LINE1 inhibitors and their use

Abstract

The present invention aims to provide an inhibitor or suppressor of (long-chain scattered element 1)LINE1(L1) expression for medical use. [Solution] The present invention provides an inhibitor or suppressor of LINE1 (long-chain scattered element 1) (L1) expression or pathology exhibiting an immunoregulatory phenotype, preferably cancer and / or metastasis, more preferably lung cancer, even more preferably non-small cell lung carcinoma (NSCLC), or colorectal cancer (CRC), or viral diseases such as immunodeficiency caused by human immunodeficiency virus (HIV) or lymphocytic choriomeningitis virus (LCMV), wherein L1 comprises or consists of a sequence having 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity with SEQ ID NOs: 1, 2, or 3.

Description

[Technical Field]

[0001] The present invention relates to inhibitors of (long scattered element 1)LINE1(L1) expression for medical use, particularly for use in the treatment and / or prevention of primary or secondary immunodeficiency, or to inhibitors of immunomodulatory phenotypes, preferably cancer and / or metastasis, more preferably lung cancer, even more preferably non-small cell lung cancer (NSCLC), or colorectal cancer (CRC), or the pathogenesis of viral diseases. [Background technology]

[0002] Transposition elements (TEs) explain genome evolution and inter-individual genetic diversity. Two-thirds of the human genome consists of repetitive sequences (66%), and of these, transposition elements (TEs) alone account for 40-45% of the human genome composition. 1,2 One intriguing question for genome biologists is unlocking the function of this "dark side" of the genome—the "living substance" that evolution can play a role in generating new functions. Today, it is clear that the ability of TEs to regulate the genome lies primarily in generating sophisticated, large-scale RNA regulatory networks that influence cellular transcripts. 3-5 TEs are classified into four distinct classes, and with the exception of DNA transposons, they are primarily retrotransposons that have acquired the ability to move via a "copy-and-paste" mechanism using RNA as an intermediate. Retrotransposons include long scattered elements (LINEs), short scattered elements (SINEs), and long terminal repeat (LTR) retrotransposons. These are further classified into autonomous and non-autonomous types depending on whether they possess an ORF that encodes the mechanism necessary for retrotransposition. 6 .

[0003] LINE is a very ancient and evolutionarily successful type of transposon. The human genome contains three LINE superfamilies (LINE1, LINE2, and LINE3), of which only LINE1 is active. The full-length LINE1 (L1) element is approximately 6kb long and constitutes an autonomous component of the genome. The LINE1 element has an internal polymerase II promoter and encodes two open reading frames, ORF1 and ORF2 (Figure 1). 7 Once L1 RNA is transcribed, it is exported to the cytoplasm for translation, where it associates with the chaperone RNA-binding protein ORF1 and the endonuclease and reverse transcriptase ORF2. These ribonucleoparticles are reintroduced into the nucleus, where ORF2 forms a single-strand nick and initiates reverse transcription from the 3' end of the L1 RNA. Reverse transcription often results in many cleaved, non-functional insertions, and therefore most of the LINE-derived repeat sequences are short, averaging about 900-1000 bp in size. It is estimated that there are more than 500,000 copies of L1 in the human genome. 7 .

[0004] The L1 apparatus is also involved in the retrotransition of SINEs (classified into three superfamilies: Alu, MIR, and MIR3). Non-autonomous retroelements lack coding ability, are short in length (approximately 300 bp), and are transcribed from the polymerase III promoter (Figure 1). Alu, the most representative human-specific SINE superfamily, is represented by 1.09 million copies in the human genome. 8 .

[0005] LTR retrotransposons are initiated and terminated by long-terminal co-directional repeat sequences embedded in transcriptional regulatory elements. Autonomous LTR retrotransposons include gag and pol genes encoding reverse transcriptase, integrase, protease, and RNAse H (Figure 1). There are four superfamilies of LTRs: ERV class I, ERV(K) class II, ERV(L) class III, and MalR. MalR is the most representative superfamily of LTRs, with 240,000 copies.9 .

[0006] Evolutionary biologists hypothesize that self-replicating RNA genomes formed the foundation of early life on Earth, and the emergence of reverse transcription played an important role in the evolution of the first DNA genome, that is, a more stable deoxyribose-based polymer 6,10 . From this perspective, multiple occurrences of reverse transcription may have contributed to expanding both the size and complexity of the human genome. The massive accumulation of retrotransposons and their promotion of genomic evolution is particularly evident in both mammals and plants. L1 and Alu are the most prominent catalysts of human genome evolution 11 , and it has been reported that homologous recombination between TEs may drive / may have driven mutations, chromosomal rearrangements, deletions, inversions and translocations 12 . TEs are a major source of somatic genome diversity and inter-individual diversity 13 , and it has been reported that TE insertion occurs physiologically 14-16 . In particular, L1 retrotransposons are finely tuned and epigenetically regulated during the development and differentiation of neural progenitor cells, and represent a mechanism that contributes to neuronal somatic diversification in the brain 13,20 , from flies to humans 17-19 , it has been widely reported that this process occurs in neurons. Deregulation of TE activity has recently emerged as an important contributing factor to many different diseases, as seen in neurological diseases, inflammatory diseases, and cancers 21-23 .

[0007] The host has developed 24 many systems that control the expression and expansion of TEs (thus including epigenetic modifications and non-coding RNAs such as Piwi-interacting RNAs), which contain the potentially harmful effects of their retrotransposition. This expansion achieves a balance between harmful and beneficial effects, and will likely become a novel regulatory mechanism that promotes genomic functions acquired through evolution 3. Currently, transposable elements (TE) are recognized to be co-opted into multiple regulatory functions to modulate the metabolism and transcription of the host genome in both mice and humans, which are mediated by their DNA elements and their corresponding transcriptional RNA products.

[0008] Beyond transposition, TE-derived RNAs (TERNA) are a vast source of novel regulatory functions. TEs were first discovered in maize by Barbara McClintock nearly 80 years ago 25,26 . She suggested that these elements are "controlling elements" that regulate gene activity. Although her theory was rejected for a long time, it was pioneering and has been thoroughly revised with the advent of next-generation sequencing (NGS) technology. Currently, the concept that TEs interact with the transcriptional regulatory function of the host genome has emerged 3,4,27、28 .

[0009] Most of the literature focuses on studying the effects of retrotransposition and de novo insertion, but it is worth noting that TEs can uncouple RNA regulatory functions from retrotransposition.

[0010] Decade-long international projects such as ENCODE (Encyclopedia of DNA Elements) and FANTOM (Functional Annotation of the Mammalian Genome) have generated a huge number of datasets that pave the way for TE research, and have analyzed them through bioinformatics. These results reveal that TEs have the precise function of establishing and influencing cell-type-specific transcriptional programs, and constructing regulatory networks promoted by both their genomic elements and derived transcripts. RNAs transcribed from these elements may have countless functions 3,28 , and it has become clear that many genomic concepts will definitely alter the way they are written in textbooks 29 .

[0011] These studies show that TEs can generate novel or alternative promoters30 , transcription factor 31 and promote the aggregation of epigenetic modifiers, and regulate their diffusion and gene expression. 32 It was revealed that this can promote [something]. Furthermore, TEs, particularly in SINE and HERV, have been shown to function in 3D genome folding as chromatin organizer binding sites. 32-35 .

[0012] In 2009, Faulkner et al. 36 This study was the first to demonstrate that retrotransposons (TEs) are widely expressed in human and mouse cell types with tissue-specific expression patterns, suggesting specific spatiotemporal activation of retrotransposons. Faulkner et al. further showed that up to 30% of the transcripts begin within repeat sequences. 36 It is interesting to note that embryonic tissues have the highest proportion of transposable element-derived sequences in their transcriptome, and that LTRs are specifically expressed in the placenta and oocytes. 37 Accordingly, it has recently been found that different classes of repeat sequences are specifically abundant in genes with distinct spatiotemporal expression, and that they further determine the timing and magnitude of their expression during development. 38 .

[0013] In this scenario, TEs increase transcriptome complexity in various ways, namely, by generating antisense transcripts in close proximity to gene promoters. 36 , acting on mRNA maturation via nursing alternative splicing sites for tissue-specific exonization. 39,40 , and selective polyadenylation signals for RNA-mediated decoys 41,42 and to provide parts 43 Furthermore, TEs contribute to RNA regulatory sequences within introns and untranslated regions (UTRs). 36 It is important to note that TE is a major contributing factor to long non-coding RNAs (lncRNAs). 44,46In this scenario, enhancer RNA functions for LTR-derived transcripts, which are necessary for maintaining pluripotency in mouse and human embryonic stem (ES) cells, were proposed. 46,47 Furthermore, it has been demonstrated that LINE and SINE are expressed as RNAs strongly bound to chromatin compartments where they are localized in true chromatin, suggesting that these RNAs may function in 3D genome folding. 48 L1 also acts as a chromatin-associated RNA that regulates open chromatin accessibility during embryogenesis. 49.50 In mouse ES cells, they have also been described as chromatin-related RNAs involved in regulating genes necessary for maintaining cell identity and two-cell stage differentiation. 51 .

[0014] These groundbreaking papers have raised awareness and knowledge of TE function and highlighted the crucial epigenetic role of transposons in embryogenesis and development; however, the contributions of TE to adult cell plasticity and disease development and progression remain understudied. This is because studying TE is inherently difficult, and due to the repetitive nature, high degree of homology, sequence divergence, and variability of TEs, the application of established techniques for biallelic genes, particularly bioinformatics, is virtually impossible.

[0015] Relevance of research on T cell transcriptional plasticity in the tumor microenvironment Today, it is well-established that innate and adaptive immune responses play a fundamental role in tumorigenesis, and the interaction between tumor cells and the immune system is defined as cancer immunoediting. In fact, the most complex form of immunoediting is represented by crosstalk between tumor-infiltrating T lymphocytes (TILs) and tumor cells, exposing newly generated antigens to the surface within the tumor microenvironment. This can result in either tumor elimination, equilibrium between the immune response and the proliferation of residual tumor cells, or escape of the tumor's immune control. 52 .

[0016] The tumor microenvironment can be highly heterogeneous in terms of the abundance, composition, and response to immune infiltration.53 In particular, the relative abundance and effector function of TILs can be inhibited by the development of tumor-specific transcriptional programs that can neutralize, eliminate, and evade the immune system. 54 Tumor-dependent immune regulatory mechanisms are established within the tumor microenvironment and rely on a complex network based on the upregulation of regulatory molecules collectively known as immune checkpoints; their function is only partially characterized. 55 Nevertheless, these molecules (e.g., CTLA-4, PD-1, PDL-1) are targets of immune checkpoint inhibitor (ICI) therapy (immunotherapy), powerfully releasing spontaneous anti-tumor immune responses and creating a paradigm shift in cancer treatment. 56-58 However, while it is clear that tumor types with higher antigenicity due to their high mutational burden (e.g., melanoma, lung, kidney, bladder) are more likely to respond to immunotherapy, it is not well understood why most patients with these highly antigenic tumors do not show a sustained response or do not respond to immunotherapy at all. In fact, the proportion of patients who do not respond remains high, and efforts in this area have been primarily focused on the search for specific ICIs against novel surface markers expressed in T cell subsets that are similarly defined at the single-cell level. 54,59-62 Regarding the genomic and epigenetic mechanisms governing the intratumoral dysfunction of TILs, very little has been reported, even when considering mechanisms that act on reversible transcriptional plasticity to restore TIL function. [Overview of the project]

[0017] The inventors characterize two of the most common types of human cancer: one where immunotherapy is used more frequently and effectively (non-small cell lung cancer, NSCLC) and the other where it is used less frequently (colorectal cancer, CRC). These are the leading and second leading causes of cancer death worldwide, respectively. Lung cancer is the most common cancer in terms of incidence (estimated 2.09 million cases in 2018). 63 NSCLC accounts for 84% of lung tumor cases. 64The 5-year overall survival rate reaches 19%. Colorectal cancer (CRC) is the third most common cancer, with an estimated 1.84 million new cases in 2018 and a 5-year overall survival rate of 60%. 63-65 .

[0018] The inventors have found that these TEs, including transcripts, represent novel therapeutic targets for promoting the re-formation of TIL transcriptions that lead to the released effector immune response, a strategy unpredictable by other approaches.

[0019] Accordingly, the object of the present invention is to use the expression of a LINE1 (long scattered element 1) inhibitor (L1) for the treatment and / or prevention of primary or secondary immunodeficiency, or for the expression of an immunoregulatory phenotype, preferably lung cancer and / or metastasis, more preferably lung cancer, even more preferably non-small cell lung cancer (NSCLC), or colorectal cancer (CRC), or a pathological condition of viral diseases such as immunodeficiency caused by human immunodeficiency virus (HIV) or lymphocytic choriomeningitis virus (LCMV), where L1 contains or consists of a sequence having 100%, 99%, 98%, 96%, 95%, 90%, 85%, or 80% identity with SEQ ID NOs: 1 and / or 2 and / or 3.

[0020] Preferably, L1 contains or consists of a sequence having 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity with sequence number 1, 2, or 3.

[0021] Preferably, L1 includes or consists of sequence numbers 1, 2 and / or 3.

[0022] Preferably, L1 includes or consists of sequence numbers 1, 2, or 3.

[0023] Another object of the present invention is a regulatory factor for the expression of LINE1(L1) for medical use, wherein L1 comprises or consists of a sequence having 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, and 80% identity with SEQ ID NOs: 1 and / or 2 and / or 3.

[0024] Preferably, L1 contains or consists of a sequence having 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity with sequence number 1, 2, or 3.

[0025] Preferably, L1 includes or consists of sequence numbers 1, 2 and / or 3.

[0026] Preferably, L1 includes or consists of sequence number 1, 2, or 3.

[0027] Preferably, the inhibitor or suppressant is at least one molecule selected from the group consisting of: a) Antisense constructs, antisense oligonucleotides, RNA interference constructs, or polynucleotides such as siRNA or polynucleotides encoding them; b) Antibodies or fragments thereof; c) polypeptide; d) small molecules; e) Polynucleotides encoding the antibody or polypeptide or its functional derivative; A vector containing or expressing polynucleotides as defined in f)a) or e); g) CRISPR / Cas9 components, e.g., sgRNA; h) A genetically engineered host cell that expresses the polypeptide or antibody, or contains at least one component of a) or e) or g.

[0028] Preferably, the polynucleotide is an isolated regulatory nucleic acid that targets LINE1.

[0029] Preferably, the inhibitory nucleic acid contains a sequence of nucleotides complementary to the 10 to 50 consecutive nucleotides of SEQ ID NO: 1, 2, or 3.

[0030] Preferably, the inhibitory nucleic acid is at least one RNA inhibitor, preferably selected from the group consisting of antisense oligonucleotides (ASOs), gapmers, mixmers, shRNAs, siRNAs, stRNAs, snRNAs, and sgRNAs, and more preferably the inhibitory nucleic acid is modified, for example, 2'-deoxy-2'-fluoro-D-arabinonucleotide (FANA)ASO and / or one or more modified bonds or bases.

[0031] Preferably, the ASO or FANA ASO includes a sequence that is hybridized with or complementary to a sequence containing or consisting of sequence numbers 1, 2, or 3.

[0032] Preferably, the inhibitory agent is used in T cells, more preferably CD4+ T naive cells or CD8+ T cells, tumor-infiltrating lymphocytes (TILs), CD4+ and CD8+ cells, B cells, natural killer cells, or tumor cells.

[0033] Preferably, the inhibitory agent is used in combination with immunotherapy and / or radiotherapy and / or chemotherapeutic agents and / or targeted therapies and / or immune system adjuvants that promote novel antigens and an enhanced immune response, wherein the immunotherapy comprises the administration of immune checkpoint inhibitors and / or chimeric antigen receptor (CAR) expressing immune effector cells, wherein the immune checkpoint inhibitor is one or more anti-CD137 antibodies; anti-PD-1 (programmed cell death 1) antibodies; anti-PDL1 (programmed cell death ligand 1) antibodies; anti-PDL2 antibodies; or anti-CTLA-4 antibodies, or comprises these.

[0034] Preferably, the inhibitory agent is used in adoptive cell transplantation, cell therapy, mismatch bone marrow transplantation, mismatch NK cell injection, or cytokine-induced killer cell injection, or the inhibitory agent is injected into a tumor site, such as an intestinal tumor or melanoma, or is delivered specifically to the site of interest by nanoparticles.

[0035] Another object of the present invention is a pharmaceutical composition comprising the above-mentioned inhibitor or suppressant and at least one pharmaceutically acceptable carrier, and optionally further comprising a therapeutic agent.

[0036] A further object of the present invention is a method for modulating the commitment of naive CD4+ T naive cells to any effector lineage and modulating the effector response in dysfunctional T cells, comprising the step of inhibiting LINE1 expression in the cells, wherein the step of inhibiting LINE1 expression in the cells is carried out by means of at least one inhibitor or depressant as defined above.

[0037] Another object of the present invention is an isolated human T cell, B cell, NK cell, or tumor cell, wherein the cell is stably or transiently affected in the expression of LINE1(L1), and preferably the cell is a CD4+ T naive cell or a CD8+ T cell, or a dysfunctional T cell, such as a TIL.

[0038] Preferably, L1 contains or consists of sequences having 100, 99, 98, 97, 96, 95, 90, 85, and 80% identity with sequence numbers 1 and / or 2 and / or 3.

[0039] Preferably, the cells are CD4+ T naive cells or CD8+ T cells, or dysfunctional T cells, such as TILs. Preferably, L1 includes or consists of SEQ ID NOs: 1, 2, or 3.

[0040] A further objective is a composition comprising at least one cell or a combination thereof, as described above, which preferably further comprises at least one physiologically acceptable carrier.

[0041] The above cells or compositions can be used as pharmaceutical agents, preferably in the treatment and / or prevention of primary or secondary immunodeficiency, or in conditions exhibiting an immunomodulatory phenotype, preferably cancer and / or metastasis, more preferably lung cancer, even more preferably non-small cell lung cancer (NSCLC), or colorectal cancer (CRC), or in the treatment and / or prevention of viral diseases such as immunodeficiency caused by HIV, lymphocytic choriomeningitis virus (LCMV).

[0042] Preferably, the cells or composition are used in adoptive cell transplantation (ACT), cell therapy, mismatched bone marrow transplantation, mismatched NK cell injection, or cytokine-induced killer cell injection, or the cells or composition are injected into a tumor site, such as an intestinal tumor or melanoma, or delivered specifically to a site of interest by nanoparticles.

[0043] Preferably, the ASO includes or consists of a nucleic acid sequence that targets or is complementary to one of the following sequences (LINE1 ASO): LINE1-a GCACTAAATGCCTACAAGAGA(Sequence ID 4) LINE1-b GATAGACCGCTAGCAAGACTA (Sequence ID 5) LINE1-c GAAGTTGAATCTCTGAATAGA (Sequence No. 6) LINE1-d GGACCTCTTCAAGGAGAACTA (Sequence No. 7) LINE1-e GGAGAGGATGCGGAGAAATAG (Sequence No. 8), Or the corresponding RNA sequence.

[0044] Preferably, the sgRNA includes or comprises a nucleic acid sequence that targets a single sequence which is a unique non-coding region adjacent to the LINE1 element to be removed, or a nucleic acid sequence that is complementary thereto.

[0045] Preferably, the sgRNA contains or comprises a nucleic acid sequence that targets, is complementary to, or is at least 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% identical to one of the following sequences. IFNGR2-F ACTGATCGTGAGAGGCTTCGTGG (Sequence No. 9) IFNGR2-R GGTCATTTAGGGTGACAGGCAGG (Sequence No. 10) ARCP2-F GCTGTCATGGGAATCACGAAGGG (Sequence ID 11) ARCP2-R AAGGAAGACCACTTTTAAGGAGG (Sequence ID 12), Or it corresponds to the corresponding RNA sequence.

