In vivo homologous recombination repair in cardiac, skeletal muscle, and muscle stem cells

Abstract

Providing in vivo homologous recombination repair in cardiac, skeletal muscle, and muscle stem cells. [Solution] A method for genome modification of skeletal muscle and cardiac muscle is disclosed, using sequence-targeted nucleases and donor sequences delivered by a virus. Some aspects of the present invention relate to a method for modifying the genome of muscle progenitor cells in vivo (e.g., in the muscle progenitor niche), the method comprising contacting muscle cells with one or more viruses, the one or more viruses transducing nucleic acid sequences encoding sequence-targeted nucleases in the muscle progenitor cells, transducing a donor template in the muscle progenitor cells, and the modification comprising insertion of nucleotide sequences corresponding to the nucleotide sequences of the donor template.

Description

[Technical Field]

[0001] Related applications This application claims the interests of U.S. Provisional Patent Application No. 62 / 666,685, filed 3 May 2018, the entirety of which is incorporated herein by reference. [Background technology]

[0002] Sequence-targeted nucleases such as CRISPR / Cas9 provide high-performance tools for editing the mammalian genome by participating in the cellular mechanisms of DNA double-strand break (DSB) repair. Non-homologous end joining (NHEJ) and homologous recombination repair (HDR) are the primary pathways that cells use to repair nuclease-generated DSBs and prevent genomic damage and cell death. While NHEJ is active throughout the cell cycle and in non-dividing cells, this error-prone pathway leads to a wide range of sequence results due to highly unpredictable nucleotide insertions and deletions.

[0003] In contrast, while HDR offers the unique ability to introduce entirely new sequence elements in addition to more precise gene editing results, HDR is generally considered inefficient in postmittal organs and requires homologous DNA present in either endogenous chromosomes or exogenous templates. Recent studies have investigated the use of CRISPR-induced HDR in cultured cells and fertilized eggs, and via local delivery to specific tissues, but the possibility of achieving in vivo multi-organ HDR in postnatal mammals has not been tested. In addition, it remains to be explored whether in vivo HDR targeting can be achieved in regenerating stem cells, which provide a storage site for edited cells to support ongoing tissue turnover and repair. [Overview of the project] [Means for solving the problem]

[0004] To our surprise and unexpectedly, we have found that postnatal cardiomyocytes, skeletal muscle cells, and muscle stem cells undergo homology-directed recombination (HDR, also known as homologous recombination) at different developmental stages in mice. This provides an unexpected opportunity for precise targeted gene substitution by HDR in skeletal muscle and cardiomyocytes, both postmittal tissues that are widely considered unreachable by this approach. To our knowledge, this data provides the first demonstration of significant in vivo HDR editing in postnatal heart by systemic AAV delivery of CRISPR / Cas9, demonstrating a substantial improvement over previously reported HDR editing rates achievable in skeletal muscle by localized intramuscular delivery. The invention described herein also provides the first demonstration of successful HDR editing in tissue stem cells within the cell's natural niche, thereby enabling unparalleled therapeutic and experimental manipulation of stem cell genomes without the need to isolate, grow, or transplant these rare cells. Ultimately, the ability to irreversibly and permanently imprint precise genome modifications into neonatal mammalian hearts and postnatal mammalian skeletal muscle satellite cells opens exciting new avenues for future therapeutic interventions for many currently refractory cardiac and muscular diseases, including Duchenne muscular dystrophy (DMD).

[0005] Some aspects of the present invention relate to a method for modifying the genome of muscle progenitor cells in vivo (e.g., in the muscle progenitor niche), the method comprising contacting muscle cells with one or more viruses, the one or more viruses transducing nucleic acid sequences encoding sequence-targeted nucleases into the muscle progenitor cells, transducing a donor template into the muscle progenitor cells, and the modification comprising insertion of nucleotide sequences corresponding to the nucleotide sequences of the donor template.

[0006] In some embodiments, one or more viruses comprise a first virus that transduces a nucleic acid sequence encoding a sequence-targeted nuclease and a donor template. In some embodiments, one or more viruses comprise a first virus that transduces a nucleic acid sequence encoding a sequence-targeted nuclease and a second virus that transduces a donor template. In some embodiments, one or more viruses comprise a first virus that transduces a nucleic acid sequence encoding a sequence-targeted nuclease, and a second virus that transduces a donor template and one or more gRNAs (e.g., one or two). In some embodiments, the sequence-targeted nuclease is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), a Cas nuclease (e.g., Cas9 nuclease), or a functional fragment thereof.

[0007] In some embodiments, the nucleic acid sequence encoding a sequence-targeted nuclease is transduced with a muscle progenitor cell-specific promoter, a constitutive promoter, or a ubiquitous promoter. In some embodiments, the donor template, and optionally one or more nucleic acid sequences encoding gRNAs, are transduced with a U6 or H1 promoter. In some embodiments, the muscle progenitor cells are muscle stem cells.

[0008] In some embodiments, at least 1% of the muscle progenitor cells in the subject are modified to include an insertion of a nucleotide sequence corresponding to the nucleotide sequence of the donor template. In some embodiments, the modification is of one allele. In some embodiments, the modification is of both alleles. In some embodiments, the subject (e.g., human or mouse) is not an infant, or a young person, or under 30 years of age.

[0009] In some embodiments, the virus is AAV serotype 6, 8, 9, 10, or Anc80. In some embodiments, the virus is administered systemically to the subject, or the virus is administered by intramuscular injection.

[0010] Some aspects of this disclosure relate to muscle fibers containing nuclei (e.g., myonuclei) having genomes modified by the methods disclosed herein.

[0011] Some aspects of this disclosure relate to methods for modifying the genome of cardiac cells in vivo in subjects, the methods comprising contacting cardiac cells with one or more viruses, the one or more viruses transducing nucleic acid sequences encoding sequence-targeted nucleases into the cardiac cells, transducing a donor template into the cardiac cells, the modification comprising insertion of nucleotide sequences corresponding to nucleotide sequences of the donor template, the cardiac cells being DNA-synthesizing cardiac cells or replicating cardiac cells.

[0012] In some embodiments, cardiac cells are selected from the group consisting of mammalian postmitotic cardiomyocytes, mammalian postmitotic cardiomyocytes capable of DNA synthesis without division / proliferation, human postmitotic cardiomyocytes, human postmitotic cardiomyocytes capable of DNA synthesis without division / proliferation, cardiomyocyte progenitor cells, proliferating mesenchymal cardiac cells, proliferating endothelial cardiac cells, and cardiomyocyte progenitor cells.

[0013] In some embodiments, the subjects (e.g., humans or mice) are infants, or young adults, or, in the case of humans, under 30 years of age. In some embodiments, one or more viruses comprise a first virus that transduces a nucleic acid sequence encoding a sequence-targeted nuclease and a donor template. In some embodiments, one or more viruses comprise a first virus that transduces a nucleic acid sequence encoding a sequence-targeted nuclease and a second virus that transduces a donor template. In some embodiments, one or more viruses comprise a first virus that transduces a nucleic acid sequence encoding a sequence-targeted nuclease, and a second virus that transduces a donor template and one or more gRNAs. In some embodiments, the sequence-targeted nuclease is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), a Cas nuclease (e.g., Cas9 nuclease), or a functional fragment thereof. In some embodiments, the nucleic acid sequence encoding the sequence-targeted nuclease is transduced with a heart-specific promoter, a ubiquitous promoter, or a non-specific promoter.

[0014] In some embodiments, the virus is AAV serotype 6, 8, 9, 10, or Anc80. In some embodiments, at least 1.6% of the cardiomyocytes in the subject are modified.

[0015] Some aspects of this disclosure relate to cardiac tissue, including cardiomyocytes, that have been modified by the methods disclosed herein.

[0016] Some aspects of this disclosure relate to methods for targeting specific striated muscle types for in vivo genomic modification in subjects by homologous recombination repair, the methods comprising systemic administration of one or more viruses, the one or more viruses transducing nucleic acid sequences encoding sequence-targeted nucleases into striated muscle cells, transducing a donor template into striated muscle cells, the modification comprising insertion of nucleotide sequences corresponding to the nucleotide sequences of the donor template, and due to the age of the subjects, the genomic modification occurs selectively in at least one striated muscle type. In some embodiments, the genome of muscle cells (e.g., progenitor muscle cells) is selectively modified. In some embodiments, the genome of cardiac cells (e.g., proliferating or DNA-synthesizing cardiac cells) is selectively modified.

[0017] The many other features and associated advantages of the present invention described above will be better understood by referring to the following detailed description of the invention.

[0018] This patent or application document includes at least one drawing made in color. A copy of this patent or patent application publication containing the color drawing will be provided by the Patent Office upon request and payment of the required fee. In certain embodiments, for example, the following items are provided: (Item 1) A method for genome modification of muscle progenitor cells in vivo in a subject, comprising contacting the muscle cells with one or more viruses, wherein the one or more viruses a. Transduction of a nucleic acid sequence encoding a sequence-targeted nuclease into the muscle progenitor cells, b. Transduction of the donor template into the muscle progenitor cells, The method wherein the modification includes the insertion of a nucleotide sequence corresponding to the nucleotide sequence of the donor template. (Item 2) The method according to item 1, wherein the one or more viruses include a first virus that transduces a nucleic acid sequence encoding a sequence-targeted nuclease and a donor template. (Item 3) The method according to item 1, wherein the one or more viruses include a first virus that transduces a nucleic acid sequence encoding a sequence-targeted nuclease and a second virus that transduces a donor template. (Item 4) The method according to item 1, wherein the one or more viruses include a first virus that transduces a nucleic acid sequence encoding a sequence-targeted nuclease, and a second virus that transduces a donor template and one or more gRNAs. (Item 5) The method according to items 1 to 4, wherein the sequence-targeted nuclease is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), a Cas nuclease, or a functional fragment or functional variant thereof. (Item 6) The method according to item 5, wherein the Cas nuclease is a Cas9 nuclease. (Item 7) The method according to items 1 to 6, wherein the nucleic acid sequence encoding a sequence-targeted nuclease is transduced by a muscle progenitor cell-specific promoter, a constitutive promoter, or a ubiquitous promoter. (Item 8) The method according to items 1 to 7, wherein a donor template and, optionally, the nucleic acid sequence encoding one or more gRNAs are transduced with a U6 or H1 promoter. (Item 9) The method according to items 1 to 8, wherein the muscle progenitor cells are muscle stem cells. (Item 10) The method according to items 1-9, wherein at least 1% of the muscle progenitor cells in the subject are modified to include an insertion of a nucleotide sequence corresponding to the nucleotide sequence of the donor template. (Item 11) The method according to items 1 to 9, wherein at least 40% of the muscle progenitor cells in the subject are modified to include an insertion of a nucleotide sequence corresponding to the nucleotide sequence of the donor template. (Item 12) The method according to items 1 to 11, wherein the virus is AAV serotype 6, 8, 9, 10 or Anc80. (Item 13) The method described in items 1 to 12, wherein the subject is a young person. (Item 14) The method according to items 1 to 13, wherein the aforementioned virus is administered systemically to the subject. (Item 15) Muscle fibers containing myonuclei having genomes modified by the methods described in items 1-14. (Item 16) A method for in vivo genome modification of cardiac cells in a subject, comprising contacting the cardiac cells with one or more viruses, wherein the one or more viruses a. Transduction of a nucleic acid sequence encoding a sequence-targeted nuclease into the cardiac cells, b. Transduction of the donor template into the cardiac cells, The method wherein the modification includes the insertion of a nucleotide sequence corresponding to the nucleotide sequence of the donor template, and the cardiac cell is a DNA-synthesizing cardiac cell or a replicating cardiac cell. (Item 17) The method according to item 14, wherein the cardiac cells are selected from the group consisting of mammalian postmitotic cardiomyocytes capable of DNA synthesis without division / proliferation, human postmitotic cardiomyocytes capable of DNA synthesis without division / proliferation, cardiomyocyte progenitor cells, proliferating mesenchymal cardiac cells, proliferating endothelial cardiac cells, and cardiomyocyte progenitor cells. (Item 18) The method described in items 16-17, provided that the subject is an infant, a young person, or under 30 years of age. (Item 19) The method according to items 16-18, wherein the one or more viruses include a first virus that transduces a nucleic acid sequence encoding a sequence-targeted nuclease and a donor template. (Item 20) The method according to items 16-19, wherein the one or more viruses include a first virus that transduces a nucleic acid sequence encoding a sequence-targeted nuclease and a second virus that transduces a donor template. (Item 21) The method according to items 16-19, wherein the one or more viruses include a first virus that transduces a nucleic acid sequence encoding a sequence-targeted nuclease, and a second virus that transduces a donor template and one or more gRNAs. (Item 22) The method according to items 16-21, wherein the sequence-targeted nuclease is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), a Cas nuclease, or a functional fragment thereof. (Item 23) The method according to item 22, wherein the Cas nuclease is a Cas9 nuclease. (Item 24) The method according to items 16-23, wherein the nucleic acid sequence encoding a sequence-targeted nuclease is transduced with a heart-specific promoter, a ubiquitous promoter, or a non-specific promoter. (Item 25) The method according to items 16-24, wherein the virus is AAV serotype 6, 8, 9, 10 or Anc80. (Item 26) The method according to items 16-25, wherein at least 1.6% of the cardiomyocytes in the subject are modified. (Item 27) Cardiac tissue, including cardiomyocytes modified by the methods described in items 16-26. (Item 28) A method for targeting a specific striated muscle type for in vivo genome modification in a subject by homologous recombination repair, comprising systemic administration of one or more viruses, wherein the one or more viruses a. Transduction of nucleic acid sequences encoding sequence-targeted nucleases into rhabdomyostomy cells, b. Transduction of a donor template into rhabdomyostomy cells, The method wherein the modification includes the insertion of a nucleotide sequence corresponding to the nucleotide sequence of the donor template, and due to the age of the subject, the genome modification occurs selectively in at least one striated muscle type. (Item 29) The method according to item 28, wherein the genome of muscle cells or muscle progenitor cells is selectively modified. (Item 30) The method according to item 28, wherein the genome of cardiac cells or cardiac progenitor cells is selectively modified. (Item 31) The method described in items 28-30, wherein the subject is an infant, a young person, or an adult. [Brief explanation of the drawing]

