Stabilizing compositions and methods for preserving body fluids

JP2026131747APending Publication Date: 2026-08-14DNA GENOTEK
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2026-06-03
Publication Date
2026-08-14

Smart Images

  • Figure 2026131747000001_ABST
    Figure 2026131747000001_ABST
Patent Text Reader

Abstract

The present invention provides a stabilizing composition for preserving body fluids at ambient temperature. [Solution] An aqueous stabilizing composition for preserving body fluids at ambient temperature, comprising a sugar selected from monosaccharides, disaccharides, or combinations thereof; a buffering agent; a C1-C6 alkanol; boric acid, a salt of boric acid, or a combination thereof; and a chelating agent, wherein the composition has a pH of 4.5 to 5.2.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a stabilization composition and method for preserving body fluids at ambient temperature. [Background technology]

[0002] Urine is a complex liquid byproduct of metabolism in most animals and is used in a variety of analytical tests. In humans, urine consists mainly of water and organic solutes, including urea, creatinine, uric acid, and trace amounts of enzymes, carbohydrates, hormones, fatty acids, pigments, mucin, and inorganic ions. Even from healthy individuals, urine also contains red blood cells, white blood cells, urothelial cells, renal cells, prostate cells, and bacteria. Due to the direct shedding of cells and cell-free material from the genitourinary tract into this sample type, urine is a valuable source of biomarkers for the study of urinary pathology. Urine from pregnant women is also a useful source of fetal DNA for non-invasive prenatal diagnosis and prognosis testing (NBY Tsui, P Jiang, KCK Chow, X Su, TY Leung, H Sun, KCA Chan, RWK Chiu and YMD Lo (2012). High resolution size analysis of fetal DNA in the urine of pregnant women by paired-end massively parallel sequencing. PLoS ONE 7(10):e48319).

[0003] Urinary cell-free DNA (UcfDNA) originates from either cells shed into the urine from the urogenital tract or circulating cell-free DNA (cfDNA) passing through glomerular filtration. cfDNA exists as fragmented nucleic acids in various extracellular fluids, including urine, in both healthy individuals and those with diseases (e.g., diabetes, cardiovascular disease, organ transplantation, stroke, epilepsy, autoimmune diseases, sepsis, and trauma), and serves as an important tool for liquid biopsy (R Meddeb, E Pisareva, AR Thierry (2019) Guidelines for the preanalytical conditions for analyzing circulating cell-free DNA.Clin Chem 65(5):623-633.Doi:10.1373 / clinchem.2018.298323;CM Stewart,PD Kothari,F Mouliere,R Mair,S Somnay,R Benayed,A Zehir,B Weigelt,SJ Dawson,ME Arcila,MF Berger,DWY Tsui(2018)The value of cell-free DNA for molecular pathology.J Pathol 244(5):616-627.Doi:10.1002 / path.5048). UcfDNA is considered to have the potential to be a useful and ultra-non-invasive tool for cancer screening, diagnosis, prognosis, and monitoring of cancer progression and treatment effectiveness (T Lu and J Li (2017) Clinical applications of urinary cell-free DNA in cancer: Current insights and promising future. Am J Cancer Res 7(11):2318-2332; S Van Keer, J Pattyn, WAA Tjalma, X Van Ostade, M Ieven, P Van Damme, A Vorsters (2017) First-void urine: A potential biomarker source for triage of high-risk human papillomavirus infected women. Eur J Obstetrics & Gynecology and Reproductive Biology 216:1-11). For example, it has recently been reported that first-void urine contains a higher risk of human papillomavirus (4.8 to 160 times more) and human DNA than later fractions (A Vorsters, P Van Damme, G Clifford (2014) Urine testing for HPV: rationale for using first void. BMJ 349:g6252).

[0004] Despite growing interest in cell-free DNA (cfDNA) analysis across various clinical fields, particularly in oncology and prenatal diagnosis, little research has been reported on sample handling, and no analytical consensus is available. Nucleated cells, inevitably found in urine, can release genomic DNA into the urine, leading to an increase in the DNA background during sample processing and storage. In addition, enzymatic degradation can obscure true cfDNA levels, given their relatively small molecular weight. Therefore, urine samples require special handling, such as processing within a short time (2-4 hours) of collection, refrigeration after collection, or preservation using stabilizing compounds. Given the collectibility of the samples, preservatives are preferably used to maintain the original proportion and integrity of cfDNA in the urine after sample collection.

[0005] UcfDNA has great potential as a non-invasive form of liquid biopsy. DNA can be present in both the cellular and cell-free fractions of urine, and the procedures used for DNA collection and processing significantly affect the results of biomarker analysis (LK Larsen, GE Lind, P Guldberg, C Dahl (2019) DNA-methylation-based detection of urological cancer in urine: Overview of biomarkers and considerations on biomarker design, source of DNA, and detection technologies. Int J Mol Sci 20,2657). Because cells and DNA in urine are easily degraded during storage (THT Cheng, P Jiang, JCW Tam, X Sun, WS Lee, SCY Yu, JTC Teoh, PKF Chiu, CF Ng, KM Chow, CC Szeto, KCA Chan, RWK Chiu, YMD Lo (2017) Whole-genome bisulfite sequencing reveals the origin and time-dependent fragmentation of urinary cfDNA. Clin Biochem 50(9):496-501. Doi:10.1016 / j.clinbiochem.2017.02.017), proper storage is important if urine samples are not processed immediately. Human urine provides a suitable environment for the function of nucleic acid hydrolases (nucleases). Specifically, DNase I is the major DNA hydrolase in urine, and its activity in urine is more than 100 times higher than its activity in serum (OE Bryzgunova, PP Laktionov (2015) Extracellular nucleic acids in urine: sources, structure, diagnostics). potential.Acta Naturae Vol 7(3):48-54.Doi:10.32607 / 20758251-2015-7-3-48-54). The half-life of ucfDNA at body temperature is approximately 2.6 to 5.1 hours (THT Cheng et al. (2017), see above). Currently, none of the registered in vitro cancer diagnostics (IVDs) are purely based on ucfDNA (WJ Locke, D Guanzon, C Ma, YJ Liew, KR Duesing, KYC Fung, JP Ross (2019) DNA methylation cancer biomarkers: translation to the clinic. Front Genet 10:1150.Doi:10.3389 / fgene.2019.01150). One of the main reasons is that the workflow for storing ucfDNA is not yet standardized. Therefore, for the effective and efficient use of any biochemical and molecular genetic test, the sample collection process, sample transport, sample processing, and sample storage / stability should be optimized and standardized.

[0006] In healthy individuals, cfDNA originates from apoptosis of nucleated cells (M Stroun, J Lyautey, C Lederrey, A Olson-Sand, P Anker (2001) About the possible origin and Mechanism of circulating DNA apoptosis and active DNA release. Clin Chim Acta 313(1-2):139-142. In malignant tumors, the tumor-derived fraction of total cfDNA, called circulating tumor DNA (ctDNA), can originate from tumor cells through a combination of apoptosis, necrosis, and active secretion (M Stroun et al. (2001) supra; S Jahr, H Hentze, S Englisch, D Hardt, FO Fackelmayer, RD Hesch, R Knippers (2001) DNA fragments in the blood plasma of cancer patients: quantities and evidence for their origin from apoptotic and necrotic). cells.Cancer Res 61(4):1659-1665;OE Bryzgunova et al.(2015, see above). ctDNA contains tumor-specific mutations, copy number variations, and changes in DNA methylation status (G Santoni,MB). Morelli, C. Amantini, N. Battelli (2018) Urinary markers in bladder cancer: An update. Front Oncol 8:362. Doi:10.3389 / fonc.2018.00362). ctDNA levels often increase with tumor volume and can be used to predict response to targeted immunotherapy, monitor tumor heterogeneity, and identify expanding drug-resistant tumor clones (RJ Diefenbach, JH Lee, RF Kefford, H. Rizos (2018) Evaluation of commercial kits for purification of circulating free DNA. Cancer Genetics 228-229:21-27. Doi:10.1016 / j.cancergen.2018.08.005).

[0007] Cancer diagnosis has begun to move away from reliance solely on direct tumor tissue biopsies for cancer detection, diagnosis, and treatment monitoring. Next-generation sequencing and genomic bioinformatics analysis have brought about a new paradigm shift from microscopic-level histological diagnosis to molecular-genomic-level cancer diagnosis. Novel non-invasive cancer diagnostic platforms, such as liquid biopsies from bodily fluids (i.e., blood, plasma, urine, etc.), are being used to investigate ctDNA or circulating tumor cells, proteomics, metabolomics, and exosomes, among other analytes, which are being used to assay ctDNA (X Wu, L Zhu and PC Ma. Next-generation novel non-invasive cancer molecular diagnostics platforms beyond tissues.Am Soc Clin Oncol Educ Book.2018 May 23;(38):964-977.Doi:10.1200 / EDBK_199767).

[0008] Molecular biomarkers have been extensively investigated and may contribute to the early detection, monitoring, and prediction of treatment responses in cancer patients (L Cerchietti and A Melnick (2017) DNA methylation-based biomarkers. J Clin Oncol 35(7):793-795). These biomarkers represent genetic and epigenetic events associated with the development and progression of cancer. DNA hypermethylation is one example of an epigenetic process. The detection of hypermethylated DNA in bodily fluids such as urine and blood is of interest as an oncological biomarker. A significant advance in cancer treatment is "liquid biopsy," which involves the analysis of genetic material from tumor cells that have been shed into bodily fluids from primary or metastatic tumors. Liquid biopsy typically involves cfDNA, This involves the extraction and analysis of cells derived from RNA (miRNA, lncRNA, and mRNA), proteins, peptides, exosomes, or biological fluids such as blood, urine, saliva, and cerebrospinal fluid (AD Meo, J Bartlett, Y Cheng, MD Pasic, GM Yousef (2017) Liquid biopsy: A step forward towards precision medicine in urologic malignancies. Mol Cancer 16:80. Doi:10.1186 / s12943-017-0644-5). Of the various liquid biopsy samples, urine and saliva are easily obtained without requiring sample collection specialists and enable real-time monitoring of the disease through continuous sampling.

[0009] Cell-free circulating DNA in plasma was first observed in 1948 by Mandel and Metais (P Mandel, P Metais (1948) Les acides nucleiques du plasma sanguine chez l'homme. CR Acad Sci Paris:241-243). Increased levels of free DNA in the serum and plasma of cancer patients were shown (SA Leon, B Shapiro, DM Sklaroff, MJ Yaros (1977) Free DNA in The serum of cancer patients and the effect of therapy. Cancer Res 37:646-650; S Jahr, et al. (2001), above). The data from Jahr et al. (2001, above) are consistent with the possibility that apoptotic and necrotic cells are the main source of plasma DNA in cancer patients. Tumor DNA features have been found in genetic material extracted from the plasma of cancer patients. These features include reduced strand stability, as well as the presence of specific oncogenes, tumor suppressor genes, and microsatellite alterations (P Anker, H Mulcahy, XQ Chen, M Stroun (1999) Detection of circulating tumor DNA in the blood (plasma / serum) of cancer patients. Cancer and Metastasis Reviews 18:65-73. Doi. https: / / doi.org / 10.1023 / A:1006260319913). Results obtained in many different cancers suggest that plasma DNA, like urinary DNA, may be a suitable target for the development of cancer diagnosis, prognosis, and follow-up studies.

[0010] The investigation of new biomarkers for kidney disease is now an urgent issue, as kidney disease affects up to 1 in 10 people in the United States (J Coresh, E Selvin, LA Stevens, J Manzi, JW Kusek, P Eggers, F Van Lente, AS Levey (2007) Prevalence of chronic kidney disease in the United States. JAMA 298(17):2038-2047). Extracellular urinary vesicles (UEVs), used in intercellular communication, represent an ideal platform for biomarker discovery (KC Miranda, DT Bond, M McKee, J Skog, TG Paunescu, N Da Silva, D Brown, LM Russo (2010) Nucleic acids within urinary exosomes / microvesicles are potential biomarkers for renal disease. Kidney Int 78(2):191-199.Doi:10.1038 / ki.2010.106). UEVs are small (20-1,000 nm) spherical structures filled with RNA and proteins, and are constantly released by healthy and abnormal cells along the entire urogenital tract (A Gamez-Valero, SI Lozano-Ramos, I Bancu, R Lauzurica-Valdemoros, FE Borras (2015) Urinary extracellular vesicles as source of biomarkers in kidney diseases. Front Immunol 6.Doi:http: / / dx.d oi.org / 10.3389 / fimmu.2015.00006). The term UEV refers to vesicles or exosomes of both plasma membrane origin (e.g., microvesicles, exosome-like vesicles, ectosomes, and retrovirus-like particles) and endosome origin. UEVs appear to reflect the physiological state of the cell from which they originate (Gamez-Valero et al. (2015), see above; D Tataruch-Weinert, L Musante, O Kretz, H Holthofer (2016) Urinary extracellular vesicles for RNA extraction: optimization of a protocol devoid of prokaryote contamination. J Extracellular Vesicles 5:30281 - http: / / dx.doi.org / 10.3402 / jev.v5.30281). In addition, secreted vesicles mediate specific modes of intercellular communication through miRNAs, mRNAs, and tRNAs known as "exosome shuttle RNAs" (H Valadi, K Ekstrom, A Bossios, M Sjostrand, JJ Lee, LO Lotvall (2007) Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange). (between cells. Nature Cell Biology 9:654-659). Significant variations have been reported in RNA profiles depending on the urine collection method, UEV concentration method, and RNA extraction method (D Tataruch-Weinert et al. (2016), see above).

[0011] Recent studies suggest that extracellular viable cells (EVs) may be key to the timely diagnosis and monitoring of genital-urinary tract malignancies. Urinary exosomes, a subclass of EVs, are tiny vesicles containing proteins, mRNA, and microRNA (miRNA) that are released by cells in all regions of the nephron and urogenital tract. Exosomes produced by prostate cells travel through the prostatic ejaculatory ducts, directly into the urethra, and migrate along with prostatic secretions, which are easily detectable in urine (OE Bryzgunova,MM Zaripov,TE Skvortsova,EA Lekchnov,AE Grigor'eva,IA Zaporozhchenko,ES Morozkin,EI Ryabchikova,YB Yurchenko,VE Voitsitskiy,PP Laktionov (2016) Comparative study of extracellular vesicles from the urine of healthy individuals and prostate cancer patients. PLoS ONE 11(6):e0157566.Doi:10.1371 / journal.pone.0157566). Nilsson et al. (J Nilsson, J Skog, A Nordstrand, V Baranov, L Mincheva-Nilsson, XO Breakefield, A Widmark (2009) Prostate cancer-derived urine exosomes: a novel approach to biomarkers for prostate cancer. Br J Cancer 100:1603-1607. Doi:10.1038 / sj.bjc.6605058) were able to detect two known prostate cancer mRNA biomarkers, PCA3 and TMPRSS2-ERG, in exosomes isolated from the urine of prostate cancer patients, demonstrating the potential of exosomes for use in prostate cancer diagnosis. This study and others support the use of RNA in exosomes isolated from urine as a diagnostic marker for prostate cancer, providing a unique and novel type of screening that is an alternative and sensitive alternative to cancer biomarkers.

[0012] In cases of urological cancer, urine is a preferred liquid biopsy source in many situations because it contains detached tumor cells and acellular tumor DNA, and can be obtained easily, non-invasively, and repeatedly (LK Larsen, GE Lind, P Guldberg, C Dahl (20 19) DNA-methylation-based detection of urological cancer in urine: Overview of biomarkers and considerations on biomarker design, source of DNA, and detection technologies. Int J Mol Sci 20, 2657). Compared to blood, urine is considered a more sensitive alternative for the early detection or monitoring of recurrence of cancer in the urogenital tract (SY Lin, JA Linehan, TG Wilson, DSB Hoon (2017) Emerging utility of urinary cell-free nucleic acid biomarkers for prostate, bladder, and renal cancers. Eur Urol Focus 3(2-3):265-272. Doi:10.1016 / j.euf.2017.03.009). In addition, it does not require qualified personnel to obtain samples that can be collected at home. However, the use of hypermethylated DNA in urinary samples in clinical practice is limited by the challenge of preserving urinary nucleic acids. Therefore, urine needs to be stored and transported in a manner that ensures nucleic acid preservation in order to enable downstream analysis (J Bosschieter,S Bach,IV Bijnsdorp,LI Segerink,WF Rurup,AP van Splunter,I Bahce,PW Novianti,G Kazemier,RJA van Moorselaar,RDM Steenbergen,JA Nieuwenhuijzen(2018)A protocol for urine collection and storage prior to DNA methylation analysis.PLoS ONE 13(8):e0200906).

[0013] There is a demand for stabilizing compositions for preserving bodily fluids such as urine at ambient temperature.

[0014] This background information is provided for the purpose of disclosing information that the applicant considers to be potentially relevant to the present invention. It is not necessarily intended, nor should it be construed, that any of the aforementioned information constitutes prior art to the present invention. [Overview of the project]

[0015] While several commercially available products exist for stabilizing nucleic acids in biological samples such as bodily fluids, these are primarily intended to stabilize either DNA or RNA, but not both simultaneously. No compositions have yet been reported for efficiently stabilizing both cellular and cell-free nucleic acids in bodily fluids such as urine. It would be beneficial to provide a collection device and a composition contained therein that prevents the lysis of intact bacteria and human cells, thereby blocking the release of undesirable nucleic acids into the biological sample, which would otherwise contaminate in vivo urinary signals. The composition would also, in addition, prevent the release of membrane vesicles. This is important because cell-free RNA is encapsulated in membrane vesicles containing microvesicles and extracellular vesicles (including, but not limited to, exosomes). Preferably, the composition maintains the stability and integrity of both cell-free and cellular nucleic acids (DNA and RNA) in bodily fluids such as urine for at least 7 days at room temperature, preventing both chemical and enzymatic degradation. This application discloses such a composition.

[0016] In one embodiment, an aqueous stabilizing composition for preserving body fluids at ambient temperature is provided, the composition comprising a sugar selected from monosaccharides, disaccharides, or combinations thereof; a buffering agent; a C1-C6 alkanol; boric acid, a salt of boric acid, or a combination thereof; and a chelating agent, the composition having a pH of 4.5 to 5.2.

[0017] In another embodiment, a method for preserving a body fluid is provided, the method comprising a) obtaining a sample of the body fluid and b) contacting the body fluid with an aqueous stabilizing composition to form a mixture, wherein the composition is The composition comprises a sugar selected from monosaccharides, disaccharides, or combinations thereof, a buffer, a C1-C6 alkanol, boric acid, a salt of boric acid, or a combination thereof, and a chelating agent, wherein the composition has a pH of 4.5 to 5.2; c) mixing the mixture from (b) to form a homogeneous mixture; and d) storing the homogeneous mixture at ambient temperature.