[0046] Sequence IDs 1-3 are non-retrotransitionable and, as discovered by the inventors, are specifically expressed in T lymphocytes (naive and dysfunctional). Therefore, inhibiting their expression is novel and advantageous because it can provide more specific targeting and efficacy in modulating the immune response of T cells. [Brief explanation of the drawing]

[0047] [Figure 1-1]Quiescent naive CD4+ T cells are enriched with LINE1 RNA, which is downregulated upon mTORC1-mediated TCR activation in vitro and in vivo. (a) Representative confocal fluorescence microscopy images of LINE1 RNA FISH (red) performed on quiescent naive and memory CD4+ and CD8+ T cells. Naive CD4+ T cells were treated with RNAse as a control. Original magnification 63x. Scale bar 5 μm. (b) Violin plot of LINE1 RNA FISH signals from four individuals; at least 246 nuclei were evaluated per group. ***P<0.0001. Standard one-way ANOVA. (c) LINE1 expression levels by qRT-PCR in quiescent naive and memory Th1, Th2, Th17 CD4+ T cells, and quiescent naive and memory CD8+ T cells; each donor is different. ***P<0.0001. Standard one-way ANOVA. (d) Presence of LINE1, HERV, and AluRNA in the cytoplasm, nucleoplasm, and chromatin of three quiescent naive CD4+ T cells. Data are expressed as mean. *P=0.0217. Standard one-way ANOVA. (e) LINE1 and actin expression levels by qRT-PCR in quiescent untreated CD4+ T cells with or without actinomycin D (n=3). Data are expressed as mean and ±sem. Actin untreated vs. actinomycin D treated. *P=0.046. One-sided t-test. (f) LINE1 expression levels by qRT-PCR in naive CD4+ T cells activated with a mixture of TCR and Th1 cytokines at 2, 4, 8 hours and 1, 3, 5, 7 days (n=6). ***P<0.0001. Standard one-way ANOVA. (g) Schematic diagram of the signaling pathway in downstream TCR activation. Drugs used to inhibit the pathway and their molecular targets are shown. [Figure 1-2](h) LINE1 expression levels by qRT-PCR in quiescent naive CD4+ T cells activated by TCR involvement and treated with different signaling pathway inhibitors for 8 hours post-activation (n=4 individuals). Each donor was a different donor. Control vs. rapamycin. ***P=0.0003. Two-tailed paired t-test. (i) Representative confocal fluorescence microscopy images of LINE1 RNA FISH (red) performed on memory Th1 CD4+ T cells isolated from LAM patients: healthy individuals, everolimus-treated patients, and sirolimus-treated patients. Original magnification 63x. Scale bar 5μm. (j) Violin plot of LINE1 RNA FISH signals from 2 memory Th1 CD4+ T cells per group; at least 138 nuclei were evaluated per group. ***P<0.0001. Mann-Whitney t-test, **P=0.0058. Mann-Whitney t-test. (k) LINE1 expression levels determined by qRT-PCR in memory CD4+ T cells isolated from four healthy individuals, two transplant patients treated with everolimus, and four LAM patients treated with sirolimus. Data are expressed as mean and ±sem. **P=0.007. Standard one-way ANOVA. [Figure 2-1] LINE1 is spliced ​​in non-standard transcripts of cell-activating genes that regulate transcription at the corresponding locus. (a) ARCP2.L1 is shown as an example of LINE1 containing the transcript, with a novel exon containing the LINE1 element zoomed in. Logarithmic changes of H3K36me3 vs. H3K9me3 (dark red), coverage tracks of naive CD4+ T cell chromatin RNA-seq (blue), splits, and supporting read tracks of the novel exon are shown. (bc) Schematic diagram of DNA FISH probe (green), smRNA FISH probe (pink), and ASO (blue) locations in the LINE1 transcript sequence. (c) Representative wide-field fluorescence microscopy images of smRNA FISH against HIRA.L1 were performed on quiescent and activated naive CD4+ T cells, as well as on naive CD4+ T cells treated with HIRA.L1 ASO or control (Scr)ASO for 48 hours. Original magnification 100x. Scale bar 5 μm. The bar graph on the right represents the number of dots per nucleus. [Figure 2-2] (d) Representative wide-field fluorescence microscope image of TSA RNA FISH on quiescent naive CD4+ T cells, combining the left-hand wide-field fluorescence microscope image of TSA RNA FISH on HIRA.L1 (red) and DNA FISH of the HIRA genomic locus (green). Original magnification 100x. Scale bar 5 μm. (e) Schematic diagram of HIRA.L1 knockdown in quiescent naive CD4+ T cells. Naive CD4+ T cells were treated with HIRA.L1 or control (Scr)ASO for 48 hours. (f) Expression levels of HIRA.L1 and standard transcripts by qRT-PCR in quiescent naive CD4+ T cells treated with HIRA.L1 or control (Scr)ASO (n=3 individuals) for 48 hours. *P=0.04. Two-tailed paired t-test. (g) Schematic diagram of LINE1 transcript deletion by Cas9 / RNP in quiescent naive CD4+ T cells. Naive CD4+ T cells were isolated with Cas9 / RNP and cultured for 96 hours. (hi) Schematic diagram of the IFNGR2(h) sequence showing the location of the sgRNA targeting the IFNGR2 locus. (i) Expression levels of IFNGR2.L1 and standard transcripts (n=4 individuals) by qRT-PCR in quiescent naive CD4+ T cells 96 hours after Cas9 / RNP fusion against IFNGR2.L1. LINE1 transcript, IFNGR2.L1 × P=0.04 two-sided paired t-test, canonical transcript × P=0.0275 one-sided paired t-test. [Figure 3-1]LINE1 transcripts, which form a complex with nucleolin, maintain transient expression of cell-activating genes that inhibit H3K36me3 deposition in quiescent naive CD4+ T cells. (a) Schematic diagram of LINE1 RNA knockdown in quiescent naive CD4+ T cells. Naive CD4+ T cells were treated with LINE1 or control (Scr)ASO for 48 hours. (b) Representative confocal fluorescence microscope image on the left of LINE1 RNA FISH (red) performed on quiescent naive CD4+ T cells treated with LINE1 or control (Scr)ASO for 48 hours. Original magnification 63x. Scale bar 5 μm. Right, violin plot display of LINE1 RNA FISH signals from two healthy individuals; at least 500 nuclei were evaluated per group. ***P<0.001. Mann-Whitney t test. (c) Standard transcript expression levels of LINE1 transcript and quiescent naive CD4+ T cells were evaluated by qRT-PCR. These were treated with LINE1 or control (Scr)ASO for 48 hours (n=3 individuals). Data are expressed as mean and sem. LINE1 transcript. **P<0.0001, F=68.60. Two-way ANOVA; Canonical transcript***P<0.0001, F=39.39. Two-way ANOVA. (d) H3K36me3, H3K4me3, H3K9me3, and H3K27me3 levels were assessed by quantitative Western blotting in quiescent naive CD4+ T cells treated with LINE1 or control (Scr)ASO (n=3 individuals) for 48 hours. H3 was used as a loading control. Data are expressed as mean and sem. H3K36me3 Scr vs LINE1. *P=0.0495 Two-tailed paired t-test. (e) Positional distribution of H3K36me3 ChIP seq signals plotted on LINE1 containing the gene or regulatory gene body between naive CD4+ T cells treated with LINE1 or control (Scr)ASO for 48 hours and quiescent naive CD4+ T cells. The median of the H3K36me3 signal (ChIP / input doubling) for the entire gene is plotted. [Figure 3-2](fg) LINE1 transcript and control gene (GAPDH) were amplified by qRT-PCR in nucleoline RIP experiments performed on quiescent naive CD4+ T cells (n=3 individuals). Data are expressed as the mean percentage of input sem. (h) Schematic diagram of nucleoline knockdown in quiescent naive CD4+ T cells. Naive CD4+ T cells were treated with nucleoline or control (Scr)ASO for 48 hours. (i) Expression levels of LINE1 transcript and standard transcript by qRT-PCR in quiescent naive CD4+ T cells treated with nucleoline ASO or control (Scr)ASO (n=3 individuals) for 48 hours. Standard transcript. ***P<0.0001. F=42.57.60 Bidirectional ANOVA. (j) Presence of LINE1 RNA in the cytoplasm, nucleoplasm, and chromatin of quiescent naive CD4+ T cells treated with nucleolin or control (Scr)ASO for 48 hours (n=3 individuals). Data are expressed as mean and ±sem. *P=0.0345, F=8.772. Two-way ANOVA. [Figure 3-3](k) Schematic diagram of LINE1 RNA knockdown in activated CD4+ T cells. Naive CD4+ T cells were treated with LINE1 or control (Scr)ASO for 48 hours and then activated via TCR binding for 7 days in the presence of a Th1 cytokine cocktail. (l) T-bet and IFN-positive cells (n=8 individuals) measured by intracellular staining in naive CD4+ T cells treated with LINE1 or control (Scr)ASO. Data are expressed as mean and sem. Tbet**P=0.0009. Two-sided paired t-test; IFN**P=0.0002. Two-sided paired t-test. (m) Schematic diagram of nucleolin knockdown in activated CD4+ T cells. Naive CD4+ T cells were treated with nucleolin or control (Scr)ASO for 48 hours and then activated via TCR binding for 7 days in the presence of a Th1 cytokine cocktail. (n) T-bet and IFN-positive cells were measured by intracellular staining in naive CD4+ T cells treated with Nucleolin or control (Scr)ASO for 48 hours, and activated for 7 days via TCR involvement in the presence of a Th1 cytokine cocktail (n=4 individuals). Data are expressed as mean and sem. Tbet*P=0.0142 two-sided t-test; IFN**P=0.0041 two-sided t-test. [Figure 4-1] LINE1 transcripts are regulated by the transcription factor IRF4. (a) Schematic diagram of CD4+ and CD8+ T cell development in the thymus. Surface markers specific to hematopoietic progenitor cells, early T cell progenitor cells, DN2, DN3, double-positive, naive CD4+, and naive CD8+ are indicated. (bc) Expression levels of LINE1 transcripts and standard transcripts in RNA-seq datasets of progenitor cells, naive and activated CD4+ T cells, and naive and activated CD8+ T cells. ***P<0.001. Wilcoxon rank-sum tests were performed for all cell types compared to naive CD4+ T cells (paired only with CD4+ activated T cells). [Figure 4-2](d) IRF4 levels were assessed by quantitative Western blotting in naive CD4+ and naive CD8+ T cells. H3 was used as a loading control. Data are expressed as mean and sem. n=3 individuals. **P=0.0085, two-tailed paired t-test. (e) LINE1 containing the gene and control gene (HECW1) promoter was amplified by qRT-PCR in IRF4 ChIP experiments performed in quiescent naive CD4+ T cells and naive CD8+ T cells (n=3 individuals). Data are expressed as mean % of input sem. LINE1 containing the gene promoter. **P=0.0034, F=10.7, including bidirectional ANOVA. (f) Schematic diagram of IRF4 knockdown in quiescent naive CD4+ T cells. Naive CD4+ T cells were treated with IRF4 or control (Scr)ASO for 48 hours. (g) Expression levels of LINE1 transcript, standard transcript, and control gene (HECW1) by qRT-PCR in quiescent naive CD4+ T cells treated with IRF4 or control (Scr)ASO for 48 hours (n=3 individuals). Data are expressed as mean and sem. LINE1 transcript** P=0.001, F=924 bidirectional ANOVA; canonical transcript* P=0.04, F=22.2 bidirectional ANOVA. [Figure 5-1]Upon activation, the LINE1 transcript is downregulated by the regulatory splicing protein PTBP1 / MATR3, but standard transcript expression is preferred by the transcription factor GTF2F1. (ab) The LINE1 transcript and the control gene (GAPDH) were amplified by qRT-PCR in quiescent naive CD4+ T cells and naive CD4+ T cells activated for 16 hours with TCR binding and a Th1 cytokine cocktail (n=3 individuals) in PTBP1 RIP experiments. Data are expressed as the mean percentage of input sem. ***P=0.0002, F=26.26, bidirectional ANOVA. (cd) The LINE1 transcript and the control gene (GAPDH) were amplified by qRT-PCR in quiescent naive and naive CD4+ T cells activated for 16 hours with TCR binding and a Th1 cytokine cocktail (n=3 individuals) in GTF2F1 RIP experiments. Data are expressed as the mean percentage of input sem. **P=0.0014, F=16.68, two-way ANOVA. [Figure 5-2](e) Using schematic diagrams of qRT-PCR methods with PTBP1 RIP (panel f) and GTF2F1 RIP (panel g), we will clarify whether PTBP1 or GTF2F1 binds to standard RAB22A mRNA, RAB22A.L1, or premRNA in activated CD4+ T cells. The primers are designed to amplify i) LINE1 exon, ii) premRNA in the region where an intron overlaps with a nearby LINE1 exon, ii) spliced ​​LINE1 transcript (fw primer exon 2 and rev primer LINE1 exon 2.1), and iv) standard transcript. (f) RAB22A RNA species were amplified by qRT-PCR in quiescent naive CD4+ T cells and naive CD4+ T cells activated for 16 hours with a TCR and Th1 cytokine cocktail in PTBP1 RIP experiments (n=3 individuals). Data are expressed as the mean % of the input sem. (g) The RAB22A RNA species was amplified by qRT-PCR in quiescent naive CD4+ T cells and naive CD4+ T cells activated for 16 hours using a TCR and Th1 cytokine cocktail in a PTBP1 RIP experiment (n=3 individuals). Data are expressed as the mean percentage of input sem. (h) Schematic diagram of PTBP1 and GTF2F1 knockdown in activated CD4+ T cells. Naive CD4+ T cells were treated with PTBP1 and GTF2F1 or control (Scr)ASO for 48 hours and then activated for 16 hours via TCR binding in the presence of a Th1 cytokine cocktail. (i) LINE1 transcript and standard transcript expression levels by qRT-PCR in activated CD4+ T cells treated with PTBP1 and GTF2F1 or control (Scr)ASO for 48 hours, and activated for 16 hours via TCR involvement in the presence of a Th1 cytokine cocktail (n=3 individuals). LINE1 transcript, ***P=0.0006, F=14.89, bidirectional ANOVA; Canonical transcript, ***P<0.0001, F=44.52, bidirectional ANOVA. [Figure 6-1]LINE1 transcripts re-accumulate in dysfunctional tumor-infiltrating effector lymphocytes. (a) Representative confocal fluorescence microscopy images of the top of LINE1 RNA FISH (red) performed on memory CD4+ and CD8+ T cells infiltrating normal adjacent tissue or CRC tumor. Original magnification 63x. Scale bar 5μm. Below are violin plots of LINE1 RNA FISH signals from two patients; at least 100 nuclei were evaluated per group. Memory CD4+ T cells ***P<0.001. Bilateral Mann-Whitney U test; Memory CD8+ T cells ***P<0.001. Bilateral Mann-Whitney U test. (b) Representative confocal fluorescence microscopy images of LINE1 RNA FISH (red) performed on memory CD4+ and CD8+ T cells infiltrating normal adjacent tissue or NSCLC tumor. Original magnification 63x. Scale bar 5μm. Below, we evaluated the violin plot representation of LINE1 RNA FISH signaling from three patients for CD4+ T cells and from two patients for CD8+ T cells, evaluating at least 84 nuclei per group. Memory CD4+ T cells ***P<0.001 Two-sided Mann-Whitney U test. [Figure 6-2](c) Left-representative confocal fluorescence microscopy image of LINE1 RNA FISH (red) performed on effector CD4+ and dysfunctional CD4+ T cells. Original magnification 63x. Scale bar 5 μm. Right, violin plot of LINE1 RNA FISH signals from healthy individuals; at least 100 nuclei were evaluated per group. ***P<0.001. Mann-Whitney U test. (d) LINE1 transcript and standard transcript expression levels by qRT-PCR in effector CD4+ and dysfunctional CD4+ T cells (n=3 individuals). Data are expressed as mean and sem. LINE1 transcript**P=0.00089, F=8.092 Bidirectional ANOVA; standard transcript***P<0.0001, F=38.08. Bidirectional ANOVA. (e) Left-representative confocal fluorescence microscopy image of LINE1 RNA FISH (red) performed on effector CD8+ and dysfunctional CD8+ T cells. Original magnification 63x. Scale bar 5μm. Right, violin plot display of LINE1 RNA FISH signals from healthy individuals; at least 100 nuclei were evaluated per group. ***P<0.001 Mann-Whitney test. (f) LINE1 transcript and standard transcript expression levels by qRT-PCR in effector CD8+ and dysfunctional CD8+ T cells (n=3 individuals). Data are expressed as mean and sem. LINE1 transcript**P=0.0039, F=17.93 bidirectional ANOVA; standard transcript***P<0.0001, F=83.66. Bidirectional ANOVA. [Figure 7-1]Re-accumulation of LINE1 transcripts in dysfunctional effector lymphocytes is regulated by IRF4, stabilized in chromatin by nucleolin, and leads to the loss of GTF2F1 / PTBP1 binding. (a) IRF4, nucleolin, GTF2F1, and PTBP1 levels were evaluated by quantitative Western blotting in effector CD4+ and dysfunctional CD4+ T cells, as well as effector CD8+ and dysfunctional CD8+ T cells. H3 was used as a loading control. Data are expressed as mean and sem (n=2 individuals). (b) RAB22A.L1, ARCP2.L1, and IFNGR2.L1 were amplified by qRT-PCR in nucleolin, PTBP1, and GTF2F1 RIP experiments performed in effector and dysfunctional CD4+ T cells, and effector and dysfunctional CD8+ T cells (n=3 individuals). Data are expressed as mean % of input sem. [Figure 7-2] (c) Schematic diagram of IRF4 knockdown in dysfunctional CD4+ and CD8+ T cells. Dysfunctional T cells were treated with IRF4 or control (Scr)ASO for 48 hours. (d) LINE1 transcript and standard transcript expression levels by qRT-PCR in dysfunctional CD4+ T cells treated with IRF4 or control (Scr)ASO for 48 hours (n=3 individuals). Data are expressed as mean and sem. LINE1 transcript***P<0.001, F=47.6. Bidirectional ANOVA; normal transcript***P<0.0001, F=36.1. Bidirectional ANOVA. (e) LINE1 transcript and standard transcript expression by qRT-PCR in dysfunctional CD8+ T cells treated with IRF4 or control (Scr)ASO (n=3 individuals). Data are expressed as mean and sem. LINE1 transcript***P=0.009, F=22.6 bidirectional ANOVA; canonical transcript**P=0.001, F=16.8. Bidirectional ANOVA. [Figure 8-1]LINE1 transcript levels regulate the dysfunctional phenotype of CD4+ and CD8+ memory T cells infiltrating CRC or NSCLC. (a) Schematic diagram of immunoassays performed on memory CD4+ and CD8+ memory T cells isolated from CRC or NSCLC treated with LINE1 or control (Scr)ASO. After ASO treatment, tumor-infiltrating memory CD4+ and CD8+ (TILs) were examined for control checkpoint staining (panels b and c), effector cytokine secretion (panels d and e), and ability to kill heterologous antigen-presenting cells containing MHCII and MHCI as monocytes (panels f and g). (b) PD-1, TIM-3, or LAG-3 positive cells measured by surface marker staining of memory CD4+ T cells isolated from CRC (black, n=3 individuals) or NSCLC (red, n=3 individuals) treated with LINE1 or control (Scr)ASO for 48 hours; PD-1 Scr ASO vs LINE ASO. **P=0.0044, two-sided t-test; TIM-3 Scr ASO vs LINE ASO. *P=0.017, two-sided t-test; LAG-3 Scr ASO vs LINE ASO. *P=0.04, two-sided t-test; LAG-3 Scr ASO vs LINE ASO. *P=0.04, two-sided t-test. (c) PD-1, TIM-3 or LAG-3 positive cells isolated from CRC (black, n=3 individuals) or NSCLC (red, n=3 individuals) and treated with LINE1 or control (Scr)ASO for 48 hours to obtain memory CD8+ T cells, PD-1 Scr ASO vs LINE ASO. *P=0.0268, two-sided t-test; LAG-3 Scr ASO vs LINE ASO. *P=0.03, measured by surface markers stained with a two-sided t-test. The staining was measured by intracellular staining in memory CD4+ T cells isolated from CRCs (black, n=2 individuals) or NSCLCs (red, n=2 individuals) that had been treated with LINE1 or control (Scr)ASO for 48 hours and then activated by TCR binding for another 48 hours. [Figure 8-2](d) IFNγ or GrzB positive cells. Data are expressed as mean and sem. IFNγ Scr ASO vs LINE ASO. *P=0.04, one-sided paired t-test; GrzB Scr ASO vs LINE ASO. *P=0.02, one-sided paired t-test. (e) IFNγ, GrzB, or PerfA positive cells were isolated from CRC (black, n=3 individuals) or NSCLC (red, n=1 individual), treated with LINE1 or control (Scr) ASO for 48 hours, and then measured by intracellular staining in memory CD8+ T cells activated by TCR binding for a further 48 hours. Data are expressed as mean and sem. IFNγ Scr ASO vs LINE ASO. *P=0.0095, two-sided paired t-test; GrzB Scr ASO vs LINE ASO. *P=0.03, one-sided paired t-test; PerfA Scr ASO vs LINE ASO. *P=0.035, one-sided paired t-test. Percentage of dead xenomonocytes after 12 hours co-culture with memory CD4+(f) or CD8+(g) T cells derived from (fg)CRC (black, n=1 individual) or NSCLC (red, n=2 individuals). Treatment with LINE1 or