[0019] [Figure 1A]Figures 1A–1J illustrate a GFP / BFP color-switch reporter system that enables identification and tracking of NHEJ and HDR-edited myoblasts. (Figure 1A) is a schematic diagram of the blue / green color-switch reporter for distinguishing HDR from inaccurate NHEJ. Inaccurate NHEJ interferes with GFP fluorescence, while HDR substitution allows a spectral shift from GFP to BFP, creating a BtgI restriction site for RFLP analysis. (Figure 1B) shows the AAV construct used for transfection and virus production: ITR, reverse terminal repeat sequence, U6, U6 promoter, CMV, CMV promoter, NLS, nuclear localization signal, pA: polyA. (Figure 1C) provides the experimental design. Skeletal muscle stem cells (satellite cells) were isolated from mice possessing a single CAG-GFP allele and transfected with the plasmid construct shown in (Figure 1B). Transfected cells were grown in culture and then sorted based on blue or green fluorescence for intramuscular transplantation into pre-injury recipient mice. (Figures 1D, 1E) are representative flow cytometry analyses of myoblasts transfected with gRNA-BFP template alone (Figure 1D, control) or myoblasts transfected with SaCas9 and gRNA-BFP template (Figure 1E, experiment). (Figures 1F, 1G) show the frequency (%) of CRISPR-HDR edited BFP+ myoblasts (Figure 1F) and CRISPR-NHEJ edited GFP- / BFP- myoblasts (Figure 1G) in control or experimental cultures. Individual data points are displayed superimposed with mean ± SD, representing N=3 independent transfections. **p<0.01, ***p<0.001, unpaired two-sided t-test, DF=4. (Figure 1H) shows that edited BFP+SMP retains electromyographic potential. GFP+ and BFP+ skeletal muscle progenitor cells were isolated by FACS, and GFP+ (bottom panel) or CRISPR / Cas9-HDR-edited BFP+ (top panel) stem cells were injected into the tibialis anterior muscle (TA) of mdx mice. The TA was then examined by fluorescence detection of BFP or GFP. Scale bar, 50 μm. Green: GFP, Blue: BFP, Red: Wheat germ agglutinin (WGA), White: TO-PRO-3. (Figure 1I) shows BtgI digestion of FACS-sorted transfected cells following PCR amplification at the GFP locus.Three distinct populations were identified: GFP+SMP (unedited), BFP+SMP (HDR), and GFP- / BFP-SMP (NHEJ). (Figure 1J) shows that the selected CRISPR / Cas9-HDR edited BFP+SMPs retained BFP expression after proliferation. BFP+SMPs were analyzed after 2 weeks of proliferation. [Figure 1B] Same as above. [Figure 1C] Same as above. [Figure 1D] Same as above. [Figure 1E] Same as above. [Figure 1F] Same as above. [Figure 1G] Same as above. [Figure 1H] Same as above. [Figure 1I] Same as above. [Figure 1J] Same as above. [Figure 2A]Figures 2A-2G illustrate that systemic AAV-CRISPR enables in vivo CRISPR-NHEJ and CRISPR-HDR in the liver, heart, and skeletal muscle of 3-week-old GFP+ / -mdx mice. Figure 2A shows the experimental design. Mdx mice possessing a single CAG-GFP allele were injected with either the GFPgRNA-BFP template alone (control) or AAV containing the AAV-GFPgRNA-BFP template and AAV-SaCas9 (dual CRISPR / Cas9 system). Organs were collected after 4 weeks for fluorescence and genomic analysis. Figures 2B, 2D, and 2F show representative fluorescence images of CRISPR-NHEJ edited (GFP- / BFP-) and CRISPR-HDR edited (BFP+) cells in the liver (Figure 2B), heart (Figure 2D), and tibialis anterior muscle (skeletal muscle, Figure 2F) after simultaneous systemic injection of AAV-GFPgRNA-BFP template and AAV-SaCas9. Scale bar, 50 μm. Green: GFP, Blue: BFP, Red: Wheat germ agglutinin (WGA), White: TO-PRO-3. Figures 2C, 2E, and 2G show the frequency (%) of BFP+ (HDR edited, left plot) or GFP- / BFP- (NHEJ edited, right plot) cells in the liver (Figure 2C), heart (Figure 2E), or tibialis anterior muscle (Figure 2G). Due to the highly multinucleated nature of this tissue, NHEJ editing cannot be quantified in skeletal muscle fibers (i.e., muscle fibers), which prevents the detection of green fluorescence disappearance unless almost all myonuclei are targeted. For simultaneous injection of AAV-gRNA template and AAV-SaCas9, N=4 mice (experimental AAV-HDR group), and for AAV-gRNA template injection alone, N=3 (AAV control group). Three fields of view were quantified for each mouse tissue to generate frequency data. [Figure 2B] Same as above. [Figure 2C] Same as above. [Figure 2D] Same as above. [Figure 2E] Same as above. [Figure 2F] Same as above. [Figure 2G] Same as above. [Figure 3A]Figures 3A–3D demonstrate that satellite cells can be targeted in vivo by CRISPR-HDR and retain the ability to fuse and form myotubes in vitro. (Figure 3A) shows representative flow cytometry analysis of skeletal muscle satellite cells from juvenile mdx mice injected intravenously with either the vehicle or AAV-GFPgRNA-BFP template alone, or with AAV-GFPgRNA-BFP template and AAV-SaCas9, to enable CRISPR-NHEJ and CRISPR-HDR. (Figures 3B, 3C) show the frequency (%) of CRISPR-HDR edited BFP+ satellite cells (Figure 3B) and CRISPR-NHEJ edited GFP- / BFP- satellite cells (Figure 3C). Individual data points are displayed overlaid with the mean ± SD. N=4 mice were injected with AAV-Cas9 and AAV-gRNA templates (experimental), N=3 mice were injected with AAV-gRNA templates only (control), and N=3 mice were injected with vehicle. *p<0.05, ns, not significant (p=0.999 in Figure 3B, p=0.7737 in Figure 3C), one-way ANOVA with Tukey's multiple comparison test, DF=7. Figure 3D shows representative fluorescence detection of myotubes differentiated from FACS-sorted in vivo AAV-HDR injected GFP+ (unedited), BFP+ (HDR), and GFP- / BFP- (NHEJ) satellite cells. Scale bar, 100um. Green: GFP, Blue: BFP, Red: Myosin heavy chain (MHC), White: TO-PRO-3. [Figure 3B] Same as above. [Figure 3C] Same as above. [Figure 3D] Same as above. [Figure 4A]Figures 4A–4F demonstrate that delivery of the color conversion system by AAV8 in P3 mice reveals tissue-dependent time limitations in in vivo CRISPR-HDR targeting. (Figure 4A) shows the experimental design. P3 offspring (wild-type and MDX) carrying a single CAG-GFP allele were injected with either GFPgRNA-BFP template alone (control) or AAV containing both AAV-GFPgRNA-BFP template and AAV-SaCas9. Organs were collected 4 weeks later for fluorescence and genomic analysis. Figures 4B, 4D, and 4F show representative fluorescence images of the detection of CRISPR-NHEJ edited (GFP- / BFP-) and CRISPR-HDR edited (BFP+) cells in the liver (Figure 4B), heart (Figure 4D), and tibialis anterior muscle (Figure 4F) of GFP+ / -;mdx mice after intraperitoneal injection of AAV-GFPgRNA-BFP template and AAV-SaCas9 (experimental) or AAV-GFPgRNA-BFP template alone (control). Scale bar, 50 μm. Green: GFP, Blue: BFP, Red: Wheat germ agglutinin (WGA), White: TO-PRO-3. Figures 4C and 4E show the frequency (%) of GFP- / BFP-(NHEJ) and BFP+(HDR) cells in the liver (Figure 4C) and heart (Figure 4E) of treated GFP;mdx and wild-type (CAG-GFP) mice. HDR editing was not detected in skeletal muscle, and NHEJ editing could not be quantified due to the high degree of multinucleation in this tissue. The experimental group consisted of N=5 (N=2 mdx, N=3 C57BL / 6J animals), and the control group consisted of N=3 (N=1 mdx, N=2 C57BL / 6J animals). [Figure 4B] Same as above. [Figure 4C] Same as above. [Figure 4D] Same as above. [Figure 4E] Same as above. [Figure 4F] Same as above. [Figure 5A]The in vitro testing of the components of the GFP / BFP color-switching reporter system is illustrated. (Figure 5A) shows a representative FACS plot demonstrating that GFP and BFP can be distinguished by flow cytometry. mdxTTF (without fluorescent protein) was transfected with either the CAG-GFP or CAG-BFP plasmid and analyzed by flow cytometry after 3 days. [Figure 5B] The in vitro testing of the components of the GFP / BFP color-switching reporter system is illustrated. (Figure 5B) shows the design of the color-switching substitution and GFP gRNA. A two-base substitution induces a spectral shift, creating a BtgI site for restriction fragment length polymorphism (RFLP) analysis. Three SaCas9-compatible gRNAs targeting GFP near the substitution site were selected. GFPgRNA2 cleaves at the site closest to the desired color-determining base, and recognition by this gRNA is invalidated by the HDR substitution, thereby preventing further Cas9 targeting of the BFP template and genomic HDR product. [Figure 5C] In vitro testing of the components of the GFP / BFP color-switching reporter system is illustrated. (Figure 5C) shows GFP disruption by GFPgRNA. GFP+ / -;mdxTTF was transfected with SaCas9 alone (control) or with SaCas9 and one of three gRNAs targeting GFP (see Figure 5B). All three gRNAs disrupt GFP expression. GFPgRNA2 was selected for use in subsequent experiments because it is close to the color-switching mutation. GFPgRNA2 is referred to as GFPgRNA or gRNA in this text. SSC, lateral scattering. [Figure 5D]The in vitro tests of the components of the GFP / BFP color switching reporter system are illustrated. (Figure 5D) shows GFP disruption and the absence of BFP expression in myoblasts transfected with SaCas9+GFPgRNA2 without the BFP template. GFP+ / -;mdx myoblasts were transfected with SaCas9+GFPgRNA2 with lipofectamine alone (lipo, control) or in the absence of the BFP template, and GFP and BFP expression were analyzed by flow cytometry. GFP- / BFP- (CRISPR-NHEJ edited) cells, rather than BFP+ cells, were present in cultures transfected with SaCas9 and gRNA, indicating that NHEJ alone could not induce the spectral shift from green to blue. [Figure 6A] The differentiation and sequencing of ex vivo CRISPR-NHEJ and HDR-edited myoblasts are illustrated. (Figure 6A) shows representative fluorescence images of myotubes differentiated from FACS-selected GFP+ (unedited), BFP+ (CRISPR-HDR edited), and GFP- / BFP- (CRISPR-NHEJ edited) myoblasts that were pre-transfected with SaCas9 and GFPgRNA-BFP templates. Scale bar, 100 μm. Green: GFP, Blue: BFP, Red: Myosin heavy chain (MHC). [Figure 6B] The differentiation and sequencing of ex vivo CRISPR-NHEJ and HDR-edited myoblasts are illustrated. (Figure 6B) shows restriction fragment length polymorphism (RFLP) analysis of genomic PCR products from FACS-selected cultured myoblasts. M, marker. [Figure 6C] Figure 6C illustrates the confirmation of differentiation and sequencing of ex vivo CRISPR-NHEJ and HDR-edited myoblasts. Sanger sequencing of genomic amplicons aligned to GFP and BFP reference sequences confirms HDR in selected BFP+ cells and NHEJ in selected GFP- / BFP- cells. [Figure 7]This diagram illustrates that systemic AAV-CRISPR enables in vivo CRISPR-NHEJ and CRISPR-HDR editing of tibialis anterior muscle fibers in juvenile mdx animals. Representative fluorescence images show the detection of CRISPR-NHEJ edited (GFP- / BFP-) and CRISPR-HDR edited (BFP+) cells in the tibialis anterior muscle of mice treated with AAV-control (GFP-gRNA-BFP template only) or AAV-experiment (gRNA template + SaCas9). Each image is a composite of 25 20x magnification images. Scale bar, 200 μm. Green: GFP, Blue: BFP, Red: Wheat germ agglutinin (WGA), White: TO-PRO-3. [Figure 8] The confirmation of CRISPR-NHEJ and HDR editing in skeletal muscle satellite cells in vivo by re-selection of GFP+, GFP- / BFP-, and BFP+ cells is illustrated. (Figure 8A) shows representative flow cytometry data illustrating the analysis of GFP and BFP expression in skeletal muscle satellite cells isolated from juvenile mdx mice pre-injected intravenously with only the vehicle AAV-GFPgRNA-BFP template or with the AAV-GFPgRNA-BFP template and AAV-SaCas9. The selection gates used to isolate GFP+ (unedited), GFP- / BFP- (NHEJ edited), and BFP+ (HDR edited) cells are shown. The selected populations were grown separately in culture for two weeks and then collected for re-analysis (shown in Figure 8B). (Figure 8B) shows representative flow cytometry analyses of GFP and BFP expression in cultured GFP- / BFP-, GFP+, and BFP+ cells pre-selected from AAV-HDR injected mice. [Figure 9]This diagram illustrates that systemic AAV-CRISPR enables in vivo CRISPR-NHEJ and CRISPR-HDR editing in neonatal C57BL / 6J animals. Representative fluorescence images of CRISPR-NHEJ-edited (GFP- / BFP-) and CRISPR-HDR-edited (BFP+) cells in the liver (shown in Figure 9A) and cardiomyocyte (shown in Figure 9B) after intraperitoneal injection of AAV-GFPgRNA-BFP template and AAV-SaCas9 (experimental) or AAV-GFPgRNA-BFP template (control) into neonatal GFP+ / - C57BL / 6J mice. Scale bar, 50 μm. Scale bar, 50 μm. Green: GFP, Blue: BFP, Red: Wheat germ agglutinin (WGA), White: TO-PRO-3. [Figure 10A] The validation of in vivo CRISPR-NHEJ and CRISPR-HDR editing in genomic PCR and next-generation sequencing is illustrated. (Figure 10A) shows a schematic diagram of the GFP / BFP transgene locus and primers used in genomic PCR. The forward primer binds upstream of the GFP / BFP start site on the genomic sequence, rather than to the template DNA, while the reverse primer binds downstream of the Cas9 cleavage site and color-switching substitution. This primer pair amplifies the transgene locus but not the template sequence (because the template does not have a forward primer binding sequence). [Figure 10B] The validation of genomic PCR and next-generation sequencing of in vivo CRISPR-NHEJ and CRISPR-HDR editing is illustrated. (Figure 10B) shows representative alignment sequences from genomic NGS analysis of in vivo CRISPR-NHEJ and CRISPR-HDR edited satellite cells, TA muscle, heart, and liver of P21 AAV-HDR injected GFP+ / -;mdx mice. * indicates a representative NHEJ sequence, and ** marks insertion sites due to inaccurate NHEJ. [Figure 10C]The validation of in vivo CRISPR-NHEJ and CRISPR-HDR editing by genomic PCR and next-generation sequencing is illustrated. (Figure 10C) shows the number of reads and allele frequencies (number of unedited, HDR-edited, or NHEJ-edited reads mapped to GFP / BFP sequences / total number of reads) of HDR and NHEJ-edited alleles detected in satellite cells selected from P21 GFP+ / -;mdx mice administered in vivo with AAV-HDR or AAV-control. BFP+ and GFP- / BFP- cells were selected from AAV-SaCas9 and AAV-gRNA-BFP template injection mice (AAV-HDR), and GFP+ cells were selected from AAV-gRNA-BFP template injection control mice (AAV-control). [Figure 11A] Figures 11A–11C illustrate that satellite cells of neonatal skeletal muscle are rarely targeted by systemic AAV-CRISPR-HDR. (Figure 11A) shows representative flow cytometry analysis of skeletal muscle satellite cells isolated from neonatal (P3)mdx and C57BL / 6 mice, either with only the AAV-GFPgRNA-BFP template as a control, or 4 weeks after intraperitoneal injection of the AAV-GFPgRNA-BFP template and AAV-SaCas9 to enable CRISPR-NHEJ and CRISPR-HDR. (Figures 11B, 11C) show the frequency (%) of CRISPR-HDR edited BFP+ satellite cells (Figure 11B) and CRISPR-NHEJ edited GFP- / BFP- satellite cells (Figure 11C). Each data point is displayed overlaid with the mean ± SD. N=2 for mdx mice injected with AAV-Cas9 and AAV-gRNA templates (experiment), N=3 for injected C57BL6 mice, N=1 for mdx mice injected with AAV-gRNA templates only (control), and N=2 for injected C57BL6 mice. *p<0.05, one-way ANOVA with Tukey's multiple comparison test, DF=4. [Figure 11B] Same as above. [Figure 11C] Same as above. [Figure 12-1] This study demonstrates that CRISPR-mediated editing reduces GFP fluorescence intensity in the liver, heart, and tibialis anterior muscle of mice treated at 3 days of age (P3) or 21 days of age (P21). [Figure 12-2] Same as above. [Figure 13-1] This study demonstrates that CRISPR-mediated editing results in a reduction of BFP fluorescence and GFP fluorescence intensity in the tibialis anterior muscle of P21 (21-day-old mice at treatment) injected with AAV-CRISPR. For each histogram, n=1400. Individual muscle fibers were circled as separate regions of interest in ImageJ, and the mean fluorescence intensity of each fiber was measured using the "Measure" function. Histograms were generated using Prism8. Medians were compared using the Mann-Whitney U test. [Figure 13-2] Same as above. [Figure 14] This shows that sublayer mononuclear cells in HDR-edited muscle are BFP+. Satellite cells are defined as sublayer mononuclear cells. [Modes for carrying out the invention]