[0018] In yet another embodiment, an aqueous composition is provided which comprises a sugar selected from monosaccharides, disaccharides, or combinations thereof; a buffer; a C1-C6 alkanol; boric acid, a salt of boric acid, or a combination thereof; a chelating agent; and a body fluid. [Brief explanation of the drawing]

[0019] For a better understanding of the present invention, including the progress of development to arrive at the final product, please refer to the following description used in conjunction with the attached drawings. [Figure 1] This chart illustrates cell-free DNA (UcfDNA) in urine from female and male donors, showing that the amount of UcfDNA in urine samples is dependent on both the sample and sex. [Figure 2A] This chart illustrates the increase in turbidity of an unstabilized first morning excretion (FMFV) urine sample due to bacterial growth (further evidenced by Figure 2B). [Figure 2B]This chart illustrates ΔCt[Ct(T7)-Ct(T0)] determined from bacterial 16S and β-globin qPCR assays for quantifying bacterial and human cell-free DNA (cfDNA) content in unstabilized urine samples after 7 days at room temperature (RT). [Figure 2C] The results of Agilent 4200 Tapestation analysis, showing a significant decrease in human cell-free DNA content after 7 days at room temperature, are illustrated. [Figure 2D] The results of Agilent 4200 Tapestation analysis, showing a significant decrease in human cell-free DNA content after 7 days at room temperature, are illustrated. [Figure 3A] (i) Stability and (ii) neutrality are shown as ΔCt[Ct(T7)-Ct(T0)] and ΔCt[Ct(T0 Chem)-Ct(T0 NA)], respectively, and are figures determined from β-globin qPCR assays for quantifying human cfDNA content in urine samples after storage at room temperature for 7 days and 0 days under various conditions, including mixing with the aqueous stabilizing composition of this application. Ct(T0) and Ct(T7) represent the qPCR cycle thresholds for 0 days and 7 days, respectively. Ct(T0 Chem) and Ct(T0 NA) represent the qPCR cycle thresholds for urine samples containing the chemical and unstorage samples (NA) on 0 days, respectively. [Figure 3B] (i) Stability and (ii) neutrality are shown as ΔCt[Ct(T7)-Ct(T0)] and ΔCt[Ct(T0 Chem)-Ct(T0 NA)], respectively, and are figures determined from β-globin qPCR assays for quantifying human cfDNA content in urine samples after storage at room temperature for 7 days and 0 days under various conditions, including mixing with the aqueous stabilizing composition of this application. Ct(T0) and Ct(T7) represent the qPCR cycle thresholds for 0 days and 7 days, respectively. Ct(T0 Chem) and Ct(T0 NA) represent the qPCR cycle thresholds for urine samples containing the chemical and unstorage samples (NA) on 0 days, respectively. [Figure 3C](i) Stability and (ii) neutrality are shown as ΔCt[Ct(T7)-Ct(T0)] and ΔCt[Ct(T0 Chem)-Ct(T0 NA)], respectively, and are figures determined from β-globin qPCR assays for quantifying human cfDNA content in urine samples after storage at room temperature for 7 days and 0 days under various conditions, including mixing with the aqueous stabilizing composition of this application. Ct(T0) and Ct(T7) represent the qPCR cycle thresholds for 0 days and 7 days, respectively. Ct(T0 Chem) and Ct(T0 NA) represent the qPCR cycle thresholds for urine samples containing the chemical and unstorage samples (NA) on 0 days, respectively. [Figure 4A] This chart illustrates ΔCt[Ct(T)-Ct(T0 NA)] determined from a β-globin qPCR assay for quantifying human cfDNA content in urine samples after storage at room temperature for 7 days under various conditions, including mixing with the aqueous stabilizing composition of this application. Ct(T) represents the qPCR cycle threshold on day 7. Ct(T0 NA) represents the qPCR cycle threshold for the unstorage sample (NA) on day 0. [Figure 4B] This chart illustrates ΔCt[Ct(T)-Ct(T0 NA)] determined from a β-globin qPCR assay for quantifying human cfDNA content in urine samples after storage at room temperature for 7 days under various conditions, including mixing with the aqueous stabilizing composition of this application. Ct(T) represents the qPCR cycle threshold on day 7. Ct(T0 NA) represents the qPCR cycle threshold for the unstorage sample (NA) on day 0. [Figure 5A](i) Stability and (ii) neutrality are shown as ΔCt[Ct(T7)-Ct(T0)] and ΔCt[Ct(T0 Chem)-Ct(T0 NA)], respectively, and were determined by β-globin qPCR assays for the quantification of human cfDNA content in urine samples after storage at room temperature for 7 days and 0 days under various conditions, including mixing with the aqueous stabilizing composition of this application. Ct(T0) and Ct(T7) represent the qPCR cycle thresholds for 0 days and 7 days, respectively. Ct(T0 Chem) and Ct(T0 NA) represent the qPCR cycle thresholds for urine samples containing the chemical and unstorage samples (NA) on 0 days, respectively. [Figure 5B] The following diagrams illustrate representative Tapestation profile analyses of unpreserved urine samples and samples containing chemical substance F (Chem F), demonstrating that cfDNA is degraded in unpreserved samples and stabilized in the aqueous stabilizing composition of this application. [Figure 5C] (i) Stability and (ii) neutrality are shown as ΔCt[Ct(T)-Ct(T0)] and ΔCt[Ct(T0 Chem)-Ct(T0 NA)], respectively, and are figures determined from β-globin qPCR assays for quantifying human cfDNA content in urine samples after storage at room temperature for 7 or 14 days and on day 0, and after mixing with the aqueous stabilizing composition of this application. Ct(T0) and Ct(T) represent the qPCR cycle thresholds on day 0 and on day 7 or 14, respectively. Ct(T0 Chem) and Ct(T0 NA) represent the qPCR cycle thresholds for urine samples containing the chemical and unstorage samples (NA) on day 0, respectively. [Figure 5D](i) Stability and (ii) neutrality are shown as ΔCt[Ct(T)-Ct(T0)] and ΔCt[Ct(T0 Chem)-Ct(T0 NA)], respectively, and are figures determined from β-globin qPCR assays for quantifying human cfDNA content in urine samples after storage at room temperature for 7 or 14 days and on day 0, and after mixing with the aqueous stabilizing composition of this application. Ct(T0) and Ct(T) represent the qPCR cycle thresholds on day 0 and on day 7 or 14, respectively. Ct(T0 Chem) and Ct(T0 NA) represent the qPCR cycle thresholds for urine samples containing the chemical and unstorage samples (NA) on day 0, respectively. [Figure 5E] (i) Stability and (ii) neutrality are shown as ΔCt[Ct(T)-Ct(T0)] and ΔCt[Ct(T0 Chem)-Ct(T0 NA)], respectively, and are figures determined from β-globin qPCR assays for quantifying human cfDNA content in urine samples after storage at room temperature for 7 or 14 days and on day 0, and after mixing with the aqueous stabilizing composition of this application. Ct(T0) and Ct(T) represent the qPCR cycle thresholds on day 0 and on day 7 or 14, respectively. Ct(T0 Chem) and Ct(T0 NA) represent the qPCR cycle thresholds for urine samples containing the chemical and unstorage samples (NA) on day 0, respectively. [Figure 6(ii)] Figures 6(i-i)A and B are charts illustrating ΔCt[Ct(T)-Ct(T0NA)] determined from a β-globin qPCR assay for quantifying human cfDNA content in a urine sample (S) spiked with prostate cancer cells, after storage for 7 days at room temperature and under various conditions including mixing with the aqueous stabilizing composition of this application. Ct(T) represents the qPCR cycle threshold on day 0 or day 7. Ct(T0NA) represents the qPCR cycle threshold for an unstorage spiked sample (NA) on day 0. [Figure 6(i-ii)] Figure 6(i-ii)C illustrates typical Tapestation profile analyses of unstorage urine samples and urine samples containing the chemical substance F (Chem F). [Figure 6(ii)]Figure 6(ii)A is a chart illustrating ΔCt[Ct(T)-Ct(T0NA)] determined from a β-globin qPCR assay for quantifying human cfDNA content in a urine sample (S) spiked with prostate cancer cells after storage at room temperature for 7 days and on day 0, including mixing with the aqueous stabilizing composition of this application. Ct(T) represents the qPCR cycle threshold on day 0 or day 7. Ct(T0NA) represents the qPCR cycle threshold for an unstorage spiked sample (NA) on day 0. Figure 6(ii)B is a chart illustrating the copy number of the β-globin gene per unit volume in some of these samples, determined using a ddPCR assay. Overall, Figures 6(i-i), 6(i-ii), and 6(ii) suggest that the aqueous stabilizing composition of this application maintains the integrity of prostate cancer cells in a concentration-dependent manner for at least 7 days at room temperature. [Figure 7] This chart illustrates ΔCt[Ct(T)-Ct(T0 NA)] determined from a β-globin qPCR assay for quantifying human cfDNA content in nucleated leukocyte-spiked urine samples (S) after mixing with the aqueous stabilizing composition of this application and a commercially available composition from Streck, under various conditions including day 0 and 7 days of storage at room temperature. Ct(T) represents the qPCR cycle threshold on day 0 or day 7. Ct(T0 NA) represents the qPCR cycle threshold of the unstorage-spiked sample (NA) on day 0. [Figure 8A] We confirm plasmid DNA methylation in vitro using CpG methyltransferase and show the digestion patterns of HpaII and MspI restriction endonucleases. [Figure 8B] Tapestation results of PCR amplification of a methylated plasmid are shown, suggesting preservation of DNA methylation in this composition over 7 days at room temperature. [Figure 8C] Tapestation results of PCR amplification of a methylated plasmid are shown, suggesting preservation of DNA methylation in this composition over 7 days at room temperature. [Figure 9A]This chart illustrates ΔCt[Ct(T7)-Ct(T0)] determined from ampicillin resistance gene (AmpR) and bacterial 16S qPCR assays for the quantification of HPV plasmid DNA and bacterial DNA, respectively, in both unstorage urine samples spiked with purified HPV16 plasmid DNA after 7 days of storage at room temperature and urine samples containing chemical F (Chem F). Ct(T7) represents the qPCR cycle threshold on day 7. Ct(T0) represents the qPCR cycle threshold on day 0. [Figure 9B] This chart illustrates ΔCt[Ct(T7)-Ct(T0)] determined from ampicillin resistance gene (AmpR) and bacterial 16S qPCR assays for the quantification of HPV plasmid DNA and bacterial DNA, respectively, in both unstorage urine samples spiked with purified HPV16 plasmid DNA after 7 days of storage at room temperature and urine samples containing chemical F (Chem F). Ct(T7) represents the qPCR cycle threshold on day 7. Ct(T0) represents the qPCR cycle threshold on day 0. [Figure 10A] (i) Stability and (ii) neutrality are shown as ΔCt[Ct(T7)-Ct(T0)] and ΔCt[Ct(T0 Chem)-Ct(T0 NA)], respectively, and were determined by β-actin RT-qPCR assays for the quantification of human EV RNA content in urine samples after storage at room temperature for 7 days and 0 days under various conditions, including mixing with the aqueous stabilizing composition of this application. Ct(T0) and Ct(T7) represent the qPCR cycle thresholds for 0 days and 7 days, respectively. Ct(T0 Chem) and Ct(T0 NA) represent the qPCR cycle thresholds for urine samples containing the chemical and unstorage samples (NA) on 0 days, respectively. [Figure 10B] Representative electrophoretic traces of extracellular vesicle (EV) RNA from both unstorage urine samples and chemical F (Chem F)-containing urine samples from day 0 and day 7 are shown. [Figure 10C](i) Stability and (ii) neutrality are shown as ΔCt[Ct(T7)-Ct(T0)] and ΔCt[Ct(T0 Chem)-Ct(T0 NA)], respectively, and were determined by β-actin RT-qPCR assays for the quantification of human EV RNA content in urine samples after storage at room temperature for 7 days and 0 days under various conditions, including mixing with the aqueous stabilizing composition of this application. Ct(T0) and Ct(T7) represent the qPCR cycle thresholds for 0 days and 7 days, respectively. Ct(T0 Chem) and Ct(T0 NA) represent the qPCR cycle thresholds for urine samples containing the chemical and unstorage samples (NA) on 0 days, respectively. [Figure 10D] (i) Stability and (ii) neutrality are shown as ΔCt[Ct(T7)-Ct(T0)] and ΔCt[Ct(T0 Chem)-Ct(T0 NA)], respectively, and were determined by β-actin RT-qPCR assays for the quantification of human EV RNA content in urine samples after storage at room temperature for 7 days and 0 days under various conditions, including mixing with the aqueous stabilizing composition of this application. Ct(T0) and Ct(T7) represent the qPCR cycle thresholds for 0 days and 7 days, respectively. Ct(T0 Chem) and Ct(T0 NA) represent the qPCR cycle thresholds for urine samples containing the chemical and unstorage samples (NA) on 0 days, respectively. [Figure 11] (i) Stability and (ii) neutrality are shown as ΔCt[Ct(T7)-Ct(T0)] and ΔCt[Ct(T0 Chem)-Ct(T0 NA)], respectively, and are figures determined from β-actin RT-qPCR assays for quantifying the human cell-free RNA content in urine samples after storage at room temperature for 7 days and 0 days under various conditions, including mixing with the aqueous stabilizing composition of this application. Ct(T0) and Ct(T7) represent the qPCR cycle thresholds for 0 days and 7 days, respectively. Ct(T0 Chem) and Ct(T0 NA) represent the qPCR cycle thresholds for urine samples containing the chemical and unstorage samples (NA) on 0 days, respectively. [Figure 12A](i) Stability and (ii) neutrality are shown as ΔCt[Ct(T7)-Ct(T0)] and ΔCt[Ct(T0 Chem)-Ct(T0 NA)], respectively, and are figures determined from β-actin RT-qPCR assays for quantifying human cell RNA content in urine samples after storage at room temperature for 7 days and 0 days under various conditions, including mixing with the aqueous stabilizing composition of this application. Ct(T0) and Ct(T7) represent the qPCR cycle thresholds for 0 days and 7 days, respectively. Ct(T0 Chem) and Ct(T0 NA) represent the qPCR cycle thresholds for urine samples containing the chemical and unstorage samples (NA) on 0 days, respectively. [Figure 12B] (i) Stability and (ii) neutrality are shown as ΔCt[Ct(T7)-Ct(T0)] and ΔCt[Ct(T0 Chem)-Ct(T0 NA)], respectively, and are figures determined from β-actin RT-qPCR assays for quantifying human cell RNA content in urine samples after storage at room temperature for 7 days and 0 days under various conditions, including mixing with the aqueous stabilizing composition of this application. Ct(T0) and Ct(T7) represent the qPCR cycle thresholds for 0 days and 7 days, respectively. Ct(T0 Chem) and Ct(T0 NA) represent the qPCR cycle thresholds for urine samples containing the chemical and unstorage samples (NA) on 0 days, respectively. [Figure 13A] The Tapestation profiles of extracted cellular DNA on day 0 and day 7 in both unstorage urine samples (NA) and urine samples containing chemical substance F (Chem F), mixed with the aqueous stabilization composition of this application, are illustrated. [Figure 13B] The Tapestation profile of the PCR-amplified GAPDH product is shown. [Figure 13C] The bacterial DNA content determined from bacterial 16S qPCR assays is shown in the figure. [Figure 14]The Tapestation profiles of extracted cfDNA on day 0 and day 7 in both unstorage saliva samples (TE) and saliva samples containing chemical F, mixed with the aqueous stabilized composition of this application, are illustrated. TE represents 1XTris-EDTA buffer. [Modes for carrying out the invention]

[0020] (definition) Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which this invention pertains.

[0021] As used herein and in the claims, the singular forms "a," "an," and "the" refer to multiple subjects unless the context clearly indicates otherwise.

[0022] As used herein, the term “including” is understood to mean that the following list is not exhaustive and may or may not include any other additional preferred items, e.g., one or more further features, components, and / or elements, as they may be.

[0023] As used herein, terms of degree such as “substantially,” “about,” and “approximately” mean a reasonable deviation from the modified term such that the final result does not change materially. These terms of degree should be interpreted as including a deviation of at least ±10% of the modified term, provided that the deviation does not negate the meaning of the word it modifies.

[0024] As used herein, the term “body fluid” means naturally occurring fluids from humans or animals, including, but not limited to, urine, saliva, sputum, serum, plasma, blood, pharyngeal, nasal / nasopharynx and sinus secretions, mucous membranes, gastric juice, pancreatic juice, bone marrow aspirate, cerebrospinal fluid, feces, semen, lactation or menstrual products, cervical secretions, vaginal fluid, tears, or lymph. In one embodiment, the body fluid is selected from urine or saliva. In another embodiment, the body fluid is urine.

[0025] As used herein, the term “ambient temperature” refers to the range of temperatures that a mixture of a body fluid (e.g., a urine sample) and the aqueous stabilizing composition described herein may experience from the time of collection, during transport (usually for a shorter period, e.g., less than 5 days, but which may involve relatively extreme temperatures), and during long-term storage before analysis. In one embodiment, the ambient temperature is in the range of about -20°C to about 50°C. In another embodiment, the ambient temperature is room temperature (RT), in the range of about 15°C to about 25°C.

[0026] As used herein, the term “monosaccharide” is understood to mean a sugar that is not broken down into simpler sugars by hydrolysis, is classified as either an aldose or a ketose, and contains one or more hydroxyl groups per molecule. In one embodiment, the monosaccharide is selected from fructose, glucose, mannose, or galactose. In another embodiment, the monosaccharide is fructose, glucose, or a combination thereof.

[0027] As used herein, the term “disaccharide” is understood to mean a compound in which two monosaccharide units are linked by a glycosidic bond. In one embodiment, the disaccharide is selected from sucrose, trehalose, and lactose. In another embodiment, the disaccharide is sucrose.

[0028] Compositions according to this application that contain disaccharides have been found to be more difficult to prepare because such solutions may have very high viscosity, which can lead to improper mixing of the components and / or addition to the sample (i.e., body fluid) due to the difficulty in mixing. Overall, monosaccharides are preferred over disaccharides in the compositions and methods of this application due to the processability of the sample.