control (Scr)ASO for 48 hours. Memory CD4+ T cells * P = 0.02, two-sided paired t-test; Memory CD8+ T cells * P = 0.04, two-sided paired t-test. [Figure 9-1]LINE1 RNA is abundant in the open chromatin region of naive CD4+ T cells. (a) Representative confocal fluorescence microscopy images of Alu RNA FISH (red) performed on quiescent naive and memory CD4+ and CD8+ T cells. Naive CD4+ T cells were treated with RNAse as a control. Original magnification 63x. Scale bar 5 μm. (b) Violin plot display of Alu RNA FISH signals from 4 individuals; at least 220 nuclei were evaluated per group. ***P<0.0001, standard one-way ANOVA. (c) Alu expression levels by qRT-PCR in quiescent naive and memory Th1, Th2, Th17 CD4+ T cells, and quiescent naive and memory CD8+ T cells, each donor is different. (d) Representative confocal fluorescence microscopy images of HERV RNA FISH (red) performed on quiescent naive and memory CD4+ and CD8+ T cells. Naive CD4+ T cells were treated with RNAse as a control. Original magnification 63x. Scale bar 5 μm. (e) Violin plot display of HERV RNA FISH signals from 3 individuals; at least 164 nuclei were evaluated per group. (f) HERV expression levels by qRT-PCR in quiescent naive and memory Th1, Th2, Th17 CD4+ T cells, and quiescent naive and memory CD8+ T cells, each donor different. [Figure 9-2](g) Presence of 18S and Xist (cytoplasmic and chromatin-associated regulatory transcripts) in the cytoplasm, nucleoplasm, and chromatin of quiescent naive CD4+ T cells from three subjects. Data are expressed as mean. (h) Representative confocal fluorescence microscopy images of LINE1 RNA FISH (red) and immunofluorescence staining (gray) for H3K4me3 and H3K9me3 on quiescent naive CD4+ T cells. Original magnification 63x. Scale bar 5 μm. (i) Pearson correlation of colocalization between RNA FISH and immunofluorescence was measured in three subjects, evaluating at least 103 nuclei per group. ***P<0.0001, standard one-way ANOVA. Quiescent naive CD4+ T cells were activated with TCR binding and (j)Th2 or (k)Th17 cytokine cocktails. LINE1 expression levels by qRT-PCR at 1, 3, 5, and 7 days in four subjects for (a) and (b). *P=0.0209. Standard one-way ANOVA;**P=0.0100 Standard one-way ANOVA. (l) LINE1 expression levels by qRT-PCR in naive CD4+ T cells activated for 72 hours with TCR binding and a Th1 cytokine cocktail, and then treated with different signaling pathway inhibitors for 48 hours (n=4 individuals). Control and rapamycin*P=0.0286. Two-sided Mann-Whitney test. (m) Phosphorylated S6 protein (pS6, mTORC1 target) levels were assessed by quantitative Western blotting for 72 hours in naive CD4+ T cells activated with TCR binding and a Th1 cytokine cocktail, and then treated with rapamycin or CsA. Tubulin was used as a loading control. (n) Representative confocal fluorescence microscopy images of LINE1 RNA FISH (red) performed on quiescent naive CD4+ T cells activated for 72 hours with TCR binding and a Th1 cytokine cocktail, and then treated with rapamycin or CsA. Original magnification 63x. Scale bar 10 μm. [Figure 10]Naive CD4+ T cells express evolutionarily older LINE1 elements, in contrast to mESCs that express evolutionarily younger, reversible LINE1 elements. (a) Heatmaps of transposable element expression at the class, superfamily, and subfamily levels in each chromatin and nucleoplasmic naive CD4+ T cell RNA-seq are replicated. Z-scores were calculated using DESeq2 on log2-transformed normalized read counts. (b) Scatter plots of LINE1 subfamily expression in nucleoplasmic (x-axis) and chromatin (y-axis) RNA-seq of naive CD4+ T cells. Subfamilies are color-coded based on evolutionary origin: mammalian-specific (L1M, orange), primate-specific (L1P, blue), human-specific (L1Hs, green), HAL (yellow). (c) Heatmaps of transposable element expression at the class, superfamily, and subfamily levels in each mESC RNA-seq are replicated. The Z-score was calculated on log2-normalized read counts using DESeq2(d and f) pie charts representing the distribution of chimeric and pure reads of Hs LINE1(d) and Mm LINE1(f) in naive CD4+ T cells. This is reported as the mean percentage of total replication in naive CD4+ T cells (see Methods). Genomic distribution of (e) Hs LINE1(e) and Mm LINE1(g) transcripts between protein-coding regions, intergenetic regions, lncRNAs, pseudogenes, and ncRNA transcription units in naive CD4+ T cells. [Figure 11-1] De Novo LINE1 Transcript Validation. (a) Long-read transcription profiles of LINE1 transcripts detected by nanopore sequencing (n=407). Lines and areas represent mean coverage and mean standard error, respectively. [Figure 11-2] (bi) A scheme of LINE1 containing gene mRNA and a novel reconstructed LINE1 transcript; LINE1 exons are shown in orange. In the middle, a scheme of PCR primers designed to verify the presence of two transcription isoforms is reported. Below are agarose gels of PCR results for LINE1 transcript, LINE1 containing gene mRNA, and negative control. [Figure 12-1] The evolutionarily older intronic LINE1 element (non-retrotranspositional) is spliced ​​as a novel exon of atypical splicing variants of genes important for cell activation. (a) Length distribution of LINE1 loci. The dashed line shows the average length of the LINE1 locus. (b) Distribution of LINE1 loci for the full-length LINE1 sequence (6kb). Primers used for qRT-PCR, probes for RNA FISH, and antisense oligonucleotides (ASOs) for LINE1 knockdown experiments are shown. Right, percentage of LINE1 loci within ORF1, ORF2, 5′UTR, and 3'UTR of the full-length LINE1 sequence. [Figure 12-2] (c) Bar graph showing the percentage of the most enriched LINE1 subfamily in LINE1 transcripts. (d) Distribution of LINE1 loci among introns, exons, promoters, 5'UTR and 3'UTR of LINE1, including protein-coding genes. (e) Consensus motifs of donor and acceptor splicing sites in LINE1 exons. (f) LINE1 RNA FISH performed on naive CD4+ T cells treated with an excipient (DMSO) or a 3TC retrotranscriptase inhibitor. [Figure 13-1]LINE1 transcript levels in quiescent naive CD4+ T cells remain cis-paused in standard transcript expression. (a) Representative wide-field fluorescence microscopy images of smRNA FISH for RAB22A.L1 on the left, performed on quiescent and activated naive CD4+ T cells, as well as naive CD4+ T cells treated with RAB22A.L1 ASO or control (Scr)ASO for 48 hours. Original magnification 100x. Scale bar 5 μm. The bar graph on the right represents the number of dots per nucleus. (b) Representative wide-field fluorescence microscopy images of TSA RNA FISH on RAB22A.L1 (red) combined with DNA FISH for the HIRA genomic locus (green) performed in quiescent naive CD4+ T cells. Original magnification 100x. Scale bar 5 μm. RAB22A.L1 and standard transcript expression levels by qRT-PCR in quiescent naive CD4+ T cells treated with RAB22A.L1 or control (Scr)ASO (n=3 individuals) for 48 hours. *P=0.04, two-sided paired t-test. (d) Schematic diagram of ARCP2 LINE1 transcript deletion by Cas9 / RNP in quiescent naive CD4+ T cells. Naive CD4+ T cells were isolated with Cas9 / RNP and cultured for 96 hours. [Figure 13-2](e) Expression levels of ARCP2.L1 and standard transcripts by qRT-PCR in quiescent naive CD4+ T cells 96 hours after nucleofection of IFNGR2.L1 or control (n=4) with Cas9 / RNP. Schematic diagram of LINE1 transcript, ARCP2.L1 × P = 0.04 one-sided paired t-test (f) Up, and sgRNA (blue) and control PCR primer (black) positions at the IFNGR2 locus. Intermediate PCR validation was performed on 25 ng of gDNA extracted from naive CD4+ T cells 96 hours after nucleofection of IFNGR2.L1 or control (n=4) with Cas9 / RNP. The primers used were the designed outer sgRNA sequences. Below, schematic diagram of predicted deletion loci (sgRNA: blue, PAM: red) by Sanger sequence analysis of PCR validation. (g) Schematic diagram of the positions of sgRNA (blue) and control PCR primer (black) at the ARCP2 gene locus. Intermediate PCR validation was performed on 25 ng of gDNA extracted from naive CD4+ T cells 96 hours after nucleofection with Cas9 / RNP targeting ARCP2.L1 or control (n=3 individuals). The primers used were the designed outer sgRNA sequences. Below is a schematic diagram of the predicted deletion locus (sgRNA: blue, PAM: red) based on Sanger sequence analysis of the PCR validation. [Figure 14-1]LINE1 transcripts inhibit H3K36me3 deposition on LINE1-containing genes. (a) LINE1 expression levels by qRT-PCR in quiescent naive CD4+ T cells treated with LINE1 or control (Scr)ASO for 48 hours (n=8 individuals). Data are expressed as mean and sem. ***P<0.0001, two-sided paired t-test. (b) Representative confocal fluorescence microscopy images of LINE1 RNA FISH (red) and immunofluorescence staining (gray) of H3K36me3 and H3K4me3 performed on quiescent naive CD4+ T cells treated with LINE1 or control (Scr)ASO for 48 hours. Original magnification 63x. Scale bar 5μm. (c) Violin plot of H3K36me3 and H3K4me3 signals from naive CD4+ T cells treated with LINE1 or control (Scr)ASO isolated from two individuals; at least 267 nuclei were evaluated per group. ***P<0.001. Two-sided Mann-Whitney U test. (d) The location distribution of H3K4me3 ChIP seq signals was compared between naive CD4+ T cells and activated CD4+ T cells and plotted on LINE1 containing the gene or regulatory gene body. The median of the H3K34me3 signal (ChIP / input doubling) for the entire gene was plotted. [Figure 14-2](ef) Representative ChIP-seq tracks of ERGIC2 LINE1 containing H3K4me3 and H3K36me3 in quiescent naive and naive CD4+ T cells, and representative ChIP-seq tracks of H3K4me3 and H3K36me3 containing FUCA2 regulatory genes activated for 16 hours with TCR binding and a Th1 cytokine cocktail. LINE1 transcripts and LINE1 genomic locations are shown. ChIP-seq coverage tracks are normalized for each input. (g) Standard transcripts and the control gene (HECW1) were amplified by qRT-PCR in H3K36me3 ChIP experiments performed in quiescent naive and naive CD4+ T cells activated for 16 hours with TCR binding and a Th1 cytokine cocktail (n=3 individuals). Data are expressed as the mean % of the input sem. H3K36me3 ChIP naive CD4+ T cells vs. activated CD4+ T cells. **P<0.0001, F=69.42, Two-way ANOVA. (h)Standard transcript and control gene (HECW1) were amplified by qRT-PCR in H3K36me3 ChIP experiments performed on quiescent naive CD4+ T cells treated with LINE1 or control (Scr)ASO for 48 hours (n=3 individuals). Data are expressed as mean % of input sem. H3K36me3 ChIP Scr vs LINE1. ***P<0.0001, F=58.86, Two-way ANOVA. [Figure 15]In cooperation with nucleolin, LINE1 transcripts inhibit the transcription of LINE1-containing genes. (a) Nucleolin expression levels and (b) protein levels were analyzed by qRT-PCR in quiescent naive CD4+ T cells treated with nucleolin or control (Scr)ASO for 48 hours in four individuals. Data are expressed as mean and sem. *P=0.0482 Two-tailed paired t-test. (c) Representative confocal fluorescence microscopy images of LINE1 RNA FISH (red) and immunofluorescence staining (gray) of H3K36me3 performed on quiescent naive CD4+ T cells treated with nucleolin or control (Scr)ASO for 48 hours. Original magnification 63x. Scale bar 5 μm. (d) Violin plot of H3K36me3 signaling from naive CD4+ T cells treated with nucleolin or control (Scr)ASO isolated from three individuals; at least 259 nuclei were evaluated per group. ***P<0.001, two-sided Mann-Whitney U test. (e) Presence of GAPDH and MALAT1 (cytoplasmic and nuclear regulatory transcript) in the cytoplasm, nucleoplasm, and chromatin of quiescent naive CD4+ T cells treated with Nucleolin or control (Scr) ASO for 48 hours (n=3 individuals). Data are expressed as mean. [Figure 16]LINE1 transcripts are downregulated upon T cell activation, while standard transcripts are upregulated. (a) Expression levels of standard transcripts and three random regulatory gene sets that do not retain the genomic LINE1 element (regulatory gene without LINE1) and regulatory gene sets that retain the LINE1 element but do not produce LINE1 transcripts (regulatory gene with LINE1) in RNA-seq datasets of quiescent and activated naive CD4+ T cells. ***P<0.001 Wilcoxon matched pair signed-rank test. (b) Expression levels of LINE1 transcripts and standard transcripts by qRT-PCR in quiescent naive and activated CD4+ T cells were observed at 16 hours with TCR involvement and a Th1 cytokine cocktail (n=3). Data are expressed as mean and sem. LINE1 transcript**P=0.0024, F=13.65 bidirectional ANOVA; standard transcript**P=0.0003, F=23.30 bidirectional ANOVA. (c) Transcription factor (TFs) binding motif studies were performed in the promoter regions of LINE1-containing genes; TFs statistically upregulated in naive CD4+ T cells compared to naive CD8+ T cells were filtered from RNA-seq and proteomics datasets (see Methods). IRF4 was one of the most enriched. (d) IRF4 expression levels by qRT-PCR in quiescent naive and activated CD4+ T cells (n=3 individuals). Data are shown as mean and sem. * IRF4 expression levels by qRT-PCR in quiescent naive CD4+ T cells treated with IRF4 or control (Scr)ASO for 48 hours (n=3 individuals). Data are shown as mean and sem. ** P=0.0042, two-tailed paired t-test. IRF4 levels by FACS analysis in quiescent naive CD4+ T cells treated with IRF4 or control (Scr)ASO for 48 hours. [Figure 17]MATR3 / PTBP1 regulates LINE1 exon splicing in activated CD4+ T cells. (a) PTBP1 expression levels by qRT-PCR in quiescent naive CD4+ T cells treated with PTBP1 or control (Scr)ASO for 48 hours and activated for 16 hours via TCR involvement in the presence of a Th1 cytokine cocktail. Data are presented as mean and sem. n=3 individuals. **P=0.0014, two-tailed paired t-test. (b) PTBP1 levels by FACS analysis in activated CD4+ T cells treated with PTBP1 or control (Scr)ASO. (c) GTF2F1 expression levels and protein levels by qRT-PCR in quiescent naive CD4+ T cells treated with GTF2F1 or control (Scr)ASO for 48 hours. (d) 4 individuals analyzed. Data are presented as mean and sem. **P=0.0031, two-tailed paired t-test. (e) MATR3 expression levels by qRT-PCR in quiescent naive CD4+ T cells treated with MATR3 or control (Scr)ASO for 48 hours were activated for 16 hours via TCR involvement in the presence of a Th1 cytokine cocktail. Data are expressed as mean and sem. n=3 individuals. **P=0.0006 two-sided paired t-test. MATR3 levels by FACS analysis in activated CD4+ T cells treated with MATR3 or control (Scr)ASO. (g) Expression levels of LINE1 transcript and standard transcript by qRT-PCR in activated CD4+ T cells treated with MATR3 or control (Scr)ASO for 48 hours were activated for 16 hours via TCR involvement in the presence of a Th1 cytokine cocktail (n=4 individuals). LINE1 transcript, ***P<0.001, F=44.8, bidirectional ANOVA; standard transcript, **P=0.006, F=29.3, bidirectional ANOVA. [Figure 18]LINE1 RNA reaccumulates in dysfunctional CD4+ and CD8+ T lymphocytes in vitro. (a) Quiescent naive CD4+ T cells were activated and differentiated into Th1 cells and exposed to stimulating anti-CD3 mAb every two days; chronic anti-CD3 stimulation induces proliferation arrest, PD-1 surface marker expression, and decreased IFN production. (b) Left side: Cell counts (n=5 individuals) of effector CD4+ and dysfunctional CD4+ T cells at 2, 4, 6, 8, and 10 days. Data are presented as mean and sem. ***P<0.0001, F=57.22, expressed by two-way ANOVA. Center: PD-1 positive cells (n=4 individuals) in effector CD4+ and dysfunctional CD4+ T cells at 2, 5, 7, and 9 days. Data are presented as mean and sem. ***P<0.0001, F=48.77, expressed by two-way ANOVA. On the right, IFN-positive cells (n=4 individuals) in effector CD4+ and dysfunctional CD4+ T cells on day 9. Data are expressed as mean and sem. *P=0.032. One-sided paired t-test. (c) Quiescent naive CD8+ T cells were activated and exposed to stimulating anti-CD3 mAb every two days; chronic anti-CD3 stimulation induces growth arrest, PD-1 surface marker expression, and decreased IFN, GrzB, and PerfA production. (d) On the left, cell counts of effector CD8+ and dysfunctional CD8+ T cells after 2, 4, 6, and 8 days. Data are expressed as mean and sem. N=4 individuals. ***P=0.0003, F=26.05. Two-way ANOVA. In the center, PD-1-positive cells in effector CD8+ and dysfunctional CD8+ T cells are observed on days 2, 5, and 7. Data are mean and sem. N=4 individuals. ***P<0.0001, F=58. Two-way ANOVA. Right side: IFN, GrzB, and PerfA-positive cells on day 9 in effector CD8+ and dysfunctional CD8+ T cells. Data are mean, sem. N=4 individuals. IFN*P=0.01; GrzB*P=0.02. Two-sided paired t-test. IRF4 levels by FACS analysis of dysfunctional CD4+ and CD8+ T cells treated with IRF4 or control (Scr)ASO for 48 hours. [Figure 19-1]LINE1 transcripts regulate the depleted phenotype of CD4+ and CD8+ T lymphocytes in vitro. (a) Schematic diagram of immunological assays performed on effector CD4+ and CD8+ T cells depleted in vitro and treated with LINE1 or control (Scr)ASO. After ASO treatment, depleted CD4+ and CD8+ T cells were examined for effector cytokine secretion (panels d and e), ability to kill heterologous antigen-presenting cells containing MHCII and MHCI as monocytes (panels f and g), and proliferative capacity by qRT-PCR (panels h and i)(bc)LINE1 expression levels in depleted CD4+ (b) and CD8+ (c) T cells treated with LINE1 or control (Scr)ASO (n=4 individuals). Data are expressed as mean and sem. CD4+ T cells**P=0.004; CD8+ T cells*P=0.007. Two-sided paired t-test. (d) Percentage of IFN or GrzB-positive wasting CD4+ T cells treated with LINE1 or control (Scr)ASO (n=4). Data are expressed as mean and sem. *P=0.0336. One-sided test. (e) Percentage of IFN, GrzB or PerfA-positive wasting CD8+ T cells treated with LINE1 or control (Scr)ASO (n=4). Data are expressed as mean and sem. IFN**P=0.002; GrzB. **P=0.004, PerfA. **P<0.001, two-sided paired t-test. (fg) Percentage of wasted CD4+(f) or CD8+(g) T cells treated with LINE1 or control (Scr)ASO and co-cultured for 12 hours with dead xenomonocytes. CD4+ T cells**P=0.009, CD8+ T cells**P=0.008, two-sided paired t-test. [Figure 19-2] (hi) Exhausted CD4+(h) or CD8+ T cells treated with LINE1 or control (Scr)ASO. (i) Proliferation assay with cell traces in T cells. [Modes for carrying out the invention]

[0048] The terms “suppressant or inhibitor” or “(selectively) repressing or inhibiting molecule” mean a molecule that alters the expression of a target. This alteration is relative to the normal or baseline level of expression in the absence of the “suppressant or inhibitor” or molecule, but represents a decrease in normal / baseline expression under otherwise similar conditions. The control or inhibition of target expression can be evaluated by any means known to those skilled in the art, and the evaluation of the target expression level or presence is preferably performed using classical molecular biology techniques, e.g., qPCR (real-time polymerase chain reaction), microarrays, bead arrays, RNAse protection analysis, or Northern blotting, or cloning and sequencing. In the context of the present invention, the target is a gene, mRNA, cDNA, or the protein encoding them. The molecules described above also include their salts, solvates, or prodrugs. The molecules described above may or may not be solvated with H2O. In the context of the present invention, the terms “targeting” or “complementary” may be intended to mean that a sequence is fully or partially complementary to all or part of a target sequence, or that it can hybridize to all or part of a particular target sequence.