[0020] Described herein are methods for precise targeted gene replacement by HDR in skeletal muscle and cardiac muscle, both postmittal tissues widely considered unreachable by this approach. Specifically, the inventors demonstrate significant improvements in the rate of HDR editing in postnatal heart and skeletal muscle by systemic AAV delivery of CRISPR / Cas9. The methods described herein also enable HDR editing in tissue stem cells within the cell's natural niche, thereby allowing targeted manipulation of stem cell genomes therapeutically and experimentally without the need to isolate, grow, or transplant these rare cells.

[0021] Methods for modifying the genome of muscle cells

[0022] Some aspects of this disclosure relate to methods for modifying the genome of muscle progenitor cells in vivo, the methods comprising contacting muscle cells with one or more viruses, the one or more viruses transducing nucleic acid sequences encoding sequence-targeted nucleases into the muscle progenitor cells, transducing a donor template into the muscle progenitor cells, and the modification comprising insertion of nucleotide sequences corresponding to the nucleotide sequences of the donor template (e.g., by homologous recombination with the donor sequence). Homologous recombination (HR)-mediated repair (also known as homologous recombination (HDR)) uses homologous donor DNA as a template for repairing double-strand DNA breaks. If the sequence of the donor DNA differs from the genome sequence, this process introduces a sequence change into the genome.

[0023] When used herein, the term “genome modification” encompasses homologous recombination additions of nucleotide sequences encoding regulatory sequences or gene products (i.e., insertions of nucleotide sequences corresponding to nucleotide sequences in a donor template). In some embodiments, modification includes homologous recombination substitution of a genomic region associated with a disease or condition (e.g., a gene mutation) with a non-pathological genomic region. For example, in some embodiments, modification includes substitution of a genomic region containing a mutation with a wild-type or non-mutant genomic region. In some embodiments, the mutation includes substitution or deletion mutations. In some embodiments, modification includes homologous recombination insertions of nucleotide sequences into the genome corresponding to the deletion portion of a deletion mutation. In some embodiments, genome modification includes homologous recombination insertions and / or substitutions of genomic sequences that regulate the expression, activity, or stability of a gene product. In some embodiments, genome modification includes modification of both alleles of the subject. In some embodiments, genome modification includes modification of one allele of the subject. In some embodiments, genome modification includes modification of one or more genes associated with a biological process. In some embodiments, the biological processes include epigenetic regulation or protein homeostasis (e.g., autophagy, ubiquitin-proteasome, heat shock response, antioxidant response, endoplasmic reticulum stress response).

[0024] As used herein, “subject” means human or animal (e.g., primates). Typically, animals are vertebrates, e.g., primates, rodents, domesticated animals or game animals. Examples of primates include chimpanzees, crab-eating macaques, spider monkeys, and macaques, e.g., rhesus macaques. Examples of rodents include mice, rats, woodchucks, ferrets, rabbits, and hamsters. Examples of domesticated and game animals include cattle, horses, pigs, deer, bison, buffalo, feline species, e.g., domestic cats, canid species, e.g., dogs, foxes, wolves, bird species, e.g., chickens, emus, ostriches, and fish, e.g., trout, catfish, and salmon. Patients or subjects include, e.g., any subset of all of the above, but excluding one or more groups or species such as humans, primates, or rodents. In certain embodiments, subjects are mammals, e.g., primates, e.g., humans. The terms “patient,” “individual,” and “subject” are used interchangeably herein. Preferably, the subject is a mammal. Mammals may be, but are not limited to, humans, non-human primates, mice, rats, dogs, cats, horses, or cattle. The subject may be male or female. The “subject” may be any vertebrate in various embodiments. The subject may be, for example, an individual to which a drug is administered or a sample is obtained or a procedure is performed, for experimental, diagnostic, and / or therapeutic purposes. In some embodiments, the human subject is neonatal to 6 months old. In some embodiments, the human subject is 6 to 24 months old. In some embodiments, the human subject is 2 to 6 years old, 6 to 12 years old, or 12 to 18 years old. In some embodiments, the human subject is 18 to 30 years old, 30 to 50 years old, 50 to 80 years old, or over 80 years old. In some embodiments, subjects are at least about 5, 10, 20, 30, 40, 50, 60, 65, 70, 75, 80, 85, or 90 years old. In some embodiments, subjects are less than about 5, 10, 20, 30, 40, 50, 60, 65, 70, 75, 80, 85, or 90 years old. In some embodiments, subjects are adults. For this purpose, a person is considered an adult if he is at least 18 years old.In some embodiments, the subjects are young people (e.g., under approximately 18, 12, or 6 years of age in human subjects). In some embodiments, the subjects are not young people (e.g., under approximately 18, 12, or 6 years of age in human subjects). In some embodiments, the subjects are embryos. In some embodiments, the subjects are fetuses. In certain embodiments, the drug is administered to a pregnant woman to treat or induce a biological effect on an embryo or fetus in the uterus.

[0025] In some embodiments, the subject has a disease or condition involving muscle tissue. In some embodiments, the subject has or has been diagnosed with muscular dystrophy. In some embodiments, the muscular dystrophy is selected from myotonic muscular dystrophy, Duchenne muscular dystrophy, Becker muscular dystrophy, limb-girdle muscular dystrophy, facioscapulohumeral muscular dystrophy, congenital muscular dystrophy, oculopharyngeal muscular dystrophy, distal muscular dystrophy, and Emery-Dreyfus muscular dystrophy. In some embodiments, the muscular dystrophy is Becker muscular dystrophy or Duchenne muscular dystrophy. In some embodiments, the methods disclosed herein are used to treat the disease or condition of the subject.

[0026] As used herein, “contacting” cells with one or more viruses may include administering the viruses systemically (e.g., intravenously) or topically (e.g., intramuscularly) to a subject. Alternatively, other routes of administration may be selected (e.g., oral, inhalation, intranasal, intratracheal, intra-arterial, intraocular, intravenous, intramuscular, and other parental routes). The method of contact is not limited and may be any suitable method available in the art.

[0027] In some embodiments, the viral composition is approximately 1.0 × 10⁶ to a human patient. 9 GC~approx. 1.0×10 15 Within the GC range (to treat an average subject weighing 70 kg), preferably 1.0 × 10 12 GC~1.0×1014 It can be formulated in dosage units to contain an amount of replication-deficient virus that is a GC. Preferably, the dosage of the replication-deficient virus in the formulation is 1.0×10 9 GC, 5.0×10 9 GC, 1.0×10 10 GC, 5.0×10 10 GC, 1.0×10 11 GC, 5.0×10 11 GC, 1.0×10 12 GC, 5.0×10 12 GC, or 1.0×10 13 GC, 5.0×10 13 GC, 1.0×10 14 GC, 5.0×10 14 GC, or 1.0×10 15 GC.

[0028] In some embodiments, at least about 0.1%, 0.5%, 1%, 2%, 3%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, and 50% or more of the genome of muscle progenitor cells or a subset thereof is modified. In some embodiments, at least about 0.1%, 0.5%, 1%, 2%, 3%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, and 50% or more of the genome of muscle progenitor cells or a subset thereof is modified by homologous recombination (e.g., genome sequences are replaced or inserted by homologous recombination). In some embodiments, at least about 40% or more of the genome of muscle progenitor cells or a subset thereof is modified by homologous recombination (e.g., genome sequences are replaced or inserted by homologous recombination). In some embodiments, at least 1% of the muscle progenitor cells in the subject are modified to include an insertion of a nucleotide sequence corresponding to the nucleotide sequence of the donor template. In some embodiments, at least 1%, 2%, 3%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, and 50% or more of the muscle progenitor cells in the subject are modified to include an insertion of a nucleotide sequence corresponding to the nucleotide sequence of the donor template. In some embodiments, the modification includes modification of at least one allele. In some embodiments, the modification includes modification of both alleles.

[0029] Examples of viruses suitable for use in the manner disclosed throughout this specification include adenoviruses, adeno-associated viruses, retroviruses (e.g., lentiviruses), vaccinia viruses and other poxviruses, and herpesviruses (e.g., herpes simplex virus). When introduced into a host cell, a virus may or may not contain sufficient viral genetic information to produce an infectious virus; that is, a viral vector may be replicable or replication-deficient.

[0030] In some embodiments, the virus is an adeno-associated virus. Adeno-associated viruses (AAVs) are small (20 nm) replication-deficient, non-enveloped viruses. The AAV genome is a single-stranded DNA (ssDNA) approximately 4.7 kilobases long. The genome contains reverse-end repeats (ITRs) at both ends of the DNA strand, as well as two open reading frames (ORFs): rep and cap. The AAV genome is most frequently integrated into specific sites on chromosome 19. Random integration into the genome occurs with very little frequency. Integration ability may be eliminated by removing at least a portion of the rep ORF from the vector, resulting in a vector that retains episomal state and provides sustained expression, at least in non-dividing cells. To use AAV as a gene transfer vector, a nucleic acid sequence encoding the desired protein or RNA, e.g., a polypeptide or RNA encoding ATPIF1 inhibitor, is inserted between the reverse-end repeats (ITRs) of the AAV genome, functionally linked to a promoter. The use of adeno-associated viruses (AAVs) and their vectors, for example, for gene therapy, is also described in Snyder, RO and Moullier, P., Adeno-Associated Virus Methods and Protocols, Methods in Molecular Biology, Vol. 807, Humana Press, 2011.

[0031] In some embodiments, the AAV is AAV serotype 6, 8, 9, 10, or Anc80 (disclosed in WO2015054653, incorporated herein by reference). In some embodiments, the AAV serotype is AAV serotype 2. Any AAV serotype or modified AAV serotype may and may not be used as appropriate.

[0032] Another suitable AAV may be, for example, rhlO [see, for example, WO2003 / 042397]. Further other AAV sources may include, for example, AAV9 [see, for example, US7,906,111, US2011-0236353-A1] and / or hu37 [see, for example, US7,906,111, US2011-0236353-A1], AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAV8 [see, for example, U.S. Patent No. 7790449, U.S. Patent No. 7282199]. In addition to these and other suitable AAV sequences, see, for example, WO2003 / 042397, WO2005 / 033321, WO2006 / 110689, U.S. Patent No. 7790449, U.S. Patent No. 7282199, and U.S. 7588772B2 for methods of generating AAV vectors. Further AAVs may be selected, if applicable, taking into account the tissue selectivity of the selected AAV capsid. The recombinant AAV vector (AAV virus particle) may comprise a nucleic acid molecule containing a 5'AAV ITR, an expression cassette as described herein, and a 3'AAV ITR, packaged within an AAV capsid. As described herein, the expression cassette may contain a regulatory element for open reading frames(s) within each expression cassette, and the nucleic acid molecule may contain additional regulatory elements.

[0033] AAV vectors may contain a full-length AAV 5' reverse-terminal repeat (ITR) and a full-length 3' ITR. A shortened form of the 5' ITR, called AITR, is described, which lacks a D-sequence and terminal degradation sites (trs). The abbreviation "sc" indicates self-complementary. "Self-complementary AAV" refers to a construct in which the coding region of the recombinant AAV nucleic acid sequence is designed to form an intramolecular double-stranded DNA template. Upon infection, instead of waiting for cell-mediated synthesis of the second strand, the two complementary halves of scAAV associate to form a single double-stranded DNA (dsDNA) unit ready for immediate replication and transcription. For example, DM McCarty et al, “Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient See "Transduction independently of DNA synthesis," Gene Therapy, (August 2001), Vol. 8, Number 16, Pages 1248-1254. Self-complementary AAVs are described, for example, in U.S. Patents 6,596,535, 7,125,717, and 7,456,683, each of which is incorporated herein by reference in its entirety.

[0034] When a pseudotyped AAV is produced, the ITR is selected from a source different from the AAV source of the capsid. For example, an AAV2 ITR may be selected for use with an AAV capsid that has a specific efficiency against a selected cell receptor, target tissue, or viral target. In one embodiment, an ITR sequence derived from AAV2, or a deletion form thereof (AITR), is used for convenience and to expedite regulatory approval. However, an ITR derived from another AAV source may be selected. If the ITR source is AAV2 and the AAV capsid is derived from another AAV source, the resulting vector may be referred to as pseudotyped. However, other sources of AAV ITR may be utilized.