[0029] As used herein, the terms "chelator" or "chelating agent" refer to certain metal ions (e.g., Ca 2+ and Mg 2+It is understood that a chelating agent is a chemical substance that forms a soluble and stable complex with other components, such as deoxyribonucleases (DNases) or endonucleases (e.g., type I, type II, and type III restriction endonucleases) and exonucleases (e.g., 3'-5' exonucleases), which are abundant enzymes in various bodily fluid samples, and sequesters ions so that they cannot normally react with other components. In this composition, the chelating agent is involved in inhibiting DNase and microbial growth in biological samples. Chelaters may include, for example, ethylene glycol tetraacetic acid (EGTA), (2-hydroxyethyl)ethylenediaminetriacetic acid (HEDTA), diethylenetriaminepentaacetic acid (DTPA), nitrilotriacetic acid (NTA), ethylenediaminetriacetic acid (EDTA), 1,2-cyclohexanediaminetetraacetic acid (CDTA), N,N-bis(carboxymethyl)glycine, triethylenetetraamine (TETA), tetraazacyclododecanetetraacetic acid (DOTA), desferrioxymin, citrate anhydrous, sodium citrate, calcium citrate, ammonium citrate, ammonium bicitrate, citric acid, diammonium citrate, ironammonium citrate, and lithium citrate. These chelating agents may be used alone or in combination of two or more of them.

[0030] As used herein, the term "C1-C6 alkanol" is understood to mean linear or branched alkanols such as methanol, ethanol, propanol, isopropanol, butanol, n-butanol, pentanol, hexanol, or any combination thereof. In one embodiment of the composition, the preferred alcohol is ethanol.

[0031] In one embodiment, an aqueous stabilizing composition for preserving body fluids at ambient temperature is provided, the composition comprising a sugar selected from monosaccharides, disaccharides, or combinations thereof, a buffer, a C1-C6 alkanol, boric acid, a salt of boric acid, or a combination thereof, and a chelating agent, the composition having a pH of 4.5 to 5.2.

[0032] In one embodiment, the aqueous composition comprises boric acid, salts of boric acid, such as dihydrogen borate, hydrogen borate, diborate, triborate, tetraborate, metaborate, hydroxoborate, borate, or a combination thereof. In another embodiment, the aqueous composition comprises boric acid, sodium borate, or a combination thereof. In yet another embodiment, the aqueous composition comprises boric acid. In one embodiment, boric acid, salts of boric acid, or a combination thereof are present in the aqueous stabilized composition in amounts of about 0.5% to about 5% (weight / volume), or about 1% to about 3% (weight / volume), or about 2% to about 2.5% (weight / volume), or about 2.2% (weight / volume).

[0033] In one embodiment, the sugar is a monosaccharide, such as fructose, glucose, mannose, galactose, or a combination thereof. In another embodiment, the monosaccharide is fructose, glucose, or a combination thereof. In yet another embodiment, the sugar is a disaccharide, such as trehalose, lactose, or sucrose, or a combination thereof. In yet another embodiment, the disaccharide is sucrose. In one embodiment, the sugar is present in the aqueous stabilized composition in an amount of about 5% to about 45% (weight / volume), or about 5% to about 40% (weight / volume), or about 10% to about 30% (weight / volume), or about 18% to about 22% (weight / volume), or about 20% (weight / volume).

[0034] Generally, the pH of the aqueous stabilized composition can be maintained within a desired range using one or more suitable buffers. According to one embodiment, the composition maintains the pH within a preferred range of 4.5 to 5.2, with a logarithmic acid dissociation constant (pK) in the range of 3 to 6.5 at 25°C. a One or more buffers having a value (non-limiting examples include acetate buffer and citrate buffer) The solution contains, for example, sodium acetate, potassium acetate, ammonium acetate, sodium citrate, and ammonium citrate. In one embodiment, the buffer is sodium acetate.

[0035] Acid dissociation constant K a is a quantitative measure of the strength of an acid in solution. The larger the K a value, the greater the dissociation of the molecules in the solution, and thus the stronger the acid. Since the number of digits spanned by the K a value is large, in practice, the logarithmic scale of the acid dissociation constant, pK a is more commonly used. The larger the pK a value, the smaller the degree of dissociation at any given pH, i.e., the weaker the acid. In living organisms, acid-base homeostasis and enzyme kinetics depend on the pK a values of many acids and bases present in cells and in the body. In chemistry, knowledge of the pK a value is necessary for the preparation of buffers and is also a prerequisite for quantitatively understanding the interaction between an acid or base forming a complex and metal ions. Those skilled in the art will understand that a given compound / buffer can buffer the pH of a solution only when its concentration is sufficient and the pH of the solution is close to its pK a (within about 1 pH unit). In one embodiment, the pH of the composition is in the range of 4.5 to 5.2. In a preferred embodiment, the pH of the composition is about 5.0. The amount of buffer in the aqueous stabilization composition is, for example, in an amount of about 150 mM to about 1.75 M, or about 150 mM to about 1.5 M, or about 500 mM to about 1.2 M, or about 0.7 M to about 0.8 M, or about 0.75 M.

[0036] In one embodiment, the C1-C6 alkanol in the aqueous stabilization composition is selected from methanol or ethanol. In another embodiment, the C1-C6 alkanol is ethanol. In yet another embodiment, the C1-C6 alkanol is present in the aqueous stabilization composition in an amount of about 5% to about 50% (volume / volume), or about 10% to about 30% (volume / volume), or about 20% to about 25% (volume / volume), or about 23% (volume / volume).

[0037] Ethanol causes dehydration or reduction of water activity of proteins, followed by electrostatic attraction, aggregation, and insolubilization between proteins. While not wishing to be bound by theory, the inventors believe that ethanol in the proportion used has little to no fixing properties in this composition, and is rather important for overall stability and enhances the functionality of other chemical compounds that may be included in this composition. In addition, for the shipment / transportation of flammable liquids, it is desirable to keep the amount of organic solvents such as ethanol in the solution below 24% by volume in order to be exempt from the Transport of Dangerous Goods (TDG) regulations (United Nations (UN) No. 1170). Otherwise, a solution with >24% ethanol is classified as Class 3 (flammable liquid), requiring special packaging and increasing the complexity and cost of transport. For this reason, aqueous stabilizing compositions containing approximately 23% (vol / vol) or less are particularly advantageous.

[0038] In another embodiment, the chelating agent in the aqueous stabilizing composition is selected from, for example, ethylenediaminetriacetic acid (EDTA), 1,2-cyclohexanediaminetetraacetic acid (CDTA), diethylenetriaminepentaacetic acid (DTPA), tetraazacyclododecanetetraacetic acid (DOTA), tetraazacyclotetradecanetetraacetic acid (TETA), desferrioxymin, or chelator analogs thereof. In another embodiment, the chelating agent is CDTA. In another embodiment, the chelating agent is present in the aqueous stabilizing composition in an amount of about 10 mM to about 120 mM, or about 10 mM to about 100 mM, or about 30 mM to about 70 mM, or about 40 mM to about 60 mM, or about 50 mM.

[0039] In one embodiment of the aqueous stabilized composition, the composition contains sugars (fructose, glucose, sucrose, or a combination thereof) in amounts of about 5% to about 45% (weight / volume), about 5% to about 40% (weight / volume), or about 10% to about 30% (weight / volume), or about 18% to about 22% (weight / volume), or about 20% (weight / volume), preferably fructose, glucose, sucrose, etc. A buffer (e.g., sodium acetate) in an amount of about 150 mM to about 1.75 M, or about 150 mM to about 1.5 M, or about 500 mM to about 1.2 M, or about 0.7 M to about 0.8 M, or about 0.75 M, and about 5% to about 50% (volt / volt), or about 10% to about 30% (volt / volt), or about 20% to about 25% (volt / volt), or 23% (volt / volt) of C1-C6 alkanols (e.g., methanol, ethanol, or a combination thereof, preferably). A compound comprising, essentially consisting of, or consisting of, ethanol, boric acid, a salt of boric acid, or a combination thereof (preferably boric acid) in amounts of about 0.5% to about 5% (weight / volume), or about 1% to about 3% (weight / volume), or about 2% to about 2.5% (weight / volume), or about 2.2% (weight / volume), and a chelating agent (such as CDTA) in amounts of about 10 mM to about 120 mM, or about 10 mM to about 100 mM, or about 30 mM to about 70 mM, or about 40 mM to about 60 mM, or about 50 mM.

[0040] In one embodiment, the aqueous stabilizing composition stabilizes cells (such as cancer cells or nucleated blood cells), extracellular vesicles, nucleic acids (for example, cellular DNA and RNA such as cell-free DNA (cfDNA), cell-free RNA (cfRNA), and extracellular vesicle RNA (EV RNA)), and / or microorganisms (such as bacteria or viruses) contained in body fluids.

[0041] In another embodiment, a method is provided for preserving body fluids, the method comprising: a) obtaining a sample of body fluid; b) contacting the body fluid with an aqueous stabilizing composition defined above to form a mixture; c) mixing the mixture from (b) to form a homogeneous mixture; and d) preserving the homogeneous mixture at ambient temperature. In one embodiment, preserving body fluids involves stabilizing cells (such as cancer cells or nucleated blood cells), extracellular vesicles, nucleic acids (e.g., DNA and RNA such as cell-free DNA (cfDNA), cell-free RNA (cfRNA), and extracellular vesicle RNA (EV RNA)), and / or microorganisms (such as bacteria or viruses) contained in the body fluids. In another embodiment, the cells, nucleic acids, extracellular vesicles, and / or microorganisms contained in the body fluids are stabilized at ambient temperature for at least 7 days. In another embodiment, the cells, nucleic acids, extracellular vesicles, and / or microorganisms contained in the body fluids are stabilized at ambient temperature for at least 14 days. In another embodiment, the body fluid is urine or saliva. In another embodiment, the body fluid is urine.

[0042] In yet another embodiment, an aqueous composition is provided which comprises a sugar selected from monosaccharides, disaccharides, or combinations thereof; a buffer; a C1-C6 alkanol; boric acid, a salt of boric acid, or a combination thereof; a chelating agent; and a body fluid. In one embodiment, the body fluid is urine. In another embodiment, the body fluid is urine, and the pH of the aqueous composition containing the body fluid is 5 to 5.5. In another embodiment, sugars are present in amounts of approximately 1.5% to approximately 15% (weight / volume), or approximately 2% to approximately 10% (weight / volume), or approximately 5% to approximately 7% (weight / volume), or approximately 6% (weight / volume); buffering agents are present in amounts of approximately 50 mM to approximately 500 mM, or approximately 200 mM to approximately 400 mM, or approximately 220 mM to approximately 240 mM, or approximately 230 mM, or approximately 225 mM; and C1-C6 alkanols are present in amounts of approximately 2% to approximately 40% (volume / volume), or approximately 3% to approximately 20% (volume / volume), or approximately 5% to approximately 10% (volume / volume). Or present in amounts of approximately 6.5% (volume / volume) or approximately 6.9% (volume / volume), boric acid, boric acid salts, or combinations thereof present in amounts of approximately 0.1% to approximately 2% (weight / volume), or approximately 0.2% to approximately 1.5% (weight / volume), or approximately 0.5% to approximately 1.0% (weight / volume), or approximately 0.7% (weight / volume), or approximately 0.6% (weight / volume), and chelating agents present in amounts of approximately 2.5 mM to approximately 50 mM, or approximately 5 mM to approximately 25 mM, or approximately 10 mM to approximately 20 mM, or approximately 16 mM, or approximately 15 mM.

[0043] In one embodiment, the body fluid is urine, and the urine sample is, for example, "LIQUID SAMPLER, KIT OF PARTS, AND METHOD FOR ASSEMBLY" The urine is collected using a device for capturing a predetermined volume of a predetermined portion of urine (e.g., the first excretion), as described in the document titled WO2014 / 037152. In one embodiment, the Colli-Pee® First Void Urine Collection Device (Novosanis) can be used. The aqueous stabilizing composition may be present in the device at the time of collection, or the urine may be brought into contact with the aqueous stabilizing composition immediately after collection. The reservoir containing the urine sample and the aqueous stabilizing composition can be sealed with a suitable cap, and the combined sample and stabilizing composition can be gently mixed, for example, by inverting the tube. The urine sample may also be collected in a standard urine sample container (e.g., VWR; catalog number 10804-050) and then mixed with the stabilizing composition. Alternatively, the collected urine may be transported to the laboratory on an ice pack, where it may be mixed with the stabilizing composition.

[0044] In another embodiment, the bodily fluid is saliva, and the saliva sample is collected using a device such as those described in WO2007 / 068094, titled "CONTAINER SYSTEM FOR RELEASABLY STORING A SUBSTANCE," WO2010 / 020043, titled "SAMPLE RECEIVING DEVICE," and WO2010 / 130055, titled "CLOSURE, CONTAINING APPARATUS, AND METHOD OF USING SAME."

[0045] In another embodiment, the bodily fluid is feces, and the fecal sample is collected using a device such as that described in WO2015 / 172250, titled "DEVICE FOR COLLECTING, TRANSPORTING AND STORING BIOMOLECULES FROM A BIOLOGICAL SAMPLE."

[0046] In yet another embodiment, the body fluid sample may be collected in a standard commercially available laboratory or transport tube (e.g., a 10 mL round-bottom tube (92 × 15.3 mm), catalog number 60.610, Sarstedt, or a larger tube depending on the type and size of the sample). The tube containing the body fluid sample and aqueous stabilizing composition can be sealed with a suitable cap, and the combined sample and stabilizing composition can be gently mixed, for example, by inverting the tube.

[0047] Body fluids should preferably be mixed immediately with the stabilizing composition at the collection point. Otherwise, the sample should be stored and / or transported on an ice pack or refrigerated before mixing with the composition.

[0048] As those skilled in the art will understand, the aqueous stabilizing compositions ("chemicals") described herein can be combined with bodily fluid samples in various ratios. For example, when the bodily fluid is urine, it is desirable to avoid excessive dilution of the sample and thus reducing the collected analyte. Therefore, the chemical:urine ratio may be in the range of, for example, 0.25:1 to 0.75:1, such as 0.25:1, 0.30:1, 0.35:1, 0.40:1, 0.45:1, 0.50:1, 0.55:1, 0.60:1, 0.65:1, 0.70:1, or 0.75:1. In one embodiment, the chemical:urine ratio is 0.40:1 to 0.45:1.

[0049] For other bodily fluids such as feces, a higher chemical:sample ratio can be used to ensure adequate mixing.

[0050] In one embodiment, after the step of contacting the body fluid with an aqueous stabilizing composition and mixing to form a homogeneous mixture, the homogeneous mixture contains about 1.5% to about 15% (weight / volume), or about 2% Approximately 10% (weight / volume), or approximately 5% to approximately 7% (weight / volume), or approximately 6% (weight / volume) of sugar (e.g., fructose, glucose, sucrose, or a combination thereof, preferably fructose, glucose, or a combination thereof), and approximately 50 mM to approximately 500 mM, or approximately 200 mM to approximately 400 mM, or approximately 220 mM to approximately 240 mM, or approximately 230 mM, or approximately 225 mM of buffering agent (e.g., sodium acetate), and approximately 2% to approximately 40% (volume / volume), or approximately 3% to approximately 20% (volume / volume), or approximately 5% to approximately 10% (volume / volume), or approximately 6.5% (volume / volume), or approximately 6.9% The mixture contains % (volume / volume) of C1-C6 alkanols (e.g., methanol, ethanol, or a combination thereof, preferably ethanol), about 0.1% to about 2.2% (weight / volume), or about 0.2% to about 1.5% (weight / volume), or about 0.5% to about 1.0% (weight / volume), or about 0.7% (weight / volume), or about 0.6% (weight / volume), of boric acid, a salt of boric acid, or a combination thereof (preferably boric acid), and about 2.5 mM to about 50 mM, or about 5 mM to about 25 mM, or about 10 mM to about 20 mM, or about 16 mM, or about 15 mM of a chelating agent (preferably CDTA).

[0051] As described above, in one embodiment, the aqueous stabilizing composition stabilizes cells (such as cancer cells or nucleated blood cells), extracellular vesicles, nucleic acids (e.g., DNA and RNA such as cell-free DNA (cfDNA), cell-free RNA (cfRNA), and extracellular vesicle RNA (EV RNA)), and / or microorganisms (such as bacteria or viruses) contained in body fluids. In one embodiment, the aqueous stabilizing composition stabilizes such components of body fluids at ambient temperature for at least 7 days. In another embodiment, the aqueous stabilizing composition stabilizes such components of body fluids at ambient temperature for at least 14 days. Such stabilization can be evaluated by methods known to those skilled in the art, for example, by monitoring the degradation of cell-free nucleic acids (as further described in the Materials and Methods section and in later examples).

[0052] ΔC tThis corresponds to a relative change in the quantity or expression of a given gene. ΔC t C t(T)- C t(T0) Corresponds to C t(T) This represents the cycle threshold on day 7 or day 14, C t(T0) This indicates the cycle threshold on day 0. The cycle threshold of the reaction (C) t The value was defined as the number of cycles at which the fluorescence of the PCR product can be detected on top of the background signal. In this study, C t(T7又はT14) -C t(T0) When calculated as, this ΔC t This explains the change in the stability of different analytes in unstorage and stored samples after storage at room temperature for a specific amount of time. ΔC t C t(T0 Chem) -C t(T0 NA) When calculated as, ΔC t This explains neutrality (the change in the baseline concentration of the analyte upon addition of a given chemical substance to a urine sample, compared to an unstorage urine sample at the time of collection, i.e., day 0). (Invariant ΔC) t ΔC close to the value or 0. t The value indicates stability, meaning that the concentration of the analyte has not changed significantly over time (and therefore indicates the stability of the analyte in the composition under test conditions). For example, in this cell-free DNA study, ΔC t The values ​​ranged from +2 to +14 in unstorage samples maintained at room temperature for 7 days. This significant ΔC t An increase in the value (median: >+5) indicates the degradation of cell-free DNA in unstorage samples. On the other hand, the ΔC of detection of cell-free DNA after storage at room temperature in this aqueous stabilized composition is... t The median value is nearly zero, indicating the stability and content preservation of cell-free DNA, and indirectly explaining the stability and integrity of cells. Regarding cell-free RNA, the median ΔC is +2.5 in non-preserved samples. t The value indicates cell-free RNA degradation, while the median ΔC is relatively low at 1.3. tThe value indicates better stability of cell-free RNA content in preserved samples compared to unpreserved samples. Regarding cell RNA stability, the median ΔC of +7.0 in unpreserved samples is higher. t The value indicates significant degradation of cellular RNA. On the other hand, a median ΔC of less than 2 in preserved samples. t The value indicates the stability of cellular RNA. Similarly, for EV RNA, a median ΔC greater than +3 in non-conserved samples. t The value indicates EV RNA instability and detection failure, but the median ΔC of 0.5 in the stored sample is lower. t The values ​​indicate excellent EVRNA stability and detection. This is because cells in body fluids... This is merely one exemplary method for evaluating the stabilization of extracellular vesicles, nucleic acids, and / or microorganisms, other methods for evaluating such stabilization are known to those skilled in the art and / or are outlined in more detail in the following sections on materials and methods and examples.