[0049] The polynucleotides described above, for example as siRNA, may further include dTdT or UU 3'-overhangs and / or nucleotide and / or polynucleotide backbone modifications, as described elsewhere in this specification. In the context of the present invention, the term “polynucleotide” includes DNA molecules (e.g., cDNA or genomic DNA) and RNA molecules (e.g., mRNA, siRNA, shRNA) as well as DNA or RNA analogs produced using nucleotide analogs. Polynucleotides may be single-stranded or double-stranded. The above RNA inhibitors can preferably hybridize to all or part of a particular target sequence. Thus, RNA inhibitors may be fully or partially complementary to all or part of the target sequence. RNA inhibitors can hybridize to a specified target sequence under moderate to high stringency conditions. RNA inhibitors may be defined by reference to specific sequence identity to the reverse complement of the sequence they are intended to target. Antisense sequences typically have at least about 75%, preferably at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% sequence identity with their reverse complements.

[0050] The term "polynucleotides and polypeptides" also includes their derivatives and functional fragments. Polynucleotides can be synthesized using oligonucleotide analogs or derivatives (e.g., inosine or phosphorothioate nucleotides).

[0051] The molecule of the present invention may be an antibody or a derivative thereof.

[0052] The term “gene” as used herein also includes the corresponding orthologous gene or homologous gene, isoform, mutant, allele variant, functional derivative, and functional fragment thereof. “Expressed protein” is also intended to include the corresponding protein encoded from the corresponding orthologous gene or homologous gene, functional mutant, functional derivative, functional fragment, or analog, and its isoform.

[0053] In the context of the present invention, the terms “polypeptide” or “protein” include the following: i. Whole proteins, allele variants, and their orthologues; ii. Functional fragments for synthesis, recombination, or proteolysis iii. Any functional equivalent, e.g., a synthetic or recombinant functional analog.

[0054] In the present invention, a "functional mutant" of a protein is a mutant that is produced by mutating one or more amino acids in its sequence and maintains its activity. In fact, if necessary, the proteins of the present invention can be modified in vitro and / or in vivo by, for example, glycosylation, myristoylation, amidation, carboxylation, or phosphorylation, and can be obtained, for example, by synthetic or recombinant techniques known in the art. The term "derivative" as used herein with respect to proteins means a chemically modified peptide or analogue thereof, where at least one substituent is not present in the unmodified peptide or analogue, i.e., the covalently modified peptide. Typical modifications include amides, carbohydrates, alkyl groups, acyl groups, esters, and the like. As used herein, the term “derivative” also means a longer or shorter polypeptide having at least 41%, preferably at least 41.5%, 50%, 54.9%, 60%, 61.2%, 64.1%, 65%, 70%, or 75%, more preferably at least 85%, even more preferably at least 90%, and even more preferably at least 95% identity with the genes and sequences disclosed herein, or the amino acid sequence of the corresponding region encoded by its orthologous gene or homologous gene. The term “analog” as used herein, when referring to a protein, means a modified peptide in which one or more amino acid residues of a peptide are substituted by other amino acid residues, and / or one or more amino acid residues are deleted from the peptide, and / or one or more amino acid residues are deleted from the peptide, and / or one or more amino acid residues are added to the peptide. Such additions or deletions of amino acid residues may occur at the N-terminus and / or C-terminus of the peptide.

[0055] A “derivative” may be a nucleic acid molecule as a DNA molecule encoding the polynucleotide described above, or a nucleic acid molecule containing the polynucleotide described above, or a polynucleotide of a complementary sequence. In the context of the present invention, the term “derivative” also refers to longer or shorter polynucleotides and / or polynucleotides having a percentage of identity of at least 41%, 50%, 60%, 65%, 70%, or 75%, more preferably at least 85%, and even more preferably at least 95% or 100%, for example, at least 90%. These include sequence numbers 1-12 or their complementary sequences, or sequences corresponding to their DNA or RNA. The terms “derivative” and “polynucleotide” also include modified synthetic oligonucleotides. Modified synthetic oligonucleotides are preferably LNA (locked nucleic acid), phosphorylated thiolated oligonucleotides or methylated oligonucleotides, morpholinose, 2'-O-methyl, 2'-O-methoxyethyl oligonucleotides, and cholesterol-conjugated 2'-O-methyl modified oligonucleotides (antagonists). The term “derivative” may also include nucleotide analogs, i.e., deoxyribonucleotides substituted with naturally occurring ribonucleotides or unnaturally occurring nucleotides. The term “derivative” may also include nucleic acids or polypeptides that can be produced by mutating one or more nucleotides or amino acids in their sequences, equivalents, or precursor sequences. The term “derivative” also includes at least one functional fragment of a polynucleotide. In the context of the present invention, “functional” means, for example, “maintaining their activity.” As used herein, “fragment” refers to a polynucleotide having a length of at least 200, 400, 600, 800, 1000, 1100, 1200, 1300, 1400, or 1500 nucleotides, or a polypeptide having a length of at least 50aa, 100aa, 150aa, 200aa, 250aa, or 300aa. The term “polynucleotide” also refers to a modified polynucleotide. As used herein, the term “vector” refers to an expression vector, which may be in the form of a plasmid, viral particle, phage, etc.Such vectors may include bacterial plasmids, phage DNA, baculoviruses, yeast plasmids, vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenoviruses, lentiviruses, avian pox viruses, and pseudorabies. Many suitable vectors are known to those skilled in the art and are commercially available.

[0056] A polynucleotide sequence, preferably a DNA sequence in the vector, is operably linked to a suitable expression regulatory sequence (promoter) to direct mRNA synthesis. Representative examples of such promoters include prokaryotic or eukaryotic promoters, such as CMV pre-initial, HSV thymidine kinase, early and late SV40, retroviral LTR, and mouse metallothionein-I. The expression vector may also include a ribosome binding site for translation initiation and a transcription vector. The vector may also include a suitable sequence for amplification of expression. In addition, the vector preferably includes one or more selection marker genes to provide a phenotypic trait for the selection of transformed host cells, such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or tetracycline or ampicillin resistance in E. coli. As used herein, the term “genetically engineered host cell” refers to a host cell transduced, transformed, or transfected with a polynucleotide or the aforementioned vector. Representative examples of suitable host cells include bacterial cells such as Escherichia coli, Streptomyces, and Salmonella tiphimurium; fungal cells such as yeast; insect cells such as Sf9; animal cells such as CHO or COS; and plant cells. The selection of a suitable host is considered to be within the scope of those skilled in the art from the teachings herein. Preferably, the host cell is an animal cell, and most preferably a human cell. The introduction of polynucleotides or the aforementioned vectors into host cells can be carried out by methods well known to those skilled in the art, such as calcium phosphate transfection, DEAE-dextran mediated transfection, electroporation, lipofection, microinjection, viral infection, heat shock, chemical permeabilization of the membrane, or transformation after cell fusion. The polynucleotide may be a vector, such as a viral vector.

[0057] The polynucleotides described above can be replicated within host cells and introduced into the body of a target to be processed as nucleic acids within a vector that produces polynucleotides. Suitable routes of administration of the pharmaceutical composition of the present invention include, but are not limited to, oral, rectal, transmucosal, intestinal, enteral, topical, suppository, inhalation (subarachnoid, intraventricular, intraperitoneal, intranasal, intraocular, parenteral (e.g., intravenous), intramuscular, intramedullary, and subcutaneous), and chemoembolization. Other suitable methods of administration include injection, viral transport, use of liposomes (e.g., cationic liposomes), oral ingestion, and / or transdermal application. In some embodiments, the pharmaceutical composition of the present invention is administered in the form of a dosage unit (e.g., tablet, capsule, bolus, etc.). For pharmaceutical applications, the composition may also be in the form of a solution, e.g., an injectable solution, emulsion, suspension, etc. The carrier can be any suitable pharmaceutical carrier. Preferably, a carrier that can enhance the potency of the molecule entering the target cell is used. A suitable example of such a carrier is a liposome. In the pharmaceutical compositions according to the present invention, the inhibitor or suppressant may be associated with other therapeutic agents. The pharmaceutical compositions may be selected based on therapeutic requirements. Such pharmaceutical compositions according to the present invention may be administered in the form of tablets, capsules, oral preparations, powders, granules, pills, injectable or injectable liquid solutions, suspensions, suppositories, or inhalation preparations. A reference for formulations is the book by Remington ("Remington: The Science and Practice of Pharmacy," Lippincott Williams & Wilkins, 2000). Experts in the art will select the dosage form and effective dose by selecting appropriate diluents, adjuvants, and / or excipients. The pharmaceutical compositions of the present invention may be manufactured by processes known in the art, for example, using various well-known mixing, dissolving, granulation, suspension, emulsification, encapsulation, encapsulation, or lyophilization processes.

[0058] The composition can be formulated with one or more physiologically acceptable carriers, including excipients and adjuvants that facilitate the processing of the active compound into a pharmaceutically usable preparation. The appropriate formulation depends on the selected route of administration. Parenteral routes are preferred in many embodiments of the present invention. For injection, including but not limited to intravenous, intramuscular, and subcutaneous injection, the compounds of the present invention can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as saline buffer or polar solvents, including but not limited to pyrrolidone or dimethyl sulfoxide. The compounds are preferably formulated for parenteral administration, for example, by bolus injection or continuous infusion. Useful compositions include suspensions, solutions, or emulsions in oily or aqueous vehicles, and may include, but are not limited to, adjuvants such as suspending agents, stabilizers, and / or dispersants. Pharmaceutical compositions for parenteral administration include, but are not limited to, aqueous solutions in water-soluble forms, such as salts of the active compound. Furthermore, suspensions of the active compound can be prepared in lipophilic vehicles. Suitable lipophilic vehicles include fatty oils such as sesame oil, synthetic fatty acid esters such as ethyl oleate and triglycerides, or materials such as liposomes. The aqueous injection suspension may contain substances that increase the viscosity of the suspension, such as sodium carboxyethylcellulose, sorbitol, or dextran. Optionally, the suspension may contain suitable stabilizers and / or reagents that increase the solubility of the compound to enable the preparation of high-concentration solutions.

[0059] Alternatively, the active ingredient may be in powder form for use with a suitable vehicle, such as sterile, pyrogen-free water. For oral administration, the compound can be formulated by combining the active compound with a pharmaceutically acceptable carrier known in the art, such a carrier that allows the compound of the present invention to be formulated for oral intake by a patient as tablets, pills, lozenges, sugar-coated tablets, capsules, liquids, gels, syrups, pastes, slurries, solutions, suspensions, concentrated solutions and suspensions for dilution in the patient's drinking water, premixtures for dilution in the patient's feed, etc. Useful excipients include fillers such as sugars containing lactose, sucrose, mannitol, or sorbitol, cellulose preparations such as corn starch, wheat starch, rice starch and potato starch, and other substances such as gelatin, tragacanth gum, methylcellulose, hydroxypropyl methylcellulose, carboxymethylcellulose sodium, and / or polyvinylpyrrolidone. For administration by inhalation, the molecules of the present invention can be conveniently delivered in the form of an aerosol spray using a pressurized pack or a sprayer and a suitable propellant. The molecules can also be formulated in rectal compositions such as suppositories or retaining enemas using conventional suppository bases such as cocoa butter or other glycerides. In addition to the formulations described above, the compounds can also be formulated as depot formulations. Such long-acting formulations can be administered by implantation (e.g., subcutaneous or intramuscular) or by intramuscular injection. For this route of administration, the compounds of the present invention can be formulated as suitable polymeric or hydrophobic materials (e.g., in emulsions with pharmaceutically acceptable oils), ion exchange resins, or sparingly soluble derivatives such as sparingly soluble salts. Furthermore, the compounds can be delivered using sustained-release systems such as a semipermeable matrix of a solid hydrophobic polymer containing the therapeutic agent. Various sustained-release substances are established and well known to those skilled in the art. A therapeutically effective amount refers to an amount of the compound effective in preventing, mitigating, or improving a protein conformational disorder. Determining the therapeutically effective dose is within the capabilities of those skilled in the art, particularly in light of the disclosures herein.Generally, the amount used in therapeutic methods is the amount that effectively achieves the desired therapeutic outcome in mammals. In particular, molecular administration should follow current clinical guidelines. Appropriate daily doses are in the range of 0.001 to 10 mg / kg body weight, especially 0.1 to 5 mg / kg. For polynucleotides, appropriate daily doses may be in the range of 0.001 pg / kg body weight to 10 mg / kg body weight. Typically, patient doses for parenteral administration of the molecules described herein range from about 1 mg / day to about 10,000 mg / day, more typically about 10 mg / day to about 1,000 mg / day, and most typically about 50 mg / day to about 500 mg / day. The above ranges are illustrative, and those skilled in the art will determine the optimal dose of the selected compound based on clinical experience and therapeutic indications.

[0060] As used herein, “oligonucleotide” or “polynucleotide” means single-stranded or double-stranded RNA or DNA containing ASOs, sgRNAs, and siRNAs that can bind to complementary single-stranded or double-stranded RNA or DNA target sequences. The sequence-specific portion of the therapeutic oligonucleotide, which is an ASO or sgRNA or siRNA of the present invention, comprises a nucleotide sequence of about 7 to about 45 bases in length. Further non-sequence-specific bases may be included in the oligonucleotide, for example, a linker sequence. “Sequence-specific” means a portion of the oligonucleotide that is complementary to the target RNA or DNA and / or directs the cleavage of the target RNA or DNA.

[0061] In this specification, "ASO" means a short stretch (approximately 7 to 45 sequence-specific nucleotides) of DNA or derivatized DNA (e.g., phosphorothioate-treated DNA) containing a sequence complementary to the target DNA or RNA. The complementary portion of the ASO will typically range from approximately 30% to 100% of the oligonucleotide.

[0062] As used herein, "siRNA" means an RNA double-stranded structure in which each strand is approximately 15 to 30 base pairs long and at least one of the strands shares at least approximately 90%, more preferably approximately 100%, homology with a DNA or RNA target.

[0063] In this specification, "gene expression" means mRNA synthesis or mRNA translation.

[0064] In one embodiment of the present invention, the therapeutic oligonucleotide of the present invention is an ASO. The ASO comprises a portion of a specific RNA sequence, or alternatively, a complementary gene sequence, and includes single-stranded DNA or RNA that reduces or inhibits gene expression. Non-limiting examples of ASOs include RNA sequences complementary to an mRNA transcript, thereby forming an RNA double helix and reducing the level of translation. Alternatively, the ASO may include a DNA sequence complementary to an mRNA transcript, which hybridizes with the mRNA transcript and acts as a substrate for RNaseH.

[0065] Antisense oligonucleotide technology is known in the art as a promising therapeutic source. Antisense oligonucleotides inhibit gene expression in a Watson-Crick base pairing manner between known nucleic acid sequences and their reverse complements (Jen, K., et al, Stem Cells, 18:307-19 (2000)). Antisense oligonucleotide therapy can be used to counteract a wide range of disorders, such as the expression of human genes involved in disease or disorder, or by targeting the replication of infectious agents (Tanaka, M., et al, Respir. Res., 2:5-9 (2000); Bunnell, BA, et al, Clin. Micro. Rev., 11:42-56 (1998)). Important considerations that must be addressed when designing antisense oligonucleotide therapies include in vivo antisense stability, effective delivery of antisense oligonucleotide therapies, and efficient intracellular localization of antisense oligonucleotides (Jen, K., et al, Stem Cells, 18:307-19 (2000)).

[0066] Depending on the target gene, ASOs that hybridize to any portion of the target gene, such as the coding region, intron, 5' untranslated region (5'UTR), translation start site, or 3'UTR, are well known to have therapeutic utility. Therefore, the sequences listed herein are merely examples of therapeutic oligonucleotides that may be used in conjunction with the present invention, encompassing all ASOs known in the art, and furthermore, all selective nucleic acid chemistry proposed in the art may be used in conjunction with the present invention, although the degree of efficacy may vary. The chemistry applicable to the therapeutic oligonucleotides of the present invention will be discussed in further detail in the section entitled “Conjugate Chemistry and Carrier Molecules” provided below. In short, the compounds listed herein represent a broad class of therapeutic oligonucleotides with various chemistry useful in the present invention. In one embodiment of the present invention, the sequence binding portion of the ASO and siRNA therapeutic oligonucleotide of the present invention is about 7 to about 45 nucleotides long. In a preferred embodiment of the present invention, the length of the sequence binding portion of the ASO and siRNA therapeutic oligonucleotide of the present invention is about 10 to about 30 nucleotides. In a particularly preferred embodiment of the present invention, the length of the sequence binding portion of the ASO and siRNA therapeutic oligonucleotides of the present invention is about 15 to about 25 nucleotides. Further oligonucleotides useful in the present invention include oligonucleotides that have previously demonstrated efficacy in free form in the art.

[0067] The therapeutic oligonucleotides of the present invention also include siRNA. siRNA is derived from RNA interference, a natural cellular process for silencing the transcription of specific genes (Sharp, PA, Genes & Dev., 15:485-490 (2001); Carmichael, GG, Nature, 418:379-380 (2002)). siRNA associates with cellular protein complexes, which then directly cleave complementary target RNAs.

[0068] In the present invention, the siRNA comprises a double-stranded RNA of about 15 to 30 nucleotides in length, wherein one strand of the double-stranded RNA preferably has at least about 90% homology to the RNA target, and more preferably up to about 100% homology to the RNA target. Alternatively, the siRNA shares sufficient homology with the RNA target to instruct the protein complex to cleave the complementary target RNA. The homology between two nucleotide sequences can be determined by those skilled in the art using a search-based computer program such as BLAST or FASTA. Alternatively, those skilled in the art can determine sequence homology using a sequence alignment program such as MegAlign (included in the DNASTAR suite of computer programs).

[0069] In a preferred embodiment of the present invention, the siRNA is modified with a chemically reactive group described below to enable the formation of a covalent bond with a mobile protein, preferably human serum albumin, and the modification of the siRNA double strand by the addition of the chemically reactive group occurs at the terminal. The chemical modification of the RNA double strand by the chemically reactive group can occur at any of the four terminals of the RNA double strand, either at the 5' or 3' end of either of the two RNA strands of the RNA double strand.

[0070] Preferably, the inhibitory nucleic acid comprises one or more peptide nucleic acid (PNA) or locked nucleic acid (LNA) molecules, or the inhibitory nucleic acid is a ribonucleic acid analog comprising a ribose ring having a bridge between its 2'-oxygen and 4'-carbon.