[0035] Single-stranded AAV viral vectors may be used. Methods for generating and isolating AAV viral vectors suitable for delivery to a target are known in the art. See, for example, U.S. Patents 7,790449, 7,282199, WO2003 / 042397, WO2005 / 033321, WO2006 / 110689, and US7588772B2. In one system, a producing cell line is transiently transfected with a construct encoding a transgene adjacent to the ITR and constructs encoding rep and cap. In a second system, a packaging cell line that stably supplies rep and cap is transfected (transiently or stably) with a construct encoding a transgene adjacent to the ITR. In each of these systems, AAV virions are produced in response to infection with a helper adenovirus or herpesvirus, so it is necessary to isolate rAAV from the contaminating virus. More recently, systems have been developed that do not require helper virus infection to recover AAV, and the necessary helper functions (i.e., adenoviruses El, E2a, VA, and E4 or herpesviruses UL5, UL8, UL52, and UL29, as well as herpesvirus polymerases) are also supplied to the trans by the system. In these new systems, helper functions can be supplied by transiently transfecting cells with constructs encoding the necessary helper functions, or cells can be engineered to stably contain the genes encoding the helper functions, and their expression can be controlled at the transcriptional or post-transcriptional level. In yet another system, the transgenes and rep / cap genes adjacent to the ITR are introduced into insect cells by infection with a baculovirus-based vector. For an overview of these production systems, see, for example, Zhang et al, 2009, “Adenovirus-adeno-associated virus hybrid for large-scale recombinant adeno-associated virus production,” Human Gene Therapy 20:922–929, the entire contents of which are incorporated herein by reference.Methods for fabricating and using these and other AAV production systems are also described in the following U.S. Patents, the entire contents of which are incorporated herein by reference: 5,139,941, 5,741,683, 6,057,152, 6,204,059, 6,268,213, 6,491,907, 6,660,514, 6,951,753, 7,094,604, 7,172,893, 7,201,898, 7,229,823, and 7,439,065.

[0036] In another embodiment, other viral vectors may be used, including embedded viruses, such as herpesviruses or lentiviruses, but other viruses may be selected. Preferably, if one of these other vectors is produced, it is produced as a replication-deficient viral vector. A “replication-deficient virus” or “viral vector” refers to a synthetic or artificial viral particle in which an expression cassette containing the gene of interest is packaged in a viral capsid or envelope, and any viral genome sequence further packaged in the viral capsid or envelope is replication-deficient, i.e., they cannot produce progeny virions but may retain the ability to infect target cells. In one embodiment, the genome of the viral vector does not contain genes encoding enzymes necessary for replication (this genome is “gutless,” i.e., it can be engineered to contain only the target transgene adjacent to the signals necessary for amplification and packaging of the artificial genome), but these genes may be supplied during production.

[0037] One or more viruses may contain promoters capable of inducing expression in mammalian cells (e.g., expression of sequence-targeted nucleases, donor templates, and / or one or more gRNAs), such as preferred viral promoters, e.g., those derived from cytomegalovirus (CMV), retroviruses, Simian viruses (e.g., SV40), papillomaviruses, herpesviruses, or other viruses that infect mammalian cells; or mammalian promoters derived from genes such as EF1 alpha, ubiquitin (e.g., ubiquitin B or C), globin, actin, or phosphoglycerate kinase (PGK); or composite promoters, such as the CAG promoter (a combination of the CMV initial enhancer element and the chicken terta-actin promoter). In some embodiments, human promoters may be used. In some embodiments, the promoter is selected from the CMV promoter, U6 promoter, H1 promoter, constitutive promoter, and ubiquitous promoter. In some embodiments, the promoter induces expression in a specific cell type, e.g., a muscle progenitor cell-specific promoter.

[0038] In some embodiments of the methods disclosed herein, suitable tissue-specific promoters can be obtained by those skilled in the art from the tissue-specific promoters listed in the “TiProD: Tissue specific promoter Database” available on the World Wide Web at tiprod.bioinf.med.uni-goettingen.de / .

[0039] The sequence-targeting nucleases that can be used in the methods disclosed herein are not limited to any sequence-targeting nucleases disclosed herein. In some embodiments, the sequence-targeting nucleases are zinc finger nucleases (ZFNs), activator-like effector nucleases (TALENs), Cas nucleases (e.g., Cas9 nucleases), or functional fragments or functional variants thereof.

[0040] There are four main types of sequence-targeted nucleases (i.e., targetable nucleases, site-specific nucleases) currently in use: zinc finger nucleases (ZFNs), activator-like effector nucleases (TALENs), and RNA-inducible nucleases (RGNs), such as the Cas protein in the CRISPR / Cas II system, as well as engineered meganucleases. ZFNs and TALENs contain a nuclease domain of restriction enzyme FokI (or an engineered variant thereof) fused to a site-specific DNA-binding domain (DBD), which is appropriately designed to target a selected DNA sequence. In the case of ZFNs, the DNA-binding domain (DBD) includes a zinc finger DBD. In the case of TALENs, the site-specific DBD is designed based on the DNA recognition code used by activator-like effectors (TALEs), a family of site-specific DNA-binding proteins found in plant pathogens such as Xanthomonas species.

[0041] The CRISPR-II system, a cluster of short repeat palindromic sequences arranged at regular intervals, is a modified bacterial adaptive immune system used as an RNA-guided endonuclease technology for genome engineering. The bacterial system includes two endogenous bacterial RNAs called crRNA and tracrRNA, as well as a CRISPR-associated (Cas) nuclease, e.g., Cas9. tracrRNA is partially complementary to crRNA and forms a complex with it. The Cas protein is induced to a target sequence by the crRNA / tracrRNA complex, which forms an RNA / DNA hybrid between the crRNA sequence and the complementary sequence within the target. For use in genome engineering, the crRNA and tracrRNA components are often combined to form a single chimeric guide RNA (sgRNA or gRNA), where the targeting specificity of crRNA and the properties of tracrRNA combine to form a single transcript that localizes the Cas protein to the target sequence, enabling it to cleave DNA. sgRNA typically consists of a guide sequence of approximately 20 nucleotides, complementary to or homologous to the desired target sequence, followed by approximately 80 nt of hybrid crRNA / tracrRNA. Those skilled in the art will understand that the guide RNA does not need to be perfectly complementary to or homologous to the target sequence. For example, in some embodiments, it may have one or two mismatches. While the genomic sequence into which the gRNA hybridizes is usually flanked by a protospacer flanking motif (PAM) sequence on one side, those skilled in the art will understand that certain Cas proteins may have looser requirements for the PAM sequence. PAM sequences are present in genomic DNA but not in sgRNA sequences. Cas proteins will target any DNA sequence that has a precise target sequence and a PAM sequence. The PAM sequence varies depending on the bacterial species from which the Cas protein originates. Specific examples of Cas proteins include Cas1, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, and Cas10. In some embodiments, the site-specific nuclease includes the Cas9 protein.For example, Cas9 derived from Streptococcus pyogenes (Sp), Neisseria meningitides, Staphylococcus aureus, Streptococcus thermophiles, or Treponema denticola may be used. The PAM sequences of these Cas9 proteins are NGG, NNNNGATT, NNAGAA, and NAAAAC, respectively. In some embodiments, Cas9 is derived from Staphylococcus aureus (saCas9).

[0042] Numerous engineered variants of site-specific nucleases have been developed and may be used in certain embodiments. For example, engineered variants of Cas9 and Fok1 are known in the art. Furthermore, it is understood that biologically active fragments or variants may be used. Another option is the use of hybrid site-specific nucleases. For example, in CRISPR RNA-induced FokI nuclease (RFN), the FokI nuclease domain is fused to the amino terminus of a catalytically inactive Cas9 protein (dCas9). RFN functions as a dimer and utilizes two guide RNAs (Tsai, QS, et al., Nat Biotechnol. 2014;32(6):569-576). Site-specific nucleases that generate single-strand DNA breaks are also useful for genome editing. Such nucleases are sometimes referred to as "nickase" and can be generated by introducing a mutation (e.g., alanine substitution) to the major catalytic residue in one of the two nuclease domains of a site-specific nuclease (such as ZFNs, TALENs, and Cas proteins) that contains two nuclease domains. Examples of such mutations include D10A, N863A, and H840A of SpCas9, or homologous sites of other Cas9 proteins. Nicks can stimulate HDR with low efficiency in some cell types. Two nickases targeting a pair of sequences located close to each other and on opposite strands can effectively generate DSBs by creating single-strand breaks on each strand ("double nicking"), which can sometimes be repaired by HDR using a donor DNA template (Ran, FA et al. Cell 154, 1380-1389 (2013)). In some embodiments, the Cas protein is a SpCas9 variant. In some embodiments, the SpCas9 variant is the R661A / Q695A / Q926A triple variant or the N497A / R661A / Q695A / Q926A quadruple variant.See Kleinstiver et al., “High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects,” Nature, Vol. 529, pp. 490-495 (and supplemental material) (2016), which is incorporated herein by reference in its entirety. In some embodiments, the Cas protein is C2c1 of the class 2 type VB CRISPR-Cas protein. See Yang et al., “PAM-Dependent Target DNA Recognition and Cleavage by C2c1 CRISPR-Cas Endonuclease,” Cell, Vol. 167, pp. 1814-1828 (2016), which is incorporated herein by reference in its entirety. In some embodiments, the Cas protein is one described in US20160319260 “Engineered CRISPR-Cas9 nucleases with Altered PAM Specificity,” which is incorporated herein by reference.

[0043] The nucleic acid encoding the sequence-targeted nuclease must be short enough to be contained within a virus (e.g., AAV). In some embodiments, the nucleic acid encoding the sequence-targeted nuclease is less than 4.4 kb.

[0044] In some embodiments, the sequence-targeted nuclease has at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% polypeptide sequence identity with naturally occurring targetable nucleases.

[0045] In some embodiments, one or more viruses comprise a first virus that transduces a nucleic acid sequence encoding a sequence-targeted nuclease and a donor template. In some embodiments, one or more viruses comprise a first virus that transduces a nucleic acid sequence encoding a sequence-targeted nuclease, a donor template, and one or more (e.g., one, two, three, four, etc.) gRNAs. In embodiments of the method described herein in which a single virus transduces a sequence-targeted nuclease, a donor template, and optionally one or more gRNAs, those skilled in the art can select a suitable virus capable of packaging the required nucleotide sequence. In some embodiments, one or more viruses comprise a first virus that transduces a nucleic acid sequence encoding a sequence-targeted nuclease, and a second virus that transduces a donor template. In some embodiments, one or more viruses comprise a first virus transducing a nucleic acid sequence encoding a sequence-targeted nuclease, and a second virus transducing a donor template and one or more (e.g., one, two, three, four, etc.) gRNAs. In some embodiments, one or more viruses comprise a first virus transducing a nucleic acid sequence encoding a sequence-targeted nuclease, and a second virus transducing a donor template and two gRNAs. In some embodiments, the ratio of the first virus to the second virus is about 1:3 to about 1:100, and includes ratios in between. For example, the ratio of the first virus to the second virus may be about 1:5 to about 1:50, or about 1:10, or about 1:20. Less preferably, the ratio may be 1:1, or there may be a greater proportion of the second virus.

[0046] In some embodiments, the method includes the delivery of one or more components (e.g., nucleic acids encoding sequence-targeted nucleases, donor templates, one or more gRNAs (e.g., two gRNAs)) mediated by a nonviral construct, such as "naked DNA," "naked plasmid DNA," RNA, and mRNA, in conjunction with various delivery compositions and nanoparticles, such as micelles, liposomes, cationic lipid-nucleic acid compositions, polyglycan compositions and other polymers, lipid and / or cholesterol-based nucleic acid conjugates, and other constructs such as those described herein. See, for example, X. Su et al, Mol. Pharmaceuticals, 2011, 8(3), pp774-787, published online: March 21, 2011, WO2013 / 182683, WO2010 / 053572 and WO2012 / 170930, all of which are incorporated herein by reference.

[0047] In some embodiments, the cells having the genome of muscle progenitor cells modified by the methods disclosed herein are muscle stem cells (e.g., adult muscle stem cells). However, muscle progenitor cells are not limited. In some embodiments, at least 1% of the muscle progenitor cells (e.g., muscle stem cells) in the subject are modified to include insertions of nucleotide sequences corresponding to the nucleotide sequences of the donor template. In other embodiments of the present invention, the methods disclosed herein include modification of muscle fiber cells. In some embodiments, both muscle progenitor cells and muscle fiber cells have their genomes modified. In some embodiments, the genome of muscle fiber cells is not modified or is substantially unmodified.

[0048] Some aspects of the present invention relate to a method for producing muscle fibers having a modified genome by modifying the genome of muscle progenitor cells (e.g., satellite cells) by the method disclosed herein. The modified muscle fiber contains one or more modified muscle progenitor cell nuclei. In some embodiments, the muscle fiber contains at least one, two, three, four, five, 10, 20, 50, 75, 100, 200, 250, 300, 400 or more modified nuclei. In some embodiments, at least about 1%, 2%, 3%, 5%, 10%, 20%, 30%, 40%, 50%, 51%, 60%, 70%, 90%, 95%, or 99% of the nuclei of the muscle fiber have genomes modified by the method disclosed herein. In some embodiments, at least about 1%, 2%, 3%, 5%, 10%, 20%, 30%, 40%, 50%, 51%, 60%, 70%, 90%, 95%, or 99% of the muscle fibers of the subject have a genome modified by the method disclosed herein. In some embodiments, the subject having muscle fibers modified by the method disclosed herein is diagnosed with muscular dystrophy. In some embodiments, the subject has muscular dystrophy. In some embodiments, the muscular dystrophy is selected from myotonic muscular dystrophy, Duchenne muscular dystrophy (DMD), Becker muscular dystrophy, limb-girdle muscular dystrophy, facioscapulohumeral muscular dystrophy, congenital muscular dystrophy, oculopharyngeal muscular dystrophy, distal muscular dystrophy, and Emery-Dreyfus muscular dystrophy. In some embodiments, the muscular dystrophy is Becker muscular dystrophy or Duchenne muscular dystrophy.

[0049] In some embodiments, the methods disclosed herein further include evaluating the fate or function of muscle progenitor cells or muscle fibers having a genome modified by the methods disclosed herein.

[0050] Methods for modifying the genome of cardiac cells

[0051] Some aspects of this disclosure relate to methods for modifying the genome of cardiac cells in vivo in subjects, the methods comprising contacting cardiac cells with one or more viruses, the one or more viruses transducing nucleic acid sequences encoding sequence-targeted nucleases into the cardiac cells, transducing a donor template into the cardiac cells, the modification comprising insertion of nucleotide sequences corresponding to the nucleotide sequences of the donor template (e.g., homologous recombination), and the cardiac cells are DNA-synthesizing cardiac cells or replicating cardiac cells.