[0053] As described in more detail in Example 7 below, preservatives / compositions containing formalin / formaldehyde-based fixatives can be used to fix cells in biological samples or specimens and prevent leakage of cellular nucleic acids into the extracellular space. Such compositions may contain formaldehyde, or alternatively, compounds capable of releasing formaldehyde, such as formaldehyde-releasing agents / formaldehyde donors / formaldehyde-releasing preservatives, which are chemical compounds that slowly release formaldehyde. Notably, formalin-fixed tissues show a high frequency of non-reproducible sequence changes compared to DNA isolated from frozen tissue (Srinivasan M, Sedmak D, Jewell S (2002) Effect of fixatives and tissue processing on the content and integrity of nucleic acids. Am J Pathol 161(6):1961-1971). Formaldehyde, the main component of the most commonly used fixatives, leads to the formation of DNA-protein and RNA-protein crosslinks. Furthermore, when the fixative solution is not buffered, nucleic acids become fragmented. Both of the above present challenges for PCR-based analysis (Gilbert MTP, Haselkorn T, Bunce M, Sanchez JJ, Lucas SB, Jewell LD, Van Marck E, Worobey M (2007) The isolation of nucleic acids from fixed, paraffin-embedded tissues - Which methods are useful when? PLoS ONE 2(6):e537.Doi:10.1371 / journal.pone.0000537, Wong SQ, Li J, Tan AY-C, Vedururu R, Pang J-MB, Do H, Ellul J, Doig K, Bell A, MacArthur GA, Fox SB, Thomas DM, Fellowes A, Parisot JP, Dobrovic A (2014) Sequence artifacts in a prospective series of formalin-fixed tumors tested for mutations in hotspot regions by massively parallel sequencing. BMC Medical Genomics 7:23. Doi:10.1186 / 1755-8794-7-23). ​​Specifically, this chemical damage to DNA is Taq DNA damage reduces DNA polymerase fidelity and PCR amplification efficiency (Sikorsky JA, Primerano DA, Fenger TW, Denvir J (2007) DNA damage reduces DNA polymerase fidelity and PCR amplification efficiency. Biochem Biophys Res Commun 355(2):431-437). Therefore, formalin / formaldehyde-based fixatives are not ideal for molecular analysis. Accordingly, the advantage of aqueous stabilizing compositions and methods for preserving body fluids at ambient temperature, as disclosed herein, is that the compositions and methods of this application do not require the use of formaldehyde or compounds / components that can release aldehydes, such as formaldehyde-releasing agents, formaldehyde donors, or formaldehyde-releasing preservatives. [Examples]

[0054] (Materials and Methods) [Cell-free nucleic acid extraction] Cell-free nucleic acid extraction was performed according to the manufacturer's protocol using the QiaAmp Circulating Nucleic Acid Extraction Kit (Qiagen; Catalog). The procedure was performed using log number 55114). First morning urination (FMFV) human urine samples, random midday urination (FV) urine samples, and saliva samples were centrifuged at 3000g–3800g for 10–20 minutes at room temperature (RT), and the clarified supernatant (2–4 mL) was used for cell-free nucleic acid extraction. The extracted cell-free nucleic acid profiles were evaluated on a 4200 Agilent Tapestation platform using HS D5000 tape (Agilent, catalog number 5067-5592) and reagents (Agilent, catalog number 5067-5593).

[0055] [Urine extracellular vesicle (EV) RNA extraction] Urine EV RNA extraction was performed using the exoRNeasy Maxi Kit (Qiagen; catalog number 77164) or ultrafiltration. Urine samples were centrifuged at 3000 × g for 10 minutes at room temperature, followed by pre-clarification by filtering the supernatant using a 0.80 μm syringe filter (Sartorius® Minisart NML®, catalog number 16592, or Millipore® Millex®-AA, catalog number SLAA033SB). EV isolation and >200 nucleotide (nt) long RNA extraction were then performed according to the manufacturer's instructions (Supplementary information: Exosomal RNA including miRNA was purified from urine using the exoRNeasy Serum / Plasma Midi / Maxi Kit). EV and EV RNA isolation using ultrafiltration was performed using an AMICON Ultra-15 centrifuge unit equipped with an Ultracel-100 regenerated cellulose membrane (Millipore-Sigma, catalog number UFC910024) as follows.

[0056] 1. Centrifuge an empty Ultracel-100 15mL column in 1XPBS pH7.4 (Thermo fisher) using centrifugation at 4000g for 5 minutes at room temperature (RT). It was cleaned using Scientific (catalog number 10010023).

[0057] 2. The urine samples, which had been previously clarified and filtered, were concentrated using an Ultracel-100 column by centrifugation at 4000g for 10 minutes at room temperature, and the resulting filtrate was discarded.

[0058] 3. The column filter containing the retained concentrated urine, at 15 mL Ultracel-100, was washed with 1XPBS (pH 7.4) (Thermo Fisher Scientific, catalog number 10010023) by centrifugation at 4000 g for 5 minutes at room temperature.

[0059] 3,700 μL of QIAzol Lysis Reagent (Qiagen, catalog number 79306) was added directly to a washed Ultracel-100 filter for lysis of captured EVs for EV RNA extraction. The filter column was transferred to a new 50 mL Falcon tube, vortexed for 10 seconds, incubated at room temperature for 5 minutes, and then centrifuged at 4000 g for 5 minutes at room temperature.

[0060] 4. The obtained filtrate and the suggestive lysate retained on the filter were collected for EV RNA isolation. 100 μL of chloroform was added and vortexed vigorously. Allow to stand at room temperature for 2-5 minutes.

[0061] Centrifuge at 12,000xg for 15 minutes at 5.4°C. Transfer approximately 400 μL of the aqueous phase to a new tube.

[0062] 6. Before transferring the mixture to the Qiagen RNeasy MinElute column, add 400 μL (equal volume) of 70% ethanol and mix as needed. At room temperature for 30 seconds, 8,0 Centrifuge at 00xg. Discard the filtrate.

[0063] 7. Add 700 μL of Buffer RWT (Qiagen) to the column. Centrifuge at 8,000xg for 30 seconds at room temperature. Discard the filtrate.

[0064] 8. Add 500 μL of Buffer RPE (Qiagen) to the column. Centrifuge at 8,000xg for 30 seconds at room temperature. Discard the filtrate.

[0065] 9. Add 500 μL of Buffer RPE (Qiagen) to the column. Centrifuge at 8,000xg for 2 minutes at room temperature. Discard the filtrate and transfer the empty column to a new 2 mL collection tube (Qiagen). Centrifuge the column at maximum speed for 5 minutes with the lid open to dry the membrane.

[0066] 10. Add 20 μL of RNase-free water to the center of the dried spin column. Allow the column to stand at room temperature for 1 minute, then centrifuge at maximum speed at room temperature for 1 minute.

[0067] 11. Store the collected RNA samples at -80°C until quantification and downstream processing.

[0068] 12. Take the extracted EV RNA sample and, following the manufacturer's instructions, transfer it to Agilent RNA Quantification was performed using the 6000 Pico Kit (catalog number 5067-1513) with an Agilent 2100 Bioanalyzer, and / or Ribogreen quantitative analysis was performed using the Quant-iT Ribogreen RNA Assay Kit (Thermo Fisher Scientific, catalog number R11490) for downstream cDNA preparations.

[0069] [16S qPCR assay] Nucleic acids extracted from urine samples were subjected to a qPCR assay using 2X iTaq Universal SYBR Mastermix (Bio-Rad, catalog number 1725121) to quantify bacterial DNA content. The primers and qPCR conditions for bacterial 16S rRNA are as follows: BacrRNA173-forward primer 5'ATTACCGCGGCTGCTGG 3' (SEQ ID NO: 1), BacrRNA173-reverse primer 5'CCTACGGGAGGCAGCAG 3' (SEQ ID NO: 2) (DC Emery, DK Shoemark, TE Blatstone, CM Waterfall, JA Coghill, TA Cerajewska, M Davies, NX West, SJ Allen (2017) 16S rRNA next generation sequencing analysis shows bacteria in Alzheimer's post-mortem brain. Frontiers in Aging Neuroscience 9:195. Doi:10.3389 / friagi.2017.00195). The amplification mixture (20 μL) contained 10 μL of 2XiTaq Universal SYBR mastermix, 1 μL each of 10 μM forward and reverse primers, 6 μL of nuclease-free water (NFW from Invitrogen, catalog number 10977023), and 2 μL of extracted urinary cell-free nucleic acids. E. coli gDNA standards and non-template controls (2 μL of RNase / DNase-free water) were used for each qPCR run in serial dilutions (1, 1:10, 1:100, and 1:1000). PCR reactions were performed on a Bio-Rad C1000 Touch Thermal Cycler (#1851196) under the following conditions: 95°C, 5 minutes, [95°C: 20 seconds, 56°C: 30 seconds] × 45 cycles. The melting curve was obtained by heating the sample from 65°C to 95°C in 0.5°C increments and reading the plate for 5 seconds at each increment. Quantitative analysis of bacterial cell-free DNA or cell-based DNA was performed using [C]. t(T7) -C t(T0) ] represents "ΔC t This was done using "[ ]". "C t(T7) " and "C t(T0) These terms represent the qPCR cycle thresholds for day 7 and day 0, respectively.

[0070] [Human β-globin qPCR assay] Nucleic acids extracted from urine samples were subjected to a qPCR assay using 2X iTaq Universal SYBR Mastermix (Bio-Rad, catalog number 1725121) to quantify bacterial DNA content. The primers and PCR conditions for the human β-globin qPCR assay are described in the literature (M Jung, S Klotzek, M Lewandowski, M Fleischhacker, K Jung (2003) Changes in concentration of DNA in serum and plasma during storage of blood The samples (Clinical Chem 49(6):1028-1029) were as follows: Forward primer: 5′ACACAACTGTGTTCACTAGC 3′ (SEQ ID NO: 3), Reverse primer: 5′CAACTTCATCCACGTTCACC 3′ (SEQ ID NO: 4). The amplification mixture (20 μL) contained 10 μL of 2X iTaq Universal SYBR master mix, 1 μL each of 10 μM forward and reverse primers, 6 μL of nuclease-free water (Invitrogen, catalog no. 10977023), and 2 μL of extracted urinary cell-free nucleic acids. Human gDNA standards and non-template controls (2 μL of RNase / DNase-free water) were used for each qPCR run in serial dilutions (1, 1:10, 1:100, 1:1000). The PCR reaction was performed using a Bio-Rad C1000 Touch Thermal Cycler (#1851196) under the following conditions: 95°C, 5 minutes, [(95°C: 20 seconds, 56°C: 30 seconds) × 45 cycles]. The melting curve was obtained by heating the sample from 65°C to 95°C in 0.5°C increments and reading the plate for 5 seconds at each increment. For stability evaluation: Human cell-free DNA quantification analysis was performed [C t(T) -Ct(T0) ] represents "ΔC t This was done using "C t(T) " represents the qPCR cycle threshold on day 7 or day 14, and "C t(T0) " represents the qPCR cycle threshold on day 0 for both unstorage urine samples and chemical-containing urine samples. Cell-free DNA quantification for unstorage day 0 (NA) samples is [C t(T) -C t(T0 NA) ] as ΔC t It is quantified using calculations, where C t(T0 NA) This represents the qPCR cycle threshold for unstorage samples on day 0. Furthermore, to evaluate neutrality (i.e., the change in the basal concentration of cell-free DNA due to the addition of a given chemical to the urine sample at the time of collection), ΔC t Calculate [C t(T0 Chem) -C t(T0 NA) ] is done as follows, and here, C t(T0 Chem) This represents the qPCR cycle threshold for a urine sample on day 0 containing a chemical / stabilizing solution.

[0071] [In vitro DNA methylation assay] This assay is described in the literature (C Ernst, PO McGowan, V Deleva, MJ; Meaney, M; Szyf, G; Turecki (2008) The effects of pH on DNA methylation state: In vitro and post-mortem brain studies. J Neurosci Methods 174(1):123-125). The pGL3-basic plasmid (Promega, catalog number E1751) contains 25 CCGG sites. 1 μg of plasmid was treated with CpG methyltransferase (New England Biolabs, catalog number M0226S), an enzyme that methylates all cytosine nucleotides in CpG dinucleotides, according to the manufacturer's protocol. To confirm the methylation state, the methylated plasmid (pGL3-CH3) was subjected to restriction endonuclease digestion with HpaII and MspI. Both of these enzymes recognize the same site (CCGG). HpaII was blocked from cleaving DNA when internal C was methylated, and MspI was sensitive to the methylation state of internal C. It is not sexual. In vitro methylated pGL3 plasmid, Zymo Research's Column purification was performed using the DNA Clean&Concentrator-5 kit (catalog number D4013). Equal volumes of purified plasmid were spiked into either 1XTE buffer pH 8.0 (positive control) or male and female pool FMFV urine samples containing the composition of the present invention, and the reaction tubes were kept at room temperature for 7 days. After incubation, the DNA samples were converted to bisulfite using the Qiagen EpiTec Bisulfite Kit (catalog number 59104). Bisulfite treatment resulted in sequence differences between the unmethylated plasmid (cytosine to uracil conversion) and the methylated plasmid (methylated cytosine maintains immunity to conversion) (Y Li and TO Tollefsbol (2011) DNA methylation detection: Bisulfite genomic sequencing analysis. Methods Mol Biol 791:11-21. Doi:10.1007 / 978-1-61779-316-5_2). PCR experiments using methylated plasmid-specific primers generate a 278 bp amplicon. The primers were used as described above by Ernst et al. (2008) (forward primer: 5'-AAGATGTTTTTTTGTGATTGGT-3' (SEQ ID NO: 5), reverse primer: 5'-TTCCTATTTTTACTCACCCAAA-3' (SEQ ID NO: 6)).

[0072] [HPV Plasmid Spike-In Assay] The E. coli DH5α strain HPV16 plasmid (human papillomavirus, type 16 clone) (ATCC catalog number 45113) was cultured in LB medium for HPV16 plasmid extraction using the ZymoPURE II Plasmid Maxi prep Sample Kit (Zymo Research, catalog numbers D4202 and D4203). The extracted / purified plasmid was spiked into the first morning urine samples from the female and male pools at concentrations (1-10 ng / mL), with or without the conserved chemicals of the present invention. 200 μL aliquots of each plasmid-spiked urine sample were processed for total DNA extraction using the QiaAmp DNA mini kit in QIAcube Connect. The amount of plasmid DNA in each reaction tube and on different days (T0 and T7) was compared to the ampicillin resistance gene (Amp) found on the HPV16 plasmid backbone. R ) was quantified using a qPCR assay. Amp R The qPCR primers and conditions were as follows: Forward primer (FP): 5'AGCCATACCAAACGACGAG 3' (SEQ ID NO: 7), Reverse primer (RP): 5'AGCAATAAACCAGCCAGCC 3' (SEQ ID NO: 8). The amplification mixture (20 μL) contained 10 μL of 2X iTaq Universal SYBR master mix, 1 μL each of 10 μM forward and reverse primers, 6 μL of nuclease-free water (Invitrogen, catalog number 10977023), and 2 μL of extracted urinary nucleic acid. HPV16 plasmid standards and non-template controls (2 μL of RNase / DNase-free water) were used for each qPCR run in serial dilutions (1, 1:10, 1:100, 1:1000). The PCR reaction was performed using a Bio-Rad C1000 Touch Thermal Cycler (#1851196) under the following conditions: 95°C, 5 minutes, [(95°C: 20 seconds, 55°C: 30 seconds) × 45 cycles]. The melting curve was obtained by heating the sample from 65°C to 95°C in 0.5°C increments and reading the plate for 5 seconds at each increment. HPV plasmid DNA quantification analysis was performed [C t(T7) -Ct(T0) ] represents "ΔC t This was done using "C t(T7) " and "C t(T0) These terms represent the qPCR cycle thresholds for day 7 and day 0, respectively.

[0073] [Extraction of cell-free and cellular RNA from urine] To extract total cellular RNA from the urine pellet, 1) extract it using the Qiagen RNeasy plus Mini Kit (catalog no. 74134) according to the manufacturer's instructions and elute it in 30 μL of RNase-free water, and / or 2) as described below, T Extraction was performed using rizol LS reagent (Sigma, catalog number T3934).

[0074] At each time point, the sample was rotated at 3800xg for 20 minutes. The pellet was resuspended at each time point in 750 μL of TRI Reagent LS (and 250 μL of water). After allowing the sample to stand for 5 minutes, it was frozen at -80°C. The sample was thawed at room temperature and processed as follows:

[0075] Add 1,200 μL of chloroform and vortex vigorously. Let stand at room temperature for 2 to 15 minutes.

[0076] Centrifuge at 12,000xg for 15 minutes at 2.4°C (the volume of the aqueous phase is approximately 70% of the volume of the TRI Reagent). Transfer 500 μL of the aqueous phase to a new tube.

[0077] Add 3.50 μL of 10x DNase buffer and 1 μL of RNase-free DNase (Lucigen, catalog number D9905K). Incubate at 37°C for 15 minutes.

[0078] Add 4,500 μL (equal volume) of acid phenol chloroform and vortex vigorously. Let stand for 5 minutes, then centrifuge at 12,000 xg for 10 minutes at 4°C. Transfer the aqueous phase to a new tube and add 1 μL of 20 μg / μL glycogen and 500 μL of isopropanol. Let stand at room temperature for 10 minutes.

[0079] Centrifuge at 12,000xg for 8 minutes at 5.4°C. Remove the supernatant and wash the pellet with 1 mL of 75% ethanol. Vortex the sample and centrifuge at 12,000xg for 5 minutes. Remove the supernatant and air dry the pellet for 5-10 minutes.

[0080] Resuspend the pellet in 6.30 μL of RNase-free water.

[0081] All cell-free nucleic acids were extracted from the supernatant using the Qiagen Circulating Nucleic Acids Kit (catalog number 55114) and eluted in 30-50 μL of kit buffer AVE. RNA profiling was performed using a 2100 Agilent Bioanalyzer with the Pico6000 RNA assay (catalog number 5067-1513). mRNA targeting analysis was performed using Thermo Fisher The Taqman-based RT-qPCR assay was performed using β-actin (ACTB:Hs00357333_g1) from Scientific (catalog number 4331182). For cell-free RNA quantification studies, cell-free DNA removal was performed using DNAse I digestion before cDNA synthesis, followed by RNA cleanup using the RNeasy MinElute Cleanup Kit (Qiagen, catalog number 74204) according to the instructions in the QIAamp Circulating Nucleic Acids Kit (Qiagen; catalog number 55114).