[0071] Preferably, the ribonucleic acid analog contains a methylene bridge between 2'-oxygen and 4'-carbon.

[0072] Preferably, at least one nucleotide of the inhibitory nucleic acid includes a modified sugar moiety selected from a 2'-O-methoxyethyl modified sugar moiety, a 2'-methoxy modified sugar moiety, a 2'-O-alkyl modified sugar moiety, and a dicyclic sugar moiety.

[0073] Preferably, the inhibitory nucleus comprises at least one modified nucleoside bond selected from phosphorothioates, phosphorodithioates, alkylphosphonothioates, phosphoramideates, carbamates, carbonates, phosphate triesters, acetamidates, carboxymethyl esters, and combinations thereof. The L1 subfamily includes HAL1, HAL1B, HAL1M8, IN25, L1, L1HS, L1M1 5, L1M1B 5, L1M2A 5, L1M3A 5, L1M3B 5, L1M3C 5, L1M3D 5, L1M3DE 5, L1M4B, L1M6 5end, L1M6B 5end, L1M7 5end, L1MA1, L1MA10, L1MA2, L1MA3, L1MA4, L1MA4A, L1MA5, L1MA5A, L1MA6, L1MA7, L1MA8, L1MA9, L1MB1, L1MB2, L1MB3, and L1MB3. 5, L1MB4, L1MA5A, L1MA6, L1MA7, L1MA8, L1MA9, L1MB1, L1MB2, L1MB3, L1MB3 5, L1MB4, L1MA5A, L1MA6, L1MA7, L1MA8, L1MA9, L1MB1, L1MB2, L1MB3, L1MB3 5, L1MB4, L1MA5A, L1MA6, L1MA7, L1MA8, L1MA9, L1MB1, L1MB2, L1MB3, L1MB3 5, L1MB4, L1MB5, L1MB6 5, L1MB7, L1MB8, L1MC1, L1MC2, L1MC4, L1MCB 5, L1MD1, L1MD2, L1MDB 5, L1ME Includes ORF2, L1ME1, L1ME2, L1ME3, L1ME3A, L1ME4A, L1MEA 5, L1MEC 5, L1MED 5, L1MEf 5end, L1PA10, L1PA11, L1PA12, L1PA12 5, L1PA13, L1PA13 5, L1PA14, L1PA15, L1PA16, L1PA2, L1PA3, L1PA4, L1PA5, L1PA6, L1PA7, L1PA8, L1PB1, L1PB2, L1PB2c, L1PB3, L1PB4, L1PREC1, L1PREC2.

[0074] (https: / / www.girinst.org / repbase / , Kenji K. Kojima, Human transposable elements in Repbase:genomic footprints from fish to humans,Mob DNA.2018;9:2).

[0075] In the context of the present invention, cancer or tumor may include any stage of cancer or tumor, such as lung cancer, preferably non-small cell lung cancer, colorectal cancer, intestinal tumor, or melanoma.

[0076] The present invention will be described by non-limiting embodiments with reference to the following drawings. [Examples]

[0077] Example 1 Materials and methods Human blood and tissue samples Blood from anonymous healthy donors was provided by Fondazione Istituto di Ricovero e Cura a Carattere Scientifico (IRCCS) Ca Granda Ospedale Maggiore Policlinico in Milan. The age and sex of the healthy donors were unknown (privacy). Peripheral blood from lymphangioleiomyomatosis (LAM) patients was obtained from Ospedale San Giuseppe-MultiMedica IRCCS in Milan. Peripheral blood from kidney transplant patients treated with everolimus was obtained from Fondazione IRCCS Ca Granda Ospedale Maggiore Policlinico in Milan. Colorectal cancer (CRC) and non-small cell lung cancer (NSCLC) specimens were provided by the European Institute of Oncology (IEO), and non-neoplastic specimens were obtained from normal adjacent tissue at least 10 cm away from the lesion. No patients had undergone palliative surgery or neoadjuvant chemotherapy and / or radiotherapy. The hospital's ethics committee approved the use of human samples for research purposes and obtained informed consent from all subjects.

[0078] T cell purification, sorting, and monocyte purification Human peripheral blood mononuclear cells (PBMCs) were purified from human blood samples by density gradient centrifugation using a Ficoll-Paque Plus. From the PBMCs, T cells were negatively selected using a magnetic separator (AutoMACS Pro Separator; Miltenyi Biotec) with either a Pan T cell isolation kit (Miltenyi Biotec) or a CD4+ T cell isolation kit (Miltenyi Biotec). T cells were stained with antibodies against surface markers, and T cell subsets were sorted by flow cytometry: naive CD4+ as CD4+CD25-CD127- / highCD45RO-, CD4+ Th1 cells as CD4+CD25-CD127- / highCD45RO+CXCR3+CCR6-, CD4+ Th2 cells as CD4+CD25-CD127- / highCD45RO+CRTH2+, and CD4+ Th17 cells as CD4+CD25-CD127- / highCD45RO+CCR6+CXCR3-; CD8+ as CD4-CD8+CD45RO-, and memory CD8+ as CD4-CD8+CD45RO+. To isolate tissue-infiltrating lymphocytes, tumor and normal adjacent tissues were washed several times and maintained overnight at 4°C in Roswell Park Memorial Institute (RPMI) 1640 supplemented with 400 g / mL gentamicin, 15 g / mL amphotericin, 500 U / mL penicillin, and 500 g / mL streptomycin. Next, the tissues were weighed, ground, and treated with 5 mL / g EDTA chelation buffer (5 mM EDTA, 1 mM DTT, and 67 g / mL DNase I in HBSS) for 20 minutes at 37°C. The tissues were then centrifuged at 500 g and room temperature, washed with Hanks equilibrium salt solution (HBSS) (Gibco), and digested with 5 mL / gr digestion solution (collagenase D diluted in HBSS and 67 g / mL DNase, with antibiotics added) at 37°C for 3 hours with stirring. The released cells were passed through a 70M strainer, washed twice with HBSS at 500g and 4°C for 10 minutes, and stratified through a Percoll gradient (100%-60%-40%-30%) at 400g for 30 minutes. T cells were harvested from the interface between the 60% to 40% Percoll layers and stained with antibodies for surface markers.Next, T cell subsets were selected by flow cytometry: memory CD4+CD45+CD3+CD4+CD25-CD127- / highCD45RO+, and memory CD8+ was identified as CD45+CD3+CD8+CD45RO+. The following antibodies were used for sorting based on flow cytometry: anti-CD4-APCCy7 (BD Biosciences; clone: ​​RPA-T4) or anti-CD4-VioGreen (Miltenyi Biotec; clone: ​​VIT4); anti-CD8-VioGreen (Miltenyi Biotec; clone: ​​REA-734) or anti-CD8-VioBlue (Miltenyi Biotec; clone: ​​REA734); anti-CD25-PECy7 (Invitrogen by Life Technologies; clone: ​​BC96); anti-CD127-PECy5 (BioLegend; clone: ​​A019D5) or anti-CD127-PE (Miltenyi Biotec; clone: ​​MB15-18C9); anti-CD45RO-BV605 (BioLegend; clone: ​​UCHL1) or anti-CD45RO-APC (Miltenyi Biotec; clone: ​​UCHL1); anti-CD3-PE (BD Biosciences; clone: ​​UCHT1); anti-CD45-Pacific Blue (BioLegend; clone 2D1); anti-CD183-PECy5 (BD Biosciences; clone: ​​1C6 / CXCR3); anti-CD294 (CRTH2)-APC-Vio770 (Miltenyi Biotec; clone: ​​REA598); anti-CCR6-FITC (BioLegend; clone: ​​G034E3). Cell sorting was performed using FACSAria III (BD Bioscience). The purity of the sorted cells was >97.5%. Monocytes were isolated from PBMCs by positive selection using a magnetic separator (AutoMACS Pro Separator; Miltenyi Biotec) with CD14μ beads (Miltenyi Biotec).

[0079] In vitro differentiation of CD4+ and CD8+ T cells 1,5 × 10⁻¹⁶ quiescent naive CD4+ T cells 6Cells were cultured on plates at / mL and stimulated with Dynabeads human T-activator anti-CD3 / anti-CD28 beads (Gibco; catalog number 1131D). They were then cultured for several hours (activated naive CD4+ T cells) or several days (effector CD4+ T cells) in a T helper medium appropriate for differentiation. The T helper medium for differentiation consisted of a complete medium made of RPMI 1640 supplemented with 10% (v / v) fetal bovine serum (FBS) (Gibco), 1% (v / v) non-essential amino acids, 1 mM sodium pyruvate, 50 U / mL penicillin, 50 g / mL streptomycin, and GlutaMAX-I (Gibco) supplemented with T helper-specific cytokines. Th1 cytokines: 20 IU / mL recombinant IL-2 (catalog number 130-097-744), 10 ng / mL recombinant IL-12 (catalog number 130-0976-704), 2 g / mL neutralizing anti-IL-4 (catalog number 130-095-753). Th2 cytokines: 100 IU / mL recombinant IL-2, 10 ng / mL recombinant IL-4 (catalog number 130-093-919), 2 g / mL neutralizing anti-IL-12 (catalog number 130-095-755), anti-IFN- (catalog number 130-095-743). Th17 cytokines: 10 ng / mL recombinant IL-1b (catalog number 130-095-374), 10 ng / mL IL-6 (catalog number 130-095-365), and 10 ng / mL IL-23 (130-095-757), 1 ng / mL recombinant TGF-1 (catalog number 130-108-971), 2 g / mL neutralizing anti-IL-12, anti-IL-4, anti-IFN- (Miltenyi Biotec). 1.5 × 10⁶ quiescent naive CD8+ T cells. 6 Cells were cultured on plates at 1 / mL, stimulated with DynaBeads human T activator anti-CD3 / anti-CD28 beads, and cultured for several days in complete medium supplemented with 20 IU / mL recombinant IL-2 (effector CD8+ T cells). Cells were maintained at 37°C in a 5% CO2 humidified incubator, counted, and divided every 2-3 days.

[0080] Dysfunctional CD4+ and CD8+ T cells in vitro Dysfunctional, chronically stimulated CD4+ and CD8+ T cells were generated with minor modifications, as described in 66. Briefly, naive CD4+ T cells were activated and differentiated into the Th1 phenotype, while naive CD8+ T cells were activated in complete medium supplemented with 20 IU / mL recombinant IL-2, with T cells counted every two days and exposed to stimulating anti-CD3 / anti-CD28 beads. For the dysfunctional, chronically stimulated T cells, T cell effector properties were tested, assessed by decreased proliferation, increased PD-1 markers, and intracellular staining of lineage-specific cytokines. Immunomodulatory CD4+ T cells were generated, as described in 67. Briefly, naive CD4+ T cells activated to differentiate into Th1 for four days were cultured in 50 ng / mL TGF for 24–72 hours. Effector properties of immunomodulatory T cells were tested by intracellular staining of lineage-specific cytokines.

[0081] T cell therapy Quiescent naive CD4+ T cells were treated with actinomycin D 5 g / mL (Merck; catalog no. A9415) for 16 hours.68 TCR signaling pathway inhibition was performed using the following immunomodulatory agents: rapamycin (100 nM; Merck; catalog no. R8781) for mTORC1, cyclosporine A (0.5 g / mL; Merck; catalog no. C3662) for the calcineurin pathway, and dexamethasone (1 M; Merck: catalog no. D4902) for the NF-B pathway. Quiescent naive CD4+ T cells were pretreated with the described drugs in excess for 2 hours, then stimulated with Dynabeads human T activator anti-CD3 / anti-CD28 beads in Th1 medium in the presence of different inhibitors, and T cells were collected 2, 4, and 8 hours after activation. Otherwise, activated naive CD4+ T cells cultured in Th1 medium for 72 hours were treated with the drugs for 48 hours. The vitality of the treated cells was controlled, and the therapeutic effect was evaluated.

[0082] Knockdown experiment Knockdown experiments were performed using FANA (2'-deoxy-2'-fluoro--D-arabino nucleic acid, https: / / www.aumbiotech.com) antisense oligonucleotides (ASOs). For GTF2F1, four ASOs were used for nucleolin, MATR3, and PTBP1 mRNA, while two FANA-ASOs were used for IRF4 mRNA. For LINE1 RNA, five ASOs were designed on the ORF2 region of the LINE1 consensus sequence, while for HIRA.L1 or RAB22A.L1, three ASOs were designed on unique and specific sequence regions of the LINE1 transcript. Irrelevant scrambled (Scr) ASOs were used as controls. ASO was mixed in equimolar ratios and administered without transfection reagent (by hand) to a final concentration of 10 M according to the manufacturer's instructions. Quiescent naive CD4+ T cells isolated from healthy donors were cultured for 48 hours in complete medium supplemented with 200 IU / mL recombinant IL-2 and 10 M ASO; naive CD4+ treated with ASO were activated with anti-CD3 / anti-CD28 beads in Th1 medium, and T cells were collected after 16 hours (activated CD4+) or 7 days (effector CD4+) in the presence of 10 M ASO. Chronically stimulated CD4+ T cells were treated with 10 M ASO from day 2 and collected on day 9 for subsequent analysis for LINE1 knockdown; otherwise, they were treated for 48 hours from day 6 for IRF4 knockdown. Memory CD4+ and CD8+ T cells isolated from tumor samples were cultured for 48 hours in complete medium supplemented with 200 IU / mL recombinant IL-2 and 10M ASO. After 48 hours of ASO treatment, cells subjected to surface marker staining and T cell elimination were alternatively activated for a further 48 hours and subjected to intracellular cytokine staining. Knockdown efficiency was controlled by RT-qPCR and / or RNA-FISH, as well as Western blotting or FACS analysis (described below).

[0083] T cell surface, intracellular staining, and proliferation assays Surface marker staining was performed in phosphate-buffered saline (PBS) with 5 × 10⁻¹⁴ samples per 1 L of antibody. 4Cells were incubated at 37°C for 30 minutes. T cells were washed in PBS and then analyzed. The following antibodies were used: anti-CD279(PD-1)-Alexa Fluor 488 (BioLegend; clone: ​​EH12.2H7), anti-CD366(TIM3-1)-BV650 (BioLegend; clone: ​​F38-2E2), and anti-CD223(LAG-3)-BV785 (BioLegend; clone: ​​11C3C65). Intracellular cytokine and transcription factor staining 5 × 10⁶ 4 T cells were stimulated with 50 ng / mL phorbol 12-myristate 13-acetate (PMA) and 0.5 g / mL ionomycin at 37°C for 2 hours. Subsequently, 100 g / mL brefelzin A (Merck) was added at 37°C for a further 2 hours. The cells were washed and fixed according to the manufacturer's instructions, and then permeabilized at 4°C for 30 minutes using a Foxp3 transcription factor fixation / permeabilization kit (Invitrogen by Life Technologies). Cytokines and transcription factors were diluted in osmotic buffer (Invitrogen by Life Technologies) in 5 × 10⁶ solutions. 4 Cells were stained by incubating 1 L of antibody at room temperature for 20 minutes. T cells were washed in PBS and then analyzed. Antibodies used for intracellular staining were anti-IFN-V450 (clone: ​​B27), anti-GrzB-FITC (clone: ​​GB11), anti-PerfA-APC (clone: ​​δG9), anti-PerfA-PE (clone: ​​δG9), and anti-T-bet-V450 (clone: ​​O4-46) (BD Biosciences). For MATR3, PTPB1 and IRF4 FACS-stained T cells were fixed at 4°C for 30 minutes as described above, then osmoticated, and the cells were then diluted in osmotic buffer (Invitrogen by Life Technologies) to 5 × 10⁶ cells. 4Cells were incubated with 1 L of primary antibody at room temperature for 1 hour. T cells were washed in PBS and stained with secondary antibody at room temperature for 30 minutes. T cells were washed in PBS and then analyzed. The following primary antibodies were used: anti-MATR3 (Abcam catalog number Ab151714), anti-PTBP1 (Abcam catalog number Ab133734), and anti-IRF4 (BioLegend catalog number 646412). The following secondary antibodies were used: goat anti-rabbit Alexa Fluor 488 (Invitrogen LifeTechnologies) and goat anti-rat Alexa Fluor 647 (Invitrogen LifeTechnologies). A proliferation assay in chronically stimulated cells was performed using cell traces (C34557), naive CD4+ and CD8+ T cells in phosphate-buffered saline (PBS) at a rate of 1 × 10⁶ cells. 6 The cells were incubated with 1 L of cell trace at 37°C for 20 minutes. The cells were then washed with 10% FBS at 37°C for 5 minutes to activate them as described above, and proliferation was assessed 7 days after activation. For all analyses above, an average of 10 4 Individual cells were acquired using FACSCanto I (BD Biosciences), and the data was analyzed using FlowJo v.10 software.

[0084] Death assay Dysfunctional, chronically stimulated effector CD4+ and CD8+ T cells treated with ASO were co-cultured with xenomonocytes in a 1:1 ratio for 12 hours. CD4+ and CD8+ memory T cells infiltrating NSCLC or CRC treated with FANA-ASO for 48 hours were co-cultured with xenomonocytes in a 1:1 ratio for 12 hours. After co-culture, cells were stained with LIVE / DEAD fixed green dead cell staining kit (Invitrogen by Life Technologies; catalog number L34969) for 20 minutes at RT, washed in PBS, and stained with CD14-APC (clone: ​​M5E2) to identify monocytes. Monocytes were identified as CD14-positive, and their viability was evaluated as a percentage of dead monocytes. Mean 10 4Individual cells were acquired using FACSCanto I (BD Biosciences), and the data was analyzed using FlowJo v.10 software.

[0085] RNA isolation and qRT-PCR Total RNA was isolated using the RNeasy Mini kit (QIAGEN) + QIAshredder (QIAGEN) according to the manufacturer's instructions. During extraction, DNase was performed using the RNase-free DNase set (QIAGEN). Total RNA was reverse transcribed using the SuperScript III First-Strand Synthesis SuperMix kit (Invitrogen by Life Technologies) according to the manufacturer's instructions. Real-time quantitative PCR was performed using the StepOnePlus real-time PCR system (Applied Biosystem by Life Technologies) with Power SYBR Green PCR Master Mix (Applied Biosystem by Life Technologies). All gene expression data were normalized to two independent housekeeping genes (18S,GAPDH). Normalized Ct values ​​were calculated as 2-dCT or 2-ddCt. For actinomycin D treatment, spike-in D.Malanogaster RNA was used for normalization.

[0086] RNA-FISH and RNA-FISH + Immunofluorescence RNA-FISH and combo RNA-FISH-immunofluorescence were performed similarly.69 Briefly, antisense biotinylated riboprobes for LINE1, AluY, and HERVK were transcribed in vitro using the MAXIscript T7 transcription kit (Invitrogen) and biotinylated RNA labeling mixture (Roche). 50–100 ng of antisense biotinylated riboprobe was used per experiment. 3% paraformaldehyde (PFA) fixed T cells were washed with 0.05% Triton-X-100 in PBS, permeabilized with 0.5% Triton-X-100 in PBS, and maintained in 20% glycerol / PBS. Cells were frozen, thawed with dry ice, and deproteinized with 0.1 M HCl. T cells were hybridized with riboprobe at 52.5°C for 3.5 minutes and incubated overnight at 37°C in a water bath. Glass was washed with 50% formamide in 2×SSC, 2×SSC, 1×SSC, and 4×SSC / 0.2% Tween-20. T cells were blocked in BSA and then incubated with streptavidin HRP (1:1000; Perkin Elmer by Akoya Biosciences) diluted in TNT / BSA (0.1M TrisHCl pH8, 0.150M NaCl, 0.1% NP-40, 4% BSA in DEPC). T cells were washed four times with TNT, and the signals were incubated in TSA working solution (1:150) for 3 minutes in 1x amplification buffer (TSA Plus Fluorescent kit Cy3.5 (Perkin Elmer)). T cells were washed four times with TNT, and the nuclei were counterstained with 1 g / mL 4,6-diamidino-2-phenylindole (DAPI). Glass was mounted on an anti-fade extended diamond mount. When RNA-FISH was conjugated with immunofluorescence, T cells were incubated overnight at 4°C in 2% BSA / 10% goat serum / 0.1% Tween / PBS with antibodies against H3K4me3 (1:250, Millipore 07-473), H3K36me3 (1:250, Abcam, catalog number 9050), and H3K9me3 (1:500, Abcam, catalog number Ab8898). Secondary antibodies conjugated with Alexa Fluor 647 were used.Images were obtained with a Leica TCS SP5 confocal microscope equipped with an HCX PL APO 63x / 1.40-NA-oil immersion objective lens, in a 0.3m Z-stack at an arbitrarily selected field.