[0052] The subjects are not limited and may be any subjects as described herein. In some embodiments, the subjects have a heart disease or condition. In some embodiments, the heart disease or condition is associated with a gene mutation. In some embodiments, the heart disease or condition can be improved or treated by correcting the gene mutation. In some embodiments, the heart disease or condition can be improved or treated by inserting a gene sequence into the genome of cardiac cells. In some embodiments, the likelihood of a heart disease or condition can be reduced or prevented by correcting a gene mutation. In some embodiments, the likelihood of a heart disease or condition can be reduced or prevented by inserting a gene sequence into the genome of cardiac cells. In some embodiments, the subjects are infants, or young adults, or under 30 years of age. In some embodiments, the subjects are not infants, or young adults, or under 30 years of age.

[0053] In some embodiments, cardiac cells are selected from the group consisting of mammalian postmitotic cardiomyocytes, mammalian postmitotic cardiomyocytes capable of DNA synthesis without division / proliferation, human postmitotic cardiomyocytes, human postmitotic cardiomyocytes capable of DNA synthesis without division / proliferation, cardiomyocyte progenitor cells, proliferating mesenchymal cardiac cells, proliferating endothelial cardiac cells, and cardiomyocyte progenitor cells.

[0054] The sequence-targeted nuclease is not limited and may be any sequence-targeted nuclease described herein. In some embodiments, the sequence-targeted nuclease is Cas9 or a functional fragment or functional variant thereof.

[0055] In some embodiments, one or more viruses comprise a first virus that transduces a nucleic acid sequence encoding a sequence-targeted nuclease and a donor template. In some embodiments, one or more viruses comprise a first virus that transduces a nucleic acid sequence encoding a sequence-targeted nuclease, a donor template, and one or more (e.g., one, two, three, four, etc.) gRNAs. In embodiments of the method described herein in which a single virus transduces a sequence-targeted nuclease, a donor template, and optionally one or more gRNAs, those skilled in the art can select a suitable virus capable of packaging the required nucleotide sequence. In some embodiments, one or more viruses comprise a first virus that transduces a nucleic acid sequence encoding a sequence-targeted nuclease, and a second virus that transduces a donor template. In some embodiments, one or more viruses comprise a first virus transducing a nucleic acid sequence encoding a sequence-targeted nuclease, and a second virus transducing a donor template and one or more (e.g., one, two, three, four, etc.) gRNAs. In some embodiments, the ratio of the first virus to the second virus is approximately 1:3 to approximately 1:100, and includes ratios in between. For example, the ratio of the first virus to the second virus may be approximately 1:5 to approximately 1:50, or approximately 1:10, or approximately 1:20. Less preferably, the ratio may be 1:1, or there may be a greater proportion of the second virus.

[0056] In some embodiments, the method includes the delivery of one or more components (e.g., nucleic acids encoding sequence-targeted nucleases, donor templates, one or more gRNAs) mediated by a nonviral construct, such as “naked DNA,” “naked plasmid DNA,” RNA, and mRNA, in conjunction with various delivery compositions and nanoparticles, such as micelles, liposomes, cationic lipid-nucleic acid compositions, polyglycan compositions and other polymers, lipid and / or cholesterol-based nucleic acid conjugates, and other constructs such as those described herein. See, for example, X. Su et al, Mol. Pharmaceuticals, 2011, 8(3), pp774-787, published online: March 21, 2011, WO2013 / 182683, WO2010 / 053572 and WO2012 / 170930, both of which are incorporated herein by reference.

[0057] One or more viruses may contain a promoter capable of inducing expression in mammalian cells (e.g., sequence-targeted nucleases, donor templates, expression of one or more gRNAs), such as a preferred viral promoter as described herein. In some embodiments, a human promoter may be used. In some embodiments, the promoter is selected from the CMV promoter, U6 promoter, H1 promoter, constitutive promoter, and ubiquitous promoter. In some embodiments, the promoter induces expression in a specific cell type. For example, in some embodiments, the promoter is a cardiac-specific promoter (e.g., a mammalian postmittal cardiomyocyte-specific promoter, a mammalian postmittal cardiomyocyte-specific promoter capable of DNA synthesis without division / proliferation, a human postmittal cardiomyocyte-specific promoter, a human postmittal cardiomyocyte-specific promoter capable of DNA synthesis without division / proliferation, a cardiomyocyte progenitor cell-specific promoter, a proliferating mesenchymal cardiomyocyte-specific promoter, a proliferating endothelial cardiomyocyte-specific promoter, or a cardiomyocyte progenitor cell-specific promoter, or a promoter specific to one or more of these enumerated subtypes). In some embodiments, the nucleic acid sequence encoding the sequence-targeted nuclease is transduced with a heart-specific promoter, a ubiquitous promoter, or a non-specific promoter.

[0058] The one or more viruses used are not limited to any suitable viruses or viruses disclosed herein. In some embodiments, the virus is AAV serotype 6, 8, 9, 10 or Anc80.

[0059] In some embodiments, the viral composition is approximately 1.0 × 10⁶ to a human patient. 9 GC (genome copy, also referred to as viral genome (vg) in this specification) ~ approximately 1.0 × 10⁻⁶ 15 Within the GC range (to treat an average subject weighing 70 kg), preferably 1.0 × 10 12 GC~1.0×10 14It can be formulated in dose units to contain a certain amount of replication-deficient virus (GC). Preferably, the dose of replication-deficient virus in the formulation is 1.0 × 10⁶ 9 GC, 5.0×10 9 GC, 1.0 × 10 10 GC, 5.0×10 10 GC, 1.0 × 10 11 GC, 5.0×10 11 GC, 1.0 × 10 12 GC, 5.0×10 12 GC, or 1.0 × 10⁻⁶ 13 GC, 5.0×10 13 GC, 1.0 × 10 14 GC, 5.0×10 14 GC, or 1.0 × 10⁻⁶ 15 It is garbage collection.

[0060] In some embodiments, at least about 0.1%, 0.5%, 1%, 2%, 3%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, and 50% or more of the genome of the target cardiac cells are modified. In some embodiments, at least about 0.1%, 0.5%, 1%, 2%, 3%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, and 50% or more of the genome of the cardiac cells are modified by homologous recombination (e.g., genome sequences are replaced or inserted by homologous recombination). In some embodiments, at least 1%, 1.6%, and 2% of the cardiac cells in the target are modified to include insertions of nucleotide sequences corresponding to nucleotide sequences of the donor template. In some embodiments, the modification includes modification of at least one allele. In some embodiments, the modification includes modification of both alleles.

[0061] Some aspects of this disclosure relate to cardiac tissue comprising cardiac cells having genomes modified by the methods disclosed herein. In some embodiments, the cardiac tissue comprises progeny cells of cardiac cells modified by the methods disclosed herein. In some embodiments, at least about 1%, 2%, 3%, 5%, 10%, 20%, 30%, 40%, 50%, 51%, 60%, 70%, 90%, 95%, and 99% of the myocytes in the cardiac tissue are modified by the methods disclosed herein or are progeny of modified cells. In some embodiments, the subject having cardiac tissue modified by the methods disclosed herein is diagnosed with a heart disease or condition. In some embodiments, the heart condition is damaged myocardium (e.g., myocardial damage following a myocardial infarction). In some embodiments, the cardiac disease is myocardial infarction, ischemic heart disease, dilated cardiomyopathy, heart failure (e.g., congestive heart failure), ischemic cardiomyopathy, hypertrophic cardiomyopathy, restrictive cardiomyopathy, alcoholic cardiomyopathy, viral cardiomyopathy, tachycardia-mediated cardiomyopathy, stress-induced cardiomyopathy, amyloid cardiomyopathy, arrhythmogenic right ventricular dysplasia, left ventricular noncompaction, endocardial fibroelastosis, aortic stenosis, aortic regurgitation, mitral stenosis, mitral regurgitation, mitral valve prolapse, pulmonary stenosis, pulmonary regurgitation, tricuspid stenosis, tricuspid regurgitation, congenital disorders, genetic disorders, or combinations thereof. In some embodiments, the methods disclosed herein may be used to promote myocardial regeneration in subjects requiring it.

[0062] In some embodiments, the methods disclosed herein further include evaluating the fate or function of cardiac cells with genomic modifications.

[0063] Methods for targeting specific striated muscle types for genome modification

[0064] Some aspects of this disclosure relate to a method for targeting a specific striated muscle type for in vivo genomic modification in a subject by homologous recombination repair, the method comprising systemic administration of one or more viruses, the one or more viruses transducing a nucleic acid sequence encoding a sequence-targeted nuclease into a striated muscle cell, transducing a donor template into the striated muscle cell, the modification comprising insertion of a nucleotide sequence corresponding to the nucleotide sequence of the donor template, and, due to the age of the subject, the genomic modification occurs selectively in at least one striated muscle type.

[0065] In some embodiments, the genome of muscle progenitor cells is selectively modified. In some embodiments, the genome of cardiac cells is selectively modified.

[0066] The subjects are not limited and may be any subjects as described herein. In some embodiments, the subjects have a muscular or cardiac disease or condition.

[0067] The sequence-targeted nuclease is not limited and may be any sequence-targeted nuclease described herein. In some embodiments, the sequence-targeted nuclease is Cas9 or a functional fragment or functional variant thereof.

[0068] In some embodiments, one or more viruses comprise a first virus that transduces a nucleic acid sequence encoding a sequence-targeted nuclease and a donor template. In some embodiments, one or more viruses comprise a first virus that transduces a nucleic acid sequence encoding a sequence-targeted nuclease, a donor template, and one or more (e.g., one, two, three, four, etc.) gRNAs. In embodiments of the method described herein in which a single virus transduces a sequence-targeted nuclease, a donor template, and optionally one or more gRNAs, those skilled in the art can select a suitable virus capable of packaging the required nucleotide sequence. In some embodiments, one or more viruses comprise a first virus that transduces a nucleic acid sequence encoding a sequence-targeted nuclease, and a second virus that transduces a donor template. In some embodiments, one or more viruses comprise a first virus transducing a nucleic acid sequence encoding a sequence-targeted nuclease, and a second virus transducing a donor template and one or more (e.g., one, two, three, four, etc.) gRNAs. In some embodiments, the ratio of the first virus to the second virus is approximately 1:3 to approximately 1:100, and includes ratios in between. For example, the ratio of the first virus to the second virus may be approximately 1:5 to approximately 1:50, or approximately 1:10, or approximately 1:20. Less preferably, the ratio may be 1:1, or there may be a greater proportion of the second virus.

[0069] In some embodiments, the method includes the delivery of one or more components (e.g., nucleic acids encoding sequence-targeted nucleases, donor templates, one or more gRNAs) mediated by a nonviral construct, such as “naked DNA,” “naked plasmid DNA,” RNA, and mRNA, in conjunction with various delivery compositions and nanoparticles, such as micelles, liposomes, cationic lipid-nucleic acid compositions, polyglycan compositions and other polymers, lipid and / or cholesterol-based nucleic acid conjugates, and other constructs such as those described herein. See, for example, X. Su et al, Mol. Pharmaceuticals, 2011, 8(3), pp774-787, published online: March 21, 2011, WO2013 / 182683, WO2010 / 053572 and WO2012 / 170930, both of which are incorporated herein by reference.

[0070] One or more viruses may contain a promoter capable of inducing expression (e.g., expression of sequence-targeted nucleases, donor templates, or one or more gRNAs) in mammalian cells, such as a preferred viral promoter as described herein. In some embodiments, a human promoter may be used. In some embodiments, the promoter is selected from the CMV promoter, U6 promoter, H1 promoter, constitutive promoter, and ubiquitous promoter. In some embodiments, the promoter induces expression in a specific cell type. In some embodiments, a nucleic acid sequence encoding a sequence-targeted nuclease is transduced with a ubiquitous promoter or a nonspecific promoter.

[0071] The one or more viruses used are not limited to any suitable viruses or viruses disclosed herein. In some embodiments, the virus is AAV serotype 6, 8, 9, 10 or Anc80.

[0072] In some embodiments, the viral composition is approximately 1.0 × 10⁶ to a human patient. 9 GC~approx. 1.0×1015 Within the GC range (to treat an average subject weighing 70 kg), preferably 1.0 × 10 12 GC~1.0×10 14 It can be formulated in dose units to contain a certain amount of replication-deficient virus (GC). Preferably, the dose of replication-deficient virus in the formulation is 1.0 × 10⁶ 9 GC, 5.0×10 9 GC, 1.0 × 10 10 GC, 5.0×10 10 GC, 1.0 × 10 11 GC, 5.0×10 11 GC, 1.0 × 10 12 GC, 5.0×10 12 GC, or 1.0 × 10⁻⁶ 13 GC, 5.0×10 13 GC, 1.0 × 10 14 GC, 5.0×10 14 GC, or 1.0 × 10⁻⁶ 15 It is garbage collection.

[0073] In some embodiments, at least about 0.1%, 0.5%, 1%, 2%, 3%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, and 50% or more of the genome of the target striated muscle cell type (e.g., cardiac muscle, muscle progenitor cells, muscle fibers) is modified. In some embodiments, at least about 0.1%, 0.5%, 1%, 2%, 3%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, and 50% or more of the genome of the striated muscle cell type (e.g., cardiac muscle, muscle progenitor cells, muscle fibers) is modified by homologous recombination (e.g., genome sequences are replaced or inserted by homologous recombination). In some embodiments, at least about 1%, 1.6%, or 2% of the striated muscle cell types in the subject (e.g., cardiac muscle, muscle progenitor cells, muscle fibers, etc.) are modified to include insertions of nucleotide sequences corresponding to the nucleotide sequences of the donor template. In some embodiments, the modification includes modification of at least one allele. In some embodiments, the modification includes modification of both alleles.

[0074] In some embodiments, human subjects are 6–24 months old. In some embodiments, human subjects are 2–6 years, 6–12 years, or 12–18 years old. In some embodiments, human subjects are 18–30 years, 30–50 years, 50–80 years, or over 80 years old. In some embodiments, subjects are at least about 5, 10, 20, 30, 40, 50, 60, 65, 70, 75, 80, 85, or 90 years old. In some embodiments, subjects are less than about 5, 10, 20, 30, 40, 50, 60, 65, 70, 75, 80, 85, or 90 years old. In some embodiments, subjects are adults. For this purpose, a human being at least 18 years old is considered an adult. In some embodiments, subjects are young people (e.g., less than about 18, 12, or 6 years old in human subjects). In some embodiments, the subjects are not young people (e.g., under approximately 18, 12, or 6 years of age in human subjects). In some embodiments, the subjects are under 1 year of age. In some embodiments, the subjects are over 1 year of age but under 6 years of age. In some embodiments, the subjects are over 6 years of age but under 12 years of age. In some embodiments, the subjects are over 12 years of age but under 18 years of age. In some embodiments, the subjects are over 18 years of age but under 24 years of age. In some embodiments, the subjects are over 18 years of age. In some embodiments, the subjects are post-pubescent. In some embodiments, the subjects are pre-pubescent. In some embodiments, the subjects are pubescent. In some embodiments, the subjects are embryos. In some embodiments, the subjects are fetuses. In certain embodiments, the drug is administered to a pregnant woman to treat or induce a biological effect on an embryo or fetus in the uterus.