[0082] [RT-qPCR assays of cells, cell-free cells, and EVRNA] cDNA was prepared using the manufacturer's protocol with random hexamers and M-MLV reverse transcriptionase (Thermo Fisher Scientific, catalog no. 28025-013) using equivalent amounts of RNA extracted from each sample. The β-actin Taqman assay was performed using 2 μL of pure cDNA with Taqman Gene Expression Master Mix II with UNG (Thermo Fisher Scientific, catalog no. 4440038) according to the manufacturer's protocol, with either pairs or triplets of each sample. The procedure was performed as follows. First, the efficiency of the ACTB TaqMan assay was tested using serial dilutions of cDNA prepared from blood RNA. The PCR reaction was performed on a Bio-Rad C1000 Touch Thermal Cycler (catalog no. 1851196) under the following conditions: 50°C, 2 min, 95°C: 10 min, [95°C: 15 sec, 60°C: 1 min] × 45 cycles. RNA stability was quantified using [C t(T7) -C t(T0) ] represents "ΔC t It was expressed as "C t(T7) " and "C t(T0) The terms " and " represent the qPCR cycle thresholds for day 7 and day 0, respectively. Furthermore, to evaluate neutrality (the change in the baseline concentration of the analyte due to the addition of a given chemical substance to the urine sample at the time of collection), ΔC t Calculate [C t(T0 Chem) -C t(T0 NA) ] is done as follows, and here, C t(T0 Chem) This represents the qPCR cycle threshold for a urine sample on day 0 containing a chemical / stabilizing solution.

[0083] [Droplet digital PCR (ddPCR) analysis of DNA samples of the target β-globin gene] For ddPCR, each reaction product contained a final primer concentration of 100 nM with 2x QX200 ddPCR EvaGreen Supermix (Bio-Rad, catalog number 1864034) in a final volume of 23 μL. 20 μL of the reaction mix was transferred to a DG 8 cartridge (Bio-Rad, catalog number 1864008) containing 65 μL of Droplet Generation Oil for EvaGreen (Bio-Rad, catalog number 1864006), covered with a DG8 gasket (Bio-Rad, catalog number 1863009), and then placed in a Bio-Rad QX200 Droplet container. The material was converted into droplets using a Generator. The droplets were then transferred to a 96-well plate (Bio-Rad, catalog number 12001925) and heat-sealed at 180°C for 6 seconds using a Pierce-able Foil Heat Seal (Bio-Rad, catalog number 1814040) and a Bio-Rad PX1 PCR Plate Sealer (catalog number 1814000). The sample was then cycled using a Bio-Rad C1000 Touch Thermal Cycler (catalog number 1851196) with a three-step cycling program: 5 minutes at 95°C, followed by 50 cycles of 30 seconds at 95°C, followed by annealing at 58°C for 1 minute and 72°C for 30 seconds, followed by 5 minutes at 4°C and 5 minutes at 90°C, and finally held at 12°C. The primers used in the β-globin ddPCR assay were the same as those used in the β-globin qPCR assay described above (forward primer: 5′ACACAACTGTGTTCACTAGC 3′ (SEQ ID NO: 3), reverse primer: 5′CAACTTCATCCACGTTCACC 3′ (SEQ ID NO: 4)). All ramp speeds were set to 2°C / second. The cycle plate was then transferred, read with a QX200 Droplet Reader (Bio-Rad, catalog number 1864003), and the data was read using Quanta-Soft. Analysis was performed using software (Bio-Rad, catalog number 1864011). For analysis, the abundance was reported as concentration (number of copies per 1 μL), and the total number of received droplets exceeded 10,000 for the given sample.

[0084] [Extraction and quantification of cellular DNA from urine] Total cellular DNA from urine pellets was extracted using the QiaAmp DNA mini kit (Qiagen, catalog number 51306) according to the manufacturer's instructions and eluted in 50 μL of elution buffer or nuclease-free water (NFW). At each time point, the samples were rotated at 3800 x g for 20 minutes. The urine pellets were frozen at -80°C until extraction. The pellets were thawed at room temperature, resuspended in 200 μL of 1X PBS, and then total DNA extraction was performed. Total cellular DNA quantification was performed using Quant-iT® Picogreen® dsDNA reagent (Thermo Fisher Scientific, catalog number P7581). Whole-genome DNA profiles were evaluated using Genomic DNA Tape according to instructions on an Agilent 4200 Tapestation. Targeted amplification of human genomic DNA was performed on amplicon products of approximately 1 Kb using GAPD. The assay was performed using H PCR. The primers and PCR conditions for the GAPDH qPCR assay were as follows: Forward primer: 5'-GTC AAC GGA TTT GGT CGT ATT G-3' (SEQ ID NO: 9), Reverse primer: 5'-CTC TCT TCC TCT TGT GCT CTT G-3' (SEQ ID NO: 10). 95°C, 5 min, [95°C, 30 sec; 56°C, 30 sec; 72°C, 60 sec] x 25 cycles; 72°C, 10 min, 4°C, hold. Each reaction was set up as follows:

[0085] [Table 1]

[0086] In the following examples, the proportion of sugar in the composition is expressed as weight / volume, the proportion of alkanol (e.g., methanol or ethanol) in the composition is expressed as volume / volume, and the proportion of boric acid is expressed as weight / volume.

[0087] Example 1 - The cell-free DNA content in urine is sample- and sex-dependent.

[0088] Approximately 20-30 mL of first morning (FMFV) urine was collected from healthy female and male donors into urine sample cups and transported and stored on ice packs until downstream processing. Within 3 hours of urine collection, 4.5 mL aliquots of each sample were centrifuged at 3,800 g for 20 minutes at room temperature. Cell-free nucleic acids were extracted using QIAamp Circulating Nucleic Acid. Extraction was performed from 4.0 mL of supernatant obtained either immediately or from frozen supernatant aliquots stored at -80°C using the Acids Kit (Qiagen, catalog number 55114; see Materials and Methods). Subsequently, urinary cell-free DNA (Ucf-DNA) concentrations were measured using the Pico-Green quantification assay. The mean urinary cell-free DNA concentration in female donors was approximately 15 ng / mL, compared to approximately 3 ng / mL in males (see Figure 1). The presence of higher levels of cell-free DNA in female urine than in male urine has also been reported in the literature (Streleckiene G, Reid HM, Arnold). N, Bauerschlag D, Forster M. Quantifying cell free DNA in urine: comparison between commercial kits, impact of gender and in See ter-individual variation. Biotechniques. 2018, 64(5):225-230.

[0089] Example 2 - Human cell-free DNA is degraded in unstabilized urine stored at room temperature.

[0090] In the absence of preservatives or stabilizers (NA), urine stored at room temperature undergoes both visible and molecular changes. In this example, 20–30 mL of first morning urination (FMFV) urine was collected from healthy female donors and stored at room temperature for 7 days. During this period, this representative urine sample was subjected to bacterial count (OD) analysis. 600nm The solution gradually became cloudy, as measured by an increase in ΔC of bacterial 16S DNA (Figure 2A). This observation is due to the ΔC of bacterial 16S DNA. t This was further supported by a quantitative bacterial 16S qPCR assay (see Figure 2B, Materials and Methods) which showed a dramatic decrease in ΔC of β-globin DNA, indicating an increase in bacterial cell-free DNA content due to bacterial cell overgrowth and lysis. In contrast, ΔC of β-globin DNA t A dramatic increase was observed, showing a significant decrease in human cell-free DNA content (Figures 2B-D). This was measured by β-globin cell-free DNA qPCR assay (see Figure 2B, Materials and Methods) and Agilent 4200 Tapestation analysis (see arrows in Figures 2C-D, Materials and Methods). Both methods comparing cell-free DNA extracted from urine aliquots on day 0 and day 7 clearly show a substantial decrease in cell-free DNA content after 7 days at room temperature (Figures 2B-D).

[0091] Example 3 - Different sugars (monosaccharides / disaccharides) can be used in this urine stabilization composition for cell-free DNA.

[0092] Five healthy male and female donors provided 60–70 mL of first morning urination (FMFV) urine samples. The samples were transported to the laboratory on ice packs, where 1) 20 mL of each sample was stored in the absence of the stabilizing composition (not stored), and 2) 12 mL of each urine sample was mixed with 4 mL of stock solution [Table 1(i)] containing different sugars, namely glucose (Chem G), sucrose (Chem S), and fructose (Chem F), and 4 mL of 95% ethanol. In this example, the final composition of the stabilizing solution after mixing with urine is described below [see Table 1(ii)]. Both types of samples were stored at room temperature (23±3°C) for at least 7 days.

[0093] On days 0 and 7, 4.5 mL aliquots of each unstorage sample and samples containing different chemicals were centrifuged at 3,800 g for 20 minutes at room temperature. After centrifugation, 4.0 mL of supernatant was collected from each sample, and cell-free DNA was extracted using the QIAamp Circulating Nucleic Acids Kit (Qiagen, see Materials and Methods). Two microliters of purified cell-free DNA from each sample served as templates for β-globin qPCR analysis (see Materials and Methods). Figures 3A and 3B show the dramatic decrease in human cell-free DNA content after unstorage samples were stored at room temperature for 7 days, and the ΔC of β-globin DNA. t This shows a dramatic increase. In contrast, ΔC is almost zero. t As shown by the median values, there was no significant change in human cell-free DNA levels in samples containing different sugars after 7 days at room temperature [Figures 3A(i) and 3B(i)]. Furthermore, there was no significant change in cell-free DNA content in urine samples upon addition of chemicals compared to unstorage (NA) samples at collection (day 0) [Figures 3A(ii) and 3B(ii)].

[0094] In a different experimental setup, healthy male and female donors provided random first vomit (FV) urine samples using the Colli-pee® device (Novosanis). The samples were transported to the laboratory on ice packs, where the male and female urine samples were pooled to create male pooled samples and female pooled samples, respectively. Aliquots were 1) stored in the absence of the stabilizing composition (not stored), and 2) mixed with different sugars [Table 2(i)], namely glucose (Chem G) and fructose (Chem F), in a urine:chemical ratio of 1:0.43. In this example, the final composition of the stabilized solution after mixing with urine is described below [see Table 2(ii)]. All samples were stored at room temperature (23±3°C) for at least 7 days.

[0095] On days 0 and 7, 2.5 mL aliquots of each unstorage sample and samples containing different chemicals were centrifuged at 3,000 g for 10 minutes at room temperature, followed by filtration using a 0.8 μm syringe filter (Sartorius® Minisart NML®, catalog no. 16592, or Millipore® Millex®-AA, catalog no. SLAA033SB). 2.0 mL of the pre-clarified supernatant was used for cell-free DNA (cfDNA) extraction using the QIAamp Circulating Nucleic Acids Kit (Qiagen, see Materials and Methods). Figure 3C(i) shows the dramatic decrease in human cell-free DNA content after 7 days of storage of unstorage samples at room temperature, specifically the ΔC of β-globin DNA. t It shows a dramatic increase (median: +5.8). In contrast, ΔC at the β-globin DNA level... t There was no significant change, and after 7 days at room temperature, the chemical substances F (Chem F) and G (Chem F) showed no significant changes. G) This suggests that there was no change in the human cell-free DNA content in the contained samples [Figure 3C(i)]. Furthermore, there was no significant change in the cell-free DNA content in the urine samples when chemical substances were added compared to unstorage (NA) samples at the time of collection (day 0) [Figure 3C(ii)].

[0096] Compositions containing the disaccharide sucrose are difficult to prepare due to their extremely high viscosity, which leads to improper mixing of the components. The high viscosity further hinders mixing, potentially resulting in improper addition of the stabilizing solution to the sample. Therefore, to avoid these fundamental complexities in the preparation and testing of the stabilizing solution, we focused on the effectiveness of monosaccharide-containing compositions while maintaining sufficient stabilization of the cell-free DNA content (Figures 3B and 3C). Overall, monosaccharides are preferred over disaccharides in this invention due to the processability of the sample.

[0097] [Table 2]

[0098] [Table 3]

[0099] [Table 4]

[0100] [Table 5]

[0101] Example 4: The presence of sugar, alcohol, buffer, and low pH modulates the stabilizing effect of the composition.

[0102] Six healthy female donors provided 30 mL of first morning urine (FMFV) samples. The urine samples were pooled together to produce two different pooled urine samples: 1) 15 mL of each pooled urine sample was stored in the absence of the stabilizing composition (NA), and 2) 11 mL of each pooled urine sample was mixed with 3 mL of the stock solution (with different replicates of the composition; Table 3 below) and 1 mL of 95% ethanol / methanol as described in Table 4. The final compositions after mixing with the pooled urine are described in Table 5 below. All samples were stored at room temperature (23±3°C) for at least 7 days. For comparison, 25 mL of pooled urine was mixed with 5 mL of Streck's urine fixative (reference composition), commercially available as "Cell-free DNA Urine Preserve" (catalog number 230216), and stored at room temperature for at least 7 days. This reference composition contains the formaldehyde-releasing agent imidazolidinyl urea, as well as K3EDTA and glycine.

[0103] On days 0 and 7, 4.5 mL aliquots of each unstorage sample and chemical-containing pooled sample were centrifuged at 3,800 g for 20 minutes at room temperature. After centrifugation, 4.0 mL of supernatant was collected from each sample and stored at -80°C. To evaluate the stability of cell-free DNA with and without stabilization compositions, frozen supernatants from both unstorage urine samples and urine samples containing different chemicals on days 0 and 7 were subjected to cell-free DNA extraction using the QIAamp Circulating Nucleic Acids Kit (Qiagen, see Materials and Methods). Two microliters of purified cell-free DNA from each sample served as templates for β-globin qPCR analysis (see Materials and Methods).

[0104] Figure 4(A and B) shows the dramatic decrease in human cell-free DNA content after storing unstorage samples at room temperature for 7 days, specifically the ΔC of β-globin DNA. t This shows a dramatic increase (NA (T7, Figures 4A and 4B). The effect of different alcohols (ethanol and methanol) on the stabilization efficiency of the composition was investigated using one of the pooled urine samples. Figure 4A suggests that ethanol in the composition may be substituted with methanol; however, methanol is toxic at the concentrations used and, compared to ethanol, is not ideal for home collection. Furthermore, human cell-free DNA in urine samples containing the composition (Chem F, pH 4.7-5.0) was found to be similar to Streck's urine fixative known as "Cell-free DNA Urine Preserve" after 7 days at room temperature (Figure 4B), indicating that the composition exhibits similar ΔC to both the composition and the reference composition. t As indicated by the values, it was suggested that this composition is as effective as the reference composition. By removing any of ethanol, buffer salts (e.g., sodium acetate), sugars, ethanol + sugar, and ethanol + salt, and by increasing the pH (≧5.5), ΔC t As indicated by the decrease in value, the effect of chemical composition F on preserving cell-free DNA content was reduced. ΔC tThis decrease suggests an increase in cell-free DNA content in urine samples maintained at room temperature for 7 days in different chemical replicates, compared to a complete composition of chemical F containing ethanol (pH 4.7–5.0) (Figure 4B). Finally, this data indicates that the ideal pH range for this composition is 4.7–5.0 (+ / -0.2).

[0105] [Table 6]

[0106] [Table 7]

[0107] [Table 8]

[0108] Example 5: A stabilizing composition for preserving nucleic acids in urine at room temperature.

[0109] A total of 11 healthy donors (males and females) provided 40–60 mL of first morning urination (FMFV) urine samples. The samples were transported to the laboratory on ice packs, where i) 20 mL of each sample was stored in the absence of the stabilizing composition (not stored), and 2) 12 mL of each urine sample was mixed with the stabilizing solution [4 mL of stock solution; Table 6(i) and 4 mL of 95% ethanol]. In this example, the final composition of the stabilizing solution after mixing with urine is described below [see Table 6(ii)]. Both types of samples were stored at room temperature (23 ± 3 °C) for at least 7 days. On days 0 and 7, aliquots of each 4.5 mL unstored sample and the sample containing the stabilizing solution were centrifuged at 3,800 g for 20 minutes at room temperature. After centrifugation, 4.0 mL of supernatant was collected from each sample, and cell-free DNA (cfDNA) was extracted using the QIAamp Circulating Nucleic Acids Kit (Qiagen, see Materials and Methods). Two microliters of purified cfDNA from each sample served as templates for β-globin qPCR analysis (see Materials and Methods). Figure 5A shows the dramatic decrease in human cell-free DNA content after unstorage samples were stored at room temperature for 7 days, as shown by the ΔC of β-globin DNA. t The dramatic increase in ΔC at the β-globin DNA level is illustrated (Figure 5A). In contrast, the ΔC at the β-globin DNA level is shown. t There were no significant changes, suggesting that there was no change in human cell-free DNA levels in Chem F-containing samples after 7 days at room temperature [Figure 5A(i)]. Furthermore, there was no significant change in cell-free DNA content in urine samples upon addition of the chemical substance compared to unstorage (NA) samples at collection (day 0) [Figure 5A(ii)]. Representative Tapestation profile analysis using HSD5000 tape (Agilent Technologies) (Figure 5B) showed the presence of cell-free nucleic acids in unstorage day 0 aliquots, chemical substance F (Chem F) day 0, and day 7 aliquots, and the cell-free nucleic acids were degraded in the unstorage day 7 aliquot.

[0110] In a different experimental setup, urine samples from both healthy male and female donors were pooled to produce pooled male and female urine samples. Aliquots of each sample were stored 1) in the absence of the stabilizing composition (unstorage), 2) mixed with the stock solution in a ratio of 1:0.43 [Table 7(i)], and 3) mixed in a Norgen urine collection and storage tube (catalog 18111). In this example, the final composition of the stabilizing solution "Chemical Substance F (Chem F)" after mixing with urine is described below [see Table 7(ii)]. All samples were stored at room temperature (23±3℃) for at least 7 days. On days 0 and 7, 2.5 mL aliquots of each unstorage urine sample and urine sample containing the stabilizing solution were centrifuged at 3,000 g for 10 minutes at room temperature, followed by filtration through a 0.8 μm syringe filter (Sartorius® Minisart). NML® ​​(registered trademark), catalog number 16592, or Millipore® Millex®-AA, catalog number SLAA033SB) was used. After centrifugation, 2.0 mL of supernatant was collected from each sample, and cell-free DNA (cfDNA) was extracted using the QIAamp Circulating Nucleic Acids Kit (Qiagen, see Materials and Methods). Figure 5C(i) shows the dramatic decrease in human cell-free DNA content after unstorage samples were stored at room temperature for 7 days, as indicated by the ΔC of β-globin DNA. t The dramatic increase in ΔC at the β-globin DNA level is illustrated [Figure 5C(i)]. In contrast, the ΔC at the β-globin DNA level is shown. t There was no significant change, suggesting that there was no change in the level of human cell-free DNA in samples containing chemical substance F (Chem F) after 7 days at room temperature [Figure 5C(i)]. On the other hand, samples containing the Norgen urine preservative showed a dramatic decrease in the human cell-free DNA content after 7 days of storage at room temperature, as indicated by the ΔC of β-globin DNA. t A significant increase was observed (Figure 5C(i)). Furthermore, there was no significant change in the cell-free DNA content in the urine sample upon addition of the chemical substance compared to the unstorage (NA) sample at the time of collection (day 0) [Figure 5C(ii)].