[0087] Quantification of RNA FISH signal To quantify the average fluorescence intensity of RNA signals in 3D reconstituted nuclei, images were analyzed using NIS-Elements Software (Nikon). In the "General Analysis," a mask for DAPI signals was generated to identify single nuclei, and then "3D Measurement" of RNA signals in each nucleus was performed. To measure the colocalization of RNA and histone mark signals, Pearson correlation was controlled for each nucleus using a command called "Collocation Threshold" in ImageJ Software.

[0088] Single molecule RNA FISH (smRNA FISH) and relative quantification on LINE1 transcripts Single-molecule RNA FISH (smRNA-FISH) was performed using HuluFISH technology. Antisense riboprobes were designed by PixelBio on specific and unique regions of the HIRA.L1 or RAB22A.L1 LINE1 transcripts, and were synthesized by directly labeling them with ATTO-568 for RAB22A.L1 and ATTO-647 for HIRA.L1. Quiescent naive, 8-hour activated CD4+ T cells, or naive CD4+ T cells with HIRA.L1 or RAB22A.L1 transcript knockdown were seeded on polysynthesized glass, fixed in 4% PFA, washed with 135 mM glycine, and held overnight in 70% EtOH. The T cells were then rinsed in 20% glycerol for 1 hour and then treated with 0.025% pepsin in 0.01N HCl for 3.5 minutes. Next, T cells were hybridized with probes diluted 1:40 in 20% formamide / 2X SSC / 10% dextran sulfate, and RAB22A.L1 was hybridized with 10% formamide / 2X SSC / 10% dextran sulfate. These were incubated overnight in a water bath at 37°C with the riboprobes. The glass was washed in 10% formamide / 2X SSC for 5 minutes for the HIRA.L1 probe and 20% formamide / 2X SSC, and in 2X SSC for 5 minutes for the RAB22A.L1 probe. The nuclei were counterstained with 1 g / mL 4,6-diamidino-2-phenylindole (DAPI). The glass was mounted on an anti-fade long-term glass mounting medium. The inventors examined smRNA FISH on an Eclipse Ti-E (Nikon Instruments) plan Apoλ objective microscope 100x oil (Nikon). 0.3 Z-stacks were collected from randomly selected irradiation fields, a minimum of 90 cells per individual were analyzed, and the number of dots per cell was counted by a person blinded to the experimental sample.

[0089] TSA RNA FISH combined with DNA FISH TSA RNA FISH combined with DNA FISH protocols was applied from 70, and from 69 and 71. Antisense TEG-biotinylated oligonucleotides for HIRA.L1 or RAB22A.L1 were synthesized by Eurofins Genomics, and smRNA FISH probes of the same sequence were used. Quiet naive cd4+ T cells were fixed in 4% PFA, washed with 0.05% Triton-X-100 in PBS, permeabilized with 0.5% Triton-X-100 in PBS, and maintained overnight in 20% glycerol / PBS. Cells were frozen, thawed with dry ice, and deproteinized with 0.025% pepsin in 0.1M HCl and 0.01N HCl. T cells were hybridized with RAB22A.L1 and 1-6 ng of biotin probe suspended in 10% formamide / 2×SSC / 10% dextran sulfate, and incubated overnight in a water bath at 37°C. Glass was washed with 50% formamide in 2×SSC, blocked with TBN / BSA (0.1M TrisHCl pH8, 150mM NaCl, 4% BSA in DEPC), and then incubated with streptavidin HRP (1:10000; Perkin Elmer by Akoya Biosciences) diluted in TNT / BSA (100mM TrisHCl pH8, 150mM NaCl, 0.2% Tween-20, 4% BSA in DEPC). T cells were washed three times with TNT and incubated with TSA action solution (1:300) in 1x amplification buffer (TSA Plus Fluorescent kit Cy3.5 (Perkin Elmer)) for 5 minutes. T cells were washed three times with TNT, fixed with 4% PFA for 2 minutes, and then maintained in 50% formamide / 2XSSC for at least 10 hours. DNA probes for HIRA or RAB22A were prepared by BAC nick translation (HIRA:RP11-1057H19; RAB22A:RP11-452017, BACPAC Chori) and labeled with digoxigenin-11-dUTP as reported.69 T cells were hybridized at 75°C for 5 minutes and incubated overnight at 37°C in a water bath. Glass was washed with 2×SSC and 0.1×SSC and rinsed with 4×SSC / 0.2% Tween-20.T cells were blocked in BSA and then incubated with anti-digoxigenin-488 (1:150; Vector Laboratories DI-7488) diluted in 4×SSC / 0.2%Tween-20 / 4%BSA. The T cells were washed three times in 4×SSC / 0.2%Tween-20, and the nuclei were counterstained with 1 g / mL 4,6-diamidino-2-phenylindole (DAPI). Glass was mounted on anti-fade long glass mounts. TSA RNA FISH combined with DNA FISH was examined in 0.3 m Z stacks in randomly selected fields on an Eclipse Ti-E (Nikon Instruments) Plan Apo λ objective microscope (Nikon).

[0090] CRISPR-Cas9-mediated deletion of the LINE1 element in quiescent naive CD4+ T cells For LINE1 element genome deletion, two different sgRNAs targeting adjacent sites of repeat elements were used; therefore, two sgRNAs were designed for each target sequence, i.e., LINE1 contained in ARCP2.L1 and IFNGR2.L1. The inventors nucleofected Cas9-sgRNA ribonucleoprotein complexes in quiescent naive CD4+ T cells. For each sgRNA, Cas9-sgRNA complexes were prepared in a 1:3 ratio by gently mixing with 40M Alt-R Sp. HiFi Cas9 Nuclease V3 (IDT, catalog no. 1081061) and 120M sgRNA (Merck) complexes were formed at 37°C for 15 minutes, and the Cas9-sgRNA complexes were resuspended in 20L of primary cell fusion solution (P3 primary cells 4D Nucleofector X kit S, Lonza) in a 1×10⁶ solution. 6In addition to naive CD4+ T cells, quiescent naive CD4+ T cells were pre-selected and cultured for 24 hours in complete medium supplemented with 200 IU / mL recombinant IL-2. Cas9-sgRNA complexes and naive CD4+ T cells were transferred to Nucleofection cuvette strips (P3 primary cells, 4D Nucleofector X kit S, Lonza, catalog number LOV4XP3032), and electroporation was performed using a 4D Nucleofector (4D Nucleofector, Lonza) with the EH115 pulse program. After nuclear fusion, the cells were resuspended in complete medium supplemented with 200 IU / mL recombinant IL-2 and cultured for 4 days at 37°C in a 5% CO2 humidified incubator. Deletions were evaluated by PCR and on genomic DNA purified from nuclear-fected naive CD4+ T cells using GoTaq G2 Flexi DNA polymerase. Primers were designed to be positioned before and after the sgRNA locations on IFNGR2.L1 and ARCP2.L1. The PCR products were similarly subjected to TA cloning and Sanger sequencing.72

[0091] Protein extraction and Western blot analysis The histone extraction protocol and subsequent Western blot analysis were performed similarly.73 In short, 1.5 × 10⁻⁶ 6 T cells were lysed in cytoplasmic extraction buffer (10 mM HEPES KOH pH 8, 10 mM KCl, 1 mM MgCl2, 0.1 mM EDTA, 0.1 mM DTT, 1 × protease inhibitor), nuclei were collected at 1500 g and 4°C, washed three times with equal volumes of cytoplasmic extraction buffer, and resuspended overnight in 0.2 N HCl on a wheel at 4°C. Histone extracts were collected by centrifugation at 16300 g for 10 minutes at 4°C, and nuclear protein extraction was performed as described on page 73. Briefly, 1 × 10 6T cells were lysed in cytoplasmic extraction buffer (10 mM HEPES KOH pH 8, 1.5 mM MgCl2, 10 mM NaCl, 1 mM DTT, 10 mM DTT, 10% glycerol, 1× protease inhibitor), and the nuclei were collected at 1200 g and 4°C. The nuclei were washed three times with the same volume of cytoplasmic extraction buffer and resuspended in nuclear buffer (10 mM HEPES KOH pH 8, 1.5 mM MgCl2, 300 mM NaCl, 1 mM DTT, 0.2% NP-40, 10% glycerol, 1× protease inhibitor) supplemented with 2 mM CaCl2 and 20 MU Nase, and held at 37°C for 30 minutes. Total protein extraction was performed as described on page 68. Protein extracts were quantified using a Qubit (Invitrogen) fluorometer and used for subsequent Western blot analysis. For Western blotting, 1-5 g of histone extract was used, and for Western blotting, 20-40 g of nuclear extract or whole extract was used. Proteins were separated on 4-12% volt bis-tris gel (Invitrogen) and transferred to a nitrocellulose membrane by wet transfer. The membrane was blocked, and the samples were incubated overnight at 4°C with the following primary antibodies: H3K4me3 (Millipore, catalog number 07-473), H3K9me3 (Abcam, catalog number Ab8898), H3K36me3 (Abcam, catalog number Ab9050), H3K27me3 (Millipore, catalog number 07-449), H3 (Abcam, catalog number Ab1791), anti-rpS6 (Cell Signaling, catalog number D68F8), anti-nucleolin (Abcam, catalog number Ab22758), anti-PTBP1 (Abcam, catalog number Ab133734), anti-KAP1 (Abcam, catalog number Ab22353), anti-IRF4 (Abcam, catalog number Ab), and anti-tubulin (Abcam, catalog number Ab6046). The membranes were treated with a suitable secondary antibody conjugated to HRP and detected by chemiluminescence using the West Dura kit (Pierce Rockford, USA). The membranes were detected using a photosensitive CCD (charge-coupled device) camera (Las 3000) with a linear response to luminescence.Protein band density was measured using ImageJ software with the "Analyze-Gel-Select lane-Plot lane" command. Results were normalized to an internally loaded control (H3) and expressed as a doubling compared to the control.

[0092] Co-Immunoprecipitation (Co-IP) Co-IP assays were performed on nuclear extracts with minor modifications, as described in 73. CD4+ T cell pellets were resuspended in cytoplasmic extraction buffer (10 mM HEPES, 5 mM MgCl2, 0.25 mM sucrose, 0.1% NP-40, 1x protease inhibitor), incubated on ice for 5 minutes, and nuclei were collected at 300 g for 10 minutes. The cells were then resuspended in nuclear extraction lysis buffer (10 mM HEPES, 1 mM MgCl2, 0.1 mM EDTA, 300 mM NaCl, 0.5% Triton X-100, 25% glycerol, 1x protease inhibitor). Next, the nuclear suspension was sonicated (using a BRANSON A250 with a 3.2 mm tapered microtip for 1 minute at 20% amplitude and 30% duty cycle per cycle), and the nuclear extract was collected by centrifugation at 16300 g for 10 minutes at 4°C. The proteins were pretreated with Dynabeads Protein A / G and quantified using a Qubit (Invitrogen) fluorometer for subsequent Co-IP analysis. Immunoprecipitation was performed on the nuclear extract by incubating 600 g of protein overnight on a rotating wheel at 4°C with 4 g of antibody anti-nucleolin (Abcam, catalog no. Ab22758) and 8 g of anti-KAP1 (Abcam, catalog no. 22353). The immunocomplexes were collected on a wheel at 4°C for 2 hours using magnetic Dynabeads Protein A / G (Invitrogen). The beads were washed once with 600 μL of low-salt buffer (10 mM HEPES, 1 mM MgCl2, 0.1 mM EDTA, 150 mM NaCl, 0.1% Triton X-100, 5% glycerol), then again with high-salt buffer (10 mM HEPES, 1 mM MgCl2, 0.1 mM EDTA, 300 mM NaCl, 0.1% Triton X-100, 5% glycerol), and finally with the low-salt buffer. The samples were eluted with Elution Buffer (5% SDS, 1x Loading Buffer, 10 mM DTT) and used for Western blot analysis.

[0093] RNA immunoprecipitation (RIP) Quiescent and 16-hour activated naive CD4+ T cells were crosslinked in 1% formaldehyde. The crosslinked cells were lysed in nuclear isolation buffer (10 mM Tris-HCl pH 7.5, 5 mM MgCl2, 320 mM sucrose, 1% Triton X-100), homogenized with Dawn, and kept on ice for 10 minutes. The nuclei were centrifuged at 2500 g for 15 minutes, resuspended in RIP buffer (25 mM Tris-HCl pH 7.4, 150 mM KCl, 5 mM EDTA, 0.5 mM DTT, 0.5% NP-40, 0.5% SDS, 100 U / mL RNAse inhibitor), and sheared (BRANSON A250, 3.2 mm tapered microtip; 1 cycle of 1 minute at 20% amplitude, 30% of duty cycle). The nuclear extract was collected by centrifugation at 16300g for 10 minutes at 4°C. 1-3 × 10 6 Nucleic extracts equivalent to one cell were incubated overnight at 4°C on a rotating wheel with 4 g of anti-nucleolin (Abcam, catalog no. Ab22758), 8 g of anti-PTBP1 (Abcam, catalog no. Ab133734), and anti-GTF2F1 (Abcam, catalog no. Ab28179). The immunocomplexes were collected on the wheel at 4°C for 2 hours using magnetic Dynabeads protein A / G (Invitrogen). The beads were washed three times with 600 μL of RIP buffer and once with PBS. Re-crosslinking was performed by incubating the immunocomplexes in NT2 buffer (50 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM MgCl2, 0.05% NP-40, 1% SDS, 1.2 mg / mL proteinase K) at 55°C for 2 hours. RNA was purified using TRI-Reagent, and DNA extraction was performed using a Turbo DNA-free kit (Invitrogen).

[0094] Chromatin and nuclear RNA extraction Cell fractionation was performed as described in 74, with minor modifications. Briefly, 5-10 × 10¹⁶ quiescent naive CD4+ T cells were used. 6The T cells were resuspended in 60 L of Buffer A (10 mM HEPES pH 7.5, 10 mM KCl, 10% (v / v) glycerol, 340 mM sucrose, 4 mM MgCl2, 1 mM DTT, 1X protease inhibitor cocktail (PIC)), an equal volume of Buffer A 0.2% (v / v) Triton X-100 was added, and the T cells were lysed on ice for 12 minutes. The T cells were centrifuged at 1200 g at 4°C for 5 minutes, and the supernatant representing the cytoplasmic RNA fraction was collected. The nuclear pellet was washed at 900 g in 120 L of NRB buffer (20 mM HEPES pH 7.5, 50% (v / v) glycerol, 75 mM NaCl, 1 mM DTT, 1 × PIC) at 4°C for 5 minutes, resuspended in 60 L of NRB buffer, and an equal volume of NRB buffer (20 mM HEPES pH 7.5, 300 mM NaCl, 1 M Urea, 1% (v / v) NP-40, 1 mM MgCl2, 1 mM DTT) was added. The mixture was dissolved on ice for 5 minutes. The lysate was centrifuged at 1200 g at 4°C for 5 minutes, and the supernatant representing the nucleoplasmic RNA fraction was collected. The chromatin pellet was washed at 1200 g in 500 L of buffer A at 4°C for 5 minutes, and then the pellet was resuspended in 50 L of buffer A representing the chromatin RNA fraction. Total, nucleoplasmic, and chromatin-associated RNAs were extracted using the Maxwell RSC miRNA Tissue Kit (Promega, catalog number AS1460) with slight adjustments according to the manufacturer's instructions.

[0095] RNA library preparation and sequencing RNA integrity was checked using TapeStation (High Sensitivity RNA Screentape assay), and libraries were prepared using 15-75 ng of total RNA. Following the manufacturer's instructions, RNA was ribopurified with RiboGone-Mammalian (TaKaRa, catalog number 634846), and libraries were prepared using the SMARTer Stranded RNA-Seq Kit (TaKaRa, catalog number 634836) according to the manufacturer's instructions. Libraries were sequenced as 100 or 150 bp pairs on Illumina NextSeq 500. RNA-seq libraries were prepared for i) chromatin and nucleoplasmic RNA from resting CD4+ naive T cells (4 individuals); ii) total RNA from resting and activated naive CD4+ T cells; and activated naive CD4+ T cells (3 individuals) using anti-CD3 / anti-CD28 beads in Th1 medium.

[0096] RNA-seq dataset processing and alignment Sequenced and publicly available RNA-seq samples were uniformly processed and aligned. CD8+ naive (GSM3591829, GSM3591834) and activated (GSM3591826, GSM3591831) T cells were recovered from mouse embryonic stem cells from Bediaga et al., ENCODE Project Consortium (GSM2400249, GSM24002550), and thymocyte samples from Buratin et al. (GSM4222226, GSM4222227, GSM4222228, GSM4222229, GSM4222230). In particular, these datasets were precisely selected to be equivalent to the datasets created in the current study, i.e., total RNA extraction and library preparation, and the read lengths of the analyzed libraries. The read quality of Fastq files was checked using FastQC v0.11.3. Using the BBDuk algorithm from BBMAP v38.51, adapters were removed from the read pairs (ktrim=rk=23 mink=11 hdist=1 tpe tbo), rRNA-derived reads matching the deposited human ribosomal RNA sequence (k=31 hdist=1) were discarded (NCBI commission: U13369.1), and low-quality bases were trimmed from the read pairs. Quality-passing read pairs were used for alignment with STAR v2.5.4a (--outFilterScoreMinOverLread 0.3--outFilterMatchNminOverLread 0.3--outFilterMatchNmin 0--outFilterMismatchNmax 10--winAnchorMultimapNmax 200 --outFilterMultimapNmax 200) on an hg38 assembly of a human reference genome or an mm10 assembly of a mouse reference genome, using annotations from GENCODE version 25 human or GENCODE version M21 mouse GTF files that function as splice junction databases.

[0097] Principal component analysis (PCA) PCA analysis was performed on a comprehensive set of transcription units consisting of 50,596 genes derived from GENCODE version 25 and 1180 repeat subfamilies from UCSC Repeat Masker (hg38) on the human genome. Gene count data was created from aligned reads using HTSeq v0.12.4 (htseq-count-yes -nonupenique-all), and the number of subfamilies per repeat subfamily was calculated as follows (see the subheading "Quantification of TE subfamily expression in RNA-seq datasets"). PCA was performed using DESeq2 for distributed-stabilized transformation (vst). PCA plots were created using the R package ggbiplot version 0.55.

[0098] Quantification of TE subfamily expression in RNA-seq datasets Transposition factors were quantified at the class (n=8), superfamily (n=112), and subfamily (n=1180) levels of the human genome annotated with UCSC RepeatMasker (hg38). Reads were crossed with UCSC RepeatMasker annotations using a crossover bed from BedTools 2.29.2 (using the "-split" parameter), and counting was performed using reads with at least 10 bp overlap with the repeat in a strand-specific manner. To mitigate the influence of multi-mapping reads on the count, reads overlapping multiple repeat loci of the same subfamily were counted at once, and the same was done at the superfamily and class levels. Furthermore, read pairs were counted as single units. This allowed for unbiased counting of long and short repeat regions. Normalized read counts were calculated using DESeq2 for all classes, superfamilies, and subfamilies.