[0075] In some embodiments, the methods disclosed herein further include evaluating the fate or function of rhabdomyoplasmic cells with genomic modifications.

[0076] The terms “decrease,” “reduce,” “decreased,” “decrease,” and “inhibit” are all used herein to generally mean a statistically significant reduction compared to a reference. However, to avoid misunderstanding, “reduce,” “decrease,” or “inhibit” usually mean a reduction of at least 10% compared to a reference level, and may include, for example, reductions of at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, and maximum reductions including, for example, a complete absence of a given entity or parameter compared to a reference level, or any reduction of 10 to 99% compared to no treatment being performed.

[0077] The terms “increased,” “enhance,” “boost,” or “activate” are all used herein in general to mean an increase of a statistically significant amount, and to avoid any misunderstanding, the terms “increased,” “enhance,” “boost,” or “activate” mean an increase of at least 10% compared to a reference level, for example, an increase including an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or an increase of up to 100%, or an increase of any 10 to 100% compared to a reference level, or an increase of at least about 2 times, or at least about 3 times, or at least about 4 times, or at least about 5 times, or at least about 10 times, or an increase of any 2 to 10 times or more compared to a reference level.

[0078] As used herein, the terms “comprising” or “comprises” are used in relation to compositions, methods, and each of their components that are essential to a method or composition, but are not limited to including elements not specified, whether essential or not.

[0079] The term "consisting of" refers to compositions, methods, and their respective components as described herein, excluding any elements not listed in the description of the embodiments.

[0080] As used herein, the term “essentially derived from” refers to those elements necessary for a given embodiment. The term permits the presence of elements that do not substantially affect the basic, novel, or functional features of that embodiment.

[0081] The terms "statistically significant" or "significantly significant" refer to statistical significance, generally meaning a p-value greater than 0.05 (calculated by the relevant statistical test). Those skilled in the art will readily understand that the statistical test relevant to any particular experiment depends on the type of data being analyzed. Additional definitions are provided below within the text of individual sections.

[0082] Definitions of general terms in cell biology and molecular biology can be found in “The Merck Manual of Diagnosis and Therapy”, 19th Edition, published by Merck Research Laboratories, 2006 (ISBN 0-911910-19-0), Robert S. Porter et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9), The ELISA guidebook (Methods in molecular biology 149) by Crowther JR (2000), and Immunology by Werner Luttmann, published by Elsevier, 2006. Definitions of common molecular biology terms can be found in Benjamin Lewin, Genes X, Jones & Bartlett Publishing, 2009 (ISBN-10: 0763766321), Kendrew et al. (eds.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8), and Cun-ent Protocols. It can also be found in Protein Sciences 2009, Wiley Intersciences, Coligan et al., eds.

[0083] Unless otherwise stated, the present invention is based, for example, on Sambrook et al., Molecular Cloning: A Laboratory Manual (3rd ed.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA (2001) and Davis et al. The procedures were carried out using standard methods, such as those described in al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (1995), both of which are incorporated herein by reference in their entirety.

[0084] As used herein, the terms “protein” and “polypeptide” are interchangeable and refer to a series of amino acid residues linked to one another by peptide bonds between the alpha-amino and carboxyl groups of adjacent residues. The terms “protein” and “polypeptide” refer to polymers of protein amino acids, including modified amino acids (e.g., phosphorylated, glycated, glycosylated, etc.) and amino acid analogs, regardless of their size or function. While “protein” and “polypeptide” are often used in reference to relatively large polypeptides, the term “peptide” is often used in reference to small polypeptides; however, the usage of these terms in the art is often redundant. The terms “protein” and “polypeptide” are interchangeable herein when referring to purified gene products and their fragments.

[0085] Therefore, exemplary polypeptides or proteins include gene products, naturally occurring proteins, homologs, orthologues, paralogs, fragments and other equivalents, variants, fragments, and the aforementioned analogues.

[0086] As used herein, the terms “nucleic acid” or “nucleic acid sequence” refer to any molecule, preferably a polymer molecule, that incorporates units of ribonucleic acid, deoxyribonucleic acid, or their analogues. Nucleic acids can be single-stranded or double-stranded. A single-stranded nucleic acid may be a single-stranded nucleic acid of denatured double-stranded DNA. Alternatively, it may be a single-stranded nucleic acid that does not originate from any double-stranded DNA. In one embodiment, the template nucleic acid is DNA. In another embodiment, the template is RNA. A preferred nucleic acid molecule is DNA containing genomic DNA or cDNA. Another preferred nucleic acid molecule is RNA containing mRNA. Nucleic acid molecules may be naturally occurring, as with genomic DNA, or they may be synthetic, i.e., prepared based on human behavior, or a combination of the two. Nucleic acid molecules may also have certain modifications, such as 2'-deoxy, 2'-deoxy-2'fluoro, 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamide (2'-O-NMA), cholesterol addition, and phosphorothioate skeletons, as well as certain ribonucleosides, such as those described in U.S. Patent No. 6,268,490, in which a methylene unit is linked between a 2'-oxygen atom and a 4'-carbon atom, both patents and patent applications in their entirety are incorporated herein by reference.

[0087] As used herein, “to treat,” “to treat,” “to treat,” or “to improve” when used in relation to a disease, disorder, or medical condition means a therapeutic treatment of the condition, the purpose of which is to reverse, reduce, improve, inhibit, slow, or halt the progression or severity of the symptoms or condition. The term “to treat” includes reducing or reducing at least one adverse effect or symptom of the condition. A treatment is generally “effective” if one or more symptoms or clinical markers are reduced. Or, a treatment is “effective” if the progression of the condition is reduced or halted. That is, “treatment” includes not only improvement of symptoms or markers but also halt or at least delay the progression or worsening of symptoms that would be expected if no treatment were given. Beneficial or desired clinical outcomes include, but are not limited to, reduction of one or more symptoms, a reduction in the degree of deficit, or a stable (i.e., non-worsening) state compared to what would be expected if no treatment were given.

[0088] The effectiveness of a given treatment for a disorder or disease may be determined by a skilled clinician. However, a treatment is considered an “effective treatment” when the term is used herein if one or all of the signs or symptoms of the disorder are altered in a beneficial manner, or if other clinically recognized symptoms are improved or improved by at least 10% after treatment with an agent or composition such as those described herein. Effectiveness may also be measured by the fact that the individual does not worsen as assessed by hospitalization or does not require medical intervention (i.e., the progression of the disease has stopped). Methods for measuring these indicators are known to those skilled in the art and / or are described herein.

[0089] The description of embodiments of this disclosure is not intended to be exhaustive or to limit the disclosure to the exact form disclosed. Specific embodiments and examples of the disclosure are described herein for illustrative purposes, but various equivalent modifications are possible within the scope of the disclosure, as will be recognized by those skilled in the art. For example, while the steps or functions of a method are presented in a given order, alternative embodiments may perform the functions in a different order, or the functions may be performed substantially simultaneously. The teachings of the disclosure provided herein may be applied to other procedures or methods as appropriate. The various embodiments described herein may be combined to provide further embodiments. The aspects of the disclosure may be modified, if necessary, to provide further embodiments of the disclosure using the compositions, functions, and concepts of the above-mentioned references and uses. These and other modifications may be made in light of the detailed description.

[0090] Certain elements of any of the embodiments described above may be combined with or substituted for elements in other embodiments. Furthermore, while certain advantages associated with certain embodiments of this disclosure are described in the context of those embodiments, other embodiments may also exhibit such advantages, and not all embodiments are necessarily required to exhibit such advantages to be within the scope of this disclosure.

[0091] All patents and other verified publications are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methods described in such publications that may be used in connection with the present invention. These publications are provided solely for their disclosure prior to the filing date of this application. In this regard, the inventors should not be construed as acknowledging that no prior rights are granted to such disclosure by prior invention or past publications or for any other reason. All statements relating to the dates or contents of these documents are based on information available to the applicant, but do not constitute an acknowledgment of the accuracy of the dates or contents of these documents.

[0092] Those skilled in the art will readily understand that the present invention is well adapted to perform its purpose and to obtain, in addition to the stated purpose and benefits, something unique to it. The details of the description and examples herein are representative of certain embodiments and are illustrative, and are not intended to limit the scope of the invention. Modifications and other uses herein are to be expected by those skilled in the art. These modifications are included within the spirit of the invention. It will be readily apparent to those skilled in the art that various substitutions and modifications may be added to the invention disclosed herein without departing from the scope and spirit of the invention.

[0093] The articles “a” and “an,” as used herein and in the claims, should be understood to include multiple referents unless otherwise explicitly indicated. Claims or descriptions containing “or” between one or more members of a group are considered satisfied unless otherwise explicitly indicated or otherwise evident from the context, if one, two or more, or all of the members of the group are present in, used in, or otherwise related to a given product or process. The present invention includes embodiments in which exactly one member of the group is present in, used in, or otherwise related to a given product or process. The present invention also includes embodiments in which two or more, or all, of the members of the group are present in, used in, or otherwise related to a given product or process. Furthermore, unless otherwise indicated, or unless it would be apparent to those skilled in the art that such a change would result in a contradiction or inconsistency, the present invention should be understood to provide all variations, combinations, and permutations introduced into another claim dependent on the same basic claim (or any other such claim) from one or more of the enumerated claims. All embodiments described herein are intended to be applicable to all different aspects of the present invention, where applicable. Any embodiment or aspect is also intended to be freely combined with one or more other such embodiments or aspects, where applicable. Where elements are presented as a list, for example, a group of marks or similar forms, each subgroup of elements is also disclosed, and it should be understood that any element(s) may be removed from this group. In general, where the present invention or an aspect of the present invention is considered to include certain elements, features, etc., it should be understood that a particular embodiment or aspect of the present invention consists of, or is essentially composed of, such elements, features, etc. For brevity, these embodiments are not specifically described herein in numerous terms.Regardless of whether specific exclusions are listed herein, it should also be understood that any embodiment or aspect of the present invention may be expressly excluded from the claims. For example, any one or more activators, additives, components, any agent, type of organism, ailment, subject, or combination thereof may be excluded.

[0094] Where the claims or description relate to a composition, unless otherwise indicated, or unless it would be obvious to a person skilled in the art that this would result in a contradiction or inconsistency, an embodiment of the present invention should be understood as a method of preparing or using a composition according to any of the methods disclosed herein, and a method of using a composition for any of the purposes disclosed herein. Where the claims or description relate to a method, for example, unless otherwise indicated, or unless it would be obvious to a person skilled in the art that this would result in a contradiction or inconsistency, an embodiment of the present invention should be understood as a method of preparing a composition useful for carrying out the method, and a product produced according to the method.

[0095] Where a range is given herein, the present invention includes embodiments that include an endpoint, embodiments that exclude both endpoints, and embodiments that include one endpoint and exclude the other. Unless otherwise indicated, it should be assumed that both endpoints are included. Furthermore, unless otherwise indicated, or unless otherwise evident from the context and the understanding of those skilled in the art, a value expressed as a range should be understood to mean any specific value or subrange within the range described in different embodiments of the present invention, up to one-tenth of the unit of the lower limit of that range, unless otherwise explicitly indicated in the context. Where a set of numerical values ​​is described herein, it should be further understood that the present invention includes embodiments as well as related embodiments, as well as embodiments in which the minimum value may be considered the minimum and the maximum value may be considered the maximum. Numerical values, where used herein, include values ​​expressed as percentages. In any embodiment of the present invention where a numerical value is preceded by "about" or "approximately," the present invention includes embodiments in which exact values ​​are listed. In any embodiment of the present invention in which the word "approximately" or "about" is not placed before the numerical value, the present invention includes embodiments in which the word "approximately" or "about" is placed before the value.

[0096] "Approximately" or "about" generally means, unless otherwise stated or otherwise evident from the context, a number that is within 1% in either direction (more than or less than that number), or in some embodiments, within 5% of the number, or in some embodiments, within 10% of the number (unless such a number would exceed 100% of the possible value to an unacceptable degree). Unless otherwise explicitly stated, in any method claimed herein that involves two or more acts, the order of the acts of the method is not necessarily limited to the order in which the acts of the method are enumerated, although the present invention should be understood to include embodiments in which the order is thus limited. Unless otherwise stated or otherwise evident from the context, any product or composition described herein may be considered "isolated." [Examples]

[0097] Enhanced potent green fluorescent protein (GFP) signaling for highly sensitive detection of CRISPR / Cas9-mediated in vivo gene editing events. 8 We developed a fluorescent protein-based reporter system (Figure 1A) using a transgenic mouse strain that universally expresses [specific protein]. The blue fluorescent protein (BFP) sequence is used to identify publicly available BFP variants. 9~11 Based on this, we designed the GFP sequence to have a minimum of two nucleotide substitutions (C197G and T199C) compared to the original GFP sequence. This simple modification allows for easy identification of the two fluorescent proteins by fluorescence-activated cell sorting (FACS) (Figures 5A-5D). The same two nucleotide substitutions also create a BtgI site for restriction fragment length polymorphism (RFLP) analysis. A single-stranded guide RNA (sgRNA) targeting the GFP substitution site was designed to fit the Cas9 protein (SaCas9) from Staphylococcus aureus, and for efficient disruption of the GFP signal, GFP + / - The gRNA was tested in tail fibroblasts (TTFs) derived from mdx mice (Figure 5B, 5C). For use in HDR experiments, this gRNA was inserted into a vector containing the AAV backbone along with a promoter-less BFP template lacking Kozak or an initiation ATG sequence (Figure 1B).

[0098] This color-switching system was used to test the ability of CRISPR / Cas9 to induce HDR in a regenerating stem cell population. + / - Satellite cells derived from the skeletal muscle of MDX mice were isolated and then subjected to ex vivo proliferation. 12、13Cells were transfected with a dual vector consisting of AAV-SaCas9 and AAV-GFPgRNA-BFP template (Figures 1B, 1C). This dual vector system was used when the ultimate goal was to deliver CRISPR / Cas9 and the template in vivo, and because the carrying capacity of AAV is limited to approximately 4.5-4.7 kb, it was not possible to include all components in a single vector. Next, flow cytometry was used to distinguish between NHEJ events and HDR events in the transfected cell population at single-cell resolution. The experimental group transfected with the dual vector included cells showing loss of green fluorescence (GFP-), representing inaccurate NHEJ-mediated disruption of the GFP reading frame, as well as cells showing loss of GFP and acquisition of the BFP signal (BFP+), representing HDR (Figures 1D-1G). In contrast, GFP- / BFP- and BFP+ cells were not present in the control transfection, and among them, the cells received only the AAV-GFPgRNA-BFP template (Figures 1D-1G). Similarly, when SaCas9 and gRNA were transfected without the BFP template (Figure 5D), no blue fluorescence was observed, indicating that NHEJ alone cannot induce a spectral shift from GFP to BFP. The GFP- / BFP- and BFP+ populations were separately sorted by FACS and validated by RFLP and Sanger sequencing to show that they were edited with CRISPR-NHEJ and -HDR, respectively (Figures 1I, 1J, 6B, 6C). Finally, we investigated whether these ex vivo-edited satellite cell-derived myoblasts retained myogenic capacity. Upon switching to differentiation medium, CRISPR-NHEJ (GFP- / BFP-) and CRISPR-HDR (BFP+) myoblasts fused to form myosin heavy chain-positive myotubes (Figure 6A). Furthermore, when transplanted into pre-injured TA muscle of mdx mice, the selected BFP+ myoblasts contributed to in vivo muscle repair by generating blue muscle fibers (Figure 1H).These data demonstrate that the GFP / BFP color switching system developed herein accurately and sensitively reports genomic CRISPR-NHEJ and CRISPR-HDR editing events at single-cell resolution, and allows for subsequent tracking of in vivo regeneration results of edited cells.