[0111] In another experimental setting, first void urine samples from healthy male and female donors collected using the Colli-pee® device (Novosanis) were pooled to generate male and female pooled urine specimens, respectively. Aliquots of each specimen were (1) without the stabilizing composition (not preserved), (2) mixed with the stock solution (Table 7i) at a ratio of 1:0.43, and (3) mixed and stored in Norgen urine collection and preservation tubes (Norgen Biotek, Catalog 18111). In this example, the final composition of the stabilizing solution after mixing with urine is described below (see Table 7(ii)). All specimens were stored at room temperature (23 ± 3°C) for at least 14 days. On day 0 and day 14, 2.5 mL aliquots of each non-preserved urine specimen and urine specimen containing the stabilizing solution were centrifuged at 3,000 g for 10 minutes at room temperature, followed by 0.8 μm syringe filtration (Sartorius® Minisart NML®, Catalog No. 16592, or Millipore® Millex®-AA, Catalog No. SLAA033SB). After centrifugation, 2.0 mL of the supernatant was recovered from each specimen, and cell-free DNA (cfDNA) was extracted using the QIAamp Circulating Nucleic Acids Kit (Qiagen, see Materials and Methods). Figures 5D(i) and 5E(i) show a dramatic decrease in the human cell-free DNA content and a dramatic increase in the ΔC t of β-globin DNA after storing the non-preserved specimens at room temperature for 14 days. In contrast, there was no significant change in the ΔC t of β-globin DNA levels, suggesting no change in the human cell-free DNA levels in the Chem F-containing specimens after 14 days at room temperature [Figures 5D(i), 5E(i)]. On the other hand, samples containing the Norgen urine preservative showed a decrease in the ΔC t of β-globin, indicating an increase or decrease in the human cell-free DNA content in female and male urine specimens, respectively, after storage at room temperature for 14 days [Figure 5D(i)] or a decrease in the ΔC tAn increase in either [Figure 5E(i)] was observed. Furthermore, female urine samples containing the Norgen urine preservative showed a change in neutrality when compared to the chemical F sample at the time of addition (day 0) [Figure 5D(ii)].

[0112] [Table 9]

[0113] [Table 10]

[0114] [Table 11]

[0115] [Table 12]

[0116] Example 6: The stabilizing composition maintains the integrity of prostate cancer cells for 7 days at room temperature.

[0117] Urine from male donors may contain shed prostatic epithelial cells as a result of shedding from the prostate during normal turnover. Furthermore, this secretion into the urine can also be increased by physical manipulation of the prostate, such as by prostate massage, particularly in patients with prostate cancer. Therefore, prostate cancer cells were used as one of the target cell types to test the stability and intactness of cells in urine samples containing a stabilizing solution.

[0118] Cell integrity was measured in the presence of the stabilizing composition chemical F using the cell-free DNA content over time. In one experimental setup [Example 6(i)], first morning urinary excretion (FMFV) samples were pooled from three healthy male and three female donors to produce one female pooled (FP) urine sample and one male pooled (MP) urine sample. Along with the male urine, the female urine samples were also included in this study to test the stability of cancer cells in a more concentrated, high-biomass-containing urine matrix. The pooled samples were centrifuged at 3,000 g for 10–20 minutes at room temperature, and the supernatant obtained was filtered using a 0.2 micron filter. These pre-clarified cell-free urine samples were divided equally and then spiked (S) with prostate cancer cells (LNCaP clone FGC; ATCC CRL-1740™).

[0119] To test the concentration-dependent effect of chemical F on the stability of spiked prostate cancer cells, various volumes (mL) of the stock solution (see Table 8) and a fixed volume of 95% ethanol were added and mixed with pre-clarified urine containing spiked prostate cancer cells to achieve different final concentrations of various components in chemical F (see Table 9). The stock solution and ethanol were mixed with pre-clarified urine containing spiked prostate cancer cells as described in Table 10.

[0120] In a different experimental setup [Example (6ii)], first morning urine (FMFV) samples were pooled from three healthy women to produce one female pooled (FP) urine sample. The pooled sample was centrifuged at 3,000 g for 10–20 minutes at room temperature, and the supernatant obtained was filtered using a 0.2 micron filter. These pre-clarified acellular urine samples were divided equally and then spiked (S) with prostate cancer cells (LNCaP clone FGC; ATCC CRL-1740™). In this experimental setup, the amount (mL) of 95% ethanol was also varied along with the amount (mL) of stock solution (Table 8) to achieve different final concentrations of components in chemical F after mixing with the pre-clarified urine containing spiked prostate cancer cells, as specified in Table 11. The amounts of stock solution and ethanol were mixed with the pre-clarified urine containing spiked prostate cancer cells, as shown in Table 12.

[0121] In both experimental setups, samples were incubated with the composition of the present invention for 30–60 minutes (day 0) or 7 days prior to cell-free DNA extraction using the QIAamp Circulating Nucleic Acids Kit (see Qiagen, Materials and Methods). The extracted human cell-free DNA was quantified using a β-globin qPCR assay (see Figure 6(i–i)(A and B) and Figure 6(ii)A, Materials and Methods) and normalized to unstorage urine (NA) on day 0.

[0122] Figures 6(i-i) and 6(i-ii) suggest that spiked human prostate cells did not leak genomic DNA into the supernatant in a concentration-dependent manner in the presence of a relatively constant amount of chemical F containing ethanol. In the absence of chemical F (NA), ΔC t This resulted in a significant increase in ΔC in both male and female pooled samples, and therefore showed a decrease in cell-free DNA content [Figure 6(i-i)A and B] compared to the significant changes in 0.5X and 0.8X chemical F. On the other hand, the 0.25X concentration showed a decrease in ΔC in MP urine samples. tA decrease in (meaning an increase in cfDNA content due to impaired cellular stability leading to genomic DNA leakage), or ΔC in FP urine samples. t It showed either an increase (meaning a decrease in cfDNA content due to impaired chemical stability leading to more degradation of cfDNA). This difference may depend on the urinary matrix. Due to the presence of high biomass in female urine samples, the concentration of components diluted to a strength of 0.25X cannot inhibit the degradation of cell-free DNA from urinary DNase, and therefore the degradation rate is faster than the storage rate, leading to an overall loss of cfDNA content. On the other hand, the male urinary matrix Due to its low biomass content, the concentration of the chemical component at 0.25X intensity can still inhibit cell-free DNA degradation from urinary DNase; therefore, the storage rate is faster than the degradation rate, leading to an increase in overall cell-free DNA content. Overall, a concentration-dependent effect of chemical F on cell-free DNA profiles and cellular stability exists in both FP and MP urine samples. Representative tapestation profile analysis of FP samples (Figure 6(i-ii)C) also showed dramatic differences in cell-free nucleic acid profiles in the absence of chemical F(NA) and 0.25X chemical F between day 0 (black trace in Figure 6(i-ii)C) and day 7 (gray trace in Figure 6(i-ii)C) compared with 0.8X and 0.5X diluted chemical F (Figure 6(i-ii)C).

[0123] Figure 6(ii)A also suggests that spiked prostate cancer cells did not leak genomic DNA into the supernatant in a concentration-dependent manner, with 1X being the most effective and 0.25X being the least effective, in the presence of chemical F containing various amounts of ethanol. 0.25X chemical F was ΔC on day 0. t The initial decrease, i.e., the increase in cfDNA content, followed by ΔC tThis resulted in an increase in the number of β-globin genes per unit volume, suggesting a decrease in cell-free DNA content on day 7 (Figure 6(ii)A). The results of the β-globin qPCR assay (Figure 6(ii)A) were further supported by a β-globin droplet digital PCR assay (Figure 6(ii)B), which also revealed that a 1X chemical F solution maintained the number of β-globin genes per unit volume, while 0.25X chemical F resulted in an initial increase on day 0, followed by a significant decrease in the number of β-globin genes per unit volume after 7 days at room temperature in spiked urine samples (Figure 6(ii)B). Overall, the data suggest that the composition of the present invention maintains the integrity of prostate cancer cells in a concentration-dependent manner for at least 7 days at room temperature.

[0124] [Table 13]

[0125] [Table 14]

[0126] [Table 15]

[0127] [Table 16]

[0128] [Table 17]

[0129] Example 7: The composition of the present invention maintains the integrity of nucleated leukocytes spiked into a pre-clarified urine sample and stored at room temperature for 7 days.

[0130] Since the bodily fluids (e.g., blood and urine) of most healthy individuals do not normally contain significant amounts of cell-free nucleic acids, an increase in cell-free nucleic acid levels usually indicates a health problem (or pregnancy). However, after blood samples are collected from patients, cell lysis begins, and nucleic acids within blood cells mix with cell-free nucleic acids, making isolation and differentiation of cell-free nucleic acids difficult. In addition, these cell-free nucleic acids are readily nuclease-initiated degradation in vitro. As a result, the presence of cell-free nucleic acids can no longer be accurately confirmed, and their ability to indicate disease may be diminished. Ideally, preventing cell lysis and cell-free nucleic acid degradation in biological samples would allow for accurate measurement of cell-free nucleic acids and detection of any disease risk.

[0131] Preservatives can be used to fix cells in biological samples or specimens, preventing the leakage of cellular nucleic acids into the extracellular space. After cell-free nucleic acids are isolated, they can be tested to identify the presence, absence, or severity of disease states, including but not limited to numerous cancers. Pathology collections worldwide represent archives of genetic material for studying populations and diseases. However, for preservation purposes, the majority of these collections are fixed in formalin / formaldehyde-containing solutions, a treatment that results in crosslinking of biomolecules. Formaldehyde-releasing agents, formaldehyde donors, or formaldehyde-releasing preservatives are chemical compounds that slowly release formaldehyde. Notably, formalin-fixed tissues show a high frequency of non-reproducible sequence changes compared to DNA isolated from frozen tissue (Srinivasan M, Sedmak D, Jewell S (2002) Effect of fixatives and tissue processing on the content and integrity of nucleic acids. Am J Pathol 161(6):1961-1971). Formaldehyde, the main component of the most commonly used fixatives, leads to the formation of DNA-protein and RNA-protein crosslinks. Furthermore, if the fixative solution is not buffered, nucleic acids become fragmented. Both of the above present challenges for PCR-based analysis (Gilbert MTP, Haselkorn T, Bunce M, Sanchez JJ, Lucas SB, Jewell LD, Van Marck E, Worobey M (2007) The isolation of nucleic acids from fixed,paraffin-embedded tissues-Which methods are useful when? PLoS ONE 2(6):e537.Doi:10.1371 / journal.pone.0000537, Wong SQ, Li J, Tan AY-C, Vedururu R, Pang J-MB, Do H, Ellul J, Doig K, Bell A, MacArthur GA, Fox SB, Thomas DM, Fellowes A, Parisot JP, Dobrovic A (2014) Sequence artifacts in A prospective series of formalin-fixed tumors tested for mutations in hotspot regions by massively parallel sequencing. (BMC Medical Genomics 7:23. Doi:10.1186 / 1755-8794-7-23). ​​Specifically, this chemical damage to DNA reduces the fidelity of Taq DNA polymerase and PCR amplification efficiency (Sikorsky JA, Primerano DA, Fenger TW, Denvir J (2007) DNA damage reduces Taq DNA polymerase fidelity and PCR amplification efficiency. Biochem Biophys Res Commun 355(2):431-437). Therefore, formalin / formaldehyde-based fixatives are not ideal for molecular analysis.

[0132] In this example, the cellular stability of isolated leukocytes spiked into urine samples was evaluated in the presence of the preservative of the present invention, compared to the formaldehyde-releasing preservative in Streck's Cell-Free DNA Urine Preserve (as described in Example 4). Leukocytes were prepared from 1 mL of whole blood after selective lysing of erythrocytes. Leukocytes were pelletized and washed, then spiked into urine samples, and leukocyte stability / integrity was measured using cfDNA content. FMFV urine samples from female and male donors were pooled together to produce two female and two male pooled urine samples, respectively. The samples were "pre-clarified" by centrifugation at 3,000 g for 10–20 minutes, followed by filtration of the supernatant using a 0.2 micron filter. The pre-clarified urine samples were divided equally, leukocytes were spiked, and then the final concentrations of the present chemical or Streck's Cell-Free DNA Urine Preserve, as mentioned in Table 13 (see below), were added. The amounts of stock solution (Table 14) and ethanol added to pre-clarified urine samples spiked with nucleated leukocytes are listed in Table 15 (see below). Following the manufacturer's protocol, samples were incubated at room temperature for 30–60 minutes (day 0) or 7 days prior to cfDNA extraction using the QiaAmp Circulating Nucleic Acid Extraction Kit. The extracted cfDNA was quantified using a β-globin qPCR assay (see Materials and Methods).

[0133] The data (see Figure 7) shows that spiked leukocytes, in the presence of chemical substance F, which is the composition of the present invention, showed ΔC after 7 days at room temperature. t The median value was nearly zero, suggesting that no genomic DNA leaked into the supernatant, indicating cfDNA preservation as well as the stability and integrity of cells over time. The composition of the present invention is functionally equivalent to Streck's formaldehyde-releasing chemical in that it stabilizes cfDNA at room temperature without the risk of crosslinking DNA.

[0134] [Table 18]

[0135] [Table 19]

[0136] [Table 20]

[0137] Example 8: This composition maintains the DNA methylation state for 7 days at room temperature in both female and male pool urine samples.

[0138] DNA methylation is the process by which methyl groups are added to DNA molecules and is one of several epigenetic mechanisms that cells use to regulate gene expression. It plays a crucial role in many biological processes, including gene expression, embryonic development, cell proliferation, differentiation, and chromosomal stability. Abnormal DNA methylation is often associated with loss of DNA homeostasis and genomic instability, leading to the development of diseases such as cancer (Y Li, TO Tollefsbol (2011) DNA methylation detection: Bisulfite genomic sequencing analysis. Methods Mol Biol 791:11-21).

[0139] An ideal urine preservation solution must maintain the methylation status of DNA in studies involving DNA methylation as an epigenetic biomarker. Therefore, to investigate the effect of chemical F on DNA methylation status, an in vitro DNA methylation assay was performed using a pGL3-basic plasmid containing 25 CCGG sites. This assay involved the following steps, as described in the Materials and Methods section: 1) In vitro methylation of the plasmid, followed by confirmation of methylation using restriction endonuclease digestion (Figure 8A). 2) Treatment of the methylated plasmid with bisulfite after incubation in control 1X TE buffer or chemical F (1X) (see Table 16 below), followed by purification and PCR amplification of the methylated plasmid using primers described in the Materials and Methods section. The amounts of stock solution (Table 17) and 95% ethanol added to the urine sample are shown in Table 18. The presence of approximately 278 base pair PCR products of methylated plasmids incubated in 1X TE buffer and chemical F solution (Figures 8B and 8C) suggests that the methylation status of DNA in both female pool (FP) and male pool (MP) urine samples treated with chemical F was maintained for 7 days at room temperature.

[0140] [Table 21]

[0141] [Table 22]

[0142] [Table 23]

[0143] Example 9: The composition of the present invention is used to preserve human papillomavirus (HPV) in the first morning urine sample after storage at room temperature for 7 days.

[0144] Cervical cancer is caused by sexually acquired infection with certain types of genital HPV, which are classified as high-risk and low-risk depending on their association with cervical cancer (Munoz). N, Bosch FX, de Sanjose S, Herrero R, Castellsaque X, Shah KV, Snijders PJ, Meijer CJ (2003) Epidemiologic classification of human papillomavirus types associated with cervical cancer. N Engl J Med 348(6):518-527. Doi:10.1056 / NEJMoa021641). HPV 16, 18, 31, 33, 35, 45, 52, 58, 39, 51, 56, and 59 are classified as high-risk HPV genotypes (Bouvard V, Baan R, Straif K, Grosse Y, Secretan B, El Ghissassi F, Benbrahim-Tallaa L, Guha N, Freeman C, Galichet According to L, Cogliano V (2009) A review of human carcinogens - Part B: Biological agents. The Lancet Oncology 10:321-322), two of these HPV types (16 and 18) are the main causes (70%) of cervical cancer and precancerous cervical lesions, according to the WHO.

[0145] Non-invasive urine testing provides a simple and feasible alternative to HPV detection in cervical specimens, based on the literature on HPV detection (Vorsters, P. Van Damme, G. Clifford (2014) Urine testing for HPV: rationale for using first void. BMJ 349:g6252; Bernal, S. et al., Comparison of urine and cervical samples for detecting human papillomavirus(HPV) with the Cobas 4800 HPV test, Journal of Clinical Virology 61(2014)548 - 552, Enerly, E. et al., Monitoring human papillomavirus prevalence in urine samples: a review, Clinical Epidemiology 2013:5 67 - 79). In this study, the effect of this composition on the stability of urine spiked with exogenous HPV circular DNA (HPV16) was evaluated. This system presents the most difficult scenario (unprotected circular DNA floating in the urine space / matrix) compared to a mixed population of endogenous virus particles that will be present in both protected (particles covered by cervical cells and / or host proteins) and unprotected states in urine samples from HPV16 - infected patients.

[0146] Healthy male and female donors provided first morning void (FMFV) urine specimens, which were transported to the laboratory on ice packs and pooled together to generate two male and two female pooled urine samples. Purified HPV16 plasmid DNA (see Materials and Methods) was spiked into approximately 1 mL of pooled FMFV urine samples at a concentration of 1 - 10 ng / mL, with or without the chemical F (pH 4.7 - 5.0), which is the composition of the present invention, and stored at room temperature for up to 7 days. The final concentrations of the components of the stabilized composition "Chemical F (Chem F)" after combination with the urine sample are described in Table 19 (below). On day 0 and day 7, 200 μL aliquots of each of the HPV16 plasmid - spiked urine samples were processed for total DNA extraction using the QiaAmp DNA mini kit according to the manufacturer's protocol. DNA was eluted using 100 μL of the kit elution buffer. The extracted DNA was further subjected to a qPCR assay for quantification of HPV16 plasmid DNA using the ampicillin resistance gene (Amp R ) on the HPV16 plasmid backbone. Bacterial DNA was quantified using a 16S qPCR assay (see Materials and Methods).