[0099] De Novo Reconstruction of De Novo LINE1 Containing Transcripts A comprehensive catalog of LINE1 containing transcripts in the quiescent naive CD4+ T cell chromatin compartment was constructed by combining two different approaches for de novo transcript assembly. Briefly, chromatin RNA-seq reads mapped to appropriate pairs (sam flags 99, 147, 83, and 163) from four biological replicas were pooled together, resulting in a total of 113 million appropriately read pairs. Two independent algorithms were used to reconstruct transcripts containing reliable TEs: PASA2.3.3 (-C -R -ALT SPLICE -ALIGNERS blat,gmap -CPU 1 -transcribed is orient) in parallel with genome-guided FR -SS lib type FR -genome-guided bam -genome-guided max intron 10000 -genome-guided min reads per partition 3), and StringTie 2.0 (-rf -a 3). To remove potential artifacts due to transcription noise or low polymerase fidelity, mono-exon transcripts were excluded from further analysis as described in 78,79. Furthermore, they were difficult to evaluate bioinformatically and required extensive manual curing. Multi-exon transcripts (UCSC repeat maskers) crossing with TE were selected. To obtain a new, consistent catalog of non-overlapping transcripts, only transcripts sharing a TE-containing exon (crossing Bed-f 0.8 -r -s) identified by both assemblers were selected. A unified set of TE transcripts was obtained by merging the selected transcripts using StringTie(merge -i -f 0). TE transcripts were annotated using gffcompare 0.11.2 for transcripts from GENCODE version 25 GTF files. Finally, de novo reconstructed TE transcripts with at least 20 bp overlap between the exon and the LINE1 locus were annotated as LINE1 containing the transcript, and 3072 transcripts were recovered. Genes that contain a LINE1 transcript within their genomic location are hereinafter referred to as "LINE1-containing genes."

[0100] Quantification of novel LINE1 transcript expression To minimize confounding effects of similar and partially overlapping standard transcription isoforms and to include multi-mapping readouts, LINE1 transcript expression was estimated using Salmon 1.1.0. The Salmon index was constructed using a reference transcriptome containing both transcripts from GENCODE version 25 and the reconstructed TE transcriptome (see the subheading “Novel Reconstruction of De Novo LINE1 Including Transcripts”).

[0101] Filtration of new LINE1 transfer material First, 1884 LINE1 transcripts specifically rich in chromatin from naive CD4+ T cells were collected. LINE1 transcripts that were more highly expressed (higher TPM) or less expressed (lower TPM) in activated T cells compared to the nuclear fraction of naive CD4+ T cells were filtered out in at least two out of three replication cycles. The 1884 LINE1 transcripts were assigned to intergenic regions or transcription units (genes), which were assigned by cross-referencing with known transcripts from GENCODE version 32 using cross-referencing Bed from Bed tool 2.29.2. Where a unique gene or intergenic region could not be assigned, the gene was classified as "ambiguous." The inventors found that of the 1884 transcripts, 1647 were annotated to known transcription units, 81 were intergenic, and 156 were ambiguous (see also the subheading "Characterization of LINE1 Transcripts"). Of the 1647 transcripts that crossed the transcription unit, 112 were assigned to non-coding genes and 1535 to protein-coding genes, of which 1469 were in the same direction (for LINE1 transcripts that crossed both coding and non-coding GENCODE transcription units, protein-coding transcripts were used for assignment). Of the 1469 transcripts, 1013 transcripts have a LINE1 containing an exon at the beginning (one of the first two exons) or end (one of the last two exons) of a novel LINE1 transcript. Furthermore, from among the 1013 transcripts having a LINE1 containing an exon with an average H3K36me3 signal, the inventors selected those with a LINE1 whose average H3K36me3 signal was twice that of the average H3K9me3 signal as evidence of transcription in its chromatin region. 80,81 H3K36me3 and H3K9me3 signals were obtained by processing pre-sorted ChIP-seq data from Roadmap Epigenomics (see ChIP-seq data analysis). Finally, LINE1 transcripts in which the LINE1 exon was extended and overlapped with the host gene's UTR were discarded as artifacts from already annotated transcripts whenever possible. This strategy identified 461 novel LINE1 transcripts.

[0102] Characteristics of LINE1 transfer prints LINE1 subfamily enrichment analysis of 461 newly identified LINE1 transcripts was performed using Fisher's exact test on the genomic distribution of all 132 LINE1 subfamilies present in the human genome (hg38), as annotated with UCSC RepeatMasker (see extended data 4c, d). LINE1 loci were annotated for LINE1 features (5'UTR, ORF1, intergeneric, ORF2, and 3'UTR) based on their sequences according to L1.4 (GenBank member L19092.1). L1.4 sequences were annotated using L1Xplorer, and LINE1 loci were aligned to L1.4 using Blastone. To capture all LINE1 loci that may be evolutionarily similar to or branch off from the L1.4 sequence, blastone was performed on two different parameters: one for closely related sequences (-word size 4 -gapopen 5 -gapextend 2 -reward -2 penanty -3 -dust no -soft masking false) and the other for branched sequences (-word size 4 -gapopextend 8 -gapextend 6 -reward -5 penanty -5 penanty -4 -dust-no -soft masking false). Blast hits with the highest coverage of the LINE1 locus were selected as best hits and annotated with LINE1 features based on the alignment position on the L1.4 sequence (see Extended Data Figure 4f). LINE1 transcripts in which PAS was detected in at least 3 out of 5 copies were considered polyadenylated (see Extended Data Figure 4g). Consensus sequences of splice motifs were searched in 461 LINE1 transcripts. The sequence logo representation of the consensus sequence at the boundary of LINE1-containing exons at the start or end of the LINE1 transcript was created using WebLogo 3.7.4 (see Extended Data Figure 4h).

[0103] PCR verification of the LINE1 transcript LINE1 transcripts were validated by PCR using GoTaq G2 Flexi DNA polymerase (Promega, catalog number M7806). PCR reactions were performed using naive CD4+ T cell cDNA (splicing of novel transcription variants was verified using RT-negative cells). Primers were designed on IFNGR2.L1, MED23.L1, HIRA.L1, EED.L1, ASH2L.L1, ARCP2.L1, DDX6.L1, RAB22a.L1 transcripts and their corresponding standard mRNAs. PCR amplicons were controlled by electrophoresis on 1.6% agarose gels. All transcripts were validated in at least three different individuals.

[0104] Quantification and control of gene expression in RNA-seq datasets For GENCODE version 25, HTSeq v0.12.4 (htseq-count-yes -nonupenic-all) was used to generate the number of reads per gene using aligned reads, and the total number of read mappings within the gene model's coordinate system was used as the library size, normalized to fragments per million base pairs (FPKM). Expression levels of LINE1-containing genes were selected from all quantified genes.

[0105] Genesis Path Analysis 407 LINE1-containing genes were included in a network analysis performed using Ingenuity Pathway Analysis (Ingenuity® Systems, www.ingenuity.com). A list of LINE1 genes, including their gene identifiers, was uploaded in the application. Each gene identifier was mapped to a corresponding gene object in the Ingenuity Pathways Knowledge Base and is called a focus gene. For network construction, 70 genes per network and a significance score >40 were considered. The networks are represented in terms of the intracellular localization of genes, and connectivity is based on direct (continuous) and indirect (dashed) relationships. In the diagrams, genes are represented as nodes, and the biological relationship between two nodes is represented as an edge.

[0106] Preparation and sequencing of nanopore cDNA libraries Libraries were prepared starting with 75 ng of chromatin RNA using a PCR-cDNA barcoding kit (Oxford Nanopore Technologies, UK) and the following manufacturer guidelines. RNA from three independent samples was processed and barcoded individually, and the final libraries were pooled together for sequencing. A TapeStation (Agilent, CA, USA) was used to verify library quality and average size. Sequencing was performed using a MinION platform and R9.4.1 flow cell (Oxford Nanopore Technologies).

[0107] Nanopore sequencing data analysis Nanopore cDNA signals were processed for multiplexed reads using Guppy basecaller software version 5.0.7 with the parameter "guppy basecaller --flowcell FLO-MIN106 -kit SQK-PCB109 --barcode kits SQK-PCB109 -trim barcodes". Reads from three biological replicas were aligned onto a reference transcriptome containing Gencode v25 using minimap2 version 2.17-r941 with the parameter "-ax map-ont" to reconstruct TE-containing transcripts (see the subheading "Novel Reconstruction of De Novo LINE1 Containing Transcripts"). The presence of LINE1 transcripts in the Nanopore data was tested by selecting uniquely aligned transcripts. Transcription profiles of LINE1 transcripts using long reads were obtained by calculating coverage using the bedtool genomecov with the parameter "-ignored-bg", splitting the LINE1 transcripts into 100 bins, and calculating the mean and standard error per bin using R3.6.2.

[0108] Chromatin immunoprecipitation (ChIP) The ChIP assay was performed as described, with some modifications. Quiescent and 16-hour activated naive CD4+ T cells were crosslinked in 1% formaldehyde. The crosslinked cells were lysed in sonication buffer (10 mM TrisHCl pH 8, 2 mM EDTA, 0.25% SDS, 1 × fully EDTA-free protease inhibitor (Roche), and 1 mM PMSF (Merck)). Chromatin was sheared (BRANSON A250 with a 3.2 mm tapered microchip; 5 cycles of 1 min at 25% amplitude, 50% of duty cycle) and run on a 0.9% agarose gel at 70 V. Immunoprecipitation was performed by incubating 25 g of chromatin diluted in 1.5× equilibration buffer (10 mM ris HCl pH 8, 233 mM NaCl, 0.166% sodium deoxycholate, 1.66% Triton X-100, 1 mM EDTA, 1× complete EDT-free protease inhibitor, and 1 mM PMSF) with 1–2 g of antibody (H3K4me3 (Millipore, catalog no. 07-473) and H3K36me3 (Abcam, catalog no. Ab9050)) on a rotating wheel overnight at 4°C. The immune complexes were recovered on a magnetic Dynabeads (Protein G; Invitrogen) for 2 hours at 4°C. The beads were washed twice with 600L of low-salt RIPA (10mM TrisHCl pH8, 100mM NaCl, 1mM EDTA, 0.1% SDS, 0.1% Na-Deoxycholate, 1% Triton X-100), twice with 600L of high-salt RIPA (10mM TrisHCl pH8, 500mM NaCl, 1mM EDTA, 0.1% SDS, 0.1% Na-Deoxycholate, 1% Triton X-100), twice with 600L of RIPA-LiCl (10mM TrisHCl pH8, 250mM LiCl, 1 mM EDTA, 0.5% Na-Deoxycholate, 0.5% NP-40), and finally with 600L of 10mM TrisHCl pH8. All RIPA buffers were supplemented with 1X completely EDTA-free protease inhibitor and 1mM PMSF.Re-crosslinking was performed by incubating the beads overnight at 65°C in Elution buffer (10 mM TrisHCl pH 8, 2% SDS). Immunoprecipitated DNA was purified using AMPure XP PCR Purification beads (Beckman Coulter) according to the manufacturer's instructions. A DNA library was prepared using 25 ng of purified DNA with the NEBNext Ultra I DNA Library Prep Kit for Illumina (NEB) without size selection or 8 PCR amplification cycles. The library was purified using AMPure XP beads, eluted in nuclease-free H2O, and paired 150 pb sequences were sequenced on the NextSeq 500 platform (Illumina).

[0109] ChIP-seq data analysis For LINE1 transcript selection, CD4+ naive T cells of H3K36me3 (ENCFF152WXT, ENCF24OZH, ENCFF416GLM, ENCF78JQO) and H3K9me3 (ENCF197EDP, ENCF287UWA, ENCF38SVK, ENCFF753UAT) were treated with the ENCODE published dataset, which includes relative input samples (ENCFF044KMD, ENCF34343ILJ, ENCF421BMD, ENCF737YRO). Fold enrichment of ChIP was performed using macs 2.2.6 on its control input with non-default parameters "-f BAM -g BAM -30495783 -p 1e-2 --nomodel --extsize [average fragment size provided by ENCODE] -keep-dup all -B -SPMR -broad" and "-m FE" of the bdgcmp module. The enriched signals of H3K36me3 and H3K9me3 were calculated as log2 ratios using the deep tool 3.4.1 bigWigCompare with a bin size of 10 bp.

[0110] Furthermore, H3K36me3 and H3K4me3 ChIP-seq sequences were prepared to examine the chromatin of LINE1 containing the genes in T cell activation or LINE1 knockdown (see above). Reads from technical replication were pooled together, and the quality of reads before and after trimming was evaluated using FastQC 0.11.9. Using Trimmomatic 0.39, reads were trimmed for low-quality base calls in paired-end mode with the parameters "ILLUMINACLIP:TruSeq3-PE.fa:2:30:10 LEADING:3 TRAILING:3 SLINGWINDOW:4:15 MINLEN:50" or in single-end mode with the adapter reference file "TruSeq3-SE.fa" and the same parameters as above. The trimmed reads were aligned to the human genome assembly hg38 using Bowtie 1.2.3 with the parameters "-m 1--best--strata -v 3" and "-X 2000--fr" for the opposite ends only. After alignment, Samtools 1.9 was used to remove end reads of pairs that were not mapped to the appropriate pair, as well as duplicate reads. 83ChIP peaks were invoked using the macs 2.2.6 Call Peaks module, with the parameters "--keep-dup all-g-30495783-Bp 0.01" for both H3K4me3 and H3K36me3 samples, and "--broad" for H3K36me3 samples only, with the paired-end specific parameter "-f BAMPE" and the single-end specific parameter "-f BAM --nomodel--extsize 200" as input, using aligned files of ChIP targets and their relative control inputs. Coverage tracks were calculated by subtracting background signals from the fragment pileup using the macs2 bdgcmp module with the parameter "-m FE". As controls for genes including LINE1, sets of the same number of genes were randomly sampled from a pool of protein-coding genes showing at least one H3K36me3 peak using the "shuf" command built into GNU coreutils. The positional distribution of H3K36me3 and H3K4me3 on LINE1, which includes the gene and regulatory genes, was obtained by dividing the gene model into 40 bins. On the other hand, using the deep tool 3.4.1, the -1.5 and +3kb flanking regions were smoothed with 150 bp long bins using the parameters "-m 6000 -b 3000 -a 3000 -bs 150", the median values ​​between replication and genes were calculated, and a cubic smoothing spline was fitted to the data using the "smooth.spline" function built into R3.6.2.

[0111] Motif Concentration Analysis Motif enrichment analysis was performed using the AME algorithm in MEME suite version 5.3.3 for both DNA and RNA binding motifs, with the parameters "--scoring avg--Fisher method--hit-lo-fraction 0.25--evalue-report-threshold 10.0--control-shuffle-----kmer 2". Transcription factor binding motifs provided by the HOCOMOCO Human (v11 CORE) database were searched on the putative promoter sequence of the LINE1 transcript host gene. The promoter region was obtained by cross-referencing the H3K4me3 and H3K27Ac peaks from two biological copies found 5 kb upstream and 1 kb downstream of the host gene transcription start site using bedtool version 2.29.2. In proteomics analysis, CD8+ / CD4+ <-2 was log2, and TF <0 in the RNA-seq dataset was considered a "CD4+ specific TF high rank". RNA-binding protein motifs provided by Ray et al. 2013 (PMID 23846655) were searched on the LINE1 RNA sequence contained in the LINE1 exon of a novel transcript.

[0112] result The present inventors provide observations on the dynamics of LINE1 expression in peripheral blood-derived human T lymphocytes, the dynamics of LINE1 expression in dysfunctional / anergy T cells in vitro and in TIL, and their identification in CD4+ naive T cells.

[0113] LINE1 RNA is expressed in the chromatin of CD4+ naive T cells and is regulated by the mTORC1 pathway during activation and differentiation. To investigate TE expression in human T lymphocytes, LINE1, Alu, and HERV superfamilies were probed using RNA FISH and qRT-PCR in quiescent naive and memory CD4+ and CD8+ T cells isolated from healthy individuals. We observed that LINE1 RNA is specifically expressed in the nucleus of quiescent naive CD4+ T cells (Figure 1a-c). Alu RNA shows a broad distribution around the perinucleus in all T cell subsets (Figure 9a-c), while HERV RNA is not expressed to a large extent (Figure 9d-f). LINE1 RNA is almost exclusively present in the chromatin fraction of naive CD4+ T cells (Figure 1d and Figure 9g) and is associated with open chromatin regions, as determined by co-localization with the H3K4me3 histone mark (Figure 9h, i). Prolonged treatment with actinomycin D moderately affected LINE1 RNA levels, indicating that these RNAs were not transcribed at a high rate in naive CD4+ T cells (Figure 1e). Next, we analyzed the dynamics of LINE1 RNA during T cell activation and differentiation and found that they were rapidly downregulated and remained at low levels during differentiation into effector cells (i.e., Th1, Th2, Th17, Figure 1f and Figures 9j, k).

[0114] The inventors hypothesized that LINE1 RNA levels are finely regulated by T cell-specific signaling pathways. Thus, when activated or differentiated CD4+ T cells were treated with various immunomodulatory agents targeting mTORC1, calcineurin, or the NF-B pathway (Figure 1g), it was found that the mTORC1 inhibitor rapamycin restored LINE1 RNA levels in activated and differentiated T cells (Figure 1h and Figures 91-n). To reinforce these in vitro data, the inventors investigated whether LINE1 RNA levels are affected in vivo by mTORC1 inhibition. Therefore, the inventors used memory CD4+ T cells isolated from the blood of kidney transplant patients treated with the mTORC1 inhibitor everolimus, and the rapamycin analog sirolimus... 21 A patient with lymphangioleiomyomatosis (LAM) [MIM: 606690] who received lifelong treatment. 20 We investigated LINE1 expression. Consistent with the regulatory role of mTORC1 on LINE1 RNA expression in vitro, we found that, unlike healthy individuals, these patients' memory CD4+ T cells reexpressed LINE1 RNA (Figure 1i-k). Therefore, we demonstrate that LINE1 RNA is enfolded in the chromatin of CD4+ T cells and rapidly downregulated there after T cell activation in an mTORC1-dependent manner.

[0115] LINE1, expressed in naive CD4+ T cells, is spliced ​​in non-standard transcriptional variants of cell-activating genes. To determine which LINE1 elements are expressed and how the LINE1 transcript is constructed, chromatin and nucleoplasmic RNA sequencing was performed from resting naive CD4+ T cells. As an initial analysis, the inventors counted the reads of TE classes, superfamilies, and families, and then compared the number of reads in the chromatin and nucleoplasmic fractions. The inventors confirmed that within the TE classes, LINE, particularly the L1M family (evolutionarily older, widely present in primates and other mammals), was most expressed and chromatin-rich, while the L1P and L1H families were expressed at low levels and nucleoplasm-rich (Figure 10a, b). This result differs from those found in mESCs. In mESCs, the evolutionarily younger, backward-transitioning L1md T and L1md A subfamilies are more highly expressed in relation to the evolutionarily older L1 Mus1 and L1 Mus3 (Figure 10a, b). In T cells, nearly half of the LINE1 readouts are chimeric (i.e., mapping both on LINE1 and in non-repeatable regions), and 79% of the readouts originate from LINE1 localized to protein-coding genes (Figure 10d, e), and are therefore likely to be included in novel transcriptogenic variants. In mESCs, the majority of LINE1 readouts originate entirely from LINE1 elements with a broader genomic distribution (Figure 10f, g), supporting the expression of different LINE1s in mouse development relative to human T cells. To identify transcriptogenic variants containing LINE1, we applied d de novo-chain genome-inducible transcriptome assembly using two algorithms, Trinity and StringTie (see Methods). 3072 multi-exon transcripts containing at least one exon were identified in LINE1. To obtain a reliable list of LINE1 transcripts, several filtering criteria were applied based on the consistency of their presence across different individuals and evidence of LINE1 exon transcription at the chromatin level (H3K36me3 / H3K9me3 ratio).The inventors recovered 461 LINE1 transcripts, which are non-standard spicing variants derived from 407 protein-coding genes. The presence of 88% of these LINE1 transcripts was verified by long nanopore readings performed on chromatin fractions of naive CD4+ T cells and could be accurately reconstituted (Figure 11a), and some were confirmed by rt-PCR in naive CD4+ T cells isolated from three different individuals (Figures 11b-i). The spliced ​​LINE1s were short in length (average 371 bp), mainly ORF2 cleavage elements, and rich in different L1M subfamilies (i.e., L1ME4a, L1MC4, L1ME4b) (Figures 12a-c). In particular, 80% of these LINE1s were located within introns (Figure 12d) and spliced ​​as novel exons containing LINE1 and intron fragments (Figure 12e). Notably, these are evolutionarily older LINE1 factors, reconstructed during evolution, and represent cleaved forms of full-length LINE1 elements that lack retrotransposases and end up as denatured elements that do not encode the proteins required for retrotransposases. In fact, to demonstrate that the observed mechanism is independent of the retrotransposition mechanism, we treated naive CD4+ T cells with a 3TC inhibitor and performed RNA-FISH findings showing that the staining of LINE1 RNA remained completely unchanged (Figure 12f).