[0099] The usefulness of the inventors' reporter system, aimed at tracking CRISPR-mediated gene editing events in vivo, was evaluated. AAV was generated using the aforementioned vector and packaged with serotype 8, which exhibits high tropism to the liver, heart, and skeletal muscle. 14 CRISPR-HDR vectors were used in young (P21) male GFP + / - It was injected intravenously into mdx mice (Figure 2A). 1 × 10⁶ mice were given to control mice (AAV control). 13 While each mouse was treated with only the AAV-GFPgRNA-BFP template of the viral genome (vg), the experimental mice (AAV-HDR) were treated with 1 × 10⁶ 13 vg AAV-GFPgRNA-BFP template and 5×10 12 Vg AAV-SaCas9 was administered. For analysis, mice were euthanized 3 weeks after injection (Figure 2A). Widespread loss of GFP signaling and acquisition of BFP signaling were detected in the livers of all experimental mice injected with AAV-HDR, but not in AAV control injected animals (Figure 2B). On average, 65.7% (range, 62–70%) of hepatocytes were edited with NHEJ and showed a decrease in GFP fluorescence, while 11.9% (range, 9–13%) of cells were edited with HDR and became BFP+ (Figure 2C), which was consistent with recently reported CRISPR-HDR editing rates in neonatal livers. 6、7 The majority of BFP+ liver cells were also GFP-, increasing the reliability of the reporter system and quantification strategy. Next-generation sequencing further confirmed CRISPR-NHEJ and CRISPR-HDR editing in the livers of experimental mice (Figures 10A, 10B). Recent publications 15While concerns have been raised regarding hepatotoxicity in non-human primates and piglets injected systemically with high doses of AAV (particularly the AAV9 variant), no lethality or apparent adverse effects on overall health were observed in AAV-injected mice in this study. These studies confirm the sensitivity and accuracy of the inventors' fluorescence imaging-based system, which aims to quantify CRISPR editing events in vivo without the need for immunostaining or signal amplification of tissue sections.

[0100] Skeletal muscle is primarily a post-mitotic tissue, mainly composed of multinucleated muscle fibers formed by the fusion of myogenic precursors derived from satellite cells. The inventors modified the Dmd reading frame in dystrophy mdx mice and restored dystrophin expression and function by utilizing AAV-CRISPR-mediated NHEJ in muscle to delete or skip Dmd exon 23. 16~18 However, past attempts at AAV-CRISPR-mediated HDR in muscle 19However, only a small amount of editing was produced (only 0.18% of alleles were edited), which may be due to the use of a muscle-specific promoter (CK8), which restricts Cas9 expression to mature muscle fibers. Therefore, the inventors evaluated the potential of CRISPR-HDR in the skeletal muscle of mdx mice whole-body-treated with the AAV-GFPgRNA-BFP template and AAV-SaCas9, which is controlled by a wide range of active regulatory elements that will be expressed in muscle fibers and their precursors, compared to a control treated with only the AAV-GFPgRNA-BFP template (Figure 2A). Notably, the inventors observed widespread BFP+ muscle fibers in the tibialis anterior muscle (TA) of all experimental mice (Figures 2F, 7). In contrast, BFP+ fibers were not present in the control (Figures 2F, 7). On average, 36.7% (range, 32–41%) of fibers were BFP+ in AAV-HDR-injected mice (P21), indicating potent HDR-mediated gene substitution (Figure 2G). While virtually no fibers showed complete loss of GFP signaling (as expected, since complete loss of green fluorescence would require CRISPR / Cas9 targeting of all or nearly all of the hundreds of myonuclei in these cells), both HDR-edited and NHEJ-edited genomic sequences were detected and confirmed by NGS (Figures 9A–9B). Furthermore, satellite cells from dual-AAV treated mice were found to be BFP+ (Figure 14).

[0101] Considering the relatively high percentage of BFP+ muscle fibers detected in this study, compared to the previously reported low efficiency of AAV-CRISPR-mediated HDR using muscle fiber-specific promoters, this study is noteworthy. 19 The inventors hypothesized that skeletal muscle stem cells could be targeted in their system, and that edited progenitor cells were then incorporated into muscle fibers. Therefore, the inventors used a widely validated surface marker profile (Ter119 - CD45 - Symptom 1 - Sca1 - CXCR4 + β1-integrin + We isolated muscle stem cells from AAV-HDR injected mice using ).12、13、20 This is consistent with the data previously released by the group of inventors. 16 Approximately 5% of FACS-isolated muscle stem cells were GFP- / BFP-, indicating in vivo disruption by AAV-CRISPR-NHEJ (Figures 3A, 3C). Importantly, the inventors also detected a smaller population (approximately 1%) of muscle stem cells that were BFP+, suggesting in vivo HDR editing by AAV-CRISPR (Figures 3A, 3B). Acquisition of blue fluorescence and loss of green fluorescence in this population were verified by re-selection of cultured proliferating cells (Figure 7) and sequencing analysis (Figure 9). To test the myogenic function of these in vivo edited satellite cells, the inventors grew them in culture and performed differentiation assays ex vivo. In vivo NHEJ and HDR-edited satellite cells retained the ability to fuse to form GFP- / BFP- and BFP+ myotubes, respectively (Figure 7D).

[0102] Similar to skeletal muscle, cardiac muscle is involved in a wide range of genetic disorders that could benefit from in vivo therapeutic gene editing; however, postnatal cardiac muscle exhibits limited proliferative activity and remarkably low regenerative capacity. 21、22 The inventors recorded AAV-CRISPR-mediated in vivo gene disruption in the hearts of neonatal and juvenile mice, but the relative efficiency of HDR versus NHEJ in this tissue has not been sufficiently tested. 16~19、23 In mice injected systemically with P21 AAV-HDR, the majority of cardiomyocytes (average 62%) lost GFP signaling, indicating high levels of NHEJ-mediated disruption of genomic GFP sequences (Figures 2D-2E). BFP+ cardiomyocytes were also present, albeit rarely (average approximately 0.58%) in all experimental mice (Figures 2D-2E). In contrast, neither GFP disruption nor BFP fluorescence was detected in AAV control mice (Figures 2D-2E).

[0103] The inventors hypothesized that the lack of proliferating cardiomyocytes in mice after P21, and the minimal contribution of endogenous cardiomyocyte progenitor cells to homeostasis, could explain the lower rate of HDR observed in cardiac muscle compared to skeletal muscle. 21、22、24The inventors further hypothesized that early administration of AAV may enhance HDR editing efficiency in organs such as the heart, which retain proliferating cells in the neonatal period but later become postmitted. The inventors also considered the mild pathophysiology of mdx mice. 25 However, they wondered whether it could affect the editing efficiency of cardiomyocytes. Therefore, the inventors investigated the GFP of P3. + / - ;mdx or GFP + / - C57BL / 6J (male and female) mice were administered the AAV-HDR vector by intraperitoneal injection (Figure 4A). AAV control animals received 3 × 10⁶ doses. 12 Only the vg / mouse AAV-gRNA template was applied, and the experimental mice (AAV-HDR) were given the same dose of AAV-gRNA template at 1 × 10⁶. 12 The treatment was performed with vg / mouse AAV-SaCas9. Similar percentages of BFP+ and GFP- / BFP- hepatocytes were detected regardless of genetic background (Figure 4B and Figure 9A). In addition, the frequency of BFP+ hepatocytes was similar between P3 and P21 experiments (approximately 10% BFP+ hepatocytes on average, Figure 2C and Figure 4C). However, the frequency of NHEJ-edited hepatocytes was reduced in neonatal mice injected (approximately 28% hepatocytes on average, Figure 4C), which may reflect the more active proliferation rate of early neonatal hepatocytes, potentially leading to a more rapid dilution loss of unintegrated AAV episomes. 26 .

[0104] The inventors also evaluated the HDR rate in cardiomyocytes and skeletal muscle after systemic administration of AAV-CRISPR to P3 neonates. BFP+ cells accounted for a mean 3.5% (range, 1.6%–4.6%) of cardiomyocytes, a frequency significantly higher than that of BFP+ cells in the hearts of P21 injected mice (Figures 4D–4E and 2D–2E). GFP- / BFP- cardiomyocytes were detected at similar rates (>60%) between the two experiments (Figures 2E and 4E), suggesting that the age-dependent differences observed in HDR did not reflect differences in the efficiency of AAV transduction. In contrast, the inventors observed no substantial acquisition of BFP signaling in skeletal muscle sections in either mdx or C57BL / 6J backgrounds (Figure 4F), which was consistent with the rare BFP+ skeletal muscle satellite cells in these muscles (0.05–0.17% BFP+, Figure 11). As mentioned above, the loss of GFP signaling could not be evaluated due to the confounding effect of muscle fiber multinucleation. In addition, these data reveal individual developmental time constraints in in vivo CRISPR-HDR gene editing in striated muscle, which offers the possibility of targeting (or detargeting) specific tissues by adjusting the timing of AAV-CRISPR administration. Whether similar developmentally controlled windows of CRISPR-HDR reachability exist in other cell types is an interesting avenue for future investigation.

[0105] The results described above are further validated by the data shown in Figure 13, which demonstrates the disappearance of GFP in the liver, heart, and muscle (TA) of dual AAV-treated animals (both P3 and P21), as well as the selective acquisition of BFP signaling (showing HDR) in P21 muscle tissue and P3 cardiac tissue.

[0106] Surprisingly and unexpectedly, the inventors, using a GFP-BFP color-switching reporter system that enables in vivo tracking of genome editing results at the single-cell level, discovered that postnatal cardiomyocytes, skeletal muscle cells, and muscle stem cells undergo template HDR at different developmental stages in mice. Systemic delivery of CRISPR-Cas9 editing components by adeno-associated virus (AAV-CRISPR) confirmed efficient NHEJ and HDR in the liver, which is consistent with previous reports (Yang, Y. et al. Nat Biotechnol 34, 334-338 (2016), Yin, H. et al. Nat Biotechnol 34, 328-333 (2016)). In addition, HDR-edited muscle stem cells and muscle fibers were detected in mice injected with AAV-CRISPR at postnatal day 21 (P21), but not at P3. On the other hand, HDR-edited cardiac cells were detected in P3-injected animals, but were almost undetectable in P21-injected animals. The inventors' results reveal the potential of sequence-specific, whole-body-dispersed in vivo AAV-CRISPR-mediated HDR in striated muscle and muscle stem cells at individual postnatal points, providing new opportunities for therapeutic development.

[0107] In conclusion, the inventors' study reports a simple yet highly effective tool for tracking in vivo NHEJ and HDR gene editing results at single-cell resolution. Furthermore, by systemic delivery of the gRNA program Cas9 via AAV, the inventors reveal an unexpected opportunity for precise targeted gene substitution by HDR in skeletal muscle and cardiac muscle, both postmittal tissues widely considered unreachable by this approach. To the inventors' knowledge, the inventors' data provide the first demonstration of significant in vivo HDR editing in postnatal cardiac tissue by systemic AAV delivery of CRISPR / Cas9, demonstrating a substantial improvement over previously reported HDR editing rates achievable in skeletal muscle by localized intramuscular delivery. 19、27The inventors' research also provides the first demonstration of successful HDR editing in tissue stem cells within the cell's natural niche, enabling unparalleled therapeutic and experimental manipulation of stem cell genomes without the need to isolate, grow, or transplant these rare cells. Ultimately, the ability to imprint irreversible and permanently precise genome modifications into neonatal mammalian heart and postnatal mammalian skeletal muscle satellite cells opens exciting new avenues for future therapeutic interventions for many currently intractable heart and muscle diseases.

[0108] animal

[0109] Hemizygous GFP transgenic mice possessing a single transgenic allele were used to create CAG-GFP mice. 8 to C57BL / 6J or C57BL / 10ScSn-Dmd mdx Produced by crossing with either / J(mdx)(Jackson Labs). GFP at 3 days postpartum (P3). + / - ;mdx and GFP + / - C57BL / 6J offspring (both male and female) were used for neonatal intraperitoneal (IP) injection, and GFP was obtained in 3-week-old males. + / - MDX mice were used for juvenile intravenous (posterior orbital) injection. The mice were maintained at the Harvard Biological Research Infrastructure in accordance with animal rearing and experimental protocols approved by the Harvard University Institutional Animal Care and Use Committee (IACUC).

[0110] AAV production and administration

[0111] AAV is a gene therapy developed by the Grousbeck Gene Therapy Center at the Schepens Eye Research Institute and Massachusetts Eye and Ear Infirmary (SERI / MEEI). Produced by the Transfer Vector Core (GTVC) and titer measured, packaged with serotype 8 as previously described 28 . Briefly, semiconfluent HEK293 cells were transfected with the rep2-cap8 packaging construct, the adenovirus helper function plasmid, and the ITR flanking transgene construct. Three days after transfection, the medium and cells were harvested and lysed and benzonase digested to remove non-particle associated DNA. The particles were purified and concentrated using tangential flow filtration, iodixanol density centrifugation, and buffer exchange into a PBS-based buffer. For neonatal (P3) intraperitoneal injection, control mice were administered only 3×10 12 viral genomes (vg) of the AAV-GFPgRNA-BFP template, and experimental mice were administered 3×10 12 vg of the AAV-GFPgRNA-BFP template and 1×10 12 vg of AAV-SaCas9. The virus was diluted with 75 μL of vehicle (PBS containing 35 mM NaCl) per injection. Mice were euthanized for analysis 4 weeks after injection. For juvenile (P21) retro-orbital injection, control mice were administered only 1×10 13 vg of the AAV-GFPgRNA-BFP template, and experimental mice were administered 1×10 13 vg of the AAV-GFPgRNA-BFP template and 5×10 12 vg of AAV-SaCas9. The virus was diluted with 312 μL of vehicle (PBS containing 35 mM NaCl) per injection. Mice were euthanized for analysis 3 weeks after injection.