[0147] After 7 days at room temperature, the composition of the present invention is ΔC t Unlike unstorage samples, which showed a significant increase in median, ΔC in stored urine samples t Exogenous spike-in HPV16 plasmid DNA in FMFV urine samples was stabilized, as indicated by a median value close to zero (Figure 9A). In addition, the composition of the present invention showed an increase in bacterial DNA content after 7 days of storage at room temperature, suggesting an increase in ΔC. t Unlike unstorage samples, which showed a significant decrease in the median of ΔC t The increase in bacterial DNA in FMFV urine samples was prevented, as indicated by the median value being close to zero (Figure 9B). The stability results obtained from spiked HPV16 DNA in urine samples can be extrapolated to the stability of endogenous HPV16 particles present in patient samples.

[0148] [Table 24]

[0149] Example 10: A stabilizing composition for the preservation of extracellular vesicle (EV) RNA in urine at room temperature.

[0150] As a non-invasive sample type, urine has a clear advantage over blood when used for liquid biopsy purposes. Urine contains prostatic secretions and therefore is a potentially valuable source for the detection and monitoring of prostate cancer. Prostate cancer is the second leading cause of cancer-related death in men and the most commonly diagnosed male malignancy worldwide, with over 11 million cases recorded in 2012 (http: / / www.cancerresearchuk.org / ) (OE Bryzgunova,MM Zaripov,TE Skvortsova,EA Lekchnov,AE Grigor'eva,IA Zaporozhchenko, EA Morozkin, EI Ryabchikova, YB Yurchenko, VE Voitsitskiy, PP Laktionov (2016) Comparative study of extracellular vesicles from the urine of healthy individuals and prostate cancer patients.PLoS One 11(6):e0157566.Doi:10.1371 / jour nal.pone.0157566).

[0151] The most well-characterized urinary biomarker for prostate cancer is a non-coding EV RNA known as PCA3(DD3), which is associated with increased expression in prostate cancer (MJ Bussemakers, A van Bokhoven, GW Verhaegh, FP). Smit, HFM Karthaus, JA Schalken, FMJ Debruyne, N Ru, WB Isaacs (1999) DD3: a new prostate-specific gene, highly overexpressed in prostate cancer. Cancer Res 59:5975-5979, KL Pellegrini, DPatil, KJS Douglas, G Lee, K Wehrmeyer, M Torlak, J Clark, CS Cooper, CS Moreno, MG Sanda (2018) Detection of prostate cancer-specific transcripts in extracellular vesicles isolated from post-DRE urine. Prostate 77(9):990-999. Doi:10.1002 / pros.23355). The ExoDx prostate test (Exosome Diagnostics) is also based on urinary exosomal RNA content for predicting high-grade prostate cancer (J McKiernan, MJ Donovan, V O'Neill, S Bentink, M. Noerholm, S. Belzer, J. Skog, MW. Kattan, A. Partin, G. Andriole, G. Brown, J.T. Wei, IM. Thompson, P. C. Arroll (2016) A novel urine exosome gene expression assay to predict high-grade prostate cancer at initial biopsy. JAMA Oncol 2(7):882-889. Doi:10.1001 / jamaoncol.2016.0097). Due to the possibility of microbial growth, as well as the unstable nature of host cells and extracellular vesicles (EVs) at the time of sample collection and transport to the laboratory, multi-center and clinic collections are increasingly discouraged for large-scale recruitment and lead to variations in the time between collection and processing, thus driving the need for urine sample stabilization for home sampling. Therefore, the development of urine stabilization for home sampling opens up new applications for various urine-derived biomarkers used in liquid biopsy analysis (e.g., urinary EV RNA in prostate cancer).

[0152] In one of the experimental setups, the first morning urine samples were collected from healthy male and female donors in standard urine collection cups. The samples were transported to the laboratory on ice packs, where they were pooled together to form pooled urine samples (MP, male pool, FP, female pool). i) 30 mL of pooled urine was stored in the absence of the stabilizing composition (not preserved), and 2) 24 mL of pooled urine samples were mixed with the stabilizing composition [4 mL of stock solution (Table 20) and 2 mL of 95% ethanol] and stored. The composition of the stock solution is described in Table 20. Both types of samples were stored at room temperature (23 ± 3 °C) for at least 7 days. The final composition of the stabilizing solution "Chem F" after mixing with urine is described in Table 21. On days 0 and 7, 10 mL aliquots of each unpreserved urine sample and Chem F-containing urine sample were centrifuged at 3,000 g for 10 minutes at room temperature, followed by 0.8 μM filtration. The pre-clarified supernatants collected from each sample after centrifugation and filtration were used for EV RNA extraction using the ExoRNeasy maxi kit (see Qiagen, Materials and Methods). The concentrations of the extracted RNA samples were measured using a 2100 Agilent Bioanalyzer and / or Ribogreen quantification. cDNA was prepared using the M-MLV Reverse Transcription kit, and qPCR was performed using a β-actin (ACTB) TaqMan assay (see Materials and Methods). Equal amounts (ng) of extracted total RNA from both unconserved and stabilized states were used in the given urine samples for cDNA synthesis.

[0153] In a different experimental setup, healthy male and female donors provided random (midday) first excretion urine samples using the Colli-Pee® First Void Urine Collection Device (Novosanis). The samples were transported to the laboratory on ice packs, where they were pooled together to form pooled urine samples (MP, male pool, FP, female pool). i) 40 mL of pooled urine was stored in the absence of stabilizing composition (not stored), and 2) 28 mL of pooled urine samples were mixed with 12 mL of chemical F (Chem F) stabilizing composition and stored. The composition of the stabilizing solutions is shown in Table 22i. Both types of samples were stored at room temperature (23±3°C) for at least 7 days. The final composition of the stabilizing solution "Chem F" after mixing with urine is shown in Table 22ii. On days 0 and 7, 17 mL aliquots of each unconserved sample and Chem F-containing sample were centrifuged at 3,000 g for 10 minutes at room temperature, followed by 0.8 μM filtration. 16 mL of pre-clarified supernatant was collected from each sample after centrifugation and filtration, and EV RNA was extracted using the ExoRNeasy maxi kit (see Qiagen, Materials and Methods). The concentration of the extracted RNA samples was measured using a 2100 Agilent Bioanalyzer and / or Ribogreen quantification (see Materials and Methods). The profile of the extracted EV RNA was also determined using a 2100 Agilent Bioanalyzer. For cDNA synthesis, equal volumes (ng) of extracted total RNA from both the unconserved and stabilized states were used in the given urine samples. cDNA was prepared using the M-MLV Reverse Transcription kit, and qPCR was performed using a β-actin TaqMan assay (see Materials and Methods).β-actin was considered a housekeeping gene for exosome mRNA quantification using qPCR assays (H Jiang, Z Li, X Li, J Xia (2015) Intercellular transfer of messenger RNAs in multiorgan tumorigenesis by tumor cell-derived exosomes. Mol Med Rep 11:4657-4663. Doi:10.3892 / mmr.2015.3312, KC Miranda, DT Bond, M McKee, J Skog, TG Paunescu, N Da Silva, D Brown, LM Russo (2010) Nucleic acids within urinary exosomes / microvesicles are potential biomarkers for renal disease. Kidney Int 78(2):191-199. Doi:10.1038 / ki.2010.106, S Haque, SR Vaiselbuh (2018) Exosomes molecular diagnostics:direct conversion of exosomes into the cDNA for gene amplification by two-step polymerase chain reaction.J Biol Methods 5(3):e96.Doi:10.14440 / jbm.2018.249, L Dong,W Lin,P Qi,M Xu,Z Wu,S Ni,D Haung,WW Weng,C Tan,W Sheng,X Zhou,X Du (2016) Circulating long RNAs in serum extracellular vesicles: their characterization and potential application as biomarkers for diagnosis of colorectal cancer.Cancer Epidemiol Biomarkers Prev 25(7):1158-1166.Doi:10.1158 / 1055-9965.EPI-16-0006).

[0154] The overall data from a total of seven samples (three female pooled urine samples and four male pooled urine samples) from both experimental settings are combined and presented in Figure 10A. Figure 10A shows the results after 7 days at room temperature. [C] t(T7) -C t(T0) ΔC representing ] t This is illustrated in the diagram. ΔC of β-actin (ACTB)RNA t (ΔC t The increase in the median of ≥+2 (Figure 10A) indicates a loss of EV RNA content in unstorage samples stored at room temperature for 7 days. However, the ΔC of β-actin RNA in Chem F-containing urine samples is lower. t The change is not significant (ΔC t The median value was nearly 0 (Figure 10A), indicating stabilization of EV RNA content after 7 days at room temperature. Furthermore, there was no significant change in EV RNA content in urine samples upon addition of chemicals compared to unstorage (NA) samples at collection (day 0) [Figure 10A(ii)]. Figure 10B illustrates representative electrophoretic traces of EV RNA from both unstorage urine samples and Chem F-containing urine samples on days 0 and 7. The electrophoretic traces clearly show a significant change in the EV RNA profile of the unstorage urine sample on day 7, unlike the Chem F-containing samples on days 0 and 7, which showed similar EV RNA profiles to the unstorage sample on day 0.

[0155] In a different experimental setup, healthy male and female donors provided random (midday) first-excretion urine samples using the Colli-Pee® First Void Urine Collection Device (Novosanis). The samples were transported to the laboratory on ice packs, where they were pooled together to form pooled urine samples (MP, male pool; FP, female pool). Aliquots of the pooled urine were either 1) stored in the absence of stabilizing composition (not stored), or 2) mixed with stock solutions containing different sugars in a urine:chemical ratio of 1:0.43 [Table 22(iii)] and stored. All samples were stored at room temperature (23±3℃) for at least 7 days. The final compositions of the stabilizing solutions after mixing with urine are listed in Table 22(iv). On days 0 and 7, aliquots of 8.5 mL each of unpreserved urine samples, Chem F-containing urine samples, and Streck preservative-containing urine samples were centrifuged at 3,000 g for 10 minutes at room temperature, followed by 0.8 μM filtration (Sartorius® Minisart NML®, catalog no. 16592, or Millipore® Millex®-AA, catalog no. SLAA033SB). 8 mL of pre-clarified supernatant was collected from each sample after centrifugation and filtration, and EV RNA was extracted using ultrafiltration (see EV RNA extraction in Materials and Methods). The concentration of the extracted RNA samples was measured using Ribogreen quantification (see Materials and Methods). For cDNA synthesis, equal amounts (ng) of extracted total RNA from the unpreserved and stabilized states were used with the given urine samples. cDNA was prepared using the M-MLV Reverse Transcription kit, and qPCR was performed using the β-actin TaqMan assay (see Materials and Methods).

[0156] Figure 10C shows the β-actin (ACTB) RNA content in both unstorage and stabilized urine samples after storage at room temperature for 7 days. t(T7) -C t(T0) ΔC representing ] t This is illustrated in the diagram. ΔC of β-actin (ACTB)RNA t [ΔCt An increase in the median ΔC > +3.5 (Figure 10C(i)) indicates a loss of EV RNA content in unstorage samples stored at room temperature for 7 days. Samples containing Chem F and Chem G showed a median ΔC of 1.5 and 1.1, respectively, for β-actin RNA. t The values ​​were shown, demonstrating efficient stabilization of EV RNA content after 7 days at room temperature [Figure 10C(i)]. Furthermore, there was no significant change in EV RNA content in urine samples upon addition of chemicals compared to unstorage (NA) samples at the time of collection (day 0) [Figure 10C(ii)].

[0157] In a different experimental setup, healthy male and female donors provided random (midday) first excretion urine samples using the Colli-Pee® First Void Urine Collection Device (Novosanis). The samples were then frozen. The samples were transported to the laboratory in packs, where they were pooled together to form pooled urine samples (MP, male pool; FP, female pool). Aliquots of the pooled urine were stored in the following ways: 1) in the absence of the stabilizing composition (NA, not preserved), 2) mixed with the chemical F stabilizing composition in a urine:chemical ratio of 1:0.43 and stored, and 3) mixed with 5 mL of Streck's urine preservative (catalog no. 230216) and stored. The compositions of the stabilizing solutions are listed in Table 23(i). Both types of samples were stored at room temperature (23±3°C) for at least 7 days. The final compositions of the stabilizing solutions after mixing with urine are listed in Table 23(ii). On days 0 and 7, 11 mL aliquots of each unpreserved urine sample, Chem F-containing urine sample, and Streck preservative-containing urine sample were centrifuged at 3,000 g for 10 minutes at room temperature, followed by 0.8 μM filtration. 10 mL of pre-clarified supernatant was collected from each sample after centrifugation and filtration, and EV RNA was extracted using the ExoRNeasy Maxi kit (see Qiagen, Materials and Methods). The concentration of the extracted RNA samples was measured using Ribogreen quantification (see Materials and Methods). Equal amounts (ng) of extracted total RNA from unconserved and stabilized states were used in the given urine samples for cDNA synthesis. cDNA was prepared using the M-MLV Reverse Transcription kit, and qPCR was performed using the β-actin TaqMan assay (see Materials and Methods).

[0158] Figure 10D shows the β-actin (ACTB) RNA content in both unstorage and stabilized urine samples after storage at room temperature for 7 days. t(T7) -C t(T0) ΔC representing ] t This is illustrated in the diagram. ΔC of β-actin (ACTB)RNA t [ΔC t An increase of ≥+3.5 (median; Figure 10C(i)) indicates a loss of EV RNA content in unstorage samples stored at room temperature for 7 days. Chem F-containing samples showed a median ΔC of +1.1 for β-actin RNA. tshowed values and demonstrated efficient stabilization of EV RNA content after 7 days at room temperature. On the other hand, for β-actin RNA at the stable time point (T7) after 7 days, a central ΔC of +1.8 t showed values, despite this, urine specimens containing Streck preservative showed a significant loss of EV RNA (+3.3 central ΔC t values) at the 0-day time point, suggesting an overall loss of EV RNA stability and content [Figure 10D(ii)].

[0159]

Table 25

[0160]

Table 26

[0161]

Table 27

[0162] [[ID=...]]

[0163] [[ID=3...]]

Table 29

[0164] [[ID=...]]

Table 30

[0165]

Table 31

[0166] ]

Table 32

[0167] ​ Example 11: A stabilizing composition for preserving cell-free RNA (cfRNA) in urine at room temperature.

[0168] Healthy male and female donors provided random (midday) first excretion urine samples using the Colli-Pee® First Void Urine Collection Device (Novosanis). Samples were transported to the laboratory on ice packs, where they were pooled together to form pooled urine samples (MP, male pool; FP, female pool). Aliquots of the pooled urine were either 1) stored in the absence of the stabilizing composition (not stored), or 2) mixed with the chemical F stabilizing composition at a urine:chemical ratio of 1:0.43 and stored. The compositions of the stabilizing solutions are listed in Table 24. Both types of samples were stored at room temperature (23±3℃) for at least 7 days. The final compositions of the stabilizing solutions after mixing with urine are listed in Table 25. On days 0 and 7, 2.5 mL aliquots of each unstored urine sample and Chem F-containing urine sample were centrifuged at 3,000 g for 10 minutes at room temperature, followed by 0.8 μM filtration. After centrifugation and filtration, 2 mL of pre-clarified supernatant was collected from each sample, and cell-free nucleic acids were extracted using the QiaAmp circulating nucleic acid extraction kit (Qiagen, see Materials and Methods). The extracted nucleic acids were subjected to DNAse digestion to remove DNA contamination and efficiently purify total cell-free RNA. The concentration of the extracted RNA samples was measured using Ribogreen quantification (see Materials and Methods). For cDNA synthesis, equal volumes (ng) of extracted total RNA from unconserved and stabilized states were used in the given urine sample. cDNA was prepared using the M-MLV Reverse Transcription kit, and qPCR was performed using the β-actin TaqMan assay (see Materials and Methods).

[0169] Figure 11(i) shows the β-actin (ACTB) RNA content in both unstorage urine samples and Chem F-containing urine samples after storage at room temperature for 7 days. t(T7) -Ct(T0) ΔC representing ] t This is illustrated. ΔC suggests a decrease in cell-free RNA content after storing unstorage samples at room temperature for 7 days. t There was an increase in the median (+2.5), but in contrast, ΔC was 1.3. t As indicated by the median, there was little change in β-actin cell-free RNA levels in Chem F-containing samples after 7 days at room temperature [Figure 11(i)]. Furthermore, there was no significant change in cell-free RNA content in urine samples upon chemical addition compared to unstorage (NA) samples at collection (day 0) [Figure 11(ii)].

[0170] [Table 33]

[0171] [Table 34]

[0172] Example 12: A stabilizing composition for preserving urinary cellular RNA in urine at room temperature.

[0173] This embodiment consists of two separate studies. In the first study, midday first-excretion urine samples were collected from eight male and eight female donors using a Colli-Pee® First-void Urine Collection Device (Novosanis) and pooled to form a total of four pooled urine samples (two male (MP) and two female (FP)). i) 40 mL of each sample was stored in the absence of the stabilizing composition (not stored), and ii) 28 mL of each urine sample was mixed with 12 mL of stock solution (Table 26). Both types of samples were stored at room temperature (23±3°C) for at least 7 days. The final compositions after mixing with urine are described in Table 27 below.

[0174] In the second study, four healthy donors provided 30 mL of first morning urination (FMFV) urine samples, which were pooled together to produce two pooled urine samples: i) each 30 mL sample was stored in the absence of the stabilizing composition (not stored, NA), and ii) each 24 mL urine sample was mixed with 4 mL of stock solution (Table 28) and 2 mL of 95% ethanol. Both types of samples were stored at room temperature (23±3°C) for at least 7 days. The final composition of the stabilizing solution "Chem F" after mixing with urine is shown in Table 29. For comparison, 25 mL of urine was mixed with 5 mL of Streck's urine fixative (reference composition), commercially available as "Cell-free DNA Urine Preserve" (catalog number 230216), and stored at room temperature for at least 7 days. The reference composition contains the formaldehyde-releasing agent imidazolidinyl urea, as well as K3 EDTA and glycine.

