items 1 to 26, further comprising a polynucleotide sequence encoding a dimerization domain. (Item 28) A polynucleotide or vector as described in any one of items 1 to 27, further comprising a 5' inverse sequence (ITR) and a 3' ITR. (Item 29) The polynucleotide or vector described in any one of items 1 to 28, wherein the vector contains the sequence described in SEQ ID NOs: 4, 6, 8, 12, 14, 16-23, 30-33, or 40-46. (Item 30) The polynucleotide or vector described in any one of items 1 to 29, wherein the vector is a recombinant viral vector comprising a skeletal vector selected from the group consisting of retroviral vectors, lentiviral vectors, mouse leukemia virus ("MLV") vectors, Epstein-Barr virus ("EBV") vectors, adenovirus vectors, herpesvirus ("HSV") vectors, or adeno-associated virus ("AAV") vectors. (Item 31) The vector is an AAV vector, a self-complementary AAV vector if necessary, and an AAVrh74 vector if necessary, a polynucleotide or vector as described in any one of items 1 to 30. (Item 32) The composition comprises a polynucleotide or vector as described in any one of items 1 to 31, a carrier, and optionally a pharmaceutically acceptable carrier. (Item 33) A method for treating cancer in a subject requiring treatment for cancer, comprising administering an effective amount of a recombinant polynucleotide or vector described in any one of items 1 to 31 or a pharmaceutical composition described in item 32 to the subject, wherein the polynucleotide or vector expresses a therapeutic anti-cancer antibody or an antigen-binding fragment thereof. (Item 34) The method according to item 33, further comprising administering an effective amount of antisense oligonucleotide, and optionally morpholino oligonucleotide, to the subject. (Item 35) The method according to item 33 or 34, further comprising administering an anticancer agent to the subject. (Item 36) The method according to item 35, wherein the anticancer agent comprises an active substance selected from peptides, polypeptides, nucleic acid molecules, small molecules, viral particles, or combinations thereof. (Item 37) The method according to item 36, wherein the virus particles are oncolytic HSV particles. (Item 38) The method according to any one of items 33 to 37, wherein the subject is a mammal. (Item 39) The method described in any one of items 33 to 38, wherein the subject is a human. (Item 40) A method for producing a bispecific or triplicate antibody in cells, comprising contacting cells containing a vector described in any one of items 1 to 31 with an effective amount of antisense oligonucleotide, optionally morpholino oligonucleotide. (Item 41) The method according to item 40, wherein the morpholino oligonucleotide has a sequence that is at least 95% identical to that of a sterically pure polynucleotide. (Item 42) The method according to item 40, wherein the vector is introduced into the cells by translocation, infection, transformation, electroporation, injection, microinjection, or a combination thereof. (Item 43) The method according to any one of items 40 to 42, wherein the cells include fibroblasts, skeletal cells, epithelial cells, muscle cells, nerve cells, endocrine cells, melanocytes, blood cells, or a combination thereof. (Item 44) The method according to any one of items 40 to 43, wherein the bispecific antibody contains a polypeptide sequence that is at least 95% identical to SEQ ID NO: 13 or 15. (Item 45) The method according to any one of items 40 to 44, wherein the triplicate antibody contains a polypeptide sequence that is at least 95% identical to SEQ ID NO: 11. (Item 46) The method according to any one of items 40-43, wherein the bispecific antibody is encoded by a polynucleotide sequence that is at least 95% identical to SEQ ID NOs. 14, 16, 22, 23, 30-33, or 40-46. (Item 47) The method according to any one of items 40 to 44, wherein the triplicate antibody is encoded by a polynucleotide sequence that is at least 95% identical to SEQ ID NO: 12. (Item 48) A kit comprising a polynucleotide or vector as described in any one of items 1 to 31, or a pharmaceutical composition as described in item 32. (Item 49) The kit described in item 48, including further instruction materials.

Claims

[Claim 1] The object, method, or system described herein and in the drawings.