[0112] Gene editing construct

[0113] The AAV-SaCas9 plasmid has been previously described 16The AAV-GFPgRNA-BFP template plasmid was generated by Gibson assembly of a pZac2.1AAV vector containing three insertions. The vector was double digested with HindIII-HF and NotI-HF (NEB). Insertion 1 (U6-GFPgRNA) was PCR amplified from the plasmid containing U6-GFPgRNA. Insertion 2 (BFP) was PCR amplified from a BFP sequence synthesized as gBlock (IDT). Insertion 3 (PolyA) was PCR amplified from the genomic DNA of a CAG-GFP transgenic animal. A two-base substitution on the BFP template enables a color switch (from green fluorescence to blue fluorescence), generating a restriction fragment length polymorphism (RFLP) detectable by BtgI restriction enzyme.

[0114] Isolation, culture, and differentiation of satellite cells

[0115] Satellite cells for ex vivo gene editing were isolated as previously described. 12To isolate in vivo-edited satellite cells, triceps, abdominal, and hind limb muscles were harvested from half of the body, finely chopped using scissors, and then subjected to two rounds of digestion at 37°C (15 minutes, followed by 10 minutes) using 0.2% collagenase type II and 0.05% dispase in DMEM (GIBCO). The enzyme was inactivated by adding FBS, the cells were centrifuged and filtered through a 70 μm strainer, and then stained for 30 minutes with an antibody cocktail containing APC-Cy7-CD45 (Biolegend, 1:200), APC-Cy7-CD11b (Biolegend, 1:200), APC-Cy7-TER119 (Biolegend, 1:200), APC-Sca1 (Biolegend, 1:200), PE-CD29 (Biolegend, 1:100), and biotin-CD184 (BD Biosciences, 1:100). After incubation of the primary antibody, the cells were washed with staining medium (SM, Hanks equilibrium salt solution + 2% serum) and then stained for a further 20 minutes with streptavidin PE-Cy7 (Biolegend, 1:200). Finally, the cells were washed twice in SM and resuspended in SM containing propidium iodide (PI) to mark dead cells. Satellite cells were sorted using FACS Aria II (BD Biosciences) based on cell PI incorporation and lack of CD45, Ter119, Sca1, and CD11b expression, as well as positive expression of CXCR4 (CD184) and β1-integrin (CD29). Surface marker profiles were used to select Pax7+ cells due to their potent myogenic potential, according to multiple publications. 12、13、20This method has been widely validated. Separately selected GFP+, BFP+, and GFP- / BFP- satellite cells were grown on collagen type I (1 ug / mL, Sigma) and laminin (10 ug / mL, Invitrogen) coated plates in growth medium (F10, 20% horse serum, 1% Pen Strep, and 1% Glutamax (Gibco)) supplemented daily with 5 ng / mL bFGF (Sigma). DNA was isolated from a subset of the proliferating cells, collected using QuickExtract (Lucigen), and used for genomic PCR and subsequent RFLP and sequencing analysis. Myogenic differentiation was initiated by switching to differentiation medium (DMEM, 2% horse serum, 1% Pen Strep, 1% Glutamax (Gibco)) and lasted for 3-4 days. Cells were fixed with 4% PFA for 20 minutes for imaging.

[0116] Transfection

[0117] Male MDX; GFP + / - Satellite cells isolated from animals were cultured for 2-3 weeks in growth medium supplemented daily with bFGF, and then re-seeded at 20,000 cells / well on 24-well plates coated with collagen (1 ug / mL) and laminin (10 ug / mL). Myoblasts were transfected on day 2 using Lipofectamine 3000 (Invitrogen) according to the manufacturer's instructions, with the control group receiving only the AAV-GFPgRNA-BFP template plasmid, or the experimental group receiving the AAV-GFPgRNA-BFP template and the AAV-SaCas9 plasmid in a 5:1 ratio (three independent transfections per group). BFP + and GFP + Cells were sorted using FACS Aria II 5 days after transfection, grown in vitro for a further 2 weeks, and then resorted and confirmed to be fluorescent. The resorted cells were then used in in vitro differentiation and in vivo transplantation assays.

[0118] mdx;GFP + / -To test GFP disruption in primary myoblasts, cells were transfected with either lipofectamine alone (control) or with plasmids encoding SaCas9 and GFPgRNA2 (without BFP template) in a 1:1 ratio, as described above.

[0119] For screening GFP-targeted gRNAs, use mdx;GFP + / - Tail fibroblasts (TTFs) were transfected with Lipofectamine 3000 using either SaCas9 alone (control) or SaCas9 and one of three gRNAs targeting GFP, according to the manufacturer's instructions.

[0120] myoblast transplantation

[0121] One day before myoblast transplantation, 25 μL of Naja mossambica mossambica cardiotoxin (0.03 mg / mL, Sigma) was injected into the tibialis anterior muscle (TA) of anesthetized male mdx recipient mice. 800,000 GFP + , 800,000 BFP + Myoblasts or vehicle (PBS) alone were injected into pre-injured TA muscle cells (N=4 TA muscle cells). The injected TA muscle cells were collected 5 weeks after transplantation for frozen sectioning and fluorescence detection.

[0122] Genome PCR and RFLP analysis

[0123] Genomic DNA was extracted from tissue, satellite cells, and proliferating myoblasts using QuickExtract DNA Extraction Solution (Epicentre / Lucigen) according to the manufacturing protocol. 1-2 μL of QuickExtract solution was used for each 25 μL of PCR reaction product mediated by Q5 hot-start polymerase (NEB). Transgene loci were amplified using the forward primer GTGCTGTCTCATCATTTTGGC (SEQ ID NO: 21) (which binds upstream of the GFP / BFP start site) and the reverse primer TCGGTCTGCTTCATGTGGTC (SEQ ID NO: 22) (which binds downstream of the Cas9 cleavage site and color-switching substitution), but the template sequence was not amplified. For RFLP analysis, PCR products were purified using the QIAquick PCR Purification Kit (Qiagen), digested with BtgI (NEB) or simulated digestion with water, and then subjected to gel electrophoresis on E-Gel EX 2% agarose gel (Invitrogen).

[0124] Sanger sequencing and next-generation sequencing

[0125] Purified genomic PCR products were cloned into the TOPO backbone using the Zero Blunt TOPO PCR cloning kit (Invitrogen) and transformed into TOP10 competent cells (Invitrogen). Individual clones were analyzed by bacterial colony Sanger sequencing performed by Genewiz in Cambridge, MA. Sequencing records were aligned to the GFP transgene using the Geneious program. For next-generation sequencing, 8-base pair (bp) barcodes were added to the genomic PCR primers. 4–10 uniquely barcoded PCR products were pooled, purified by PCR, and then analyzed by CRISPR sequencing using MGH DNA core (available at / / dnacore.mgh.harvard.edu / on the World Wide Web). NGS results were analyzed using the CRISPResso program after multiplexing. Representative NGS sequences are shown.

[0126] Sectioning and fluorescence imaging

[0127] The tissue was dissected and immediately fixed in 4% PFA at room temperature for 90 minutes, then washed with PBS and transferred to 30% sucrose, incubated overnight at 4°C. The immersed tissue was then embedded in OCT compound (Tissue-Tek) and frozen in isopentane in a liquid nitrogen bath. The tissue was sectioned using Microm HM550 (Thermo Scientific) and stained with Alexa Fluor555-wheat germ agglutinin and TO-PRO-3 iodide (Life Technologies) according to the manufacturer's instructions. BFP + GFP - (BFP - The number of cells (including all cells) and the total number of cells were manually quantified using ImageJ. For the liver and heart, three representative fields containing approximately 200-350 cells each were counted for each tissue. For P21 injection TA sections, images of the combined fields (25 images at 20x magnification) were counted with more than 1000 cells per image.

[0128] statistical analysis

[0129] GraphPad Prism 7.0 software was used to perform the statistical analysis. Independent two-tailed t-tests were performed in Figures 1F-1G. One-way ANOVA with Tukey's multiple comparison test was performed in Figures 3B-3C and 11B-11C. The exact p-values ​​and degrees of freedom (DF) can be found in the captions of the corresponding figures.

[0130] References

[0131] 1. Symington, LS & Gautier, J. Double-strand break end resection and repair pathway choice.Annu Rev Genet 45,247-271,doi:10.1146 / annurev-genet-110410-132435(2011).

[0132] 2. Heyer, WD, Ehmsen, KT & Liu, J. Regulation of homologous recombination in eukaryotes. Annu Rev Genet 44, 113-139, doi:10.1146 / annurev-genet-051710-150955 (2010).

[0133] 3.Ishizu, T. et al.Targeted Genome Replacement via Homology-directed Repair in Non-dividing Cardiomyocytes.Sci Rep 7,9363,doi:10.1038 / s41598-017-09716-x(2017).

[0134] 4.Long,C.et al.Prevention of muscular dystrophy in mice by CRISPR / Cas9-mediated editing of germline DNA.Science 345,1184-1188,doi:10.1126 / science.1254445(2014).

[0135] 5.Nishiyama,J.,Mikuni,T.&Yasuda,R.Virus-Mediated Genome Editing via Homology-Directed Repair in Mitotic and Postmitotic Cells in Mammalian Brain.Neuron 96,755-768 e755,doi:10.1016 / j.neuron.2017.10.004(2017).

[0136] 6.Yang,Y.et al.A dual AAV system enables the Cas9-mediated correction of a metabolic liver disease in newborn mice.Nat Biotechnol 34,334-338,doi:10.1038 / nbt.3469(2016).

[0137] 7.Yin,H.et al.Therapeutic genome editing by combined viral and non-viral delivery of CRISPR system components in vivo.Nat Biotechnol 34,328-333,doi:10.1038 / nbt.3471(2016).

[0138] 8.Wright,D.E.et al.Cyclophosphamide / granulocyte colony-stimulating factor causes selective mobilization of bone marrow hematopoietic stem cells into the blood after M phase of the cell cycle.Blood 97,2278-2285(2001).

[0139] 9.Chu,V.T.et al.Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells.Nat Biotechnol 33,543-548,doi:10.1038 / nbt.3198(2015).

[0140] 10.Glaser,A.,McColl,B.&Vadolas,J.GFP to BFP Conversion:A Versatile Assay for the Quantification of CRISPR / Cas9-mediated Genome Editing.Molecular therapy.Nucleic acids 5,e334,doi:10.1038 / mtna.2016.48(2016).

[0141] 11.Richardson,C.D.,Ray,G.J.,DeWitt,M.A.,Curie,G.L.&Corn,J.E.Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA.Nat Biotechnol 34,339-344,doi:10.1038 / nbt.3481(2016).

[0142] 12.Cerletti,M.et al.Highly efficient,functional engraftment of skeletal muscle stem cells in dystrophic muscles.Cell 134,37-47(2008).

[0143] 13.Sherwood,R.I.et al.Isolation of adult mouse myogenic progenitors:functional heterogeneity of cells within and engrafting skeletal muscle.Cell 119,543-554,doi:10.1016 / j.cell.2004.10.021(2004).

[0144] 14.Zincarelli,C.,Soltys,S.,Rengo,G.&Rabinowitz,J.E.Analysis of AAV serotypes 1-9 mediated gene expression and tropism in mice after systemic injection.Mol Ther 16,1073-1080,doi:10.1038 / mt.2008.76(2008).

[0145] 15.Hinderer,C.et al.Severe Toxicity in Nonhuman Primates and Piglets Following High-Dose Intravenous Administration of an Adeno-Associated Virus Vector Expressing Human SMN.Human gene therapy,doi:10.1089 / hum.2018.015(2018).

[0146] 16.Tabebordbar,M.et al.In vivo gene editing in dystrophic mouse muscle and muscle stem cells.Science 351,407-411,doi:10.1126 / science.aad5177(2016).

[0147] 17.Nelson,C.E.et al.In vivo genome editing improves muscle function in a mouse model of Duchenne muscular dystrophy.Science 351,403-407,doi:10.1126 / science.aad5143(2016).

[0148] 18.Long,C.et al.Postnatal genome editing partially restores dystrophin expression in a mouse model of muscular dystrophy.Science 351,400-403,doi:10.1126 / science.aad5725(2016).

[0149] 19.Bengtsson,N.E.et al.Muscle-specific CRISPR / Cas9 dystrophin gene editing ameliorates pathophysiology in a mouse model for Duchenne muscular dystrophy.Nature communications 8,14454,doi:10.1038 / ncomms14454(2017).

[0150] 20.Maesner,C.C.,Almada,A.E.&Wagers,A.J.Established cell surface markers efficiently isolate highly overlapping populations of skeletal muscle satellite cells by fluorescence-activated cell sorting.Skelet Muscle 6,35,doi:10.1186 / s13395-016-0106-6(2016).

[0151] 21.Alkass,K.et al.No Evidence for Cardiomyocyte Number Expansion in Preadolescent Mice.Cell 163,1026-1036,doi:10.1016 / j.cell.2015.10.035(2015).

[0152] 22.Senyo,S.E.et al.Mammalian heart renewal by pre-existing cardiomyocytes.Nature 493,433-436,doi:10.1038 / nature11682(2013).

[0153] 23.Johansen,A.K.et al.Postnatal Cardiac Gene Editing Using CRISPR / Cas9 With AAV9-Mediated Delivery of Short Guide RNAs Results in Mosaic Gene Disruption.Circ Res 121,1168-1181,doi:10.1161 / CIRCRESAHA.116.310370(2017).

[0154] 24.Cai,C.L.&Molkentin,J.D.The Elusive Progenitor Cell in Cardiac Regeneration:Slip Slidin’ Away.Circ Res 120,400-406,doi:10.1161 / CIRCRESAHA.116.309710(2017).

[0155] 25.McGreevy,J.W.,Hakim,C.H.,McIntosh,M.A.&Duan,D.Animal models of Duchenne muscular dystrophy:from basic mechanisms to gene therapy.Dis Model Mech 8,195-213,doi:10.1242 / dmm.018424(2015).

[0156] 26.Wang,L.,Wang,H.,Bell,P.,McMenamin,D.&Wilson,J.M.Hepatic gene transfer in neonatal mice by adeno-associated virus serotype 8 vector.Human gene therapy 23,533-539,doi:10.1089 / hum.2011.183(2012).

[0157] 27.Lee,K.et al.Nanoparticle delivery of Cas9 ribonucleoprotein and donor DNA in vivo induces homology-directed DNA repair.Nature Biomedical Engineering 1,889(2017).

[0158] 28.Zinn,E.et al.In Silico Reconstruction of the Viral Evolutionary Lineage Yields a Potent Gene Therapy Vector.Cell Rep 12,1056-1068,doi:10.1016 / j.celrep.2015.07.019(2015).

Claims

[Claim 1] The invention described in the specification.

Images