[0175] On days 0 and 7, aliquots of 15-16 mL each of unpreserved urine samples, Chem F-containing urine samples, and Streck preservative-containing urine samples were centrifuged at 3,800 g for 20 minutes at room temperature. After centrifugation, the whole cell pellet was collected from each sample, and urinary cellular RNA was extracted using either the Trizol LS reagent (Study I) or the Qiagen RNeasy plus Mini Kit (Study II) as described in Materials and Methods, according to the manufacturer's protocol. Targeted mRNA analysis of the extracted cellular RNA was performed using β-actin (ACTB) TaqMan-based RT-qPCR experiments as described (see Materials and Methods).

[0176] The overall data from a total of four samples (two female pooled urine samples and two male pooled urine samples) from the first experimental setup are combined and presented in Figure 12A. Figure 12A(i) shows the β-actin (ACTB) RNA content in both unstorage urine samples and Chem F-containing urine samples after storage at room temperature for 7 days. t(T7) -C t(T0) ΔC representing ] t This is illustrated. ΔC of cellular β-actin (ACTB)RNA content. tThere was a dramatic increase, indicating a dramatic loss of cellular RNA content in the unpreserved specimens stored at room temperature for 7 days. However, the ΔC of cellular β-actin RNA t was significantly lower in the Chem F-containing specimens when compared to the unpreserved specimens (Figure 12A(i)), indicating the stability of cellular RNA in urine specimens containing the stabilization solution after 7 days at room temperature. Furthermore, there were no major changes in the cellular RNA content in urine specimens at the time of chemical addition compared to the unpreserved (NA) samples at the time of collection (day 0) [Figure 12A(ii)].

[0177] Figure 12B(i) further shows a dramatic increase in the ΔC t of cellular β-actin (ACTB) RNA content, indicating a dramatic loss of cellular RNA content in both unpreserved specimens and specimens containing Streck's urine preservative stored at room temperature for 7 days. However, the ΔC of cellular β-actin t was significantly lower in the Chem F-containing specimens when compared to the unpreserved specimens and specimens containing Streck's preservative [Figure 12B(i)]. Furthermore, when compared to the Chem F-containing specimens, the specimens containing Streck's preservative showed a greater change in the cellular RNA content in urine specimens at the time of chemical addition compared to the unpreserved (NA) samples at the time of collection (day 0) [Figure 12B(ii)]. Overall, this data indicates the stability of cellular RNA in specimens containing this stabilization composition after 7 days at room temperature.

[0178]

Table 35

[0179]

Table 36

[0180]

Table 37

[0181] [Table 38]

[0182] Example 13: A stabilizing composition for preserving urinary cellular DNA in urine at room temperature.

[0183] In this study, midday first-excretion urine samples were collected from six healthy male and six female donors using the Colli-Pee® First-void Urine Collection Device (Novosanis) and pooled to form a total of four pooled urine samples [two male pools (MP) and two female pools (FP)]. i) 30 mL of each sample was stored in the absence of the stabilizing composition (not stored), and ii) 21 mL of each urine sample was mixed with 9 mL of stock solution (Table 30). Both types of samples were stored at room temperature (23±3°C) for at least 7 days. The final composition after mixing with urine was then determined. This is described in Table 31 below.

[0184] On days 0 and 7, 15 mL aliquots of each unstorage sample and Chem F-containing sample were centrifuged at 3000 g for 10 minutes at room temperature. After centrifugation, the whole cell pellet was collected from each sample, and urinary cell DNA was extracted using the QiaAmp DNA Mini Kit (Qiagen) according to the manufacturer's protocol. The extracted cell DNA profile was evaluated using a genomic DNA tape on an Agilent 4200 Tapestation. Using the extracted DNA, a PCR product of approximately 1 kb (GAPDH gene) was amplified to measure DNA stability as described (see Materials and Methods).

[0185] Figure 13A illustrates the tapestation profiles of extracted cellular DNA at day 0 and day 7 in both unstorage urine samples (NA) and urine samples containing chemical F. In FP samples, there was a consistent and dramatic loss of high molecular weight genomic DNA in unstorage samples stored at room temperature for 7 days. In unstorage MP samples, one pooled sample showed an increase in high molecular weight genomic DNA due to bacterial growth, while the second pooled sample showed a significant decrease in high molecular weight genomic DNA after 7 days at room temperature. However, the high molecular weight genomic DNA profile was preserved in both Chem F-containing FP and MP urine samples after 7 days at room temperature (Figure 13A), thus demonstrating the stability of cellular DNA. Next, targeted amplification of the GAPDH gene with an amplicon size of approximately 1 Kb was performed to determine the stability of the high molecular weight DNA band in both unstorage and Chem F-containing urine samples at day 0 and day 7.

[0186] Figure 13B shows the results of GAPDH PCR amplification. The presence of approximately 1 kb of product strongly indicates the stability of human cell DNA in both Chem F-containing FP and MP urine samples after 7 days of storage at room temperature. In unstorage samples, GAPDH PCR amplification failed, indicating a lack of stability of human cell DNA. Bacterial 16S qPCR was performed on DNA extracted from both FP and MP samples as described in Materials and Methods. Unlike the chemical F (Chem F)-containing samples, which showed no significant change in bacterial DNA content from day 0 to day 7, bacterial 16S qPCR showed a dramatic increase in the percentage of bacterial DNA content in both unstorage urine samples of FP and MP after 7 days of storage at room temperature (Figure 13C). Overall, the data suggest that human cell DNA is preserved and bacterial growth is prevented in urine samples containing the stabilization solution after 7 days of storage at room temperature. In contrast, unstorage samples showed complete loss of human cell DNA and a dramatic increase in bacterial DNA after 7 days of storage at room temperature.

[0187] [Table 39]

[0188] [Table 40]

[0189] Example 14: A stabilization composition for preserving cell-free nucleic acid profiles in saliva samples stored at room temperature.

[0190] Like urine sampling, saliva sampling is simple, safe, and inexpensive, making it ideal for home collection. Saliva consists of various molecules (e.g., enzymes, hormones, antibodies, mucins, growth factors, nucleic acids, exosomes, and antimicrobial components) filtered, processed, and secreted from the vascular system that nourishes the salivary glands. Many of these enter saliva from the blood by passing through intercellular spaces via transcellular or paracellular pathways. Therefore, most compounds found in blood are also present in saliva. Thus, saliva exhibits high potential for monitoring health and disease (YH Lee and DT Wong (2009) Saliva: an emerging biofluid for early detection). of diseases.Am J Dent 22(4):241-248, KA Hyun, H Gwak, J Lee, B Kwak, HI Jung (2018) Salivary exosome and cell-free DNA for cancer detection. Micromachines 9:340).

[0191] In this study, raw saliva samples were collected from six healthy individuals and mixed together to form pooled saliva samples. i) 7 mL of the pooled saliva sample was mixed with 3 mL of 1X TE buffer (Thermo Fisher Scientific, catalog number AM9858) (not stored), and ii) 7 mL of the pooled saliva was mixed with 3 mL of the stock solution (see Table 32). Efficient separation of extracellular and cellular compartments. To overcome the mucous properties of saliva, TE buffer was added to unstorage samples. Both types of samples were stored at room temperature (23±3°C) for at least 7 days. The final composition after mixing with saliva is shown in Table 33 below.

[0192] On days 0 and 7, 4.5 mL of each unstorage sample and chemical substance F(Chem) were used. Aliquots of the F) sample were centrifuged at 3,800 g for 20 minutes at room temperature. After centrifugation, 4.0 mL of supernatant was collected from each sample, and cell-free nucleic acids were extracted using the QIAamp Circulating Nucleic Acids Kit (Qiagen, see Materials and Methods). The extracted cell-free nucleic acid profiles were recorded using HS D5000 tape (Agilent, catalog no. 5067-5592) and Agilent Evaluation was performed using a 4200 Tapestation. Figure 14 illustrates the Tapestation profiles of extracted cell-free DNA at day 0 and day 7 for both unstorage saliva samples (NA) and stored Chem F-containing saliva samples. The Tapestation data (Figure 14) clearly shows the preservation of the cell-free DNA profile in saliva samples containing a stabilized solution at room temperature after 7 days, while there was a dramatic change in the cell-free DNA profile in unstorage samples at room temperature after 7 days compared to the profile at day 0.

[0193] [Table 41]

[0194] [Table 42]

[0195] All publications, patents, and patent applications referenced herein indicate the level of skill of those skilled in the art to which the present invention belongs, and each individual publication, patent, or patent application is incorporated herein by reference to the same extent as it is indicated that it is incorporated by reference specifically and individually.

[0196] Having described the present invention in this manner, it will be apparent that similar modifications may occur in many respects. Such modifications should not be considered departures from the spirit and scope of the invention, and all such modifications that would be obvious to those skilled in the art are intended to be included within the following claims. The scope of the claims should not be limited to preferred embodiments set forth for illustrative purposes, but should be given the broadest interpretation consistent with the overall description.

Claims

1. An aqueous stabilizing composition for preserving body fluids at ambient temperature, A sugar selected from monosaccharides, disaccharides, or combinations thereof, Cushioning material, C 1 -C 6 Alkanol and, Boric acid, boric acid salts, or combinations thereof, Contains a chelating agent, The composition having a pH of 4.5 to 5.

2.

2. The aforementioned sugar is a monosaccharide. The aforementioned sugar is a monosaccharide selected from fructose, glucose, mannose, galactose, or a combination thereof, and The aforementioned sugar is a monosaccharide selected from fructose, glucose, or a combination thereof. The composition according to claim 1, further comprising one or more of the following characteristics.

3. The aforementioned sugar is a disaccharide. The aforementioned sugar is a disaccharide selected from trehalose, lactose, or sucrose, or a combination thereof, and The aforementioned sugar is sucrose. The composition according to claim 1, further comprising one or more of the following characteristics.

4. The buffer is an acetate buffer, a citrate buffer, or a combination thereof. The buffer is an acetate buffer selected from sodium acetate, potassium acetate, ammonium acetate, or a combination thereof. The buffer is a citrate buffer selected from sodium citrate, ammonium citrate, or a combination thereof. The buffering agent is sodium acetate. Said C 1 -C 6 The alkanol is selected from methanol or ethanol. Said C 1 -C 6 Alkanol is ethanol. The chelating agent is selected from ethylenediaminetriacetic acid (EDTA), 1,2-cyclohexanediaminetetraacetic acid (CDTA), diethylenetriaminepentaacetic acid (DTPA), tetraazacyclododecanetetraacetic acid (DOTA), tetraazacyclotetradecanetetraacetic acid (TETA), desferrioxymin, or chelator analogs thereof, and The chelating agent is CDTA. The composition according to any one of claims 1 to 3, further comprising one or more of the above characteristics.

5. The sugar is present in an amount of 5% to 45% (weight / volume), or 5% to 40% (weight / volume), or 10% to 30% (weight / volume), or 18% to 22% (weight / volume), or 20% (weight / volume), The buffering agent is present in an amount of 150 mM to 1.75 M, or 150 mM to 1.5 M, or 500 mM to 1.2 M, or 0.7 M to 0.8 M, or 0.75 M. Said C 1 -C 6 Alkanols are present in amounts of 5% to 50% (volume / volume), 10% to 30% (volume / volume), 20% to 25% (volume / volume), or 23% (volume / volume). The boric acid, the boric acid salt, or a combination thereof is present in an amount of 0.5% to 5% (weight / volume), 1% to 3% (weight / volume), 2% to 2.5% (weight / volume), or 2.2% (weight / volume), The composition according to any one of claims 1 to 4, wherein the chelating agent is present in an amount of 10 mM to 120 mM, or 10 mM to 100 mM, or 30 mM to 70 mM, or 40 mM to 60 mM, or 50 mM.

6. The composition is Fructose, glucose, sucrose, or a combination thereof in amounts of 5% to 45% (weight / volume), or 5% to 40% (weight / volume), or 10% to 30% (weight / volume), or 18% to 22% (weight / volume), or 20% (weight / volume), A concentration of sodium acetate in an amount of 150 mM to 1.75 M, or 150 mM to 1.5 M, or 500 mM to 1.2 M, or 0.7 M to 0.8 M, or 0.75 M, Methanol, ethanol, or a combination thereof in amounts of 5% to 50% (volume / volume), 10% to 30% (volume / volume), 20% to 25% (volume / volume), or 23% (volume / volume), Boric acid in amounts of 0.5% to 5% (weight / volume), or 1% to 3% (weight / volume), or 2% to 2.5% (weight / volume), or 2.2% (weight / volume), A composition according to any one of claims 1 to 5, comprising, essentially consisting of, or consisting of, 10 mM to 120 mM, or 10 mM to 100 mM, or 30 mM to 70 mM, or 40 mM to 60 mM, or 50 mM of CDTA.

7. The composition is Fructose, glucose, or a combination thereof in amounts of 5% to 45% (weight / volume), or 5% to 40% (weight / volume), or 10% to 30% (weight / volume), or 18% to 22% (weight / volume), or 20% (weight / volume), A concentration of sodium acetate in an amount of 150 mM to 1.75 M, or 150 mM to 1.5 M, or 500 mM to 1.2 M, or 0.7 M to 0.8 M, or 0.75 M, Ethanol in amounts of 5% to 50% (volume / volume), or 10% to 30% (volume / volume), or 20% to 25% (volume / volume), or 23% (volume / volume), Boric acid in amounts of 0.5% to 5% (weight / volume), or 1% to 3% (weight / volume), or 2% to 2.5% (weight / volume), or 2.2% (weight / volume), Including, or essentially consisting of, amounts of CDTA in the range of 10 mM to 120 mM, or 10 mM to 100 mM, or 30 mM to 70 mM, or 40 mM to 60 mM, or 50 mM. A composition according to any one of claims 1 to 6, comprising the same.

8. The composition according to any one of claims 1 to 7, wherein the composition stabilizes cells, extracellular vesicles, nucleic acids, and / or microorganisms contained in the body fluid.

9. The cells are selected from cancer cells or nucleated blood cells. The nucleic acid is deoxyribonucleic acid (DNA). The nucleic acid is DNA, and the DNA includes cell-free DNA (cfDNA). The nucleic acid is DNA, and the DNA includes circulating tumor DNA (ctDNA). The nucleic acid is ribonucleic acid (RNA). The nucleic acid is RNA, and the RNA includes cell-free RNA (cfRNA). The nucleic acid is RNA, and the RNA includes extracellular vesicle RNA (EV RNA), and The microorganism is selected from bacteria or viruses. The composition according to claim 8, further comprising one or more of the following characteristics.

10. A method for preserving bodily fluids, a) Contacting the obtained sample of the bodily fluid with an aqueous stabilizing composition defined in any one of claims 1 to 9 to form a mixture, b) Mixing the mixtures in (a) to form a homogeneous mixture, c) A method comprising storing the homogeneous mixture at ambient temperature.

11. The method according to claim 10, wherein preserving the body fluid includes stabilizing cells, extracellular vesicles, nucleic acids, and / or microorganisms contained in the body fluid.

12. The cells are selected from cancer cells or nucleated blood cells. The nucleic acid is deoxyribonucleic acid (DNA). The nucleic acid is DNA, and the DNA includes cell-free DNA (cfDNA). The nucleic acid is DNA, and the DNA includes circulating tumor DNA (ctDNA). The nucleic acid is ribonucleic acid (RNA). The nucleic acid is RNA, and the RNA includes cell-free RNA (cfRNA). The nucleic acid is RNA, and the RNA includes extracellular vesicle RNA (EV RNA), and The microorganism is selected from bacteria or viruses. The method according to claim 11, further comprising one or more of the above features.

13. The method according to claim 11, wherein the cells, nucleic acids, extracellular vesicles, and / or microorganisms contained in the body fluid are stabilized at ambient temperature for at least 7 days or at ambient temperature for at least 14 days.

14. The method according to any one of claims 10 to 13, wherein the bodily fluid is urine or saliva.

15. Aqueous composition, A sugar selected from monosaccharides, disaccharides, or combinations thereof, Cushioning material, C 1 -C 6 an alkanol, and Boric acid, boric acid salts, or combinations thereof, Chelating agents, Body fluids, including A composition in which the bodily fluid is stored at ambient temperature.

16. The aforementioned sugar is a monosaccharide. The aforementioned sugar is a monosaccharide selected from fructose, glucose, mannose, galactose, or a combination thereof, and The aforementioned sugar is a monosaccharide selected from fructose, glucose, or a combination thereof. The composition according to claim 15, further comprising one or more of the following characteristics.

17. The aforementioned sugar is a disaccharide. The aforementioned sugar is a disaccharide, and the aforementioned disaccharide is selected from trehalose, lactose, or sucrose, or a combination thereof, and The aforementioned sugar is sucrose. The composition according to claim 15, further comprising one or more of the following characteristics.

18. The buffer is an acetate buffer, a citrate buffer, or a combination thereof. The buffer is an acetate buffer selected from sodium acetate, potassium acetate, ammonium acetate, or a combination thereof. The buffer is a citrate buffer selected from sodium citrate, ammonium citrate, or a combination thereof. The buffering agent is sodium acetate. Said C 1 -C 6 The alkanol is selected from methanol or ethanol. Said C 1 -C 6 Alkanol is ethanol. The chelating agent is selected from ethylenediaminetriacetic acid (EDTA), 1,2-cyclohexanediaminetetraacetic acid (CDTA), diethylenetriaminepentaacetic acid (DTPA), tetraazacyclododecanetetraacetic acid (DOTA), tetraazacyclotetradecanetetraacetic acid (TETA), desferrioxymin, or chelator analogs thereof, and The chelating agent is CDTA. The composition according to any one of claims 15 to 17, further comprising one or more of the above characteristics.

19. The sugar is present in an amount of 1.5% to 15% (weight / volume), or 2% to 10% (weight / volume), or 5% to 7% (weight / volume), or 6% (weight / volume). The buffering agent is present in an amount of 50 mM to 500 mM, or 200 mM to 400 mM, or 220 mM to 240 mM, or 230 mM, or 225 mM. Said C 1 -C 6 Alkanols are present in amounts of 2% to 40% (volume / volume), 3% to 20% (volume / volume), 5% to 10% (volume / volume), 6.5% (volume / volume), or 6.9% (volume / volume). The boric acid, the boric acid salt, or a combination thereof is present in an amount of 0.1% to 2% (weight / volume), or 0.2% to 1.5% (weight / volume), or 0.5% to 1.0% (weight / volume), or 0.7% (weight / volume), or 0.6% (weight / volume), The composition according to any one of claims 15 to 18, wherein the chelating agent is present in an amount of 2.5 mM to 50 mM, or 5 mM to 25 mM, or 10 mM to 20 mM, or 16 mM, or 15 mM.

20. The composition according to any one of claims 1 to 9, 15 to 19, wherein the bodily fluid is urine or saliva.