[0116] Figure 2a shows how a representative LINE1 transcript (e.g., ARPC2) is reconstructed. The presence of HIRA.L1 in naive CD4+ T cells and their downregulation upon activation were further confirmed by single-molecule RNA-FISH (smRNA-FISH), which detected unique regions of the LINE1 exon (Figures 2b, c, and 13a).

[0117] To infer the functional relevance of 407 protein-coding genes from which LINE1 transcripts originate, we used IPA (Ingenuity Pathway Analysis) network analysis to find direct and consistent relationships with genes necessary for cell activation (e.g., gene expression, cell signaling and intercellular interactions, cell cycle). In summary, the above experiments identified a large set of previously unknown, non-standard transcripts of genes necessary for cell activation, and therefore suggest that these transcripts are involved in maintaining restorative CD4+ T cells.

[0118] Since LINE1 transcripts originate from cell-activating genes and are localized in chromatin, we investigated whether they can regulate the expression of their corresponding protein-coding genes (hereinafter referred to as standard transcripts). First, as exemplified by the combo DNA-RNA FISH experiments of HIRA and RABB22A (Figures 2d and 13c), we observed that LINE1 transcripts localize cis at their genomic loci. Next, using antisense oligonucleotides (ASOs) designed on the non-repeating region of the LINE1 exon, we removed naive CD4+ T cells containing HIRA.L1 or RABB22A.L1 transcripts and found that only the corresponding standard transcripts were upregulated (Figures 2e, f, and 13d). Finally, by deleting LINE1 from the introns of the IFNGR2 and ARPC2 genes and using a Cas9 RNP complex with sgRNA on a unique region adjacent to the repeat sequence, we demonstrated in naive CD4+ T cells that i) the LINE1 element is required for the initiation of the LINE1 transcript and ii) the role of LINE1 transcript regulation is strictly cis (Figure 2g-i and Figure 13e-h). Therefore, our results suggest that the LINE1 transcript maintains arrest in the chromatin expression of the corresponding standard transcript.

[0119] LINE1 transcripts act by forming complexes with nucleolins, reducing the expression of LINE1-containing genes in the cis state of naive CD4+ T cells. We investigated how LINE1 transcripts epigenetically regulate the expression of the genes from which they originate. LINE1 transcripts were knocked down by treating quiescent naive CD4+ T cells with LINE1 ASO for 48 hours (Figure 3a, b). Interestingly, upregulation of genes containing LINE1 was found to occur in quiescent naive CD4+ T cells with knocked-down LINE1 RNA (Figure 3c). Since LINE1 RNA can regulate chromatin condensation and gene silencing, we investigated whether knockdown of LINE1 transcripts affects the chromatin structure of quiescent T cells. Therefore, quantitative Western blotting of histone extracts and immunostaining of naive T cells treated with LINE1 ASO for 48 hours were used to evaluate the levels of several histone traces (i.e., H3K36me3, H3K4me3, H3K9me3, H3K27me3). We found that depletion of LINE1 RNA resulted in a significant increase in H3K36me3, indicating chromatin remodeling toward active transcription that occurs in the absence of cell activation (Figure 3d and Figures 14a-c). Interestingly, H3K36me3 ChIP-seq of naive T cells lacking LINE1 RNA was performed, and we found that the increase in H3K36me3 was specific to LINE1-containing genes, and the same was observed during T cell activation (Figure 3e and Figures 14d-h). This indicates that LINE1-containing genes are released by regulatory activity via LINE1 transcripts in the absence of activation.

[0120] In mESCs, it has been reported that nucleolin, a LINE1 RNA-binding protein, forms a complex with LINE1 RNA and Kap1, regulating cell identity and 2C stage differentiation genes. Therefore, we investigated the relationship between nucleolin and LINE1 RNA in T cells. We performed RNA immunoprecipitation to discover that nucleolin forms a complex with LINE1 transcripts (Figure 3h). Interestingly, nucleolin ASO treatment phenocopys the effect of LINE1 ASO, which promotes transcription of LINE1-containing genes and increases H3K36me3 (Figures 15a, d). In quiescent naive CD4+ T cells, nucleolin depletion by 48 hours of treatment with a specific ASO did not change LINE1 RNA levels, but after cell fractionation, a decrease in chromatin-associated LINE1 RNA was observed. This indicates that nucleolin is involved in chromatin compartmentalization of LINE1 RNA (Figures 3i, j and 15e). Finally, the inventors investigated whether the regulation of LINE1 RNA affects the effector function of T cells. First, naive CD4+ T cells lacking LINE1 RNA were activated and differentiated into Th1 effector cells for 7 days. These cells were observed to double the production of the transcription factor Tbet and the secretion of the effector cytokine IFN (Figure 3k, l). Importantly, the same phenotype was observed with nucleolin knockdown under the same conditions (Figure 3m, n). Taken together, these results indicate that LINE1 RNA regulates the transcriptional switch from quiescent to activated state in naive CD4+ T lymphocytes and acts on the nucleolin-chromatin complex via H3K36me3 chromatin remodeling.

[0121] LINE1 transcripts are regulated by the IRF4 transcription factor in CD4+ T cells. Since LINE1 transcripts originate from genes involved in cell activation, we investigated why CD8+ T cells, unlike developmentally close CD4+ T cells, do not express LINE1 transcripts. Therefore, we profiled the expression of 461 LINE1 transcripts and standard transcripts using RNA seek data from T cell progenitor cells and naive and activated CD4+ and CD8+ T cells (see Figure 4a, Methods). Among all T cell precursors, LINE1 transcripts were uniquely expressed by naive CD4+ cells, supporting previous results (Figures 4b and 1a-c). Interestingly, standard transcripts are CD4+ T cell specific. In particular, in activated CD4+ T cells, LINE1 transcripts are downregulated, while standard transcripts are upregulated (Figures 4b, c and extended data Figures 16a, b). Next, we searched for transcription factors (TFs) that were more highly expressed in CD4+ cells than in CD8+ T cells in RNA-seq (see Methods) and proteomics datasets, and found that their motifs were rich in LINE1 containing gene promoters that could explain the differential regulation of these loci. This analysis was interesting because IRF4 is a key factor reported in CD4+ T cell activation (Figure 16c). First, we verified that IRF4 is almost absent in CD8+ T cells (Figure 4d) and upregulated in CD4+ T cell activation (Figure 16d). Next, we demonstrated by ChIP that IRF4 binds to genes containing promoters in naive CD4+ T cells, rather than to naive CD4+ T cells themselves (Figure 4e). Then, we depleted IRF4 in naive CD4+ T cells using IRF4 ASO (Figure 4f and Figure 16e,f) and observed strong downregulation of both LINE1 and standard transcripts (Figure 4g). This indicates that this TF regulates their CD4+ specific expression. Overall, these data suggest that during T cell development, LINE1 and the corresponding standard transcript are CD4+ T cell specific under the control of the IRF4 transcription factor.

[0122] Upon T cell activation, LINE1 transcripts are downregulated by the splicing repressor PTBP1 / MATR3 and the elongation factor GTF2F1, promoting the expression of standard transcripts. Since IRF4 is a key factor in T cell activation and is directly involved in LINE1, including locus regulation, how are LINE1 transcripts downregulated in activated CD4+ T cells? Attig et al. have already reported that several heteromer RNA-binding proteins bind to intronic LINE1, which affects lineage-specific splicing; in particular, PTBP1 and MATR3 regulate RNA splicing within and around LINE. Furthermore, they reported that LINE1 RNA downregulation is under the control of mTORC1 (Figure 1), so we cross-referenced this dataset with the dataset of Hsu et al., which describes in detail proteins regulated by mTORC1. We identified only one protein, GTF2F1, that binds to intronic LINE1 and is also regulated by mTORC1. GTF2F1 is a transcription elongation factor that is phosphorylated upon T cell activation. Therefore, we investigated the roles of PTBP1, MATR3, and GTF2F1 in regulating LINE1 transcripts in activated CD4+ T cells. We performed RNA immunoprecipitation experiments using PTBP1 and GTF2F1 and showed that these two factors specifically bind to LINE1 exons in activated CD4+ T cells (Figure 5a-d). In detail, as exemplified by RABB22A, PTBP1 binds only to premRNA in line with its splicing regulatory role, while GTF2F1 binds to both premRNA and spliced ​​standard transcripts, as expected for transcription elongation factors (Figure 5e-g). In fact, when we depleted PTBP1, MATR3, and GTF2F1 with ASOs in naive CD4+ T cells and then activated them, we found that LINE1 transcripts were expressed more, but standard transcripts were expressed less (Figure 5h and Figure 17). This indicates that the causal relationship between LINE1 and the standard transcript is reversed.The inventors hypothesize that the LINE1 transcript is a non-standard splicing variant, regulated by PTBP1 / MATR3 / GTF2F1, and promotes the expression of the standard transcript in cell activation.

[0123] LINE1 transcripts are re-accumulated in TILs via IRF4 and nucleolin, and through the loss of the PTPB1 / GTF2F1 mediated mechanism. The inventors analyzed the dynamics of LINE1 RNA in T cells isolated from the tumor microenvironment, where effector T cells often become dysfunctional. Recent reports have described the contribution of transcription factors and epigenetic modifications to dysfunction, but the underlying mechanisms are not yet fully understood. 91-93 Therefore, the inventors evaluated the LINE1 RNA content in CD4+ and CD8+ T cells isolated from several colorectal cancers (CRCs), non-small cell lung cancers (NSCLCs), and corresponding non-tumorous adjacent tissues. Notably, LINE1 RNA signaling was observed in tumor memory CD4+ T cells, and surprisingly, LINE1 RNA signaling was also observed in tumor memory CD8+ T cells from all tumor samples. However, in non-tumorous adjacent tissues, no signal was detected in memory T cells, similar to what was observed in peripheral blood (Figure 6a, b).

[0124] Therefore, the inventors investigated in vitro LINE1 RNA expression in exhausted CD4+ and CD8+ T cells by exposing them to a stimulating anti-CD3 mAb every two days. Repeated anti-CD3 stimulation induced expected proliferation arrest, PD-1 upregulation, and decreased effector cytokine secretion in both CD4+ and CD8+ T cells (Figure 18). Interestingly, these dysfunctions and consistent re-accumulation of LINE1 RNA in the nuclei of CD4+ and CD8+ T cells were observed. More specifically, a specific increase in LINE1 transcripts and a corresponding decrease in gene expression were observed (Figure 6c-f). Consistent with the accumulation of LINE1 transcripts, the inventors found that exhausted CD4+ and CD8+ T cells had higher levels of the transcription factor IRF4 protein and nucleolins, and decreased levels of GTF2F1 (Figure 7a). In particular, using a RIP assay, we found that LINE1 transcripts are bound by nucleolin, while losing PTBP1 and GTF2F1 binding (Figure 7b). Knockdown of IRF4 confirmed that this transcription factor is also involved in LINE1 transcription (Figures 7c, d, 18h). Overall, these datasets indicate that LINE1 transcripts accumulate again in exhausted T cells and TILs, which is due to the generation and stabilization of LINE1 transcripts in chromatin via IRF4-nucleolin, while the regulatory mechanism mediated by PTBP1 / GTF2F1 is lost.

[0125] LINE1 transcript levels control the effector response of TILs. To evaluate whether the dysfunctional behavior observed in tumor T cells is at least partially attributable to LINE1 RNA accumulation and modulated by LINE1 targeting, we isolated tumor CD4+ and CD8+ T cells and knocked down LINE1 transcripts with LINE1 ASO. We then measured the LINE1-depleted cells for inhibitor checkpoint expression, effector cytokine production, and target cell killing ability (Figure 8a). We found that targeting LINE1 reduced the proportion of PD-1, LAG3, and TIM3 in positive cells (Figure 8b,c). Consistent with these results, we also observed increased effector cytokine secretion (IFN and granzyme B for CD4+ and CD8+ T cells, and perforin A for CD8+ T cells) in memory TILs depleted for LINE1 (Figure 8d,e). These data suggest an increase in TIL functionality, and to support this, we also measured the target cell-killing ability of memory CD4+ and CD8+ TILs treated with LINE1 ASO compared to tumor T cells treated with unrelated ASOs, verifying that the killing ability of TILs nearly doubled with LINE1 knockdown (Figure 8f, g).

[0126] As a natural consequence of these results, knockdown of LINE1 RNA in previously in vitro depleted T cells restores effector cytokine secretion (IFN and granzyme B for CD4+ and CD8+ T cells, and perforin A for CD8+ T cells) and killing ability (Figure 18f, g), but proliferation is not modified by LINE1 ASO treatment (Figure 18h, i). In summary, our findings indicate that LINE1 RNA levels regulate the T cell effector response, and that their accumulation in tumor T cells is associated with dysfunctional behavior that may be partially retroactive to LINE1 RNA ASO.

[0127] array The consensus sequence of the LINE1 sequence, which is largely contained in the LINE1 transcript reconstituted in T cells.

[0128] >L1ME4A L1ホモサピエンス (query number 1)

[0129] >L1M4B L1ホモサピエンス

[0130] >L1MC4 L1 Homo sapiens

[0131] LINE1 ASOs can target these LINE1 elements, which are specifically expressed in naive CD4+ T cells (see results).

[0132] The nomenclature for the above sequence is as follows (below the IUPAC nucleotide code and corresponding base): A: Adenine C: Cytosine G: Guanine T (or U): Timin (or Uracil) R:A or G Y:C or T S:G or C W:A or T K:G or T M:A or C B:C or G or T D: A or G or T H:A or C or T V: A, C, or G N: Any base, -:gap

[0133] Reference materials

[0134] [ka]

[0135] [ka]

[0136] [ka]

[0137] [ka]

Claims

1. A suppressor or inhibitor for use in the treatment and / or prevention of primary or secondary immunodeficiency disorders, for pathologies exhibiting LINE1 (long chain scattered element 1) (L1) expression or immunoregulatory phenotypes, preferably cancer and / or metastasis, more preferably lung cancer, even more preferably non-small cell lung carcinoma (NSCLC), or colorectal cancer (CRC), or viral diseases such as immunodeficiency caused by human immunodeficiency virus (HIV) or lymphocytic choriomeningitis virus (LCMV), Here, L1 is an inhibitor or suppressor comprising a sequence having 100, 99, 98, 97, 96, 95, 90, 85, or 80% identity with sequence number 1, 2, or 3.

2. A LINE1 (L1) expression inhibitor or suppressor for medical use, comprising or comprising a sequence in which L1 has 100, 99, 98, 97, 96, 95, 90, 85, or 80% identity with SEQ ID NO: 1, 2, or 3.

3. An inhibitor or inhibitor for use according to claim 1 or 2, wherein L1 comprises or consists of SEQ ID NO: 1, 2, or 3.

4. Inhibitors or inhibitors a) Polynucleotides, for example, antisense constructs, antisense oligonucleotides, RNA interference constructs, or siRNAs, or polynucleotides encoding them; b) Antibodies or fragments thereof; c) Polypeptide; d) small molecules; e) Polynucleotides encoding the antibody or polypeptide or its functional derivative; A vector containing or expressing a polynucleotide as defined in f) a) or e); g) CRISPR / Cas9 component, e.g., sgRNA; A host cell that expresses a polypeptide or antibody as defined in h) a) or e), or that is genetically engineered to contain at least one component of g). An inhibitor or inhibitor for use according to any one of claims 1 to 3, which is at least one molecule selected from the group consisting of the following.

5. The inhibitor or inhibitor for use according to claim 4, wherein the polynucleotide is an isolated inhibitory nucleic acid targeting LINE1.

6. The inhibitor or inhibitor for use according to claim 5, wherein the inhibitory nucleic acid comprises a sequence of nucleotides complementary to 10 to 50 consecutive nucleotides of SEQ ID NO: 1, 2, or 3.

7. The inhibitory nucleic acid is at least one RNA inhibitor, preferably selected from the group consisting of antisense oligonucleotides (ASOs), gapmers, mixamars, shRNAs, siRNAs, stRNAs, and snRNAs, and more preferably the inhibitory nucleic acid is modified, for example, comprising 2'-deoxy-2'-fluoro-D-arabinonucleotide (FANA) ASO and / or one or more modified bonds or bases, according to claim 6.

8. The inhibitor or deterrent according to claim 7, wherein the ASO comprises a sequence that may hybridize with or be complementary to a sequence comprising or consisting of sequence numbers 1, 2, or 3.

9. An inhibitor or suppressor for use according to any one of claims 1 to 8, used with T cells, preferably CD4+ T naive cells or CD8+ T cells, tumor-infiltrating lymphocytes (TILs) that are both CD4+ and CD8+, B cells, natural killer cells, or tumor cells.

10. An inhibitor or suppressant to be used in combination with immunotherapy and / or radiotherapy and / or chemotherapeutic agents and / or targeted therapies that promote novel antigens and enhanced immune responses and / or immune system adjuvants, wherein the immunotherapy preferably comprises the administration of immune effector cells expressing immune checkpoint inhibitors and / or chimeric antigen receptors (CARs), and preferably the immune checkpoint inhibitor comprises an anti-CD137 antibody; an anti-PD-1 (programmed cell death 1) antibody; an anti-PDL1 (programmed cell death ligand 1) antibody; an anti-PDL2 antibody; or an anti-CTLA-4 antibody, or one or more thereof, according to any one of claims 1 to 9.

11. An inhibitor or suppressant according to any one of claims 1 to 10, used in adoptive cell transplantation (ACT), cell therapy, mismatch bone marrow transplantation, mismatch NK cell injection, or cytokine-induced killer cell injection, or the inhibitor or suppressant is injected into a tumor site, for example, an intestinal tumor, melanoma, or is specifically delivered to a site of interest by nanoparticles.

12. A pharmaceutical composition comprising an inhibitor or suppressant as defined in any one of claims 1 to 11, and at least one pharmaceutically acceptable carrier, and optionally further comprising a therapeutic agent.

13. A method for modulating the involvement of naive CD4+ T naive cells with respect to any effector lineage and modulating the effector response in dysfunctional T cells, comprising the step of inhibiting LINE1 expression in the cells, wherein the step of inhibiting LINE1 expression in the cells is carried out by at least one inhibitor or suppressor as defined in any one of claims 1 to 11.

14. Isolated human T cells, B cells, NK cells, or tumor cells whose LINE1 (L1) expression is stably or transiently affected, Here, L1 contains or consists of a sequence having 100, 99, 98, 97, 96, 95, 90, 85, or 80% identity with sequence number 1, 2, or 3. Preferably, the cells are isolated human T cells, B cells, NK cells, or tumor cells, such as CD4+ T naive cells or CD8+ T cells, or dysfunctional T cells, for example, TILs.

15. A composition comprising at least one cell or combination thereof as defined in claim 14, wherein the composition preferably further comprises at least one physiologically acceptable carrier.

16. Cells according to claim 14 or composition according to claim 15 for use as a pharmaceutical, preferably for the treatment and / or prevention of pathologies exhibiting primary or secondary immunodeficiency or immunoregulatory phenotypes, preferably cancer and / or metastasis, more preferably lung cancer, even more preferably non-small cell lung cancer (NSCLC), or colorectal cancer (CRC), or viral diseases such as HIV, lymphocytic choriomeningitis virus (LCMV), Preferably, the cells or composition are used in adoptive cell transplantation (ACT), cell therapy, mismatch bone marrow transplantation, mismatch NK cell injection, or cytokine-induced killer cell injection, or the cells or composition are injected into a tumor site, for example, intestinal tumor, melanoma, or delivered specifically to the target site by nanoparticles.

Images